text
stringlengths 0
868k
|
|---|
Apart from the correlation studies mentioned above, the ability to innovate and solve novel problems flexibly, proxies for flexible cognitive capacities and potentially for domain - general intelligence, have not been investigated comparatively . Few experimental studies have specifically focused on innovativeness, and flexible problem solving per se . The majority of experiments in animal cognition, in both the physical and social domain, present animals with specific problems and investigate how the animals solve them in order to examine specific cognitive abilities / processes . Mostly, these tasks have been tailored to be ecologically valid for one particular species, or have focused on contexts/ questions so specific that they could not be reproduced in other species easily (e.g., dolphins; food - storing srub jays). Other problem solving tasks, particularly in physical cognition, have secondarily become comparative paradigms and have been established as so - called benchmark tests for examining the existence of certain cognitive abilities in different species, e.g., the trap - tube for examining an understanding of causality in terms of surface continuity, povinelli s cane task and heinrich s string - pulling task for testing responsiveness to connectivity etc . Most of these typically started off from a single experiment designed for testing a particular species and some subsequently applied to other species, sometimes without paying sufficient attention to species differences in morphological (hand or beak), behavioral (e.g., object exploration, affordance learning) and perceptual features (e.g., field of vision), in addition to psychological variables (such as motivational, emotional or attentional states, inhibitory control or neophobia / neophilia). Yet all these factors can potentially have a big impact masking cognitive skills actually present in a species and producing misrepresentative results . Another methodological problem of comparative cognition is that paradigms are applied to many species, but with slightly converted methodologies (better fitting the newly compared species demands), hence at a cost of comparability . If the methodology is not standardised, it is hard to interpret the findings of comparative studies, because any detected differences between species could be owing to the different procedures . An odd handicap for comparative cognition in this context appears to be that modification or improvement of an already used comparative paradigm, instead of merely replicating it in a new species, may increase the chances of a study to become published . Often however, a direct comparison would have been scientifically more valuable than yet another improvement to an existing experimental paradigm . Recently, this has been acknowledged and several research groups have begun to run comparative studies with the exact same methods . The difficulty of comparative cognition therefore is to find comparative paradigms that are compatible with many different species (i.e., that are ecologically valid for all the species to be compared, and not influenced by potentially confounding species - specific variables), and that have a standardised methodology that can be applied to different species in exactly the same way . Because of the potentially confounding impact of different methodologies, the same cognitive ability should be investigated with not just a single but several tests with slightly different angles in any given species . Recently, comparative studies carry out entire batteries in different species tests, e.g., those comparing cognitive abilities in the social and physical domain . Yet, what is missing is to have a battery of tests establishing species differences that might affect performance in different cognitive tests, such as object exploration, motivation, attentiveness and fear / neophobia . A new such comparative approach is the multi - access - box (mab), recently published in plos one (see fig . 1). It presents the animal with a novel problem that can be solved in four different ways, thus offering the possibility to examine species differences in how novel problems are perceived, explored and approached and in which order solution(s) are discovered . This provides several data that can be used for establishing a behavioral (e.g., object exploration,) and psychological profile (e.g., motivation, flexibility, impulsivity, persistence, inhibitory control) and hence extract behavioral and perceptual determinants of different species performance in the tasks . Simultaneously, it is a suitable paradigm to collect data about problem solving ability, innovativeness and flexibility, i.e., theoretical covariates of general intelligence, across species in a standardized manner . Multi access box (mab) (as in plos one, copyright 2011 by the public library of science . Reprinted with permission of the author). A food reward presented in the center of a transparent box can be retrieved by one of four possible methods, which are built in the four walls of the mab: opening a window, pulling a string, inserting a ball or inserting as stick tool . The mab approach comprises not just one but several solutions to an extractive foraging problem at the same time (food out of reach in the center of a transparent box), i.e. It consists of a battery of alternative tasks that all lead to the same goal . Two solutions (opening a window and pulling a string) could be discovered by haptic exploration (touching the box at particular sites), while the other two additionally required the handling of objects, either wooden sticks or marbles, as tools (inserting a ball or a stick tool into specific openings). The other important feature of the mab is that subjects were forced to continue exploring alternative solutions, once they had successfully discovered and consistently used one particular solution, by blocking the one in use . This creates an order system which allows to detect species differences in which tasks are approached and explored first and how, how many solutions are discovered and how fast, whether and how quickly the subjects switch between options or whether they focus or settle on particular ones, as well as which tasks are problematic and why . In this manner we can detect not only species differences in problem solving performance, but also learn about the various underlying non - cognitive factors that may affect it . Although designed for large scale comparisons of different closely- and distantly related species from different ecological backgrounds, the initial mab study compared just two avian species from different families, a corvid, the new caledonian crow (ncc; corvus moneduloides) and a parrot, the kea (nestor notabilis) (see fig . 2). Both species are known for their large brains, their innovativeness and problem solving skills, but nccs are naturally tool - using species while kea have not been observed to use tools in the wild, but are famous for their neophilia . Subjects were exposed to the transparent mab with the food reward in the center, which could be extracted by the four different methods corresponding to the four walls of the box . Once a method was mastered, it was blocked and the bird s performance in reaching criterion in any of the others was recorded until all four methods had been discovered . Figure 2 . Kea and new caledonian crow using the stick (left) and the ball - shaped (right) tool on the multi access box . Found that one kea and one ncc detected all four solutions, demonstrating that the solutions offered were within both species capacity . The kea were much quicker in discovering multiple solutions than the habitually tool - using nccs and showed more individual variation . The keas were also more flexible once openings were blocked, switching to other solutions much quicker than the ncc . Innovation rate as well as performance in this paradigm were strongly impacted by differences in exploration technique and neophilia rather than by cognitive discrepancies . The highly neophilic kea explored the apparatus more in a haptic than in a visual manner . They found its functional properties, while manipulating the affordances of the mab they perceived as most salient . In contrast to the kea and probably due to their more visually guided exploration technique, the nc crows had problems solving the window solution . The window mechanism could not be deduced by visual inspection alone (without knowledge of hinge - mechanisms), but could be readily discovered by haptic exploration . Another difference was that the nc crows tended to persist with the first option that worked, whereas the kea, owing to their higher level of neophila, switched between solutions . Differences in beak morphology also affected the birds performance: the kea had problems maneuvering the stick tool because of their beak curvature, whereas the crows with their straight beaks had a good grip of the tools . Yet, the nc crows used their straight beak more for pecking than tearing actions, which would have been advantageous in detecting the mab apparatus s affordances in case of the window option (grasping and pulling the window crank). An important new tool that could be incorporated in the mab procedure and that could be revealing in comparisons of flexible problem solving may be reversal learning. Species with different ecological backgrounds may have been selected for different strategies in trial and error learning and problem solving . In terms of energy pay - off it may, under certain circumstances, be advantageous to persist (e.g., in the case of nccs fishing for particularly nutritious wood - boring beetle larvae in rotten wood as, which can take considerable time but has a high potential return). In other contexts it may save energy to give up if something does not work and try something else instead . Reversal learning tasks reflect differences in flexibility and are informative of how fast animals can adjust their behavior to new external feedback, let go of previously reinforced behavioral patterns, but at the same time they offer a measure of persistence . To illustrate how reversal learning could be implemented, we present some data not published in the original auersperg et al . Once a subject had discovered all solutions, we incorporated a reversal learning task for the two solutions incorporating a tool (see fig . 2). For the two successful subjects, uk, a ncc and kermit, a kea, the last used tool option was blocked and the previous tool option was reopened . As can be seen the crow required a similar amount of trials to relearn the previous option as the kea, although of course data on more individuals would be desirable . Illustrate how even diminutive differences in non - cognitive behavioral components such as neophilia or morphology can mask and/or interfere with the respective cognition involved and impact on the species performance . It highlights how different performance in problem solving task are not always symptomatic of species differences in cognitive ability or general intelligence . It highlights in particular, what major impact differences in object exploration (haptic or visual exploration mode) and affordance learning, which have only recently become a topic in animal cognition, can have on performance in artificial experimental tasks, and hence how this affects the comparability of two species in the same task . In future comparative research, establishing behavioral and psychological profiles of the species to be compared ought to precede comparative tests of specific cognitive skills or general intelligence . This may help to identify problem solving tasks that are equivalently applicable to the target species and hence achieve a high degree of
|
Structural deficiencies and functional abnormalities of heart valves are conditions that need cardiovascular surgery . These abnormalities may be caused by congenital diseases or by a variety of acquired diseases that result in valvular stenosis, valvular insufficiency, or both . The rheumatic heart disease (rhd), the most common heart valve disease in underdeveloped countries, is a condition that causes damage to the valve function, due to an abnormal immune response to group a streptococcal infection, especially during infancy . Patients with rhd have valvular lesion caused by the rheumatic valve involvement (stenosis and/or regurgitation) or secondary to ventricular dilatation, leading to mitral or tricuspid insufficiency . The aortic stenosis, the most common valve disease in industrialized countries, had been considered, for many years, a degenerative disease that would appear with aging, and that was caused by the passive accumulation of calcium on the surface of the valve leaflet . Recent studies, however, have demonstrated that this disease represents an active process that may be divided into 2 distinct phases: an early initiation phase, similar to atherosclerosis, and a later progression phase that involves pro - calcifying and pro - osteogenic factors . In the last few decades, these conditions have been the object of great attention in the cardiology field, mainly due to changes in their presentation profile and treatment . These changes came as a result of a significant reduction in the incidence and sequelae of rheumatic fever, increase in life expectancy, technological advancement, and the discovery of new causes for valve diseases, including the alleged role of infectious agents in their pathogenesis . Infectious agents are well known to cause infective endocarditis, another major cause of valve replacement, but there are recent evidence also connecting these pathogens to valvular stenosis and/or regurgitation . In this context, an association between chlamydophila pneumonia infection and aortic stenosis has been suggested by nystrm - rosander et al and turgeman et al . Oral micro - organisms have already been indirectly associated with other cardiovascular diseases (cvd), such as atherosclerosis . Oral bacteria involved in the etiopathogenesis of chronic periodontitis are known to cause an immune and moderate systemic inflammatory response, elevating the serum concentration of multiple cytokines and inflammatory markers that are abundantly produced in pathological periodontal tissues and strongly associated with the pathogenesis of some cvds . The presence of oral bacteria in valvular tissue with or without clinical endocarditis have been investigated through sensitive molecular exams, such as the polymerase chain reaction (pcr), in order to investigate the mechanisms that can link oral infections to cvd . In addition to identifying oral bacteria dna in valvular tissue, nomura et al have reported the mechanisms that led cariogenic bacteria to colonize heart valves . Considering the recent findings, the aim of this study is to identify cariogenic and periodontopathogenic micro - organisms in the dental plaque, saliva, and cardiac valves of patients undergoing valve replacement surgery, regardless of the disease, in order to contribute with epidemiologic data regarding the presence of oral bacteria in cardiac valves . Detailed evaluation of oral health status of all patients, including presentation of caries and periodontal disease history, by dental examination, will also be reported . This data could provide evidence of a connection between oral diseases and the frequency of oral micro - organisms in valve samples . Carlos alberto studart gomes (fortaleza, cear, brazil) who were consecutively scheduled for cardiovascular surgery of valve replacement between march 2012 and september 2012 were enrolled in this study, which accounted for a convenience sample of 42 patients . All participants gave their informed consent and this study was approved by the ethics committee of the hospitals where the research was performed . Two examiners (f.a.f.o and c.p.f) were calibrated to evaluate teeth condition and current periodontal status of the patients, using the indexes dmft (decayed, missing, and filled teeth) and psr (periodontal screening and recording), respectively . For inter - examiner calibration, both examiners evaluated the same 10 volunteers that were not enrolled in the study . After 1 week, the same patients were re - evaluated to assess intra - examiner calibration . The kappa values ranged from 0.80 to 0.97 . Before the cardiovascular surgery, the previously calibrated examiners performed bedside oral examination . Information regarding smoking history, hypertension, diabetes mellitus, dyslipidemia, and other comorbidities were obtained through medical charts and anamnesis . Only 1 patient could not undergo the periodontal examination due to his poor physical condition . For dentate patients, during oral examination, supragingival and subgingival dental plaque were collected . Only for edentulous patients, saliva samples were collected by rubbing sterilized absorbent paper points in the oral mucosa and on the alveolar ridge, palate, and tongue . The oral samples were stored in a sterile vial containing phosphate - buffered saline (pbs) at 20c for subsequent molecular analysis . A total of 47 cardiac valves were collected, aseptically, during valve replacement surgeries . A fragment of each sample was stored in a sterile container containing pbs at 20c for further analysis using real - time pcr . Dna extraction and molecular analysis through real - time pcr were carried out, respectively, at the laboratory of human cytogenetics and laboratory of human and medical genetics of the federal university of par (belm, brazil). A total of 114 samples of supragingival and subgingival dental plaque, saliva, and cardiac valves (30 mg) were transferred to sterile plastic tubes of 2 ml containing a buffer, maintaining aseptic handling, and posteriorly homogenized . Dna extraction proceeded according to a standard protocol that used proteinase k and cetyltrimethylammonium bromide (ctab) to remove complex polysaccharide . The samples of extracted dna were subjected to real - time pcr for the detection of dna from 4 different bacterial species: s. mutans, p. gingivalis, p. intermedia, and t. denticola . Taqman probes to 16s bacterial ribosomal dna (table 1) were specifically designed for this study (life technologies). For real - time pcr, 1 l of genomic dna (5 ng) was added to 8 l of taqmanuniversal pcr master mix (applied biosystems), 0.35 l of probe, and 3.15 l of water . The final volume of 14 l was obtained by adding ipc (1 l) and ipc dna (0.5 l), which was used as an internal control for the reaction . Amplification was carried out in a thermal cycler 7500 real - time pcr system (applied biosystems). Bacterial dna was replaced by water as a negative control for the reaction . The real - time pcr protocol consisted of an initial step of denaturation at 95c for 10 min, followed by 40 cycles at 95c for 15 s, and 60c for 1 min . List of primers and probes designed for the identification of different cariogenic and periodontopathogenic micro - organisms the distribution pattern of the quantitative data of the sample was evaluated through the shapiro wilk test . Posteriorly the quantitative data were submitted to the student t test and expressed as mean sem . Qualitative nominal variables were expressed as absolute frequency (relative frequency) and analyzed by the fisher exact test or the chi - square test with bonferroni correction . When possible, the prevalence ratio expressed as the prevalence ratio (confidence interval minimum maximum) was calculated . (cdc atlanta) was used and a significance level of p <0.05 was established for all analyses . Carlos alberto studart gomes (fortaleza, cear, brazil) who were consecutively scheduled for cardiovascular surgery of valve replacement between march 2012 and september 2012 were enrolled in this study, which accounted for a convenience sample of 42 patients . All participants gave their informed consent and this study was approved by the ethics committee of the hospitals where the research was performed . Two examiners (f.a.f.o and c.p.f) were calibrated to evaluate teeth condition and current periodontal status of the patients, using the indexes dmft (decayed, missing, and filled teeth) and psr (periodontal screening and recording), respectively . For inter - examiner calibration, both examiners evaluated the same 10 volunteers that were not enrolled in the study . After 1 week, the same patients were re - evaluated to assess intra - examiner calibration . The kappa values ranged from 0.80 to 0.97 . Before the cardiovascular surgery, the previously calibrated examiners performed bedside oral examination . Information regarding smoking history, hypertension, diabetes mellitus, dyslipidemia, and other comorbidities were obtained through medical charts and anamnesis . Only 1 patient could not undergo the periodontal examination due to his poor physical condition . For dentate patients, during oral examination, supragingival and subgingival dental plaque were collected . Only for edentulous patients, saliva samples were collected by rubbing sterilized absorbent paper points in the oral mucosa and on the alveolar ridge, palate, and tongue . The oral samples were stored in a sterile vial containing phosphate - buffered saline (pbs) at 20c for subsequent molecular analysis . A total of 47 cardiac valves were collected, aseptically, during valve replacement surgeries . A fragment of each sample was stored in a sterile container containing pbs at 20c for further analysis using real - time pcr . Dna extraction and molecular analysis through real - time pcr were carried out, respectively, at the laboratory of human cytogenetics and laboratory of human and medical genetics of the federal university of par (belm, brazil). A total of 114 samples of supragingival and subgingival dental plaque, saliva, and cardiac valves (30 mg) were transferred to sterile plastic tubes of 2 ml containing a buffer, maintaining aseptic handling, and posteriorly homogenized . Dna extraction proceeded according to a standard protocol that used proteinase k and cetyltrimethylammonium bromide (ctab) to remove complex polysaccharide . The samples of extracted dna were subjected to real - time pcr for the detection of dna from 4 different bacterial species: s. mutans, p. gingivalis, p. intermedia, and t. denticola . Taqman probes to 16s bacterial ribosomal dna (table 1) were specifically designed for this study (life technologies). For real - time pcr, 1 l of genomic dna (5 ng) was added to 8 l of taqmanuniversal pcr master mix (applied biosystems), 0.35 l of probe, and 3.15 l of water . The final volume of 14 l was obtained by adding ipc (1 l) and ipc dna (0.5 l), which was used as an internal control for the reaction . Amplification was carried out in a thermal cycler 7500 real - time pcr system (applied biosystems). The real - time pcr protocol consisted of an initial step of denaturation at 95c for 10 min, followed by 40 cycles at 95c for 15 s, and 60c for 1 min . List of primers and probes designed for the identification of different cariogenic and periodontopathogenic micro - organisms the distribution pattern of the quantitative data of the sample was evaluated through the shapiro wilk test . Posteriorly the quantitative data were submitted to the student t test and expressed as mean sem . Qualitative nominal variables were expressed as absolute frequency (relative frequency) and analyzed by the fisher exact test or the chi - square test with bonferroni correction . When possible, the prevalence ratio expressed as the prevalence ratio (confidence interval minimum maximum) the statistical software epiinfo 3.5.1 for windows (cdc atlanta) was used and a significance level of p <0.05 was established for all analyses . For the present study, a total of 114 oral samples (supragingival plaque, subgingival plaque, and saliva) and cardiovascular samples (heart valves) were collected from 42 patients with a mean age of 55.6 13.8 years . Regarding the medical conditions that led to valve replacement surgery, mitral regurgitation (23.4%) and aortic stenosis (21.2%) were the most common (table 2). Demographic, clinic, and dental characteristics of patients with heart valve diseases detailed oral examination for the investigation of dental caries and periodontitis was carried out in all 42 individuals . The mean number of teeth missing due to caries was 23.52 9.41 per patient, and all patients have already had a previous experience of caries resulting in tooth loss . According to the highest degree of periodontal disease observed in the individual, excluding edentulous patients (44.0%), periodontal pockets> 4 mm (43.4%), and dental calculus (34.7%) were present in a greater number of patients . Other demographic, medical, and dental characteristics of the patients are summarized in table 2 . Molecular analysis of oral samples revealed high frequency of s. mutans and p. intermedia in supragingival plaque, saliva, and subgingival plaque of dentate and edentulous patients (ranging from 60.0% to 100.0%), whereas p. gingivalis and t. denticola were present in fewer oral samples (ranging from 17.6% to 64.0%) (fig . 1). Distribution profile of oral bacteria between dentate and edentulous patients revealed significant differences for p. gingivalis (p = 0.024) and t. denticola (p = 0.037). According to the probing depth, p. gingivalis (p = 0.002) and t. denticola (p = 0.044) were found with a higher frequency in patients with periodontal pockets> 4 mm, with a rate> 75.0% . Percentage distribution of cariogenic and periodontopathic bacteria in dental plaque, saliva, and heart valve samples . P <0.05 versus valve sample of pi, pg, and td . P <0.05 versus supragingival dental plaque, subgingival dental plaque, and saliva sample for each oral bacteria . P <0.05 oral sample of dentate patients versus the oral sample of edentulous patients (saliva) for each oral bacteria . Regarding the presence of oral bacteria in the heart valves, all 4 micro - organisms were found in at least 1 sample, and only 5 valves (10.6%) were not infected with cariogenic or periodontopathic bacteria . The micro - organism most frequently found in the valve samples was the s. mutans (89.3%), followed by p. intermedia (19.1%), p. gingivalis (4.2%), and t. denticola (2.1%) (fig . Significant difference was observed between the frequency of s. mutans and the studied periodontopathic bacteria in the valve tissue (p <0.001) (fig . 1). Likewise, p. intermedia was significantly more present in the valve tissue compared to p. gingivalis (p = 0.025) and t. denticola (p = 0.007). Gingivalis, p <0.001; t. denticola, p <0.001), there was no significant difference between the presence of s. mutans in heart valve and dental plaque or saliva (p = 0.060) (fig . 1). There was no significant difference between the frequency of oral bacteria in the heart valves regarding dental condition (dentate, edentulous) (p = 0.504), anatomical location (aortic or mitral) (p = 0.596), and clinical diagnosis (stenosis, insufficiency, or both) (p = 0.256). For many years, studies have been developed with an aim to investigate the possible connection between periodontal disease and cardiovascular disease, through the evaluation of inflammatory markers that are common to both pathologies . However, recent studies, such as the study of nakano et al, attempted to elucidate the direct mechanisms that link oral diseases to cvds, and, according to this author, the presence of oral bacteria in the bloodstream (bacteremia) is probably one of the initiators of biological events that justify this association . The involvement of cariogenic bacteria in the pathogenesis of some cvds has been studied, and the reported detection rate of s. mutans in cardiovascular samples has been superior to the detection rate of periodontopathic bacteria . In the present study, a high detection rate of s. mutans in the heart valve samples, as well as dental plaque and saliva samples was observed . The higher frequency of s. mutans in the heart valves compared to other studies may be related to the great previous experience of dental caries among the participants of the present study . It was also observed a high percentage of tooth loss due to caries, and epidemiological studies have demonstrated that the absence of teeth may be a risk factor associated with many cardiovascular diseases, including aortic stenosis . In our research, the high detection rate of s. mutans in dental plaque samples and saliva samples may suggest that the s. mutans found in the valve samples was originated from the oral cavity . In the present study, edentulous patients also presented a high frequency of the cariogenic bacterium in saliva and cardiac valve samples . These bacteria can be found in the oral cavity even after complete tooth loss, adhered to soft tissue or dentures . The colonization of s. mutans in the cardiac tissue of these patients may have happened previously to complete tooth loss . Another theory is that these bacteria may have entered the bloodstream after complete tooth loss through soft tissue trauma . Statistically significant difference was found between the frequency of s. mutans and the other investigated micro - organisms in the heart valves . In the past few years, in vitro and in vivo experimental studies have reported that s. mutans has the ability to modify the expression of certain genes influenced by plasma components, in order to obtain advantages while inside the bloodstream . These findings may justify this bacterium's high ability to settle in the heart valve tissue . Jung et al reported the role of atla, a recent discovered fibronectin binding protein, in the s. mutans resistance to fagocitosis and in its ability to survive in the bloodstream . Fibronectin, elastin, laminin, and collagen are considered the most common extracellular matrix components and may serve as receptors for s. mutans . The discovery of bacterial surface structures such as the proteins p1, wapa, gtfb, gtfc, gtfd, cnm, and cbm, has been important to understand the mechanisms of attachment of these pathogens to the cardiovascular tissue, with subsequent invasion of endothelial cells, induction of inflammation with the production of cytokines, platelet aggregation, and foam cell formation . Jung et al and matsumoto - nakano et al have already reported the important interaction between this bacterium and the platelets in heart valve tissue through experimental studies, where they show that platelet aggregation is stimulated by this micro - organism . Pariodontophatic bacteria were found less frequently in heart valve tissue, when compared to the gram - positive bacterium s. mutans, corroborating the findings of nakano et al . Great variability is reported in the literature regarding the prevalence of these bacteria in heart valve tissues and atherosclerotic plaques, and the reported frequency is either superior or inferior to that observed in the present study . Many authors that found a higher frequency of these periodontal bacteria in cardiovascular tissues, compared to the present study, have included in their studies only dentate patients with moderate to severe periodontitis . In the present study, the majority of the dentate patients presented periodontal disease, exhibiting dental calculus and periodontal pockets> 3.5 mm for> 4 mm . This fact was determinant for the periodontal bacteria of the orange complex (p. intermedia) and red complex (p. gingivalis, t. denticola) to be detected at a high frequency in the dental plaque, specially subgingival plaque removed from periodontal pockets> 6 mm, corroborating previously reported findings . Among the gram - negative micro - organisms, p. intermedia was significantly more detected in the heart valve tissue (p <0.05). The high detection rate of this micro - organism in the oral samples of dentate (supragingival and subgingival dental plaque) and edentulous patients (saliva) probably explains its higher frequency in the heart valve samples, compared to the other periodontopathic bacteria . The hypothesis that periodontopathic bacteria can infect cardiovascular samples prior to complete tooth loss of a patient that had periodontal disease may be considered, as suggested by some authors, such as zaremba et al . The frequency of periodontopathic bacteria in the heart valve samples was considered low, when compared to their frequency in the oral samples, which may suggest that these micro - organisms have greater difficulty in surviving inside the bloodstream and adhering to heart valve tissue, compared to s. mutans . P. gingivalis has received special attention among the periodontopathic bacteria regarding its association with cvds, although it was found at a low frequency in the present study . This bacterium is detected at a high frequency in studies that investigate its presence in atherosclerotic plaques, and in vitro and in vivo experimental studies have demonstrated that p. gingivalis accelerates the process of atherosclerotic plaque formation through different mechanisms . In the present study, real - time pcr was used because it has previously demonstrated high sensitivity and efficacy in detecting bacterial dna in valve tissue and oral samples, even at low levels . Nevertheless, the polymerase chain reaction may also detect dna of dead bacteria, which poses a doubt regarding the role of the detected bacteria in the pathogenesis of the disease . It is unlikely that the bacteria present in the heart valve tissue are innocuous, as recent laboratorial studies have given support to the idea that these bacteria may have a direct influence in the initiation and progression of the disease . . The evaluation of the expression of different biomarkers (inflammatory, thrombotic, and osteogenic) in human heart valves affected with chronic diseases and its correlation with the presence and frequency of oral bacteria in those samples may provide a positive association between the infection and the intensity of the local inflammatory process . This would be an important finding to confirm an active role of the oral bacteria in the progression of these diseases . In summary, cariogenic and periodontopathic bacteria were found in dental plaque, saliva, and cardiac valve samples of patients with cardiovascular disease . The detection rate of s. mutans in cardiovascular samples was superior to the detection rate of periodontopathic bacteria . This finding may be related to the great previous experience of dental caries among the participants of the present study and s. mutans possible ability to survive in the bloodstream and attach to extracellular matrix components.
|
The earliest evidence for protein quality control at the er came from observations that unassembled subunits of the t cell receptor were rapidly degraded in the cells (lippincott - schwartz et al ., this degradation occurred independently of lysosomal proteases, leading to the proposal that the er itself would house some uncharacterized proteolytic activity toward misfolded proteins . Then a landmark study in yeast showed that the degradation of a short - lived misfolded er membrane protein was blocked in cells lacking ubc6, a component of the ubiquitin conjugation machinery (sommer and jentsch, 1993). The ubiquitin system mediates the covalent attachment of ubiquitin, a small 76amino acid protein, to target proteins in the cytoplasm by the sequential action of activating (e1), conjugating (e2), and ligase (e3) enzymes (pickart, 2001). Proteasome system in er protein quality control was confirmed by studies on the degradation of mutant and wild - type cystic fibrosis transmembrane conductance regulator (cftr), a large membrane protein with a complicated folding process (jensen et al . Inhibition of proteasome function led to accumulation of cftr molecules, and interestingly, a significant fraction of these was detected as ubiquitin conjugates (jensen et al . Soon after, it became clear that a similar mechanism could also account for the degradation of luminal misfolded proteins such as cpy *, a mutant version of the yeast vacuolar carboxypeptidase y and a prototype erad substrate (hiller et al ., these papers demonstrated that aberrant proteins in the lumen and membrane of the er are degraded in the cytoplasm where the components of the ubiquitin proteasome system reside . Subsequent genetic and biochemical studies, primarily in budding yeast but also in mammalian cells, identified many erad components and led to a general understanding of the organization of the pathway . An important realization was that the one - size - fits - all model does not apply to erad and that this pathway encompasses multiple branches with distinct specificity for different classes of misfolded proteins (taxis et al ., 2003; vashist and ng, 2004; carvalho et al ., 2006; however, irrespective of the branch, the same sequence of events leads to the degradation of all erad substrates (fig . 1 a). The first step is the recognition of a substrate in the crowded er environment . Then the substrate is transported across the er lipid bilayer back into the cytoplasm, a step known as retrotranslocation . On the cytosolic side of the er membrane, the substrate subsequently, the ubiquitinated substrate is extracted from the membrane in an atp - dependent manner and released in the cytoplasm for degradation by the proteasome . The execution of these steps is coordinated by a membrane - embedded protein complex named after the e3 ligase at its core . The canonical e3 ligases involved in erad are themselves multispanning membrane proteins, in which the ring (really interesting new gene) domain responsible for the ligase activity is in the cytoplasm . 1 b and table 1) where doa10 (swanson et al ., 2001) and hrd1 (bordallo et al . Assemble into the doa10 and the hrd1 complexes, respectively, each responsible for the degradation of a class of erad substrates (carvalho et al ., 2006). (a) the events defining the erad of a generic luminal substrate with a misfolded domain (red star). Substrate recognition, retrotranslocation, and ubiquitination are coordinated by a membrane - embedded e3 ligase complex . (b) the e3 ligase complexes involved in erad in s. cerevisiae and their substrate specificities . Er proteins with a misfolded domain in the cytoplasm (erad - c substrates) are degraded via the doa10 complex . Proteins with luminal (erad - l) or intramembrane (erad - m) misfolded domains are degraded via the hrd1 complex . Misfolded domains on proteins are indicated by a red star . Components of the yeast e3 ligase complexes and their mammalian counterparts based on the analysis of a few model substrates, the e3 ligase complex specificity appears to be determined by the location of the misfolded lesion on a substrate relative to the er membrane: proteins with misfolded domains in the cytoplasmic side of the membrane (erad - c substrates) are degraded via the doa10 complex; proteins with luminal (erad - l substrates) or intramembrane (erad - m substrates) misfolded domains are targeted to the hrd1 complex (fig ., 2003; vashist and ng, 2004; carvalho et al ., 2006). Factors involved in substrate recognition are unique to the e3 ligase complex and likely determine the substrate specificity of each erad branch . On the other hand, the components that act at late steps of erad, such as the cdc48 atpase complex (p97 in mammals) required for membrane extraction of ubiquitinated substrates (bays et al ., 2001b; ye et al ., 2001; jarosch et al ., 2002; 2002), are common to both e3 ligase complexes . In mammalian cells the best - studied e3 ligases are hrd1 and gp78 (table 1). They are both homologous to yeast hrd1 but assemble distinct e3 ligase complexes that preferably target different substrates (schulze et al ., 2005; mueller et al ., 2008 several more e3 ligases have been implicated in erad in mammalian cells (such as rma1/rnf5, trc8, rfp2, rnf170, and rnf185) but these are still poorly characterized . Only few substrates are known for each ligase and a preference for particular erad substrate classes has been difficult to infer (claessen et al ., 2012). The commitment to degradation by erad occurs at the level of substrate recognition; therefore, this step needs to be tightly controlled . Inefficient detection of misfolded proteins leads to their accumulation, ultimately affecting cell function (travers et al .,, overactive erad would likely have its cost, with the degradation of significant amounts of folding intermediates . This is a complex task considering the er environment, in which a complete spectrum of protein species coexist, from newly synthesized unfolded molecules to fully folded proteins . Proteins share structural similarities, for example the exposure of hydrophobic patches that are normally hidden once proteins acquire the native structure . These molecules are kept in a soluble state by binding to chaperones such as the er hsp70 (kar2 in yeast and bip in mammals), which are essential for the folding of newly synthesized polypeptides as well as for the disposal of misfolded proteins . However, chaperones on their own do not appear to determine the fate of their clients . Instead, recognition factors that are part of the e3 ligase complexes play a major role in erad substrate selection . For example, the recognition of erad - l substrates requires the luminal components of the hrd1 complex hrd3, kar2 and, in the case of glycosylated substrates, the lectin yos9 (plemper et al ., 1997, 1999; bhamidipati et al ., 2005; kim et al ., 2005; szathmary et al ., 2005; carvalho et al ., 2006; denic et al the yeast derlin der1, a membrane protein of the hrd1 complex, might also be involved in erad - l substrate recognition (gauss et al ., 2006b; stanley et al ., 2011). Moreover, certain erad - m substrates appear to be recognized directly by the e3 ligase hrd1 (sato et al ., 2009). However, the features recognized on the misfolded proteins by these erad factors are largely unknown . An informative exception is the recognition of luminal misfolded n - linked glycoproteins in saccharomyces cerevisiae (fig . As they enter the er lumen, proteins are often modified at asparagine residues (in the context of the n - x - s / t sequence) with a well - defined, branched glycan moiety made up of three glucose, nine mannose, and two n - acetylglucosamine residues, glc3man9glcnac2 (fig . Early glycan - processing enzymes such as glucosidases lead to the binding of lectins that facilitate the folding of the newly synthesized proteins . In contrast, late acting enzymes, such as the mannosidase htm1, trigger the binding of a different lectin that engages the protein in erad (jakob et al . This difference in the kinetics of the glycan - trimming enzymes provides an opportunity for newly synthesized proteins to acquire the native conformation and traffic beyond the er (fig . 2 a). A long er residency, indicative of folding problems, results in the processing of the misfolded glycoproteins by htm1, which generates a biochemical mark (1,6-linked mannose) decoded by the lectin yos9, an erad substrate recognition factor (quan et al ., 2008; clerc et al ., 2009) if properly folded, the proteins leave the er . Prolonged residency in the er, indicative of a persistent misfolded domain (red star), leads to htm1-dependent exposure of an -1,6linked mannose residue (red bar). Together, the misfolded domain and the terminal -1,6 mannose form the degradation signal recognized by hrd3/yos9 . (b) recognition of native mhc i heavy chain by the cytomegalovirus -encoded us2 adaptor in infected cells . Us2 binds to folded mhc i in the er membrane and delivers it to an e3 ligase complex containing the e3 trc8 and the signal - peptide peptidase spp resulting in mhc i degradation by erad . (c) sterol - dependent recognition of hmgr by insigs in mammalian cells . Under low sterol levels high sterol levels, in particular the accumulation of 24,25-dihydrolanosterol (four - ringed structure in gray), cause insig to bind to hmgr and to deliver it to an e3 ligase complex that promotes hmgr degradation by erad . Both yeast htm1 and its mammalian counterpart edem are in complex with oxidoreductases (pdi1 in yeast, erdj5 in mammals), required for the stability of htm1 and also for reducing disulfide bonds in misfolded proteins, which might affect subsequent erad steps (ushioda et al ., 2008; clerc et al ., the binding of yos9 to the 1,6-linked mannose is not sufficient to trigger the degradation of the misfolded protein . This processed glycan must be located in an unstructured polypeptide segment that is bound by hrd3 (xie et al ., 2009). The delivery of substrates to hrd3 might be facilitated by the luminal chaperone kar2 that is essential for erad (plemper et al . Xie et al ., 2009). The dual recognition of a specific n - linked glycan by yos9 and an unstructured segment by hrd3 likely enhances the stringency of erad substrate recognition, perhaps by a kinetic proofreading mechanism (fig . The recognition mechanism of misfolded luminal n - linked glycoproteins is likely similar in mammalian cells because the yeast components are largely conserved in higher eukaryotes (table 1). Os-9 and xtp3-b, the mammalian homologues of yos9, use their glycan - binding domain not only to interact with glycans in the misfolded protein but also with sel1, the mammalian version of hrd3, which is itself a glycoprotein (christianson et al ., 2008). Whether the interactions with sel1 and the substrates occur sequentially or correspond to different pools of os-9/xtp3-b is unclear . In either case, using the same domain to interact with a component and a substrate offers os-9/xtp3-b an additional mechanism to regulate recognition of n - glycosylated erad substrates . Recent work in yeast suggests that a different type of glycosylation, o - mannosylation, plays an important role in removing certain luminal proteins from futile folding cycles and thus favoring their degradation by erad after prolonged residency in the er (goder and melero, 2011; xu et al ., 2013). The enzymes involved in protein o - mannosylation physically associate with erad machinery, but how o - mannosylated proteins are captured by the erad components is still unclear (goder and melero, 2011). Therefore, o - mannosylation is another appealing mechanism for generating an irreversible biochemical mark on proteins displaying folding problems . A common feature between erad substrate recognition by n - glycan trimming and o - mannosylating enzymes is that both appear to be slow processes, requiring substrates to stay for relatively prolonged periods in the er . Whether other mechanisms involved in recognition of misfolded proteins by erad also require a lag period in the er is not known . Nevertheless, it is curious that newly synthesized proteins were shown to be protected from degradation for a period of time, even under conditions that favor their misfolding (vabulas and hartl, 2005). Therefore, recognition of misfolded proteins might have evolved as an intrinsically slow process, perhaps to spare some folding intermediates from prematurely engaging in erad . The degradation of specific folded proteins by erad is mediated by the same general machinery, but the recognition of these substrates involves distinct factors . A simple mechanism to target a native protein to erad is by a substrate - specific adaptor . For example, the human cytomegalovirus encodes er membrane adaptor proteins, us2 and us11, which bind independently to newly synthesized mhc i molecules and deliver them to erad components for degradation . As a consequence, infected cells display less mhc i complex at their surface and escape detection by the immune system (wiertz et al ., 1996a). Despite this common outcome, us11 uses its transmembrane domain to recruit mhc i into a complex which contains derlin-1 as well as sel1l, the p97 atpase complex and its membrane adaptor ubxd8 (lilley and ploegh, 2004; ye et al . Intriguingly, the e3 ligase required for us11-mediated mhc i degradation is not known and both hrd1 and gp78 e3 ligases, which are found in complex with derlin-1, appear to be dispensable . Us2, on the other hand, delivers its substrate to the erad ligase complex containing the e3 trc8 and spp, the signal peptide peptidase (fig . The precise function of spp in erad is not known and it is not even clear whether it involves its proteolytic activity . Despite these differences, both us2 and us11 act as adaptors to deliver a specific erad substrate, mhc i heavy chain, to the e3 ligase complexes that promote its degradation . A similar mechanism targets cd4 for degradation in cells expressing the hiv - encoded er membrane protein vpu . In this case, vpu works not only as the substrate adaptor for cd4 but also as a scaffold to recruit a cytosolic e3 ligase complex, scf, required for cd4 ubiquitination (fujita et al ., 1997; schubert et al ., 1998). In vitro reconstitution of vpu - mediated cd4 ubiquitination revealed that the specificity of adaptor - mediated substrate selection can be further increased at the level of substrate ubiquitination, which can be counteracted by the activity of de - ubiquitinating enzymes (zhang et al ., 2013). The strategy of using a substrate - specific adaptor is not exclusive to viral encoded proteins . Both in drosophila and in mammalian cells, the derlin - related irhom proteins function as adaptors in the erad - mediated degradation of egfr ligands as they traffic through the er (zettl et al ., 2011). Elegant genetic experiments in flies showed that this mode of regulated erad was important to control sleeping behavior that requires egfr signaling (zettl et al ., 2011). It is likely that more substrate - specific adaptors will be identified as our knowledge of the mechanisms of regulated erad expands . A substrate - specific adaptor also functions in the regulated erad of hmgr, a key enzyme of the sterol biosynthetic pathway . In this case the adaptor, either insig-1 or insig-2, does not bind constitutively to hmgr (song et al ., instead, the interaction only occurs in the presence of 24,25-dihydrolanosterol, an intermediate metabolite in sterol biosynthesis . Under low sterols levels hmgr 2 c). On the other hand, high sterol synthesis leads to a rise in 24,25-dihydrolanosterol concentration, which favors the binding of hmgr to one of the insig proteins, its delivery to an e3 ligase complex, and consequently its degradation by the proteasome (fig . 2 c). Whereas gp78 and the trc8 were originally implicated in hmgr regulated erad, recent data suggest that additional e3 ligases might also be involved (song et al ., 2005; lee et al ., 2010; jo et al ., 2011 degradation of hmgr by erad results in reduced flux through the sterol biosynthetic pathway and reestablishment of membrane lipid homeostasis . Interestingly, insig-1 (but not insig-2) is itself subjected to reciprocal sterol - regulated erad (lee et al ., 2006). Conversely, if sterol levels are high insig-1 binds to scap, another key er membrane protein required for sterol homeostasis, leading to a much longer insig-1 half - life . These data illustrate the complex interplay between the opposing effects of sterols on the stability of the hmgr enzyme and one of its adaptors for regulated degradation by erad . In yeast, sterol homeostasis also involves negative feedback of an hmgr homologue, hmg2 (hampton et al ., 1996). Like in mammals, degradation of yeast hmg2 is controlled by the insig - like proteins nsg1 and nsg2 and requires the e3 ligase hrd1 (bays et al . In fact, hrd1 was originally identified in a genetic screen for mutants defective in hmgr degradation (hrd genes; hampton et al ., 1996). The binding of hmg2 to nsg1 is also modulated by sterol levels (theesfeld and hampton, 2013). However, in contrast to mammalian cells, the binding of nsg1 promotes hmg2 stability, indicating that the recognition of this substrate is mechanistically different in the two systems (flury et al ., it has been proposed that nsg1 and nsg2 work as hmg2-specific chaperones and that in their absence hmg2 presents sufficient conformation instability to engage in erad as a misfolded protein (flury et al . This degradation is further accelerated by high concentrations of an early sterol - intermediate metabolite, geranylgeranyl pyrophosphate (theesfeld and hampton, 2013). Therefore, a change in the affinity to a binding partner is another strategy to target a protein for erad in a signal - dependent manner . Squalene monooxygenase (sqle), another enzyme of the sterol biosynthetic pathway, is also targeted by regulated erad both in yeast and in mammals (foresti et al ., 2013). Sqle degradation requires the yeast doa10 e3 ligase complex or its mammalian homologue teb4, indicating that two independent branches of erad control distinct steps in sterol biosynthesis (foresti et al ., 2013). Although the mechanism for the recognition of sqle by erad machinery is still not known, it is clear that insigs are dispensable for this recognition, both in mammals and in yeast (gill et al ., 2011; foresti et al ., 2013). In mammals, the n - terminal domain of sqle is necessary and sufficient for cholesterol - dependent degradation (gill et al ., 2011). Whether this domain binds directly to cholesterol or interacts with an erad - specific adaptor is not known . The mechanism for sqle recognition by erad in yeast is likely to be different because this n - terminal domain is only conserved among certain animals . Based on these few examples, it is clear that signal - mediated erad depends on the ability of cells to sense the concentration of some lipids in their membranes and on specific adaptors to selectively degrade key enzymes . Our knowledge on the mechanisms by which other classes of regulated erad substrates are recognized will grow as more of these are identified . The commitment to degradation by erad occurs at the level of substrate recognition; therefore, this step needs to be tightly controlled . Inefficient detection of misfolded proteins leads to their accumulation, ultimately affecting cell function (travers et al .,, overactive erad would likely have its cost, with the degradation of significant amounts of folding intermediates . This is a complex task considering the er environment, in which a complete spectrum of protein species coexist, from newly synthesized unfolded molecules to fully folded proteins . Proteins share structural similarities, for example the exposure of hydrophobic patches that are normally hidden once proteins acquire the native structure . These molecules are kept in a soluble state by binding to chaperones such as the er hsp70 (kar2 in yeast and bip in mammals), which are essential for the folding of newly synthesized polypeptides as well as for the disposal of misfolded proteins . However, chaperones on their own do not appear to determine the fate of their clients . Instead, recognition factors that are part of the e3 ligase complexes play a major role in erad substrate selection . For example, the recognition of erad - l substrates requires the luminal components of the hrd1 complex hrd3, kar2 and, in the case of glycosylated substrates, the lectin yos9 (plemper et al ., 1997, 1999; bhamidipati et al ., 2005; kim et al ., 2005; szathmary et al ., 2005; carvalho et al ., 2006; denic et al the yeast derlin der1, a membrane protein of the hrd1 complex, might also be involved in erad - l substrate recognition (gauss et al ., 2006b; stanley et al ., 2011). Moreover, certain erad - m substrates appear to be recognized directly by the e3 ligase hrd1 (sato et al ., 2009). However, the features recognized on the misfolded proteins by these erad factors are largely unknown . An informative exception is the recognition of luminal misfolded n - linked glycoproteins in saccharomyces cerevisiae (fig . As they enter the er lumen, proteins are often modified at asparagine residues (in the context of the n - x - s / t sequence) with a well - defined, branched glycan moiety made up of three glucose, nine mannose, and two n - acetylglucosamine residues, glc3man9glcnac2 (fig . Early glycan - processing enzymes such as glucosidases lead to the binding of lectins that facilitate the folding of the newly synthesized proteins . In contrast, late acting enzymes, such as the mannosidase htm1, trigger the binding of a different lectin that engages the protein in erad (jakob et al . This difference in the kinetics of the glycan - trimming enzymes provides an opportunity for newly synthesized proteins to acquire the native conformation and traffic beyond the er (fig . 2 a). A long er residency, indicative of folding problems, results in the processing of the misfolded glycoproteins by htm1, which generates a biochemical mark (1,6-linked mannose) decoded by the lectin yos9, an erad substrate recognition factor (quan et al ., 2008; clerc et al ., 2009) if properly folded, the proteins leave the er . Prolonged residency in the er, indicative of a persistent misfolded domain (red star), leads to htm1-dependent exposure of an -1,6linked mannose residue (red bar). Together, the misfolded domain and the terminal -1,6 mannose form the degradation signal recognized by hrd3/yos9 . (b) recognition of native mhc i heavy chain by the cytomegalovirus -encoded us2 adaptor in infected cells . Us2 binds to folded mhc i in the er membrane and delivers it to an e3 ligase complex containing the e3 trc8 and the signal - peptide peptidase spp resulting in mhc i degradation by erad . (c) sterol - dependent recognition of hmgr by insigs in mammalian cells . Under low sterol levels high sterol levels, in particular the accumulation of 24,25-dihydrolanosterol (four - ringed structure in gray), cause insig to bind to hmgr and to deliver it to an e3 ligase complex that promotes hmgr degradation by erad . Both yeast htm1 and its mammalian counterpart edem are in complex with oxidoreductases (pdi1 in yeast, erdj5 in mammals), required for the stability of htm1 and also for reducing disulfide bonds in misfolded proteins, which might affect subsequent erad steps (ushioda et al ., 2008; clerc et al ., the binding of yos9 to the 1,6-linked mannose is not sufficient to trigger the degradation of the misfolded protein . This processed glycan must be located in an unstructured polypeptide segment that is bound by hrd3 (xie et al ., 2009). The delivery of substrates to hrd3 might be facilitated by the luminal chaperone kar2 that is essential for erad (plemper et al . Xie et al ., 2009). The dual recognition of a specific n - linked glycan by yos9 and an unstructured segment by hrd3 likely enhances the stringency of erad substrate recognition, perhaps by a kinetic proofreading mechanism (fig . The recognition mechanism of misfolded luminal n - linked glycoproteins is likely similar in mammalian cells because the yeast components are largely conserved in higher eukaryotes (table 1). Os-9 and xtp3-b, the mammalian homologues of yos9, use their glycan - binding domain not only to interact with glycans in the misfolded protein but also with sel1, the mammalian version of hrd3, which is itself a glycoprotein (christianson et al ., 2008). Whether the interactions with sel1 and the substrates occur sequentially or correspond to different pools of os-9/xtp3-b is unclear . In either case, using the same domain to interact with a component and a substrate offers os-9/xtp3-b an additional mechanism to regulate recognition of n - glycosylated erad substrates . Recent work in yeast suggests that a different type of glycosylation, o - mannosylation, plays an important role in removing certain luminal proteins from futile folding cycles and thus favoring their degradation by erad after prolonged residency in the er (goder and melero, 2011; xu et al ., 2013). The enzymes involved in protein o - mannosylation physically associate with erad machinery, but how o - mannosylated proteins are captured by the erad components is still unclear (goder and melero, 2011). Therefore, o - mannosylation is another appealing mechanism for generating an irreversible biochemical mark on proteins displaying folding problems . A common feature between erad substrate recognition by n - glycan trimming and o - mannosylating enzymes is that both appear to be slow processes, requiring substrates to stay for relatively prolonged periods in the er . Whether other mechanisms involved in recognition of misfolded proteins by erad also require a lag period in the er is not known . Nevertheless, it is curious that newly synthesized proteins were shown to be protected from degradation for a period of time, even under conditions that favor their misfolding (vabulas and hartl, 2005). Therefore, recognition of misfolded proteins might have evolved as an intrinsically slow process, perhaps to spare some folding intermediates from prematurely engaging in erad . The degradation of specific folded proteins by erad is mediated by the same general machinery, but the recognition of these substrates involves distinct factors . A simple mechanism to target a native protein to erad is by a substrate - specific adaptor . For example, the human cytomegalovirus encodes er membrane adaptor proteins, us2 and us11, which bind independently to newly synthesized mhc i molecules and deliver them to erad components for degradation . As a consequence, infected cells display less mhc i complex at their surface and escape detection by the immune system (wiertz et al . Us11 uses its transmembrane domain to recruit mhc i into a complex which contains derlin-1 as well as sel1l, the p97 atpase complex and its membrane adaptor ubxd8 (lilley and ploegh, 2004; ye et al ., 2004; mueller et al ., 2008 intriguingly, the e3 ligase required for us11-mediated mhc i degradation is not known and both hrd1 and gp78 e3 ligases, which are found in complex with derlin-1, appear to be dispensable . Us2, on the other hand, delivers its substrate to the erad ligase complex containing the e3 trc8 and spp, the signal peptide peptidase (fig . The precise function of spp in erad is not known and it is not even clear whether it involves its proteolytic activity . Despite these differences, both us2 and us11 act as adaptors to deliver a specific erad substrate, mhc i heavy chain, to the e3 ligase complexes that promote its degradation . A similar mechanism targets cd4 for degradation in cells expressing the hiv - encoded er membrane protein vpu . In this case, vpu works not only as the substrate adaptor for cd4 but also as a scaffold to recruit a cytosolic e3 ligase complex, scf, required for cd4 ubiquitination (fujita et al ., 1997; schubert et al ., 1998). In vitro reconstitution of vpu - mediated cd4 ubiquitination revealed that the specificity of adaptor - mediated substrate selection can be further increased at the level of substrate ubiquitination, which can be counteracted by the activity of de - ubiquitinating enzymes (zhang et al ., 2013). The strategy of using a substrate - specific adaptor is not exclusive to viral encoded proteins . Both in drosophila and in mammalian cells, the derlin - related irhom proteins function as adaptors in the erad - mediated degradation of egfr ligands as they traffic through the er (zettl et al ., 2011). Elegant genetic experiments in flies showed that this mode of regulated erad was important to control sleeping behavior that requires egfr signaling (zettl et al ., 2011). It is likely that more substrate - specific adaptors will be identified as our knowledge of the mechanisms of regulated erad expands . A substrate - specific adaptor also functions in the regulated erad of hmgr, a key enzyme of the sterol biosynthetic pathway . In this case the adaptor, either insig-1 or insig-2, does not bind constitutively to hmgr (song et al ., instead, the interaction only occurs in the presence of 24,25-dihydrolanosterol, an intermediate metabolite in sterol biosynthesis . Under low sterols levels hmgr 2 c). On the other hand, high sterol synthesis leads to a rise in 24,25-dihydrolanosterol concentration, which favors the binding of hmgr to one of the insig proteins, its delivery to an e3 ligase complex, and consequently its degradation by the proteasome (fig . 2 c). Whereas gp78 and the trc8 were originally implicated in hmgr regulated erad, recent data suggest that additional e3 ligases might also be involved (song et al ., 2005; degradation of hmgr by erad results in reduced flux through the sterol biosynthetic pathway and reestablishment of membrane lipid homeostasis . Interestingly, insig-1 (but not insig-2) is itself subjected to reciprocal sterol - regulated erad (lee et al ., 2006). Conversely, if sterol levels are high insig-1 binds to scap, another key er membrane protein required for sterol homeostasis, leading to a much longer insig-1 half - life . These data illustrate the complex interplay between the opposing effects of sterols on the stability of the hmgr enzyme and one of its adaptors for regulated degradation by erad . In yeast, sterol homeostasis also involves negative feedback of an hmgr homologue, hmg2 (hampton et al ., is controlled by the insig - like proteins nsg1 and nsg2 and requires the e3 ligase hrd1 (bays et al . In fact, hrd1 was originally identified in a genetic screen for mutants defective in hmgr degradation (hrd genes; hampton et al ., the binding of hmg2 to nsg1 is also modulated by sterol levels (theesfeld and hampton, 2013). However, in contrast to mammalian cells, the binding of nsg1 promotes hmg2 stability, indicating that the recognition of this substrate is mechanistically different in the two systems (flury et al ., 2005;, it has been proposed that nsg1 and nsg2 work as hmg2-specific chaperones and that in their absence hmg2 presents sufficient conformation instability to engage in erad as a misfolded protein (flury et al ., 2005; this degradation is further accelerated by high concentrations of an early sterol - intermediate metabolite, geranylgeranyl pyrophosphate (theesfeld and hampton, 2013). Therefore, a change in the affinity to a binding partner is another strategy to target a protein for erad in a signal - dependent manner . Squalene monooxygenase (sqle), another enzyme of the sterol biosynthetic pathway, is also targeted by regulated erad both in yeast and in mammals (foresti et al ., 2013). Sqle degradation requires the yeast doa10 e3 ligase complex or its mammalian homologue teb4, indicating that two independent branches of erad control distinct steps in sterol biosynthesis (foresti et al ., 2013). Although the mechanism for the recognition of sqle by erad machinery is still not known, it is clear that insigs are dispensable for this recognition, both in mammals and in yeast (gill et al . The n - terminal domain of sqle is necessary and sufficient for cholesterol - dependent degradation (gill et al ., 2011). Whether this domain binds directly to cholesterol or interacts with an erad - specific adaptor is not known . The mechanism for sqle recognition by erad in yeast is likely to be different because this n - terminal domain is only conserved among certain animals . Based on these few examples, it is clear that signal - mediated erad depends on the ability of cells to sense the concentration of some lipids in their membranes and on specific adaptors to selectively degrade key enzymes . Our knowledge on the mechanisms by which other classes of regulated erad substrates are recognized will grow as more of these are identified . After being selected, erad substrates are retrotranslocated across the er membrane back into the cytoplasm . In the case of misfolded luminal proteins the complete polypeptide needs to be retrotranslocated, whereas for membrane substrates this step requires the transport of only certain domains . As a consequence, ubiquitination of luminal substrates only occurs at late stages of retrotranslocation, once a portion of the substrate has been exposed to the cytoplasm . In contrast, ubiquitination of most, but not all (burr et al ., 2013), membrane substrates is coupled to their retrotranslocation . In analogy to the transport of newly synthesized proteins into the er or mitochondria, it has been postulated that retrotranslocation occurs through a protein - conducting channel . However, the identity of the retrotranslocation channel has been at the center of an intense debate that is almost as old as the research in this field . Over the years, several channel candidates have been proposed but it has been difficult to gather definitive evidence in support of any of them . The sec61 translocon used for protein import into the er was the first proposed retrotranslocation channel (wiertz et al ., 1996b). Sec61 was found to interact with erad substrates both in yeast and in mammalian cells as well as with the yeast proteasome (wiertz et al ., 1996b; kalies et al ., 2005; scott and schekman, 2008). However, the significance of these associations is not clear . Recent work showed that proteins engaging the sec61 translocon aberrantly or persistently in their way into the er become substrates of the hrd1 ligase complex, which might explain the interaction between sec61 and some erad substrates (rubenstein et al ., 2012). In addition, certain yeast sec61 mutants displayed defects in degrading model erad substrates, even under conditions in which general forward translocation appeared not to be dramatically affected (pilon et al ., 1997; it remains to be determined whether this phenotype is caused by a specific impairment in retrotranslocation . The e3 ligase complexes interact with erad substrates immediately before and after their retrotranslocation, indicating this step occurs in their immediate vicinity . Therefore, multispanning membrane proteins within the e3 ligase complexes have also been seen as good candidates to mediate retrotranslocation (ye et al ., 2001; lilley and ploegh, 2004; kreft et al ., 2006; horn et al ., 2009; carvalho et al ., 2010; these include the e3 ligases themselves as well as proteins of the derlin family (der1 in yeast), which are essential for the degradation of all luminal erad substrates but whose function has remained elusive . In vitro experiments using mammalian - derived microsomes loaded with the yeast erad substrate mutant pro--factor indicate that derlin might be involved in retrotranslocation (wahlman et al ., 2007). In this simplified system, in which synthesis and retrotranslocation were uncoupled, the substrate cross - linked to derlin but not to sec61 . Moreover, its retrotranslocation was blocked by anti - derlin antibodies whereas antibodies directed to sec61 had no effect (wahlman et al ., 2007). It should be noted that mutant pro--factor is a noncanonical substrate because its retrotranslocation does not require ubiquitination . Interactions between the yeast der1 and the prototype erad - l substrate cpy * were also detected by site - specific photocrosslinking in yeast (carvalho et al . These cross - links were seen even in cells lacking the substrate recognition factors hrd3 and yos9, and were increased if conserved polar residues in the membrane domain of der1 were mutated . An interpretation of these results is that der1 mediates the transfer of substrates from the recognition factors hrd3/yos9 to the hrd1 ligase inside the membrane (mehnert et al ., 2014). A compelling piece of evidence for a function during substrate retrotranslocation was reported for the e3 ligase hrd1 (fig . Although commonly working in the context of the hrd1 complex, overexpressed hrd1 can mediate the degradation of erad - l substrates even in the absence of its membrane partners hrd3, der1, and usa1 (plemper et al . Hrd1 selectivity for misfolded proteins is lost, suggesting that the other subunits of the complex are critical to control hrd1 activity and substrate specificity (denic et al ., 2006). Hrd1 interacts with a sizeable region of a modified version of cpy * during the early stages of retrotranslocation, as assayed by site - specific photocrosslinking (carvalho et al ., importantly, the interaction likely occurs inside of the er bilayer because it is lost if substrate recognition is blocked or if the transmembrane segments of hrd1 are mutated . Hrd1 contains only six transmembrane segments; therefore, erad - l substrate retrotranslocation requires hrd1 oligomerization, which normally is facilitated by usa1 but can occur spontaneously upon hrd1 overexpression (horn et al ., 2009; all these data make a strong case for a direct role of hrd1 in the retrotranslocation of erad - l substrates, but the possibility that it works with some partner(s), such as der1, sec61, or other unknown factors cannot be excluded at this point . Moreover, it is not known whether this is a unique feature of hrd1 or whether the membrane domains of other e3 ligases also participate in the retrotranslocation of other classes of erad substrates . A working model for hrd1-mediated retrotranslocation of a luminal misfolded glycoprotein . Upon recognition (not depicted), the misfolded protein (gray) is transferred to hrd1 . The binding can occur either to hrd1 monomers or to usa1-mediated hrd1 dimers (1). Substrate - bound hrd1 dimer self - ubiquitinates (2), which leads to the recruitment of the cdc48 atpase complex . Atp hydrolysis by cdc48 induces a conformational change in hrd1 dimer that facilitates the early stages of substrate retrotranslocation (3). Once exposed to the cytoplasm, the substrate is ubiquitinated by hrd1 and recognized by the cdc48 complex (4), which uses its atpase activity to complete substrate retrotranslocation (5). After retrotranslocation, the ubiquitinated substrate is released in the cytosol for degradation by the proteasome (6). Ubiquitin is depicted as small circles . In most of these cross - linking experiments the retrotranslocation of cpy * was dampened by fusing it to a very tightly folded domain, indicating that erad - l substrates need to be unfolded before this step (bhamidipati et al . 2010). Whether unfolding is also a prerequisite for the retrotranslocation of other classes of erad substrates is not settled yet (fiebiger et al ., 2002; tirosh et al .,, substrates are ubiquitinated, a modification that allows their recognition by the cdc48/p97 atpase complex composed of a homohexamer of cdc48/p97 and by the cofactors ufd1 and npl4 (bays et al ., 2001b; ye et al ., 2001, 2003; the recruitment of this atpase complex to the er membrane is facilitated by ubiquitin regulatory x (ubx) domain containing proteins, ubx2 in yeast and ubxd8 in mammals (neuber et al ., 2005; schuberth and buchberger, 2005; mueller et al ., 2008). The atpase activity of the cdc48/p97 complex provides the driving force to move ubiquitinated substrates out of the membrane into the cytosol (ye et al ., 2003). Although the role of cdc48/p97 in this process is well established, the mechanism that couples atp hydrolysis to membrane extraction of the substrate is still not understood . In addition to the cdc48/p97 complex, the atpase subunits of the proteasome regulatory particle were also shown to play a role in retrotranslocation of some erad substrates (lipson et al ., 2008). The driving force for the retrotranslocation of the few non - ubiquitinated substrates, like the cholera toxin or pro--factor, is not known (kothe et al ., 2005; the cdc48/p97 complex also serves as a platform for other ubiquitin - modifying enzymes such as de - ubiquitinating enzymes (dubs; rumpf and jentsch, 2006; jentsch and rumpf, 2007; ernst et al . Although the role of some of these cdc48/p97-binding factors is not clear yet, it was shown that interfering with the dubs yod1 and ataxin-3 affected substrate retrotranslocation (wang et al ., 2006; ernst et al ., 2009). The requirement for dub activity during retrotranslocation suggests that the process involves cycles of ubiquitination and de - ubiquitination . In some cases these cycles might be important to increase the specificity of substrate recognition, as was shown for the vpu - mediated degradation of cd4 (zhang et al ., 2013). Interestingly, the retrotranslocation of some noncanonical substrates like cholera toxin, which are not ubiquitinated, is also affected by manipulation of both e3 ligase and dub activities (hassink et al ., 2006; these results suggest that retrotranslocation requires the ubiquitination of some factors other than the substrates . Future studies should test some obvious candidates such as the components of the e3 ligase complexes themselves . There is some recent evidence that the yeast cdc48 complex might be acting also much earlier, during the initial stages of retrotranslocation of an erad - l substrate, before it is exposed to the cytoplasm (fig . 3). Using a cross - linking strategy, it was shown that the interaction between hrd1 and an early retrotranslocation intermediate was lost in mutants of the cdc48 complex (carvalho et al ., 2010). Interestingly, a similar defect was detected in hrd1 mutants impaired for e3 ligase activity (carvalho et al ., it was proposed that in early stages of erad - l substrate retrotranslocation, hrd1 induces the ubiquitination of an erad component, perhaps hrd1 itself . This ubiquitination signals the recruitment of the cdc48 complex, which upon atp hydrolysis would induce changes in the conformation or in the oligomeric status of hrd1, resulting in substrate retrotranslocation . This model is consistent with the well - established role of cdc48/p97 in the disassembly and remodeling of protein complexes (jentsch and rumpf, 2007). Once the substrate emerges on the cytosolic side and is ubiquitinated by hrd1, the atpase complex binds to it and promotes the final stages of its retrotranslocation . Although many aspects of this model still wait for experimental support, it would provide a unifying role for the cdc48/p97 atpase as the driving force for substrate retrotranslocation in erad (fig . Substrates are kept soluble and transferred to the proteasome by cytosolic chaperones such as the bag6 complex (claessen and ploegh, 2011; wang et al ., 2011; xu et al ., 2012) or shuttle factors like rad23 and dsk2 (medicherla et al ., 2004). The identification of most of the components involved in this process and how these are pieced together and organized in the different erad branches were important achievements . A major challenge for the future is to reveal the mechanistic aspects of the pathway . Such developments should, for example, help in discerning the basis by which misfolded proteins are recognized in each of the different erad branches . The mechanisms of substrate retrotranslocation and the roles played by the different components, such as the e3 ligases and the cdc48/p97 complex, will certainly be another interesting area to follow . However, progress on these topics might require the development of new approaches, such as in vitro systems with purified components recapitulating individual erad steps . In early days, erad was perceived as a process mainly dedicated to er protein quality control . The picture now emerging places erad closer to other ubiquitination systems in the cytoplasm and nucleus, which control the turnover of specific proteins to achieve a certain physiological state . Therefore, another major challenge for the coming years is the detailed characterization of the roles of erad beyond quality control . Although the central role of erad in sterol homeostasis is unequivocal, it will be important to clarify whether erad has a more general role in the regulated degradation of folded er proteins and in that way modulates other er - related functions . A systematic and rigorous identification of regulated erad substrates should help in addressing these issues . Uncovering the intersections of erad with other cellular pathways will provide important insights into the mechanisms of er and cellular homeostasis.
|
Parasitic intestinal nematodes are widespread, affecting human and vertebrates . Worldwide, more than one - third of mankind is infected with helminths of which 100200 million people are infected with strongyloides [2, 3] and approximately 800 million with trichuris . The investigated nematodes strongyloides ratti and trichuris suis are very closely related to their human - pathogenic homologues strongyloides stercoralis and trichuris trichiura [5, 6]. In contrast to immune responses to microbes with mainly inflammation, the immune responses to helminths are mostly less intense and highly regulated . Modulation of the host's immune response reported from t. suis ova can be beneficial for an attenuation of inflammatory bowel diseases (ibd) such as crohn's disease and ulcerative colitis [8, 9]. Helminths release multiple excretory / secretory (e / s) products which enable them to establish, survive, and reproduce in their hosts successfully [10, 11]. In case of s. ratti and t. suis, these e / s products include antioxidative proteins such as thioredoxin (trx), heat shock proteins, and numerous proteases as well as protease inhibitors, galectins, and orthologous of host cytokines [10, 1216]. Trx has also been reported in e / s products of multiple helminths [1720]. Recently, these e / s proteins have also been detected in extracellular vesicles from helminths . Trx or the trx system in general is widespread from archaea to human consisting of trx, the trx reductase, and nadph . Hereby, trx is reduced by the trx reductase in an nadph - dependent manner . In general, trx superfamily members regulate thiol - based redox control, operating as protein disulfide oxidoreductases, and protect cytosolic proteins against aggregation in the cell . Its redox - regulating activity is important for dna replication, maintenance of the cellular redox state, and, therefore, the cellular homeostasis and antioxidant defense [22, 25]. Furthermore, trx is part of multiple cellular pathways and capable of regulating transcription factor activities, inhibition of apoptosis, protection from high - energy oxygen radicals, and regeneration of denatured proteins and is critical for signal transduction through thiol redox control as well as more specific processes like presenting antigens [22, 23, 2628]. Without a signal peptide, trx is secreted by a nonclassical secretory pathway by various cells [29, 30]. The numerous extracellular activities of trx include anti - inflammatory and antiapoptotic, and thus cytoprotective effects [3133]. Of interest, multifunctional prokaryotic trx, which displays unrelated properties, that is, antioxidant activity and promotion of dna replication, has been described as moonlighting protein [3436]. In the e / s products of strongyloides and of multiple other helminths numerous multifunctional proteins have been detected like the moonlighting enzymes enolase and glyceraldehyde-3-phosphate dehydrogenase [10, 13, 3739]. While trx is well characterized, less is known about the functions of trx - lp . The trx - lp, a member of the trx superfamily, is a fusion protein composed of the classical trx domain (wcgpc) at the n - terminus and a c - terminal proteasome - interacting thioredoxin (pith) domain, formerly known as duf1000 (protein families database, http://pfam.xfam.org/family/pf06201). It is larger than the classical trx (12 kda), which is highly conserved in all species [23, 25]. Proteins of the trx superfamily have been reported in various protozoan parasites including plasmodium, trypanosoma, and toxoplasma [4043] and in the trematode clonorchis sinensis . Besides thiol - based redox control, eukaryotic trx - lps are also involved in signaling processes as cofactors of certain enzymes, regulating specific signal proteins [45, 46]. For example, the human trx - related protein (trp32), known as txnl-1, protects the cell against glucose deprivation - induced cytotoxicity and is involved in activation of antiapoptotic akt / pi3k signaling as well as pten (phosphatase and tensin homologue deleted on chromosome ten) inhibition [47, 48]. Another example is the thioredoxin domain containing 17 (txndc17), also known as trx - related protein of 14 kda (trp14), which is stat-3-dependent and responsible for the drug resistance in human colorectal cancer cells . Trp14 also shows, like trx1, s - nitrosylase activity and furthermore is able to control the tnf-/nf-b signaling pathway [4951]. In addition, pten is also an interaction partner of human trx and among others trx controls the tnf-/nf-b signaling pathway as well [52, 53]. The novel thioredoxin - related transmembrane protein tmx4 is a type i transmembrane protein with its trx - like domain inside the er which possibly plays a role in the correct folding of proteins inside the er due to its reductase function . Since trx have been reported to act as chemoattractant for leukocytes and to induce cytokines we wanted to examine if srtrx - lp has similar impact on monocytic cells . In the present study we cloned and characterized two trx - lps and investigated some functional activities including their chemotactic activity, their ability to promote wound healing processes in the intestinal epithelial cell (iec) caco-2 model, and their involvement in cytokine release in a three - dimensional- (3d-) cell culture model the s. ratti life cycle was maintained in our laboratory as reported [13, 15]. Animal experiments were approved by and conducted in accordance with guidelines of the animal protection board of the city of hamburg (g21131/591 - 00.33). The life cycle was maintained using wistar rats by serial passage and the developmental stages isolated as described . S. ratti and t. suis extracts were prepared from freshly harvested life stages as described before [13, 15]. Pcr products and plasmids were sequenced by the dideoxy termination method of sanger performed by eurofinsgenomics.eu . For homology searches further, for bioinformatics analyses the expert protein analyses system (expasy) proteomics server of the swiss institute of bioinformatics (http://expasy.org/tools/) was used . To obtain the conserved domains of the trx - lps the protein families database (pfam) of the usa server (http://pfam.xfam.org/family/pf06201) was used which represents proteins by multiple sequence alignments and hidden markov models (hmms). Multiple sequence alignments were performed by the program clustal_w2 (http://www.ebi.ac.uk/tools/msa/clustalw2/) from the european bioinformatics institute which is part of the european molecular biology laboratory (embl - ebi). Srtrx - lp and tstrx - lp sds - page bands were excised, cut into small cubes, and transferred to microtubes and in gel digestion was performed as described elsewhere . Briefly, gel pieces were destained using 30% acetonitrile (acn), 0.07 m nh4hco3, reduced with 20 mm dithiothreitol and alkylated by 1% acrylamide, and dehydrated using 100% acn . Acn was removed and the gel pieces were dried using a vacuum centrifuge and rehydrated in 0.1 m nh4hco3 containing 0.5 g of trypsin (promega, mannheim, germany). A sufficient volume of 0.1 m nh4hco3 was added to cover the gel pieces completely and digestion was performed at 37c overnight . The peptide containing supernatant was transferred to new microtubes and the gel pieces were extracted with 50% acn, 0.1% trifluoroacetic acid followed by 0.1 m nh4hco3 and acn . Samples were dried in the vacuum centrifuge, resuspended in 5% acn and 5% formic acid, desalted using c18 stagetips, dried again, and resuspended in 5% acn and 5% formic acid . For reversed phase chromatography in house manufactured analytical columns were used . Using 100 m inner diameter fused silica capillaries, spray tips were generated with a p2000 laser puller (sutter instruments, novato, ca, usa) and packed with 5 m reprosil - pur 120 c18-aq particles (dr . Maisch, ammerbuch - entringen, germany). Peptides were loaded directly on the analytical column using a nanoflow uhplc system (easy - nlc 1000, thermo fisher scientific, bremen, germany) at a flow rate of 1 l / min solvent c (water with 0.1% formic acid). Peptides were eluted applying a 60 min linear gradient from 100% solvent a (water with 5% dmso, 0.1% formic acid), to 65% solvent a, 35% solvent b (acn with 5% dmso, 0.1% formic acid) at a flow rate of 400 nl / min . Eluting peptides were ionized in the positive ion mode at 1.6 kv in the nanospray ion source of an orbitrap velos mass spectrometer (thermo fisher scientific, bremen, germany). Survey scans (m / z 400 to 1200) were performed in the orbitrap analyzer at a resolution of 30,000 followed by fragmentation of the 10 most abundant ions in the linear ion trap by collision induced dissociation . Dynamic exclusion was set to 30 sec with an exclusion list size of 500 . Files were analyzed using maxquant (version 1.5.2.8) using the following settings: protein n - terminal acetylation and oxidation of methionine were set as variable modifications and propionamide at cysteine was set as fixed modification; enzyme specificity was set to trypsin and up to two missed cleavage sites were allowed . Data were searched against a database consisting of all s. ratti and t. suis entries from uniprot / trembl (version from 12/01/2014, 12,462 entries) as well as common contaminations . S. ratti and t. suis rna were isolated from adult parasitic females as described before and the cdna was synthesized by using the first strand cdna kit from new england biolabs inc . Reverse primers were generated using the online tool provided by clontech (http://bioinfo.clontech.com/infusion/) (tstrx - lp: forward: aaggtcgtcatatgatggct ataaaggagataa; reverse: tcctcgagaattcctaatgagcttctccctt; srtrx - lp: forward: aaggtcgtcatatgatggctataaaggagataa; reverse: tcctcgagaattcctaatgagcttctccctt). Fragments were amplified by pcr using the infusion hd cloning kit from clontech according to the manufacturer's instructions and the phusion high - fidelity dna - polymerase from thermo scientific (waltham, usa). The trx - lp pcr fragments from s. ratti and t. suis were cloned into pjc45 vector and iba 3 plus vector, transformed into escherichia coli stellar cells (clontech, usa) and sequenced (eurofins mwg). The s. ratti and t. suis trx - lps were expressed in lipopolysaccharide- (lps-) free e. coli strain clearcoli bl21 (de3) (lucigen simplifying genomics), which do not trigger the endotoxic response in human cells, in luria - bertani medium containing 100 g / ml ampicillin . The expression of the his - tag fusion proteins was induced by isopropyl--d - thiogalactopyranoside (iptg, final concentration 1 mm) and the expression of the strep - tag fusion proteins by anhydrotetracycline (aht, final concentration 200 g / l), for 5 h at 37c . The bacterial cells were collected by centrifugation (6,000 g) for 15 min and kept at 20c until use . Recombinant proteins were purified by using ni affinity chromatography (qiagen, hilden, germany) or strep - tactin superflow plus (qiagen, germany) according to the manufacturer's instructions . The imidazole or desthiobiotin was removed by dialysis overnight using phosphate - buffered saline (pbs, ph 7.4). Even though the endotoxin - free e. coli strain was used the lps inhibitor polymyxin b (sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) was applied to verify expression and purity of the proteins, which were visualized by coomassie brilliant blue g-250 staining . After sds - page and the following transfer onto nitrocellulose membranes, the membranes were incubated with the anti - his6-peroxidase (2) (mouse monoclonal; 1: 5000; roche life science, mannheim, germany) overnight at 4c . According to the method of holmgren (1979) as well as luthman and holmgren (1982), disulfide reduction activity was measured by reduction of insulin [61, 62]. In this test, the turbidity of the sample was measured, which is caused by the precipitating reduced insulin . The resulting decrease in absorbance, the srtrx - lp was repeatedly regenerated by dtt . Here, the regeneration of active trx - lp is faster than the direct reduction of insulin by dtt . Initially, 1.6 mm insulin (bovine pancreas, sigma - aldrich, hamburg, germany) was prepared by a suspension of 50 mg of insulin in 2.5 ml 100 mm potassium phosphate buffer (ph 6.5) for the reaction approach . Here, the ph was first adjusted to 3 with 1 m hcl solution to completely dissolve the protein and the ph was adjusted to 6.5 with 1 m naoh . The solution was supplemented with dh2o to a volume of 5 ml . Thereafter, a master mix of 825 l 1.6 mm insulin (160 m final volume) and 4675 l pe (100 mm potassium phosphate, 2 mm edta, ph 6.5) buffer was prepared . Srtrx - lp was tested at a concentration of 1 m (30 g / ml), 2.5 m (75 g / ml), and 5 m (150 g / ml). In an interval of 1 min over a period of 40 min, the reduction of insulin by srtrx - lp was measured . As a negative control, the relative specific enzymatic activity was calculated by the following formula: a650 1000/mg protein concentration in the reaction mix . According to the method of wollman et al . (1988), the trx - lp from either s. ratti or t. suis was reduced by 100 mm dtt for 1 h at room temperature (rt) and dialyzed against 80 mm hepes and 10 mm edta buffer for 1 h at 4c to remove dtt . The buffer was mixed with 1.7 m igm (piercetm mouse igm isotype control, thermo scientific, czech republic) and 0.5 l, 1 l, and 5 l of the reduced trx - lp solution for overnight reaction at rt . For protein size determination sds - page analysis healthy volunteers served as source for peripheral blood mononuclear cells (mnc) and polymorphonuclear cells (pmn) purified from venous blood samples (collected in sodium citrate tubes). First, erythrocytes were sedimented from anticoagulated blood samples by addition of equal amounts of 6% hydroxyethyl starch (heas - steril, fresenius, friedberg, germany). Mncs were separated from pmn as reported before by density centrifugation using a two - level density gradient consisting of mono - poly resolving media (1.114 g / ml; mp biomedicals, stockholm, sweden) and lymphoflot (1.077 g / ml; bio - rad, dreieich, germany). The cells were washed carefully with pbs, followed by a centrifugation step at 1,800 rpm for 10 min . This step was optionally repeated one more time, if too many platelets were present . While the mncs were added to the thp-1 media, the pmns were resuspended in hbss both at a concentration of 5 10 cells / ml and stored on ice until further use . To analyze the immunological effect of srtrx - lp and tstrx - lp, the recombinant proteins were used as stimuli in a 3d - coculture model, composed of human intestinal epithelial and dendritic cells (dcs), derived from monocytic thp-1 cells, grown on a collagen scaffold that mimics the in vivo natural microenvironment . The human intestinal epithelial cells, caco-2 cells, were grown in dmem media (with 10% fcs, 1% nonessential amino acids, 1% pen / strep; liefer - co) until denseness of 7080% was reached and seeded on 12-well plates in thincerts tc inserts (greiner bioone) followed by the addition of 200 l collagen (university hospital wrzburg) to each insert . Prior to adding the caco-2 cells, the collagen was incubated 1 h at 37c for gelation . To detach the caco-2 cells from the flask the cells were trypsinized prior to transfer 10 cells / well into the collagen - layered inserts and incubated for 2 h at 37c and 5% co2 to let them adhere on the collagen . For differentiation to dcs, thp-1 cells were washed twice in pbs and seeded in serum - free rpmi 1640 media supplemented with il-4 (1000 iu / ml; peprotech, hamburg, germany) and gm - csf (1000 iu / ml; peprotech) and were grown for 710 days . Subsequently the generation of mature dcs was verified by staining 10 washed cultured cells with phycoerythrin- (pe-) conjugated monoclonal anti - cd86 (b7 - 2) antibodies (mouse anti - human cd86-pe - conjugated antibody; becton - dickinson bioscience, san diego, usa, and a pe - conjugated isotype control; pharmingen, leiden, netherlands) analyzed by flow cytometry (cellquestpro; bd) (data not shown). After proper development of both cell types, the caco-2-collagen inserts were transferred to the wells with grown dcs, which were floated with dmem media (10% fcs, 1% nonessential amino acids, 1% pen / strep). The trx - lps were added as stimuli (5 g, 10 g, and 25 g / ml), while the ufm-1 activating protein uba-5 (25 g / ml) from the nonparasitic nematode caenorhabditis elegans served as negative control . Further controls were performed with the bacterial cell wall components lps (1 g / ml; sigma - aldrich, taufkirchen, germany) and lipoteichoic acid (lta, 0.1 g / ml; sigma - aldrich, taufkirchen) to analyze potential endotoxin contaminations and to compare both responses . The supernatants were taken after 24 h, 48 h, and 72 h and stored at 20c until further use . For detection of the cytokines tnf-, il-10, il-22, and tslp in cell supernatants, kits from ebioscience (san diego, usa) were used according to the manufacturer's instructions . Here, il-10 was detected with a sensitivity of 2 pg / ml, il-22 and tslp with a sensitivity of 8 pg / ml, and tnf- with a sensitivity of 4 pg / ml . To measure the binding affinity of the s. ratti and t. suis trx - lps to certain cell types, the purified proteins were labeled using the alexa fluor 647 protein labeling kit microscale (a30009) from invitrogen (oregon, usa) according to the manufacturer's instructions . The binding affinity for both trx - lps to monocytes, lymphocytes, and granulocytes from peripheral blood, as well as to the cell lines thp-1 cells (undifferentiated and differentiated) and caco-2 cells, were tested . The fluorescently labeled proteins were tested in four different concentrations (0.1 g and 0.2 g [data unpublished] and 0.4 g and 0.6 g). Each sample, which consisted of srtrx - lp or tstrx - lp and the cell type to be tested, was brought to a volume of 200 l with pbs and incubated for 30 min . After incubation, samples were washed twice, resuspended in 150 l pbs, and analyzed by flow cytometry on a facscalibur cytometer (bd biosciences), with 10,000 events collected from the gated populations . For further characterization of the binding specificity, cells were preincubated with 0.1 g and 0.2 g (data not shown) or 0.4 g and 0.6 g of unlabeled protein for 30 min prior to the addition of the corresponding labeled proteins . The data were analyzed with cellquestpro . To evaluate the chemotactic activity of human monocytic thp-1 cells, boyden chambers were used as described previously [68, 69]. Dtt (100 mm) reduced trx - lps from s. ratti and t. suis were tested at concentrations of 3 ng, 30 ng, 300 ng, and 1 g each in 100 l . The assay was performed with negative controls (random migration) such as chemotaxis buffer (pbs containing cacl2, mgcl2, and bsa) and thp-1 media (rpmi containing hepes and 10% fcs) and as positive control lps at 100 ng, since lps induces migration of monocytic cells . Thp-1 cells (2 10) were allowed to migrate through polyvinyl - pyrrolidone - free polycarbonate filters (pore size: 3 m; nuclepore, tbingen, germany) within 90 min at 37c and 5% co2 . Afterwards, migrated cells were counted by using an inverted zeiss microscope (axiovert 25). To monitor epithelial cell migration of caco-2 cells and the ability of trx - lps to improve the wound healing process, we used the cytoselect 24-well wound healing assay (cell biolabs, inc .) According to the manufacturer's instructions . By means of the cytoselect wound healing 500 l of a caco-2 cell suspension (containing 0.5 10 cells) was added to each well after the inserts had firm contact with the bottom of the wells . After overnight incubation, a monolayer was formed, the inserts were removed, the cells were washed, and the different stimuli were added . We used both trx - lps, from s. ratti and t. suis, in concentrations of 3 ng, 30 ng, 300 ng, 1 g, 10 g, and 25 g per 500 l . As a positive control the human epidermal growth factor (egf; 0.5 ng, 5 ng, 10 ng, 15 ng, and 25 ng) was included in order to get the proper concentration for maximal wound healing effects . As negative control cell media and lps were added . An inverted digital microscope (evos fl thermo fisher scientific) by advanced microscopy group was used for observation (4x magnification). The cells were incubated for 4 days, whereby each 24 h a picture was taken and the percent closure was calculated . Statistical differences between groups were analyzed with the t - test for independent samples or the mann p <0.05 was taken as moderate evidence of significance and p <0.01 as strong evidence of significance . Srtrx - lp is represented by the cluster sr00399 and was abundantly found in s. ratti e / s products of parasitic s. ratti females . The partial sequence was identified as the thioredoxin family protein and was used to obtain the full - length cdna sequence by pcr . Further, the full - length cdna sequence of the t. suis hypothetical protein m513 (accession no . The protein sequence of the recombinantly expressed s. ratti and t. suis trx - lps have been verified by mass spectrometry . Conserved domains of the trx - lps from the intestinal helminths s. ratti and t. suis were ascertained by the protein families database (pfam). Neither the trx - lp from s. ratti nor the trx - lp from t. suis contain a signal peptide . Both proteins have an n - terminal thioredoxin domain containing the active side motif cxxc (cgpc) and a c - terminal pith (proteasome - interacting domain of thioredoxin - like) domain . The alignment of the amino acid sequences from different organisms revealed a relatively low degree of identity between the different species . Between the trx - lps from s. ratti and t. suis the degree of identity (39%) was not as high as between trx - lps from s. ratti and b. malayi (56%). Trx - lps (94%), similar to the sequences of s. ratti and s. stercoralis (99.9%) (data not shown). Comparing the other aligned helminth protein sequences, the similarities to the s. ratti and the t. suis trx - lps varied between 35% and 56% . The comparison of the redox - regulating protein between s. ratti and homo sapiens showed 43% identity . The aligned helminth sequences share, except for the trematode schistosoma mansoni, the catalytic site sequence (cgpc) with the human trx - lp sequence of the active site . There are always two cysteines which are separated by two amino acids, mostly glycine and proline . Instead of a glycine, the s. mansoni catalytic site sequence has an arginine (r) (figure 1). Both parasite trx - lps have a trx - like domain (left) as well as the pith domain (right) (figure 2; phyre2:). Srtrx - lp and tstrx - lp were recombinantly expressed in endotoxin - free e. coli as his - tagged proteins and as strep - tagged proteins . The amount of purified his - tagged proteins, however, was higher than the amount of purified strep - tagged proteins . Thus, after preliminary tests with strep - tagged proteins, we further worked with his - tagged proteins . Both parasite proteins were verified by western blot using anti - strep and anti - his antibody (figure s1) and mass spectrometry . (1) insulin reduction . For measurement of the functional activity of srtrx - lp using insulin, the precipitation of free insulin -chains was measured spectrophotometrically at a wavelength of 650 nm according to holmgren (1979) as well as luthman and holmgren (1982) [61, 62]. A concentration of 1 m (30 g / ml), 2.5 m (75 g / ml), and 5 m (150 g / ml) of the srtrx - lp was used and the measuring time was plotted against the rate of precipitation (a650/min 10), which was about 0.064 a650/min at the highest concentration . Srtrx - lp reduces insulin with a relative specific activity of 1556.67 and is regenerated by dtt whereby in the negative control and the lowest concentration of srtrx - lp only a slight precipitation of insulin could be measured (figure 3). Its molecular weight is about 950 kda and it contains 26 interchain disulfide bridges that are potential substrates for trx and thus for trx - lp . Additionally to the insulin reduction activity assay, the dithiol - disulfide oxidoreductase activity of the trx - lps was analyzed by an igm reduction test according to wollman et al . As positive control igm was reduced by 100 mm dtt at which bands at about 70 kda (heavy chain igm) and 25 kda (light chain igm) occur (figure 4, 3rd lanes). Only exposing igm to the highest amount of srtrx - lp, five main bands were identified (figure 4(a), lane 7). In addition to the bands at 70 kda and 25 kda, similar to the reduction of igm with dtt, and the band at 250 kda, now bands at about 30 kda, representing monomeric s. ratti trx - lp and 60 kda representing dimeric s. ratti trx - lp, were determined . Almost similar protein bands have been observed when t. suis trx - lp was analyzed (figure 4(b)); however, t. suis trx - lp also at the low and intermediate concentration leads to the reduction of igm . Further, bands at 140 kda (heavy chain dimers of igm) were predominant at all tstrx - lp doses (figure 4(b)). The binding ability to other immune cells as well as mucosal caco-2 cells was examined by facs (figure 5). Monocytes, lymphocytes, and neutrophils as well as caco-2 cells, thp-1 cells, and thp-1-derived dendritic cells (dcs) were exposed to alexa flour - labeled trx - lps . Thus, srtrx - lp (figure 5(a)) as well as tstrx - lp (figure 5(b)) proteins strongly bound to monocytic cells shown in a dose - dependent manner for peripheral monocytes (srtrx - lp: mfi 175185; tstrx - lp: mfi 1960), thp-1 cell line (srtrx - lp: mfi 36108; tstrx - lp: mfi 38133), and generated dcs (srtrx - lp: mfi 85170). Srtrx - lp and at lower degree tstrx - lp also bound to caco-2 cells (srtrx - lp: mfi 4552; tstrx - lp: mfi 1442) and with limited affinity to neutrophilic granulocytes (srtrx - lp: mfi 15 - 16; tstrx - lp: mfi 1750) and lymphocytes (srtrx - lp: mfi 911; tstrx - lp: mfi 1020). In order to verify the differentiation of thp-1 cells to dcs by il-4 and gm - csf, cd86 localized on the surface of differentiated dcs but not on thp-1 cells (data not shown). The s. ratti and t. suis trx - lps were examined for their ability to induce the release of cytokines in human 3d - cocultures of intestinal epithelial cells (iec) and dcs . The release of the inflammatory (tnf-), anti - inflammatory (il-10), and th2-related cytokines (il-22, tslp) was analyzed . In preliminary experiments, the optimized concentrations of lps and lta were determined as 0.5 g / ml and 0.1 g / ml (data not shown). 200 g / ml t. suis extract was used as a positive control and cell culture medium was used as a negative control (figure 6(a)). The trx - lps were tested at concentrations of 3 ng, 30 ng, 300 ng, 1 g, 10 g, and 25 g (each per ml). The reduced state (reduction via dtt) and the oxidized state (freshly purified protein, only partly reduced, see igm reduction) of the trx - lps made no difference in the cytokine response (data not shown). This observation indicated that the immune responses the proteins triggered are probably active site - independent . 10 g and 25 g of both helminthic trx - lps are the most representative concentrations inducing the highest cytokine release . Cocultured cells exposed to t. suis (ts) extract showed in particular an enhanced production of il-10 and il-22 after 48 h and an even higher release of il-10 after 72 h, while the proinflammatory cytokine tnf- was downregulated (figure 6(a)). Srtrx- as well as tstrx - lp induced initially a slightly pronounced release of proinflammatory tnf- after 24 h (p <0.01), followed by an increased production of il-22 and tslp after 48 h of incubation (p <0.01). In response to the exposure of the cocultures to trx - lps in particular the th2-associated cytokine il-22 was produced after 48 h and 72 h (p <0.01). At a concentration of 25 g of tstrx - lp, the tnf- release increased after 48 h and even dominated the il-22 production . After 72 h, the il-22 and tslp production was dominating the overall tnf- production . 10 g / ml of trx - lps appears to be slightly more potent with respect to cytokine release than 25 g of protein with statistical significance only between the il-22-inducing srtrx - lp concentrations after 48 h (p <0.01) (figure 6(b)). Therefore, we investigated the chemotactic activity of the parasite trx - lps for monocytic thp-1 cells by using boyden chambers . Different trx - lp concentrations (3 ng, 30 ng, 300 ng, and 1 g; each per 100 l) from both studied parasites were added to the lower compartment of the chambers . In the negative control, a few cells migrated through the membrane, while the cell migration using lps as stimulant was significantly increased . Among the different applied trx - lp concentrations the highest migration rate was detected at 3 ng . The overall cell migration was higher in case of s. ratti trx - lp than after stimulation with the tstrx - lp and half bell - shaped dose - response curve reported for chemokines is more pronounced in case of the tstrx - lp (figure 7). As an important functional activity it was investigated whether the trx - lps from both nematode parasites express wound healing activity . Therefore, the effect of different concentrations of trx - lps on epithelial cell (caco-2) wound closure (figure 8, data, and figure 9, microscopic photography) was analyzed . Compared to the untreated cells, where the wound - like area narrowed 1015% every day, the stimulated cells showed almost twice as much growth . 300 ng/500 l of both parasite trx - lps are the most potent concentration for promoting the wound healing process as well as 10 ng of egf, which was included as positive control, while 3 ng and 30 ng and concentrations upon 1 g (each per 500 l) have a more moderate effect on wound healing . The wound healing process was highly significantly promoted by egf and tstrx - lp (p <0.01) as well as significantly promoted by srtrx - lp (p <0.05). Trx is a physiologically important multifunctional protein and prokaryotic trx has been described as so - called moonlighting protein [34, 35]. The multiple biological functions comprise features as growth factor and antioxidant, as inhibitor of apoptosis and transcriptional factor, and as chemokine [22, 23, 2528]. Very little is known about trx - lps, in particular about those from helminths and their potential role in parasite - host interaction . There is only one publication about an endoplasmic reticulum located trx transmembrane related protein from the trematode clonorchis sinensis, containing a trx domain with the active site motif cys - pro - ala - cys (cpac). This redox molecule is suggested to serve as protection against host- and parasite - generated ros . Contrariwise, the s. ratti trx - lp has the catalytic domain sequence of the uniformly small (12 kda) ubiquitous trx proteins (wcgpc) but has a size of approximately 30 kda . Comparably, the t. suis trx - lp has a size of approximately 33 kda and the same catalytic domain sequence as the classic trx . In the present study, trx - lp from two parasitic nematodes, s. ratti and t. suis, were cloned, expressed, and characterized for the first time . In case of both helminths the protein was present in the e / s products of the parasites [13, brattig et al . The molecular mass (3033 kda) as well as the proteins structure suggested similar functions to those of the human trx - related protein (trp32), also known as txnl-1, which protects the cell against glucose deprivation - induced cytotoxicity and is involved in antiapoptotic signaling [47, 48, 71]. Like srtrx- and tstrx - lp, trp32 consists of an n - terminal trx and a c - terminal pith domain as well . Trx - lps are known to have several binding partners and substrates they associate with by means of their trx domain, which exerts redox - active functions . The c - terminal pith domain is able to interact with the 26s proteasome by the substrate - recruiting factor of the 26s proteasome eef1a1 [72, 73]. Similar to trx, trx - lps of eukaryotic cells are also multifunctional and involved in different cellular processes including cofactor functions or the regulation of specific signaling proteins which may indicate possible moonlighting properties that have to be demonstrated in the future [3436]. Comparisons of trx - like homologues by multiple sequence alignments revealed a high sequence similarity between trx - lps from t. suis and from t. trichiura (94% identity). Apart from this, the protein alignment showed a relatively low degree of similarity (35%56%) between different nematodes, either parasitic or nonparasitic . Except for s. mansoni all other species had the strongly conserved n - terminal trx catalytic site sequence (cgpc). At the c - terminus all trx - lps possess the pith domain . Like trx, the analyzed parasite proteins have no signal peptide and are released from cells by nonclassical protein export [29, 75]. Trx - lp has also various roles in several human cellular and extracellular processes, since reactive oxygen species (ros) occur in the normally functioning metabolism . The dithiol - disulphide oxidoreductase activity of both recombinant s. ratti and t. suis trx - lps was either analyzed by insulin reduction according to holmgren (1979) or igm reduction according to wollman et al . The relative specific activity of trx from e. coli amounts to a value of 4930 units . Findings that measured relative specific activity of the srtrx - lp has an activity of about 1557 units show that it has a comparable activity to classical trx . (1988) have already shown that recombinant human trx is able to reduce the disulfide bridges of murine igm . Therefore, we suggested trx domain containing trx - lps may also have the ability to reduce igm . We could show that indeed both trx - lps reduced the s - s bonds of igm . Since all tstrx - lp used doses resulted in the formation of the same bands in sds - page, this trx - lp appears to be more active than the s. ratti trx - lp . Even at the lowest concentration minor protein bands the more intensive they were the higher the added concentration of tstrx - lp was . A reduction of igm by not fully removed dtt can be excluded since then the strength of the formed bands would be the same in each approach . Although even at the lowest concentration bands have been formed, they were more intensive at the highest concentration . Furthermore, in the igm reduction assay of srtrx - lp no bands were existent at the lowest and the intermediate concentration of the added protein . Through those activity assays it could be demonstrated that the recombinantly expressed trx - lps have redox functions and are able to act as classical trx . In further analysis it has been reported to be released by monocytes and also to be chemotactic for monocytes, neutrophils, and t lymphocytes . Accordingly, we have observed that s. ratti and t. suis trx - lps exhibit chemotactic activity for monocytes and have the ability to interact with them . An attraction of monocytic cells to a nematode - dwelling site could subsequently lead to an activation of the cells leading to a consecutive generation of wound healing fostering cytokines like il-22 and immunoregulatory interleukins [7880]. Both parasite trx - lps bound to monocytic cells, to the thp-1 cells, and to peripheral monocytes although in some facs analysis there were only limited counting events . Of interest, the parasite redox - regulating proteins also bound to caco-2 cells and more weakly to lymphocytes and granulocytes . Thus, trx - lps seem to interact with intestinal epithelial cells, the first - line host cells that get exposed to e / s products released by the colonizing parasitic females, and also with second - line cells, the monocyte - derived dcs . Of interest, trx has been reported to possess immunological activities . Thus, it has been attributed to an anti - inflammatory role besides suppression of apoptosis and fostering cell growth [32, 8183]. Trx can interact with immune cells and facilitates the production of tnf- [31, 84] by monocytic lineage, but it is also able to counteract the production of inflammatory cytokines such as tnf- [85, 86]. In the present study, 3d - coculturing of the intestinal epithelial caco-2 cells and thp-1-derived dcs was performed . Hereby, parasite trx - lps induced the release of proinflammatory tnf- in the first day of the culture and at high concentration after 48 h followed by a prevailing generation of the th2-related cytokine il-22 besides lower levels of tslp and il-10 . Il-22 may be predominantly released by activated dcs in the cell cultures after 2 - 3 days [78, 80, 87]. Il-22, particularly produced by immune cells present beneath the epithelium, as the innate lymphoid cells [78, 80, 88], acts through signal transducer and activator of transcription (stat-3) and is important in maintaining the homeostasis of the gut and therefore serves the protection from intestinal inflammation . An important source of il-22 in acute colitis is tlr - stimulated cd11c dcs which are located in the surficial mucosal epithelium of the gut and are getting activated by invading pathogens like bacteria or parasites . These cells initiate, via il-22 and thus stat-3, processes that are important for a proper stress response, mucosal wound healing, and apoptosis pathway [78, 79, 89]. Il-22 may profoundly increase the proliferation and turnover of iecs and the production of mucus and antimicrobial peptides . Accordingly, the release of proteins from intestinal nematodes like trx - lps may contribute to preserve or restore the integrity of the intestinal barrier . Thus, there are three possible pathways for helminthic trx - lps to act: firstly, secreted trx / trx - lp protects the parasite against high ros production initiated by the host's first - line immune response via cells of the monocyte - macrophage linage . Trx may be important for redox control at wound margins, since much ros emergence was proven there [91, 92]. Therefore, among others, it serves the migration of cells and closure of wounds . Then, antioxidant molecules are probably important to maintain the balance in order to prevent stress - induced cell death . Secondly, secreted trx - lp stimulates mucosal dcs to generate high levels of il-22 which promotes epithelial cell proliferation and the preservation or restitution of the integrity of the intestinal barrier . In the present study we had shown that 300 ng of parasite trx - lps promoted the wound healing process of epithelial caco-2 cells . A third possible function of trx - lp secreted by the parasite may be to mimic antioxidant molecules of the host and may lead to interference reactions in the host's antioxidant metabolism concerning the substrates and binding molecules . Thus, recent reports indicated that distinct molecules secreted by helminth parasites can foster wound healing and modulate the host's immune response . In summary, we identified and characterized the secreted trx - lps from s. ratti and t. suis . Both multifunctional proteins expressed antioxidative activity and the capability to interact with the host's mucosal cells, indicated by chemotactic activity for monocytic cells, binding to host's epithelial cells as well as to immune cells, by the release of cytokines . In particular, the promoting wound healing effect indicates the involvement of trx - lp in many pathways that are initiated in the local parasite - host interaction
|
Most patients with hodgkin's disease and spinal epidural involvement either present with concurrent neurological and nodal disease or develop neurological disease after being diagnosed with hodgkin's disease . A case of a 30-year - old male patient with primary thoracic epidural lymphoma who presented with back pain is presented in this paper . The severity of pain was associated with the inability to perform the activities of daily living . The patient did not have any lymphoma - related b - type symptoms, including body weight loss, fever and sweat at night . A magnetic resonance imaging (mri) scan of the thoracic spine demonstrated an epidural tumor at the t911 level (figs 13). Histological examination revealed the polymorphous cellular infiltration by histiocytes, large mononuclear cells and lacunar reed sternberg cells with folded multi - lobed nuclei and small nucleoli (fig . 4). Immunohistochemical staining was positive for cd15 and cd30 and negative for cd3, cd20, cd79a or cd45ro . These features were most frequently observed in the mixed cellularity type of hodgkin's lymphoma . The results of all other examinations (f-18 fluorodeoxyglucose positron emission tomography (f-18 fdg pet / ct), bone marrow biopsy and computed tomography (ct) of the chest, abdomen and pelvis) were negative for an occult disease . Six courses of chemotheraphy containing abvd regimen (adriamycin, bleomycin, vinblastine and dacarbazine) were given to the patient . Postoperative mri scan did not reveal any evidence of hodgkin's disease (fig . 5), f-18 fdg pet / ct, ct of the chest, abdomen and pelvis were obtained in 24 months and did not reveal any evidence of hodgkin's disease . Figure 1:t2 weighted mri revealed a mass at the t9 - 11 level . Figure 2:t1 weighted mri revealed a mass at the t9 - 11 level . Figure 3:axial t1 weighted mri revealed at the epidural space . Figure 4:histological examination revealed mixed cellularity type of hodgkin's lymphoma . Figure 5:postoperative mri scan did not reveal any evidence of hodgkin's disease . T2 weighted mri revealed a mass at the t9 - 11 level . Patients with hodgkin's disease develop spinal cord compression caused by epidural hodgkin's lymphoma and usually observed in the presence of an advanced disease [1, 2]. There are six case reports in the literature that describe patients with primary spinal epidural hodgkin's lymphoma [16] (table 1). Samadian et al . Reported a case of primary and isolated spinal epidural hodgkin's lymphoma at l1l3 level . Al - khayat et al . Reported a hodgkin's lymphoma case with epidural involvement at c7t1 level . Reported a case with primary extranodal hodgkin's disease who underwent decompressive surgery accompanied with stabilization and radiotheraphy . Reported cases with primary spinal epidural hodgkin's lymphoma (s: surgery, rt: radiotheraphy, ct: chemotheraphy e: epidural, v: vertebral, p: paraspinal) moridaira et al . Rao et al . Published a case with primary spinal epidural hodgkin's lymphoma . Our case is apparently the seventh case to be diagnosed with hodgkin's disease who presented with spinal cord compression due to epidural space without lymphoma elsewhere . The abnormal mri marrow signal of the t9 and t10 vertebral bodies can be seen in fig . Maybe the tumor in fact originated within the abnormal t9 or t10 bone marrow and spread to the epidural space via the epidural venous plexus . Surgery is the first therapeutic approach in malignancies compressing the spinal cord . Because hodgkin's lymphoma is a very chemosensitive and radiosensitive tumor, the indications for surgery were reduced and limited to laminectomy or even biopsy only, leaving the major role to chemotheraphy and radiotheraphy . The combination of chemotheraphy and involved - field radiotheraphy is the most common treatment strategy; two to four cycles of abvd are considered as the international gold standard for early - stage hodgkin's lymphoma in combination with 2030 gy of involved - field radiotheraphy [7, 8]. We chose the first therapeutic approach for this patient who underwent gross total resection of the tumor, because the tumor type was unknown at the time of initial presentation . The present case demonstrated that physicians should include primary spinal epidural hodgkin's lymphoma in the differential diagnosis of spinal tumors . Treatment of hodgkin's lymphoma will almost always include in the acute phase a form of emergency decompressive surgery, with or without resection, followed by chemotheraphy and/or radiotheraphy.
|
Human leukocyte antigen (hla) matching significantly reduces the risk of graft rejection and graft failure after solid - organ transplantation [13] and graft - versus - host disease (gvhd) after hematopoietic stem - cell transplantation (hsct) [49]. These pathological conditions evolve due to an alloreactive immune response that is initiated through interaction of allogeneic hla with antibodies or the t - cell receptor (tcr). The subsequent immune response directed against allogeneic hla impairs transplant outcome, emphasizing the need to avoid alloreactive responses after transplantation . The highly polymorphic hla system can be subdivided into two major classical classes: hla class i and hla class ii . In general, hla class - i molecules (hla - a, -b, and -c) present endogenous peptides of 811 amino acids in length that can be recognized by cd8 + t cells, while hla class - ii molecules (hla - dr, -dq, and -dp) present exogenous peptides of 1318 amino acids in length that can be recognized by cd4 + t cells . Hla class - i molecules consist of a polymorphic alpha chain and a nonpolymorphic beta-2-microglobulin and have a rather closed peptide binding groove . On the other hand, hla class - ii molecules consist of a polymorphic alpha and beta chain and have a more open structure . Acquiring hla - matched donors for transplantation is very challenging, due to the high level of polymorphisms in the hla system . Hla incompatible transplantations can therefore not be avoided for a large number of patients . In those cases where a fully hla - matched donor is not available, there is a clinical need to predict whether a certain hla mismatch will elicit severe b - cell and t - cell - mediated alloreactive responses or not . There is cumulating evidence that these high - risk hla mismatches (so - called nonpermissible mismatches / unacceptable mismatches) and well - tolerated hla mismatches (so - called permissible mismatches / acceptable mismatches) exist, as epidemiological studies have shown that permissibility of hla - mismatched combinations is highly variable [6, 7, 10]. For example, hla - b44:02 and hla - b44:03 mismatching leads to the induction of allospecific cd8 + t cells in vitro and bone marrow - allograft rejection in vivo . The amino - acid sequences of hla - b44:02 and hla - b44:03 differ only in one amino acid, indicating that even small amino - acid changes between hla molecules can result in major alloreactive immune responses after transplantation . On the other hand, hla class - i mismatches that are highly diverse may well be tolerated in hsct . Differences in permissibility between hla - mismatched combinations may be explained by a different impact of amino - acid polymorphisms on peptide - binding features . Some amino - acid sequence polymorphisms will alter peptide - binding motifs and peptide - hla complex conformation, thereby potentially inducing alloreactive immune responses, while others will not alter peptide - hla landscapes . Characterizing the permissibility of hla mismatches prior to transplantation allows selection of the most optimal donor - recipient match and thereby will help to diminish the risk of posttransplantation complications after hla incompatible transplantations . However, epidemiological studies do not provide a universal tool for defining permissibility for every hla - mismatched combination, as these data are limited to the specific hla - mismatched combinations studied; very large study populations would be required to study all potential combinations . Several approaches have therefore been developed to define permissibility of hla - mismatched combinations; some of these approaches are very useful in predicting alloreactivity . We here review the current knowledge regarding hla - directed alloreactivity and the various in vitro and in silico methodsthat can be used to predict this alloreactivity . Hla alloreactivity in transplantation involves both b - cell- and t - cell - mediated responses . Three mechanisms of alloreactivity directed towards allogeneic hla have been described: direct, indirect, and semidirect allorecognition . Igg hla alloantibodies directly recognize intact allogeneic hla molecules that are present on the cell surface . These antibodies play a pivotal role in solid - organ transplantation and probably also have a role in hsct [1518]. The humoral response directed against allogeneic hla can be established upon exposure to allogeneic hla during pregnancies, blood transfusions, or (previous) transplantations . During this response these peptides can subsequently be presented on hla class - ii molecules that are present on the cell surface . Recognition of these hla class - ii presented hla - derived epitopes by cd4 + t cells results in b - cell activation and igm to igg isotype switching . Donor - specific igg hla antibodies (dsa) that are subsequently produced can bind directly to small polymorphic amino - acid residue patches that are present on the molecular surface of hla antigens [2022], thereby inducing rejection of graft tissue / cells, designated as antibody - mediated rejection . In addition to alloantibodies, alloreactive t cells can also directly recognize intact allogeneic hla molecules . There is compelling evidence that cross - reactive t cells are involved in direct t - cell recognition [2431]. These cross - reactive t cells initially react towards a foreign peptide, for instance, a viral peptide, presented by self - hla . However, these t cells can also respond to allogeneic hla presenting a self- or viral peptide [2431]. Although these cross - reactive t cells can persist over time, direct t - cell recognition is predominantly involved in the acute stage of alloreactivity . Intact hla molecules present on resident donor - derived antigen - presenting dendritic cells are considered to be the driving force behind direct recognition in solid - organ transplantation, since parenchymal cells within transplanted tissues are unable to induce direct t - cell recognition (reviewed in). Because these dendritic cells are depleted over time, the contribution of direct recognition in chronic graft rejection after solid - organ transplantation is limited [32, 33]. In contrast to direct t - cell recognition, indirect t - cell recognition is considered to be mainly involved in later stages of alloreactivity . During indirect recognition, t cells recognize processed epitopes derived from allogeneic hla that are presented by hla molecules that are likely shared between donor and recipient [35, 36], as t cells are restricted to self - hla . Indirect t - cell recognition is also involved in the formation of hla alloantibodies, since t - cell recognition of b - cell presented hla epitopes is required in this process [19, 37]. Thus, indirect t - cell recognition may also partly contribute to early alloreactivity, as indirect recognition can amplify the direct recognition response . In semidirect allorecognition, allogeneic hla: peptide complexes are transferred from allogeneic cells to autologous dendritic cells, resulting in a chimeric antigen - presenting cell . Transfer of allogeneic hla: peptide complexes can be achieved through secretion of endosomes containing hla: peptide complexes or through cell - to - cell contact between donor and recipient dendritic cells . Antigen - presenting cells that acquire intact allogeneic hla: peptide complexes on their cell surface may elicit both direct and indirect alloreactive t - cell responses . Although in vivo evidence for the role of the semidirect allorecognition pathway in graft rejection and gvhd is limited, it has been shown that this pathway is able to elicit cytotoxic alloimmunity in vitro and in vivo and that the transfer of allogeneic hla: peptide complexes likely occurs in an in vitro system of gvhd . Humoral sensitization to hla class - i and class - ii epitopes and the subsequent production of hla - specific antibodies can occur upon pretransplant exposure to allogeneic hla . The presence of dsa before transplantation is related to antibody - mediated rejection and significantly impairs graft prognosis [15, 16]. Therefore, evaluation of hla - sensitizing events (i.e., pregnancies, blood transfusions, and previous transplants) is generally included in standard pretransplantation screening . Pregnancy is a major contributor to hla sensitization, as approximately 30% of the pregnancies results in child - specific sensitization towards hla - a, -b, -c, and/or -dr loci . Moreover, the hla sensitization frequency increases with the number of full - term pregnancies . Blood transfusions can induce hla sensitization in approximately a third of the solid - organ transplantation recipients . However, blood transfusions have a less prominent effect on hla alloimmunization than pregnancy and solid - organ transplantation [44, 45]. In addition to the classical sensitizing events, hla alloantibodies can also be raised against epitopes in allergens, ingested proteins, and microorganisms that are cross - reacting with hla . Although the presence of these natural dsa in kidney recipients is associated with the induction of mild episodes of antibody - mediated rejection, these patients have favorable graft outcome . Therefore, the existence of these natural dsa prior to transplantation is currently not a contraindication for transplantation . Although dsa detection methods are important tools for risk assessment prior to transplantation, pretransplant evaluation of preformed dsa remains challenging . For example, antibodies might become undetectable at the moment of transplantation due to the decay of antibody levels over time . The clinical relevance of these preexisting low dsa levels is highly variable; some preformed dsa will elicit hla alloreactivity in vivo, whereas others will not . Currently used detection methods may thus not detect the whole repertoire of clinically relevant dsa . The complement - dependent cytotoxicity (cdc) crossmatch assay (reviewed in) is a potent manner to measure the presence of clinically relevant antibodies, whereas other dsa detection assays, like the hla - based enzyme - linked immunoabsorbent assay (elisa) and luminex - based assays [50, 51], provide valuable but limited information about the clinical relevance of identified dsa . Currently, the cdc assay seems to be a potent indicator for alloreactivity, while in vitro dsa detection methods can further support the matching procedure for solid - organ transplantation . Combining in vitro assays with an in silico prediction method allows identification of acceptable hla mismatches towards which a recipient will likely not develop antibody - mediated responses . Assessment of humoral sensitization to allogeneic hla was initially performed by the cdc crossmatch assay . This assay measures the presence of preformed or de novo formed antibodies through their induction of complement - dependent lymphocyte killing . A positive cdc test was associated with a significantly impaired outcome after kidney transplantation [49, 52]. Despite its potency to mimic the in vivo situation, cdc crossmatch assays lack sensitivity and may show false positive results . To overcome these problems, a more sensitive assay was developed: the flow cytometry - based crossmatch (fcxm) assay . However, both fcxm and the classical cdc crossmatch test correlate equally well to clinical outcome after kidney transplantation . The lack of sensitivity and specificity of cytotoxicity crossmatch assays has led to development of solid - phase assays, such as the hla - based elisa and luminex assays [50, 51]. These solid - phase methods, particularly luminex, are very sensitive and specific; relevant anti - hla class - i and class - ii antibody profiles in solid - organ transplant recipients can be identified and monitored over time . Combining antibody profiles that are present in solid - organ transplant recipients, with hla typing of the donor, designated as virtual crossmatching, allows identification of dsa and therefore might be useful in risk stratification prior to solid - organ transplantation (reviewed in [56, 57]). Unfortunately, estimation of the clinical relevance of dsa detected with solid - phase assays remains challenging, as tools to discriminate between nondetrimental dsa and deleterious dsa are lacking . Nevertheless, the presence of class - i and class - ii dsa detected by luminex in the absence of positive cdc assay is suggested to be indicative for impaired graft outcome in kidney transplantation . In vitro cdc - based dsa detection assays have their limitations; these assays are not suitable to determine hla - mismatch permissibility for highly sensitized transplantation candidates . Because of the high sensitization levels in those individuals, cdc assays often become almost completely positive, which complicates selection of suitable cdc - negative donors that will not elicit hla alloreactivity in vivo . Therefore, alternative in silico methods were sought to predict acceptability of hla - mismatched combinations . The in silico algorithm hlamatchmaker is based on the principle that hla - specific alloantibodies can bind to distinct amino - acid polymorphisms (immunogenic epitopes) present on hla antigens [20, 21]. Multiple polymorphic amino - acid residues on the molecular surface of hla antigens have been identified . Some of these residues are inaccessible for antibodies, since they are located near the cell membrane or within peptide - binding groove of the hla molecule, while other residues are fully accessible for antibodies [20, 21]. Hlamatchmaker uses this knowledge to predict which hla mismatches are not able to induce complications in transplantation recipients by defining the acceptable mismatches [20, 21]. Initially, hlamatchmaker defined immunogenic epitopes as antibody - accessible, linear sequences of amino - acid polymorphisms (triplets) [20, 21]. Triplets that are present in donor hla antigens, but not in the recipient hla antigens, were considered to elicit humoral responses [20, 21]. On the other hand, triplets that are present in both donor and recipient hla antigens were considered as acceptable [20, 21]. Thus, hlamatchmaker provides a tool for identification of acceptable hla mismatches . The clinical applicability of hlamatchmaker in matching strategies has been extensively evaluated . It has been shown that the triplet version of hlamatchmaker is a potent indicator for the presence and magnitude of allogeneic hla - directed antibody responses in renal transplantation and during pregnancy [59, 60]. In contrast, the number of triplet mismatches was not indicative for the induction of t - cell alloreactivity . This lack of correlation between triplets and t - cell alloreactivity is probably caused by alternative epitope binding by t cells or by the involvement of larger polymorphic sequences in t - cell alloreactivity . With regard to hsct, the number of triplets did not correlate to acute gvhd, engraftment, or survival . Despite its applicability in hla - matching strategies, the triplet version of hlamatchmaker represents an incomplete repertoire of immunogenic epitopes, as only linear sequence positions are implemented . This hiatus has resulted in the development of a redefined version of hlamatchmaker that identifies eplets . Eplets are immunogenic hla epitopes that are critical for antibody binding and consist of polymorphic amino - acid patches located at the molecular surface of hla molecules . These polymorphic patches may consist of polymorphisms in linear sequence positions and three - dimensional polymorphic patches in discontinuous sequence positions . Therefore, implementation of eplets into the algorithm has led to a more accurate definition of structural hla epitopes . Evaluation of the eplet version of hlamatchmaker has shown a similar performance in predicting allogeneic hla acceptability compared to the triplet version . Nevertheless, the eplet version of hlamatchmaker provides further discrimination of highly divergent hla specificities . Although conflicting results were reported with regard to the prognostic information that is provided by hlamatchmaker on graft outcome ([6366], reviewed in), it is generally accepted that hlamatchmaker is a suitable tool to analyze serum antibodies and to identify acceptable mismatches in solid - organ transplantation . However, hlamatchmaker is inappropriate for hsct donor selection . In addition to the number of eplets as determined by hlamatchmaker, additional determinants can be used to define allogeneic hla acceptability, for instance, physiochemical properties of polymorphic amino acids . Differences in physiochemical properties between mismatches, including electrostatic potential and hydrophobicity, are useful to predict hla class - i- and class - ii - specific alloantibody responses prior to solid - organ transplantation [6870]. With higher physiochemical disparity between hla mismatches, the risk of antibody development increases after kidney transplantation [6870]. These observations suggest that differences in physiochemical properties between polymorphic amino acids may be relevant in defining acceptable hla mismatches . The presence of t - cells directly recognizing intact allogeneic hla molecules was previously shown in individuals suffering from graft rejection after solid - organ transplantation [71, 72] and gvhd after hsct . There is compelling evidence that direct t - cell alloreactivity results from cross - reactive t cells that are initially primed by a foreign peptide, for instance, a viral peptide [2431]. For example, the hla - b08:01-presented ebv peptide flrgraygl is recognized by an ebv - specific tcr, that possesses cross - reactive capacities towards hla - b44:02-presented peptide eeyqafty [24, 75]. Thus, the hla - b08:01-presented peptide flrgraygl elicits a public immune response . During a public immune response, the immune response directed against an identical epitope virus - specific t cells can be detected in high levels in healthy individuals, it is likely that cross - reactive virus - specific t cells may be present in both solid - organ transplantation recipients and hsct donors prior to transplantation . The presence of virus - specific t cells that are cross - reactive with allogeneic hla in these individuals may significantly contribute to complications after transplantation . However, most virus - specific t - cell responses do not have the propensity to induce public tcr responses nor predictable cross - reactivity with allogeneic hla . A single viral infection can therefore result in the establishment of multiple t cells that are cross - reactive to multiple hla molecules, whereas other viral infections do not give rise to these cross - reactive t cells . In addition, virus - specific t cells with the same antigen specificity, but different tcrs, elicit different unpredictable patterns of alloreactivity [26, 79]. The molecular mechanism behind t - cell cross - reactivity is complex and currently incompletely understood . T - cell cross - reactivity assumably arises due to structural homology of hla: peptide complexes (reviewed in) rather than sequence homology of the presented peptides . Despite their sequence dissimilarity, the structure of flrgraygl and eeyqafty epitopes in the context of their presenting hla molecules is quite similar . Therefore, molecular mimicry likely attributes to the observed cross - reactivity between these epitopes . On the other hand, cross - reactive tcr in mice can dock to self - mhc: peptide complexes in a different orientation than to allogeneic mhc: peptide complexes, suggesting that cross - reactivity can be established without molecular mimicry . Thus, direct alloreactivity is a complex immune response that can only partially be explained by molecular mimicry . Since the molecular mechanism behind direct t - cell recognition is poorly understood, prediction of alloreactivity based on viral history is complex . Knowledge about viral history is therefore not sufficient to predict direct t - cell alloreactivity directed towards allogeneic hla . Since direct t - cell allorecognition was studied intensively over the past decades, several alternative approaches to predict direct t - cell alloreactivity in vitro and in silico have been developed . Cytotoxic t lymphocyte precursor assays (ctlp) determine permissibility of hla mismatches through in vitro evaluation of effector cytotoxic t - cell induction . This chromium 51 (cr) release - based assay, initially described by brunner et al . Further development of this assay has resulted in an assay that estimates the extent of alloreactive t - cell responses directed towards allogeneic hla . Since individual allogeneic hlas can be linked to ctlp frequencies, these assays are a useful approach to distinguish between permissible and nonpermissible mismatches in vitro . More importantly, a high ctlp frequency correlates reasonably well with clinical outcome in vivo; high ctlp frequencies were associated with graft rejection after solid - organ and tissue transplantation [73, 84, 85] and with gvhd and impaired survival after allogeneic hsct [82, 83, 86]. Association between graft failure and the presence of primed cytotoxic t lymphocytes in sensitized transplant candidates (e.g., women after previous pregnancy) was shown as well . Despite the usefulness of ctlp assay in estimating t - cell alloreactivity, the time - consuming and laborious character of this assay is a major drawback . In order to overcome these disadvantages, alternative in silico approaches amino - acid polymorphisms at tcr - recognition and peptide - binding regions between hla class - i mismatches were analyzed for their physiochemical and/or position characteristics and were correlated to ctlp outcome . These analyses resulted in the establishment of a novel algorithm, which aims to predict hla class - i mismatch - specific ctl alloreactivity . Although the algorithm can predict ctlp outcome reasonably well, usage of this model for donor selection seems limited; this tool does not predict gvhd development in patients receiving hsct . The first clinically relevant model that successfully estimates the effect of direct recognition in hsct has recently been developed . This hla - dpb1-restricted model is designated as the t - cell epitope (tce) model . This model has been based on in vitro data from two alloreactive t - cell clones isolated from an hsct patient with graft rejection due to an hla - dpb1 mismatched graft . Membrane - bound intact hla was essential for recognition of the hla - dpb1 mismatch by the alloreactive t - cell clones; the clones did not respond to b - lymphoblastoid cell lines transduced with a truncated mismatched - hla - dpb1 construct that did not lead to cell - surface expression of hla - dpb1 . Thus, it seems likely that these two alloreactive t - cell clones recognized the hla - dpb1 mismatched antigen in a direct manner . In order to identify patterns of recognition of other alleles, the t - cell clones were further tested for their recognition of other hla - dpb1 alleles . Alleles were divided into three different immunogenic levels: highly immunogenic (i.e., both clones recognized the alleles), intermediate immunogenic (i.e., one of the clones recognized the allele but the other did not), or nonimmunogenic (i.e., both clones did not recognize the allele). Since testing of all hla - dpb1 alleles in vitro is very time consuming, immunogenicity of other hla - dpb1 alleles was extrapolated, based on similarities between the peptide - binding grooves of the in vitro tested alleles and the not - tested hla - dpb1 alleles . Subsequently, hla - dpb1 mismatches were labeled as permissive or nonpermissive based on their immunogenic level and the concept of thymic education . For example, when the hla - dpb1 allele of the donor belongs to the highly immunogenic group, then donor t cells should be educated not to respond to hla - dpb1 alleles belonging to the highly immunogenic group and, in theory, will also not respond to lower immunogenic alleles . Therefore, when the recipient has an hla - dpb1 allele belonging to the same or a lower immunogenic group, then the hla - dpb1 mismatch will be permissive in the graft - versus - host (gvh) direction . On the other hand, since the hla - dpb1 allele of the recipient is not immunogenic, recipient t cells are able to respond to (higher) immunogenic alleles of the donor . Thus, such mismatches are nonpermissive in the host - versus - graft (hvg) direction . Nonpermissive mismatches, defined by the tce model, are highly correlated to alloreactivity as reflected by gvhd, graft rejection, and transplant - related mortality after hla - dpb1-mismatched hsct [4, 9092]. Counterintuitively, in these situations, the direction of the nonpermissiveness appears not to be important: both hvg and gvh nonpermissive mismatches lead to alloreactivity in the gvh direction (i.e., gvhd) [4, 91]. Therefore, both hvg and gvh nonpermissive mismatches are considered overall nonpermissive [4, 91]. The in silico model histocheck has been developed to estimate t - cell alloreactivity between hla class - i and class - ii mismatches . Histocheck calculates a matching score for any donor - recipient combination based on their hla typing, the so - called sequence - similarity matching score . The sequence - similarity matching score is determined by comparing differences in amino acids between hla alleles with regard to their functional similarity and their location in the hla molecule; amino - acid positions involved in tcr recognition and hla - peptide binding are implemented in the sequence - similarity matching score . As a high sequence - similarity matching score represents a high level of dissimilarity between donor and recipient, correlation of the sequence - similarity matching scores with clinical outcome was expected . However, histocheck is not indicative for transplant outcome in vivo, as sequence - similarity matching scores showed no correlation with gvhd after hsct [9496]. The inability of histocheck to be indicative for t - cell alloreactivity may be explained by several limitations of this model: histocheck does not integrate the presence of alloreactive donor t cells nor viral history in its algorithm . Additionally, the concepts of aforementioned molecular mimicry between hla: peptide complexes and unconventional docking of tcr are not included in histocheck . Since these aspects of direct t - cell recognition are complex and not fully understood, establishment of reliable, clinically relevant tools to predict direct t - cell recognition remains challenging . An alternative approach to predict direct t - cell alloreactivity is to analyze the impact of amino acids at certain locations within hla molecules . Several amino - acid substitutions in the peptide - binding domain of hla class - i molecules are related to an increased risk of gvhd, whereas other amino - acid substitutions are related to a diminished relapse risk . The effect of specific amino - acid changes on alloreactivity was recently investigated in a large cohort . In this study, the impact of changes on hla class - i positions 9, 99, 116, and 156 for peptide binding alteration and position 77 for killer cell immunoglobulin - like receptor binding was investigated in recipients of an allogeneic hsct with a single allelic mismatch at either the hla - a, -b, or -c locus . Particularly amino - acid changes at position 116 in hla - c were associated with an increased acute gvhd risk [97, 98], but also changes at position 99 for hla - c and position 9 for hla - b were associated with clinical t - cell alloreactivity . By determining the effect of specific amino acids within the hla molecule, multiple amino - acid positions have been identified that influence transplantation outcome; this knowledge may be used for donor selection . Indirect recognition of allogeneic hla acts via presentation of peptides derived from allogeneic hla molecules . Over 350 of these indirectly recognizable hla - derived peptides t - cells recognizing these peptides likely play a role in alloreactivity; the erection of indirectly recognizing t cells after solid - organ transplantation was strongly correlated to both acute [100102] and chronic graft failure [102, 103]. Furthermore, the presence of circulating t - cells recognizing allogeneic hla epitopes in an indirect manner was predictive of rejection . As mentioned previously, indirect t - cell recognition is considered to be a slower alloreactive response than direct t - cell recognition [33, 34]. The proposed slower rate of indirect t - cell recognition may be related to the idea that indirectly recognizing t cells arise from the naive pool, whereas directly recognizing t cells likely evolve from the memory pool, as the latter t cells are supposedly cross - reactive . Since direct recognition has received most attention historically, not many methods are available to predict indirect recognition of hla disparities; there is no in vitro system available and only one in silico model . We have recently developed a model for in silico prediction of indirectly recognizable hla - derived peptides, the so - called pirches model (predicted indirectly recognizable hla epitopes). Indirect t - cell recognition that targets allogeneic hla depends on hla - derived peptides that differ between host and graft . Hla - derived peptides that are identical between donor and recipient should be ignored by the alloimmune system, as t - cells recognizing these peptides should have been deleted from the repertoire due to thymic selection . Thus, the hvg reaction of graft rejection after solid - organ transplantation should be evoked by donor - specific peptides, whereas gvhd after hsct should be evoked by recipient - specific peptides . We have designated the donor - specific peptides that can be recognized by the recipient as hvg - pirches and the recipient - specific peptides that can be recognized by the donor as gvh - pirches . In order to elicit indirect t - cell recognition, allogeneic hla proteins need to be processed into peptides and these peptides need to be presented on shared hla . Since both steps are determined by certain motifs in the protein sequences, both antigen processing and antigen presentation pathways our pirches model uses these predictions to define permissibility of hla mismatches . For hla class - i peptide presentation (designated as pirche - i), the pirches model first determines proteasomal cleavage of all hla molecules of the donor and recipient into peptides and transport of those peptides via the transporter associated proteins (tap) into the endoplasmic reticulum (er). Subsequently, the binding affinities of the predicted cleavage products to hla class - i alleles are predicted, as a derivative of peptide presentation by the hla class - i molecules that are shared between donor and recipient . Prediction of hla class - ii - presented epitopes (pirche - ii) is restricted to hla - binding affinity predictions of peptides, since (enzymatic) cleavage patterns have not been clearly defined yet . On the basis of their performance, we implemented netchop, netmhcpan, and netmhc - ii or netmhciipan (reviewed in [106109]) in our pirches model to predict the number of pirche - i and pirche - ii . Netchop is a potent predictor of proteasomal cleavage and tap transport, whereas netmhcpan predicts binding affinity to hla class i. netmhc - ii can predict peptide binding to hla class - ii alleles for which binding data exist, whereas for netmhciipan these data were extrapolated to other alleles . Both hla class - i- and hla class - ii - binding predictors have good predictive capacities and are frequently used to identify viral epitopes . The first construction of the pirches model was based on predicting hla class - i - derived peptide presentation on shared hla - dr and used the binding affinity predictions of netmhc - ii . After kidney transplantation with hla class - i mismatches, mismatches that led to allogeneic hla - specific antibody production correlated to higher numbers of hvg - pirche - ii compared to mismatches that did not led to antibody production, suggesting that indirect recognition of hla - derived epitopes was required for hla - specific igg antibody production . For hsct, the situation is more difficult, as alloreactivity after hsct not only involves cd4 + t - cell recognition and stimulation of b cells but clearly involves cd8 + t - cell recognition of alloantigens as well . Moreover, usage of netmhciipan was incorporated, as netmhc - ii can only predict binding to a limited number of hla - dr alleles . Indeed, after hla - mismatched hsct, high numbers of both gvh - pirche - i and -ii are correlated to clinical alloreactivity (thus et al ., manuscripts in preparation). In the current pirches model, we regarded any difference in presentable peptides derived from donor - versus - recipient alleles as a pirche (i.e., only one amino - acid difference is regarded as difference). The model can likely be improved when the t - cell recognition is more specifically elucidated . It is well known that some positions of peptides are more important in tcr binding than others [123, 124], as amino acids that are lying deep inside the peptide binding groove of the presenting hla molecule are likely not seen by the tcr . Furthermore, polymorphisms leading to different peptide properties (e.g., polar versus nonpolar and hydrophobic versus hydrophilic) may lead to more pronounced t - cell recognition . These refinements are currently being studied for their effect on the predictive potential of the model . Hla mismatches can cause severe posttransplantation complications such as graft rejection and gvhd . In these complications, the induction of both antibody production and t - cell recognition may play a role . Interestingly, permissibility of hla - mismatched combinations is highly variable; some mismatches are poorly tolerated, whereas others are highly permissible . Although the degree of hla amino - acid sequence disparity varies largely amongst different hla mismatches depending on the allelic versus antigenic nature of the mismatch and the hla locus, the number of polymorphic amino - acid residues in itself is not predictive for the permissibility of hla - mismatched combinations, as multiple additional factors are involved . Both the nature and the position of the amino - acid polymorphisms within the mismatched hla, as well as their effect on neighboring amino acids, determine the permissibility of hla - mismatched combinations . Several approaches have been developed to predict the permissibility of hla mismatches, thereby aiming to improve donor selection procedures . The objective of all these approaches is to predict the development of the abovementioned antibody and t - cell recognition of allogeneic hla . Several well - established in vitro assays can be used to detect dsa that are related to impaired graft survival . In addition to these assays, hlamatchmaker is a well - validated tool to identify which hla mismatches do not induce alloreactive humoral responses in transplantation recipients . Although hlamatchmaker is a powerful predictor for acceptable hla mismatches in solid - organ transplantation, this tool is not suitable for predicting hla permissibility in the setting of hsct . With regard to direct t - cell recognition, the risk for clinical alloreactivity can be estimated with the in vitro ctlp assay . In addition to this in vitro assay, several in silico approaches aim at predicting direct recognition - based t - cell alloreactivity . For example, the tce model can assess nonpermissive hla - dpb1 mismatches for hsct . The relevance of the tce model has not yet been investigated in solid - organ transplantation . Practically, one should note that hla - dpb1 is rarely typed prospectively in the setting of solid - organ transplantation, as donor availability is more restricted than for hsct . Although histocheck has been developed to estimate direct recognition in silico for all hla loci, this model does not correlate to alloreactivity in vitro nor in vivo . Alternatively, several studies have identified amino - acid positions that are influencing transplantation outcome; this information can be implemented in donor selection procedures . This model predicts hla - derived epitopes that can be presented on shared hla classes i and ii . Both pirche - i and pirche - ii are well correlated to alloreactivity after hsct . With regard to pirche - ii, increasing numbers of pirche - ii are correlated to antibody production after solid - organ transplantation . Alloreactivity after transplantation can unlikely be attributed to one single pathway of hla recognition . To determine the relative contribution of direct and indirect recognition, combining the different methods of predicting alloreactivity would be of interest . Direct and indirect recognition may act synergistically, and therefore the combination of a positive ctlp assay and a high number of pirches may lead to a more pronounced alloreactive response . Furthermore, combining the pirches and the tce models for hla - dpb1 mismatches might allow identification of hla - dpb1 mismatches recognized in both direct and indirect manners . Moreover, a combination of low pirche - ii and low number of eplets as determined by hlamatchmaker may be favorable in solid - organ transplantation . In conclusion, over the past decades, many approaches have been developed to predict alloreactivity after transplantation in vivo, some attempts leading to more successful predictors than others . The failure of multiple tools to predict alloreactivity is not surprising, as knowledge about alloreactivity is still limited . However, multiple approaches seem to be clinically relevant and some are currently implemented in clinical practice . Further improvement of the definition of hla - mismatch permissibility, and implementation of these definitions into the donor - selection procedure, will eventually lead to reduced alloreactivity, thereby improving clinical outcome after solid - organ transplantation and hsct.
|
In hiv-1 infection, depletion of t cells is caused by productive virus infection and fas - mediated apoptosis of infected and uninfected cells [1, 2]. In addition, chronic immune activation, especially of cells of the innate immune system, together with accompanying, counteracting endogenous anti - inflammatory mechanisms, further contributes to t - cell depletion [3, 4]. Hiv infection of plasmacytoid dendritic cells causes persistent activation, resulting in excessive production of proapoptotic interferon (ifn)-, as well as immunosuppressive indoleamine-2,3-dioxygenase and transforming growth factor (tgf)- [413]. In the case of monocytes / macrophages, translocation of microbial products, especially lipopolysaccharide and dna, across the damaged intestinal epithelium, results in persistent systemic activation of these cells due to interaction with toll - like receptors 4 and 9, as well as with cytosolic pathogen nucleic acid sensors [1423]. The resultant production of proinflammatory cytokines, especially tnf-, drives t - cell activation and activation - induced cell death [6, 21, 22]. Sustained immune activation is associated with disease progression, aids, and death . While highly active antiretroviral treatment (haart) is able to suppress viral replication to levels of <25 copies / ml plasma and partially restore circulating cd4 t cells, it is unable to normalize immune activation [21, 25]. Immune activation in hiv infection is associated with the presence of circulating proinflammatory / anti - inflammatory and antiviral cytokines / chemokines, as well as with other biomarkers of immune activation, which vary qualitatively and quantitatively with disease progression [2631]. However, relatively little is known about the profile of circulating biomarkers of immune activation in the setting of advanced hiv-1 subtype c infection, as well as the usefulness of its measurement, not only in monitoring response to haart, but also as a strategy to detect virologic treatment failure . Black, adult (18 years) participants attending the antiretroviral clinic at a district hospital in pretoria, south africa, were included in this study . Ethics approval was granted by the research ethics committee, faculty of health sciences, university of pretoria (ethics committee approval number 46/2011). All participants gave informed consent and whole blood samples were collected in edta vacutainers, processed within 24 hours to separate the plasma component by centrifugation, and stored at 70c for up to 37 months . Cd4 t - lymphocyte counts (cd4) (beckman coulter sa (pty) ltd .) And hiv-1 rna (vl) (nuclisens hiv-1 viral load assay v1.2 or v2.0) were measured by standard flow cytometric and pcr - based procedures respectively, according to manufacturer's instructions . Sixty hiv - infected participants were followed from pre - treatment to approximately 6 months on haart as part of a larger study on immune reconstitution inflammatory syndrome (iris). Pre - treatment samples were taken prior to the initiation of haart in patients presenting with cd4 counts 200 cells/l blood or who stage 4 disease . Twenty patients were randomly selected from those who started haart, were clinically stable, did not develop clinical signs of iris during the first six months of treatment, and were virologically suppressed (vl <50 copies / ml plasma) at approximately 6 months of haart (suppressed group). Drug regimens consisted of two nucleos(t)ide reverse transcriptase inhibitors (nrtis) (stavudine (d4 t) + lamivudine (3tc), n = 18, or tenofovir (tdf) + 3tc, n = 2) and one nonnucleoside reverse transcriptase inhibitor (nnrti) (efavirenz (efv), n = 14 or nevirapine (nvp), n = 4). Two patients were started on ritonavir - boosted lopinavir (lpv / r) for clinical reasons . A second group consisted of 30 participants failing haart as evidenced by two successive vl results of> 1000 copies / ml plasma at least eight weeks apart despite intensive adherence counselling (failing group). Drug regimens consisted of two nrtis (d4 t + 3tc, n = 23 or zidovudine (azt) + 3tc, n = 7) and one nnrti (efv, n = 20 or nvp, n = 10). Participants had been referred for drug resistance testing and study samples were taken at the time of referral . They had been on haart for a median time of 30 months (range 997 months) and had been failing treatment for a median of 15.5 months (range 538 months). Five patients (17%) had been referred from peripheral clinics and the duration of treatment failure could not be determined . Three patients (10%) had experienced treatment interruptions at some time before treatment failure and 13 (43%) never had a suppressed vl while on haart . All patients with cd4 200 cells/l (n = 21) were on cotrimoxazole or dapsone prophylaxis . A third group (n = 8) of black, hiv - uninfected, healthy control subjects was also included in the study . The median ages of the control, suppressed, and failing groups were 29 (range 2449), 41.5 (2563), and 40.5 (2755) years, respectively, and the corresponding male: female ratios were 1: 0.6, 1: 4, and 1: 4 . These were selected on the basis of being largely representative of t - cell, monocyte / macrophage, dendritic cell, and natural killer cell activation . Circulating cytokines / chemokines were measured using (i) the bioplex suspension bead array system (bio - rad laboratories inc ., hercules, ca, usa) (il-6, il-10, ifn-, tnf-, ccl2/mcp-1, ccl3/mip-1, ccl4/mip-1, and cxcl10/ip-10) or (ii) conventional elisa, namely, ifn- (ebioscience inc ., san diego, ca, usa); tgf-1 total (biolegend, san diego, ca, usa); cxcl9/mig and stnf - r1 (raybiotech inc ., norcross, ga, usa); and scd14 (abcam, cambridge, ma, usa). C - reactive protein (crp) and 2-microglobulin (2 m) were assayed by nephelometry (siemens healthcare diagnostics, bn prospec nephelometer, newark, usa). Previously published ranges for each of these parameters together with supporting references are shown as supplementary data (see supplementary material available online at http://dx.doi.org/10.1155/2014/198413). As participant groups consisted of 30 individuals, data were considered to be nonparametric and distribution - free statistical tests implemented in stata v11.2 (statacorp). Median concentrations of each parameter were compared between cohorts using the wilcoxon mann - whitney test for independent groups and wilcoxon signed rank sum test for matched groups . Correlations between parameters were determined using the spearman correlation test for the hiv - infected pre - haart group (n = 20), as well as for this group combined with the group failing haart (n = 50). Statistical significance was set at p 0.05 . Cd4counts, hiv-1 vl, and levels of inflammatory biomarkers are shown in table 1 . As expected, plasma vl decreased from a median of 53,000 to <50 rna copies / ml plasma and there was a significant increase in the circulating cd4 count (83 to 208 cells/l; p <0.0001) in the suppressed group . With respect to the circulating biomarkers of immune activation, cxcl9, cxcl10, tgf-1, stnf - r1, 2 m, and scd14 were significantly elevated (p <0.03) and ccl4 significantly decreased (p = 0.04) in the pre - haart group relative to the control group, while ifn- was moderately increased but not significantly so (p = 0.07). Following 6 months of haart, cxcl9, cxcl10, 2 m, ifn-, il-6, tnf-, and stnf - r1 were significantly decreased (p <0.01), ccl4 increased (p <0.001), while tgf-1 and scd14 also remained elevated despite undetectable plasma vl . It is difficult to attribute major significance to the decreases in tnf- and il-6 as the pretherapy values for both were low . No difference was observed in ifn-, ccl3, and crp either between the hiv - infected and uninfected control group or the virologically suppressed group pre- and post - haart . In the failing group, the same 5 biomarkers (cxcl9, cxcl10, tgf-1, 2 m, and scd14) were also significantly elevated compared with the control group (p <0.02), the values for cxcl10 and 2 m being somewhat lower than those of the pre - haart group (p <0.03), while those of cxcl9, tgf-1, and scd14 were essentially comparable (p> 0.5). Although the value for ccl2 was significantly lower and that of il-10 higher than the corresponding values of the control group, interpretation is difficult as these values were low in both groups . Correlations between cd4, vl, and the various biomarkers in the pre - haart group are shown in table 2 . Cd4 counts correlated negatively and significantly with vl and with stnf - r1 and ccl2 . Significant positive correlations were also observed between several of the biomarkers including, but not limited to, ifn-, cxcl10, ccl2, ccl3, and tnf-. Although not shown, correlations for the composite group (consisting of the pre - haart and failing groups) were generally comparable, albeit weaker, with the exception of cd4 count with vl (r = 0.64, p <0.001), while the following modest correlations were found: (i) ccl4 with cxcl9, il6, ccl3, and ifn- (r = 0.30, 0.43, resp . ; p <0.03, p <0.001); and (ii) 2 m with cd4 counts, il-6, and ifn- (r = 0.28, 0.43, resp . ; p <0.05, p <0.02). Our findings in patients infected with hiv-1 subtype c are consistent with the coexistence of distinct mechanisms of immune activation, which appear to be differentially affected by successful haart [21, 25]. Although only moderately elevated pre - haart, it is likely that ifn-, probably originating from cd4 and cd8 t cells, underpins the increases in cxcl9 and 10, a contention supported by the strong, positive intercorrelation between ifn- and ccl10, as well as that of ccl9 with ccl10 . Other cell types such as dendritic cells and monocytes may also contribute to the increases in these cytokines pre - haart following exposure of the cells to alternative activators such as ifn-1 [11, 32, 33]. The unexpectedly low level of ifn-, as well as those of ccl2 and 3, may be due to advanced immunosuppression in the setting of high levels of tgf-1 in this group of patients . In the case of 2 m, cxcl 9 and 10, and tnf - r1 (a surrogate for tnf), haart - associated decreases most likely reflect efficient viral suppression and consequent decreased turnover and reactivity of both cd4 and cd8 t cells . The absence of effects of haart on plasma scd14, as previously reported by us and others [17, 21], as well as the increase in ccl4, is consistent with ongoing chronic inflammation due to sustained activation of monocytes / macrophages, even in the face of virally suppressive therapy, and may persist for several years [21, 35]. In this setting, the persistent activation of monocytes / macrophages, predominantly the subtype which coexpresess cd14 and cd16, is most likely driven by the process of microbial translocation [21, 24, 36]. The consequence is sustained generation of proinflammatory mediators and cytokine - driven t - cell death pathways . Interestingly, sandler et al . Recently reported significant positive correlations between plasma scd14, il-6, crp, serum amyloid a, and d - dimer in patients infected with hiv-1 subtype b . Subjects with the highest quartile of plasma scd14 concentrations had a 6-fold higher risk of death than those in the lowest quartile . In addition, supported by the findings of the current study, endogenous, monocyte / macrophage - targeted, anti - inflammatory mechanisms are also likely to contribute to ongoing immunosuppression with tgf-1 appearing to play a pivotal role . Notwithstanding platelets, plasmacytoid dendritic cells, macrophages of the m2 phenotype, and immunoregulatory cd8 t cells, immunosuppressive and profibrotic tgf-1 is likely to originate predominantly from regulatory t cells [38, 39]. In this context it is noteworthy that extensive fibrosis of the t - cell zone of lymphoid tissue appears to be a significant factor in the failure of t - cell reconstitution following successful haart . Persistently elevated plasma levels of tgf-1 and scd14, even in the setting of ostensibly successful haart, may therefore identify a subset of patients at highest risk of a poor outcome . In the group of patients failing haart, the circulating concentrations of cxcl9, cxcl10, and 2 m were also significantly higher than those of the control group and, with the exception of cxcl9, significantly lower than the pre - haart values for the suppressed group . The circulating concentrations of scd14 and tgf-1 in the failing group were comparable to those of the suppressed group both before and after therapy . Persistent elevations, or a rebound following an earlier decrease, in plasma cxcl9, cxcl10, and 2 m appear to be associated with a poor response to haart, suggesting that serial measurement of these biomarkers may be a useful adjunctive strategy . With respect to previous studies, our findings are generally in agreement with a recent study by kamat et al . In which elevated circulating concentrations of cxcl9, cxcl10, scd14, and soluble il-2 receptor (sil-2r) represented a profile which distinguished viremic and aviremic subjects infected with hiv-1 subtype b from uninfected, healthy control subjects . In agreement with the report of kamat et al ., we also detected a significant, negative correlation between numbers of circulating cd4 t cells and vl but failed to show a correlation between these disease markers and cxcl10 in the pre - haart group . However, this correlation was detected when the pre - haart and failing groups were combined, most likely due to increased statistical power . We also detected a significant positive correlation between cxcl9 and cxcl10, while in contrast to these authors, a significant, positive correlation between cxcl10 and ifn- was evident as can be expected in conditions of chronic inflammation . Notwithstanding the different viral types investigated, several other important differences underscore the strengths of the current study . Most importantly, the profile of biomarkers of immune activation measured by kamat et al ., which did not include 2 m or tgf-1, was not measured serially in a single cohort of patients pre- and post - haart as done in the current study, which may account for the observed lack of effect of haart on ifn- in the former study . Limitations, however, are (i) small sample sizes; (ii) measurement of circulating biomarkers at a single time point (6 months) following initiation of haart in the suppressed group; and (iii) no pretherapy measurement of circulating biomarkers prior to initiation of therapy in the failing group . Nonetheless, the general agreement with previous studies, predominantly in the setting of hiv-1 subtype b infection, supports the reliability of our findings . In conclusion, successful administration of haart to patients with hiv-1 subtype c infection is accompanied by significant decreases in circulating biomarkers associated with t - cell activation and turnover (ifn-, cxcl9, cxcl10, stnf - r1, and 2 m). Serial measurement of 3 of these (cxcl9, cxcl10, and 2 m) may represent a useful adjunct to measurement of viral loads in monitoring responses to haart . In addition, persistently elevated levels of scd14 and tgf-1, despite successful haart, are consistent with chronic activation of monocytes / macrophages and possible risk of a poor outcome, underscoring the adjunctive therapeutic potential of monocyte / macrophage - targeted anti - inflammatory chemotherapy in patients with advanced hiv infection.
|
Six specimens of k. sectatrix (2 males with mean weigh of 950 50 g, mean body length 376.5 30.4 mm; 4 females with mean weigh of 868 146 g, mean body length 361.2 22.9 mm) were caught by commercial trawlers in angra dos reis (2300 s 4410w), rj . Fishes were kept in thermal boxes filled with ice prior to being transported to the laboratory and then immediately dissected . Both stomach and intestine were removed and examined individually using a stereoscopic microscope . Nematodes found were fixed in 95 parts of ethanol 70%, three parts formaldehyde 40% and two parts of glacial acetic acid, cleared in lactophenol and studied and measured using light microscopy . For a detailed study of some structures, samples of eggs were extracted from a dissected uterus of a dissected female and the spicules were obtained from a dissected male . Drawings were made using a drawing tube attached to a light microscope olympus bx 51, magnifications of 40x, 100x, 200x, 400x and 1000x . For scanning electron microscopy (sem), specimens were dehydrated in a series of ethanol washes, dried by evaporation with haexamethyldisilazane, coated with gold and scanned in a jeol jsm 6460-lv sem . The identification at the genus level was based on moravec (2007) and anderson et al . Host identification was based on the illustrated key by menezes and figueiredo (1985); nomenclature and classification are updated according to fishbase (froese & pauly 2012). Holotype, allotype and paratypes are deposited in the oswaldo cruz institute helminthological collection (chioc), rj . 1line drawings of pseudascarophis brasiliensis sp . Nov . Collected from the stomach of kyphosus sectatrix from rio de janeiro, brazil . A: anterior end of male, lateral view; b: cephalic end of female, apical view; c: region of vulva, lateral view; d: fully developed egg; e: posterior region of female, lateral view; f: posterior region of male, ventral view; g: posterior region of male, lateral view; h: right spicule, ventrolateral view; i: distal end of left spicule, ventrolateral view . Bars = a, c, g: 50 m; b: 2 m; d, h, i: 20 m; e, f: 75 m . 2scanning electron micrographs of pseudascarophis brasiliensis sp . Nov . Collected from the stomach of kyphosus sectatrix from rio de janeiro, brazil . A: cephalic end, apical view (a: pseudolabia; b: tooth - like digitiform process; c: cephalic papillae; arrow head: amphid); b: cephalic end, ventrolateral view (c: cephalic papillae); c: deirid; d: lateral alae, lateral view; e: lateral alae, ventral view; f: posterior end of female, ventrolateral view (arrow head: phasmid); g: posterior end of male, lateral view (p: caudal papillae; lp: lateral caudal papillae; arrow head: phasmidial papilla); h: area rugosa of male . Bars = a, b, c: 2 m; d: 5 m; e, g: 20 m; f, h: 10 m . Diagnosis - females larger than males, anterior part of body more slender than posterior part; cuticle thick and transversely striated . Cephalic end rounded in both sexes, four submedian inconspicuous cephalic papillae, visible only by sem (fig . 2a, b) and pair of lateral amphids, posterolateral to pseudolabia (fig . Two lateral pseudolabia t - shaped in apical view, emerging externally and somewhat elevated in relation to lateral margins of oral aperture, arching medially to join lateral walls of anterior part of buccal cavity and lacking apical protrusions (figs 1b, 2a, b). Four anteriorly directed tooth - like digitiform processes (2 subdorsal and 2 subventral), emerging sub - marginally from internal surface of oral cavity, not projecting beyond anterior margin of it (figs 1b, 2a, b). Deirids bifurcated (fig . Vestibule long, with distinct funnel - shaped prostom visible in lateral view (fig . Nerve - ring encircles muscular oesophagus near its junction with vestibule, excretory pore slightly posterior to nerve ring (fig . 2d, e), extending from level of prostom to that of anterior ends of subventral caudal alae in males and anterior to the level of anus in females . Male (based on holotype and 9 paratypes) - body 12.8 (10.3 - 15.4) mm long, maximum width at middle of body 82.5 (70 - 100); width at level of nerve ring 42.6 (38 - 54), of oesophago - intestinal junction 55.8 (41 - 78) and of anus 59.6 (51 - 81). Vestibule including prostom 136.4 (130 - 145) long; prostom 10 (8 - 12) long, 10.4 (8 - 12) wide in lateral view . Length of muscular oesophagus 330 (290 - 390); length of glandular oesophagus 5.5 (4.3 - 6.6) mm; length ratio of muscular and glandular parts of oesophagus 1:16.6 (1: 14.4 - 21.47); length of entire oesophagus and vestibule representing 45.5 (41 - 50)% of total body length . Nerve - ring situated at 163.5 (140 - 180) from anterior extremity; deirids and excretory pore at 58 (50 - 65) and 180 (150 - 225), respectively, from anterior end . Posterior end of body spirally coiled provided with vesicular caudal alae (figs 1 g, 2 g). Pre - anal papillae: three pairs of subventral pedunculate papillae, of which second and third pairs close to each other (fig . One pair of lateral pedunculate papillae somewhat posterior to cloacal aperture, which may occur at cloacal line . Postanal papillae: six pairs present, first four pairs subventral and pedunculate, fourth pair smaller than others, last two pairs sessile near tail tip, located at the same line, in which one is lateral and large and one ventral and very small where phasmidial openings are located (fig . At least three longitudinal lines of serrate ventral cuticular ridges (area rugosa), anterior to cloaca, about 190 long (figs 1 g, 2h). Left spicule 380.6 (344 - 418) long, broad with circular rounded anterior end and somewhat inflated dorsoventrally at distal thin tip (fig . 1i); its shaft 161 (145 - 178) long, forming 44.6 (2.1 - 46.3)% of overall length of spicule (measured in 3 males). Right spicule 108.8 (100 - 116) long, stout with rounded distal end and thin tip (fig . Tail conical, 237 (200 - 280) long, with rounded tip . Female (based on allotype and 9 paratypes, all gravid) - body 17.7 (15.9 - 19.8) mm long; maximum width at middle of body 139.2 (100 - 190); width at level of nerve ring 46.9 (41 - 54), of oesophago - intestinal junction 64.7 (52 - 80) and of anus 66.5 (50 - 86). Vestibule including prostom, 131.2 (110 - 143) long; prostom 12 (11 - 13) long, 10.4 (8 - 12) wide in lateral view . Length of muscular oesophagus 381.7 (300 - 465); length of glandular oesophagus 6.1 (5.3 - 6.7) mm; length ratio of muscular and glandular parts of oesophagus 1:16.1 (1:12.8 - 18.9); length of entire oesophagus and vestibule representing 36.4 (33 - 38)% of total body length . Deirids, nerve - ring and excretory pore located at 61.2 (50 - 68), 152.5 (130 - 171) and 185.1 (149 - 220), respectively, from anterior extremity . Vulva posterior to middle of body, situated at 11.6 (10.9 - 12.3) mm from anterior end of body, at 65.8 (60.1 - 70.5)% of body length; vulvar lips not elevated (fig.1c). Tail conical, 123.9 (110 - 150) long, with rounded tip (figs 1e, 2f). Phasmidial opening in small lateral papillae about 10 from tail tip (figs 1e, 2f). Mature eggs (containing larvae) oval, 31.1 (30 - 33) long and 20.9 (20 - 22) wide, thick - walled, with smooth surface and distinct polar knobs, one tuff of four thin filaments emerging from each polar knob (fig . Type - locality - angra dos reis (2300 s 4410w), rj . Type data and depository - holotype (male specimen) chioc 35848a; allotype (female specimen) chioc 35848b; paratypes chioc 35849a (2 male specimens), chioc 35849b (2 female specimens). Host - parasite data - prevalence: four infected fishes of six analysed; mean intensity of infection: 10 10.8 (3 - 26); mean abundance: 6.7 9.8 . Etymology - the specific name refers to the country where the specimens were collected . The taxonomy and classification of cystidicolidae has been complex because this group of nematodes exhibit small size; thus some of their morphologically important features are visible only by sem (moravec 2007, moravec & justine 2010). Therefore, many of the previous studies lack morphological details and provide inadequate descriptions . Cephalic structures are generally considered to be important for the classification of cystidicolidae, although their significance in generic discrimination is still under discussion and more evidence is necessary not only from electron microscopy, but also molecular data (ferrer et al . 2005, moravec et al . 2006, moravec 2007, moravec & gonzlez - sols 2007, moravec & klimpel 2007, 2009). However, there is an increasing consensus in the literature for defining cystidicolid genera based on head morphology . Several genera of cystidicolidae (ascarophis van beneden, caballeronema margolis, capillospirura skryabin, cystidicoloides skinker, pseudascarophis and similascarophis muoz, gonzlez & george - nascimento) are very similar to each other, with minute differences represented by details of their cephalic structures, which are only visible by sem . Moreover, there exist various intermediate features that can be interpreted as interspecific rather than intergeneric differences (moravec & klimpel 2007). Indeed, many members of these genera have been reported within ascarophis (ferrer et al . 2005) or transferred to it (moravec 2007, moravec & gonzlez - sols 2007, moravec & justine 2007). In fact, the latter authors have stated that it is apparent from sem studies that the shape and size of pseudolabia, the shape of the mouth and the development of submedian labia (from well - developed to absent) may differ among ascarophis species . Consequently, ascarophis has been defined as a catch all genus, which also includes species with filamented and non - filamented eggs (ferrer et al . The general morphology of the new species agrees with most diagnostic features described for pseudascarophis, which was erected to accommodate p. kyphosi, a parasite of the congeneric host kyphosus cinerascens (forskl) from japan (ko et al . 1985). Indeed, the structure of the mouth is almost identical between both species, indicating that the specimens studied here belong to pseudascarophis, in agreement with ko et al . (1985), as well as with the latest review of cystidicolidae provided by moravec (2007). The homogeneity of cephalic structures, therefore, confirms the validity of the genus pseudascarophis . The only discrepancies between the new species and the generic diagnosis provided by ko et al . (1985) are the presence of lateral alae, cephalic papillae (referred as indistinct in the type species and consequently in the genus), three pairs of precloacal and one pair of adcloacal papillae in males (instead of only 3 pairs of precloacal and none adcloacal papillae) and the smooth egg shell instead of rugged shell as in p. kyphosi . The presence of four submedian cephalic papillae is a characteristic of spirurine nematodes (moravec 2007) and these structures, apparently inconspicuous in p. kyphosi, probably were overlooked by ko et al . The presence of lateral alae is an uncommon feature in cystidicollids, except for two genera, i.e., ctenascarophis mamaev and metabronema (taylor) (crites et al . Apparently, p. kyphosi lacks lateral alae, since these structures were not described by ko et al . However, to be conclusive about the presence or absence of this feature in pseudascarophis, the genus must be reviewed and all previous described species must be better studied, mainly because some of them (i.e., p. tropica and p. genypteri) seem to be misclassified . Other differences between the new species and p. kyphosi are based on morphometry . Males of both species are similar in size, although the description of p. kyphosi is based on only two specimens . However, the new species has a longer glandular oesophagus (4.3 - 6.6 mm vs. 2.9 - 3.0 mm), a longer tail (200 - 280 vs. 125 - 150), longer spicules (left 344 - 418 vs. 185 - 210 and right 100 - 116 vs. 80 - 90) and, as mentioned above, it has a different pattern of caudal papillae . Measurements of p. kyphosi females are also based on only two specimens, who are longer than the new species (27.2 - 33.4 mm vs. 15.0 - 19.8 mm) and consequently all other measurements are larger . In addition, some morphometric relationships were different when comparisons were made after calculating some of these from the data provided by ko et al . In fact, the new species has a relatively longer oesophagus (32.3 - 38.2% of body length vs. 23.3 - 28.3%) and tail (0.6 - 0.8% of body length vs. 0.4%). Eggs of both species are similar in length, but those of p. kypsosi are thinner (14 - 17 vs. 20 - 22) and have more filaments (at least 6) in the tuffs of polar knobs, rather than four as in the new species . At present, two other species have been described in pseudascarophis, namely, p. tropica and p. genypteri (soloveva 1996, muoz & george - nascimento 2001). However, both of them have some features which differs them from the diagnosis of this genus, especially in the morphology of the cephalic end, casting doubts on their generic identity . In fact, the inclusion of p. tropica in pseudascarophis is based on ambiguous diagnostic criteria such as the structure of head end, digestive system and reproductive system (soloveva 1996); although this species is described as having four teeth - like formations slightly protruded from outside of oral opening, but these structures are not depicted and specimens were not studied by sem . On the other hand, the description of p. tropica suggests various similarities with ascarophis parupenei moravec, orecchia and paggi (e.g. Morphology of cephalic end and posterior end of male, posterior extremity of female with a small appendix and non - filamented eggs) described from parupeneus indicus (shaw) (mullidae) (moravec et al . 1988), congeneric of parupeneus chrysopleuron (temminck & schlegel) which is the type host of p. tropica . The other species, p. genypteri, a parasite of genypterus chilensis (guichenot) (ophidiidae) from chile (muoz & george - nascimento 2001), was originally assigned to this genus by lacking cephalic papillae, submedial and medial labia, as well as because of the progressive prominence of cuticular striations from anterior to posterior body regions and by having the anterior third of body wider than the posterior region . At specific level, p. genypteri was distinguished from p. kyphosi because it has larger spicules, rounded pseudolabia that join in the middle of the oral opening, eight digitiform buccal processes, unfilamented eggs and four pairs of preanal and five pairs of postanal papillae, the same set of differences allow distinguishing it from the new species . P. genypteri was considered different from ascarophis by two characteristics, i.e., their pseudolabia appear to be rounded, instead of being conical as in ascarophis and the anterior third is thicker than the rest of the body . N. by owing its ambiguous diagnosis, its similarity with a. parupenei and due to the broader spectrum of morphological features which this genus includes . On the other hand, p. genypteri is provisionally retained in pseudascarophis, based on the criteria of muoz and george - nascimento (2001) for separating it from ascarophis and by the presence of digitiform buccal processes, until new evidence can help to clarify its generic status.
|
Although survival rates have improved over the past decades, ovarian cancer still has the highest mortality of the gynaecological malignancies.1 ovarian cancer is responsible for 150 000 deaths worldwide annually, and 5year survival in europe and the usa is 3845%.1, 2, 3 prognostic factors that have been identified for women diagnosed with ovarian cancer are age, performance status, histologic tumour type, tumour stage (fdration internationale de gyncologie et d'obsttrique, figo stage), and preoperative tumour load.4, 5 however, complete resection of macroscopic tumour at cytoreductive surgery has been found to be the most important prognostic factor, and it is vital that surgery is always aimed at achieving this goal.4, 5 primary debulking is the preferred treatment for patients with advanced ovarian cancer . When primary debulking is not possible because the patient's physical condition does not allow it or it is estimated that complete tumour resection cannot be accomplished, neoadjuvant chemotherapy followed by interval debulking provides an alternative treatment option with comparable survival rates.5 cancer cachexia, a syndrome of involuntary weight loss and muscle wasting, is common among women with advanced ovarian cancer and has also been associated with adverse clinical outcomes and survival.6 however, weight loss is a poor indicator of disease status in ovarian cancer considering the fact that it is frequently not apparent because of growing volumes of ascites, oedema, or the tumour itself including its metastases . In like manner, other changes such as muscle wasting or accumulation of adipose tissue in different compartments of the body remain indiscernible to the beholder when bodyweight alone is evaluated . In recent years, the understanding of cancerrelated weight loss has therefore guided research to the study of body composition features rather than bodyweight alone . Computed tomography (ct) has been extensively studied and applied in this field and has the advantage that scans are often readily available for cancer patients . Ct imaging enables precise quantification of skeletal muscle (sm) mass and different adipose depots on a single slice, which can be used to estimate total body muscle and fat mass.7, 8 crosssectional analysis of tissue at the level of the third lumbar vertebra (l3) strongly correlates with total body adipose and muscle mass and has thus been widely adopted for characterization of cancer patients.7, 9, 10 among the compartments that can be distinguished on ct are sm, intramuscular adipose tissue (imat), visceral adipose tissue (vat), and subcutaneous adipose tissue (sat). Severe loss of sm mass known as sarcopenia is associated with poor survival in patients with various types of cancer.11, 12, 13, 14 adverse effects are also seen from redistribution of adipose tissue from subcutaneous depots to storage sites in sm and the abdominal cavity.11, 15, 16 studies concerning body composition and survival in patients with ovarian cancer are scarce . In a retrospective study of advanced ovarian cancer patients undergoing primary debulking surgery, sm and vat were not predictive of survival, but low combined sat + imat was associated with worse overall survival (os).17 these results have not been confirmed by others . Changes in body composition in patients undergoing neoadjuvant or palliative chemotherapy have been evaluated in oesophageal, gastric, pancreatic, and lung cancer.18, 19, 20, 21 these studies have included relatively small numbers of patients, which makes it difficult to assess the validity of their findings . The impact of neoadjuvant chemotherapy on muscle mass in ovarian cancer patients has not been investigated . This study aims to investigate os in patients with ovarian cancer related to the changes in sm mass and body composition arising during neoadjuvant chemotherapy . This study has been approved by the local medical ethics committee and has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki . A retrospective study was performed including patients with advanced ovarian cancer (figo 2013 stage iibiv) who were treated with neoadjuvant chemotherapy prior to interval debulking in the maastricht university medical centre (maastricht, the netherlands) between january 2000 and june 2014 . Subjects were eligible for inclusion when the following criteria were met: (i) a routine abdominal ct scan was performed before the start of neoadjuvant chemotherapy and a second abdominal ct scan before interval debulking (typically after 34 cycles of chemotherapy), (ii) both ct scans were of sufficient quality to perform accurate measurements of tissue area, and (iii) sufficient relevant clinical data could be retrieved from the patient's file . Os was computed from the date of the initial ct scan up to the date of death from any cause . The ct date was chosen instead of the date of diagnosis because this date could not be retrieved for all patients . For patients who were still alive at the time of analysis, a fixed date was set for data collection, and all patients were censored at this date, which was at least 6 months after the last included subject was diagnosed . The following clinical characteristics were recorded: age, figo stage, length, weight, weight loss preceding diagnosis, number of chemotherapy cycles, days between ct scans, percentage weight loss during chemotherapy, and surgical outcome . Age was evaluated at the time of the initial ct scan and categorized into <60 years, 6170 years and> 70 years . Reported weight and length were used to calculate body mass index (bmi) in kg / m . Patients were assigned to bmi categories established by the world health organization: bmi <18.5 = underweight, bmi 18.524.9 = normal weight, bmi 2529.9 = overweight and bmi> 30 = obese.22 the outcome of interval debulking was categorized into complete (no visible evidence of macroscopic residual disease), optimal (macroscopic residual disease <1 cm), or incomplete (macroscopic residual disease> 1 cm). For each ct scan, a single axial slice at the level of l3 was selected . Image analysis software, sliceomatic v5.0 (tomovision, montreal, qc, canada), was used to demarcate sm, imat, vat, and sat according to predefined validated boundaries based on the number of hounsfield units (hu). An example of how tissues were measured with sliceomatic software is shown in figure 1 . The following thresholds were applied: 29 to + 150 hu for sm, 190 to 30 hu for imat and sat, and 150 to 50 hu for vat . A single assessor who was trained in the anatomy of the specific tissues of interest evaluated all scans subsequently, and the surface areas in square centimeter were quantified automatically based on the demarcations . Total adipose tissue (tat) was computed by summating imat, vat, and sat . The surface area of sm was normalised for stature to compute the sm index (smi) in cm / m . The median smi at baseline from our own population was used to divide patients in a low muscle mass group (smi below median) and a high muscle mass group (smi equal to or above median). Body composition analysis with sliceomatic. Example of ct scans prechemotherapy (a, c) and postchemotherapy (b, d) in a 46year old patient with figo stage iv ovarian cancer . Increases in sm, imat, vat and sat were measured with sliceomatic v5.0 (tomovision, montreal, qc, canada). Nb: the increase in vat is accompanied by a reduction of ascites; a *, ascites; l3, third lumbar vertebra; sm, skeletal muscle (red); imat, intramuscular adipose tissue (green); vat, visceral adipose tissue (yellow); sat, subcutaneous adipose tissue (teal). Example of ct scans prechemotherapy (a, c) and postchemotherapy (b, d) in a 46year old patient with figo stage iv ovarian cancer . Increases in sm, imat, vat and sat were measured with sliceomatic v5.0 (tomovision, montreal, qc, canada). Nb: the increase in vat is accompanied by a reduction of ascites; a *, ascites; l3, third lumbar vertebra; sm, skeletal muscle (red); imat, intramuscular adipose tissue (green); vat, visceral adipose tissue (yellow); sat, subcutaneous adipose tissue (teal). This percentage change was divided by the number of days between scans and multiplied by 100 days to provide a standard measure for all patients (percent change per 100 days). A measurement error of 2% was adopted based on previously reported accuracy of ct for muscle and fat tissue analysis.7 changes between 2% and + 2% were thus considered maintenance of tissue. Finally, changes were dichotomised into loss of tissue (> 2% decrease per 100 days) and maintenance / gain of tissue (any increase or 2% decrease). For practical reasons, the term gain of tissue the mean changes in muscle and adipose tissue were analyzed with paired ttests, and the mean percentage change per 100 days was calculated for sm, imat, vat, sat, and tat . Loss of sm was compared with gain of sm. Baseline characteristics were analyzed with independent ttests for continuous variables and chisquared or fisher's exact tests for categorical variables . Univariable and multivariable proportional hazards coxregression models were applied to test predictors of os and calculate individual hazard ratio's (hr) with 95% confidence intervals (95%ci). Clinical variables and body composition parameters were initially tested as effect modifiers in a univariable model at a significance level of 10% . All significant variables were then tested together in a multivariable model in which a significance level of 5% was applied . The continuous variables that were tested were age, bmi (prechemotherapy and postchemotherapy), weight loss during chemotherapy, weight loss preceding diagnosis, and number of cycles of chemotherapy . The categorical variables of main interest were changes in sm, imat, vat, sat, and tat during chemotherapy in which loss of tissue was compared with gain of tissue . The remaining categorical variables tested were low smi at baseline and after chemotherapy (yes or no), figo stage iv (in comparison with figo stages ii and iii combined), presence of ascites (yes or no), and complete interval debulking (in comparison with optimal and incomplete interval debulking). All analyses were performed with the statistical software package spss v20.0 (ibm corp, chicago, il, usa). This study has been approved by the local medical ethics committee and has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki . A retrospective study was performed including patients with advanced ovarian cancer (figo 2013 stage iibiv) who were treated with neoadjuvant chemotherapy prior to interval debulking in the maastricht university medical centre (maastricht, the netherlands) between january 2000 and june 2014 . Subjects were eligible for inclusion when the following criteria were met: (i) a routine abdominal ct scan was performed before the start of neoadjuvant chemotherapy and a second abdominal ct scan before interval debulking (typically after 34 cycles of chemotherapy), (ii) both ct scans were of sufficient quality to perform accurate measurements of tissue area, and (iii) sufficient relevant clinical data could be retrieved from the patient's file . Os was computed from the date of the initial ct scan up to the date of death from any cause . The ct date was chosen instead of the date of diagnosis because this date could not be retrieved for all patients . For patients who were still alive at the time of analysis, a fixed date was set for data collection, and all patients were censored at this date, which was at least 6 months after the last included subject was diagnosed . The following clinical characteristics were recorded: age, figo stage, length, weight, weight loss preceding diagnosis, number of chemotherapy cycles, days between ct scans, percentage weight loss during chemotherapy, and surgical outcome . Age was evaluated at the time of the initial ct scan and categorized into <60 years, 6170 years and> 70 years . Reported weight and length were used to calculate body mass index (bmi) in kg / m . Patients were assigned to bmi categories established by the world health organization: bmi <18.5 = underweight, bmi 18.524.9 = normal weight, bmi 2529.9 = overweight and bmi> 30 = obese.22 the outcome of interval debulking was categorized into complete (no visible evidence of macroscopic residual disease), optimal (macroscopic residual disease <1 cm), or incomplete (macroscopic residual disease> 1 cm). For each ct scan, a single axial slice at the level of l3 was selected . Image analysis software, sliceomatic v5.0 (tomovision, montreal, qc, canada), was used to demarcate sm, imat, vat, and sat according to predefined validated boundaries based on the number of hounsfield units (hu). An example of how tissues were measured with sliceomatic software is shown in figure 1 . The following thresholds were applied: 29 to + 150 hu for sm, 190 to 30 hu for imat and sat, and 150 to 50 hu for vat . A single assessor who was trained in the anatomy of the specific tissues of interest evaluated all scans subsequently, and the surface areas in square centimeter were quantified automatically based on the demarcations . Total adipose tissue (tat) was computed by summating imat, vat, and sat . The surface area of sm was normalised for stature to compute the sm index (smi) in cm / m . The median smi at baseline from our own population was used to divide patients in a low muscle mass group (smi below median) and a high muscle mass group (smi equal to or above median). Body composition analysis with sliceomatic. Example of ct scans prechemotherapy (a, c) and postchemotherapy (b, d) in a 46year old patient with figo stage iv ovarian cancer . Increases in sm, imat, vat and sat were measured with sliceomatic v5.0 (tomovision, montreal, qc, canada). Nb: the increase in vat is accompanied by a reduction of ascites; a *, ascites; l3, third lumbar vertebra; sm, skeletal muscle (red); imat, intramuscular adipose tissue (green); vat, visceral adipose tissue (yellow); sat, subcutaneous adipose tissue (teal). Example of ct scans prechemotherapy (a, c) and postchemotherapy (b, d) in a 46year old patient with figo stage iv ovarian cancer . Increases in sm, imat, vat and sat were measured with sliceomatic v5.0 (tomovision, montreal, qc, canada). Nb: the increase in vat is accompanied by a reduction of ascites; a *, ascites; l3, third lumbar vertebra; sm, skeletal muscle (red); imat, intramuscular adipose tissue (green); vat, visceral adipose tissue (yellow); sat, subcutaneous adipose tissue (teal). This percentage change was divided by the number of days between scans and multiplied by 100 days to provide a standard measure for all patients (percent change per 100 days). A measurement error of 2% was adopted based on previously reported accuracy of ct for muscle and fat tissue analysis.7 changes between 2% and + 2% were thus considered maintenance of tissue. Finally, changes were dichotomised into loss of tissue (> 2% decrease per 100 days) and maintenance / gain of tissue (any increase or 2% decrease). For practical reasons, the term gain of tissue will hereafter be used to describe both maintenance and gain of tissue . The mean changes in muscle and adipose tissue were analyzed with paired ttests, and the mean percentage change per 100 days was calculated for sm, imat, vat, sat, and tat . Loss of sm was compared with gain of sm. Baseline characteristics were analyzed with independent ttests for continuous variables and chisquared or fisher's exact tests for categorical variables . Univariable and multivariable proportional hazards coxregression models were applied to test predictors of os and calculate individual hazard ratio's (hr) with 95% confidence intervals (95%ci). Clinical variables and body composition parameters were initially tested as effect modifiers in a univariable model at a significance level of 10% . All significant variables were then tested together in a multivariable model in which a significance level of 5% was applied . The continuous variables that were tested were age, bmi (prechemotherapy and postchemotherapy), weight loss during chemotherapy, weight loss preceding diagnosis, and number of cycles of chemotherapy . Age and bmi were also assessed categorically . The categorical variables of main interest were changes in sm, imat, vat, sat, and tat during chemotherapy in which loss of tissue was compared with gain of tissue . The remaining categorical variables tested were low smi at baseline and after chemotherapy (yes or no), figo stage iv (in comparison with figo stages ii and iii combined), presence of ascites (yes or no), and complete interval debulking (in comparison with optimal and incomplete interval debulking). All analyses were performed with the statistical software package spss v20.0 (ibm corp, chicago, il, usa). We identified 566 patients that were treated for ovarian cancer in the maastricht university medical centre between january 2000 and june 2014 (figure 2). After exclusion of 436 patients (patients with nonadvanced disease, patients without ct examinations, patients who only underwent primary debulking, and/or patients without sufficient clinical data), 130 patients were evaluated with ct measurements . Another seven patients were excluded either because of missing ct scans prechemotherapy or postchemotherapy or because of insufficient quality of the scans . Baseline characteristics for the included subjects are presented in table 1 . At the time of censoring, followup for this group was at least 6 months and ranged from 231 to 3850 days with a median of 681 days . Baseline characteristics se, standard error of the mean; sm, skeletal muscle; bmi, body mass index; smi, skeletal muscle index; ct, computed tomography; os, overall survival . Missing values: 58/123 missing missing values: 53/123 missing . Significant differences between sm loss and sm gain (p <0.05, independentsamples ttest or chisquared test). Mean body composition measurements at baseline are shown in table 2 . Median smi at baseline was 41.5 cm / m, which was used as cutoff to define high and low baseline smi in the study population . Body composition changes during neoadjuvant chemotherapy sd, standard deviation; sm, skeletal muscle; imat, intramuscular adipose tissue; vat, visceral adipose tissue; sat, subcutaneous adipose tissue; tat, total adipose tissue . Indicate significant changes in l3 area measurements between scan 1 and 2 (p <0.05 using pairedsamples ttest). Subjects with high versus low baseline smi did not show significant differences in os with a pvalue of 0.613 in kaplan meier analysis (figure 3). Kaplan meier curve comparing overall survival between high baseline smi and low baseline smi; pvalue = 0.613; smi, skeletal muscle index . Kaplan meier curve comparing overall survival between high baseline smi and low baseline smi; pvalue = 0.613; smi, skeletal muscle index . Treatment with neoadjuvant chemotherapy resulted in significant decreases in median sm, vat, sat, and tat as well as a significant increase in imat . Subjects who were able to maintain or gain sm during chemotherapy had an increased os in kaplan meier analysis in comparison with patients who lost sm (p = 0.004, figure 4). This difference in survival was most prominent from 2 years after start of therapy onwards . To assess other differences between patients with gain or loss of muscle mass, baseline characteristics were presented separately for these groups in table 1 . Besides a significant difference in os as already noted in kaplan mean smi at baseline was significantly lower in the group of patients who could increase sm, and low baseline smi was present in 70% of these patients compared with 41% of patients who experienced muscle loss during chemotherapy (p = 0.003). Furthermore, patients who lost sm during chemotherapy also lost more weight in general between scans (4.8% weight loss versus 1.4% weight loss, p = 0.043). Kaplan meier curve comparing overall survival between loss of skeletal muscle (> 2% decrease per 100 days) and maintenance or gain of skeletal muscle (any increase or 2% decrease per 100 days); pvalue = 0.004; sm, skeletal muscle . Kaplan meier curve comparing overall survival between loss of skeletal muscle (> 2% decrease per 100 days) and maintenance or gain of skeletal muscle (any increase or 2% decrease per 100 days); pvalue = 0.004; sm, skeletal muscle . Finally, we tested whether our variable of interest change in sm held significance in a coxregression model under influence of other potential predictors of os . Only four variables were significant at the level of 10% in the univariable model and were included in the multivariable model: (i) age> 70 years, (ii) complete interval debulking, (iii) loss of sm, and (iv) loss of vat (table 3). Completeness of interval debulking had a positive outcome on os with a hr of 0.49 (p = 0.005). Loss of sm and loss of vat were also significant in the multivariable model and influenced os negatively with hr's of 1.77 and 1.83, respectively . Univariable and multivariable coxregression analyses hr, hazard ratio; ci, confidence interval; bmi, body mass index; sm, skeletal muscle; imat, intramuscular adipose tissue; vat, visceral adipose tissue; sat, subcutaneous adipose tissue; tat, total adipose tissue . Missing data for 46 patients, analysis was carried out with available data from 77 patients . Missing data for 8 patients, analysis was carried out with available data from 115 patients . Missing data for 53 patients, analysis was carried out with available data from 70 patients . Missing data for 58 patients, analysis was carried out with available data from 65 patients . Median smi at baseline was 41.5 cm / m, which was used as cutoff to define high and low baseline smi in the study population . Body composition changes during neoadjuvant chemotherapy sd, standard deviation; sm, skeletal muscle; imat, intramuscular adipose tissue; vat, visceral adipose tissue; sat, subcutaneous adipose tissue; tat, total adipose tissue . Indicate significant changes in l3 area measurements between scan 1 and 2 (p <0.05 using pairedsamples ttest). Subjects with high versus low baseline smi did not show significant differences in os with a pvalue of 0.613 in kaplan kaplan meier curve comparing overall survival between high baseline smi and low baseline smi; pvalue = 0.613; smi, skeletal muscle index . Kaplan meier curve comparing overall survival between high baseline smi and low baseline smi; pvalue = 0.613; smi, skeletal muscle index . Treatment with neoadjuvant chemotherapy resulted in significant decreases in median sm, vat, sat, and tat as well as a significant increase in imat . Subjects who were able to maintain or gain sm during chemotherapy had an increased os in kaplan meier analysis in comparison with patients who lost sm (p = 0.004, figure 4). This difference in survival was most prominent from 2 years after start of therapy onwards . To assess other differences between patients with gain or loss of muscle mass, baseline characteristics were presented separately for these groups in table 1 . Besides a significant difference in os as already noted in kaplan mean smi at baseline was significantly lower in the group of patients who could increase sm, and low baseline smi was present in 70% of these patients compared with 41% of patients who experienced muscle loss during chemotherapy (p = 0.003). Furthermore, patients who lost sm during chemotherapy also lost more weight in general between scans (4.8% weight loss versus 1.4% weight loss, p = 0.043). Kaplan meier curve comparing overall survival between loss of skeletal muscle (> 2% decrease per 100 days) and maintenance or gain of skeletal muscle (any increase or 2% decrease per 100 days); pvalue = 0.004; sm, skeletal muscle . Kaplan meier curve comparing overall survival between loss of skeletal muscle (> 2% decrease per 100 days) and maintenance or gain of skeletal muscle (any increase or 2% decrease per 100 days); pvalue = 0.004; sm, skeletal muscle . Finally, we tested whether our variable of interest change in sm held significance in a coxregression model under influence of other potential predictors of os . Only four variables were significant at the level of 10% in the univariable model and were included in the multivariable model: (i) age> 70 years, (ii) complete interval debulking, (iii) loss of sm, and (iv) loss of vat (table 3). Completeness of interval debulking had a positive outcome on os with a hr of 0.49 (p = 0.005). Loss of sm and loss of vat were also significant in the multivariable model and influenced os negatively with hr's of 1.77 and 1.83, respectively . Univariable and multivariable coxregression analyses hr, hazard ratio; ci, confidence interval; bmi, body mass index; sm, skeletal muscle; imat, intramuscular adipose tissue; vat, visceral adipose tissue; sat, subcutaneous adipose tissue; tat, total adipose tissue . Missing data for 46 patients, missing data for 8 patients, analysis was carried out with available data from 115 patients . Missing data for 53 patients, analysis was carried out with available data from 70 patients . Missing data for 58 patients, analysis was carried out with available data from 65 patients . Our goal was to investigate whether changes in sm mass occur in ovarian cancer patients undergoing neoadjuvant chemotherapy and if so, whether these changes have an impact on survival . We found that women who maintained or gained sm during neoadjuvant treatment had a better prognosis than women who lost sm . Loss of sm during chemotherapy and a shorter os are closely related according to our findings, but the direct causality of this relationship is unclear . The increased amount of weight loss in the muscle loss group suggests that these patients suffered from a higher degree of cachexia . The metabolic and inflammatory changes associated with cachexia together with the decreased muscle nitrogen reserves could explain the poor prognosis in this group.23 inactive and malnourished patients will experience more muscle wasting and are more prone to have complications when undergoing surgery.24, 25 reasons why patients are unable to maintain a healthy diet or physical activity are diverse . Patients with a good responding tumour might feel better compared with patients with bulky, poorresponding tumours . Perioperative malnutrition has also been associated with higher rates of suboptimal debulking surgery and thus a shorter survival in a study of older women diagnosed with ovarian cancer.26 in addition, muscle loss by itself is associated with poor physical function, increased chemotherapy toxicity, and longer recovery after surgery.27, 28, 29 finally, the presence of comorbidities and old age could also be detrimental . Interestingly, decrease in sm over time was an important prognostic factor for os, while low sm at a specific time point was not . We measured the smi at baseline and after chemotherapy, but os was not different for patients with low smi versus high smi . Moreover, when we compared patients who gained sm and lost sm, we found that patients with a gain of sm had a lower mean smi at baseline . Many studies on sarcopenia only measure baseline / single time point sm, which sometimes has an effect on but often does not influence survival.17, 21, 30, 31 in our opinion, measuring sm loss over time is absolutely necessary to adequately identify sarcopenic patients, because important limitations of baseline measurements are that they cannot measure sm loss and are greatly influenced by interpersonal variation of muscle mass and other variables such as obesity and ethnicity . The poor prognostic value of low baseline smi was clearly shown in our data, where low muscle index at baseline could not predict survival, and in fact, many patients with low baseline smi gained muscle mass during chemotherapy and were classified as high baseline smi after neoadjuvant treatment . Our results have also shown an association between loss of vat and a shorter os . This was also confirmed in other studies.20, 32 we approach this finding with caution because we have noticed that vat was not always easily identified and measured in subjects where ascites was present before treatment, as was the case in 55% of patients . Therefore an increase in vat could represent an increased measurement of vat because of diminished ascites after chemotherapy treatment rather than an actual increase in vat because of other causes . Survival gain associated with an increase of vat could thus reflect the group of patients with a good response to chemotherapy . However, this hypothesis cannot be confirmed in our data because patients with ascites were divided equally among the women who gained vat and the women who lost vat during chemotherapy . Other authors in the field have found mixed results regarding the relationship between muscle and adipose tissue changes and survival . Our findings are concordant with the outcome of a study in nonsmall cell lung cancer patients; stene et al . Found a longer os for patients who maintained or gained sm in comparison with patients who lost sm, and survival was irrespective of the presence of sarcopenia at baseline.21 in general, a mean decrease in sm is seen during chemotherapy for patients with lung cancer, pancreatic cancer, and oesophagogastric cancer, similar to our findings in ovarian cancer.18, 19, 20, 21, 32, 33 however, this decrease in sm did not alter os rates in oesophagogastric cancer.18, 19 in pancreatic cancer, a decline in sm and vat was recorded during neoadjuvant chemotherapy, but only loss of vat was associated with a shorter os.20, 32 known prognostic factors such as age, bmi, tumour stage, or weight loss may attribute to prognosis, but we were not able to find a significant relationship for these variables with os . As reported by prado et al ., obesity is not protective against muscle loss, on the contrary; sarcopenic obesity was associated with poorer functional status and was an independent predictor of survival.31 therefore, an evaluation of bodyweight instead of body composition can be misleading when a patient is assessed . Because of the retrospective nature of this study, it was not always possible to retrieve all variables and possible confounders of interest in all patients . Body weight and bmi both before the start of treatment as well as during chemotherapy were not retrievable for all subjects . It would also have been interesting to incorporate world health organization performance status and tumour marker ca125 into the analyses, but due to too many missing data, this was not possible . A second important shortcoming of this study is selection bias . Instead of studying all patients with ovarian cancer, we only selected the patients with advanced disease who were assigned to neoadjuvant chemotherapy and interval debulking . These patients often have large bulky tumours, more advanced locoregional and distal tumour spread, and/or a worse performance status, which prevents them from undergoing primary surgical treatment . For this study, we intentionally made the decision to use this particular group because it gave us the opportunity to compare muscle loss over the course of time due to the availability of multiple ct scans . Patients who are treated with primary debulking only receive one ct scan before treatment and are not followedup with ct during adjuvant chemotherapy unless a suspicion of recurrence arises . Whether our results can be reproduced in ovarian cancer patients who receive primary cytoreductive surgery without neoadjuvant chemotherapy will be a topic of future research . Furthermore, our study took place in a specialized oncologic centre in the south of the netherlands . Survival rates could vary between specialized and nonspecialized centres but also countries or health care systems across the world . Therefore, we believe it is important that body composition measurement studies for gynaecological malignancies should be validated in other populations . Unlike many other published manuscripts, we decided to use our own cutoff value to define sarcopenia in our population . In which a value of 38.5 for smi is used to define sarcopenic patients, but this cutoff value is based on obese patients with respiratory and gastrointestinal tumours, and we did not find this cutoff representative for the present study population.31 the use of a different and lower cutoff value (e.g. 38.5) would have resulted in a higher number of sarcopenic patients; we tested whether this significantly changed any of the outcomes but found that this was not the case in both the kaplan meier and coxregression analyses (data not shown). Instead, we decided to set our own cutoffs, which is a more unbiased approach . In this manuscript, we have provided evidence that loss of sm and loss of vat during neoadjuvant chemotherapy is detrimental to os for ovarian cancer patients . Evaluation of sm at a specific time point does not help in predicting survival, which is why we propose a measurement over time to adequately identify sarcopenic patients . External and prospective validation of these findings in other cohorts from (inter)national centres is imperative . However, even more important are prospective randomized controlled trials investigating whether nutritional, pharmacological and/or physical interventions to maintain or even increase sm and adipose tissue can improve os in ovarian cancer patients . Nutritional intervention schemes have been developed for ovarian cancer patients and cancer patients in general, largely based on expert opinions and often lacking clinical evidence.34, 35 our goal was to investigate whether changes in sm mass occur in ovarian cancer patients undergoing neoadjuvant chemotherapy and if so, whether these changes have an impact on survival . We found that women who maintained or gained sm during neoadjuvant treatment had a better prognosis than women who lost sm . Loss of sm during chemotherapy and a shorter os are closely related according to our findings, but the direct causality of this relationship is unclear . The increased amount of weight loss in the muscle loss group suggests that these patients suffered from a higher degree of cachexia . The metabolic and inflammatory changes associated with cachexia together with the decreased muscle nitrogen reserves could explain the poor prognosis in this group.23 inactive and malnourished patients will experience more muscle wasting and are more prone to have complications when undergoing surgery.24, 25 reasons why patients are unable to maintain a healthy diet or physical activity are diverse . Patients with a good responding tumour might feel better compared with patients with bulky, poorresponding tumours . Perioperative malnutrition has also been associated with higher rates of suboptimal debulking surgery and thus a shorter survival in a study of older women diagnosed with ovarian cancer.26 in addition, muscle loss by itself is associated with poor physical function, increased chemotherapy toxicity, and longer recovery after surgery.27, 28, 29 finally, the presence of comorbidities and old age could also be detrimental . Interestingly, decrease in sm over time was an important prognostic factor for os, while low sm at a specific time point was not . We measured the smi at baseline and after chemotherapy, but os was not different for patients with low smi versus high smi . Moreover, when we compared patients who gained sm and lost sm, we found that patients with a gain of sm had a lower mean smi at baseline . Many studies on sarcopenia only measure baseline / single time point sm, which sometimes has an effect on but often does not influence survival.17, 21, 30, 31 in our opinion, measuring sm loss over time is absolutely necessary to adequately identify sarcopenic patients, because important limitations of baseline measurements are that they cannot measure sm loss and are greatly influenced by interpersonal variation of muscle mass and other variables such as obesity and ethnicity . The poor prognostic value of low baseline smi was clearly shown in our data, where low muscle index at baseline could not predict survival, and in fact, many patients with low baseline smi gained muscle mass during chemotherapy and were classified as high baseline smi after neoadjuvant treatment . Our results have also shown an association between loss of vat and a shorter os . This was also confirmed in other studies.20, 32 we approach this finding with caution because we have noticed that vat was not always easily identified and measured in subjects where ascites was present before treatment, as was the case in 55% of patients . Therefore an increase in vat could represent an increased measurement of vat because of diminished ascites after chemotherapy treatment rather than an actual increase in vat because of other causes . Survival gain associated with an increase of vat could thus reflect the group of patients with a good response to chemotherapy . However, this hypothesis cannot be confirmed in our data because patients with ascites were divided equally among the women who gained vat and the women who lost vat during chemotherapy . Other authors in the field have found mixed results regarding the relationship between muscle and adipose tissue changes and survival . Our findings are concordant with the outcome of a study in nonsmall cell lung cancer patients; stene et al . Found a longer os for patients who maintained or gained sm in comparison with patients who lost sm, and survival was irrespective of the presence of sarcopenia at baseline.21 in general, a mean decrease in sm is seen during chemotherapy for patients with lung cancer, pancreatic cancer, and oesophagogastric cancer, similar to our findings in ovarian cancer.18, 19, 20, 21, 32, 33 however, this decrease in sm did not alter os rates in oesophagogastric cancer.18, 19 in pancreatic cancer, a decline in sm and vat was recorded during neoadjuvant chemotherapy, but only loss of vat was associated with a shorter os.20, 32 known prognostic factors such as age, bmi, tumour stage, or weight loss may attribute to prognosis, but we were not able to find a significant relationship for these variables with os . As reported by prado et al ., obesity is not protective against muscle loss, on the contrary; sarcopenic obesity was associated with poorer functional status and was an independent predictor of survival.31 therefore, an evaluation of bodyweight instead of body composition can be misleading when a patient is assessed . Because of the retrospective nature of this study, it was not always possible to retrieve all variables and possible confounders of interest in all patients . Body weight and bmi both before the start of treatment as well as during chemotherapy were not retrievable for all subjects . It would also have been interesting to incorporate world health organization performance status and tumour marker ca125 into the analyses, but due to too many missing data, this was not possible . A second important shortcoming of this study is selection bias . Instead of studying all patients with ovarian cancer, we only selected the patients with advanced disease who were assigned to neoadjuvant chemotherapy and interval debulking . These patients often have large bulky tumours, more advanced locoregional and distal tumour spread, and/or a worse performance status, which prevents them from undergoing primary surgical treatment . For this study, we intentionally made the decision to use this particular group because it gave us the opportunity to compare muscle loss over the course of time due to the availability of multiple ct scans . Patients who are treated with primary debulking only receive one ct scan before treatment and are not followedup with ct during adjuvant chemotherapy unless a suspicion of recurrence arises . Whether our results can be reproduced in ovarian cancer patients who receive primary cytoreductive surgery without neoadjuvant chemotherapy will be a topic of future research . Furthermore, our study took place in a specialized oncologic centre in the south of the netherlands . Survival rates could vary between specialized and nonspecialized centres but also countries or health care systems across the world . Therefore, we believe it is important that body composition measurement studies for gynaecological malignancies should be validated in other populations . Unlike many other published manuscripts, we decided to use our own cutoff value to define sarcopenia in our population . In which a value of 38.5 for smi is used to define sarcopenic patients, but this cutoff value is based on obese patients with respiratory and gastrointestinal tumours, and we did not find this cutoff representative for the present study population.31 the use of a different and lower cutoff value (e.g. 38.5) would have resulted in a higher number of sarcopenic patients; we tested whether this significantly changed any of the outcomes but found that this was not the case in both the kaplan meier and coxregression analyses (data not shown). Instead, we decided to set our own cutoffs, which is a more unbiased approach . In this manuscript, we have provided evidence that loss of sm and loss of vat during neoadjuvant chemotherapy is detrimental to os for ovarian cancer patients . Evaluation of sm at a specific time point does not help in predicting survival, which is why we propose a measurement over time to adequately identify sarcopenic patients . External and prospective validation of these findings in other cohorts from (inter)national centres is imperative . However, even more important are prospective randomized controlled trials investigating whether nutritional, pharmacological and/or physical interventions to maintain or even increase sm and adipose tissue can improve os in ovarian cancer patients . Nutritional intervention schemes have been developed for ovarian cancer patients and cancer patients in general, largely based on expert opinions and often lacking clinical evidence.34, 35 the authors certify that they comply with the ethical guidelines for authorship and publishing of the journal of cachexia, sarcopenia and muscle.36
|
We now have quite detailed knowledge of the partners of the plk4 family of kinases at centrioles . In c. elegans, zyg-1 is targeted to centrioles by spd-2 [5, 6] whereas in drosophila, asterless has this function . Targeting in mammalian cells requires the respective counterparts of both proteins cep192 and cep152 [8, 9] that can each interact with plk4 s cryptic polo - box domain . Procentriole formation can be initiated at multiple sites not only when plk4 is overexpressed [3, 4, 10] or when its scf - dependent proteolysis is prevented [11, 12], but also when expression of its targeting subunit is elevated . Despite this extensive knowledge several substrates of plk4/zyg-1 have been identified to date that include sas-6, cep152, and a component of -turc, gcp6, but it is not clear how phosphorylation of these proteins might affect centriole duplication . To address this question we chose to identify centriole proteins that could be phosphorylated by plk4 in vitro . To this end we purified an active form of drosophila plk4 expressed in e. coli that was able to undertake known autophosphorylation [1620] and was also active toward an artificial substrate (figure s1a available online). We first tested whether this preparation of plk4 would phosphorylate proteins found in the outer layers of the centriole [21, 22]. This revealed that plk4 could weakly phosphorylate its partner protein, asl (figure s1b), and cep97 (figure s1c), a protein that complexes with the cp110 centriole capping protein . However, it could not phosphorylate the microtubule wall - associated protein, sas4 [21, 2426], (figure s1b); rcd4, a poorly characterized centriole duplication protein (figure s1c); or bld10/cep135, a protein required for maintenance but not formation of the core centriole [27, 28] (figure s1c). We then asked whether the core centriole proteins ana2 and sas6 might be substrates as both are essential for centriole duplication in drosophila [29, 30] and their respective counterparts in c. elegans, sas-5 and sas-6, are immediately downstream of zyg-1 in the recruitment hierarchy of centriole proteins in c. elegans [5, 6]. Strikingly, plk4 could strongly phosphorylate ana2 but not sas6 (figures 1a, s1d, and s1e), suggesting the possibility that ana2 might be the plk4 substrate that triggers centriole duplication . To test the above hypothesis, we first mapped the sites on ana2 phosphorylated by plk4 in vitro and tested the significance of their modification . Mass spectrometric analysis revealed multiple plk4 phosphorylation sites of which four serine residues (s318, s365, s370, and s373) (figures 1b and 1c, arrows, figure s1 g) stood out because their total spectral counts (times a particular phospho - peptide was detected) were much higher than any others . Moreover, they seemed to be the only plk4 sites in the c - terminal part of ana2 as their mutation to alanine prevented phosphorylation by plk4 in vitro (figures 1d and s1f). Their functional importance was also suggested by their conservation within the stan motif that characterizes ana2 orthologs (figure 1c) and the finding that phosphorylation of the same sites could be detected in vivo (see figure s1 g and legend). To test their biological significance, we asked whether ana2 with alanine substitutions at these sites (ana2 - 4a) would permit centriole duplication . For this purpose we first established two d.mel-2 cell lines, stably expressing untagged versions of either wild - type ana2 (ana2-wt) or ana2 - 4a that each lacked the utrs of the endogenous gene . Three 4-day treatments of control d.mel-2 cells with ds ana2-utr rna led to complete loss of centrioles from 68% of cells (data not shown). By contrast, depletion of endogenous ana2 from the line expressing the ana2-wt transgene had no significant effect upon centriole number, indicating that it can fully substitute for the endogenous protein . However, expression of transgenic ana2 - 4a not only failed to rescue endogenous ana2 depletion, but also had a significant dominant - negative effect, an increased proportion of cells lacking centrioles following control - rnai (figures 1e and 1f). Together this demonstrates the functional importance of these four conserved serines in the stan motif of ana2 for centriole duplication . We next considered whether phosphorylation of ana2 by plk4 might affect its interaction with other components of the centriole duplication machinery . To this end we loaded recombinant gst - ana2 onto beads, incubated with either active or inactive (plk4) kinase and then with s - methionine - labeled centriole proteins synthesized in vitro . We were unable to detect binding of ana2 to either rcd4 or ana1; its binding to sas4 showed no change; and its weaker binding to bld10 showed a 3.5-fold increase in response to ana2 s phosphorylation state (figures 2a and s2a). However, sas6 showed a dramatic increase in binding to ana2 phosphorylated by plk4 (figures 2a and 2b). The c - terminal part of ana2 containing the stan motif was necessary and sufficient for this phospho - dependent interaction with sas6 (figure 2c), leading us to test the consequences of mutations at its four plk4 sites . We found that the ana2 - 4a mutant was unable to interact with sas6 even after incubation with active plk4 (figure 2b), indicating that phosphorylation on these sites is required . When we mutated individual serines to alanines, the strength of the interaction was diminished, particularly with s370a mutant, but not completely abolished (figure s2b). Thus plk4 phosphorylation of ana2 on all four residues is critical to mediate its interaction with sas6 in vitro . To validate these findings in vivo, we cotransfected d.mel-2 cells with sas6-myc and flag - ana2 (either wt or 4a) and either active plk4 mutated in its degron (plk4) or inactive plk4 (nondegradable and kinase - dead following flag - pulldown we could detect sas6 associated with ana2-wt but not ana2 - 4a and only when coexpressed with the active form of plk4 (figure 2d). This verifies our in vitro findings that following phosphorylation by plk4, ana2 is able to interact with sas6 . Sas6 provides a structural basis for centriole architecture; its oligomers adopt a 9-fold symmetrical arrangement to form the cartwheel structure of the procentriole [31, 32]. Stil (human ana2) and hsas6 are the first proteins to follow plk4 to a dot - like structure marking assembly of the procentriole [9, 22, 33]. Sas6 is essential for correct centriole structure in drosophila although, unlike plk4, its overexpression does not lead to proper centriole formation in eggs . However, boosting expression of both sas6 and ana2 stimulates formation of multiple microtubule organizing centers in eggs and tubular aggregates linked to disengaged centrioles in spermatocytes . Interestingly, however, such sas6 and ana2 could be recruited to centrioles only if plk4 were also overexpressed in spermatocytes leading to centriole overduplication . These earlier findings might be accounted for if the phosphorylation of ana2 by plk4 triggered the first step in cartwheel formation by sas6, leading to procentriole formation . To address the above hypothesis, we first needed to examine the progressive recruitment of ana2 and sas6 to centrioles in their duplication cycle relative to the outer centriolar marker d - plp . At mitotic entry, each centrosome comprises a pair of orthogonally engaged centrioles, which we refer to as mother and daughter, surrounded by peri - centriolar, microtubule - nucleating material . The daughter centriole is immature at this stage and matures during mitosis . In drosophila cells, the mother centriole is encircled by a d - plp ring and during maturation, two horns of d - plp progressively extend around the daughter to give a complete ring by metaphase / early anaphase . Once the d - plp ring is complete, the paired centrioles disengage during late anaphase so that each newly born cell exits cytokinesis into g1 with two well - separated centrioles (figure s3). At mitotic entry, sas6 and ana2 are both present in two discrete puncta, one in the center of the mother centriole, the other marking the daughter and yet to become encircled by d - plp . When the mother and mature daughter disengage, they each have a single dot of ana2 or sas6 at their center . Then, in late anaphase / telophase, a second ana2/sas6 dot appears at the periphery of each physically separated centrioles, marking the site of procentriole formation (figure s3). With this knowledge, we could then address the interdependencies of ana2 and sas6 for their loading onto centrioles . We found that both ana2-wt and the ana2 - 4a mutant localized to centrioles, arguing that ana2 recruitment does not require its plk4-dependent association with sas6 (figure 3a). We then explored the ability of endogenous ana2 to localize to centrioles in the absence of sas6 and found this to be largely unaltered (figure 3b). We then explored the reciprocal possibility by depleting ana2 and assessing the localization of sas6 . We found that this diminished the level of sas6 by 2- to 3-fold and resulted in centrioles that had only a single central punctum of sas6 . Sas6 failed to load onto anaphase / telophase centrioles in ana2-depleted cells so that the majority of interphase centrioles retained only a single sas6 punctum (figures 3c and 3d). Thus sas6 loading and the consequential formation of the procentriole are dependent on ana2 . Because phosphorylation of ana2 by plk4 is required for ana2 to bind sas6, we determined the effects of plk4 depletion and found that this had similar consequences to ana2 rnai for sas6 loading (figures 3c and 3e). This accords with a requirement for ana2 to be phosphorylated by plk4 in order to interact with and therefore load sas6 onto the centriole . Finally, to determine whether phosphorylation of the four plk4 sites within the stan motif was critical for sas6 recruitment, we asked whether ana2 - 4a would block the recruitment of sas6 . For this purpose we depleted the endogenous ana2 from our cell lines overexpressing either ana2-wt or ana2 - 4a and simultaneously monitored the localization of the transgenic ana2 proteins and endogenous sas6 . The great majority (91%, n = 34) of interphase centrioles in cells with endogenous ana2 substituted by ana2-wt had two colocalizing puncta of ana2 and sas6 on both mother and daughter / procentriole (figure 4) as expected from our above study of untreated cells (figure s3). In striking contrast, when endogenous ana2 was substituted with ana2 - 4a, the majority (85%, n = 20) of interphase centrioles had puncta of ana2 on mother and daughter, but sas6 was associated only with the mother (figure 4). This further demonstrates that ana2 is able to load onto the site of procentriole formation irrespective of whether it can be phosphorylated by plk4 . However, plk4-mediated phosphorylation of ana2 is necessary in order to recruit sas6 for procentriole formation . Together our findings suggest a series of events that include disengagement of centrioles at the end of mitosis and the initiation of procentriole formation accompanied by re - engagement by loading sas6 . This would accord with the finding that centrioles of sas6 mutant spermatocytes in drosophila lose both their 9-fold symmetry and their engagement; the former being consistent with sas6 s role in establishing the cartwheel structure, the latter suggesting that sas6 is also required to maintain the orthogonal link between mother and daughter . Here we observe that disengagement of the mother / daughter pair occurs immediately following the maturation of the daughter centriole, a process that we see through completion of a ring of d - plp that encircles the daughter s ana2 and sas6 . This has similarities to the plk1-dependent maturation and disengagement of the mother / daughter centriole pair of human cells as they pass through mitosis [37, 38]. Effectively, these processes constitute duplication licensing; they activate a site on the daughter centriole and clear sas6 from the perimeter of the mother, allowing both mother and daughter to initiate procentriole formation . In accord with this notion, we see the recruitment of new ana2 and sas6 onto the mother and daughter only once they have disengaged . It is of interest to compare our findings on sas6 recruitment in drosophila to events in human cells where sas6 is destroyed during g1 . A recent study has shown that sas6 is first transiently recruited to the lumen of the mother centriole in s phase before being repositioned to the site of procentriole formation, events that are dependent upon stil (human ana2) and plk4 . This contrasts to drosophila where sas6 is stable at the core of the centriole once it is incorporated, and only its initial incorporation into procentrioles appears to be dependent on ana2 and plk4 . Our evidence strongly suggests that the very first act of procentriole formation requires ana2 to be phosphorylated by plk4 . A mutant form of ana2 unable to be phosphorylated at the plk4 sites permits neither sas6 recruitment nor centriole duplication, and depletion of either plk4 or ana2 similarly prevents the spatio - temporal events of sas6 loading . Thus, although we cannot exclude the possibility that other protein kinases can also phosphorylate ana2 in vivo, it seems most probable that ana2 s phosphorylation by plk4 initiates centriole duplication because plk4 is the only known protein kinase whose activity is sufficient for de novo centriole formation . The phosphorylation of ana2 in its stan motif enables it to recruit sas6, presumably to form a new cartwheel structure and establish engagement of the new procentrioles to both old mother and daughter . How does ana2 itself become recruited onto the site of procentriole formation and how is new ana2 (and hence sas6) restricted to this single site? What is the architecture of the ana2-sas6 complex? As we progress further in understanding how the centriole components are pieced together and how these events are controlled by reversible phosphorylation and regulated protein stability, the answers to these questions will surely emerge.
|
Radioactive iodine (rai) therapy has been used as a first line of treatment for graves hyperthyroidism (graves disease [gd]) for more than seven decades and is still the treatment of choice in many parts of the world . It's a common practice to pretreat patients with antithyroid drugs (atd) prior to radioiodine ablation, to restore euthyroidism and to prevent exacerbation of the thyrotoxic state seen in some patients after radioiodine therapy . Atd have a radioprotective effect and pretreatment with atd has been shown to increase the risk of treatment failure with subsequent i. this effect has been demonstrated more consistently with propylthiouracil (ptu) than with carbimazole (cmz) or methimazole (mmi). It has been recommended that atd should be stopped 35 days before i to reduce the interference of atd with the efficacy of radioiodine therapy . Men with gd have a lower rate of remission compared to women and the impact of long - term pretreatment with atd on the efficacy of radioiodine treatment in men has not been adequately evaluated . The objective of this retrospective study, in men with gd, was to compare the efficacy of fixed doses of radioiodine between patients with and without long - term cmz pretreatment . We reviewed the case records of 464 male patients with gd treated at m. s. ramaiah medical college, bangalore, with i, in the period between 1998 and 2008 . Gd was defined as the occurrence of biochemical hyperthyroidism (raised serum total / free t4 concentration and undetectable / low thyroid stimulating hormone [tsh]) together with the presence of at least two of the following: a palpable diffuse goiter, diffusely increased uptake on the technetium 99 m thyroid scan, elevated titers of thyroid peroxidase and/or tsh receptor autoantibodies, and/or the presence of ophthalmopathy . The inclusion criteria were: radionuclide studies and thyroid function tests consistent with gd, a recipient of i therapy, at least 1-year of follow - up data available post i therapy and discontinuation of cmz therapy at least 57 days before radioiodine administration . Exclusion criteria included therapy with any atd other than cmz or atd therapy during radioiodine therapy . Patients were divided into two groups - patients pretreated with cmz as a primary long - term therapy that subsequently received i and untreated newly diagnosed patients who were given i alone without atd pretreatment . In patients opting for atd as primary therapeutic option, our policy was to administer them for 1224 months and patients who were biochemically hyperthyroid or who required a dosage of> 10 mg / d of cmz to maintain euthyroidism at the end of therapy would then be advised to take i therapy . Of the 335 patients, 148 patients had been pretreated with atd and remaining 187 patients received i without pretreatment . Patients were treated with a single fixed dose of i based on the uptake of radioiodine and thyroid size . The dose of i varied from 5 to 15 millicurie (mci). In patients pretreated with atd, the drugs were withdrawn 57 days before radioiodine therapy . Following rai treatment, thyroid status all the patients within the study group were followed up for at least 12 months after treatment . Cure of hyperthyroidism after i was defined as euthyroid status for 6 months off treatment or the need for levothyroxine replacement for biochemical hypothyroidism . Data are reported as mean and standard deviation for the continuous variables, number and percentage for the categorical variables . Student's t - test (unpaired t - test) was used to compare the outcome results between drug - nave patients and patients who were previously on atd . Chi - squared test was used to compare the observed frequencies of palpable goiter and ophthalmopathy between the two study groups . Two sample proportion test was used to compare the success rate of a single dose of i and differences in the rates of worsening of ophthalmopathy (%) between the study groups . Data are reported as mean and standard deviation for the continuous variables, number and percentage for the categorical variables . Student's t - test (unpaired t - test) was used to compare the outcome results between drug - nave patients and patients who were previously on atd . Chi - squared test was used to compare the observed frequencies of palpable goiter and ophthalmopathy between the two study groups . Two sample proportion test was used to compare the success rate of a single dose of i and differences in the rates of worsening of ophthalmopathy (%) between the study groups . The baseline demographic, clinical, and laboratory characteristics of the cohort are summarized in table 1 . The overall success rate of a single dose of i for the entire cohort was 80.2% (275/335) and the cumulative rate of hypothyroidism at 1-year was 64.5% . Baseline characteristics of the two study groups a mean dose of i administered was similar in the two groups . The success rate of a single dose of i was significantly higher in patients without pretreatment than in patients who were pretreated with cmz (91.4% vs. 82.3%, p = 0.01) [figure 1]. The rate of hypothyroidism within the first 6 months after i therapy was significantly higher in patients without pretreatment (55.1% vs. 44.6%, p = 0.05). The rate of hypothyroidism between 6 months and 1-year after i therapy was not significantly different between the two groups (12.2% vs. 16.9%, p = 0.2). There was a trend for a higher cumulative rate of hypothyroidism at last follow - up in the drug - nave patients (78.1% vs. 69.7%), though it did not quite achieve the threshold for statistical significance (p = 0.08) [table 2]. There was also a nonsignificant trend for a shorter mean duration for the development of hypothyroidism in the drug - nave patients . Cumulative rates of hypothyroidism between 1 and 6 months and 6 and 12 months were 55.1% and 12.2% respectively . 13.3% of drug - nave patients and 12.8% of patients who had previously received atd before i were euthyroid at the last follow - up without the need for levothyroxine replacement . Comparison of rates of hypothyroidism and euthyroidism between the two groups (p <0.05, significant) comparison of outcome measures between the two groups our data demonstrate that male patients with graves hyperthyroidism pretreated with cmz have reduced efficacy with subsequent i therapy . Cumulative hypothyroidism and hypothyroidism within 6 months after i were also lower in them compared to patients who were not pretreated . Although radioiodine is considered a safe and effective treatment for gd, controversies remain on the optimal method for calculating the dose and the most appropriate dose regimen . Achieving long - term euthyroidism appears to be a futile objective and most series report high rates of cumulative hypothyroidism after i. our findings are in concurrence with these studies, with two - thirds of patients developing hypothyroidism within 1-year . In our study, cure rates of 6795% have been reported after different doses of i (512.3 mci) and studies employing higher doses (> 10 mci) have reported success rates between 86% and 95% . A study from south india reported a success rate of 95% with a fixed dose of 10 mci in gd . The results are comparable to a previous study of 58 patients that reported a success rate of 82% of a fixed dose of rai in patients on long - term cmz . Another study of 61 patients found a success rate of 80% in patients pretreated with mmi . A retrospective study in patients of gd on long - term ptu reported a success rate of 83% for i when ptu was stopped at least a week before i therapy and 71% when ptu was stopped for 47 days . A prospective study reported a success rate of 83% at 1-year in patients pretreated with cmz when it was stopped 3 days before i. simultaneous use of atd with rai has consistently been shown to result in lower efficacy and higher failure rate than treatment with rai alone . However, studies have demonstrated that pretreatment with atd leads to a higher failure rate even if the drugs are discontinued 47 days before rai therapy and not restarted posttherapy . This effect has been demonstrated consistently with ptu and studies on cmz / mmi yielded conflicting results . Hancock et al ., found that ptu discontinued 47 days before radioiodine dosing was associated with a significant increase in the failure rate of subsequent radioiodine therapy . Two other studies also reported that ptu pretreatment significantly reduced the efficacy of i therapy . Imseis et al ., found that ptu (but not mmi) may reduce the therapeutic efficacy of subsequent i when they were discontinued 555 days before radioiodine treatment . Goolden and fraser found equal cure rates from i with and without cmz pretreatment, when cmz was discontinued 35 days before i therapy . Two randomized controlled trials (rcts) reported that mmi pretreatment did nt interfere with the efficacy of i therapy . Another study found no interference of cmz treatment with the efficacy of i131 when it was discontinued 57 days before radioiodine therapy, but the success rate was much lower if it was simultaneously administered with i therapy . In another study, pretreatment with mmi reduced the efficacy of i only when it was administered on the day of i therapy . However, a few other studies have reported that cmz or mmi pretreatment reduces the efficacy of i. connell et al ., reported that cmz stopped 5 days before i reduced the rate of hypothyroidism at 1-year compared to nonpretreated patients . Atd, including cmz, given within 1-week after radioiodine treatment was found to reduce the efficacy of i131 in a retrospective study of 206 patients . A retrospective study of 360 patients with hyperthyroidism, with a follow - up range of 210 years, reported that atd, including both ptu and cmz pretreatment reduces the efficacy of radioiodine therapy . In that study, the response rate was significantly higher in the group without pretreatment (95%) as compared to patients with pretreatment (80.9%), much similar to the results of our study . Another retrospective study of 449 patients with hyperthyroidism using a 550mbq fixed dose regimen found that cmz pretreatment stopped 1-week before radioiodine therapy reduced the efficacy of radioiodine treatment . Finally, a meta - analysis of 14 rct reported that adjunctive atd, including cmz, were associated with an increased risk of treatment failure with i and reduced risk for hypothyroidism . Antithyroid drugs are used in the management of gd either as primary therapy for several months while awaiting remission of the disease or as pretreatment for several weeks prior to definitive rai therapy . Atd are believed to have a radioprotective effect and hence interfere with and reduce the efficacy of i therapy . Radio resistance conferred by thioureas as cmz does not have a sulfhydryl group, it was proposed that it confers no radioresistance . In many of the studies examining the effect of atd on i, ptu or cmz were used as pretreatment for several weeks before i and very few studies examined the effects of long - term atd used as a primary therapy for several months of gd . Our study results suggest that cmz pretreatment also reduces the efficacy of subsequent i like ptu . Although the success rate of i in patients pretreated with cmz noted in our study was similar to that reported in previous studies, we also found that cmz pretreatment reduced the efficacy of subsequent i unlike them . First, cmz was used for a longer duration in our patients than in many other studies . In a previous study, mmi given for more than 4 months before radioiodine therapy was shown to reduce the efficacy of subsequent i therapy . Second, the radioprotective effect could be gender divergent, and we studied only male patients . Male patients have been shown to have a significant poor response after i therapy as compared to female patients, and the response may be worse after pretreatment with atd . A mean dose of i in patients pretreated with atd was 8.7 mci that is lower than that used in many other studies . There is evidence to suggest that radio resistance - conferring effects of atd are more commonly seen at lower doses and radioprotective effect of atd can at least partly be overcome by increasing the dose of i. the merits of our study are a large number of patients and an uniform study group . A large prospective randomized control study is warranted to further clarify the effect of pretreatment with cmz on the efficacy of i therapy . Male patients with graves hyperthyroidism pretreated with cmz have lower efficacy with i therapy compared to nonpretreated patients.
|
Genomic islands (gis) are clusters of foreign genes acquired from nongenealogical organisms through horizontal gene transfer (hgt). Previous studies have elucidated some hgt mechanisms, including (i) transformation, (ii) conjugation, (iii) transduction, and (iv) gene transfer agent . The occurrences of hgt make considerable contribution to genome evolution, which is especially evident in pathogenic organisms or antibiotic resistant organisms [6, 7]. Such quantum - leap evolution can cause drastic changes to species, especially in bacteria, and shape the world where humans live [810]. Therefore, it is practically significant to explore origins of gis (i.e., donors of gis). Besides, the occurrence of hgt between highly divergent organisms has great impact on phylogenetics, which can disclose the evolutionary relationship of organisms . The acquired gis or biological features may contaminate the correctness of phylogenetic realtions therefore, exploring the origin donor of gis can also contribute to the analysis of genealogical phylogenetics . Some previous research works of constructing donor - recipient network based on individual genes have been carried out [11, 12], where the network is composed of a set of vertices (i.e., organisms) and edges, which connect vertices and reveal the occurrences of hgt between organisms . By studying the visualized networks, the researchers could uncover the hidden mechanisms of hgt such as genomic biases or barriers, dna repair bypasses, and eukaryotes origins and evolutions . While using individual genes for studying donor - recipient network can reveal the mechanisms of hgt to some degree, a hgt event usually occurs in a cluster of sequential genes instead of single genes separately . Therefore, it may not truly reflect the donor - recipient networks accurately if using single - gene - based analysis . Available gi detection tools these days make it possible to generate donor - recipient network based on gis . Current gi prediction tools can be grouped into three categories: (1) sequence composition based approach, (2) comparative genome analysis approach, and (3) integrative approach . The most representative signatures include g + c content, dinucleotide biases, codon usage, mobility genes (including transposases and integrases), and trna genes [14, 15]. Related tools using this kind of approach include alienhunter, centroid, gidetector, gihunter, pai ida, and sigi - hmm . Comparative genome approach uses the phylogenetically close species as reference genomes and identifies subsequences that are unique in the query genomes and treats them to be gis . The integrative approach uses the prediction results of the above programs to obtain census gis . The availability of these gi tools, thus, provides us with a chance to study donor - recipient relationship through gis . In this paper, we propose using gis to trace the origins of gis and study donor - recipient networks across organisms . To make our donor - recipient networks meaningful, we model edges as weighted, which can be represented by the number of gis that a donor genome contributes to a recipient genome . In a previous study, it was hypothesized that if a hgt happened between two organisms, a series of subsequent directional transfers should be very likely to arise . Therefore, it is reasonable to hypothesize that if two nongenealogical organisms harbor more occurrences of hgt, the more confident donor - recipient relationship is between them . In this study, we would also like to check whether donor - recipient relationship is random or biased . Previous studies have shown that hgt is not a random event but of preferences to occur . It has been found that hgt occurs among organisms which share similar factors such as genome size, genome g / c composition, carbon utilization, and oxygen tolerance ., we will describe the dataset and our computational framework in detail (it is freely available for noncommercial use at http://www5.esu.edu/cpsc/bioinfo/software/gidonor). In section 3, we will illustrate the usage of computational framework on three case studies and discuss our predicted results with visualized networks . Finally, we draw a conclusion in section 4 and discuss our possible future work . Genbank, an open - access resource which is established and maintained by the national center of biotechnology information (ncbi), houses all publicly available biological sequences such as genomic sequences and protein sequences . To trace gi donors, we collected all available prokaryotic nucleotide sequences from genbank, which covered 162 million sequences with 150 billion nucleotides bases in total . Genbank provides different data formats for feeding different programs . For local based blast search in our framework, this format is small in terms of size, so that it is convenient to download, and it can also be transformed into fasta format . For alienhunter, used for gi detection in our framework, we used fasta format . More specifically, we fed alienhunter with fasta nucleic acid files with the extension of essentially, our framework relies on two kinds of bioinformatics tools, sequence similarity search tool and gi prediction tool . We used blast as the sequence similarity tool since it is accurate and efficient in terms of computing time . We used sequence composition based gi tools for predicting gis in our framework because this kind of approach can be applied to any query genome sequence . By integrating multiple bioinformatics tools, our framework can process sequenced genomic data automatically and obtain final predicted donor organisms . The framework consists of five steps (also shown in figure 1), includingobtaining gis in a query genome with sigi - hmm;collecting initial candidate donor genomes by blast;predicting complete gi lists in candidate donor genomes using alienhunter;obtaining final donor genomes through overlapping;visualizing donor - recipient relationships.each step of our computational framework will be described in the following subsections . Obtaining gis in a query genome with sigi - hmm; collecting initial candidate donor genomes by blast; predicting complete gi lists in candidate donor genomes using alienhunter; obtaining final donor genomes through overlapping; visualizing donor - recipient relationships . Sigi - hmm, an open - source program, is based on genome composition analysis and is available for local installation, as well as web gui on islandviewer . Sigi - hmm first analyzes the codon usage of each gene, provides the score for each gene based on the codon usage, and thus can find alien genes based on codon usage scores . Because sigi - hmm produces the highest precision rate, guaranteeing the predicted gis to be true gis, we adopted it as the gi prediction tool in query genomes . Because islandviewer has provided predicted gis by the program of sigi - hmm, we took advantage of it and obtained predicted gis for any query genome from islandviewer . In order to automatically collect gis provided by islandviewer, we developed a perl script to send out query genome information to islandviewer's server and extract gi ranges from the islandviewer server . Blast is extensively used in sequence similarity measurement due to its efficient computation, high accuracy, and the availability of cross - platforms . Therefore, blast was incorporated into the framework for searching initial candidate donor genomes, which should contain genomic fragments similar to gi sequence in the query genomes . In blast, the cutoff value e is used to evaluate the similarity between genome sequences . In this study, we set e value of 10 as the cutoff to find our candidate donors . The blast output contains information of genome sequence alignments, alignment score, and e values, and such information can be processed systematically through open source of bioperl . Therefore, we wrote a perl script that uses bioperl modules to extract relevant information from blast outputs . The initial candidate donor genomes obtained by blast search may contain some false positive donors (i.e., the genome fragments similar to those gis in the query genome are also transferred from donor genomes); thus a filtering process should be conducted to remove such false positives and obtain final donor genomes . Theoretically, the final candidates should possess a characteristic; that is, the detected similar genomic fragments from blast should be original (in other words, they are not gis) in the corresponding hosts . In order to check whether such genomic fragments are original or not, we must use gi tools to check whether they are gis or not . We incorporated a gi tool alienhunter in our framework to extract a complete list of gis for all initial candidate donor genomes . We chose the alienhunter tool in this step because previous assessment study on available gi tools had shown that alienhunter possesses the highest recall rate, compared with other sequence compositions including sigi - hmm, islandpath, pai ida, and centroid . In other words, alienhunter can predict the most complete lists of gis in any candidate donor genome . This is very crucial because we can filter out more initial candidate donors and guarantee the final identified donors to true donors . In that sense, final donor genomes were obtained by filtering out initial candidate genomes (obtained from section 2.2.2), where genomic fragments similar to recipients of gis were also predicted as gis from section 2.2.3 . More formally, let a set {g, s, g} represent the information from previous steps, where g denotes the set of gis of a query genome obtained from sigi - hmm, s denotes the set of initial candidate donor genomes obtained from blast, and g denotes the set of gis on initial candidate genomes predicted from alienhunter . Furthermore, for each of them,(i)g = {gii 0}, (ii)s = {s(i, j)i, j 0}, (iii)g = {gi, j, 0}, where gi denotes the ith gi in query genome, s(i, j) denotes the jth initial candidate donor for potentially donating ith gi (gi) on query genome, and g denotes uth gi for a candidate donor (s(i, j)). G = {gi, j, 0}, for any given query genome, a list of final candidate donor genomes can be obtained by running the previous steps in our framework . In order to quantitatively visualize the number of donations from donors, we intended to produce a donor - recipient weighted network, where nodes denote donors and the recipient and the weights corresponding to edges are the number of hgt occurrences (i.e., quantified by the gi transfers) between two organisms . By looking at heavy weighted edges in networks therefore, we utilized it to generate the donor - recipient network in our framework . We have applied our computational framework on three bacterial cases, including donor prediction of mycobacterium tuberculosis h37rv, herminiimonas arsenicoxydans, and a hgt network establishment of three species in thermoanaerobacter (t. pseudethanolicus atcc 33223, t. tengcongensis, and t. strain x514). The possible hgt mechanisms of these species had been studied previously, and thus our predicted results could be investigated by comparing previous studies . Mycobacterium tuberculosis (m. tuberculosis) is a bacterial species that causes most cases of tuberculosis (tb). M. tuberculosis h37rv is the best characterized strain of m. tuberculosis and had been sequenced and analyzed biologically . Previous work that combined genome - wide parametric analysis showed that m. tuberculosis encompassed 48 gis, which consist of 4.5% of the genome (199 kb), and include 256 genes [35, 36]. Through applying our framework in m. tuberculosis h37rv, we hope to reveal the origins of gis and provide a complete list of gi donors to substantially enrich the information of mycobacterial pathogenicity . Figure 3 displays all predicted final candidate donors from our framework, where species with the same genus have been dyed with the same colors and positioned next to each other for better visualization . As shown in figure 3, the predicted donor genus which contributed the most is gordonia, followed by nocardia and rhodococcus in descending rank . The number of gis, in which each genus of donors contributed to the recipient h37rv, has been summarized in figure 4 . When comparing our predicted donors of h37rv's gis with the predicted potential donors from previous studies, we found that there are a lot of matching predictions . For instance, three donors with the highest donations, including gordonia, nocardia, and rhodococcus, were also detected as their potential origins of gis (figures 3 and 4). Besides, we also incorporated bradyrhizobium and corynebacterium into our final candidate donors . In addition, our framework has detected a new potential donor, bifidobacterium animalis, which has not been reported in previous studies . We strongly believe in this as one of the high potential donors since b. animalis resides in the body of most mammals including humans, which may interact with m. tuberculosis and transfer genes to m. tuberculosis . Herminiimonas arsenicoxydans (h. arsenicoxydans) is an arsenite - oxidizing bacterium that belongs to heterotrophic betaproteobacterium . It was isolated from heavy - contaminated sludge with arsenic and other heavy metals from industrial wastewater treatment plants . Under aerobic conditions, it can oxidize arsenite to arsenate and produce at least two arsenate reductases . It was revealed to be able to resist against numerous heavy metals such as se, mn, cr, cd, sb, and ni . All of those competences enable its widely ecological usage in arsenical polluted environment . A better understanding of h. arsenicoxydans can be beneficial for arsenical polluted remediation . Like previous network, species of the same genus have the same colors, and they are placed next to each other in the network . As we can see in the network of figure 5, janthinobacterium marseille (j. marseille) is a highly frequent donor (the occurrence of hgts is 11 times). Actually, j. marseille belongs to the order burkholderiales, which has been reported to be the major gene donation source for h. arsenicoxydans . Both our predicted results and previous studies strongly indicate that this is the donor for h. arsenicoxydans . We also notice that the number contributed by the genus of ralstonia is 16 times, which is also very significant . These findings strongly indicate that species in the burkholderiales order are major contributors to gis found in h. arsenicoxydans . Another noticeable gis contributor was from the pseudomonadales order (figures 5 and 6), which was also consistent with previous study . Therefore, we can conclude that the origins of gis in the genome of h. arsenicoxydans are from burkholderiales and pseudomonadales . Thermoanaerobacter is a genus that contains a cluster of thermophilic and anaerobic bacteria distributed in high - temperature surroundings like springs . They can absorb heat from surroundings as their source of energy to drive their metabolism . Therefore, it will be particularly interesting to study the adaptability of thermophile, examine the evolution path, and ultimately uncover the origins of such special features . A simplified directed network of donor - recipient relationship has been generated in previous work . The directed network was focused on three members of thermoanaerobacter, including t. pseudethanolicus strain atcc33223, t. tengcongensis, and t. strain x514 . We extended the previous network with more predicted donors as shown in figures 7 and 8 . As you can see, our directed network has expanded previously studied network on a basically consistent condition . For instance, we predicted one gi in t. strain x514 that originally belongs to clostridium thermocellum atcc 27405 . This is consistent with their predicted result even though they considered it as a mediator, which played an agent role in the transfer . We also detected seven gi transfers between t. pseudethanolicus strain atcc33223 and t. strain x514 and one gi transfer from t. pseudethanolicus strain atcc33223 to t. tengcongensis mb4 . Most noticeably, t. brockii finnii ako-1 was present as the donor for all three query genomes as shown in figure 5 . We hypothesize that t. brockii finnii ako-1 interacts with these three thermoanaerobacter species and may contribute heat - resistant related genes to these species . Hgt has provided organisms apportunities to obtain special features from foreign organisms . In order to reveal genetic sources of hgt, the predicted results in this study were consistent with previous studies, strongly indicating the correctness of our computational framework overall . In addition, our framework has also discovered some new donors not reported in previous studies, and further investigation of these new discoved donors indicates that they are possible donors in the biological and evolutionary perspective . While there is no standard benchmark to measure the accuracy of our framework, it should be noted that the accuracy of our framework depends on the performance of other prediction tools . On the one hand, on the other hand, we adopted sequence composition analysis tools, which is generally applicable to any sequenced query genome, but the prediction is not the most accurate one when compared to comparative genome analysis gi tools . For instance, a genome with a typic genome size will take about one hour to complete the entire process of gi search . Thus, for a query genome, it could generate dozens of initial candidate donor genomes, and thus it takes about a day and night to complete the whole process . In this study, we just studied three query genomes, for the purpose of testing the correctness of our computational framework . In the next stage, we will use a cluster of computers or superpower computers, to predict hgt donors for all sequenced bacterial and archaea genomes using our framework . We will build a large - scale donor - recipient network based on all the results . We believe that such kind of networks will reveal a panoramic view of gene transfer information across microbial organisms and provide some insights into evolutionary biologists to study genome evolution.
|
Fatty acids are hydrocarbon chains with a carboxyl group at one end and a methyl group at the other . The biological reactivity of fatty acids is defined by the length of the carbon chain and by both the number and position of any double bonds present . While saturated fatty acids do not contain double bonds within the acyl chain, unsaturated fatty acids contain at least one double bond . When two or more double bonds are present, unsaturated fatty acids are referred to as pufa . There are two families of pufa, and they are classified as omega-3 (n-3) and omega-6 (n-6) based on the location of the last double bond relative to the terminal methyl end of the molecule . Linoleic acid (la, c18:2n-6) (precursor to the n-6 series of fatty acids) and -linolenic acid (ala, c18:3n-3) (precursor to the n-3 series of fatty acids) are the simplest members of each family of pufa and are termed essential fatty acids as the body cannot synthesise these . Pufa regulate a wide variety of biological functions, depending on the location of the last double bond, which range from blood pressure and blood clotting to the correct development and functioning of the brain and nervous system . In addition, lipid mediators generated from long - chain (lc-) pufa (arachidonic acid (aa) in the n-6 series and eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) in the n-3 series) have important roles in immune regulation and inflammation . The main dietary sources of la include plant oils such as sunflower, safflower, and corn oils (table 1), but they are also present in cereals, animal fat, and wholegrain bread . Rich dietary sources of ala include green leafy vegetables, flaxseed, and rapeseed oils (table 1). Over the last few decades, extreme qualitative nutritional changes have taken place with increased levels of fatty acid consumption . Today, industrialised societies are characterised by an increase in saturated fat, omega 6 pufa, and trans fatty acid intake, as well as an overall decrease in omega-3 pufa intake . Fatty acids now represent 2842% of total energy consumed by european populations [4, 6], whereas, in ancestral nutrition, fatty acid consumption was only approximately 2030% of total energy [4, 7, 8]. As a result of the increased consumption of la - rich vegetable oils associated with the western diet, n-6 pufa consumption has become progressively much higher than that of n-3 pufa . Optimal dietary intakes of the n-6: n-3 ratio should be around 14: 1 . However, according to the nutritional changes described above in the western diet, this ratio has now increased to be within the range of 10: 1 to 20: 1 . In parallel, there are coinciding increases in the incidence of diseases involving inflammatory processes such as cardiovascular disease, obesity, ibd, rheumatoid arthritis, and cancer . A study carried out by hassan and hanachi, involving 984 iranian women, suggested that a good dietary pattern rich in fruits, legumes, vegetables, cereals, and fish, rich in n-3 pufa, can decrease the likelihood of developing the metabolic syndrome . Another study performed in france, involving 912 men, concluded that a low consumption of fish rich in n-3 pufa is associated with a higher probability of developing the metabolic syndrome . Thus, high intake of n-6 pufa, along with low intakes of n-3 pufa, shifts the physiological state to one that is proinflammatory and prothrombotic with increases in vasospasm, vasoconstriction, and blood viscosity and the development of diseases associated with these conditions . Pufa play an important role in the composition of all cell membranes where they maintain homeostasis for correct membrane protein function and influence membrane fluidity, thus regulating cell signalling processes, cellular functions and gene expression . Other functions of pufa require their metabolism to more highly unsaturated members of their family . For example, la is converted to aa (20:4n-6) via -linolenic acid (gla, 18:3n-6) and dihomo--linolenic acid (dgla, 20:3n-6). By the same set of enzymes, ala can be converted to epa (20:5n-3) and dha (22:6n-3). The primary site for pufa metabolism is the liver; however, it can also take place in various other tissues . It is these longer chain metabolites of la and ala that are of major clinical importance within different organs such as the brain, kidney, and liver [1517]. Cyclooxygenases (cox) and lipoxygenases (lox) can convert aa to the 2-series of prostaglandins, the 2-series of thromboxanes, and the 4-series of leukotrienes . These are very important, active and short - lived hormones termed eicosanoids which are involved in various pathological processes involving inflammatory conditions such as atherosclerosis, obesity, and ibd . Since pufa give rise to a variety of biologically active compounds which all have important roles in pathological and physiological processes, a proper understanding is needed regarding the contribution these active compounds have on the coinciding increases in inflammatory diseases seen with the disruption of the balance in the ratio of n-6: n-3 associated with the western diet . Linoleic acid can be metabolized to other more unsaturated, long - chain members of the n-6 family by the insertion of additional double bonds during consecutive elongation and desaturation mechanisms (figure 1). The initial rate limiting desaturation of la to gla is catalysed by the enzyme delta-6-desaturase (fads2). Elongation then takes place to convert gla to dgla, by elongation of very long - chain fatty acids (elovl) 5, and finally a cycle of elongation and desaturation by delta-5-desaturase (fads1) generates aa . The importance of the fads2 gene in lc - pufa synthesis has recently been demonstrated in mice [19, 22]. The first study by stoffel et al . Demonstrates that loss of the fads2 gene abolishes synthesis of lc - pufa with further downstream effects on the cox and lox pathways, eventually leading to hypogonadism and sterility of male and female mice . Further demonstrated by this fads2 null model was the pivotal role pufa - substituted phospholipids play in establishing cell polarity, shown here for tight junctions of sertoli cells of the testis and the gap junction network between ovarian follicle cells . Stroud et al . Demonstrated impairment of male reproduction and also both dermal and intestinal ulceration in fads2 null mice . Elongation of very long - chain fatty acids (elovl) 5 is one of seven mammalian fatty acid condensing enzymes involved in microsomal fatty acid elongation . Studies using liver microsomal protein from elovl5 null mice found greater tissue accumulation of gla and a decrease in the levels of downstream metabolism products such as aa for n-6 metabolism and dha for n-3 metabolism . The metabolic consequence of this reduction of aa and dha was the activation (or derepression) of sterol regulatory element - binding protein (srebp)-1c . Activation of this transcription factor (as will be discussed in further detail later) in elovl5 null mice resulted in the activation of further genes involved in fatty acid and triglyceride synthesis, which culminated in the development of hepatic steatosis . There are many other factors involved in the regulation of delta-5-desaturase and delta-6-desaturase enzyme activity . For example, decreased activity in both delta-5 and delta-6 desaturases have been demonstrated in the liver of obese nafld patients . Low delta-6-desaturase enzyme activity was reported in diabetic rats where insulin acts as a well - known delta-6-desaturase stimulator . Since la and ala are metabolized by the same set of enzymes, a natural competition exists between these two fatty acids, whereby delta-5-desaturase and delta-6-desaturase will exhibit affinity to metabolize n-3 over n-6 pufa, provided that they exist in a ratio of 1: 14 . However, the higher consumption of la, as now seen in the western diet, shows an increase in the preference of these enzymes to metabolize n-6 pufa, leading to aa synthesis, despite the fact that these enzymes show higher affinity for n-3 pufa . Supplementation of the diet with epa and dha has been shown to correct this imbalance by partially replacing aa from the cell membranes of platelets, erythrocytes, neutrophils, monocytes, and hepatocytes where aa is usually found in high proportions . The intermediates of pufa metabolism can either be incorporated into phospholipids or undergo further elongation / desaturation steps . In the n-6 pathway, aa, synthesized from the desaturation of dgla by delta-5-desaturase (fads1), can be further elongated by elovl2 to docosatetraenoic acid (c22:4n-6) or to its respective set of eicosanoids via cox and lox enzymes . The importance of elovl2-derived pufa in mammals has recently been demonstrated in elovl2-ablated mice, thus demonstrating the importance of this elongase enzyme . This study showed the role elovl2 plays in the elongation of c20 and c22 pufa in order to produce c24:4n-6 up to c30:5n-6 pufa in testis, where they are required for normal spermatogenesis and fertility . Binding of growth factors and hormones to membrane receptors leads to activation of phospholipase a2 which releases aa from the cell membrane where the free acid can become a substrate for eicosanoid biosynthesis through the activities of cox and lox . The eicosanoids derived from aa are synthesized in larger quantities than ever before due to increases in dietary intake . Eicosanoids are biologically active lipids and include prostaglandins (pgs), thromboxanes (txs), leukotrienes (lts), and hydroxyeicosatetraenoic acids (hetes) which have all been implicated in various pathological processes such as inflammation and cancer (table 2). When they are present in high quantities, they influence various metabolic activities besides inflammation such as platelet aggregation, haemorrhage, vasoconstriction, and vasodilation . In general, aa - derived eicosanoids are proinflammatory but they have important homeostatic functions in regulating both the promotion and resolution of inflammation in the immune response . In contrast, it is known that the n-3 pufa and their lc - derivatives mostly promote anti - inflammatory activities . In a recent study involving 250 clinically stable, chronic obstructive pulmonary disease (copd) patients, higher intakes of n-3 pufa were associated with lower proinflammatory cytokine concentrations (e.g., tumour necrosis factor alpha (tnf)) while higher n-6 pufa intake was associated with higher proinflammatory interleukin-6 (il-6) and c - reactive protein (crp) concentrations in the diseased state . While copd is a complex chronic inflammatory condition, it is interesting to see the association between dietary intake of n-6 versus n-3 pufa on serum inflammatory markers associated with the disease . Despite ample evidence that increased dietary consumption of n-6 pufa induces a proinflammatory response in the host, it must be reported that recent studies have also shown the opposite [34, 35]. A recent review has suggested that n-6 pufa have some anti - inflammatory actions such as those of the n-3 pufa . For example, mean serum crp concentrations tended to decrease with increased n-6 pufa consumption in both japanese men and women . Nevertheless, evidence of these associations is limited . Metabolism of aa by the cox enzymes (cox-1, a constitutive enzyme, or cox-2, an inducible enzyme) leads to the synthesis of the 2-series of prostaglandins: pge2, pgi2, pgd2, and pgf2 (largely produced by monocytes and macrophages) and thromboxanes a2 and b2 . The synthesis of aa - derived eicosanoids is, however, dependent on the concentration of dgla, as dgla competes with aa for cox and lox . When dgla is in excess, it inhibits the synthesis of aa - derived eicosanoids due to its higher affinity for the cox and lox enzymes . The activity of 5-lox metabolises aa to hydroxyl and hydroperoxy derivatives: 5-hete and 5-hydro - peroxyeicosatetraenoic acid (5-hpete). These derivatives in turn produce the 4-series of leukotrienes: leukotriene a4 (lta4), leukotriene b4 (ltb4), leukotriene c4 (ltc4), leukotriene d4 (ltd4), and leukotriene e4 (lte4). Monocytes, macrophages, and neutrophils produce ltb4, while mast cells, eosinophils and basophils produce ltc4, ltd4, and lte4 . For example, pgi2 and pge2 exert their acute inflammatory response in arthritis [42, 43]. Pge2 can also increase its own synthesis through induction of cox-2 leading to the production of the proinflammatory cytokine il-6 in macrophages [41, 44]. Ltb4 has many proinflammatory functions, acting as an important activator of neutrophils, a chemotactic agent for leukocytes, induces release of lysosomal enzymes, accelerates reactive oxygen species (ros) production, and increases vascular permeability . Ltb4 also leads to the production of inflammatory cytokines like tnf-, interleukin 1 beta (il-1) and il-6 by macrophages . However, the overall pathophysiological outcome will depend on the cells present, the nature of the stimulus, the timing of eicosanoid generation, the concentrations of different eicosanoids generated, and the sensitivity of target cells and tissues to the eicosanoids generated . In contrast, epa can also act as a substrate for cox and lox enzymes and gives rise to an entirely different set of eicosanoids (table 2). These are the 3-series prostaglandins and thromboxanes and the 5-series leukotrienes, which are considered to be less inflammatory or even anti - inflammatory in comparison to the eicosanoid family derived from aa . The mode by which prostaglandins and leukotrienes exert their biological homeostatic and inflammatory actions depends on binding to their respective g - protein coupled receptors (gpcrs). Specific gpcrs have been identified for all the prostanoids, where there are at least nine known prostanoid receptor forms in mouse and man [47, 48]. Although most of the prostaglandin gpcrs are localised at the plasma membrane of platelets, vascular smooth muscle cells, and mast cells, some are situated at the nuclear envelope . Four of these receptor subtypes bind pge2 (ep1ep4), two bind pgd2 (dp1 and dp2), and more specific receptors bind pgf2, pgi2, and txa2 (fp, ip, and tp, resp . ). Pge2 and pgi2 are the predominant proinflammatory prostanoids, and, through their activation of ep2 and ip, respectively, they can increase vascular permeability and leukocyte infiltration . In individuals with asthma, thus, during asthmatic attacks in humans, pgd2 is released in large amounts by mast cells . Pgd2 can also promote inflammation via dp2 through activation of eosinophils [47, 51]. Interacts with btl1 and btl2 through which important roles in host defence of cells and inflammation are mediated . Ltb4 induces leukocyte infiltration and as already mentioned above leads to the release of proinflammatory cytokines . As an example, in patients with ibd, the colonic mucosa contains 3- to 7-fold higher counts of cells expressing the 5-lox pathway, thus increasing the tissue synthesis of ltb4 . Ltc4 and ltd4 can contract smooth muscle by interacting with two subtypes of cysteinyl leukotriene receptors, cyslt1 and cyslt2 . A mechanism has been proposed whereby a coordinated program for resolution initiates in the first few hours after the inflammatory response . A switch occurs whereby the aa - derived prostanoids and leukotrienes, which have set the inflammatory response to begin, undergo further metabolism to become another generation of eicosanoids derived from aa termed lipoxins and hence terminate inflammation at the local contained sites . Since these lipoxins are involved in the resolution of the acute inflammation that occurs as a result of the overproduction of the proinflammatory eicosanoids derived from aa, they are said to have pro - resolving and anti - inflammatory functions . These events coincide with the biosynthesis of resolvins and protectins from n-3 fatty acids, which act to shorten the period of neutrophil infiltration . However, while the initial response of the aa - derived eicosanoids to promote inflammation is beneficial in one respect, for example, in the control of blood flow and vessel dilation, the increase in the ratio of n-6: n-3 pufa leads to an overall increase in the production of proinflammatory cytokines and an unnecessary over reactive inflammatory response leading to the pathogenesis of inflammatory diseases . In addition, the decrease in consumption of n-3 pufa which leads to an overall decrease in resolvin and protectin production is detrimental to the inflammatory response as these products, which have the ability to dominate the resolution phase of inflammation, can no longer exert this potential; thus, the inflammatory response cannot be terminated effectively . Nuclear receptors are a family of ligand - activated transcription factors that either directly or indirectly control various genes of lipid metabolism and inflammatory signalling . Upon ligand binding, nuclear receptors can undergo conformational changes which dissociate corepressors and facilitate recruitment of coactivator proteins to enable transcription activation [21, 56]. Lc - pufa and their eicosanoid derivatives can act as ligands for these transcription factors and hence elicit changes in gene expression by governing the activity of nuclear transcription factors . The regulation of gene expression by dietary fats is believed to be one of the greatest factors impacting on the development of certain diseases of affluence related to the metabolic syndrome, such as hepatic steatosis and nafld . The peroxisome proliferator - activated receptor (ppar) family is composed of three proteins: ppar, ppar/, and ppar, and, although they each have different tissue distributions, their biological functions overlap . The ppars have emerged as important regulators of metabolic and inflammatory signalling, in both metabolic disease and immunity . The role ppar plays in the regulation of genes involved in lipid metabolism was first identified in the early 1990s, on the basis of being a target of the hypolipidaemic fibrate drugs and other compounds that induce peroxisome proliferation in rodents [57, 58]. Pufa, especially those of the n-3 family and their eicosanoid derivatives, are ligands for the ppars . The n-3 fatty acids epa and dha have been shown to be more potent as in vivo activators of ppar than the n-6 fatty acids [5962]. Once ppars become activated, they form heterodimers with the retinoid x receptor (rxr) and these dimers then bind to ppar responsive elements (ppres) in target genes to alter coactivator / corepressor dynamics and induce transcription . Ppar has recently been shown to exert hypolipidaemic effects through activation of skeletal muscle, cardiac and hepatic genes encoding proteins which are involved in lipid oxidation [6365]. Thus, the ppars, particularly ppar, play an important role in insulin sensitization, atherosclerosis, and metabolic diseases . In the regulation of inflammatory signalling, nfb, another transcription factor regulated by pufa, is found in almost all animal cell types, has a crucial role in inflammatory signalling pathways, and plays a key role in regulating the immune response to infection . It controls several cytokines (e.g., il-1, il-2, il-6, il-12, and tnf-), chemokines (e.g., il-8, monocyte chemoattractant protein-1), adhesion molecules, and inducible effector enzymes (e.g., inducible nitric oxide synthase and cox-2). Nfb becomes activated as a result of a signalling cascade triggered by extracellular inflammatory stimuli (such as free radicals, bacterial or viral antigens), which involves phosphorylation of an inhibitory subunit of nfb (ib), which in turn allows the translocation of the remaining nfb dimer to the nucleus, with the result of an increase in expression of inflammatory genes . Since the n-3 lc - pufa show anti - inflammatory action, they inhibit nfb activity . As an example, both epa and dha have been shown to block the activity of nfb through decreased degradation of ib, in human monocytes and human thp-1 monocyte - derived macrophages [67, 68]. However, this effect is not observed to the same extent with n-6 lc - pufa, due to potency in the inhibition of nfb . Interestingly, 5-lox, the enzyme which converts aa to the 4-series leukotrienes and 5-hete, translocates into the nucleus in association with nfb [70, 71]. Srebp-1c is a transcription factor required for the insulin - mediated induction of hepatic fatty acid and triglyceride synthesis . Responsive targets in mammalian cells include genes of fatty acid metabolism, such as fatty acid synthase (fas), and its expression is most commonly found in high levels in macrophages, liver, white adipose tissue, adrenal glands, and the brain of both mice and humans . For example, n-3 lc - pufa have been shown to suppress srebp-1c gene expression and so inhibit transcription of lipogenic and hepatic genes involved in lipid biosynthesis [73, 74]. Studies have shown that a decrease in hepatic srebp-1c leads to a decrease in hepatic fas, thus lowering lipid accumulation within the liver [7577]. However, the n-3 pufa are more potent inhibitors of srebp-1c, than the n-6 pufa, and this will be discussed in more detail further on . More recently, the liver x receptors (lxr- and -) have been shown to play a major role in lipogenesis through regulation of transcription of the gene encoding srebp-1c . This study concluded that the downregulation of srebp-1c transcription by n-3 pufa results from attenuated transactivation of the ligand - activated nuclear receptor lxr- . A more recent study in mice fed an n-3 pufa depleted diet showed increased activation of srebp-1c and related pathways which was consistent with increased lxr activity, thus highlighting the importance of n-3 pufa depletion related to lipid accumulation in the liver however, in another study by pawar et al ., fish oil fed rats showed a suppression of hepatic srebp-1c target genes, but no change in expression of genes directly regulated by lxr . Inhibition of lxr may also be an indirect effect of pufa stimulation of ppar transcription factors . Cross - talk between ppar and lxr via srebp-1c has been reported, whereby overexpression of ppar inhibited lxr - induced srebp-1c promoter activity, through a reduction of lxr binding to its activator, rxr . Both n-6 and n-3 however, it is well known that n-3 pufa are more potent ligands to these nuclear receptors than n-6 pufa . Through n-3 pufa - mediated activation of ppar and inhibition of srebp-1c, lipid biosynthesis can be reduced and lipid degradation can be increased [21, 29]. By targeting the transcription of various nuclear receptors involved in regulating lipogenic gene expression through dietary fatty acids, prevention of certain diseases related to the metabolic syndrome, such as hepatic steatosis and nafld, can be reduced in the future . The contribution n-6 pufa make to the development of liver disease due to the increased consumption of la - rich foods and the decreased consumption of ala rich foods is phenomenal and will be discussed in further detail . Already discussed are the positive contributions of n-3 pufa in the prevention of lipid biosynthesis in various organs, such as the liver, for example, through the activation of ppar and inhibition of nfb and srebp-1c . However, since these n-3 pufa are more potent ligands for these nuclear receptors and western diets overall consumption of n-6: n-3 has increased dramatically over the last 50 years in particular, what now becomes the fate of the these nuclear receptors and how have our dietary changes impacted upon our health status through regulation of inflammatory gene expression? More importantly, determination of the molecular and cellular mechanisms regulated by pufa may help identify novel sites for pharmacological intervention . Clinical studies indicate that inflammation is at the base of many diseases including nafld, cardiovascular disease, atherosclerosis, ibd, and neurodegenerative diseases such as ad (figure 2). The contribution of n-6 pufa to these inflammatory conditions will be reviewed below with a particular focus on nafld . Nafld is often described as the hepatic component of the metabolic syndrome and is rapidly becoming a serious public health problem . The range of liver damage associated with nafld begins with steatosis and can often persist to further steatohepatitis (nash), advanced fibrosis and cirrhosis . Occurrence of nafld is much higher in subgroups of the population with obesity, metabolic syndrome, and type 2 diabetes, whereby prevalence in developing the disease for those with type 2 diabetes may be as high as 70% [82, 83]. Both nutritional factors and alterations in lipid metabolism of the liver are the primary metabolic abnormalities which lead to hepatic steatosis . The role of n-3 lc - pufa as a potential therapeutic target in the pathogenesis of nafld has recently been demonstrated . Within the liver, n-3 lc - pufa presence is associated with an increased ability to direct fatty acids away from triacylglycerol storage and to enhance their oxidation . However, n-3 lc - pufa levels are decreased in the hepatic tissue of patients with nafld [86, 87]. Depletion of n-3 lc - pufa within the livers of nafld patients is a major problem as liver fatty acids now become directed away from oxidation and secretion and instead towards triacylglycerol storage . In addition, a higher n-6: n-3 lc - pufa ratio within the liver of nafld patients may contribute to the development of fatty liver due to a derangement in the capacity to regulate liver lipid metabolism . A recent comparative review also demonstrated various mechanisms through which consumption of fish oil has been beneficial in the alleviation of nafld such as (i) decreased plasma nonesterified fatty acids (nefa) concentrations; (ii) decreased de novo lipogenesis, very low - density lipoprotein (vldl) export, and plasma triglyceride concentrations; (iii) decreased adipocyte size and visceral fat content . The mechanisms which lead to the development of fatty liver, such as impaired fatty acid oxidation and increased de novo fatty acid synthesis, are regulated by hepatic gene transcription . N-3 lc - pufa regulate lipid metabolism in the liver by acting as ligand activators of the transcription factor ppar. Activation of ppar results in the upregulation of genes which are involved in fatty acid and lipid metabolism and which stimulate fatty acid oxidation [17, 89]. In two separate studies employing murine models of nash, administration of a ppar agonist prevented steatohepatitis and reversed the established disease [90, 91]. Vldl is a type of lipoprotein made by the liver from triglycerides, cholesterols, and apolipoproteins . Within the bloodstream, vldl transports cholesterol from the liver, thus enabling fats to move within the bloodstream, and it is here that vldl itself also acts as a precursor to low - density lipoprotein (ldl), often referred to as bad cholesterol . Ppar activation increases the secretion of apoliopoprotein b-100 (apo b-100), which is the main structural protein of vldl, and upregulates the expression of liver fatty acid binding protein (lfabp) which is essential for the secretion of apo b-100 [92, 93]. Since n-3 lc - pufa upregulate ppar, hepatic fatty acid oxidation has the potential to occur within the liver, and, since more apo b-100 is secreted out of the liver, less vldl is synthesized, with the result of less of this harmful cholesterol entering the bloodstream, where the downstream further effects on the development of atherosclerosis are attenuated . However, with the reduced availability of n-3 lc - pufa from dietary intake and the increases in n-6 pufa consumption, ppar does not become activated to its full potential . This results in pufa favouring fatty acid and triglyceride synthesis over fatty acid degradation . As demonstrated by ppar mice, rates in their ability to oxidise fatty acids are decreased during periods of food deprivation; thus, they develop characteristics of adult - onset diabetes including fatty livers, elevated blood triglyceride concentrations, and hyperglycemia . N-3 lc - pufa are also involved in the negative regulation of the transcription factor srebp-1c within the liver, thus acting as inhibitors in the expression of lipogenic genes such as fas . The effect n-3 lc - pufa have on srebp-1c is to reduce endogenous lipid production and accumulation of triglycerides in the liver, and this is achieved by reducing the amount of mature srebp-1c available for de novo lipogenesis within the nucleus . Therefore, depletion of n-3 lc - pufa and an increase in the ratio of n-6: n-3 lc - pufa in the liver of nafld patients results in fatty acid and triacylglycerol synthesis over oxidation, again leading to fatty liver . A recent study by pachikian et al . Using mice fed a depleted n-3 pufa diet showed increases in hepatic activation of srebp-1c leading to increased lipogenesis, contributing to hepatic steatosis . This is consistent with a previous study in rats fed an n-3 pufa - depleted diet whereby hepatic accumulation of triglycerides and esterified cholesterol led to both macro - and microvesicular steatosis caused by changes in the fatty acid pattern that resulted from n-3 pufa depletion . Another mechanism involved in the depletion of n-3 lc - pufa from the liver of obese nafld patients and which further exacerbates the disease progression is the decreased liver fatty acid delta-5 and delta-6 activity in these patients . Impairment of these enzymes affects the desaturation and elongation pathways of la and ala, which are required for the synthesis of their lc - pufa derivatives within the liver . Decreased activity in both delta-5 and delta-6 desaturases has been demonstrated in the liver of obese nafld patients . This may be attributed to the lower intake of ala (n-3 precursor), the imbalance in the n-6: n-3 lc - pufa ratio which occurs in the liver and higher consumption of trans isomers (18: 1, n-9 trans) inhibiting delta-6 desaturase . The depletion of n-3 lc - pufa within the liver of these patients resulting from the decrease in delta-5 and delta-6 desaturase activity may lead to further development of steatosis by altering the activity of ppar and srebp-1c . This will determine a metabolic imbalance favouring lipogenesis over fatty acid oxidation since n-3 lc - pufa depletion induces srebp-1c expression and upregulation of lipogenic genes . In general, it is also understood that the adipose tissue acts as a suitable biomarker for dietary fatty acid intake . Considering that in nafld, there is an enhancement in n-6 adipose tissue content and a significant decrease in n-3 adipose tissue content, this suggests that while there is an adequate amount of n-6 fatty acids for metabolism within the liver, n-3 fatty acids cannot be metabolized to the same extent due to inadequate dietary intake . Also, decreased dietary intake of n-3 pufa constitutes a limiting factor for the production of n-3 lc - pufa in liver lipids of nafld patients, resulting from the competition between the two metabolic pathways (figure 1), particularly at the desaturation steps thus, a dietary imbalance comprising inadequate intake of n-3 pufa and an excess intake of n-6 pufa leads to defective desaturation of pufa . Oxidative stress caused by the accumulation of liver triglycerides and insulin resistance are major contributors in the pathogenesis of nafld . Both oxidative stress and mitochondrial dysfunction are often associated with the increased production of ros and proinflammatory cytokines related to nafld . Recent human studies have described a strong association between the severity of nash and the degree of oxidative stress [100102]. The increased prooxidant activity associated with oxidative stress leads to elevation in hepatic lipid peroxidation status . Lipid peroxidation can also cause immunological dysfunction, which could lead to the development of hepatic fibrogenesis . This could potentially lead to an increase in the release of 4-hydroxy-20-nonenal (hne), which can bind hepatocyte proteins forming new antigens and therefore provoking a harmful immunological response . For example, seki et al . Reported a correlation between hepatic expression of hne and the degree of severity of necroinflammation and fibrosis . Oxidative stress associated with nafld has also been shown to increase production of proinflammatory cytokines . This hepatotoxicity associated with the production of inflammatory cytokines induced through oxidative stress may indirectly activate transcription factors such as nfb . The accumulation of nefas within hepatocytes of nafld patients is another source of nfb activation . Oxidative stress and changes in dietary intake trends may contribute to low hepatic lc - pufa . The increase in lipid peroxidation associated with nafld, as discussed, may contribute to the decrease in lc - pufa, as they are particularly susceptible to lipid peroxidation [105, 106]. Thus, oxidative stress - dependent lipid peroxidation may represent an alternative mechanism to liver n-3 lc - pufa depletion in nafld; since pufa are more susceptible to peroxidation and the greater availability of n-6 lc - pufa in the livers of nafld patients results in enhanced peroxidation of these la derived lc - pufa into their eicosanoid derivatives . For example, ltb4, an aa - derived eicosanoid, is involved in acceleration of ros production . The increased production of proinflammatory cytokines and eicosanoids, produced from n-6 pufa metabolism, cause enhanced liver kupffer cell production of inflammatory cytokines causing activation of nfb, further exacerbating systemic and hepatic insulin resistance with worsening inflammation and fibrosis . Insulin resistance as seen in nafld may be related to the depletion in n-3 lc - pufa because they are expected to modify membrane - mediated processes such as insulin signalling . In summary, the depletion of n-3 lc - pufa, the decrease in the ratio of product / precursors of lc - pufa, the increase in n-6 pufa, and the increase in n-6 lc - pufa derived eicosanoid production within the liver all contribute to the development of nafld and related pathophysiologies such as insulin resistance . Recently, the relationship between the n-6: n-3 pufa ratio within the liver and severity of steatosis was demonstrated . In this study, patients with nafld showed significant correlation between the n-6: n-3 pufa ratio and the quantity of hepatic triglycerides, as a marker of the severity of hepatic steatosis . Defective desaturation of pufa due to inadequate intake of n-3 pufa, and a higher intake of n-6 pufa further enhances the contribution of desaturase inhibition in nafld . Characterised by low - grade arterial inflammatory lesions that can mature along with disease progression . It is the underlying cause of coronary heart disease (chd), and abnormalities in the metabolism of essential fatty acids that are characteristic of the associated risk factors . Under normal physiological conditions, healthy endothelial cells synthesise and release adequate amounts of no, pgi2, and pge1, maintaining a downstream balance between pro- and anti - inflammatory molecules . However, in atherosclerosis, this balance becomes disrupted, leaning towards an increase in the production of proinflammatory cytokines such as il-1, il-2, il-6 and tnf-, resulting in the further progression of the disease . These proinflammatory cytokines can induce oxidative stress by enhancing the production of ros by monocytes, macrophages, and leukocytes . Since pufa and their eicosanoid derivatives modulate inflammation, they play a significant role in this disease . Decreases in ala - derived lc - pufa such as epa and dha seen in endothelial cell pufa deficiency, increases the production of proinflammatory cytokines and free radicals which results in the development of insulin resistance . As an example, early studies in greenland eskimos, a population consuming a high - fat diet, but rich in n-3 pufa, showed that ingestion of epa and dha led to decreases in the mortality rate from cvd . Similarly, japanese populations eat more fish than north americans and present a lower rate of acute myocardial infarction and atherosclerosis [112, 113]. Other later studies have further demonstrated strong associations between n-3 pufa intake and decreased risks of cvd [114116]. The role of n-6 pufa in cvd is much more complex than the role of n-3 pufa . Studies have shown that txa2 promotes the initiation and progression of atherosclerosis by regulating platelet activation and leukocyte - endothelial cell interactions . Ltb4 acts as a potent chemotactic agent, inducing the generation of ros, activating neutrophils, and inducing the aggregation and adhesion of leukocytes to the vascular endothelium . Since aa is derived from la, a reduction of la intakes will reduce tissue aa content, which in turn will reduce any inflammatory potential and therefore lower the risk for cvd . Endothelial dysfunction (ed) is a characteristic of early - state atherosclerosis common in patients with insulin resistance and diabetes . A recent review by simopoulos reported that diets enriched in la increase the la content of ldl and its susceptibility to oxidation, whereby oxidative modification increases the atherogenicity of ldl cholesterol . Studies have also shown that in patients with type 2 diabetes susceptible of developing ed, there are substantial increases in la concentrations in all ldl subfractions . Cellular oxidative stress associated with la oxidation of ldl and la mediated ed is a critical signal transduction pathway involved in nfb activation, whereby nfb is critical for the expression of inflammatory genes associated with ed . The susceptibility of ldl to oxidation by la and its associated metabolites is linked to the severity of coronary atherosclerosis development [121, 123]. Despite the evidence to suggest that n-6 pufa consumption increases the risk of developing cvd, recent evidence has suggested that both la and ala have the ability to prevent cvd . In this study, la significantly reduced levels of crp, an inflammatory marker, upregulated in cvd in japanese men . However, other evidence to suggest that n-6 pufa have an anti - inflammatory effect when consumed in such high quantities, such as that seen in the western diet, is limited . Since it has been proposed that diets high in la reduce ala metabolism and since ala metabolites such as epa / dha have been shown to reduce mortality rates from cvd [111113], the balance of n-6 to n-3 pufa is important in the prevention of atherosclerosis and cvd . Ibd is classified as a group of chronic systemically natured diseases of unclear pathology which cause inflammation of the digestive tract, including crohn's disease (cd) and ulcerative colitis (uc). While environmental factors indeed play a significant role in the etiology of the disease, more recent attention has been placed on various dietary and nutritional factors, specifically the lipid components of the diet as triggers of ibd [125, 126]. It is difficult to suggest that dietary influences or supplementation can reduce the incidence of ibd or impact beneficially (through anti - inflammatory effects) upon the disease progression since, like many chronic diseases, ibd is multifactorial . Despite this, lower prevalence of ibd has been observed with consumption of diets rich in n-3 lc - pufa derived from fish oils, such as that seen of the greenland eskimos [127, 128]. It has also been reported that patients of ibd who supplement their diets with n-3 pufa show anti - inflammatory actions, with decreased production of ltb4 by neutrophils and colonic mucosa, resulting from incorporation of the n-3 pufa into the gut mucosal tissue [129, 130]. A recent study using il-10 knockout mice (mice that spontaneously develop colitis) demonstrated significantly reduced colonic inflammation when fed n-3 pufa - rich fish oil as compared with mice that were fed n-6 pufa - rich corn oil . In japan, increased reports in the incidence of ibd correlate with the increased dietary intake of n-6 pufa [132, 133]. Importantly, while n-3 pufa show decreased production of ltb4 by neutrophils and colonic mucosa [129, 130], metabolism of aa increases the production of ltb4 within the inflamed intestinal mucosa of ibd . A more recent report demonstrated abnormal prevalence of the enzymes that coordinate to generate ltb4 from membrane - derived aa in active ibd biopsies . The recruitment of neutrophils and other leukocytes to the ibd gut mucosa seen with colonic injury may be a direct result of the increased ability to generate ltb4 from aa . It is clear from the literature that n-3 pufa have a positive effect on reducing the risk of ibd [135137]. The situation is less clear for n-6 pufa, although the proinflammatory eicosanoids derived from aa have been shown to play a crucial role in the pathogenesis of all these related inflammatory disorders . As n-3 pufa have been shown to alleviate the progression of ibd, while n-6 pufa have been implicated in the origin of ibd, the importance of a balance in the ratio of n-6: n-3 pufa in today's dietary regime is highlighted . Rheumatoid arthritis is a long - term disease that leads to inflammation of the joints and surrounding tissues, causing pain, swelling, and impaired function . It is characterised by infiltration of t - lymphocytes, macrophages, and plasma cells into the synovium, with the initiation of a chronic inflammatory state that involves the overproduction of proinflammatory cytokines . Studies have shown that aa - derived eicosanoids, pge2, and pgi2 play a role in the pathogenesis of rheumatoid arthritis [42, 139]. Pgi receptor - deficient (ip) mice subjected to collagen - induced arthritis (cia) showed a significant reduction in arthritic scores and reduction in il-1 and il-6 levels in the arthritic paws . Inhibition of both pge receptors (ep2 and ep4) suppressed inflammatory events and arthritis in cia . Supplementation with n-3 pufa has been demonstrated to modulate the activity of inflammatory factors that cause cartilage destruction during arthritis [138, 140]. Moreover, decreasing n-6 pufa intake (especially aa) down to less than 90 mg / day through an anti - inflammatory lactovegetarian (versus normal western) diet was shown to improve the clinical symptoms associated with rheumatoid arthritis . Ad is the most common form of dementia in the elderly, clinically characterised by memory dysfunction, loss of lexical access, spatial and temporal disorientation, and impaired judgement . The pathogenesis of ad is extremely complex, with genetic factors, education, and lifestyle all playing crucial roles in disease onset . However, a poor understanding of the pathogenesis of ad means that there are no curative treatments yet available . Recently, much interest has been shown in the role of diet in both the pathogenesis and prevention of this disease . The role of n-6 pufa and oxidised eicosanoid derivatives of n-6 pufa have recently been reviewed as contributing to -amyloid deposition, a hallmark of ad onset and progression [142, 143]. Aa is distributed in several different cell types in both the grey and white matter in the brain . The role aa plays in oxidative stress and lipid peroxidation has already been discussed in relation to nafld; however, oxidative stress and production of ros has also been suggested to play a role in ad, thus suggesting a role of aa and lipid oxidation products (eicosanoids) in the onset and progression of the disease [144, 145]. Furthermore, the enhanced consumption of n-6 pufa leads to an excessive production of the proinflammatory cytokines derived from aa through cox and lox enzymatic activity which lead to brain damage [146, 147]. As an example, a study using transgenic mice with memory impairment and -amyloid deposition, fed a diet poor in n-3 pufa but rich in n-6 pufa, showed that they were found to have a significant decrease in the postsynaptic receptor complex in the brain which regulates memory and learning and a net potentiation of programmed cell death . Studies have shown that dha provides support to learning and memory events in animal models of ad and protection against the disease [149151]. Another recent epidemiological study indicated a relationship between higher fish consumption and improved cognitive function in later life . Both dha and epa have been shown to competitively counteract the production of proinflammatory eicosanoids derived from n-6 pufa in the brain of ad patients . The neuroprotective role of epa has been demonstrated since epa competes with aa for incorporation into cell membrane phospholipids and for oxidation by the cox enzyme, thus exerting anti - inflammatory actions . The resulting production of anti - inflammatory pge3 might result in decreased levels of proinflammatory pge2 . The balance between the n-6: n-3 pufa ratio may therefore play a crucial role in the onset of ad . A recent study showed that a lower n-6: n-3 pufa ratio was associated with a lower incidence of dementia, especially in depressed patients . Furthermore, we have previously demonstrated in patients with major depression, increases in plasma aa and il-6 associated with inflammation . Therefore, a dietary pattern consisting of lower n-6 pufa and higher n-3 pufa or a more balanced n-6: n-3 pufa ratio may be therapeutic in the pathogenesis of ad . Increases in the ratio of n-6: n-3 pufa, characteristic of the western diet, could potentiate inflammatory processes and consequently predispose to or exacerbate many inflammatory diseases . The change in ratio and increase in n-6 pufa consumption change the production of important mediators and regulators of inflammation and immune responses towards a proinflammatory profile . Chronic conditions such as cvd, diabetes, obesity, rheumatoid arthritis, and ibd are all associated with increased production of pge2, ltb4, txa2, il-1, il-6, and tnf-, whereby the production of these factors increases with increased dietary intake of n-6 pufa and decreased dietary intake of n-3 pufa . In conclusion, the unbalanced dietary consumption of n-6: n-3 pufa is detrimental to human health, and so the impact of dietary supplementation with n-3 pufa upon the alleviation of inflammatory diseases, more specifically, nafld needs to be more thoroughly investigated.
|
Myeloid sarcoma (ms) are solid tumours composed of immature myeloid cells involving an extramedullary site . These tumours are also named chloroma in view of their green coloration due to high myeloperoxydase content . Ms occurs mainly in patients with known acute myeloid leukaemia (aml), myeloproliferative disorder or myelodysplastic syndrome [1, 2]. In few cases, ms may be the presenting feature of aml, and the most common sites of involvement are bones, soft tissue, lymph nodes, skin, gastrointestinal tract and body cavities . Presentations in the female genital tract (fgt) are uncommon . Radioiodine (i) is used in the treatment of thyroid cancer in order to eliminate residual thyroid tissue following total thyroidectomy and to treat metastatic disease [3, 4]. It is known that ionizing radiations, including i, are highly effective in producing chromosomal aberrations that sometimes are linked to the occurrence of secondary leukaemia . Aml is an uncommon complication of exposure to i, occurring mostly after a cumulative dose higher than 800 mci [3, 5]. Although cases of patients developing leukaemia after low - dose radioactive iodine are reported, the link with the treatment is still a matter of debate . We report a case of acute myeloid leukaemia revealed by a ms of the uterine cervix in a 48-year - old woman, 17 months after receiving a total dose of 100 mci i for papillary thyroid cancer . A 48-year - old woman, gravida 3, para 3, was referred to our unit in april 2007 for a large uterine cervical mass detected during an intrauterine device change . Her medical history was marked by a total thyroidectomy for papillary carcinoma performed 17 months before . She received a single dose of 100 mci radioiodine (i) and a suppressive dose of thyroid hormone . Six months later she had a negative whole - body i scan . On admission, besides pallor and moderate asthenia, the physical examination revealed a large gray - green - tinged cervical mass extended to both parametriae . Her last gynecological examination and pap smear (one year before) were normal, as were the last laboratory examinations . Cervical smear performed by the gynecologist revealed the presence of atypical squamous cells of undetermined significance (ascus - bethesda system 2001). Imaging confirmed the presence of a homogeneous cervical tumour measuring 6 cm, extending to both parametriae . Cervical biopsy showed cervical stroma being infiltrated by sheets of medium sized immature cells, many of which had clear cytoplasm (fig . 1; hematoxylin and eosin stain; original magnification 200). 2; original magnification 200), cd 117 and cd 34 antigens, leading to the diagnosis of ms . Laboratory examinations revealed the following values: hemoglobin 5.4 g / dl, hematocrit 16%, white blood cell count 5.1 10/mm with 75% of blast cells and a platelet count of 19 10/mm . A bone marrow biopsy confirmed the diagnosis of acute aml type m2 according to the french - american - british classification scheme . Cytogenetic studies on bone marrow cells failed to show any translocation or inversion, but demonstrated a trisomy 3 confirmed by fish . Induction treatment was carried out using high - dose cytarabine and daunorubicin according to lam 2006 protocol . As the medullogram showed 66% pathological blasts 15 days after the beginning of the treatment, the patient underwent reinduction therapy using the same drugs . The patient's course was complicated by febrile neutropenia and staphylococcal sepsis which was successfully treated . A post - chemotherapy medullogram done prior to discharge in may 2007 showed a hypocellular marrow with 3% blasts (1% pathological blasts). One month later, a bone marrow biopsy showed the persistence of 11% pathological blasts . A compensation treatment according to the lam 2006 protocol (high doses of amsacrine and aracytine) was performed . They occur mainly in patients with known aml, myeloproliferative disorder or myelodysplastic syndrome . In very few cases ms of the uterine cervix as an initial clinical presentation of acute myeloid leukaemia is uncommon [1, 2]. Radioiodine is used in the treatment of thyroid cancer in order to eliminate residual thyroid tissue following total thyroidectomy and to treat metastatic disease [3, 4]. Aml is an uncommon complication of exposure to i, which when it occurs, does so mostly after cumulative doses higher than 800 mci [3, 5]. Although cases of patients developing leukaemia after low - dose radioactive iodine are reported, the link with the treatment is still a matter of debate . In this report the patient had received a single dose of 100 mci i for the treatment of a thyroid cancer 17 months before the diagnosis . Ms occurs most commonly in bone, periosteum, soft tissue, lymph nodes and skin, whereas the fgt is rarely involved [1, 2]. The ovaries and breasts deserve special mention as sites of involvement, but garcia et al only 23 cases of ms of the uterine cervix have been reported before . The majority of patients with ms of the cervix present vaginal or postcoital bleeding . Diagnosis is especially difficult when the tumour mass is isolated with no evidence of systemic aml . In these cases, ms are frequently misdiagnosed in biopsies and the most common incorrect diagnosis cited is large cell lymphoma . Cytochemical and immunohistochemical studies are extremely helpful for establishing the correct diagnosis in such cases . Prognosis of ms of the uterine cervix is poor, ranging from an average survival of 9 months in patients without manifest leukaemia to 3.2 months for patients with manifest aml at presentation . In our case she was asymptomatic and an examination of peripheral blood and bone marrow after the diagnosis of fgt involvement revealed aml m2 . The development of aml is a rare but known complication of radioiodine therapy usually occurring after a cumulative dose of more than 800 mci . However, a few cases of aml after a lower dose of i have already been reported . Table 1 summarizes a review of published reports of acute myeloid leukaemia in patients treated with i for thyroid disorders . Two groups can clearly be distinguished: patients who developed leukaemia 12 to 24 months after the radioiodine therapy, and those whose disease occurred after a period longer than 2 years . Cytogenetic analysis of bone marrow showed described chromosomal rearrangement in cases 6 and 7 (trisomy 8 and t(15,17), respectively). In our patient we do not know whether these cases of aml can be considered as a second neoplasia or as a secondary effect of radioactive treatment . Nevertheless, ionizing radiation, including i, is known to be highly involved in producing chromosome aberrations that could be linked to the occurrence of secondary leukaemia [8, 9]. It has actually been shown that the frequency of complex abnormalities in karyotypes is higher in radioiodine treatment - related aml than in de novo aml . It is unclear whether treatment with low - dose radioactive iodine contributed to the development of leukaemia in the patients described . The development of aml after low - dose radioiodine could represent a therapy - induced complication . Alternatively, we could also hypothesize that the bone marrow of these patients shows individual susceptibilities that put them at greater risk for the potential damaging effect of i therapy . Finally, these patients could represent a part of the population that would have developed aml without any i therapy . As the incidence of leukaemia after low - dose radioiodine therapy is unclear, a strict hematological follow - up of patients treated with any dose of i therapy is recommended to accurately detect any hematological complication which might have been underestimated . Unusual presentations, such as chloroma of the uterine cervix, may reveal myeloid malignancy and should therefore be kept in mind.
|
Ras is a disorder characterized by recurring ulcers confined to the oral mucosa in patients with no other signs of disease but many investigators believe that immunologic disorders, hematologic deficiencies and allergic or psychological abnormalities may play a role . Ras are classified as minor (<1 cm in size) ulcers healing faster without scars and major (> 1 cm in size) which take longer time to heal and often scar . The third type is herpetiform ulcers which manifests as recurrent crops of dozens of small ulcers throughout the oral mucosa . Ras minor composes from 70% to 87% of all forms of ras and a recent study places its frequency rate at 17.7% in the general population . Ras is characterized by multiple, recurrent, small, round, or ovoid ulcers with circumscribed margins, erythematous haloes and yellow or grey floors, it usually presents first in childhood or adolescence and then can occur later in adult life . Apthous ulcers, which usually occur on the non - keratinized oral mucosa, can cause considerable pain and may interfere with eating, speaking and swallowing . Investigators drew an analogy between ulcers developing at sites of trauma and the positive pathergy reaction in bechet's disease . Other associated factors include systemic diseases and nutritional deficiencies, food allergies, genetic predisposition, immune disorders, the use of certain medications and human immunodeficiency virus infection . About 50% of first - degree relatives of patients with recurrent apthous stomatitis also have the condition suggesting genetics as one of the associated factors in its etiology . The clinician should routinely perform a blood test to rule out iron, vitamin b12 or folate deficiency as well as a complete blood count . Elimination diets or dietary supplementation if a hematinic deficiency is involved may resolve symptoms completely . Ras and recurrent intraoral herpes are the two most commonly encountered recurring oral lesions in the dental office . Because the general frequency and clinical similarity of these conditions often make it difficult to distinguish one from the other, therapeutic intervention may be inappropriate since the former is an autoimmune phenomenon and the latter is a viral infection . Aphthous ulcers are one of the most common oral diseases world - wide but oral lesions similar to aphthous ulcers may be present in several systemic diseases . There are several diseases that should be included in the differential diagnosis of a patient who presents with a history of recurring ulcers of the mouth such as behet's syndrome, recurrent herpes simplex virus infection, recurrent erythema multiforme and cyclic neutropenia so a thorough history and clinical evaluation of the patient is must . Diagnosis is on clinical grounds alone and must be differentiated from other causes of recurrent ulceration, particularly behet disease - a systemic disorder in which aphthous - like ulcers are associated with genital ulceration and eye disease (particularly posterior uveitis). Levamisole is a levisomer of tetramisole ((-)-2,3,5,6-tetrahydro-6-phenylimidazole [2,1 - 6] thiazole monohydrochloride) and has been used as a broad spectrum anti - helminthic drug since 1966 . This drug commonly used by gastroenterologists, having a wide range of immunomodulatory actions, has been used successfully as monotherapy and an adjunct to treatment in a variety of diseases . It has been successfully used in the treatment of parasitic, viral and bacterial infections including inflammatory skin diseases . It has also been used in combination with other drugs for treating a number of dermatologic disorders, e.g. In combination with cimetidine for treating recalcitrant warts, with prednisolone for treating lichen planus, erythema multiforme and aphthous ulcers of the oral cavity . Levamisole has been tried in multiple chronic oral ulcerative lesions such as mucous membrane pemphegoid, oral lichen planus (olp) and pemphigus vulgaris with varied results . In one study conducted by lu et al ., all patients were given 150 mg / day of levamisole and 15 mg / day of prednisolone for 3 consecutive days each week, along with topically applied dexamethasone orobase . The addition of levamisole to prednisolone produced improved results in the management of above stated mucocutaneous disorders . In yet another study, it has also been concluded that for erosive olp patients, the combination therapy is superior to the single therapy of levamisole or of chinese medicinal herbs as studied by serum levels of squamous cell carcinoma associated antigen determined by a microparticle enzyme immunoassay . Adverse affects of levamisole are mild and infrequent and include rash, nausea, abdominal cramps, taste alteration, alopecia, arthralgia and a flu - like syndrome and rarely cause agranulocytosis . Agranulocytosis is commonly seen in those patients with human leukocyte antigen - b27 positivity and in those patients who have undergone long - term levamisole therapy . It is more widespread in south asia (53%) than in other regions of the world . It was concluded in one study that routine administration of intestinal anthelmintic agents results in a marginal increase in hemoglobin (1.71 g / l), which could translate on a public health scale into a small (5 - 10%) reduction in the prevalence of anemia in populations with a relatively high prevalence of intestinal helminthiasis . Since ras is commonly associated with hematinic deficiencies, this drug can be used as an adjunct for its management . A study published in 1978, renoux et al . Have reported that levamisole increased cellular immunity and has been approved for many autoimmune and inflammatory diseases . Histologically, ras are mucosal ulcerations with a mixed inflammatory infiltrate and large granular lymphocytes predominating in the preulcerative and healing phases and okt8 cells predominating in the ulcerative phase . Increased adherence of neutrophils may help perpetuate the ulceration and release of tumor necrosis factor (tnf) has also been reported . As recurrent aphthous ulcerations (rau) are common oral inflammatory lesions, tnf - alpha plays an important inflammatory mediator and a critical cytokine for adequate host defense . A study by sun concluded that a significantly higher than normal serum level of tnf - alpha (normal 3.8 pg / ml) can be detected in 20 - 39% of patients in the ulcerative stage of major, minor or herpetiform ulcerations . The serum tnf - alpha level may be associated with the severity and the stage of ras . It has been concluded that levamisole can modulate serum tnf - alpha levels in ras patients . Interleukin-6 (il-6) is a pro - inflammatory cytokine that has effects on cellular and humoral immunities and levamisole and levamisole plus chinese medicinal herbs can modulate the serum il-6 level in ras patients . The therapeutic effect of ras can be monitored by a reduction of serum il-6 level in rau patients . It was also suggested that the combination therapy is superior to the single therapy of levamisole only . In a study conducted to evaluate the effect of levamisole on the immune system of patients with ras or olp, it was found a significant improvement in clinical symptoms and normalization of the decreased cd4/cd8 ratio in rau patients after levamisole treatment . Moreover, the decreased cd4/cd8 ratio, which persisted until the remission stage in the untreated ras patients, reverted to normal in the active late stage in the levamisole - treated patients . This reversion of aberrant cellular immunity in an earlier stage of the ulcer cycle may explain why ras patients experience symptom improvement after antihelminthic drug therapy . . Topical medications such as antimicrobial mouth - washes and topical corticosteroids (dexamethasone) can achieve the primary goal to reduce pain and to improve healing time but do not improve recurrence or remission rates . In severe conditions of major apthous stomatitis cases of major ulcers that are characterized by pain and dysphagia and that are recurrent usually require systemic therapy . Several systemic drugs have been used to treat major ulcers including systemic corticosteroids, dapsone, colchicine, thalidomide, pentoxifylline, low - dose interferon- and levamisole . The therapeutic choice of drug depends on the severity of the disease, the number of ulcers, their location and duration and the level of associated orofacial pain . However, despite detailed clinical, immunologic, hematologic and microbiologic investigation, the etiology of ras remains unknown . At present, topical steroids and antimicrobial mouth rinses are the mainstays of treatment, but there is still no means of preventing recurrence of the oral ulceration . Though the primary goals of therapy for ras are relief of pain, reduction of ulcer duration and restoration of normal oral function, secondary goals include reduction in the frequency and severity of recurrences and maintenance of remission with levamisole showing variable efficacy . Thus, ras can be effectively managed with a variety of topical and systemic medications . Levamisole hydrochloride may reduce healing time and reduce the number of ulcers, but an older study found only subjective improvement . This drug has proven to increase hemoglobin concentration of the patient along with regulating immune system of the ras patients . Prolonged use of this drug should be avoided due to its adverse side - effects especially agranulocytosis . Recurrent apthous stomatitis is a multifactorial condition and it is likely that immune - mediated destruction of the epithelium is the final common pathway in rau's pathogenesis . Levamisole hydrochloride may reduce healing time and reduce the number of ulcers with its immune regulation and improve hematologic picture and thus can be considered as one of drugs for the treatment modality of recurrent apthous stomatitis.
|
Radical surgery is the gold standard for the treatment of the primary lesion of penile carcinoma . These procedures allow an excellent local control of disease, with a 6% recurrence rate for partial penectomy . In the absence of lymph node metastasis, these procedures are associated with a five - year survival in 80% of cases . However, the conventional surgery has given poor aesthetic, anatomical and functional results, and this dramatically influences patients quality of life . The major surgical complications include: difficulties in urination whilst standing, impaired sexual function, and an appearance of distal urethral stenosis in 20% of cases, which require a second surgery in 8% of cases . Modern guidelines for early - stage tumors prescribe conservative penile - sparing techniques, which include the dissection of the glans from the cavernosal apexes with a full excision of small tumors localized on the glans or prepuce . The length and shape of the penis are therefore maintained inducing less of an emotional impact than radical surgery, with the recovery of coital function in most cases . Most authors reported confusing results about techniques of glandectomy and penile - sparing surgery without glans reconstruction . Potency - sparing techniques include reconstructive glanduloplasty using split - thickness skin grafts, buccal mucosa or scrotal flaps which have been carried out to restore both the anatomic and aesthetic appearance of the penis . All of these procedures only partially solve aesthetic and psychological problems but, for the most part, the patient completely loses sensibility and consequently the ability to achieve ejaculation and orgasm . Furthermore, penile length and appearance are definitively compromised . With the original technique of urethral glanduloplasty, satisfactory functional and sexual outcomes such as the restoration of erection, sensibility in the area of the neoglans and ejaculation (please check this retains your original meaning) many studies have been carried out on the global, clinical, and psychological outcomes of surgery in penile carcinoma without any distinction between conservative and demolitive techniques . Furthermore, few papers have reported on sexual outcomes related to conservative and reconstructive surgical techniques . The purpose of this study was to evaluate the psychological and sexual outcomes and the quality of life related to the original technique, consisting of organ potency - sparing surgery and glans reconstruction with distal urethra in patients affected by locally confined carcinoma of the penis . Forty - two patients (mean age 56 years) with penile cancer clinically confined (ta, t1, t2) were prospectively evaluated . Thirty - eight out of 42 patients (90.4%) enrolled in the study had a high - school degree or higher education and belong to the middle or upper class [table 1]. Treatment strategies included diathermocoagulation in six cases with superficial lesions, glandulectomy and glanduloplasty with urethral mucosa and the sparing of cavernosal apexes in 25 cases, and glandulectomy and limited apical resection in 11 cases of stage t2 . Tumor characteristics inguinal lymphadenectomy according to catalona's technique was carried out in all the patients staged t2-t2 or g3, either during demolitive surgery or as a second delayed operation after assessment of definitive histology . Glans has been carefully dissected from cavernosal apexes and from distal urethra and removed en - bloque with the neuro - vascular bundle . Saving cavernosal apexes allowed the physician to perform a potency - sparing technique, thanks to the preservation of adequate penile length for coital function . Glandular reconstructive urethroplasty included a full dissection and mobilization of the whole penile urethra from the ventral corpora cavernosa from the apexes as far as the base of the penile shaft, in order to obtain a uretrhal stump at least 3 cm longer than the cavernous bodies . Subsequently, the ventral part of the urethra was longitudinally sectioned for 3 cm and shaped to cover the cavernosal apexes, tying the mucosa over the dorsal side of penile albuginea [figure 1]. Urethral margins were fixed to the corpora cavernosa apexes by 3/0 absorbable sutures and the penile skin was sutured to the corpora cavernosa at a distance of 1 cm from the margin of the neoglans . This was a decision to widen the area of the neoglans by the growth and migration of urethral epithelium that would have occurred completely, 30 days after the operation . Finally, the urethral neomeatus was sutured to the penile skin ventrally and a bladder catheter was left for five days . The neoglans is created by positioning distal urethra in the distal part of the cavernosal apexes potential participants received invitation letters, detailed information sheets and consent forms . Patients participated only if they so desired; informed consent was obtained one to two days before the surgery . Sexual functions, such as erection, ejaculation and libido were evaluated with an iief-15 questionnaire relating to: before the appearance of the neoplasia (about three months before the surgery), two weeks before surgery and six months after surgery . This is a clinical tool [table 3] which has been widely tested, has good face validity and is clinically informative for use with mentally ill patients . It is sensitive enough to discriminate between mental health and non - mental health community residents and has been used in several treatment evaluation studies . The questionnaire included questions relating to unpleasant feelings, familial and social relationships, and quality of work . The scores relating to two weeks before the surgery have been compared to those obtained six months after surgery . Bigelow's questionnaire statistical analysis was conducted using t - student for repeated measures for continuous variables and analysis of variance for logical variables . Forty - two patients (mean age 56 years) with penile cancer clinically confined (ta, t1, t2) were prospectively evaluated . Thirty - eight out of 42 patients (90.4%) enrolled in the study had a high - school degree or higher education and belong to the middle or upper class [table 1]. Treatment strategies included diathermocoagulation in six cases with superficial lesions, glandulectomy and glanduloplasty with urethral mucosa and the sparing of cavernosal apexes in 25 cases, and glandulectomy and limited apical resection in 11 cases of stage t2 . Tumor characteristics inguinal lymphadenectomy according to catalona's technique was carried out in all the patients staged t2-t2 or g3, either during demolitive surgery or as a second delayed operation after assessment of definitive histology . Glans has been carefully dissected from cavernosal apexes and from distal urethra and removed en - bloque with the neuro - vascular bundle . Saving cavernosal apexes allowed the physician to perform a potency - sparing technique, thanks to the preservation of adequate penile length for coital function . Glandular reconstructive urethroplasty included a full dissection and mobilization of the whole penile urethra from the ventral corpora cavernosa from the apexes as far as the base of the penile shaft, in order to obtain a uretrhal stump at least 3 cm longer than the cavernous bodies . Subsequently, the ventral part of the urethra was longitudinally sectioned for 3 cm and shaped to cover the cavernosal apexes, tying the mucosa over the dorsal side of penile albuginea [figure 1]. Urethral margins were fixed to the corpora cavernosa apexes by 3/0 absorbable sutures and the penile skin was sutured to the corpora cavernosa at a distance of 1 cm from the margin of the neoglans . This was a decision to widen the area of the neoglans by the growth and migration of urethral epithelium that would have occurred completely, 30 days after the operation . Finally, the urethral neomeatus was sutured to the penile skin ventrally and a bladder catheter was left for five days . The neoglans is created by positioning distal urethra in the distal part of the cavernosal apexes patients participated only if they so desired; informed consent was obtained one to two days before the surgery . Sexual functions, such as erection, ejaculation and libido were evaluated with an iief-15 questionnaire relating to: before the appearance of the neoplasia (about three months before the surgery), two weeks before surgery and six months after surgery . This is a clinical tool [table 3] which has been widely tested, has good face validity and is clinically informative for use with mentally ill patients . It is sensitive enough to discriminate between mental health and non - mental health community residents and has been used in several treatment evaluation studies . The questionnaire included questions relating to unpleasant feelings, familial and social relationships, and quality of work . The scores relating to two weeks before the surgery have been compared to those obtained six months after surgery . Statistical analysis was conducted using t - student for repeated measures for continuous variables and analysis of variance for logical variables . Six months after surgery 31/42 patients (73%) reported spontaneous rigid erections, 25/42 (60%) reported coital activity while 19/25 (76%) of the group treated with glans reconstruction (urethral glanduloplasty) reported normal ejaculation and orgasm, regained an average of 35 days after surgery [table 4, right column]. Thirty out of 42 patients (71%) reported scores related to libido comparable to those before disease . Iief-15 score assessed before penile cancer disease and six months after surgical treatment the average scores in the entire study were as follows: before the appearance of neoplasia (about three months before the surgery), the iief-15 scores for erection, ejaculation, orgasm and libido were 20, 5, 11, and 9 respectively . These were not significantly different (i.e. P> 0.05) to those recorded two weeks before the surgery, which were: 21, 5, 13, and 8 respectively [table 5]. Quality of life questionnaire scores evaluated before and during disease and six months after surgery . (* p<0.05) mean scores on bigelow's quality of life questionnaire (relating to sexual pleasure, familial, social and professional relationships) showed a significant improvement at 6 months after surgery from those at 2 weeks before surgery (p<0.01). In particular, scores relating to unpleasant feelings decreased from 30 to 16 (p <0.01), sexual pleasure scores increased from 18 to 37 (p <0.01), familial and partner relations also improved (4 to 16) (p <0.01). No significant difference was recorded in the domains relating to friend relationships and professional quality whose scores increased from 20 to 22 (p <0.05) and 18 to 21 (p> 0.05). Penile cancer and its treatment can affect sexual function, psychological well - being, quality of life, and may also result in post - traumatic stress disorder . One of the major handicaps in evaluating sexual outcomes after penile surgery is the lack of standardization of clinical data . The majority of studies used retrospective data collection from a small number of patients in single units, using different measuring tools . In addition, the study tools differed by administration, interview and semi - structured interview . An early systematic review of the quality of life (psychosexual and psychosocial) literature in penile cancer has considered 6 of 437 studies on this issue . Authors have reported an overall impact on patients wealth in up to 40% and psychological symptoms in approximately 50%, with signs of post - traumatic stress disorder in almost the same proportion . Specifically, in 6 studies reviewed by authors, 13 different quantitative tools were used to assess psychological wealth . The hospital anxiety and depression score (hads) demonstrated pathological anxiety in up to 31% of patients . Ficarra used the diagnostic and statistical manual of mental disorders of psychiatric illness (dsm iii - r) pointing out a rate of mental illness in 53%, avoidance behavior in 25% and impaired wealth in 40% . The results varied from 36% with no sexual function in one study, to 67% in another reporting reduced sexual satisfaction, to 78% reporting high confidence with erections in yet another . The glans - sparing technique has been documented in 12 patients: for all of whom sexual desire was patients need therefore to be supported externally (via partners, family and friends) and internally (via life experiences). Wives, ex - wives and girlfriends should be involved in such a rehabilitation program in order to give emotional and practical support . Currently, no sufficient help is offered in terms of screening for depression or anxiety in penile cancer patients . Positive responses included gratitude for the rapidity of surgery, removal of unpleasant symptoms and relief of initial anxiety . Frequent follow - up appointments were appreciated as they provided reassurance of swift intervention in any recurrence . The modern approach to penile carcinoma should be a compromise between oncological safety and functional preservation . In our experience (experiment), glans reconstructive urethroplasty has shown clear long - term anatomical and functional advantages if compared to standard therapies for penile carcinoma: postoperative iief scores have demonstrated recovery of sexual function to that of before the onset of disease, including rigid erection, libido and ejaculation, with operative time not significantly longer than the simple amputation (mean: 35 min). The quality of life of patients after the operation in terms of quality of job, familial and partner relationships, and sexual pleasure was satisfactory . It was surprising that the ejaculatory reflex was restored in the majority of our patients . The new arising concept is that thermal and tactile vibratory stimulation of the urethral mucosa of the neoglans can activate ejaculatory and orgasmic pathways during sexual activity and some investigational reports seem to support this hypothesis . Thus far, no published surgical technique for penile carcinoma has exhibited a full recovery of sexual functions . Our study indicates that sexual - sparing surgical treatments have a positive impact in a multitude of ways on a patient's life including familial relationships, and social and working conditions . These treatments allow the patient to obtain both cancer eradication and anatomical - psychological integrity, to preserve body image and to restore complex mechanisms such as erection and ejaculation . The role of women and the centrality of wives in supporting men's health in general, and in penile cancer in particular, is also very important . Furthermore it is necessary to identify adequate tools to measure and identify psychological and sexual dysfunction in this group of patients . Well designed multicentre studies are therefore needed to improve the global management of patients with penile cancer.
|
Thanks to rapid developments in the fabrication and self - assembly techniques, the electrical transport through nanoscale quantum systems such as a single quantum dot, multiple quantum dots, atoms or molecules coupled to metallic electrodes has been an interesting subject in recent years [1 - 6]. In the nanoscale quantum systems, the electrical transport is ballistic, while the phase coherence of the electrons is preserved . Especially, the quantum interference effects in an ab ring including a quantum dot have been reported . The results showed that fano effect with asymmetric parameters was a good probe to quantum interference effects in the nanoscale systems . The transport properties of a quantum ring consisting of two parallel - coupled quantum dots sandwiched between two metallic electrodes have been also studied theoretically and experimentally in the last few decades [7 - 22]. For example, an ab interferometer including two coupled quantum dots with each quantum dot inserted in each arm was presented, and an oscillating electric current was detected experimentally . Such a double - quantum - dot model consisting of the parallel - coupled double - dot system has been studied extensively in some previous theoretical works [13 - 18]. When the interdot coupling is considered, a bonding molecular state and an antibonding molecular state are developed . A swap effect can be found in the quantum system by tuning the magnetic flux threading the quantum ring, which may be used in the future quantum computations . Recently, the transport properties of multi - parallel - coupled quantum dots have attracted considerable attention due to their potential applications and abounding physics [23 - 31]. Zeng et al . Studied the ab effects in a quantum ring consisting of four quantum dots sandwiched between two metallic electrodes, and a fano dip is developed when the energy levels of quantum dots in two arms are mismatched . Offered a quantum model describing multi - parallel - coupled quantum - dot molecule, and fano effects in the quantum system were studied in detail . More recently, li et al . Studied the electrical transport through a triple - arm ab interferometer consisting of three parallel quantum dots with electron - electron interactions under an applied electric field . In this work, we study the quantum interference effects in a double - aharonov - bohm interferometer consisting of five quantum dots sandwiched between two metallic electrodes as shown in fig . 1 . The left quantum ring consisting of the quantum dot 1, the quantum dot 2, quantum dot 3 and the left metallic electrode encloses the magnetic flux . The right ring consisting of the quantum dot 3, the quantum dot 4, the quantum dot 5, and the right metallic electrode encloses the magnetic flux . For simplicity, we consider that only one energy level exists in each quantum dot, and the energy levels of all quantum dots can be tuned by the voltages applied on the quantum dots . In this work, we studied in detail the quantum interference effects in the double - quantum - ring structure in the case of symmetric dot - electrode couplings . The results show that the linear conductance peaks at zero temperature can be effectively tuned by using the intermediate quantum dot 3 . As the energy level of the quantum dot 3 changes, a three - peak structure may evolve into a two - peak structure in the linear conductance spectrum . When the energy levels of quantum dots in arms are not aligned with one another two fano peaks can be effectively modified by tuning the energy level of quantum dot 3 . Our results show that the ab oscillating behavior depends strongly on the difference between the magnetic fluxes threading the left and right rings . In addition to the general ab oscillation with 2-period, an ab oscillation with -period can be developed when the difference between the two magnetic fluxes is (2n + 1)(n = 0, 1, 2,). Schematic plot of a double - aharonov - bohm interferometer consisting of five quantum dots sandwiched between two metallic electrodes . The left ring encloses a magnetic flux, and the right ring encloses a magnetic flux the parallel - coupled quantum - dot structure that we consider is illustrated in fig . The interdot and intradot coulomb interactions are neglected, and the total hamiltonian describing the quantum system is written as where the first term hleads in eq . (1) describes the left and right electrodes in the noninteracting electron approximation where denotes the creation(annihilation) operator for an electron with energy k and momentum k in electrode . The second term in eq . (1) describes the dynamics of the five parallel - coupled quantum dots, which can be modeled by using the following five - site hamiltonian where creates (annihilates) an electron with the energy j in the jth quantum dot, and the ab phase and the flux quantum . Tij describes the interdot tunneling coupling between the dot i and dot j, for convenience, which is regarded as a real number . The third term in eq . (1) describing the tunneling coupling between the quantum dots and the electrodes is divided into two parts describes the tunneling coupling between the isolated quantum dots and the electrode a phase factor is attached to vj in the presence of the magnetic flux, and they can be written as,,, . In order to study the transport through the double - quantum ring, we need know the retarded (advanced) green s function . The retarded green s function is defined as applying the equation of motion method, we obtain a series of equations, four new green s functions arising from the tunneling couplings between the quantum dots and metallic electrodes appear in the above eqs . (816), the retarded green s function can be calculated by the following 5 5 matrix where and) (j = 1, 2 for = l; j = 4, 5 for = r). The linear conductance of the double quantum ring at zero temperature can be calculated by the landauer formula, the linewidth matrices and are given in the case of the symmetrical dot - electrode tunneling couplings, the linear conductance has the following form, where and . From the above equation, we note that the linear conductance includes the contributions from four different electron tunneling paths (13 4, 135, 23 4;235) and interference terms among them . In this section, the dependence of the linear conductance on system parameters is discussed numerically and analytically . The coupling strength between the quantum dots and the metallic electrodes is taken as the energy unit . Through this paper, all energy levels in quantum dots, tunneling couplings and fermi energy are measured by . We first study the linear transport properties of the double - ab interferometer consisting of five parallel - coupled quantum dots with the same energy levels (j = 0, j = 1, 2, 3, 4, 5) in the absence of the magnetic fluxes (l = r = 0). Figure 2a shows the linear conductance of the double - quantum - ring structure as a function of the fermi level ef in the case of symmetrical interdot tunneling couplings . The same interdot tunneling coupling strengths are chosen as t13 = t23 = t34 = t35 = t. there are total five molecular states in center five - dot quantum system, but three molecular states of which with zero energy are degenerate . Other two molecular states are located at 2 t and 2 t, respectively . So we find that there are three resonance peaks with = 2e / h appearing at 0, 2 t and 2 t, respectively . With t increasing, the position of the center conductance peak has no changing, while the other two conductance peaks move in the opposite direction as shown in fig 2b and 2c, we display the linear conductance as a function of the fermi energy ef in the case of asymmetrical interdot tunneling couplings . In fig . 2b, we assume the interdot tunneling coupling strengths as and t34 = t35 . In this case, three conductance peaks are located at 0,, and, respectively . As t34 decreases, the conductance peaks are suppressed and become narrower as shown in fig . 2c, we examine the transport properties of the double - quantum - ring structure by tuning t23 and t34 . Here a fano dip (zero conductance point) appears at ef = 0 when t23 (t34) is different from t13(t35). The behind reason is the destructive interference effects between the electron waves directly transmitting through the three coupled quantum dots in series and side - coupled quantum dots (see the inset in fig . 2c). As t23 and t34 decrease, a three - peak structure in the linear conductance spectrum evolves into the four - peak structure . When t23 = t34 = 0, the quantum device becomes a three quantum - dot array sandwiched between two metallic electrodes with side - coupled quantum dots as shown in the inset of fig . 2c . The fano dip is located at the energy levels of the side - coupled quantum dots (2 = 4 = 0). It is noted that two peaks become closer and narrower as t23 and t34 decrease . The energy levels of the quantum dots are chosen as 1 = 2 = 3 = 4 = 5 = 0 figure 3 displays the linear conductance as a function of ef when the energy level of the third quantum dot 3 is not aligned with those of the other four quantum dots . Five molecular states appear at, respectively . When 3 = 0, three conductance peaks with = 2e / h are centered at 0, and, respectively . The linear conductance as a function of ef under the different values of 3 is plotted in fig . The left two conductance peaks evolve into a single conductance peak, and the right conductance peak moves in the right direction in the case of 3> 0 . We also find the height of the left conductance peak is suppressed . In the case of 3 the right two conductance peaks evolve into a single conductance peak, and the height of the conductance peak is suppressed . The left conductance peak moves in the left direction, and the height of the conductance peak has no changing . In order to explore the dependence of the linear conductance on the energy level of the intermediate quantum dot 3, we plot the linear conductance as a function of 3 under several different interdot couplings in fig . The linear conductance first increases and reaches the maximum value at the certain value 3 m . Once the interdot couplings are enough small, the resonant conductance peak is almost pined at ef . The transport properties of the double - quantum ring are similar with these of a single quantum dot coupled straightly to metallic electrodes . Linear conductance as a function of the fermi energy level ef in a the case of 3> 0; b the case of 3 <0 . 2 linear conductance as a function of the energy level of the quantum dot 3 in the presence of different interdot tunneling coupling strengths . Other system parameters are chosen as in fig . 2 in fig . 5, we study the transport properties of the double - quantum ring when the same interdot coupling strengths (t13 = t23 = t34 = t35 = t =) are considered, and the energy levels of quantum dots parameters are chosen as, and, respectively . Since the degenerate states are opened in this case, five conductance peaks appear in the linear conductance spectrum . The linear conductance consists of three breit - wigner peaks and two sharp asymmetric fano peaks . The linear conductance in the absence of magnetic flux can be written as linear conductance as a function of the fermi energy ef under several different values of the quantum dot 3 . Other quantum - dot energy levels are chosen as,, and, respectively using eq . (17), we arrive at from the above equation, we see clearly = 0 for or . The linear conductance spectrum has mirror symmetry around 3 in the case of 3 = 0 . With increasing 3, the left fano peak is suppressed, while the right fano peak is firstly suppressed, then it is enhanced . The periodic oscillation in the linear conductance for the magnetic flux is key features when the phase coherence of the electrons is preserved . In this section, we start with the study of dependence of the linear conductance on the magnetic fluxes through the double - quantum ring . The dependence of the linear conductance on the fermi energy in the presence of the same magnetic flux through the left and right rings (l = r =) is shown in fig . 6 . The same interdot tunneling couplings and the same quantum - dot energy levels 1 = 2 = 3 = 4 = 5 = 0 = 0 are considered . When the magnetic flux is presented, a fano dip is developed when the fermi energy is aligned with 0 . With increasing, the three - peak structure disappears, while a four - peak structure in the linear conductance spectrum appears . When the magnetic fluxes are further increased, the four - peak structure evolves into a double - peak structure . After some algebra, we derive the linear conductance in the presence of the magnetic flux as the following analytical form linear conductance as a function of the fermi energy ef under several different magnetic fluxes threading the left and right rings l = r = from the above equation, we see clearly that the linear conductance disappears when ef = 0, and four molecular states are located around and, respectively . With increasing, the two middle conductance peaks are suppressed obviously, while the outside conductance peaks become shaper as shown in fig . When approaches, we can obtain an approximate formula for the linear conductance where 1 and 2 represent two small quantities . Equation (26) shows two narrower conductance peaks are centered at as shown in fig . When = n(n is odd number), the linear conductance disappears everywhere for any value of ef . Figure 7 shows the images of the linear conductance as functions of l and the fermi energy ef . Denotes the difference between magnetic fluxes through the left quantum ring and right quantum ring . When, a general 2-periodic ab oscillation for l is obtained as shown in fig . When, a -periodic ab oscillation appears in the quantum system as shown in fig . The above results can be explained as following expressions . When the magnetic fluxes through the double - quantum ring are considered, using eq . (24), we arrive at when, the above equation can be simplified as images of the linear conductance as functions of the fermi energy ef and l for a, b, and c, respectively . D linear conductance as a function of magnetic flux l for [solid (black) line], [dashed (red) line], and [dotted (blue) line], respectively . 6 so an ab oscillation with -period is developed as shown in fig . 7c and it is well known that an oscillating current in the ab interferometer has been detected experimentally . For a single quantum ring consisting of two parallel - coupled quantum dots sandwiched between two metallic electrodes, 2-periodic oscillation of the linear conductance is reported in the pervious works . The linear conductance as a function of l under the different energy levels in the quantum dot 3 or several different values of r is shown in fig . The fermi energy ef is fixed at, and other system parameters are chosen as in fig . The ab oscillation for l in the presence of different energy levels of the quantum dot 3 is potted in fig . A series of shaper resonant peaks appear at 2n (n = 0, 1, 2), and the linear conductance reaches a minimum (= 0) when l approaches (2n + 1) (n = 0, 1, 2). When the energy level in quantum dot 3 is not aligned with other quantum - dot levels, the single conductance peak around 2n splits into the two conductance peaks . With 3 moving away from zero energy point, it is noted that the double - peak structure around 2n disappears slowly as the magnetic flux threading the right quantum ring increases . A ab oscillations for l in the presence of several different energy levels of the quantum dot 3 with r = 0; b ab oscillations for l in the presence of several different magnetic fluxes r with the fixed . Other system parameters are chosen as 1 = 2 = 4 = 5 = 0,, and we first study the linear transport properties of the double - ab interferometer consisting of five parallel - coupled quantum dots with the same energy levels (j = 0, j = 1, 2, 3, 4, 5) in the absence of the magnetic fluxes (l = r = 0). Figure 2a shows the linear conductance of the double - quantum - ring structure as a function of the fermi level ef in the case of symmetrical interdot tunneling couplings . The same interdot tunneling coupling strengths are chosen as t13 = t23 = t34 = t35 = t. there are total five molecular states in center five - dot quantum system, but three molecular states of which with zero energy are degenerate . Other two molecular states are located at 2 t and 2 t, respectively . So we find that there are three resonance peaks with = 2e / h appearing at 0, 2 t and 2 t, respectively . With t increasing, the position of the center conductance peak has no changing, while the other two conductance peaks move in the opposite direction as shown in fig ., we display the linear conductance as a function of the fermi energy ef in the case of asymmetrical interdot tunneling couplings . In fig . 2b, we assume the interdot tunneling coupling strengths as and t34 = t35 . In this case as t34 decreases, the conductance peaks are suppressed and become narrower as shown in fig . 2c, we examine the transport properties of the double - quantum - ring structure by tuning t23 and t34 . Here a fano dip (zero conductance point) appears at ef = 0 when t23 (t34) is different from t13(t35). The behind reason is the destructive interference effects between the electron waves directly transmitting through the three coupled quantum dots in series and side - coupled quantum dots (see the inset in fig . 2c). As t23 and t34 decrease, a three - peak structure in the linear conductance spectrum evolves into the four - peak structure . When t23 = t34 = 0, the quantum device becomes a three quantum - dot array sandwiched between two metallic electrodes with side - coupled quantum dots as shown in the inset of fig . 2c . The fano dip is located at the energy levels of the side - coupled quantum dots (2 = 4 = 0). It is noted that two peaks become closer and narrower as t23 and t34 decrease . The energy levels of the quantum dots are chosen as 1 = 2 = 3 = 4 = 5 = 0 figure 3 displays the linear conductance as a function of ef when the energy level of the third quantum dot 3 is not aligned with those of the other four quantum dots . Five molecular states appear at, respectively . When 3 = 0, three conductance peaks with = 2e / h are centered at 0, and, respectively . The linear conductance as a function of ef under the different values of 3 is plotted in fig . 3a and 3b . The left two conductance peaks evolve into a single conductance peak, and the right conductance peak moves in the right direction in the case of 3> 0 . We also find the height of the left conductance peak is suppressed . In the case of 3 the right two conductance peaks evolve into a single conductance peak, and the height of the conductance peak is suppressed . The left conductance peak moves in the left direction, and the height of the conductance peak has no changing . In order to explore the dependence of the linear conductance on the energy level of the intermediate quantum dot 3, we plot the linear conductance as a function of 3 under several different interdot couplings in fig . The linear conductance first increases and reaches the maximum value at the certain value 3 m . Once the interdot couplings are enough small, the resonant conductance peak is almost pined at ef . The transport properties of the double - quantum ring are similar with these of a single quantum dot coupled straightly to metallic electrodes . Linear conductance as a function of the fermi energy level ef in a the case of 3> 0; b the case of 3 <0 . 2 linear conductance as a function of the energy level of the quantum dot 3 in the presence of different interdot tunneling coupling strengths . Other system parameters are chosen as in fig . 2 in fig . 5, we study the transport properties of the double - quantum ring when the same interdot coupling strengths (t13 = t23 = t34 = t35 = t =) are considered, and the energy levels of quantum dots parameters are chosen as, and, respectively . Since the degenerate states are opened in this case, five conductance peaks appear in the linear conductance spectrum . The linear conductance consists of three breit - wigner peaks and two sharp asymmetric fano peaks . The linear conductance in the absence of magnetic flux can be written as linear conductance as a function of the fermi energy ef under several different values of the quantum dot 3 . Other quantum - dot energy levels are chosen as,, and, respectively using eq . (17), we arrive at from the above equation, we see clearly = 0 for or . The linear conductance spectrum has mirror symmetry around 3 in the case of 3 = 0 . With increasing 3, the left fano peak is suppressed, while the right fano peak is firstly suppressed, then it is enhanced . The periodic oscillation in the linear conductance for the magnetic flux is key features when the phase coherence of the electrons is preserved . In this section, we start with the study of dependence of the linear conductance on the magnetic fluxes through the double - quantum ring . The dependence of the linear conductance on the fermi energy in the presence of the same magnetic flux through the left and right rings (l = r =) is shown in fig . 6 . The same interdot tunneling couplings and the same quantum - dot energy levels 1 = 2 = 3 = 4 = 5 = 0 = 0 are considered . When the magnetic flux is presented, a fano dip is developed when the fermi energy is aligned with 0 . With increasing, the three - peak structure disappears, while a four - peak structure in the linear conductance spectrum appears . When the magnetic fluxes are further increased, the four - peak structure evolves into a double - peak structure . After some algebra, we derive the linear conductance in the presence of the magnetic flux as the following analytical form linear conductance as a function of the fermi energy ef under several different magnetic fluxes threading the left and right rings l = r = from the above equation, we see clearly that the linear conductance disappears when ef = 0, and four molecular states are located around and, respectively . With increasing, the two middle conductance peaks are suppressed obviously, while the outside conductance peaks become shaper as shown in fig . When approaches, we can obtain an approximate formula for the linear conductance where 1 and 2 represent two small quantities . Equation (26) shows two narrower conductance peaks are centered at as shown in fig . Figure 7 shows the images of the linear conductance as functions of l and the fermi energy ef . Denotes the difference between magnetic fluxes through the left quantum ring and right quantum ring . When, a general 2-periodic ab oscillation for l is obtained as shown in fig . When, a -periodic ab oscillation appears in the quantum system as shown in fig . The above results can be explained as following expressions . When the magnetic fluxes through the double - quantum ring are considered, using eq . (24), we arrive at when, the above equation can be simplified as images of the linear conductance as functions of the fermi energy ef and l for a, b, and c, respectively . D linear conductance as a function of magnetic flux l for [solid (black) line], [dashed (red) line], and [dotted (blue) line], respectively . 6 so an ab oscillation with -period is developed as shown in fig . 7c and 7d . It is well known that an oscillating current in the ab interferometer has been detected experimentally . For a single quantum ring consisting of two parallel - coupled quantum dots sandwiched between two metallic electrodes, 2-periodic oscillation of the linear conductance the linear conductance as a function of l under the different energy levels in the quantum dot 3 or several different values of r is shown in fig . The fermi energy ef is fixed at, and other system parameters are chosen as in fig . The ab oscillation for l in the presence of different energy levels of the quantum dot 3 is potted in fig . Appear at 2n (n = 0, 1, 2), and the linear conductance reaches a minimum (= 0) when l approaches (2n + 1) (n = 0, 1, 2). When the energy level in quantum dot 3 is not aligned with other quantum - dot levels, the single conductance peak around 2n splits into the two conductance peaks . With 3 moving away from zero energy point, it is noted that the double - peak structure around 2n disappears slowly as the magnetic flux threading the right quantum ring increases . A ab oscillations for l in the presence of several different energy levels of the quantum dot 3 with r = 0; b ab oscillations for l in the presence of several different magnetic fluxes r with the fixed . Other system parameters are chosen as 1 = 2 = 4 = 5 = 0,, and in summary, the transport properties and quantum interference effects in a double - ab interferometer in series consisting of five quantum dots in the case of symmetric dot - electrode tunneling couplings are studied by using green s function equation of motion method . The energy levels of all quantum dots can be tuned by the voltages applied on the quantum dots in experiments . The linear conductance can be effectively modified by the intermediate quantum dot 3 . As the energy level in the quantum dot 3 changes, a three - peak structure in the linear conductance spectrum evolves into a two - peak structure . When the quantum - dot levels in arms are not aligned with one another the ab oscillation for the magnetic flux in the double - ab interferometer is also studied in this work . The results show that the ab oscillating behavior depends strongly on the difference between the magnetic fluxes threading the left and right quantum rings . An ab oscillation with -period for the magnetic flux threading the left quantum ring is developed when the difference between the two magnetic fluxes is (2n + 1)(n = 0, 1, 2,). The authors thank the supports of the national natural science foundation of china (nsfc) under grant no . 10947130 and the science foundation of the education committee of jiangsu province under grant no . 09kjb140001 . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
|
Brown sequard syndrome resulting from compression due to an epidural hematoma is a relatively rare occurrence, more so with a spontaneous history . She underwent an open door laminoplasty for evacuation of the hematoma . Following surgery the patient responded rapidly and currently at 18 months in the emergency room when a patient is clinically diagnosed as a case of brown sequard syndrome it is important to ask for an mri scan of the cervical spine . Hematoma in the cervical epidural space should be considered in the differential diagnosis of brown sequard syndrome especially in the elderly with history of doubtful trivial trauma . Brown sequard syndrome is an incomplete spinal cord lesion characterized by a clinical presentation reflecting hemi - section of the spinal cord . This is referred to as ipsilateral hemiplegia and contralateral pain and temperature sensation deficits (anaesthesia). The most common cause is penetrating trauma such as a gunshot wound or stab wound to the spinal cord, however spinal tumours and blunt trauma to the spine have also been implicated as potential causes . Hematoma is also a cause of brown sequard syndrome but is very rare and usually occurs with predisposing risk factors for bleeding (anticoagulant therapy, hypertension). Brown sequard syndrome as a result of cervical epidural hematoma is a rare entity with only a handful of cases reported in literature . We describe a case of brown sequard syndrome in a 65 year old female without any underlying risk factors, presenting with sudden onset hemiparesis rapidly progressing to hemiplegia (within a span of days) due to a cervical epidural hematoma following a doubtful history of trivial trauma . A previously healthy 65 year old female presented to us with the complaint of right side hemiplegia without any significant history of trauma . On subsequent inquiry she gave a history of brisk involuntary hyperextension of the neck following which she developed sudden onset hemiparesis, progressed to hemiplegia within a span of five days . She did not have a history of any congenital or acquired disorder of coagulation . On elaborate neurological survey it was found that motor power of the patient s right side upper and lower limb was of grade 0/5 with anesthesia of left side below c3 . She was evaluated with a cervicodorsal mri scan, which showed a hyper intense space occupying lesion suggesting an epidural hematoma at the c3-c4 level (fig.1). The patient was taken up for emergency surgery . With the patient in prone position under general anaesthesia, a posterior midline incision was taken exposing the tips of the spinous processes from c3 to c5 levels . Two bony gutters were drilled bilaterally at the border of the exposed laminae by means of an air drill . In our case, the left side border of the laminae was excised from its cranial to caudal end with a kerison rongeur and the spinous processes and the laminae were pushed laterally as if to open a door, thereby exposing the spinal canal (hirabayashi s open door laminoplasty). A. t2 weighted transverse section of the cervical cord showing an area of heterogeneous hyper intensity compressing the cord . B. t1 weighted transverse section of the spine showing an isointense lesion compressing the cord . C. t2 weighted sagittal cut of the cervical spinal cord showing heterogeneous hyper intense signal of the hematoma . Postoperatively the patient was immobilized with a hard cervical collar and physiotherapy (passive mobilization) was started . Four months following the surgery the patient regained her motor strength to grade 3/5 with partial return of sensory functions . At twelve months follow up motor power of the affected side improved to grade 5/5 with regaining of normal sensory functions on opposite about 40% of the cases reported in the literature till date do not have any demonstrable etiology and are therefore referred to as idiopathic spontaneous cervical epidural hematoma . These need to be differentiated from other well known causes such as neoplasm and systemic diseases, anticoagulant therapy, hypertension or vascular malformations and pregnancy for planning of the management and to predict prognosis . There is controversy regarding the source of the hematoma; is it arterial or venous? The proponents of the venous origin theory maintain that the sudden increase in intra - thoracic and intra - abdominal pressure leads to the rupture of the thin walled epidural veins . Thus during activities like coughing, sneezing, straining during defecation and micturition, vomiting and coitus these thin walled epidural veins may rupture and lead to the generation of the hematoma . However several authors have pointed out that since the epidural venous pressure is less than the intrathecal pressure, thus these ruptured veins are an unlikely source to produce a hematoma large enough to cause compression of the thecal sac and develope brown sequard syndrome . After study of the arterial structures of the cervical epidural region it has been hypothesized that extreme movements at the cervicodorsal junction could result in tearing of the arteries . The high arterial pressure can lead to development of hematoma large enough to cause compression of the dural sac leading to the clinical syndrome of cord compression . The most common presentation of spontaneous cervical epidural hematoma is acute onset of neck pain, which is usually radiating in nature and the localization depends on the involvement of specific nerve roots . The second most common symptom is weakness of the limbs below the level of compression . The weakness gradually increases over days but complete loss of motor power has not been reported and this deficit rarely recovers spontaneously . Mri is the diagnostic tool of choice in spontaneous cervical epidural hematoma . On t2 weighted images the hematoma appears as an area of heterogeneous hyper- intensity of the cord with focal hypo - intense areas . On t1 weighted images the lesion is usually iso - intense in the acute phase; however chronic hematomas may be hyper- intense . The treatment of choice in spontaneous cervical epidural hematoma is emergency surgical decompression although a few cases have been reported in literature to have recovered without any surgical intervention . The procedure of choice is a laminectomy, although a hemi - laminectomy or laminoplasty could be performed depending on the extent and localization of the hematoma . Ispontaneous cervical epidural hematoma leading to a brown sequard syndrome is a rare entity in clinical practice and it has a fatal progressive course in cases where the diagnosis is delayed . Spontaneous cervical epidural hematoma may present as hemiparesis prompting the emergency room physician to make an erroneous diagnosis of cerebrovascular accident, leading to delay in the diagnosis . Prompt diagnosis of the condition and urgent decompression is vital to prevent irreversible damage of the cord . A thorough clinical examination is a must followed by a mri scan of the cervical spine to exclude this rare entity . Although there have been rare reports of spontaneous recovery, surgical decompression is the preferred modality of treatment . In cases presenting as hemiparesis, sensory examination of opposite side an mri can delineate the cause and surgical decompression is warrented in cases of spontaneous epidural hematoma that causes neurodeficit.
|
In accordance with the recent increases in human life expectancy and income, the medicalhealthcare paradigm is gradually expanding to include post - treatment, prevention, and health management . It has become a serious challenge to meet the rise in expectations regarding medical services, while there is a lack of professionals in the field of welfare among other problems . Narrowly defined,' remote medical service' means the provision of limited medical services, such as diagnosis and treatment via communication tools as the medium without direct meeting between patient - doctor or doctor - doctor . However, the range of medical services delivered remotely has steadily expanded, and currently, the concept has expanded to include all types of health management service . Remote medical services can largely be classified into the following three categories:' telemedicine', which allows for initial diagnosis by the doctor viewing the condition of the patient via a device that supports video imagery;' remote monitoring', which allows for constant checking of information for an extended period of time and personalized diagnosis for treatment of chronic illness; and lastly,' remote con trol' of remote diagnosisremote treatment, etc ., which utilize new information and communications technology . Central to acquiring data for medical use is data acquisition and utilization technology in remote medical technologies . Such technology can utilize sensing technology and internet of things (iot) technology, which include wearable technology, making more concrete realization possible, and studies in the healthcare field utilizing these applied technologies are actively being conducted nowadays . However, in the iot environment where a variety of data should be continually transmitted and processed, taking only partial security issues into consideration has led to seemingly small security threats can, in fact, be a threat to human lives . Furthermore, to support remote medical services in the iot environment, previous studies have attempted to change services in accordance with sub - elements, and there is a constraint in that the entire structure should be restructured when security elements are added or a new service is created . Accordingly, there is a need for a method and structure that can satisfy the security demands of existing remote medical services and can dynamically support security demands regarding newly created ser vices . In short, there is a need for studies regarding a new method and structure for remote medical services in the iot environment . This study aimed to provide flexibility regarding new services and security elements through a service - oriented structure . The proposed framework supports dynamic security elements for each service by including security elements throughout the entire process from the creation to the destruction of data . Here, we describe various types of remote medical services and define common elements and structures that serve as a basis for remote medical services in the iot environment . In addition, the structural and functional limitations of the remote medical environment based on the defined elements are extracted . First,' remote treatment' is one type of medical service that is being developed that strives to overcome geographic and time - related obstacles . Remote treatment service was introduced for prisoners of the full sutton prison located in a suburb of the city of york by airedale nhs foundation trust of the united kingdom in 2006 . The kiosk - type unmanned telemedicine system' healthspot station', which was introduced on consumer electronics show (ces) in 2013, is an installation - type clinic where various types of physical examination in addition to video treatment by a doctor are possible within the designated space . This includes many services, such as welldoc bluestar, which is a remote diabetes management mobile software approved by the us food and drug administration, and phonedoctorx, which allows a professional medical team in a remote location to view the abnormal conditions that occur during regular nursing care of a facility resident via video phone to assist in decision - making . Next,' remote monitoring' started with technology introduced in the aerospace program of the former soviet union to detected the signals of living organisms for remote communication . This technology also made it possible for nasa to collect biometric data and check predictable physical funct ions in advance to allow for remote response while astronauts conducted their work . According to the frost & sullivan survey, the growth rate of the remote monitoring market has maintained double digits in the past 10 years, and it is currently expected to achieve remarkable advances in the development of wearable devices and data sensing technology centering on iot . Ultimately, this research will enable medical consumers, such as cancer patients and patients with chronic illnesses, to have their health condition constantly monitored by medical staff and to have a' designated doctor' who can provide them with medical services regardless of time and place . Finally, remote' diagnosistreatmentcontrol' management are being attempted along with various technological developments . Sunnyvale, ca, usa), which is famous for application in robot - assisted surgical procedures, has proven the effect by attempting an operation from a remote location focusing on many large domestic hospitals . In addition, ibm watson analyzes big data within 3 seconds, focusing on 600,000 clinical data and 42 medically related db, in providing a practical advice service to medical staff . Furthermore, asklepios hospital, located in hamburg, germany, has attempted to utilize augmented reality by overlapping an actual photograph based on a pre - operation clinical image of the patient in operation . Various efforts are being made around the world to provide diverse remote medical services, including changi general hospital in singapore, which uses qr codes to manage personalized administration for each patient via robot . The technology that serves as the basis for the remote medical services mentioned above is presented in figure 1 . The structure makes data collection from sensors and devices, pro cessing, transmission, execution, analysis, and other actions possible to support remote medical services . For remote medical services in such a structure, change in service is inevitable in accordance with sub - elements, including network technology, protocol, sensor, device, etc . Also, there is a constraint in that the structure should be restructured whenever a new service is created . The same problem occurs when a security service and technology is applied to a remote medical environment . When the required factors of iot, human, object, and service are applied to the remote medical environment,' human' is subdivided into classifications of patient, medical personnel, and non - patient .' Object' refers to all objects and infrastructure on the internet located around the' human' element, in other words patients, medical personnel, and non - patients . Lastly,' service' is media that expresses and supports medical communication between human - object - infrastructure . Accordingly, remote medical services with an iot architecture can be classified into the following three layers: 1) the perception layer, which receives health signal entries from various sensors; 2) the network layer, which takes on the role of transmitting the health data from the perception layer to the application layer; and 3) the application layer, which provides various services and interfaces via the health data received from the network layer . Consequently, the security elements of the remote medical architecture should be included at the initial design level because simple cyber - attacks can be directly connected to threats against patients' lives . A service - oriented architecture is flexible and can support a combination of applications depending on telemedicine environmental changes . Therefore, this study was focused on designing a service - oriented architecture and security for remote medical services . If remote medical services are carried out in the iot environment, security vulnerability in the general remote medical setting and security vulnerability in the iot environment will both be present . Therefore, in this section, the remote medical security threats in the iot environment that take both conditions into consideration are extracted, and then security demands regarding these threats are described . We describe the threats that can occur if certain elements are not considered during the provision of remote medical services in the iot environment . 1) if device authentication is not taken into consideration: in other words, if access to all devices is indiscreetly permitted without certifying the device (or sensor) in the remote medical services in iot environment, the credibility of the collected medical data cannot be guaranteed . 2) if role and situation - based access control is not taken into consideration: accurate decision and control regarding various conditional device (or sensor) accesses, which can occur during the provision of remote medical services in the iot environment, will be difficult . 3) if user authentication is not taken into consideration: if authentication regarding patients and medical staff, who are the main agents of telemedicine, is not considered, remote monitoring, and control, are unclear . In such a case, preventing medical practice of unauthorized person, misuse of remote medical services, and accountability of medical practice will be impossible . In addition, security threats that can be caused by iot, as well as the structure and characteristics of remote medical services also exist, as seen in table 1 . Accordingly, we extracted threats from this case and table 1 to prevent security threats against remote medical services in the iot environment and to protect the privacy of patients . A method that can overcome the challenges regarding confidentiality, integrity, and availability is needed . Collection of various types of data from devices (or sensors) should be secure . Therefore, the following security requirements should be satisfied for the entire process from acquisition to destruction . Confidentiality: personal health information should not be disclosed to unauthorized access during transmission . Therefore, only authorized devices, networks, and users should be able to use the information after the authentication process between the perception layer, network layer, and application layer . Furthermore, a function that allows confidentiality selection should be provided regarding items related to invasion of privacy in which individual specifics exist . Integrity: the data transmitted by the sender and the data received by the receiver should be consistent . Measures including authentication, encryption, security channel, and others are requested for the protection of integrity during data transmission . An integrity protection measure is also necessary to prevent unauthorized data modification regarding previously stored data . Availability: delays, bottlenecks and other problems that degrade availability should not occur in data processing, even when it includes security measures with confidentiality, integrity, authentication, non - repudiation, and so on . In particular, sensitive devices and services that can be directly related to a patient's life, require 2 - 3 layers of guarantee measure for availability . Authentication: authentication is the process to determine whether or not someone is an actual user, and it is required before data access . In particular, access control of remote medical services considering a variety of factors should meet the demands for mobility and timeliness . Non - repudiation: non - repudiation is required to ensure accountability regarding specific acts . In the remote medical environment specifically, certification of authentication technology based on a public - key is required to secure reliability between medical activities . Privacy: privacy means that personal secrets cannot be disclosed without consent . In remote medical services with iot, security measures should be provided for handling sensitive information (e.g., name, address, health history, disease information, etc .) Related to individuals . The proposed framework is composed of a total of five layers, including the application service layer, service support layer, network layer, perception support layer, and perception layer . The application service layer offer a convenient user interface to patients, medical staff, and non - patients . It is supplied with data and resources from the service support layer based on requests by the service . In each of the service applications, independent service with reinforced security exists . The service support layer manages data and resources which serve as the basis for the efficient performance of the application service layer . It takes the data transmitted by the perception support layer and stores it in an integrated database through the second access controller . The service mgr (service management), data mgr (data management), resource mgr (resource management), and system clock manage and supply service, data, resource, and time data regarding the application service . The a_en / decryptor encrypts (or decrypts) the data received from the a_communicator . The a_communicator receives the data from the p_communicator, and then the data is forwarded to the second access controller (or a_en / decryptor). It handles direct and indirect data communication between the service support layer and perception support layer . The perception support layer collects the data received from the perception layer and controls bad data and unauthorized access . After that, it performs pretreatment to ensure that the data collected from different types of devices and sensors can be used appropriately . The p_encryptor encrypts the data received from the classifier, and the p_communicator sends the data that was received from the p_encryptor and classifier . The perception layer is the domain in which the device (or sensor) that creates data exists . Various types of data created in this layer are transmitted to the perception support layer . In the next section, we focus on the perception side layer and application side layers, which are the core territories of remote medical services with iot, in adding each network elements to propose framework, which will be separated into two sections, namely, the a - n section and n - p section, in the explanation . The n - p section refers to the perception support layer, perception layer, and network layer, while the a - n section refers to the application service layer, service support layer, and network layer . The a - n section of the proposed framework includes parts that perform important functions, including management of the application service layer and supplying data and resource, and thorough access control should be conducted regarding this . Access control is handled by the contextual - based access control (cbac) technique, which is based on time and spatial data and takes timely and migratory characteristics of the subject of control into consideration, as well as role - based access control (rbac), which allows flexible control in accordance with a complex environment and group . Next, we explain the access control process utilizing cbac and rbac . The terms and constraints used in cbac are presented in table 2 . Authentication by cbac: uses cbac, which is a technique that controls access through contextual information . It verifies whether the confirmed timely - spatial information and system standard time value are within the permitted range (min: minimum value, max: maximum value). If the result is true, access validity is decided after verification that the scanned access location is within the permitted location range . Authentication by rbac: in this stage, rbac is used, which controls access via role information . Limited to access with first round of authentication complete, the access profile of the service access attempter and previously registered access profile stored into db, are checked for consistency . If the result is true, the role is verified to check whether the requested role is an authorized role in deciding the second round of authentication . The n - p section is the part that handles device and sensor access as well as preprocessing, classification, and processing of the data received from it, and security measures during data processing should be available . Security during data processing uses data authentication, encryption, and security channel of reliable device . . Authentication of device: valid devices are identified by comparing the initially verified device i d and device i d with authorized access . In the case of a valid device, the device i d and the current time from the device (sensor) and collection gateway are put through exclusive - or . Then, based on the created value, each of the created otp values is compared in completion of the final first authentication . The device authentication process is shown in table 5 . In the proposed framework, for secure and prompt processing of various types of health data obtained from sensors and devices, the data is processed separately in classification stages, including preprocessing in a secure mode that processes it into an appropriate form for processing and an actual processing stage . Preprocessing: this stage divides the data into efficient data processing units and removes mixed in data that exceeds the range or is not permitted, prior to processing . In this stage, classification: security mode application usage is determined regarding data that has had unnecessary raw data and error values removed and separated into efficient processing units . The units are distributed into secure mode and normal mode with applied security processing in accordance with the mode value for each hardware i d defined in preprocessing . Processing: if general data without security application is processed, it is classified into normal mode, which applies the general processing method, and secure mode, which selectively applies security measures, including authentication, encryption, security channel, etc ., in situations requiring security . Next, we describe how the data classified into secure mode for the purposes of secure processing of data are processed . Table 6 shows an example that defines whether or not the security elements are applied to authentication, secure channel, data encryption regarding received data from applicable devices and sensors after the security mode has been determined for each device and sensor . As shown in figure 4, secure mode applies the security element in accordance with security level (1 - 3). Then, data encryption / decryption and secure channel are selectively applied, following the user definition . The applied method uses each hardware i d and application mode, encryption and security channel application execution of hardware i d and secure mode table as reference in processing . Authentication (essential): authentication, which is the process of verifying the validity of a user, blocks unauthorized access regarding important data or personal data that should kept confidential through authentication of data classified as secure mode . Data encryption / decryption (optional): by encrypting the data with a mathematically verified symmetric key encryption and algorithm, it prevents plaintext exposure of transmitted sensitive data . If the encrypted data was modulated during transmission, data integrity can also be verified because decoding is not possible . Secure channel (optional): during network transmission between two points, an asymmetric key encryption algorithm and electronic signature should be used to prevent exposure of transmission status and transmission data by composing a security channel (virtual network) during the connection of a separate sender and receiver in cases of data requiring stronger security . Here, we present a medical service scenario in which a secure remote medical service is provided in the iot environment with proposed framework application . Table 7 defines the medical service - oriented terms and figure 5 displays a diagram based on the proposed framework . Whether security technology is applied to each of stages - is explained in relation to the process . Transfer of perception data: verify through da between device (or sensor)-device (or sensor), device (or sensor)-collection gateway, and transmit data securely through sc, ded during data transmission . The collected data transferring and preprocessing from device (or sensor): after completing da on the collection gateway, cbac and rbac should be applied to transmit the collected data . If additional security is required, ded and sc should be used because they make it possible to provide strong security service ., transferred data update and access to electronic medical records: the ua used when accessing the electronic medical records of the medical staff and others, including ded, sc, cbac, and rbac are shown in ., providing the services to users: da is used when device and sensor transmit data from the user (non - patient, patient). On the other hand, when the user wishes to access a service, the ua is used . The application of cbac and rbac is required during data transmission between user - service; sc and ded are selectively provided for stronger security . Here, we describe various types of remote medical services and define common elements and structures that serve as a basis for remote medical services in the iot environment . In addition, the structural and functional limitations of the remote medical environment based on the defined elements are extracted . First,' remote treatment' is one type of medical service that is being developed that strives to overcome geographic and time - related obstacles . Remote treatment service was introduced for prisoners of the full sutton prison located in a suburb of the city of york by airedale nhs foundation trust of the united kingdom in 2006 . The kiosk - type unmanned telemedicine system' healthspot station', which was introduced on consumer electronics show (ces) in 2013, is an installation - type clinic where various types of physical examination in addition to video treatment by a doctor are possible within the designated space . This includes many services, such as welldoc bluestar, which is a remote diabetes management mobile software approved by the us food and drug administration, and phonedoctorx, which allows a professional medical team in a remote location to view the abnormal conditions that occur during regular nursing care of a facility resident via video phone to assist in decision - making . Next,' remote monitoring' started with technology introduced in the aerospace program of the former soviet union to detected the signals of living organisms for remote communication . This technology also made it possible for nasa to collect biometric data and check predictable physical funct ions in advance to allow for remote response while astronauts conducted their work . According to the frost & sullivan survey, the growth rate of the remote monitoring market has maintained double digits in the past 10 years, and it is currently expected to achieve remarkable advances in the development of wearable devices and data sensing technology centering on iot . Ultimately, this research will enable medical consumers, such as cancer patients and patients with chronic illnesses, to have their health condition constantly monitored by medical staff and to have a' designated doctor' who can provide them with medical services regardless of time and place . Finally, remote' diagnosistreatmentcontrol' management are being attempted along with various technological developments . Sunnyvale, ca, usa), which is famous for application in robot - assisted surgical procedures, has proven the effect by attempting an operation from a remote location focusing on many large domestic hospitals . In addition, ibm watson analyzes big data within 3 seconds, focusing on 600,000 clinical data and 42 medically related db, in providing a practical advice service to medical staff . Furthermore, asklepios hospital, located in hamburg, germany, has attempted to utilize augmented reality by overlapping an actual photograph based on a pre - operation clinical image of the patient in operation . Various efforts are being made around the world to provide diverse remote medical services, including changi general hospital in singapore, which uses qr codes to manage personalized administration for each patient via robot . The technology that serves as the basis for the remote medical services mentioned above is presented in figure 1 . The structure makes data collection from sensors and devices, pro cessing, transmission, execution, analysis, and other actions possible to support remote medical services . For remote medical services in such a structure, change in service is inevitable in accordance with sub - elements, including network technology, protocol, sensor, device, etc . Also, there is a constraint in that the structure should be restructured whenever a new service is created . The same problem occurs when a security service and technology is applied to a remote medical environment . When the required factors of iot, human, object, and service are applied to the remote medical environment,' human' is subdivided into classifications of patient, medical personnel, and non - patient .' Object' refers to all objects and infrastructure on the internet located around the' human' element, in other words patients, medical personnel, and non - patients . Lastly,' service' is media that expresses and supports medical communication between human - object - infrastructure . Accordingly, remote medical services with an iot architecture can be classified into the following three layers: 1) the perception layer, which receives health signal entries from various sensors; 2) the network layer, which takes on the role of transmitting the health data from the perception layer to the application layer; and 3) the application layer, which provides various services and interfaces via the health data received from the network layer . Consequently, the security elements of the remote medical architecture should be included at the initial design level because simple cyber - attacks can be directly connected to threats against patients' lives . A service - oriented architecture is flexible and can support a combination of applications depending on telemedicine environmental changes . Therefore, this study was focused on designing a service - oriented architecture and security for remote medical services . If remote medical services are carried out in the iot environment, security vulnerability in the general remote medical setting and security vulnerability in the iot environment will both be present . Therefore, in this section, the remote medical security threats in the iot environment that take both conditions into consideration are extracted, and then security demands regarding these threats are described . We describe the threats that can occur if certain elements are not considered during the provision of remote medical services in the iot environment . 1) if device authentication is not taken into consideration: in other words, if access to all devices is indiscreetly permitted without certifying the device (or sensor) in the remote medical services in iot environment, the credibility of the collected medical data cannot be guaranteed . 2) if role and situation - based access control is not taken into consideration: accurate decision and control regarding various conditional device (or sensor) accesses, which can occur during the provision of remote medical services in the iot environment, will be difficult . 3) if user authentication is not taken into consideration: if authentication regarding patients and medical staff, who are the main agents of telemedicine, is not considered, remote monitoring, and control, are unclear . In such a case, preventing medical practice of unauthorized person, misuse of remote medical services, and accountability of medical practice will be impossible . In addition, security threats that can be caused by iot, as well as the structure and characteristics of remote medical services also exist, as seen in table 1 . Accordingly, we extracted threats from this case and table 1 to prevent security threats against remote medical services in the iot environment and to protect the privacy of patients . A method that can overcome the challenges regarding confidentiality, integrity, and availability is needed . Collection of various types of data from devices (or sensors) should be secure . Therefore, the following security requirements should be satisfied for the entire process from acquisition to destruction . Confidentiality: personal health information should not be disclosed to unauthorized access during transmission . Therefore, only authorized devices, networks, and users should be able to use the information after the authentication process between the perception layer, network layer, and application layer . Furthermore, a function that allows confidentiality selection should be provided regarding items related to invasion of privacy in which individual specifics exist . Integrity: the data transmitted by the sender and the data received by the receiver should be consistent . Measures including authentication, encryption, security channel, and others are requested for the protection of integrity during data transmission . An integrity protection measure is also necessary to prevent unauthorized data modification regarding previously stored data . Availability: delays, bottlenecks and other problems that degrade availability should not occur in data processing, even when it includes security measures with confidentiality, integrity, authentication, non - repudiation, and so on . In particular, sensitive devices and services that can be directly related to a patient's life, require 2 - 3 layers of guarantee measure for availability . Authentication: authentication is the process to determine whether or not someone is an actual user, and it is required before data access . In particular, access control of remote medical services considering a variety of factors should meet the demands for mobility and timeliness . Non - repudiation: non - repudiation is required to ensure accountability regarding specific acts . In the remote medical environment specifically, certification of authentication technology based on a public - key is required to secure reliability between medical activities . Privacy: privacy means that personal secrets cannot be disclosed without consent . In remote medical services with iot, security measures should be provided for handling sensitive information (e.g., name, address, health history, disease information, etc .) We describe the threats that can occur if certain elements are not considered during the provision of remote medical services in the iot environment . 1) if device authentication is not taken into consideration: in other words, if access to all devices is indiscreetly permitted without certifying the device (or sensor) in the remote medical services in iot environment, the credibility of the collected medical data cannot be guaranteed . 2) if role and situation - based access control is not taken into consideration: accurate decision and control regarding various conditional device (or sensor) accesses, which can occur during the provision of remote medical services in the iot environment, will be difficult . 3) if user authentication is not taken into consideration: if authentication regarding patients and medical staff, who are the main agents of telemedicine, is not considered, remote monitoring, and control, are unclear . In such a case, preventing medical practice of unauthorized person, misuse of remote medical services, and accountability of medical practice will be impossible . In addition, security threats that can be caused by iot, as well as the structure and characteristics of remote medical services also exist, as seen in table 1 . Accordingly, we extracted threats from this case and table 1 to prevent security threats against remote medical services in the iot environment and to protect the privacy of patients . A method that can overcome the challenges regarding confidentiality, integrity, and availability is needed . Collection of various types of data from devices (or sensors) should be secure . Also remote medical services should not be modified or wiretapped during transmission . Therefore, the following security requirements should be satisfied for the entire process from acquisition to destruction . Confidentiality: personal health information should not be disclosed to unauthorized access during transmission . Therefore, only authorized devices, networks, and users should be able to use the information after the authentication process between the perception layer, network layer, and application layer . Furthermore, a function that allows confidentiality selection should be provided regarding items related to invasion of privacy in which individual specifics exist . Integrity: the data transmitted by the sender and the data received by the receiver should be consistent . Measures including authentication, encryption, security channel, and others are requested for the protection of integrity during data transmission . An integrity protection measure is also necessary to prevent unauthorized data modification regarding previously stored data . Availability: delays, bottlenecks and other problems that degrade availability should not occur in data processing, even when it includes security measures with confidentiality, integrity, authentication, non - repudiation, and so on . In particular, sensitive devices and services that can be directly related to a patient's life, require 2 - 3 layers of guarantee measure for availability . Authentication: authentication is the process to determine whether or not someone is an actual user, and it is required before data access . In particular, access control of remote medical services considering a variety of factors should meet the demands for mobility and timeliness . Non - repudiation: non - repudiation is required to ensure accountability regarding specific acts . In the remote medical environment specifically, certification of authentication technology based on a public - key is required to secure reliability between medical activities . Privacy: privacy means that personal secrets cannot be disclosed without consent . In remote medical services with iot, security measures should be provided for handling sensitive information (e.g., name, address, health history, disease information, etc .) The proposed framework is composed of a total of five layers, including the application service layer, service support layer, network layer, perception support layer, and perception layer . The application service layer offer a convenient user interface to patients, medical staff, and non - patients . It is supplied with data and resources from the service support layer based on requests by the service . In each of the service applications, independent service with reinforced security exists . The service support layer manages data and resources which serve as the basis for the efficient performance of the application service layer . It takes the data transmitted by the perception support layer and stores it in an integrated database through the second access controller . The service mgr (service management), data mgr (data management), resource mgr (resource management), and system clock manage and supply service, data, resource, and time data regarding the application service . The a_en / decryptor encrypts (or decrypts) the data received from the a_communicator . The a_communicator receives the data from the p_communicator, and then the data is forwarded to the second access controller (or a_en / decryptor). It handles direct and indirect data communication between the service support layer and perception support layer . The perception support layer collects the data received from the perception layer and controls bad data and unauthorized access . After that, it performs pretreatment to ensure that the data collected from different types of devices and sensors can be used appropriately . The p_encryptor encrypts the data received from the classifier, and the p_communicator sends the data that was received from the p_encryptor and classifier . The perception layer is the domain in which the device (or sensor) that creates data exists . Various types of data created in this layer are transmitted to the perception support layer . In the next section, we focus on the perception side layer and application side layers, which are the core territories of remote medical services with iot, in adding each network elements to propose framework, which will be separated into two sections, namely, the a - n section and n - p section, in the explanation . The n - p section refers to the perception support layer, perception layer, and network layer, while the a - n section refers to the application service layer, service support layer, and network layer . The a - n section of the proposed framework includes parts that perform important functions, including management of the application service layer and supplying data and resource, and thorough access control should be conducted regarding this . Access control is handled by the contextual - based access control (cbac) technique, which is based on time and spatial data and takes timely and migratory characteristics of the subject of control into consideration, as well as role - based access control (rbac), which allows flexible control in accordance with a complex environment and group . Authentication by cbac: uses cbac, which is a technique that controls access through contextual information . It verifies whether the confirmed timely - spatial information and system standard time value are within the permitted range (min: minimum value, max: maximum value). If the result is true, access validity is decided after verification that the scanned access location is within the permitted location range . Authentication by rbac: in this stage, rbac is used, which controls access via role information . Limited to access with first round of authentication complete, the access profile of the service access attempter and previously registered access profile stored into db, are checked for consistency . If the result is true, the role is verified to check whether the requested role is an authorized role in deciding the second round of authentication . The n - p section is the part that handles device and sensor access as well as preprocessing, classification, and processing of the data received from it, and security measures during data processing should be available . Security during data processing uses data authentication, encryption, and security channel of reliable device . . Authentication of device: valid devices are identified by comparing the initially verified device i d and device i d with authorized access . In the case of a valid device, the device i d and the current time from the device (sensor) and collection gateway are put through exclusive - or . Then, based on the created value, each of the created otp values is compared in completion of the final first authentication . In the proposed framework, for secure and prompt processing of various types of health data obtained from sensors and devices, the data is processed separately in classification stages, including preprocessing in a secure mode that processes it into an appropriate form for processing and an actual processing stage . Preprocessing: this stage divides the data into efficient data processing units and removes mixed in data that exceeds the range or is not permitted, prior to processing . In this stage, classification: security mode application usage is determined regarding data that has had unnecessary raw data and error values removed and separated into efficient processing units . The units are distributed into secure mode and normal mode with applied security processing in accordance with the mode value for each hardware i d defined in preprocessing . Processing: if general data without security application is processed, it is classified into normal mode, which applies the general processing method, and secure mode, which selectively applies security measures, including authentication, encryption, security channel, etc ., in situations requiring security . Next, we describe how the data classified into secure mode for the purposes of secure processing of data are processed . Table 6 shows an example that defines whether or not the security elements are applied to authentication, secure channel, data encryption regarding received data from applicable devices and sensors after the security mode has been determined for each device and sensor . As shown in figure 4, secure mode applies the security element in accordance with security level (1 - 3). Then, data encryption / decryption and secure channel are selectively applied, following the user definition . The applied method uses each hardware i d and application mode, encryption and security channel application execution of hardware i d and secure mode table as reference in processing . Authentication (essential): authentication, which is the process of verifying the validity of a user, blocks unauthorized access regarding important data or personal data that should kept confidential through authentication of data classified as secure mode . Data encryption / decryption (optional): by encrypting the data with a mathematically verified symmetric key encryption and algorithm, it prevents plaintext exposure of transmitted sensitive data . If the encrypted data was modulated during transmission, data integrity can also be verified because decoding is not possible . Secure channel (optional): during network transmission between two points, an asymmetric key encryption algorithm and electronic signature should be used to prevent exposure of transmission status and transmission data by composing a security channel (virtual network) during the connection of a separate sender and receiver in cases of data requiring stronger security . The a - n section of the proposed framework includes parts that perform important functions, including management of the application service layer and supplying data and resource, and thorough access control should be conducted regarding this . Access control is handled by the contextual - based access control (cbac) technique, which is based on time and spatial data and takes timely and migratory characteristics of the subject of control into consideration, as well as role - based access control (rbac), which allows flexible control in accordance with a complex environment and group . Authentication by cbac: uses cbac, which is a technique that controls access through contextual information . It verifies whether the confirmed timely - spatial information and system standard time value are within the permitted range (min: minimum value, max: maximum value). If the result is true, access validity is decided after verification that the scanned access location is within the permitted location range . Authentication by rbac: in this stage, rbac is used, which controls access via role information . Limited to access with first round of authentication complete, the access profile of the service access attempter and previously registered access profile stored into db, are checked for consistency . If the result is true, the role is verified to check whether the requested role is an authorized role in deciding the second round of authentication . The n - p section is the part that handles device and sensor access as well as preprocessing, classification, and processing of the data received from it, and security measures during data processing should be available . Security during data processing uses data authentication, encryption, and security channel of reliable device . . Authentication of device: valid devices are identified by comparing the initially verified device i d and device i d with authorized access . In the case of a valid device, the device i d and the current time from the device (sensor) and collection gateway are put through exclusive - or . Then, based on the created value, each of the created otp values is compared in completion of the final first authentication . The device authentication process is shown in table 5 . In the proposed framework, for secure and prompt processing of various types of health data obtained from sensors and devices, the data is processed separately in classification stages, including preprocessing in a secure mode that processes it into an appropriate form for processing and an actual processing stage . Preprocessing: this stage divides the data into efficient data processing units and removes mixed in data that exceeds the range or is not permitted, prior to processing . In this stage, classification: security mode application usage is determined regarding data that has had unnecessary raw data and error values removed and separated into efficient processing units . The units are distributed into secure mode and normal mode with applied security processing in accordance with the mode value for each hardware i d defined in preprocessing . Processing: if general data without security application is processed, it is classified into normal mode, which applies the general processing method, and secure mode, which selectively applies security measures, including authentication, encryption, security channel, etc ., in situations requiring security . Next, we describe how the data classified into secure mode for the purposes of secure processing of data are processed . Table 6 shows an example that defines whether or not the security elements are applied to authentication, secure channel, data encryption regarding received data from applicable devices and sensors after the security mode has been determined for each device and sensor . As shown in figure 4, secure mode applies the security element in accordance with security level (1 - 3). Then, data encryption / decryption and secure channel are selectively applied, following the user definition . The applied method uses each hardware i d and application mode, encryption and security channel application execution of hardware i d and secure mode table as reference in processing . Authentication (essential): authentication, which is the process of verifying the validity of a user, blocks unauthorized access regarding important data or personal data that should kept confidential through authentication of data classified as secure mode . Data encryption / decryption (optional): by encrypting the data with a mathematically verified symmetric key encryption and algorithm, it prevents plaintext exposure of transmitted sensitive data . If the encrypted data was modulated during transmission, data integrity can also be verified because decoding is not possible . Secure channel (optional): during network transmission between two points, an asymmetric key encryption algorithm and electronic signature should be used to prevent exposure of transmission status and transmission data by composing a security channel (virtual network) during the connection of a separate sender and receiver in cases of data requiring stronger security . Here, we present a medical service scenario in which a secure remote medical service is provided in the iot environment with proposed framework application . Table 7 defines the medical service - oriented terms and figure 5 displays a diagram based on the proposed framework . Whether security technology is applied to each of stages - is explained in relation to the process . Transfer of perception data: verify through da between device (or sensor)-device (or sensor), device (or sensor)-collection gateway, and transmit data securely through sc, ded during data transmission . The collected data transferring and preprocessing from device (or sensor): after completing da on the collection gateway, cbac and rbac should be applied to transmit the collected data . If additional security is required, ded and sc should be used because they make it possible to provide strong security service ., transferred data update and access to electronic medical records: the ua used when accessing the electronic medical records of the medical staff and others, including ded, sc, cbac, and rbac are shown in ., providing the services to users: da is used when device and sensor transmit data from the user (non - patient, patient). On the other hand, when the user wishes to access a service, the ua is used . The application of cbac and rbac is required during data transmission between user - service; sc and ded are selectively provided for stronger security . Excluding survey - type theses from the previous research considered, four studies that took confidentiality, integrity, availability, and privacy into consideration were used in conducting a comparative analysis against the proposed framework . The comparative analysis of the proposed framework was conducted with the security element as the standard, which was the selection standard of the previous research and previous studies . Confidentiality: the proposed framework provides confidentiality via device- and user - based authentication and status- and role - based access control and security channel, encryption, etc ., for the purpose of confidentiality between device (or sensor), device (or sensor)-collection gateway, service and user . Mentioned the network structure and secure transmission regarding health information exchange via verified encryption and hash algorithm . Li et al . Mainly focused on secure patient - oriented personal health record access and efficient key management . Suggested maintaining confidentiality via an adaptive management model and focused on the role of security metrics . Tested authentication and authorization in the iot healthcare environment through a certificate - based dtls handshake protocol - based structure and proposed a technology for ip confidentiality in the iot environment . Integrity: if an integrity verification measure is not available during data transmission and reception, there is a concern about too much data modulation; this is particularly important in the case of medical data . Accordingly, to guarantee integrity, it should be possible to check for data modulation in each section . In the proposed structure, the integrity of transmitted and received data in each section is guaranteed through the first and second authentication . Proposed an encryption and hash algorithm for network - focused health information exchange; verification is not performed in each section . In addition, as there is no mention of non - repudiation, it is difficult to ensure accountability regarding medical care . Li et al . Attempted to prevent access to unauthorized self - health information and to ensure accountability regarding data access . In savola et al ., role metrics on access control exists; however, there is no specific mention about that method of access control . Availability: the framework proposed in this paper makes it possible to selectively apply encryption and a security channel that excludes authentication in each section, in providing confidentiality and integrity; thus, flexibly securing availability is possible . The framework proposed by zaidan et al . Was designed only taking confidentiality and integrity into consideration . The method proposed by li et al . Raises a concern because it can decrease availability in an environment where large amounts of data are obtained from various types of devices and sensors . Proposed availability metrics that include various elements, such as qos, resilience, scalability, etc ., but there is no specific mention about details . Is structurally dispersed in key management and is comparatively more secure than the state of the art centralized delegation - based structure; therefore, it is more secure from availability attack . Privacy: the proposed framework decreases the exposure of sensitive information compared to other studies by applying a security channel and encryption during the transmission of sensitive information between network sections . Also, privacy is made more secure by only allowing personnel with authorized roles to access data within the permitted time regarding specific medical staff and by applying ua, cbac, rbac during emr access by the medical staff . Discussed privacy protection through privacy metrics, but they did not suggest a specific method . Excluding survey - type theses from the previous research considered, four studies that took confidentiality, integrity, availability, and privacy into consideration were used in conducting a comparative analysis against the proposed framework . The comparative analysis of the proposed framework was conducted with the security element as the standard, which was the selection standard of the previous research and previous studies . Confidentiality: the proposed framework provides confidentiality via device- and user - based authentication and status- and role - based access control and security channel, encryption, etc ., for the purpose of confidentiality between device (or sensor), device (or sensor)-collection gateway, service and user . Mentioned the network structure and secure transmission regarding health information exchange via verified encryption and hash algorithm . Li et al . Mainly focused on secure patient - oriented personal health record access and efficient key management . Suggested maintaining confidentiality via an adaptive management model and focused on the role of security metrics . Tested authentication and authorization in the iot healthcare environment through a certificate - based dtls handshake protocol - based structure and proposed a technology for ip confidentiality in the iot environment . Integrity: if an integrity verification measure is not available during data transmission and reception, there is a concern about too much data modulation; this is particularly important in the case of medical data . Accordingly, to guarantee integrity, it should be possible to check for data modulation in each section . In the proposed structure, the integrity of transmitted and received data in each section is guaranteed through the first and second authentication . Proposed an encryption and hash algorithm for network - focused health information exchange; verification is not performed in each section . In addition, as there is no mention of non - repudiation, it is difficult to ensure accountability regarding medical care . Li et al . Attempted to prevent access to unauthorized self - health information and to ensure accountability regarding data access . In savola et al ., role metrics on access control exists; however, there is no specific mention about that method of access control . Availability: the framework proposed in this paper makes it possible to selectively apply encryption and a security channel that excludes authentication in each section, in providing confidentiality and integrity; thus, flexibly securing availability is possible . The framework proposed by zaidan et al . Was designed only taking confidentiality and integrity into consideration . The method proposed by li et al . Raises a concern because it can decrease availability in an environment where large amounts of data are obtained from various types of devices and sensors . Proposed availability metrics that include various elements, such as qos, resilience, scalability, etc ., but there is no specific mention about details . Is structurally dispersed in key management and is comparatively more secure than the state of the art centralized delegation - based structure; therefore, it is more secure from availability attack . Privacy: the proposed framework decreases the exposure of sensitive information compared to other studies by applying a security channel and encryption during the transmission of sensitive information between network sections . Also, privacy is made more secure by only allowing personnel with authorized roles to access data within the permitted time regarding specific medical staff and by applying ua, cbac, rbac during emr access by the medical staff . Discussed privacy protection through privacy metrics, but they did not suggest a specific method . Utilizing the databases of pubmed, springer, ieee, science - direct, bmc thesis,' remote medical' and' iot' were searched under the and condition, and' telehealth',' mobile health',' telemedicine' were each searched under a combination of or condition . As a result, approximately 1,200 papers were searched, and among these, a total of 30 were extracted based on a standard of abstract containing security elements . As with the security threats classified in table 1, the searched papers were classified into device (or sensor), infrastructure, and service for discussion of the previous research in each category . Device (included sensor): doukas et al . Described digital certificates and pki data encryption based on a gateway for aggregation of health sensor data and to resolve security problems . Hsu and pan proposed agent - based telemedicine based on a p2p networking architecture . Explained the main security goals for the next generation of implantable medical devices and analyzed the most relevant protection mechanisms . It focuses on protection of shared data's collection and lost / stolen device's data . Infrastructure: saleem et al . Propose a framework for security based on ieee 802.15.4 . Also, in, the security vulnerabilities and major attacks in the context of wireless body area network (wban) were identified . Zhang and zhang introduced a secure and flexible platform based on iot and cloud computing that uses short - distant ambient communication protocols for medical purposes . Chen et al . Proposed an enhanced authentication scheme that overcomes the weaknesses inherent in khan et al . 's scheme, and they demonstrated that their scheme is more secure and robust for use in a telecare medical information system . Al ameen et al . Described security and privacy issues in wban, and they proposed measures for healthcare application in wban . Focused on a multiple data owner scenario and divided the users in the phr system into multiple security domains . Jiang et al . Proposed a secure and efficient authentication scheme with user privacy preservation which is practical for a telecare medical information system . Das and goswami proposed a robust remote user authentication scheme for connected health care that preserves uniqueness and anonymity . Kim and lee proposed cryptanalysis that discourages any use of the two schemes under investigation in practice, and they revealed some subtleties and challenges in designing this type of scheme . Das and goswami proposed a novel and secure biometric - based remote user authentication scheme to withstand the security flaw found in awasthi - srivastava scheme and enhanced the features required for an idle user authentication scheme . Is more secure than a state - of - the - art centralized delegation - based architecture because it uses a more secure key management scheme between sensor nodes and the smart gateway . Proposed their secure framework for health information transmission within a central cloud - based model . Service for remote medical: savola et al . Proposed adaptive security management mechanism based on security metrics . And they described protection methods of confidentiality, integrity, availability in ehealth iot application . Shin introduced a framework for secure remote health - monitoring systems using a realistic risk model for sensor - data quality . Abie and balasingham described a risk - based adaptive security framework for iots in ehealth that estimates and predicts risk damages and future benefits using game theory and context - awareness techniques . The framework proposed by al - haj and amer is implemented on a block - level of the partitioned - image for integrity, thus enabling the localized detection of tampered regions . In table 9, the searched papers were first classified into device, infrastructure, and service . Then, they were sorted according to how they include the main security elements, such as confidentiality, integrity, availability, and privacy in understanding the characteristics and tendency of previous researches related to remote medical security . In the infrastructure field, it is evident that many studies took various security elements into consideration . However, it is evident that there has been less research in this area than in the device and service fields . Accordingly, there is a need to reflect various security elements in all domains of service, infrastructure, and device . As the demands and expectations regarding medical services are increasing, various new medical services are being introduced . In particular, there is much interest regarding possible medical activities via remote medical services from long distance, and this is being combined with the new concept of the iot . However, security element support has remained weak, with security being impossible in some cases or only partial security elements being provided regarding the modification of existing services and the creation of new service . Accordingly, remote medical security in the iot environment requires a new structure and method to prevent various threats directly connected to the safety of patients' lives . This paper proposed a service - oriented security framework for remote medical services in the iot environment . The proposed framework is a service - oriented structure that can support dynamic security elements in accordance with demands regarding various types of new remote medical services that will be created in the iot environment, which will soon be realized . It enables the provision of secure services that guarantee confidentiality, integrity, and availability for all, including patients, non - patients, and medical staff . Security elements are realized via role- and situation - based access control, user access control, data encryption, and the provision of a security channel . In future studies, we will conduct an in - depth study regarding techniques that can satisfy demands in accordance with key generation and management . In addition, we plan to enhance the efficiency and availability of the authentication method in the iot remote medical environment . Utilizing the databases of pubmed, springer, ieee, science - direct, bmc thesis,' remote medical' and' iot' were searched under the and condition, and' telehealth',' mobile health',' telemedicine' were each searched under a combination of or condition . As a result, approximately 1,200 papers were searched, and among these, a total of 30 were extracted based on a standard of abstract containing security elements . As with the security threats classified in table 1, the searched papers were classified into device (or sensor), infrastructure, and service for discussion of the previous research in each category . Device (included sensor): doukas et al . Described digital certificates and pki data encryption based on a gateway for aggregation of health sensor data and to resolve security problems . Hsu and pan proposed agent - based telemedicine based on a p2p networking architecture . Explained the main security goals for the next generation of implantable medical devices and analyzed the most relevant protection mechanisms . It focuses on protection of shared data's collection and lost / stolen device's data . Infrastructure: saleem et al . Propose a framework for security based on ieee 802.15.4 . Also, in, the security vulnerabilities and major attacks in the context of wireless body area network (wban) were identified . Zhang and zhang introduced a secure and flexible platform based on iot and cloud computing that uses short - distant ambient communication protocols for medical purposes . Chen et al . Proposed an enhanced authentication scheme that overcomes the weaknesses inherent in khan et al . 's scheme, and they demonstrated that their scheme is more secure and robust for use in a telecare medical information system . Al ameen et al . Described security and privacy issues in wban, and they proposed measures for healthcare application in wban . Focused on a multiple data owner scenario and divided the users in the phr system into multiple security domains . Jiang et al . Proposed a secure and efficient authentication scheme with user privacy preservation which is practical for a telecare medical information system . Das and goswami proposed a robust remote user authentication scheme for connected health care that preserves uniqueness and anonymity . Kim and lee proposed cryptanalysis that discourages any use of the two schemes under investigation in practice, and they revealed some subtleties and challenges in designing this type of scheme . Das and goswami proposed a novel and secure biometric - based remote user authentication scheme to withstand the security flaw found in awasthi - srivastava scheme and enhanced the features required for an idle user authentication scheme . Is more secure than a state - of - the - art centralized delegation - based architecture because it uses a more secure key management scheme between sensor nodes and the smart gateway . Proposed their secure framework for health information transmission within a central cloud - based model . Service for remote medical: savola et al . Proposed adaptive security management mechanism based on security metrics . And they described protection methods of confidentiality, integrity, availability in ehealth iot application . Shin introduced a framework for secure remote health - monitoring systems using a realistic risk model for sensor - data quality . Abie and balasingham described a risk - based adaptive security framework for iots in ehealth that estimates and predicts risk damages and future benefits using game theory and context - awareness techniques . The framework proposed by al - haj and amer is implemented on a block - level of the partitioned - image for integrity, thus enabling the localized detection of tampered regions . In table 9, the searched papers were first classified into device, infrastructure, and service . Then, they were sorted according to how they include the main security elements, such as confidentiality, integrity, availability, and privacy in understanding the characteristics and tendency of previous researches related to remote medical security . In the infrastructure field, it is evident that many studies took various security elements into consideration . However, it is evident that there has been less research in this area than in the device and service fields . Accordingly, there is a need to reflect various security elements in all domains of service, infrastructure, and device . As the demands and expectations regarding medical services are increasing, various new medical services are being introduced . In particular, there is much interest regarding possible medical activities via remote medical services from long distance, and this is being combined with the new concept of the iot . However, security element support has remained weak, with security being impossible in some cases or only partial security elements being provided regarding the modification of existing services and the creation of new service . Accordingly, remote medical security in the iot environment requires a new structure and method to prevent various threats directly connected to the safety of patients' lives . This paper proposed a service - oriented security framework for remote medical services in the iot environment . The proposed framework is a service - oriented structure that can support dynamic security elements in accordance with demands regarding various types of new remote medical services that will be created in the iot environment, which will soon be realized . It enables the provision of secure services that guarantee confidentiality, integrity, and availability for all, including patients, non - patients, and medical staff . Security elements are realized via role- and situation - based access control, user access control, data encryption, and the provision of a security channel . In future studies, we will conduct an in - depth study regarding techniques that can satisfy demands in accordance with key generation and management . In addition, we plan to enhance the efficiency and availability of the authentication method in the iot remote medical environment.
|
A confirmed case was defined as invasive disease caused by n. meningitidis of serogroup w135 2a p1.2,5 or belonging to the et-37 complex . A probable case was defined as illness in a pilgrim or a pilgrim contact, with either invasive disease due to n. meningitidis serogroup w135 of unknown serotype (identified by polymerase chain reaction [pcr] or detection of specific antigens) or with a clinical diagnosis of invasive meningococcal infection without microbiologic confirmation . Cases included were those with dates of hospital admission from march 18, 2000, until july 31, 2000 . Nonpilgrim case - patients were classified as 1) living in the same household as a pilgrim during the 7 days before the date of onset, 2) being in contact with a pilgrim but not living in the same household during the 7 days before the date of onset, or 3) having no identified contact with a pilgrim . A questionnaire was sent by e - mail in april 2000 to the national surveillance centers in europe, and interviews of cases were conducted by telephone or in person . For each case, information was anonymously requested on demography, ethnicity, clinical symptoms, medical history, housing situation, meningococcal vaccination history, contact with hajj 2000 pilgrims, and travel to saudi arabia . Additionally, the number of visas delivered for the hajj 2000 was obtained from saudi embassies, and information was collected in france on the observance of the specific prophylactic measures for pilgrims and their household contacts . As cases occurred predominantly in france and the uk, only these two countries were considered in further analysis . The case - fatality rate (cfr) observed in cases from france was compared with the cfr of all n. meningitidis infections reported to the national surveillance system in france during 19951999 . The same comparison was performed for the uk . The probability of dying from the outbreak strain was estimated for france and the uk by using a logistic regression model . In addition to the outcome (death), variables included in the model were age and having an epidemic case versus a national surveillance case . Consecutively, the age - adjusted relative risks (rr) of dying from the epidemic were estimated from the odd ratios by the log link function . To evaluate the impact of the french control measures implemented on april 8, we compared the number of cases in france with those in the uk before and after april 8 for a) pilgrim and household contacts, and b) out - of - household contacts and those for whom no contact with a pilgrim was identified . The ratio of cases in france after and before the intervention was compared with the same ratio in the uk . An effective intervention would be expected to result in a measure of impact less than one, and vice versa . The descriptive analysis was carried out with epi info (centers for disease control and prevention, version 6.04c). The logistic regression was performed with stata version 6.0 (stata corporation, college station, tx). Data on cases reported during 19951999 were issued from the public health laboratory service in the uk and from the institut de veille sanitaire in france . From march 18 to july 31, 2000, some 90 cases of serogroup w135 meningococcal disease were ascertained from nine european countries (the uk, france, the netherlands, germany, finland, sweden, belgium, switzerland, and norway) (figure 1). Questionnaires were fully completed for 80 cases (89%), and partly completed for 10 cases . Eighty - four isolates (93%) were confirmed as n. meningitidis serogroup w135 serotype 2a subtype p1.2,5 . Six probable cases were diagnosed by soluble antigen detection (one case) or pcr (five cases). Cases of w135 meningococcal disease reported per country in europe after hajj 2000, march 18july 30, 2000 . The peak of the outbreak was rapidly reached in week 14, two weeks after the first return of pilgrims from mecca . Since that time of 90 cases, 45 (50%) occurred during the first 4 weeks after the first return of pilgrims . In the uk, the first reported cases occurred within 1 week after the hajj and increased rapidly to a peak of 12 cases in week 14 (figure 2b). In france, the outbreak started and peaked in week 13 (figure 2c). For the other countries, cases occurred sporadically during the 4 months after the hajj . Cases of w135 invasive meningococcal disease by week of hospital admission, march 1july 2000: a. europe (90 cases), b. the united kingdom (42 cases), and c. france (24 cases). Twelve cases (13%) were in pilgrims (all vaccinated with vaccine against meningitis a and c before traveling to mecca), 31 (34%) in household contacts of a pilgrim, and 21 (23%) in contacts outside the household; for 26 cases (29%), no pilgrim contact was identified . A total of 19,749 pilgrims from the uk and 19,100 from france participated in the hajj 2000 . Eight cases of meningococcal disease occurred in the uk and four in france, giving incidence rates in the pilgrim population of 41 and 21/100,000, respectively . No cases occurred in pilgrims from other countries, although germany had 18,000 pilgrims and the netherlands had 4,500 pilgrims . For finland, sweden, belgium, switzerland, and norway, pilgrims were affected first (all cases in pilgrims were reported in the 4 weeks after the hajj): the peak of cases occurred in week 13, household contacts cases peaked in week 14, out - of - household contact cases peaked in week 16, and cases with unknown or no identified contact with a pilgrim peaked in week 19 (figure 3). Cases of w135 invasive meningococcal disease, by week of hospital admission and type of contact, europe, march forty - seven (54%) of the 87 patients whose sex was known were female . Fifty - one (65%) of the 78 nonpilgrim patients were <5 years of age . The median age of the pilgrim patients was 51 years; for nonpilgrims, it was 2 years . Information on clinical features was available for 69 cases, including meningitis (30 cases), septicemia (23 cases), or both (16 cases). Arthritis (six cases), osteomyelitis (one), and pneumonia (one) were also reported from patients with septicemia . Thirteen patients had underlying long - term diseases, but none had preexisting immunodeficiency . In the uk, 75% of patients were of indian ethnicity; in france, the majority (74%) were north african . Fourteen patients died (cfr 15.6%, 14/90) (table 1). In france, 4 (16.7%) of 24 case - patients died, compared with 152 (10.3%) of 1,481) observed for meningococcal disease due to all serogroups of n. meningitidis in france from 1995 to 1999 . The age - adjusted rr of dying during the outbreak was 1.26, (95% ci [0.52; 3.06], p=0.63). In the uk, 8 (19.0%) of 42 patients died, compared with 862 (8.3%) of 10,448 observed for meningococcal disease due to all serogroups of n. meningitidis in the uk during19951999 . The age - adjusted rr was 1.99 (confidence interval 1.02; 2.74, p=0.06). There was no evidence that the rr in france differed from the rr in the uk (p=0.55). The netherlands, germany, finland, sweden, belgium, norway, and switzerland . The median length of stay in saudi arabia for pilgrim case - patients was 21 days (range 1440). The median interval between the beginning of the hajj and the date of onset of disease was 16 days (range 1129); the median interval between return from the pilgrimage and the onset of disease was 2 days (range 08). Among cases with pilgrim contact, the median interval between return of the pilgrim from mecca and onset of disease was 8 days for household contacts and 6.5 days for out - of - household contacts (p=0.58). Further characteristics of pilgrim cases and cases by type of contact with a pilgrim are shown in table 2 . Regarding the assessment of the french recommendations, the comparison between france and the uk of the ratio of cases after and before interventions were put in place was 2.43 for pilgrims and their household contacts . This result of> 1 yields no evidence that the french measures had a positive impact in preventing cases in pilgrims and their household contacts (p=0.27) (table 3). The ratio among out - of - household and no known contacts was 0.56, indicating a possible positive impact of the measures in limiting the spread of the outbreak strain, although the result was not statistically significant (p=0.62). Ratio is divided by the same ratio in the united kingdom and its 95% confidence interval . An international coordination group was set up within 2 weeks after the outbreak was recognized in europe, followed by an early warning alert to all the european countries . This facilitated information sharing, standardization of the case definition, and implementation of a standardized questionnaire for the investigation . The willingness of participant countries led to a satisfactory completion rate for reports, allowing a precise description of the outbreak throughout europe . However, case ascertainment may have varied in different countries since some countries identified cases through microbiologic findings only and some through clinical as well as microbiologic findings . In 1987, an outbreak of meningococcal disease linked to the hajj was described in several european countries, but the description was limited to pilgrim cases and a few secondary cases (13). In the hajj 2000 outbreak, the added value of molecular biological investigation, together with the epidemiologic investigation, allowed us to describe a w135 clonal outbreak and the diffusion of this strain from pilgrims to the general population (5). In sweden, n. meningitidis w135 of the same serotype and subtype has been documented since 1979, but pulsed - field gel electrophoresis and the sulfadiazine resistance of the w135 isolates indicate that the outbreak was probably due to a new strain of w135 meningococci (8). After its description in 1968 and during the 1970s, n. meningitidis w135 was considered a minor serogroup, of little clinical importance (9). Only in the early 1980s was this organism described as a fully pathogenic strain, as an important new cause of disease in europe and the united states and as an emerging cause of meningococcal disease in africa (10,11). During the 1990s, n. meningitidis w135 represented 2.6% to 4% of all reported n. meningitidis in the uk, france, and the united states (1214). The first two cases of meningococcal disease in pilgrims due to w135 associated with the hajj were described in 1993 in saudi arabia in an indonesian and an american pilgrim (15). From 1998 to march 2000, fewer than two cases of the w135 2a: p1 - 5,2 strain were reported yearly in england and wales (kaczmarski eb, pers . Comm .) And two cases per year in france (taha mk, pers . Comm . ). The outbreak strain belonged to the et-37 complex, which is mainly composed of serogroup c (16). It causes disease in clusters and has a higher transmissibility than other strains (5,17,18). Although the cfrs in cases from france and the uk were high, the age - adjusted rrs of dying during the outbreak were not significantly higher than those observed in the routine surveillance of meningococcal disease due to all serogroup of n. meningitidis in these two countries . Thus, the outbreak strain appears to be of similar virulence to n. meningitidis serogroups that normally cause meningococcal disease in the uk and france . Cfrs have been shown to be linked with age and to increase among very young and older people (19). The initially large number of cases in older people at the beginning of the outbreak might explain this finding . Methods used to evaluate the impact of the specific control measures implemented in france intended to take into account differences in meningococcal disease incidence rates between the two countries and potential differences in pilgrims initial carriage of the outbreak strain at their return from mecca . Since the number of cases in each group (pilgrims, household, out of household, and no identified contact with a pilgrim) was low, the power of the test did not allow identification of the difference of impact between them . Defining other groups could not have allowed conclusions to be drawn, since the number would have also been low . Information collected from the only manufacturer of rifampicin in france indicated that the total number of doses distributed to pharmacies represented only half the doses needed to treat the target group (approximately 100,000 persons living in pilgrims households), indicating that compliance with the recommendations was low . In addition, all those who were provided treatment may not have taken it effectively, although compliance would not be expected to be a major problem with only 2 days of medication . As of the end of march 2001 in france, no cases were reported in persons who had taken rifampicin and no strain of n. meningitidis w135 resistant to rifampicin had been isolated at the nrc . For the prevention of cases among pilgrims and household contacts, the <1 ratio between france and the uk indicated that the measure had no impact in preventing cases in pilgrims and pilgrims household in france . This might be due to the delay of 2 weeks between the first return of pilgrims and the release of the measure, an interval during which transmission of the pathogenic strain occurred inside the pilgrims households . The absence of significant impact of the measure to limit the diffusion of the pathogenic strain to the out - of - household contacts and persons with no contacts identified may be explained either by the very small number of cases considered or by potential misclassification . Cases in the general population may also have been underestimated in comparison with the likely high case ascertainment in pilgrims . However, such underestimates are unlikely since virtually all invasive strains of n. meningitidis are sent to the reference laboratory in france and the uk . However, data for cases of w135, 2a p1.2,5 obtained from national reference laboratories in france and the uk for september 2000february 2001 indicated that 13 cases were reported in the uk and 9 in france, suggesting that there was no long - lasting effect of the measure and that immunity to the strain was probably increasing in the population (20). In the uk, carriage studies showed that this strain was still circulating within the muslim community (stuart jm, pers . The results of the measures implemented in france do not allow us to draw conclusions for use of mass prophylaxis in the future, mainly because of the small number of cases in our study . Following this outbreak, france and the uk, among other countries, recommended quadrivalent vaccine for travelers to the hajj 2001 (21,22; pers . Subsequent quadrivalent vaccine coverage was estimated to be 47% and 65% in the uk and in france, respectively . Another outbreak of meningococcal disease caused by n. meningitidis w135 2a p1.2,5 occurred in hajj pilgrims and their contacts in 2001; most cases were from saudi arabia and the uk . During the period march 28june 29, 2001, 10 cases of meningococcal disease due to w135 2a p1.2,5 were reported to the nrc in france (0 deaths) and 25 in the uk (8 deaths) (2325). Since may 2001, quadrivalent vaccine is now a requirement for all pilgrims to future hajj pilgrimages (26).
|
The data presented are based on the retrieval of relevant medical literature by searching pubmed with the terms deferasirox (dfx) and non - transfusion - dependent thalassemia (ntdt) for studies published between 2000 and 2015 . The cochrane database for systematic reviews and clinical trial registries was also searched, and pertinent reviews were identified (searches last updated august 1, 2015). Thalassemia is a complex entity related to a group of inherited diseases, caused by defective or absent hemoglobin chain synthesis leading to anemia . In general, the severity of the disease depends on the genotype inherited without a definite genotype phenotype correlation due to the presence of several genetic, along with environmental factors, which can alter clinical expression jointly to secondary and tertiary genetic modifiers.1 however, patients with ntdt do not require regular rbc transfusions for survival, but may require occasional transfusions owing to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications.2 therefore, ntdt encompasses a great variety of syndromes mixed in terms of their molecular background, clinical course, and severity, with the sole common characteristic of independence from regular transfusions.3 currently, beta - thalassemia intermedia, alpha - thalassemia (mainly hbh disease), and mild / moderate forms of hbe / beta - thalassemia are the most prevalent forms in the world.4 despite the lack of a stable transfusional iron overload, the majority of patients with ntdt accumulate iron . Ineffective and expanded erythropoiesis are both responsible for the activation of known and unknown signals of epcidin suppression and of a consequent increased intestinal absorption of iron.5 thus, patients with ntdt progressively increase their iron stores which may become clinically significant in the second decade of life and is responsible, along with chronic anemia and hemolysis, for most complications observed in older untreated patients.6 however, it is conceivable that, particularly in the more severe forms, some complications could be ascribed to transfusion therapy (either intermittent or regular) as observed for the increased risk of endocrinopathy.7 patients with ntdt accumulate iron chiefly in the liver and scantly in the heart, which may explain the tendency to not develop myocardial siderosis as compared to patients with thalassemia major (tm).8,9 however, the liver iron overload shown in patients with ntdt has been found to be similar to that of patients with beta tm.10 the elevated iron burden, despite occurring with differences in iron metabolism, pathophysiology and loading rate, is directly involved in the development of several complications or may add in some way to their severity.11 in fact, evaluating a series of unchelated patients by r2 and r2 * magnetic resonance imaging (mri), a liver iron concentration (lic) of 5 or more mg / g dry weight (dw) was found to be the cut - off able to accurately discriminate between patients with and without morbidities.12 recently, patients with ntdt were also found to have an increased risk of hepatocellular carcinoma and those affected showed a lic of 8.5 mg / g dw (median: 8.5; interquartile range: 4.517.8).13 obviously, chelation practice has been routinely performed in the management of iron overload in patients with ntdt, as their anemia contraindicates phlebotomy, but for a long time only as good clinical practice and without both the use of guidelines and the evidence of clinical benefit as observed in their tm counterparts . The optimal care study was the first retrospective study highlighting a protective effect of iron chelation therapy against several complications of ntdt such as pulmonary hypertension and endocrinopathies and thus reinforced the indication to accurately chelate this category of patients.7 on the other hand, it was demonstrated that an increase in serum ferritin level over time was associated with worsening of hepatic fibrosis in patients with ntdt who are not receiving iron chelation treatment.14 the evidence of these studies suggested to scrupulously estimate iron loading particularly at liver level to control and prevent such iron burden with effective iron chelation therapy . Guidelines on ntdt chelation treatment have been recently established and recommend initiation of chelation therapy in patients with either ferritin levels higher than 800 ng / l or lic above 5 mg / g dw.15 however, measurement of ferritin may underestimate the level of iron and sometimes among the main ntdt subtypes an irregular correlation exists between ferritin level and lic, as measured by r2 mri or superconducting quantum imaging device.16,17 therefore, a decision - making algorithm has also been created to aid monitoring of iron burden and initiation of chelation therapy.18 until 2005, the two drugs were available to treat iron overload in a variety of hematologic disorders: deferox - amine (dfo), administered mainly using continuous slow subcutaneous infusion, and the oral iron chelator deferiprone (dfp).19,20 the dfo, a hexadentate chelator binding iron at a 1:1 molar ratio, was introduced in clinical practice over 40 years ago to decrease iron overload.21 however, the need for frequent and prolonged subcutaneous administration has been associated with undesirable adverse effects and noncompliance to treatment resulting in elevated risk of iron - induced complications.22,23 the oral three times a day agent dfp, a bidentate hydroxypyridone with a small molecular weight, was first used and approved in europe in 1999 for the treatment of iron overload in tm when dfo was contraindicated or inadequate . Us food and drug administration approval for clinical use of dfp was delayed until october 2011 because of the lack of traditional safety and efficacy trials comparing dfp and dfo . While dfo and dfp alone and in combination have been widely used in several trials involving patients with tm and proved to be effective in the reduction of iron burden,2427 the scientific evidence of their efficacy in the setting of ntdt is very incomplete and limited to specific subpopulations.28 recently, calvaruso et al described the first 5-year long - term randomized clinical trial comparing the effectiveness of dfp vs dfo in patients with thalassemia intermedia (ti) showing that long - term iron chelation therapy with dfp is similarly effective as dfo . However, the use of dfp was accompanied by the occurrence of rare but serious adverse events during treatment, such as neutropenia and agranulocytosis.29 the once daily oral iron chelator, dfx (exjade, novartis pharmaceuticals corporation, basel, switzerland), was introduced later, but has rapidly shown to be effective for reduction of body iron in iron - overloaded patients with transfusion - dependent anemias . It is a tridentate chelator that mobilizes iron stores by binding selectively to the ferric (fe) form of iron.30,31 the efficacy of dfx has also been demonstrated in sickle - cell disease and in bone marrow failure syndromes, such as myelodysplastic and aplastic syndromes, diamond blackfan and fanconi anemia.3234 in a phase i / ii trial with 49 patients with hf - related hereditary hemochromatosis, dfx also proved to be effective in reducing iron overload.35 in the past few years, several clinical trials have shown that accurate monitoring and dose adjustment of dfx was safe and effective in the long - term management of iron - overloaded patients with tm . Briefly, it has been assessed that dfx at a dose of 20 mg / kg per day can stabilize serum ferritin levels and lic, while at doses of 3040 mg / kg per day is able to reduce these parameters and achieve negative iron balance in patients with transfusional iron overload.36 pharmacokinetic and pharmacodynamic properties of dfx have been mainly assessed among patients with tm and have been extensively reviewed elsewhere.37,38 however, studies from the myelodysplasia population seem to indicate that dfx has a constant pharmacological profile, independently from the underlying disease or race.39 the dfx is currently the only chelator to have gained approval for the treatment of iron overload in patients with ntdt in the usa (patients 10 years of age with an lic 5 mg fe / g dw and sf> 300 ng / ml) and in europe (lic 5 mg fe / g dw and sf> 800 ng / ml with inadequate response or contraindication to dfo).40 to date three small studies and one large randomized trial have evaluated the safety and efficacy of dfx in patients with ntdt with iron overload (table 1). In the prospective open label study by voskaridou et al 11 patients received dfx at a starting dose of 1020 mg / kg per day, according to the baseline iron burden, with subsequent dose adjustments according to efficacy and adverse events . After 1 year of treatment, significant improvement of mean liver t2 * (p=0.02) was observed in the eight patients who completed the study.41 in the study by ladis et al,42 eleven patients were enrolled to receive dfx at 10 or 20 mg / kg per day for 24 months . Mean lic, measured by mri - t2 *, and mean serum ferritin were significantly reduced (p=0.005 and p<0.05, respectively) in the nine patients completing the study both at 12 and 24 months and five patients achieved lic <3 mg fe / g dw . In both studies, cardiac t2 * and left ventricular ejection fraction remained normal in all patients.41,42 thalassa, a randomized, double - blind, placebo controlled phase ii trial, is the largest study to investigate the safety and efficacy of dfx in reducing iron overload in patients with ntdt.43 the trial included 166 patients with -thalassemia intermedia (n=95), -thalassemia (n=22) and hbe/-thalassemia (n=49), and was conducted over 1 year . Iron - overloaded patients (10 years of age with lic 5 mg fe / g dw and serum ferritin> 300 ng / ml) were randomized to dfx starting doses of 5 or 10 mg / kg per day or matching placebo . After 1 year of treatment with dfx mean lic decreased significantly from baseline in both starting dose groups (dfx 5 mg / kg per day: 2.330.70 mg fe / g dw; p=0.001 and 10 mg / kg per day: 4.180.69 mg fe / g dw; p<0.001) compared to placebo . The decrease in lic, measured by r2-mri, was more significant (p=0.009) for the dfx 10 mg / kg per day group compared with the lower dose group (1.850.70 mg fe / g dw). Similarly, serum ferritin decreased significantly with dfx from baseline to week 52 compared to placebo (least squares mean 121 ng / ml in 5 mg / kg per day group, 222 ng / ml in 10 mg / kg per day group, + 115 ng / ml for placebo; p<0.001). Patients who completed the thalassa core study were eligible to enter the 1-year extension phase, where patients were continued on dfx or were switched from placebo.44 verall, 133 patients entered the extension phase, including 48 who crossed over from placebo . Patients randomized to receive dfx in both phases (n=110) achieved a mean absolute reduction of lic of 7.14 mg fe / g dw from baseline and a mean decrease of serum ferritin of 450 ng / ml . Patients who switched over from placebo achieved a mean absolute reduction of 6.66 mg fe / g dw from baseline . At the end of the extension phase the proportion of patients achieving an lic of <5 mg fe / g was 38.6% overall (39.1% randomized to dfx in the core study; 37.5% originally randomized to placebo). A subanalysis was performed evaluating lic reduction in various subgroups, based on baseline lic, baseline serum ferritin, age, sex, race, splenectomy status, and underlying ntdt syndrome.45 across all subgroups, patients receiving dfx showed a greater reduction in lic compared with patients who received placebo with better results in patients in the 10 mg / kg per day starting dose group . The most frequently reported adverse events were mild to moderate in severity . In the thalassa study adverse events assessed to be drug related by the investigators were reported in 24.1% of the patients and were mostly gastrointestinal disorders (mostly nausea and diarrhea), which resolved spontaneously or with dose adjustment or drug interruption . As for renal function, no progressive increases in serum creatinine were observed . In patients treated for 2 years, five experienced two consecutive increases> 33% above baseline and above upper limit of normal.43,44 no similar reports by voskaridou et al41 and ladis et al,42 although in the latter at the end of the 2nd year of treatment serum creatinine increased and creatinine clearance decreased compared to baseline, but neither reached abnormal values . In all three studies mean alt levels decreased over time, suggesting a corresponding improvement in liver function . Only one patient in the thalassa extension study experienced hepatitis, which was suspected to be drug related.42 in general efficacy was achieved at relatively lower doses compared to patients with transfusional iron overload . However, monitoring for efficacy and adverse events with adequate dose adjustments remains pivotal in all patients . The most recent study was a multicenter trial performed in iran by karimi et al who treated 50 -thalassemia inter - media patients with serum ferritin> 1,000 ng / ml with dfx for 12 months, observing a significant decrease of ferritin starting at 4 months of treatment.46 the recent definition of serum ferritin thresholds to predict clinically relevant lics together with more and more wide access to mri technology have led to the frequent diagnosis of iron overload in patients with ntdt, where initiation of chelation therapy is indicated . As a consequence, to control iron imbalance and to prevent iron toxicity, the long term use of a safe and effective chelator is required . An extensive experience gained from studies in patients with tm with over 150,000 patient years of drug exposure has definitively shown that dfx has a favorable side - effect profile in patients with transfusion - dependent thalassemia (tdt), with treatment - related adverse events comprising gastrointestinal, renal and dermatologic effects that were generally mild and reversible on cessation of treatment.47 in this review the restricted experience from the results on 238 patients with ntdt under continuous dfx treatment were evaluated . These studies involve small numbers of patients followed for 13 years who generally had never been transfused and encompasses two pilot studies, a prospective, placebo - randomized trial with its 2-year extension study and a retrospective study.4146 overall, dfx, at doses ranging from 10 to 20 mg and in a dose - dependent manner, was effective in reducing lic and/or ferritin in patients with different subgroups of ntdt . Similarly to tdt, drug - related adverse events reported during these studies, were manageable, self - resolving, and typically did not necessitate discontinuing therapy, even as patients achieved low lic levels toward the end of the study.48 following monthly monitoring, incidences of liver and renal abnormalities were low and nonprogressive . Mild, nonprogressive increases in serum creatinine levels were also observed in a few patients; these increases were generally within the normal range and rarely exceeded twice the upper limit of normal . Taken together, these data suggest that the use of dfx can successfully manage iron overload in patients with ntdt . However, further data and larger study populations are needed to explore the safety profile of this drug in this group of patients (table 2). Post - marketing surveillance studies and information from the ongoing thetis trial will provide additional assessment of the long - term efficacy and safety of dfx.49 given the need for lower doses as compared to tm, less toxicity and less morbidity are expected in ntdt than that observed when dfx was initially administered in patients with tm . Obviously, in most ntdt forms, lifelong treatment with iron chelation may not be necessary and several attempts at improving drug efficacy and reducing drug toxicity have been given particular attention, as the need to interrupt chelation if treatment goals are reached . In fact, a prudent and conservative approach has been adopted in the thalassa trial in the sense that lic <3 mg fe / g dw was used as an indicator to interrupt iron chelation therapy in the hypothesis that it could represent a low, acceptable iron burden.43 in the described post hoc analysis, a consistent safety profile was nevertheless demonstrated as patients approached this target, indicating that such low iron burdens may be obtained with minimal risk of overchelation.48 this approach, now included in current guidelines for chelation therapy in ntdt, obviously will guarantee from the observed risk in tdt that overchelation could further reduce glomerular filtration rate also in ntdt.50 however, it should be taken into account that cases of glomerular hyperfiltration may be observed in patients with ntdt and that the administration of dfx could bring the glomerular filtration rate levels under control.51 thus, it could be argued that occasionally a potential adverse event may become a useful strategy against the potential damage of persistent glomerular hyperfiltration . While a severe or> 5 mg fe / g dw lic was clearly associated with complications, the level of acceptable iron burden and iron associated toxicity in ntdt may be different and transiently modifiable by occasional transfusional requirement . Currently, in line with the thalassemia international federation guidelines for dfx use in patients with ntdt, iron chelation should be stopped in patients reaching lic of 3 mg fe / g dw or sf of 300 ng / ml, when mri is unavailable, as safety data do not exist to support continued chelation with dfx below this level.15 on the other hand, due to the permanent progressive iron accumulation, therapy should be restarted when patients re - achieve a lic of 5 mg fe / g dw thus realizing a gray zone (from 3 to 5 mg fe / g dw), where patients are either interrupting treatment or waiting to restart it . It has also been observed that each genetic entity of ntdt has different erythroid activity, hepcidin levels and occasional transfusional iron loading, which may generate in some cases and in the presence of nearly normal lic level, high levels of saturation of transferrin which in turn produces labile iron species and potential organ damage.52,53 given that dfx has been shown not only to control iron burden but also labile plasma iron, the chelatable form of non - transferrin - bound iron, there could be the space to test dfx for a maintenance and or a transient therapy in such circumstances.54 as dfx remains within the therapeutic range over a 24-hour period, it offers a complete chelation coverage at standard doses and can therefore better control labile plasma iron.55 further studies are needed to fully evaluate the efficacy and the safety of alternative administration schedules (ie, alternate days, three times / week) and/or reduced doses of dfx to control iron stores in this gray zone, where a maintenance chelation therapy could be acceptable . Further studies are also needed to better delineate the appropriate schedule of treatment of dfx to induce a neutral iron balance according to the increased risk of renal injury when a considered safe or normal iron burden has been reached . On the other hand, consideration should be given in the future also to better tailor initial dfx therapy to the basal iron depot, to different subtypes of ntdt, to splenectomy status and to the rate of occasional transfusional iron intake, all conditions which may affect iron balance in ntdt . Of particular interest, over the long - term use of dfx, will be also the prospective determination of the impact of iron chelation on most common complications and survival in patients with ntdt . The thetis trial will focus on the effects of 5-year treatment with dfx on the endocrine profile . The favorable outcome of dfx on osteopenia and osteoporosis observed in patients with tm could be expected also in ntdt.56 similarly, the reported long - term effects of dfx treatment on liver fibrosis should be also readdressed in ntdt.57 currently, to improve anemia and reduce the occasional transfusional requirements, patients with ntdt are frequently treated with older drugs such hydroxycarbamide58 and new agents such as those interfering with the activity of several transforming growth factor- family cytokines involved in late stages of erythropoiesis59,60 and jak2 inhibitors.61 thus, the efficacy, safety, and pharmacokinetics of dfx should also be evaluated in patients concomitantly receiving some of these drugs, taking into account that the potential interference of such drugs with mechanisms regulating the iron absorption, could further address and limit iron overload . In conclusion, following the results of the thalassa and extension studies, dfx has become the current gold - standard for iron chelation in patients with ntdt . However, prospective data from a randomized comparison with other chelating agents and from a magnitude of drug - exposure comparable to that obtained for patients with tm should be performed to obtain a more accurate and complete evaluation of its profile in patients with ntdt.
|
Long - term hyperglycemia causes health problems including heart disease, eye, kidney, and nerve damage . It is estimated that the number of people with diabetes will alter from 171 million to 336 million in the period 20002030 . Studies have shown that blood lipids are related to several factors such as lifestyle, diet, and smoking, body mass index (bmi), waist circumference, physical activity, sex and age . Dyslipidemia consists of different abnormalities in lipid profile and is one of the main risk factors of several diseases such as cardiovascular disease (cvd), diabetes mellitus, hypertension, stroke, or acute pancreatitis . Increasing its prevalence is related to unhealthy diet and lifestyle changes in the most developed and developing countries . Healthy diet and natural food are so important to prevention and sometime treatment of diseases . Finding the beneficial natural ingredients have been noted for prevention or treatment of metabolic disorders due to the expensive medications and the side effects of drugs . Recently, findings showed vinegar and acetic acid (the main ingredient of vinegar) affect postprandial glucose, lipid profiles, blood pressure and weight loss . Studies showed that consuming acetic acid and apple cider vinegar reduced postprandial glucose and insulin responses in healthy subjects, type 2 diabetes and insulin resistant . In spite of the evidences that demonstrate the hypoglycemic effect of vinegar, lack of antihyperglycemic action of vinegar in humans honey is a natural food and a complex mixture of sugars, in which fructose and glucose are the main constituents . Fructose is a monosaccharide, which is absorbed more slowly from the gastrointestinal tract compared to glucose, so after fructose consumption blood glucose increases slightly . In addition, natural honey contains various antioxidants and according to previous findings, antioxidant intake was associated with weight loss in obese individuals and beneficial effects on risk factors of cvd . Studies showed that honey intake considerably decreased postprandial glycemic response or had less adverse effect on plasma glucose than other sugars or sweeteners in diabetic patients . However, another study reported that, 8-week consumption of natural honey led to a significant elevation in glycosylated hemoglobin (hba1c) level, with no significant change in fasting blood sugar (fbs) concentration in diabetic patients . This negative effect on hba1c can be due to the high dose or high glucose: fructose constituent of honey administered . Studies showed vinegar and honey had some beneficial effects on blood glucose or lipid profiles separately . Honey vinegar syrup (hvs), a mixture of these two ingredients is traditional syrup . Sekanjabin is one of the oldest iranian drinks, which is made by sugar and vinegar . Sucrose can cause lots of disorders . In the present study using natural honey as beneficial ingredient instead of sugar for preparation of hvs, the aim of this study was to investigate the effect of hvs consumption on cvd risk factors in healthy individuals . The study included 72 healthy male and female volunteers (32 male and 40 female) aged 2040 years and bmi between 18.5 and 30 kg / m . Inclusion criteria were lack of medications affecting blood glucose, lipid or appetite, no acute or chronic diseases, no smoking, no pregnancy or lactation . The exclusion criteria were having special diet, honey or vinegar consumption during the last 3 months prior the study, pregnancy during the trial, diagnosis of disease (such as bacterial or viral infections, seasonal allergies or acute illnesses) and start drug therapy during the trial, volunteers with known / suspected drug or alcohol abuse, and allergies to hvs . All subjects signed an informed consent and withdrawal from the study was permitted at any time . Eligible subjects were randomly assigned to either control (normal diet, n = 36) or intervention group (normal diet plus 21.66 g honey vinegar, n = 36) for 4-week . The main composition of honey vinegar is shown in table 1 . For the preparation of hvs, 1 kg of natural honey was mixed with six units of water (1500 ml) and was heated for a few minutes . Some branches of mint were added to the mixture and let the syrup to be condensed . Then 300 g of vinegar was added to the syrup, after fewer pimples were removed from the heat it is allowed to be cooled, and the syrup poured into the bottles and was delivered to the participants . Participants should mix two tablespoons of hvs (21.66 g) with 250 cc water and drank it in mid - morning or early evening snack daily for 4-week . Composition of honey included 17.1% water, 38.38% fructose, 31% glucose, 7.2% maltose, 1.5% sucrose, 4% oligosaccharides, 0.5% vitamins, minerals and enzymes, etc ., total phenolic content was 79.63 0.11 mg gallic acid equivalents/100 g honey, total flavonoids content was 7.94 0.54 mg catechin equivalents/100 g, hydroxymethylfurfural level was 3.80 0.14 mg/100 g and diastase activity (-amylase) values was 17.4 2.8 schade units . Dietary recommendations were based on healthy food pyramid . In both groups, we recommended 2530% energy from lipid, 15% from protein, and 5560% from carbohydrate . Intervention group received extra calories (about 75 kcal) via hvs consumption . During the study, we called or used text messages twice a week to remind participants to drink hvs regularly . Dietary assessments were performed using 3 days food records (2 days mid - week and a weekend day) 3 times during the study period: baseline, week 2 and week 4 . We used nutrition 4 software (first databank, san bruno, ca) for nutrient analysis . Nutrient composition of the hvs blood samples were obtained from fasting subjects between 7:00 and 8:00 a.m. after at least 12 h fasting at week 0 and week 4 . Fasting blood glucose (fbs) and serum insulin was measured by colorimetry and enzyme - linked immunosorbent assay respectively . Total cholesterol (tc), high - density lipoprotein cholesterol (hdl - c) and triglycerides (tg) were measured by enzymatic methods using autoanalyzer elan 2000 . Low - density lipoprotein cholesterol (ldl - c) concentration in serum samples with tg 400 mg / dl was calculated by friedewald et al . We calculated the homeostasis model assessment of insulin resistance (homa - ir), with the following formula, homa - ir = (fasting insulin [miu / l] fasting glucose [mmol / l])/22.5 . Values in the text are mean standard deviation (quantitative variables) or percent (qualitative variables) analysis of covariance was used to compare changes of variables included fbs, insulin, homa - ir, tc, tg, hdl - c, ldl - c and ldl - c / hdl - c between two groups of control and intervention . The study included 72 healthy male and female volunteers (32 male and 40 female) aged 2040 years and bmi between 18.5 and 30 kg / m . Inclusion criteria were lack of medications affecting blood glucose, lipid or appetite, no acute or chronic diseases, no smoking, no pregnancy or lactation . The exclusion criteria were having special diet, honey or vinegar consumption during the last 3 months prior the study, pregnancy during the trial, diagnosis of disease (such as bacterial or viral infections, seasonal allergies or acute illnesses) and start drug therapy during the trial, volunteers with known / suspected drug or alcohol abuse, and allergies to hvs . All subjects signed an informed consent and withdrawal from the study was permitted at any time . Eligible subjects were randomly assigned to either control (normal diet, n = 36) or intervention group (normal diet plus 21.66 g honey vinegar, n = 36) for 4-week . For the preparation of hvs, 1 kg of natural honey was mixed with six units of water (1500 ml) and was heated for a few minutes . Some branches of mint were added to the mixture and let the syrup to be condensed . Then 300 g of vinegar was added to the syrup, after fewer pimples were removed from the heat it is allowed to be cooled, and the syrup poured into the bottles and was delivered to the participants . Participants should mix two tablespoons of hvs (21.66 g) with 250 cc water and drank it in mid - morning or early evening snack daily for 4-week . Composition of honey included 17.1% water, 38.38% fructose, 31% glucose, 7.2% maltose, 1.5% sucrose, 4% oligosaccharides, 0.5% vitamins, minerals and enzymes, etc ., total phenolic content was 79.63 0.11 mg gallic acid equivalents/100 g honey, total flavonoids content was 7.94 0.54 mg catechin equivalents/100 g, hydroxymethylfurfural level was 3.80 0.14 mg/100 g and diastase activity (-amylase) values was 17.4 2.8 schade units . Dietary recommendations were based on healthy food pyramid . In both groups, we recommended 2530% energy from lipid, 15% from protein, and 5560% from carbohydrate . Intervention group received extra calories (about 75 kcal) via hvs consumption . During the study, we called or used text messages twice a week to remind participants to drink hvs regularly . Dietary assessments were performed using 3 days food records (2 days mid - week and a weekend day) 3 times during the study period: baseline, week 2 and week 4 . We used nutrition 4 software (first databank, san bruno, ca) for nutrient analysis . Blood samples were obtained from fasting subjects between 7:00 and 8:00 a.m. after at least 12 h fasting at week 0 and week 4 . Fasting blood glucose (fbs) and serum insulin was measured by colorimetry and enzyme - linked immunosorbent assay respectively . Total cholesterol (tc), high - density lipoprotein cholesterol (hdl - c) and triglycerides (tg) were measured by enzymatic methods using autoanalyzer elan 2000 . Low - density lipoprotein cholesterol (ldl - c) concentration in serum samples with tg 400 mg / dl was calculated by friedewald et al . We calculated the homeostasis model assessment of insulin resistance (homa - ir), with the following formula, homa - ir = (fasting insulin [miu / l] fasting glucose [mmol / l])/22.5 . Values in the text are mean standard deviation (quantitative variables) or percent (qualitative variables). Paired t - test was used to compare changes of variables within groups . Analysis of covariance was used to compare changes of variables included fbs, insulin, homa - ir, tc, tg, hdl - c, ldl - c and ldl - c / hdl - c between two groups of control and intervention . Eleven participants discontinued the study (overall attrition rate = 15.3%) for some reasons . Five participants (three in the intervention group and two in the control group) withdrew during the study period for personal reasons . Four participants (two in the intervention group and two in the control group) were excluded because of viral infection and drug therapy . One subject in the control group was excluded because of seasonal allergies and drug therapy and one participant from the intervention group withdrew because of adverse effects (nausea, stomach ache and headache). Thus, the main analyses were conducted with 61 participants (intervention group, n = 30; control group, n = 31) [figure 1]. Summary of subject flow diagram the baseline demographic characteristics of the 72 study subjects are summarized in table 2 . There were no differences between the groups for sex, educational status, job, age and daily caloric intake at baseline . No between - group differences were found in bmi and blood examination findings at baseline . Baseline characteristics of the study population dietary intake data from 16 subjects (22.22%) were not analyzed because they had incomplete food records (the attrition rate at the first, second and the third, three - dimensional food records was = 4.16, 8.69 and 11.11%, respectively). A total of 56 subjects (77.77%) were included in the analysis of dietary data (n = 27 and 29 from intervention and control groups, respectively). Sugar, fructose and glucose intake were higher among the intervention group [table 3]. Dietary intakes of study participants throughout the study insulin level increased (p = 0.01) and hdl - c concentration (p <0.001) and tc (p = 0.05) decreased in intervention group significantly . The changes in hdl - c in two groups of intervention and control were different significantly . No significant changes were observed in fbs, tg and ldl - c [table 4]. The effect of hvs on glucose metabolism and lipid profiles * no serious adverse events were reported . Subjects who withdrew from the study did not report any serious adverse events as a reason for withdrawal . Only one participant reported nausea, stomach ache and headache after 15 days of hvs consumption . Eleven participants discontinued the study (overall attrition rate = 15.3%) for some reasons . Five participants (three in the intervention group and two in the control group) withdrew during the study period for personal reasons . Four participants (two in the intervention group and two in the control group) were excluded because of viral infection and drug therapy . One subject in the control group was excluded because of seasonal allergies and drug therapy and one participant from the intervention group withdrew because of adverse effects (nausea, stomach ache and headache). Thus, the main analyses were conducted with 61 participants (intervention group, n = 30; control group, n = 31) [figure 1]. There were no differences between the groups for sex, educational status, job, age and daily caloric intake at baseline . No between - group differences were found in bmi and blood examination findings at baseline . Dietary intake data from 16 subjects (22.22%) were not analyzed because they had incomplete food records (the attrition rate at the first, second and the third, three - dimensional food records was = 4.16, 8.69 and 11.11%, respectively). A total of 56 subjects (77.77%) were included in the analysis of dietary data (n = 27 and 29 from intervention and control groups, respectively). Sugar, fructose and glucose intake were higher among the intervention group [table 3]. Insulin level increased (p = 0.01) and hdl - c concentration (p <0.001) and tc (p = 0.05) decreased in intervention group significantly . The changes in hdl - c in two groups of intervention and control were different significantly . No significant changes were observed in fbs, tg and ldl - c [table 4]. No serious adverse events were reported . Subjects who withdrew from the study did not report any serious adverse events as a reason for withdrawal . Only one participant reported nausea, stomach ache and headache after 15 days of hvs consumption . This present pilot hypothesis - testing study investigated the potential effect of hvs on blood sugar and lipid profiles . In contrast, we did not observe amelioration in hdl - c level . According to the previous findings our findings are in accordance with the previous human or experimental studies, which reported a negative significant effect of fructose on hdl - c level . Study on patients with nonalcoholic fatty liver disease showed fructose consumer group had lower fasting serum glucoses, tg and hdl - c . The short - term effect of oral fructose on patients with chronic kidney disease showed tc, ldl - c, and hdl - c significantly decreased and serum tg markedly increased . Animal studies reported high - fructose feeding (60 g/100 g diet) to normal rats led to a significant increase in the concentrations of cholesterol, tg, very low - density lipoprotein cholesterol and ldl - c, but hdl - c reduced significantly . High fructose diet in metabolic syndrome rats were accompanied by high significant increase in serum tg, tc and ldl - c while hdl - c level was significantly decreased as compared to control groups . Honey lowered serum concentrations of tg compared with diets of equal energy densities in rats . Findings showed honey consumption decreased tc, ldl - c and increased hdl - c level in healthy subjects and patients with hyperlipidemia . Similarly, a recent study found that 8-week honey intake significantly reduced tg, tc, ldl - c, ldl / hdl ratio and increased hdl - c compared with baseline in type 2 diabetic patients . Another study indicated that the intake of vinegar along with high - fat meal increased tg levels significantly without any notable effect on other lipid variables . These results showed vinegar could ameliorate unfavorable effects of high - fat diet on lipid profiles . According to findings, acetate in vinegar inhibits lipogenesis and stimulates fatty acid oxidation and may lead to beneficial effects on lipid profiles . The precise mechanism of action in not clearly understood, but it can be explained by the role of fructose in reducing the lipoprotein lipase (lpl) and lecithin cholesterol acyl transferase (lcat) activities in plasma . Lcat, the enzyme that catalyzes esterification of cholesterol with ffas, along with lpl is responsible for hdl - c synthesis . Reduction in the lpl activity, an insulin - sensitive enzyme, in hvs consumers can be ascribed to the insulin resistance induced by fructose . Fructose can lead to a decrease in the ability of insulin to stimulate the activity of lpl . Bahrami et al . Showed, honey consumption for 8-week augmented hba1c levels in patients with type 2 diabetes . The major copound of hvs is honey (approximately 70% honey vs. 30% grape vinegar); therefore, its effects on variables can be explained mostly via the honey's ingredients . The underlying mechanisms of the effect of hvs can be explained via two different ways: (1) honey reduces prostaglandin levels and elevates nitric oxide . It was demonstrated that pge2 is one of the major physiological inhibitors of insulin and glucose - induced insulin secretion, (2) polyphenol compounds of grape vinegar improve insulin sensitivity or insulin release via the pi3 kinase - akt pathway and activate sirtuin-1 and adenine monophosphate kinase . In the present study the interaction between nutrients in honey and grape vinegar may lead to different effect in comparison with consumption of honey and vinegar separately . Zinc and copper are two trace elements in honey that are important for insulin and glucose metabolism; however, in the present study after hvs consumption we observed no favorable changes in these variables . The strengths of this study are its randomized, controlled design; this study is the first trial that investigated the effect of honey and vinegar together . We observed no significant effect of hvs on blood sugar and lipid profile between groups except for hdl - c . However, tc level decreased, and fasting insulin increased significantly in the intervention group.
|
Although the neurotoxic action of lead is known for centuries, it has not yet been adequately elucidated which effects would be useful early indicators of a clinically latent lead intoxication . Lead, as a trace element, is not necessary for the organism, and is known to be toxic in almost all organ systems . Lead, because of its high affinity for the nervous system, produces neurological effects and impairments which have been described frequently . These effects might be subdividing into those occurring in the central, the peripheral, and the autonomic nervous systems . According to reports in the literature, lead - exposed subjects a great number of studies have focussed on deterioration of psychic or psychomental performance, describing mainly disturbed mood and affectivity [8, 1619] as well as impaired performance such as enhanced fatigue symptoms, poor concentration, impaired memory, dysmnesia, and blocking of thought processes [9, 20]. The symptom verified most frequently has been a diminished reaction speed [9, 13, 2022]. Neuropsychological data reported in the literature have demonstrated that continuous low - degree lead exposure impairs sensorimotor and primary central information processing . Observed in higher - exposed workers (4180 g / dl) a longer sensorimotor reaction time, in particular for simple tasks, and impairment of the short - term memory . Araki et al . Found in lead - exposed workers statistically significant changes in evoked potentials which disappeared after one year of nonexposure . Murata et al ., hirata and kosaka, and abbate et al . Described similar effects for the early visually evoked potentials after lead exposure . For early auditory evoked potentials, latency alterations have been demonstrated after chronic lead exposure [25, 28, 29]. In the literature, there has been evidence suggesting that the response of the peripheral nervous system to chronic lead exposure is more pronounced when compared to the cns [26, 3032]. Ulnaris extensor muscle paralysis in hands and feet is a typical symptom of lead intoxication . In the search for effects of lead intoxication in the peripheral nervous system, measuring the motor nerve conduction velocity has turned out to be a useful approach even though this issue has been controversially discussed in the literature [4, 25, 26, 3336]. As proposed by ogawa et al ., determining the latency of achilles jerk is a method that lends itself to describing lead - induced subclinical impairment of the peripheral nervous system . Bjetak, in a study of lead - exposed workers, found that sensorimotor performance was affected even though memory and reaction tests did not reveal any difference compared to controls . The effects of low - dose lead occupational exposure on neurobehavioral functions are still not well defined by occupational literature . Lead exposures may affect cardiovascular health through the autonomic nervous system [41, 42]. A method suitable to describe the function of the autonomic nervous system is the cardiac - rhythm analysis or analysis of heart rate variability (hrv). Abnormal cardiac autonomic function may be an important contributor to the pathophysiology of vascular disease, heart failure, and myocardial ischemia and their consequences, including sudden cardiac death . Despite the wealth of literature published on this issue, work investigating the influence of harmful substances on this division of the nervous system has been scarce [25, 42, 4550]. These publications gave accounts of a significantly reduced parasympathetic activity in lead - exposed workers when compared to nonexposed controls . The study from park et al . Provides evidence that people with higher past exposures to lead are at increased risk of adverse health outcomes from air pollution . However, gennart et al . Reported that in 98 lead - exposed workers studied, blood levels of lead (4075 g / dl) did not exert any influence on the autonomic nervous system as judged from sinus arrhythmia . Reference found that the validity and precision of the studies on the association between lead exposure and decreased heart rate variability are often limited by small sample sizes, limitations in the assessment of lead exposure, and lack of control for established cardiovascular risk factors and other confounders . From these sources dealing with the various divisions of the nervous system and a potential effect which lead may have, in the search for early effects, it is reasonable to conclude the following . Early forms of a neurotoxic action of lead, with no other pathological clinical findings, show numerous individual features of manifestation making the scientific description of lead - induced neuronal disorders difficult . Hence, in the search for early effects of neurotoxic lead exposure, it is only a multifactorial approach that can be pursued . The multilevel concept proposed by fahrenberg, which comprehensively includes performance, strain, and subjective feeling, may serve this purpose . Whilst in the past 30 years useful schemes of reducing the levels of harmful substances in companies and in the general environment in industrial nations have substantially reduced the lead exposure, there was a copper works facility in east germany where workers in various jobs had been definitely continuously exposed to levels of up to 25% above the german threshold limit values (de - mak) of lead in air (0.1 mg / m) over a period of more than ten years . The mak value (maximale arbeitsplatz - konzentration) is defined as a maximum permissible concentration of a chemical compound present in the air within a workplace, which, according to current knowledge, does not impair the health of the employee or cause undue annoyance . Under these conditions, exposure can be repeated and of long duration over a daily period of 8 hours, constituting an average working week of 40 hours . Mak values are those from the deutsche forschungsgemeinschaft (dfg). For the usa and for sweden, permissible exposure limits are 0.15 mg / m and 0.05 mg / m, respectively . This rare situation of exposure, being substantially improved through rehabilitation measures after the unification of germany, brought about the present study, as it offered a chance for objectifying neurotoxic effects induced by occupational lead exposure . The aim of the investigation was to define proper and sensitive indicators as screening methods of early neurologic effects after occupational exposition by lead using psychometric and psychopathologic procedures . The investigation schedule involved all the available male workers of a copper works facility who had had a history of several years occupational chronic lead exposure . These 70 males satisfied the criteria for being included in the study: voluntary participation, no pathological clinical findings, definite average lead exposure (0.13 0.09 mg / m air) within the threshold limit value (mak) range (see above), aged over 35 years, and not less than five years of uninterrupted work in the area of exposure . They formed the group of exposed subjects (e) with mean blood levels of lead (bpb) of 30.6 10.2 g / dl over the past 12 years; the internal dose time - weighted average (twa) calculated as proposed by hnninen et al . Out of the 70 exposed subjects (e), 21 had a higher exposure (he, bpb continuously> 35 g / dl) and 49 had a lower exposure (le, mean bpb over the period under investigation <35 g / dl). The mean bpb over the 12-year period under investigation was 43.0 6.1 g / dl for the he group and 25.3 6.3 g / dl for the le group . On the day of examination, the current bpb level was 30.4 15.5 g / dl in group e, 42.9 12.7 g / dl in group he, and 24.0 12.7 g / dl in group ie males . The twa values for the he and ie exposure groups were determined as 41.9 6.2 g / dl and 24.5 6.4 g / dl, respectively . On the analogy of the internal dose twa, one can follow the procedure described by bleecker et al . To calculate the external lead - in - air lifetime - weighted average exposure (lwae) of exposed subjects while allowing for their accurate duration of stay in the areas of exposure, along with the lead - in - air concentrations measured . The lwae value determined for the 21 he subjects was 0.17 0.11 mg / m and that for the 49 le subjects 0.10 0.08 mg / m. compared to these lead - exposed workers were 27 male controls (c) working in the iron and steel industry, with no history of occupational exposure to heavy metals or solvents and with criteria for being included in the study identical to those of exposed subjects . The control group was not more similar in sample size, because we subdivided afterwards our exposed subjects into both groups, he (n = 21) and le (n = 49), and compared the controls with this both exposed group . Criteria for exclusion from the present study for both groups were evidence of nervous lesions or unusual psychic signs, known diabetes mellitus, manifest arterial hypertension or cardiac insufficiency, and abuse of alcohol and/or drugs . The following age information applies to the subjects studied: group e mean age 43.4 5.4 years (3552 years), subgroup he mean age 41.3 4.8 years (3650 years), subgroup le mean age 44.3 5.4 years (3552 years), and group c mean age 45.2 4.9 years (3552 years). All test persons involved were subjected to an identical test programme which included psychometry of various performance areas (1st level), determination of physiological strain reactions during the tests (2nd level), and inquiry on subjective state of health (3rd level). The test battery used the following pc systems: swedish performance evaluation system (spes) [5658] and combitest [59, 60]. (1) performance level: capacity of short - term memory (memory span for numbers and labyrinth test),central information processing speed (initiation time (int) in case of single - choice reaction (scr) to a visual signal),movement time (mov) in case of single - choice reaction (scr) to a visual signal, concentration power and load capacity (reaction time under selection requirements in case of a multiple - choice reaction task (mcr) with adaptive mode),psychomotor coordination, sensorimotor performance (outtime and speed reached in pursuit test), psychomotor response (maximum frequency of the preferred hand in the tapping test). Capacity of short - term memory (memory span for numbers and labyrinth test),central information processing speed (initiation time (int) in case of single - choice reaction (scr) to a visual signal),movement time (mov) in case of single - choice reaction (scr) to a visual signal, concentration power and load capacity (reaction time under selection requirements in case of a multiple - choice reaction task (mcr) with adaptive mode),psychomotor coordination, sensorimotor performance (outtime and speed reached in pursuit test), psychomotor response (maximum frequency of the preferred hand in the tapping test). Capacity of short - term memory (memory span for numbers and labyrinth test), central information processing speed (initiation time (int) in case of single - choice reaction (scr) to a visual signal), movement time (mov) in case of single - choice reaction (scr) to a visual signal, concentration power and load capacity (reaction time under selection requirements in case of a multiple - choice reaction task (mcr) with adaptive mode), psychomotor coordination, sensorimotor performance (outtime and speed reached in pursuit test), psychomotor response (maximum frequency of the preferred hand in the tapping test). (2) physiological strain level: the heart action potentials were recorded by means of modified thoracic nehb anterior leads . The r - r intervals were recorded within 1 ms accuracy . Immediately after the experiment, the process of heart period duration covering the time of the test phases identifiable by markers was visualized on monitor . Further processing of the r - r intervals by means of fast fourier transformations (fft) as well as calculation of the cardiac rhythm parameters and power density spectra were conducted after the test on the basis of the registered data . When plateau (steady state) was seen in cardiac performance, the following values were calculated from the r - r intervals or the cardiac phase duration (cpd) values, in addition to the heart rate (hr): hr as a mean heart rate value on entire recording, absolute sinus arrhythmia (saa) as proposed by eckoldt (1)saa=1ni=1n|cpdi+1cpdi| (ms), where cpd = cardiac phase duration (ms) or duration of phases of cardiac cycle, n = number of successive cpds considered (not less than 200), and i = no . Of cpd, the total power density spectrum (tp) of the cpds as a short - term estimate of the total power of spectral density in the range of frequencies between 0 and 0.5 hz (ms) representing the overall activity of the autonomic nervous system, the power density bandsvlf (0.00.5 hz) = thermoregulatory band or very low - frequency band, reflecting overall activity of some slow mechanisms of sympathetic function (ms),lf (0.050.15 hz) = circulatory band or low - frequency band, reflecting mixed sympathetic and parasympathetic activity (ms),hf (0.150.5 hz) = rsa (respiratory sinus arrhythmia) band, or high - frequency band, reflecting parasympathetic activity and corresponds to n - n variations (time between two heartbeats) caused by respiration (ms),the relative proportions of these bands in the total power density spectrum relative uf band share of tp - vlf (%), relative lf band share of tp - lf (%), relative hf band share of tp - hf (%). A major vagal influence on the saa and the hf band share in the total power density spectrum with regard to cardiac regulation has long been postulated.ambulatory holter monitoring was done on a total of 70 exposed workers and 27 controls . Ambulatory electrocardiography was obtained using a tracker tape recorder (reynolds medical, hertford, uk) at a sampling rate of 128 hz in the occupational department . Immediately after the experiment, the process of heart period duration covering the time of the test phases identifiable by markers was visualized on monitor . Further processing of the r - r intervals by means of fast fourier transformations (fft) as well as calculation of the cardiac rhythm parameters and power density spectra were conducted after the test on the basis of the registered data . When plateau (steady state) was seen in cardiac performance, the following values were calculated from the r - r intervals or the cardiac phase duration (cpd) values, in addition to the heart rate (hr): hr as a mean heart rate value on entire recording, absolute sinus arrhythmia (saa) as proposed by eckoldt (1)saa=1ni=1n|cpdi+1cpdi| (ms), where cpd = cardiac phase duration (ms) or duration of phases of cardiac cycle, n = number of successive cpds considered (not less than 200), and i = no . Of cpd, the total power density spectrum (tp) of the cpds as a short - term estimate of the total power of spectral density in the range of frequencies between 0 and 0.5 hz (ms) representing the overall activity of the autonomic nervous system, the power density bandsvlf (0.00.5 hz) = thermoregulatory band or very low - frequency band, reflecting overall activity of some slow mechanisms of sympathetic function (ms),lf (0.050.15 hz) = circulatory band or low - frequency band, reflecting mixed sympathetic and parasympathetic activity (ms),hf (0.150.5 hz) = rsa (respiratory sinus arrhythmia) band, or high - frequency band, reflecting parasympathetic activity and corresponds to n - n variations (time between two heartbeats) caused by respiration (ms),the relative proportions of these bands in the total power density spectrum relative uf band share of tp - vlf (%), relative lf band share of tp - lf (%), relative hf band share of tp - hf (%). Hr as a mean heart rate value on entire recording, absolute sinus arrhythmia (saa) as proposed by eckoldt (1)saa=1ni=1n|cpdi+1cpdi| (ms), where cpd = cardiac phase duration (ms) or duration of phases of cardiac cycle, n = number of successive cpds considered (not less than 200), and i = no . Of cpd, the total power density spectrum (tp) of the cpds as a short - term estimate of the total power of spectral density in the range of frequencies between 0 and 0.5 hz (ms) representing the overall activity of the autonomic nervous system, the power density bands vlf (0.00.5 hz) = thermoregulatory band or very low - frequency band, reflecting overall activity of some slow mechanisms of sympathetic function (ms),lf (0.050.15 hz) = circulatory band or low - frequency band, reflecting mixed sympathetic and parasympathetic activity (ms),hf (0.150.5 hz) = rsa (respiratory sinus arrhythmia) band, or high - frequency band, reflecting parasympathetic activity and corresponds to n - n variations (time between two heartbeats) caused by respiration (ms), vlf (0.00.5 hz) = thermoregulatory band or very low - frequency band, reflecting overall activity of some slow mechanisms of sympathetic function (ms), lf (0.050.15 hz) = circulatory band or low - frequency band, reflecting mixed sympathetic and parasympathetic activity (ms), hf (0.150.5 hz) = rsa (respiratory sinus arrhythmia) band, or high - frequency band, reflecting parasympathetic activity and corresponds to n - n variations (time between two heartbeats) caused by respiration (ms), the relative proportions of these bands in the total power density spectrum relative uf band share of tp - vlf (%), relative lf band share of tp - lf (%), relative hf band share of tp - hf (%). Relative uf band share of tp - vlf (%), relative lf band share of tp - lf (%), relative hf band share of tp - hf (%). A major vagal influence on the saa and the hf band share in the total power density spectrum with regard to cardiac regulation has long been postulated . Ambulatory holter monitoring was done on a total of 70 exposed workers and 27 controls . Ambulatory electrocardiography was obtained using a tracker tape recorder (reynolds medical, hertford, uk) at a sampling rate of 128 hz in the occupational department . (3) psychological - state level: subjective state (ez) as proposed by nitsch [63, 64] and state during the past six months as determined by means of the spes.while no premorbid - intelligence determination was conducted in the subjects, there is good reason to assume that as studied by seeber, it covaries with the standard of education and qualification, and the subjects studied (exposed subjects and controls) were of the same standard.in a supporting approach, a search analysis for drugs and/or metabolites including caffeine and nicotine was conducted at the university's institute of clinical pharmacology, as the results of performance tests may be modified by such substances . Subjective state (ez) as proposed by nitsch [63, 64] and state during the past six months as determined by means of the spes.while no premorbid - intelligence determination was conducted in the subjects, there is good reason to assume that as studied by seeber, it covaries with the standard of education and qualification, and the subjects studied (exposed subjects and controls) were of the same standard.in a supporting approach, a search analysis for drugs and/or metabolites including caffeine and nicotine was conducted at the university's institute of clinical pharmacology, as the results of performance tests may be modified by such substances . Subjective state (ez) as proposed by nitsch [63, 64] and state during the past six months as determined by means of the spes . All statistical analyses were performed with the statistical software package spss for windows (version 15.0). The student's t - test (normal distribution) or mann - whitney test (not normal distribution) were applied to test statistically significant differences between workers and controls . Results were presented using tables displaying the mean with the standard deviation (sd). The analysis was performed using a critical error probability of 0.05 (5%). Moreover, statistical evaluation was performed by means of multivariate methods and single - factor analysis of variance, mantel - haenzel's test . Effect variables known from the literature, such as sex and circadian influence on measurements, were insignificant in this study, as it only involved males, and measurements were consistently taken at the same time of the day . Multivariate biostatistical analysis (oneway procedure using scheffe's test; spss for windows) was performed to identify the lead exposure - related variability of the parameters studied versus other variance - generating sources (age, standard of education / qualification, prior case histories, and motivation). No statistically significant difference was found with respect to the effect factors mentioned, and hence, a monocausal consideration can be presented below excluding lead as an influencing variable (1) performance dataout of the performance data which are mainly influenced centrally, viz int, the total duration and the number of errors in the labyrinth test, the time needed, and the interstimulus interval achieved in the adaptive mcr test (see above), it is only for the initiation time int of the single - choice reaction task (scr) that statistically significant differences were seen between exposed subjects and controls . The mean values of this parameter were 330.3 42.8 ms for the 70 lead - exposed subjects and 306.0 26.5 ms for the controls, with p = .001 (cf . Figure 1), suggesting a slowing of the central information processing speed in exposed subjects.mainly motor performance parameters are the movement time (mov) in the scr, the sensorimotor performance, outtime (out1 and out2) during the first and the second halves of the pursuit test (pur), and the maximum tapping frequency (frq1 and frq2) during the first and the second halves of the tapping test . The movement time was 112.4 35.4 ms in lead - exposed subjects, thus being markedly slower when compared to the controls (91.4 21.6 ms) with p = .001 . Similarly, in the tapping test, the tapping frequency of the preferred hand of exposed subjects was lower than that seen in the normal controls, in particular during the first half of the test, the respective values being 5.4 0.7 hz and 5.8 0.6 hz (p = .03).the total reaction time (ges) in the single - choice reaction task comprises the preferably centrally induced int and the motor - induced mov . Again, exposed subjects (444.2 68.1 ms) were seen to be markedly slower than the controls (398.4 39.1 ms) with p <.001.selecting from the group of 70 lead - exposed subjects (e) the higher exposed (he) and the lower exposed (le) workers, comparison to the controls revealed significantly impaired performance for those exposed to the harmful substance as can be seen in table 1 . Out of the performance data which are mainly influenced centrally, viz int, the total duration and the number of errors in the labyrinth test, the time needed, and the interstimulus interval achieved in the adaptive mcr test (see above), it is only for the initiation time int of the single - choice reaction task (scr) that statistically significant differences were seen between exposed subjects and controls . The mean values of this parameter were 330.3 42.8 ms for the 70 lead - exposed subjects and 306.0 26.5 ms for the controls, with p = .001 (cf . Figure 1), suggesting a slowing of the central information processing speed in exposed subjects . Mainly motor performance parameters are the movement time (mov) in the scr, the sensorimotor performance, outtime (out1 and out2) during the first and the second halves of the pursuit test (pur), and the maximum tapping frequency (frq1 and frq2) during the first and the second halves of the tapping test . The movement time was 112.4 35.4 ms in lead - exposed subjects, thus being markedly slower when compared to the controls (91.4 21.6 ms) with p = .001 . Similarly, in the tapping test, the tapping frequency of the preferred hand of exposed subjects was lower than that seen in the normal controls, in particular during the first half of the test, the respective values being 5.4 0.7 hz and 5.8 0.6 hz (p = .03). The total reaction time (ges) in the single - choice reaction task comprises the preferably centrally induced int and the motor - induced mov . Again, exposed subjects (444.2 68.1 ms) were seen to be markedly slower than the controls (398.4 39.1 ms) with p <.001 . Selecting from the group of 70 lead - exposed subjects (e) the higher exposed (he) and the lower exposed (le) workers, comparison to the controls revealed significantly impaired performance for those exposed to the harmful substance as can be seen in table 1 . (2) physiological strain datathe subjects performing the multistage psychometric test battery did not exhibit any qualitatively different deflection of the physiological reaction parameters hr, saa, and the spectral power density of the cpd as well as the arterial blood pressure . However, the controls exhibited higher average hr and lower average saa (see table 2).still, care should be taken in interpreting the latter finding, as the tonicity prevailing prior to lead exposure was not known . After repeated measurements of hr and saa at rest, normal subjects can be classed into a predominantly vagotonic group i (low hr and high saa) and a predominantly sympathicotonic group ii (comparatively high hr and low saa) [66, 67]. According to ward's cluster analysis (spss), among the 70 lead - exposed copper workers, there were 32 vagotonic subjects (group i) and 28 sympathicotonic subjects (group ii), whereas 10 subjects of group e could not be statistically assigned . Of the 27 controls, two were classed as group i and 22 group ii, while three could not be classed at all . Thus, a greater proportion of exposed subjects could be classed into the group of vagotonic subjects (i) which, in terms of the regulation theory, is more favourable . Figure 2 shows the tonicity pattern in terms of hr and saa at rest, under the strain of the memory span for numbers test, and during recovery.the mean initial condition (rest) for the two groups appears to be different: controls exhibited a high average hr of 75.2 min and a low saa of 16.0 ms . The respective values for the lead - exposed subjects were 67.1 min and 29.6 ms . When under strain, both groups responded with an increase in activity that was characterised by rising hr and diminishing saa . Return to the initial tonicity after recovery showed differences between lead - exposed subjects and nonexposed controls . The former had a marked deficit when compared to the controls; after a 5-min recovery, they were still far away from the initial tonicity, their heart rate being 69.6 min and their sinus arrhythmia by eckoldt saa 25.7 ms . After an identical recovery period, the controls exhibited a much more pronounced relaxation as can be seen from the vegetatively induced cardiovascular parameters of hr = 74.8 min and saa = 17.8 ms versus the values at rest given above . From the higher sinus arrhythmia saa during recovery versus rest, it appears that group c was more relaxed at the end of the test series when compared to the beginning, which was not true for group e. when group e was subdivided into high - exposed (he) and low - exposed (le) subjects, it was found that the recovery tonicity, expressed as the difference between saa at rest and saa during recovery, was further away from the tonicity at rest the higher the workers' exposure to lead had been . This effect can also be seen in figure 2.the result of an fft of successive interbeat intervals represents a power density spectrum which is usually subdivided into three frequency bands a (thermoregulatory effects; 00.05 hz), b (blood pressure regulation; 0.050.15 hz) and c (respiratory sinus arrhythmia; 0.150.5 hz). The absolute power density of the cardiac phase duration spectrum and its three bands a, b, and c, as a whole, was higher for the exposed subjects compared to the controls, a finding which is consistent with the varied group structure by the individual tonicity as outlined above . To permit a lead - modified vagal tone to be identified, one should have a closer look at the regulative dynamics of the frequency band pattern at different strain conditions . Comparison of the relative frequency bands for the two groups of subjects at rest, under test strain, and during subsequent recovery after 5 min reveals different band distributions for lead - exposed subjects and controls as demonstrated by figure 3.it can be seen that in the lead - exposed subjects, the relative pattern of the c band (respiratory sinus arrhythmia) did not change between the three experimental stages, whereas in the controls, a statistically significant difference (p = .01) was observed, typically between the test strain (23.9%) and subsequent recovery (19.9%). The exposed subjects did not exhibit any difference between the three test stages, but a difference did exist between rest and test (p = .05) as well as between test and recovery (p = .03). The subjects performing the multistage psychometric test battery did not exhibit any qualitatively different deflection of the physiological reaction parameters hr, saa, and the spectral power density of the cpd as well as the arterial blood pressure . However, the controls exhibited higher average hr and lower average saa (see table 2). Still, care should be taken in interpreting the latter finding, as the tonicity prevailing prior to lead exposure was not known . After repeated measurements of hr and saa at rest, normal subjects can be classed into a predominantly vagotonic group i (low hr and high saa) and a predominantly sympathicotonic group ii (comparatively high hr and low saa) [66, 67]. According to ward's cluster analysis (spss), among the 70 lead - exposed copper workers, there were 32 vagotonic subjects (group i) and 28 sympathicotonic subjects (group ii), whereas 10 subjects of group e could not be statistically assigned . Of the 27 controls, two were classed as group i and 22 group ii, while three could not be classed at all . Thus, a greater proportion of exposed subjects could be classed into the group of vagotonic subjects (i) which, in terms of the regulation theory, is more favourable . Figure 2 shows the tonicity pattern in terms of hr and saa at rest, under the strain of the memory span for numbers the mean initial condition (rest) for the two groups appears to be different: controls exhibited a high average hr of 75.2 min and a low saa of 16.0 ms . The respective values for the lead - exposed subjects were 67.1 min and 29.6 ms . When under strain, both groups responded with an increase in activity that was characterised by rising hr and diminishing saa . Return to the initial tonicity after recovery showed differences between lead - exposed subjects and nonexposed controls . The former had a marked deficit when compared to the controls; after a 5-min recovery, they were still far away from the initial tonicity, their heart rate being 69.6 min and their sinus arrhythmia by eckoldt saa 25.7 ms . After an identical recovery period, the controls exhibited a much more pronounced relaxation as can be seen from the vegetatively induced cardiovascular parameters of hr = 74.8 min and saa = 17.8 ms versus the values at rest given above . From the higher sinus arrhythmia saa during recovery versus rest, it appears that group c was more relaxed at the end of the test series when compared to the beginning, which was not true for group e. when group e was subdivided into high - exposed (he) and low - exposed (le) subjects, it was found that the recovery tonicity, expressed as the difference between saa at rest and saa during recovery, was further away from the tonicity at rest the higher the workers' exposure to lead had been . The result of an fft of successive interbeat intervals represents a power density spectrum which is usually subdivided into three frequency bands a (thermoregulatory effects; 00.05 hz), b (blood pressure regulation; 0.050.15 hz) and c (respiratory sinus arrhythmia; 0.150.5 hz). The absolute power density of the cardiac phase duration spectrum and its three bands a, b, and c, as a whole, was higher for the exposed subjects compared to the controls, a finding which is consistent with the varied group structure by the individual tonicity as outlined above . To permit a lead - modified vagal tone to be identified, one should have a closer look at the regulative dynamics of the frequency band pattern at different strain conditions . Comparison of the relative frequency bands for the two groups of subjects at rest, under test strain, and during subsequent recovery after 5 min reveals different band distributions for lead - exposed subjects and controls as demonstrated by figure 3 . It can be seen that in the lead - exposed subjects, the relative pattern of the c band (respiratory sinus arrhythmia) did not change between the three experimental stages, whereas in the controls, a statistically significant difference (p = .01) was observed, typically between the test strain (23.9%) and subsequent recovery (19.9%). The exposed subjects did not exhibit any difference between the three test stages, but a difference did exist between rest and test (p = .05) as well as between test and recovery (p = .03). (3) psychological state datafrom the spes questions relating to the psychological state, 16 were selected which are logically connected with a neurotoxic exposure in question: (1) = physically tired in the morning, (2) = mentally tired in the morning, (3) = general sensation of lack of energy, (4) = feelings of vertigo or fainting, (5) = lack of initiative, (6) = difficulties falling asleep, (7) = disturbed sleep, (8) = waking up too early, (9) = finding it hard to concentrate, (10) = anxious, restless, out of balance, (11) = being forgetful, (12) = feeling down without reason, (13) = being easily upset, (14) = headaches, (15) = feeling clumsy or shaky, and (16) = prickling sensation, numbness in limbs . The answers of never, occasionally, often, and very often scored points from 0 to 3 . A statistically significant difference between exposed subjects and controls was noted for questions 1, 2, 3, 4, 9, 11, 12, and 15 (p <.05; see table 3). Each of these significant differences concerned greater complaints experienced by the lead - exposed subjects versus controls.at the end of the psychometric test series, each subject was shown nitsch's ez self - rating scale . In evaluating the subjective opinions, a positive exertion attitude too was considered as this feature is known to have a major influence on psychometric test results . Yet, factor, no statistical differences were observed between the groups and, hence, the varied findings obtained in the performance tests are not thought to be attributable to differences in exertion attitude or motivation . From the spes questions relating to the psychological state, 16 were selected which are logically connected with a neurotoxic exposure in question: (1) = physically tired in the morning, (2) = mentally tired in the morning, (3) = general sensation of lack of energy, (4) = feelings of vertigo or fainting, (5) = lack of initiative, (6) = difficulties falling asleep, (7) = disturbed sleep, (8) = waking up too early, (9) = finding it hard to concentrate, (10) = anxious, restless, out of balance, (11) = being forgetful, (12) = feeling down without reason, (13) = being easily upset, (14) = headaches, (15) = feeling clumsy or shaky, and (16) = prickling sensation, numbness in limbs . The answers of never, occasionally, often, and very often scored points from 0 to 3 . A statistically significant difference between exposed subjects and controls was noted for questions 1, 2, 3, 4, 9, 11, 12, and 15 (p <.05; see table 3). Each of these significant differences concerned greater complaints experienced by the lead - exposed subjects versus controls . At the end of the psychometric test series, each subject was shown nitsch's ez self - rating scale . In evaluating the subjective opinions, a positive exertion attitude too was considered as this feature is known to have a major influence on psychometric test results . Yet, similar to the motivation factor, no statistical differences were observed between the groups and, hence, the varied findings obtained in the performance tests are not thought to be attributable to differences in exertion attitude or motivation . In the light of the great expectations the occupational medicine is to meet when it comes to detecting vocationally induced disturbances of health in good time such that primarily successful preventive action can be taken, early indicators hitherto not considered from the clinical viewpoint are also needed for neurotoxic substances . This approach is in line with workers' increasing demand for comprehensive occupational medical care . In east germany, an old nonferrous metal works facility was available for the investigation in which, ideally suited for the study, 70 male workers had been continuously exposed to occupational lead over not less than 5 years, with exposure levels being roughly identical to the current german threshold limit value for lead of 0.1 mg / m. of these 70 males, 21 had had a verified permanent lead concentration of more than 35 g / dl over the past 510 years . The average level among the normal population of germany has been reported to range from 5 to 8 g / dl, and there has been a trend towards lower concentrations . Considering the literature on psychometric performance impairment, the lead - exposed subjects examined in the present study were expected to exhibit effects which relate to the short - term memory, the discrimination capacity, or the speed of information processing as well as the motor reaction time . In fact, only few of the present performance findings came up to the hypothetical expectations of being early indicators of a lead - induced neurotoxic harm . Those were predominantly the motor performance features of movement time in the single - choice reaction task and the tapping frequency in the tapping test, the total reaction time in the single - choice reaction task, and the initiation time, which may be considered a parameter of central information processing . The present findings failed to meet the great expectations for the adaptive multiple - choice reaction task . This contrasts sharply with lilienthal et al . Who described multiple - choice reaction tests as providing more meaningful information in case of a lead - induced damage in question compared to single reactions . However, the present psychometric findings revealing an impaired performance for some of the lead - exposed subjects compared to the controls need to be qualified when the doses involved are considered . Indeed, an increasing individual lead dose did not bring about a statistically significant impairment of performance data . It is because of the pronounced difference between groups that early diagnosis in occupational medicine cannot do without single - reaction and tapping tests . To objectify a lead - induced neurotoxic damage not yet identified by the clinician or occupational physician, use should be made of physiological strain parameters as well as psychological state and subjective experience data, in addition to the performance data referred to above . According to the hypothesis proposed, workers after many years of lead exposure were assumed to exhibit greater strain reactions than the nonexposed controls, provided the performance was comparable . While the specificity of the strain parameters of heart rate was partly to characterise a varied strain pattern, results were obtained for the cardiac rhythm response (heart rate variability) which were not expected when the study was planned on the grounds of the literature . This relates to the slowed restoration of the initial vegetative condition in the lead - exposed subjects once they have performed their test tasks . In fact, a simple vegetative tonicity comparison between exposed subjects and controls at rest does not consistently lend itself to indicating the expected effect of a restricted cardiac phase duration variability and, thus, vagus depression by lead . In this respect, we go against a number of other workers [25, 4547] who described this effect for lead workers at rest . In the latter publications, it has been tacitly assumed that the restricted hrv found was solely caused by exposure to heavy metals, while disregarding the fact that even normal subjects not occupationally exposed to harmful substances are generally known to differ greatly from each other because of their hrv at rest, whether inherited and/or acquired as a result of their conduct of life (in particular sports activities). Therefore, unless sufficient previous knowledge is available, sectional comparison of hrv variables for various groups of subjects is not suited to provide meaningful information on the effect of an individual factor . The effect of a slowed restoration of the initial vegetative condition as noted in this study does not take into account the interindividually varied vegetative tonicity at rest, and hence, it is believed to be a measure more appropriate to describe lead - induced vagus depression . A slower adjustment of cardiovascular parameters due to diminished vagus efferences was described as early as 1977 by schwarz who performed vagus blocking experiments . Described that in copper smelters, occupational exposure to lead hrv is lower than in healthy subjects, which results rather from the decreased parasympathetic than from the increased sympathetic activity . A longitudinal study performed at intervals of several years in case of persisting exposure would offer another approach to demonstrating the effect of vocationally absorbed lead . In fact, a repeated study conducted among workers of a company after about 4 years revealed a progressive restriction of the hrv . As already mentioned, a study also included search for early indicators of a clinically concealed lead - induced neurotoxic damage at the level of subjective state and experience too . The hypothesis of an impaired subjective sensation of the state of health and the mental state was confirmed for a number of categories in lead - exposed workers versus controls, and the findings were statistically significant . In this context, effects with regard to tiredness (or lassitude) and lack of energy deserve particular mention . This is essential to valuation of limits as the copper workers studied had been exposed to the german threshold limit value (de - mak). However, verification of impaired subjective state and experience through years of exposure to lead within statutory limits does not apply to all of the categories included in the questionnaire or factor groups of the spes method as well as nitsch's self - rating scale . Still, applied occupational medicine should include these methods in its activities of monitoring lead - exposed subjects, especially since they can be implemented without any need for major equipment . It is admitted, though, that studies of subjective state and mental experience alone are not sufficient to reliably ascertain the neurotoxic effect of lead within the bounds of exposure hitherto considered harmless . Some studies described the bone lead levels as a good indicator of exposure and lead toxic effects but unfortunately not possibly practicable in the occupational studies in our institute . Park et al . Have reported that associations between patella bone lead levels on heart rate variability are stronger among study participants with metabolic syndrome and with individual component of metabolic syndrome . As the occupational and environmental medicine is increasingly required to advance into spheres where marked effects by harmful substances fail to occur (being undisputable that in companies and in the general environment, weak pollutant - induced effects occur, particularly in sensitive subjects), an interdisciplinary approach involving several clinical and theoretical disciplines is becoming essential . In the present study, an exemplary attempt was made to get psychophysiology, clinical psychology, and cardiology involved in an issue of occupational medicine . Modern occupational medicine should proceed along these lines so as to meet the self - set high standard of optimal prevention for all working people.
|
Hepatitis c virus (hcv) infection is reported to have a prevalence of approximately 3% worldwide . Majority of patients with chronic hcv have a mild, asymptomatic elevation in serum transaminase levels with no significant clinical symptoms . Around 25% of patients with chronic hcv have persistently normal alanine aminotransferase (pnalt). Definition of normal alanine aminotransferase (alt) has changed over time and reference range for normal alt differs based on different laboratory cutoffs . Prati et al . In 2002 suggested new cutoffs with 30 u / l (international unit) for men and 19 u / l for women compared to 40 u / l and 30 u / l for men and women, respectively . A 2009 american association for the study of liver disease (aasld) practice guideline suggested an alt value of 40 u / l on 2 - 3 different occasions separated by at least a month over a period of 6 months . Others have used 3 different alt levels equal to or below upper limit of normal (uln) separated by at least 1 month and sometimes over a period of 18 months . It was generally thought that people with pnalt have a mild liver disease and the degree of liver fibrosis is minimal [614]. Based on this, later on, it was realized that a considerable number of such patients developed significant inflammation and fibrosis over time . More recently, treatment has been recommended along the same lines for patients with pnalt as patients with elevated alt . Although more data is becoming available about the relationship of liver enzymes and course of chronic hcv infection, data regarding hcv infection and pnalt is relatively scarce . Because of variation in the definition of pnalt, fewer studies have looked at the relationship of pnalt with chronic hcv infection using updated normal alt definitions . Department of hepatology at the university of illinois (u of i) medical center, chicago, had a database of over 1200 patients with chronic hcv infection . Medical records of these patients were reviewed in an effort to characterize patients with chronic hcv infection and pnalt . Histological and clinical parameters for patients with pnalt as well as elevated alt were analyzed . Database of patients with hcv infection presenting to u of i medical center, chicago, was reviewed . Patients with biopsy proven hcv infection and a detectable hcv ribonucleic acid (rna) in blood were chosen . Of these, patients with an alt at liver biopsy, at least one additional over the next 12 months, and liver biopsy slides available for review were identified . Most of the liver biopsy procedures were done at u of i medical center and in cases where biopsies were done at outside facility they were read again at u of i medical center . Two expert hepatologists, who were masked to clinical data, assigned knodell et al . Intervals for alt measurement were chosen around the time of liver biopsy as well as 3, 6, and 12 months after biopsy . Patients with end - stage renal disease like those on dialysis and stage iv chronic kidney disease with creatinine clearance of 1529, those who received organ transplant, those with co - infection with hiv, those who were positive for hepatitis b surface antigen (hbsag), and those receiving antiviral therapy for chronic hcv were excluded . Pnalt was defined as alt 30 u / l on at least 2 different occasions over 12 months . Strict pnalt was defined as alt 30 u / l for males and 19 u / l for females . Demographic data including age at biopsy, gender, and race were recorded . Clinical data included body mass index (bmi), alcohol use, tobacco use, and presence of diabetes mellitus (dm). Hcv virus was further characterized by recording hcv rna levels, genotype, and duration of infection . Histological data included individual markers of inflammation like portal tract inflammation, piece meal necrosis, and lobular inflammation as well as fibrosis according to knodell et al . Scoring system . Inflammatory score (sum of portal tract inflammation, piece meal necrosis, and lobular inflammation) and histologic activity index (hai) score (sum of inflammatory score and fibrosis) were calculated . Histologic data from pnalt was then compared with patients from elevated alt group . Finally, clinical characteristics of pnalt with advanced fibrosis were compared with pnalt but with no advanced fibrosis . Independent sample t - test and chi - squared test were used to calculate p values where appropriate . A total of 243 patients out of a database of 1200 patients with hcv satisfied the study criteria . Main reasons to exclude a large number of patients were a lack of detectable rna despite biopsy report, outside biopsy report but slides not available for review, single or no alt value, and patients undergoing treatments . Those analyzed were further divided into pnalt, strict pnalt, and elevated alt group . 32 (13%) of these patients were identified as pnalt group and 211 (87%) were identified as elevated alt group . Only 13 (5%) patients satisfied criterion for strict pnalt and this group was not analyzed further . The range of alt values at different time intervals was specified (table 1). 24 (75%) of pnalt patients were females while 85 (40%) with elevated alt were females . 13 (41%) with pnalt were african american (aa) compared to 87 (41%) with elevated alt, 14 (44%) were caucasian (w) compared to 79 (38%) with elevated alt, and 5 (15%) were hispanic (h) compared to 44 (21%) with elevated alt . There was no statistically significant difference in the racial distribution between pnalt and elevated alt group . There was a higher frequency of women in the pnalt group compared to the elevated alt group (p = 0.001). Diabetes and alcohol use were more common among patients with elevated alt compared to pnalt (p = 0.04 and 0.049, resp . ). Most notably, patients with pnalt had a higher rate of cirrhosis (p = 0.007). There were no differences in age at biopsy, tobacco use, bmi, rna level, and duration of infection between pnalt and elevated alt groups (table 2). Further evaluation of liver histology showed no statistically significant difference in mean fibrosis score, mean portal tract inflammation score, mean piecemeal necrosis score (pmn), mean lobular inflammation score, mean histologic activity index (hai) score, and mean inflammatory score between pnalt group and elevated alt group (table 3). Comparison of clinical characteristics of pnalt group with advanced fibrosis with pnalt group without advanced fibrosis showed that only platelet count was significantly different between the two groups (table 4). Tables 5 and 6 characterize the distribution of hcv genotypes based on pnalt and hai score, respectively . The natural history of chronic hcv infection with pnalt is poorly understood [1820]. We attempt to describe the characteristics of patients with pnalt, which constitutes almost 2530% of patients with chronic hcv infection . Firstly, a high proportion of patients with pnalt had advanced fibrosis, and degree of inflammation was not significantly different than chronic hcv infection with abnormal alt . Secondly, it was difficult to identify a substantially large set of patients with hcv infection and pnalt given that there is a significant fluctuation in the alt level over time [9, 15]. We chose duration of 12 months to observe the levels of alt instead of 6 months period . It is becoming clear that 6 months is probably too short given that in some cases alt level may fluctuate after initial period of stability [7, 2124]. Most patients with pnalt were females, which is consistent with earlier findings [79]. Similarly, age at biopsy, bmi, rna level, and duration of infection were not significantly different between the two groups . Hcv genotype distribution showed that a majority (81%) of patients belonged to genotype 1 and it is a well - characterized fact . There was no significant difference in terms of distribution of genotypes between the 2 groups (table 5). Also there was no significant difference in hai according to genotype distribution (table 6). Hcv genotyping was performed in 181/243 (75%) patients and was missing in 62 (25%) patients . The likely reason was transition from paper to electronic records in 1990s and loss of some data . Within pnalt, those with advanced fibrosis differed from those without advanced fibrosis by platelet count only . Similarly, pnalt patients were divided based on low - normal alt (<19) and high - normal alt (2030) for comparing hai scores among them but no significance was seen (table 7). Studies to date have been mentioning a milder disease for pnalt in terms of fibrosis and necroinflammation [79, 2628]. Some studies have pointed to this fact as well [14, 29, 30]. This is an interesting finding given that despite significant inflammation (comparable to abnormal alt) the alt levels in some of these patients have been consistently low . Similarly, advanced fibrosis was more common in pnalt group as compared to the elevated alt group (p = 0.007). It is thought that alt levels normalize in patients with advanced fibrosis and that is why some authors will advocate doing liver biopsy in patients with hcv infection and normal alt levels . It is interesting to note that the 6 patients with pnalt who had cirrhosis also had evidence of thrombocytopenia . Our results indicate that platelet count can be used as a marker to predict fibrosis in patients with pnalt . For instance, almost all patients in the study group had an alt measured around biopsy but only slightly more than half had alt measured around 12 months . Second, sample size was relatively small and might not be a true representative of patients with pnalt . This might in particular be valid for pnalt with advanced fibrosis as 8 (25%) out of 32 patients with pnalt had f3-f4 while only 19 (9%) out of 211 patients with elevated alt had f3-f4 (p = 0.007). It is not clear if the outcome would have been the same if denominator for pnalt was high . Small sample size was caused mainly as described before as well as comorbid conditions like advanced kidney disease, hiv, hbsag positive, and being on antiviral treatment . For example, 11 patients with pnalt were excluded as they had esrd; alt levels are known to be lower in esrd [34, 35] secondary to an impaired immune response in patients with esrd . This raises concern that those with pnalt and severe liver fibrosis may have been in biochemical remission . For example, of the 8 patients with severe liver fibrosis (stages 3 and 4) and pnalt, only 2 patients had 4 alt measurements over 12 months (over the period of 0, 3, 6, and 12 months), while 3 patients had 3 alt measurements over 12 months, and the remaining 3 patients had only 2 alt measurements over the 12 months period . Thus, it is not possible to say with certainty that all patients with pnalt and severe liver damage had uniformly low alt all along . In conclusion, histological changes observed in hcv patients with pnalt will argue that alt is not a reliable indicator of hepatic inflammation or fibrosis . Female gender, absence of dm, and abstinence from alcohol were associated with pnalt . These findings indicate the need for more studies with higher number of pnalt patients to look at the relationship of pnalt with changes occurring at histological and molecular levels.
|
Acute uncomplicated cystitis (auc) is the most commonly encountered bacterial infections in healthy women and fluoroquinolone treatment has been a standard therapy for it (1). However, a trend toward increasing drug resistance among escherichia coli (e. coli) has complicated the treatment of auc over the past few years (2). Most of these infections are caused by distinctive e. coli strains, and these strains possess virulence factors (vfs) to overcome host defenses and injure or invade host tissues so that the e. coli persist and multiply within the host's urinary tract (3). Several investigations have shown that the ciprofloxacin resistant e. coli strains (cfre) display overall reduced virulence, whereas the ciprofloxacin susceptible e. coli strains (cfse) are more virulent (4 - 7). Some epidemiological studies have also reported that cfre isolates exhibit a different phylotype than do their susceptible counterparts . However, the previous studies have major limitations for their findings to be generally accepted . First of all, the small numbers of the cfre isolates may limit the ability to characterize the resistant strains because of the increased likelihood of type i and ii errors (7). Second, because the expression patterns of vf and the phylotyping are different among different countries, the isolates from western countries have some limitations to explain the phylotyping and vfs in asia . For example, russian urinary tract infection isolates belonged more often to phylogenetic group a and they possessed fewer virulence genes than did the norwegian isolates (9, 10). Third, the available studies were a mix of data from uncomplicated and complicated cystitis . However, the characteristics of auc are different from the complicated cystitis according to the antibiotic resistance, the drug treatment responses and the associated diseases . We must separately characterize the two patterns of cystitis in a study that focuses on their phylotyping and their virulence expressions . Fourth, the absence of the clinical or epidemiological data of the host in the previous studies does not allow assessing the impact of the host on certain vf profiles or on the phylotyping from the infection . To clarify the clinical characteristics of the ciprofloxacin resistance in patients with auc, we analyzed the vfs, the resistance phenotype and the clinical characteristics for 54 samples of ciprofloxacin resistant strains from patients with auc and 55 randomly selected ciprofloxacin sensitive strains from patients with auc in 22 korean hospitals . All the female patients between 18 and 65 yr old and who presented with symptoms of dysuria, urgency, frequency or a combination of these between may and october 2006 were included in this study . The women who had received antimicrobial agents in the 4 weeks previous to the study were excluded . A clean - catch midstream urine sample was examined for the presence of leukocytes by microscopy, and then it was sent to a central laboratory for culture . Only one specimen per patient the e. coli included in the study were from cultures yielding 10 colony forming unit (cfu)/ml (2). In total, 225 e. coli isolates were prospectively collected from the urine samples of the female outpatients with uncomplicated cystitis in 22 hospitals of korea . The minimum inhibitory concentration (mic) of ciprofloxacin resistance was determined by the agar dilution method on mueller - hinton agar (becton, dickinson and company, franklin lakes, nj, usa) as recommended by the nccls (2). All 54 samples with ciprofloxacin resistance and the 55 randomly selected ciprofloxacin sensitive samples were included . For the total 109 isolated samples, 6 of the patients' medical records were not available for clinical data analysis . The numbers of white blood cells (wbc) in the urine were dichotomized into 1 - 4 wbc and 5 wbc per high power field . The numbers of cases of recurrent cystitis were also dichotomized into no recurrence and recurrence within a year after the first bout of auc . One e. coli colony was harvested from the characterized plate and the bacteria were grown at 37 in luria - bertani broth . The bacterial dna was extracted by using the wizard genomic dna purification kit (promega, madison, wi, usa). The e. coli isolates were grouped into phylogenetic biotypes (a, b1, b2, and d) according to the presence of the chua and yjaa genes and tspe4.c2 by performing multiplex polymerase chain reaction (pcr) (table 1) (11). Pcr was performed with 25 l of the following reaction mixture: 12.5 l of 2 times gotaq green master mixture (promega), 20 pm of each primer and 1 l of the dna template . The amplification conditions were as follows: each step consisted of 95 for 30 sec, 55 for 30 sec and 72 for 30 sec, and there was a final extension step of 7 min at 72. thirty cycles were performed for amplification . We also examined for 7 vfs (fima, papgiii, papef, cnf1, hlya, sfai, and dafabc) by performing a single polymerase chain reaction (table 1). The amplification conditions were as follows: each step consisted of denaturation at 95 for 30 sec, annealing at 53 for fima and papgiii, 55 for cnf1, 57 for hlya, papef, and sfai, and 59 for 30 sec for dafabc and extension at 72 for 30 sec . Statistical analysis was performed by using fisher's exact test, chi - square tests, student's t - tests and the mann - whitney test . Multiple variables were assessed as predictors of the categorical outcomes by multivariable logistic regression analysis . All the female patients between 18 and 65 yr old and who presented with symptoms of dysuria, urgency, frequency or a combination of these between may and october 2006 were included in this study . The women who had received antimicrobial agents in the 4 weeks previous to the study were excluded . A clean - catch midstream urine sample was examined for the presence of leukocytes by microscopy, and then it was sent to a central laboratory for culture . Only one specimen per patient the e. coli included in the study were from cultures yielding 10 colony forming unit (cfu)/ml (2). In total, 225 e. coli isolates were prospectively collected from the urine samples of the female outpatients with uncomplicated cystitis in 22 hospitals of korea . The minimum inhibitory concentration (mic) of ciprofloxacin resistance was determined by the agar dilution method on mueller - hinton agar (becton, dickinson and company, franklin lakes, nj, usa) as recommended by the nccls (2). All 54 samples with ciprofloxacin resistance and the 55 randomly selected ciprofloxacin sensitive samples were included . For the total 109 isolated samples, 6 of the patients' medical records were not available for clinical data analysis . The numbers of white blood cells (wbc) in the urine were dichotomized into 1 - 4 wbc and 5 wbc per high power field . The numbers of cases of recurrent cystitis were also dichotomized into no recurrence and recurrence within a year after the first bout of auc . One e. coli colony was harvested from the characterized plate and the bacteria were grown at 37 in luria - bertani broth . The bacterial dna was extracted by using the wizard genomic dna purification kit (promega, madison, wi, usa). The e. coli isolates were grouped into phylogenetic biotypes (a, b1, b2, and d) according to the presence of the chua and yjaa genes and tspe4.c2 by performing multiplex polymerase chain reaction (pcr) (table 1) (11). Pcr was performed with 25 l of the following reaction mixture: 12.5 l of 2 times gotaq green master mixture (promega), 20 pm of each primer and 1 l of the dna template . The amplification conditions were as follows: each step consisted of 95 for 30 sec, 55 for 30 sec and 72 for 30 sec, and there was a final extension step of 7 min at 72. thirty cycles were performed for amplification . We also examined for 7 vfs (fima, papgiii, papef, cnf1, hlya, sfai, and dafabc) by performing a single polymerase chain reaction (table 1). The amplification conditions were as follows: each step consisted of denaturation at 95 for 30 sec, annealing at 53 for fima and papgiii, 55 for cnf1, 57 for hlya, papef, and sfai, and 59 for 30 sec for dafabc and extension at 72 for 30 sec . Statistical analysis was performed by using fisher's exact test, chi - square tests, student's t - tests and the mann - whitney test . Multiple variables were assessed as predictors of the categorical outcomes by multivariable logistic regression analysis . The prevalence of vfs were as follows; fima, papef, papgiii, sfai, dafabc, cnf1, and hlya was present in 96%, 54%, 68%, 91%, 49%, 72%, and 29% of the samples, respectively (fig . The expressions of papef, cnf1, and hlya were significantly more prevalent in the cfse than in the cfre (p=0.007, p=0.018, p=0.011, respectively), whereas the expression of fima, dafabc, papgiii, and sfai were not (p=0.346, p=1.0, p=0.839, p=0.514, respectively) (table 2). The phylotype b2, d, a, and b1 was present in 57%, 26%, 16%, and 1% of the samples, respectively (fig . The cfse was marginally associated with the group b2 (p=0.05) (table 2). Presence of pyuria and a previous history of auc within the recent year were not related with the phylotyping and the all virulence factors (table 3). The expressions of phylotype groups b2, papef, and fima were associated with a lower absolute patient age (p=0.03, p=0.002, p=0.03, respectively) (table 4). On the logistic regression model, the expressions of cnf1 and papef reduced the ciprofloxacin resistance risk (odds ratio [or] 0.237, 95% confidence interval [ci] 0.07 - 0.79 for cnf1; or 0.40, 95% ci 0.16 - 0.96 for papef) (table 5). However, the phylogenetic background did not increase the risk of ciprofloxacin resistance (or 1.843, 95% ci 0.766 - 4.437, p=0.173) (table 5). This study was a prospective nation - wide study that was conducted to evaluate the antibiotic resistance of e. coli isolates from korean auc patients (2). The exclusion criteria were symptoms of or predisposing factors for complicated urinary tract infections such as pregnancy, symptoms lasting longer than 7 days, fever, known urological or nephrological problems, and more than 4 recurrences in the previous year (2). The previous data has shown that among human clinical e. coli isolates, resistance to ciprofloxacin is associated with decreased virulence and phylogenetic groups b2 (3 - 8). If this is true, the e. coli isolates in areas with a higher prevalence of ciprofloxacin resistance should show a lower incidence of virulence factors . It is known that the expressions of vfs and phylotypes are different between nearby or remote countries (9, 10, 12). The fluoroquinolone resistance by e. coli is highly detected mostly in the asia - pacific area . Moreover, ciprofloxacin should be reconsidered in some asian countries as a first line treatment for recurrent cystitis (2, 13, 14). However, there is little data about the expressions of vfs and the phylotypes in e. coli isolates from asian patients with auc . The high prevalence of fima is in accordance with the studies conducted by other investigators (4, 15). Our results showed that the proportions of fima among the ciprofloxacin resistant isolates and the ciprofloxacin sensitive isolates were not different . P - fimbriation is a characteristic of the strains that cause upper urinary tract infections . Each p - fimbriation is composed of a major subunit papa and minor adherence - related fimbrial subunits such as pape, papf, and papg . We amplified the partial gene sequence of pape and papf because it is well known that the results of gene sequencing papef are very similar or identical to those shown for other pap families for ciprofloxacin resistance (8). In addition, the expression of papef significantly reduced the ciprofloxacin resistance risk (or 0.40, 95% ci 0.16 - 0.96 for papef). The result of our study on the papef expression was well matched with other previous studies (6, 7). The prs (pap - related substance) adhesin variant, which is also known as class iii g adhesin or the papg variant iii, is usually the predominant papg variant among the e. coli isolates from women and children with cystitis (16). Even though the protein sequences between papg and papgiii were very similar (94% match in protein sequences with the blast analysis), there was no correlation between the expressions of papef and papgiii (p=0.199). In addition, the expression of papgiii in our study was not associated with ciprofloxacin resistance . 17) reported that the expression of papgiii was lower among isolates that caused cystitis than our study . But a geographically uneven distribution of papgiii or the differences of the patients' disease status may have contributed to the dissimilarity of papiii expression . In this respect, there was a significant correlation in our study between the presence of the papgiii gene and the presence of genes encoding cnf1 and hyla (p=0.000, p=0.006, respectively). (17) reporting that there was a 100% association between the presence of the papgiii gene and the presence of alpha - hemolysin and necrotizing factor type 1 . Cnf1 (cytotoxic necrotizing factor type 1) belongs to a group of bacterial necrotic substances that destroy host cells . E. coli also produce hemolysins, which are cytotoxic due to the formation of transmembranous pores in host cell membranes (18). In addition to lysing erythrocytes, hemolysin is toxic to a range of host cells in ways that probably contribute to inflammation, tissue injury and impaired host defenses . Our results showed that the genes encoding hemolysin and cnf1 among the cfse strains were more prevalent than the cfre strains . Afa gene clusters encoding a - fimbrial adhesion are frequently found in e. coli causing intestinal and urinary tract infections . Members of the s - fimbrial family of adhesins are frequently expressed in the extraintestinal e. coli strains isolated from men (3). This adhesion family consists of s - fimbriae (sfa), with its subtypes sfai and sfaii . In our study, the dafabc and sfai gene did not exhibit any trend for virulence - associated ciprofloxacin resistance . Interestingly, the incidences of virulence factors were high when compared with those of other studies (6, 7, 9). This finding is not similar with the rule " quinolone - resistant uropathogenic e. coli are less virulent " . Many studies have used the multiplex pcr for determining the expression of virulence factors (15, 17), which was sometimes difficult to define a specific band according to each virulence factor . Practically, some studies have used a multiplex pcr first and then hybridized amplified products with a specific sequence product in order to obtain high specificity (8, 19). In our study, we did not use multiplex pcr because of the presence of non - specific bands and the small differences among the specific bands (for example papef, sfai, and fima in fig . 1). We did a single test " one pcr process for one virulence factor " . Although time consuming, this test is easy and accurate (6). We duplicated the experiment using 20% of the samples . In the present work, 109 e. coli isolates were classified into 4 phylogenetic groups via polymerase chain reaction: 63 group b2, 17 group a, 28 group d and 1 group b1 . Of 63 group b2 isolates, 38 revealed ciprofloxacin sensitivity, whereas 25 revealed ciprofloxacin resistance . Of 17 group a isolates, 8 revealed ciprofloxacin sensitivity, while 9 revealed ciprofloxacin resistance . Of 28 group d isolates, 11 revealed ciprofloxacin sensitivity, whereas 17 revealed ciprofloxacin resistance . Resistant e. coli isolates, the shift toward the non - b2 phylogenetic groups (notably, groups a, d and b1) was noted . Local inflammatory manifestations such as dysuria, frequency, lower abdominal pain together and pyuria are noted in the cases with auc . Few studies have yet examined the expression of virulence factors and the characteristics of patients with auc . We examined the associations between vfs and the patient characteristics as age, concomitant pyuria and a previous cystitis history within the recent year . Pyuria and a previous cystitis history were related neither with the phylotyping result nor with the vfs . The expressions of the phylotype group b2, papef and fima were found to be associated with a lower absolute patient age . Ciprofloxacin resistance was not related with the patients' ages in our study (table 4). Unlike our study result, it is well known that an old age group above 65 yr showed a tendency for antibiotic resistance as well as a tendency of asymptomatic or less symptomatic infections (20, 21). The difference may be a result of different age composition and a strict guideline to exclude the complicated uti in this study . In conclusion, the ciprofloxacin resistant e. coli isolates from patients with acute uncomplicated cystitis exhibit the non - b2 phylotype and a selective loss of virulence factors in korea.
|
Human papillomavirus (hpv) infection is considered as the most common sexually transmitted virus infection (1). Cervical cancer is the second / third leading cause of cancer in females, with an estimated 493,000 cases and 273,000 deaths, annually (2). The human papillomavirus genotypes 6, 11, 16 and 18 are transmitted sexually and considered as the most common cause of anogenital warts and cervical cancers (3, 4). Human papillomavirus are small, non - enveloped, double - stranded circular dna, 8 kb in size, surrounded by a 55-nm capsid . So far, more than 150 genotypes of the virus have been identified (5). Low risk hpvs result in benign tumors, while high - risk hpvs generate malignant tumors . Human papillomavirus types 6 and 11 have low malignant potential; however, some studies have introduced these types as risk factors for vulvar malignancy (1, 2). Genotypes 16 and 18 of hpv are high risk hpvs and responsible for 70% of all cervical cancer cases (3 - 5). A high prevalence of hpv genotypes 16 and 53 has been reported in iran (6, 7). The pap smear, cytological evaluations, serological and immunohistochemical staining methods for identification of hpv variants are insensitive . On the other hand, a highly specific and sensitive test for hpv genotyping determination is the polymerase chain reaction (pcr) (3). Thus, the pcr can be a screening test for detection of hpv dna in precancerous lesions of genital warts (4, 5). The present study was conducted to determine the frequency of hpv genotypes in patients with anogenital warts . This study was a cross sectional research designed with 54 patients with anogenital warts referred and registered at the dermatology department of imam hospital of ahvaz city, southwest iran, during 2011 to 2012 . Patients with anogenital warts who under treatment, those with severe systemic diseases, and immunocompromised (cancerous and organ transplanted) individuals were excluded from the study . The ethical committee of ahvaz jundishapur university of medical sciences approved this study (eth-488) and all patients signed an informed consent form . A questionnaire was set up and completed based on the patients data such as age, gender, marital status, characteristic of lesions (duration, location and shape) and physical examination . Laboratory tests including venereal disease research laboratory (vdrl), human immunodeficiency virus (hiv), and hepatitis c virus (hcv) antibodies as well as hbs ag were carried out for all patients . The warts were diagnosed based on clinical findings for typical lesions while histopathological assessment was performed for suspicious lesions . The samples were then fixed in 10% formalin and sent to a virology laboratory affiliated to ahvaz jundishapur university of medical sciences . The dna was extracted from the patients tissue sample using a high pure pcr template kit (roche, germany), according to the manufacturer s instruction . 5 - tttgttactg tggta gatactac - 3, and reverse, gp6 5 - gaaaaataaactgtaaa tcatattc - 3 . The pcr reaction mixture was then prepared containing: 5 l template, 1 l dntp 10 mm, 0.3 l enzyme taq polymerase 5 u / ul, 5 l pcr buffers 10x, 1 l of each primer (gp5 and gp6) at a concentration of 30 picomoles and 36.7 l of dnase free water with a final volume 50 l . The pcr reaction mixture including patient samples, positive and negative control was subjected to a thermocycler (teqlab, germany) and the following thermal cycles were set up: initial denaturation at 95c for five minutes, followed by 35 cycles of denaturation at 95c for 40 seconds, annealing at 40c for 40 seconds, extension at 72c for 45 seconds, and final extension 72c for three minutes . An amount of 6 l of positive pcr product was electrophoresed on 1.5% agarose and the presence of a 150 bp band indicated a positive reaction . The positive pcr product was then sequenced (abi sequencer, bioneer co. south korea). The results of sequences were blasted using the national center for biotechnology information (ncbi) site . For the analysis of variable mean and standard division, this study was a cross sectional research designed with 54 patients with anogenital warts referred and registered at the dermatology department of imam hospital of ahvaz city, southwest iran, during 2011 to 2012 . Patients with anogenital warts who under treatment, those with severe systemic diseases, and immunocompromised (cancerous and organ transplanted) individuals were excluded from the study . The ethical committee of ahvaz jundishapur university of medical sciences approved this study (eth-488) and all patients signed an informed consent form . A questionnaire was set up and completed based on the patients data such as age, gender, marital status, characteristic of lesions (duration, location and shape) and physical examination . Laboratory tests including venereal disease research laboratory (vdrl), human immunodeficiency virus (hiv), and hepatitis c virus (hcv) antibodies as well as hbs ag were carried out for all patients . The warts were diagnosed based on clinical findings for typical lesions while histopathological assessment was performed for suspicious lesions . The samples were then fixed in 10% formalin and sent to a virology laboratory affiliated to ahvaz jundishapur university of medical sciences . The dna was extracted from the patients tissue sample using a high pure pcr template kit (roche, germany), according to the manufacturer s instruction . 5 - tttgttactg tggta gatactac - 3, and reverse, gp6 5 - gaaaaataaactgtaaa tcatattc - 3 . The pcr reaction mixture was then prepared containing: 5 l template, 1 l dntp 10 mm, 0.3 l enzyme taq polymerase 5 u / ul, 5 l pcr buffers 10x, 1 l of each primer (gp5 and gp6) at a concentration of 30 picomoles and 36.7 l of dnase free water with a final volume 50 l . The pcr reaction mixture including patient samples, positive and negative control was subjected to a thermocycler (teqlab, germany) and the following thermal cycles were set up: initial denaturation at 95c for five minutes, followed by 35 cycles of denaturation at 95c for 40 seconds, annealing at 40c for 40 seconds, extension at 72c for 45 seconds, and final extension 72c for three minutes . An amount of 6 l of positive pcr product was electrophoresed on 1.5% agarose and the presence of a 150 bp band indicated a positive reaction . The positive pcr product was then sequenced (abi sequencer, bioneer co. south korea). The results of sequences were blasted using the national center for biotechnology information (ncbi) site . For the analysis of variable mean and standard division, chi - square and t student test were used . All patients had negative test results for vdrl, hbs ag, hiv and hcv antibodies . Out of 54 samples, 46 (85.18%) cases showed positive results for hpv dna . A total of 26 (56.6%) samples were from males and 20 (43.4%) from females while eight (14.81%) showed negative results for hpv dna (table 1). The patients age ranged from 19 to 44 years with a mean age of 29.6 6.8 years . Overall, 37 (80%) patients had multiple sexual partners, and nine (20%) had one sexual partner . Duration of disease in 16 participants was less than one month whereas in 18 participants this duration was equal or more than three months, and in 12 patients it was one to three months . The lesions in males were detected on the penis (24 cases), scrotum (1 case), penis - scrotum (11 cases) and suprapubic area (1 case). The lesions in females were found in vulva (12 cases) and anus (7 cases). A total of 32 (70%) patients with flat condylomata and 14 (30%) with condylomata acuminate were found . Condylomata acuminata was found in 19 females and 13 males whereas flat condyloma was observed in six females and eight males . The hpv genotypes were found in 46 samples including 26 (48.14%) males and 20 (37.03%) females . The results of sequencing revealed that frequency of hpv16, hpv11 and hpv6 was 58.69%, 26.08% and 15.21%, respectively . Furthermore, hpv16 was observed in 17 (31.48%) males and 10 (18.51%) females . Human papillomavirus 11 was found in seven (12.96%) males and five (9.25%) female, while hpv6 was detected in two (3.7%) males and five (9.25%) females . In the present study, 46 patients with anogenital warts showed positive results for hpv . A higher rate of positive hpv was found in male patients, which is in accordance with the results of ciconte et al . It is likely that more frequent anal intercourse was the reason behind this finding . In the current study, 76% of married patients had positive hpv results, which was in accordance with the study of nassiri et al . The most probable reason for the higher rate of genital warts in married individuals might be multiplicity of sexual partners . Genital (85.18%) and anal (15.2%) areas were the most common anatomical locations of the warts . The most common sites of involvement were the penis in males and the vulva in females . In some studies, involvement of genital locations was found more than anal sites (3, 10). In our investigation, the single female patients had only anal involvement . In the iranian culture, proof of a girls virginity prior to her marriage is required, thus anal sexual contact is preferred by some unmarried girls . In our study, out of 54 patients with anogenital warts, 46 (85%) samples showed a strong positive pcr for hpv . Aubin et al . From france (2008), studied acuminata condylomata among 214 females and 209 males . They detected hpv - dna with dominant genotypes of hpv6 (69%), and low prevalence of hpv11 (16%) and hpv16 (9%) (11). In the present study, hpv 16 and 6 showed the highest and lowest frequencies in both genital and anal locations, respectively . Wang et al . In 2012, studied a total of 120, 772 samples from female cervical in 37 chinese cities and reported that the most prevalent genotypes were hpv16 (4.82%) and hpv52 (4.52%), followed by hpv58 (2.74%). Two genotypes hpv6 (4.01%) and hpv11 (2.29%) were predominant in the low - risk hpv (lrhpv) type, while the mixed genotypes hpv16 + 52 and hpv52 + 58 were most common in females with multiple infections (12). Detected hpv 6 or 11 in 79% of the specimens, and hpv 16 or 18 in 21% of samples (3). Reported that most cases of anogenital warts were associated with high prevalence of hpv 6 and 11 followed by low prevalence of hpv 16 and 18, which were not consistent with our results (9). In our study, one couple with genital warts shared the hpv 11 strain and the other couple shared hpv 16 infection . In the study of konno et al . On 12 couples with genital warts, 78% of couples had the same hpv dna, detected by dna hybridization (13). In conclusion, our findings revealed that the most prevalent genotypes in anogenital warts were hpv 16, 11 and 6, respectively.
|
Amblyopia is a developmental disorder associated with early abnormal visual experience that disrupts neuronal circuitry in the visual cortex and results in abnormal vision . In the past, the patients with amblyopia beyond the age of sensitive period of brain development generally received no treatments because of the long believed notion that, beyond the critical period, the neural network structure is not flexible and lacks plasticity . Therefore, the traditional treatments for amblyopia, for example, patching or penalizing the fellow eye, have been limited to children at critical period age only (i.e., before 10 years old). In the recent years, there has been accumulating evidence showing the existence of neural plasticity in the mature human visual system . Plasticity in adults with amblyopia is also dramatically evident in the reports of amblyopic patients whose visual acuity spontaneously improved in the wake of visual loss due to macular degeneration in the fellow eye [3, 4]. Adults with amblyopia can improve their perceptual performance and visual acuity through extensive practice on a challenging visual task . Meanwhile, animal study showed environmental enrichment in adult amblyopic rats restored normal visual acuity and ocular dominance . Recently, it has been shown that the monocular vision in adults with amblyopia can be improved after a 10 min application of repetitive transcranial magnetic stimulation to the visual cortex, suggesting that a significant part of the monocular vision loss might be suppressive in nature . These findings are consistent with the notion that the connections from the amblyopic eye may be suppressed during their lifetime rather than being destroyed . The predominant theory suggests that amblyopia results from a mismatch between the images of two eyes; one eye is favored and the other eye is suppressed . Animal studies and clinical evidence also have indicated that suppression is a key mechanism that causes amblyopia . The imbalanced suppressive drive prior to binocular combination may be the key factor in amblyopia and thus is different from those that are caused by monocular loss of function . This perspective allows us to approach the treatment of amblyopia in a radically different way, that is, weakening the suppression . It is known that information from an amblyopic eye can be strongly suppressed when both eyes are open . To reduce the suppression, it is necessary to have the presence of such suppression, so it may not be ideal to restore the vision in the amblyopic eye using only monocular methods . We argue that taking a binocular approach to amblyopia treatment may offer a more principled and effective option [11, 12]. Recently, there have been a few reports on binocularly focused models of treatment of amblyopia in adults [11, 13]. In single - noise binocular training created by hess et al . Stimulus are shown to the amblyopic eye at high contrast, while the contrast of the stimuli shown to the nonamblyopic eye is decreased . Here, we designed a novel approach to shift interocular visual attention under binocular viewing condition, in which the same contrast of stimuli is shown to the amblyopic eye and nonamblyopic eye and another feature is to fully use patient's attention . We hypothesized that attention shift may improve the vision in the amblyopic eye as well . There are two major categories of monocular amblyopia: anisometropic and strabismic . The causing mechanisms of strabismic and anisometropic amblyopia are different . In anisometropic amblyopia, the amblyopic eye does not see the high spatial frequencies, while the low spatial frequency contour falls on the corresponding area in both eyes . The viewing condition of strabismic amblyopia is even worse that all spatial frequencies of the images fall on noncorresponding areas in the two eyes, and binocular suppression covers all spatial frequencies to avoid diplopia . Therefore, antisuppression treatment for strabismic amblyopia may lead to diplopia before the eyes are aligned optically or surgically or if the sensory fusion after improvement of binocularity and vision in amblyopic eye is not sufficient to prevent double vision . The inclusion criteria were (1) age over critical period age, (2) anisometropic amblyopia with binocular difference of best corrected visual acuity (bcva) equal to or more than two lines, and (3) bcva of the amblyopic eye equal to or worse than 0.8 . Ten patients (age 1434 years) were recruited from july 2011 to september 2012 in our clinic . All of the patients in the trial underwent initial ocular examination that included assessment of the bcva before the training; lack of improvement was confirmed after wearing glasses for 3 months . Titmus stereopsis, random - dot stereopsis, and bcva were measured before the training and 6 weeks after the training . All pre- and postvisual examinations were compiled by the same specially trained optometrist for consistency in visual acuities and stereoscopic measurements . This study was approved by the institutional review board of eye and ent hospital of fudan university . All participants gave written informed consent in accordance with the declaration of helsinki (2008). The interocular shift of visual attention (isva) training consisted of a pair of reusable glasses with two colored filters and software for use on a personal computer . During the training, patients were instructed to maintain a constant distance between the eyes and the screen of computer . The software was designed to be engaging and interactive, which was designed by one of the authors (ahw). The patients were given a copy of this program to perform self - training at home . They were asked to have 2 training sessions each day, each session lasting for 15 to 30 minutes . The square target mimicked landolt c. the size of the opening was one - fifth of the whole target . Visual angle of the target could be changed as shown in the staircase paradigm (figure 2). There were 2 openings: one in red color and one in cyan color . Through blue - red goggles, the red opening was seen only by the eye wearing blue lens and the cyan opening was seen only by the eye wearing red lens . The task was to push one of four arrow keys to indicate the opening direction that was seen by the amblyopic eye . The opening direction was a random 4-alternative forced - choice (4-afc) each time . During training, the fellow eye was first occluded to make sure the patients focused their attention on the image from the amblyopic eye and saw the opening . The patients selected the direction of cyan opening if the amblyopic eye was fitted with the red lens or selected the direction of red opening if the amblyopic eye was fitted with the blue lens . Take, for example, a patient with his / her amblyopic eye fitted with the red lens . The patient was asked to keep attention on the cyan opening; meanwhile, his / her good eye could also see the red opening through the blue lens . The red c and the cyan c seen by the patient fell on the corresponding areas in both eyes and could be fused, like in normal subject . The patient fused these two cs into a white square ring with the red and the blue openings . It started at an opening size of 5 pixels, went up and down in 1 pixel step, and stopped when reaching the 5th reversals along the test procedure . The logarithms of the visual angles at these 5 reversals were averaged to give an estimate of visual acuity at this training . On a 19-inch 16: 9 screen set at 1366 768 resolution, one pixel was equivalent to 160 sec of arc when viewed at 40 cm test distance . Six consecutive right answers would lead to a smaller visual angle, while two consecutive wrong answers would lead to a larger visual angle in each step . We increased the number of correct answers in the process to emphasize its training purpose rather than threshold approaching . The task started at an opening size of 800 sec of arc, went up and down in 160 sec of step, and stopped when it reached the 5th reversals . The logarithms of the visual angles at these 5th reversals were averaged to give an estimate of visual acuity at this training . Due to the discrete data, differences between pre- and posttraining stereopsis (titmus stereopsis and random - dot stereopsis) were assessed using wilcoxon sign rank test . Discrete data were presented as median and range, while continuous data were presented as mean and range . All statistical assessments were two - tailed and were considered significant at the 0.05 level . Statistical analyses were performed using spss 15.0 statistics software (spss inc, chicago, il). Isva training led to significantly improvment in stereopsis . As shown in table 1, ten amblyopic patients participated in this study, 6 males and 4 females . The average age of these patients was 26.7 years (range, 14 to 34 years). Median thresholds of titmus stereopsis and random - dot stereopsis were 400 sec (range, 140 to 800 sec) and 500 sec (range, 140 to 800 sec) before the training . Posttraining measurements were taken at 6 weeks . The same measurement procedures were used for pre- and posttraining tests . Median thresholds of titmus stereopsis and random - dot stereopsis were 50 sec (range, 40 to 400 sec) and 120 sec (range, 40 to 600 sec) after the training . Figures 3 and 4 showed the comparison of these measurements before and after the training . Notably, 2 patients who had no measurable stereoscopic depth perception in random - dot stereopsis before the training acquired 200 sec and 600 sec after the training, respectively . Both titmus stereopsis (wilcoxon sign rank test: z = 2.809, p = 0.005) and random - dot stereopsis (wilcoxon sign rank test: z = 2.317, p = 0.018) were significantly improved after isva training . We also measured bcva before and after the training . As seen in figure 5 and table 1, in amblyopic eyes, average bcva before the training was 0.39 0.14, and average bcva after the training was 0.31 0.14 . Improvement in bcva after isva training was 0.74 line (paired t - test: factor of 1, t8 = 5.842, p <0.001). In the follow eyes, the bcva had no changes (paired t - test: factor of 1, t8 = 0.218, p = 0.832). The mainstay of amblyopia treatment nowadays is occlusion and/or penalization with atropine or over - plus lens to the fellow eye . All these approaches rely on a passive procedure to make the fellow eye see less and enhance the vision in the amblyopic eye . Here, we used isva training, a novel binocular approach, for anisometropic amblyopes and demonstrated that this active procedure could significantly improve visual acuity in the amblyopic eye and stereopsis by rendering binocular competition . One main feature of our treatment is to fully use patient's attention . Patients learned to use their visual attention by forcing the amblyopic eye to actively search for repeatable and calibrated targets of certain arc minutes within their visual field . Visual attention is taken as a trivial matter in our daily life . When you focus your attention on a person within your visual field, despite the fact that you do not fixate on him / her, you get more information of his / her posture or expression and so forth, compared with when you do not focus your attention on him / her . Recent neurophysiological studies have demonstrated that if a preferred stimulus and a nonpreferred stimulus are presented in one neuron's receptive field, cell's responsiveness depends on the attentional state . Attending to the preferred stimulus increases the cell's firing rate, whereas attending to the nonpreferred stimulus attenuates it . This finding suggests that attention shifts the receptive field of the cell at the attended location [19, 20]. Thus, neurons with receptive fields at that location either remain active or become more active, while the others are suppressed . Visual attention in monocular viewing condition manifests as that visual acuity increases at attended location and decreases at unattended location within the visual field . Along similar rationale, we hypothesize that isva might increase the visual acuity of the amblyopic eyes, either transiently or permanently . Another important feature of our treatment is the use of binocular stimulus . Although monocular treatments that excite the weak eye alone is effective [2, 22], ooi et al ., xu et al ., and li et al . Have shown that binocular training is more effective than monocular training to excite the amblyopic eye, while completely inhibiting the strong eye's perception to recalibrate the interocular balance of excitatory and inhibitory interactions . They indicated that adult amblyopes trained with a binocular protocol gained improvements in visual acuity and stereopsis [13, 23, 24]. To et al . Trained patients using an ipod video game, whereby stimuli elements were presented dichoptically, with lower contrast stimuli being presented to the fellow eye to counteract the suppression and allow for binocular combination . The improved visual acuity and stereopsis results were significantly greater in groups that were trained by binocular therapy than monocular therapy . The common feature between our study and previous two studies [13, 25] is the use of binocular viewing conditions . All three studies showed significant treatment effects . In our binocular training paradigm, visual attention is highly demanded in the amblyopic eye, which helps to recalibrate the interocular balance of excitatory and inhibitory interactions . The procedure of applying proactive attention is the very procedure of modulating the excitatory and inhibitory circuits . Currently, in most available video games for treatment of amblyopia, the stimuli elements were presented separately to each eye and lower contrast stimulus was presented to the fellow eye to enhance the visibility for amblyopic eye to counteract suppression and allow for binocular combination . What was unique in our design was that the isva in our experiment was an active process . Patients learned to use their visual attention by forcing the amblyopic eye to actively search for repeatable and calibrated targets of certain arc minutes within their visual field . The image seen by the fellow eye was kept in a good visibility during the whole training course . Cortical neurons with receptive fields at that location either remain active or become more active, while the others are suppressed . It was interesting that this equal visibility of the images in both eyes in our task resembled the condition as in the course of binocular rivalry that caused the amblyopia in the first place . Binocular rivalry has been shown to produce a characteristic counter - phase pattern in the signal from the two eyes . As the image in one eye becomes dominant, its cortical signal strengthens and the signal corresponding to the other eye weakens . Recent studies have shown strong training effect by using rivalry stimuli and directing patient's attention to the amblyopic eye image . These studies suggest that the rivalry suppression of the strong eye not only enhances the weak eye's excitatory signal (a push effect), but also strengths the amblyopic eye's inhibition to the strong eye (a pull effect). Our stimulus paradigm may also have the same effect since the two eyes are seeing images in different colors and may rival over time . The initial cue (paying attention to the notch seen by the amblyopic eye) works in the same way as in the binocular rivalry study, and thus our training procedure may also use the same push - pull neural mechanism . During our experiment, the patients were engaged in finding the targets using their amblyopic eyes, which was so challenging to their visual system that the training was intensive and active, which may lead to a more efficient result . Improvements to this experiment could be a larger sample size, a more even distribution of patient ages and their severity of amblyopia, and longer training sessions in the future . Duration of the study can be lengthened by increasing the patients' motivation, which can be achieved by informing the patient upfront of potential acuity and binocular improvements translating to an enhanced daily life in driving, working, and social activities . This is the first study for this novel device to be used in the treatment of amblyopia and demonstrates an improvement in visual acuity and stereopsis . More patient samples in a sham controlled randomized clinical trial are required to verify its true effectiveness and place in future management of amblyopia.
|
Between july 2010 and june 2013, 385 csf cytology samples were collected from 42 patients with the presence of a metastatic tumor confirmed by at least two histologic or cytological studies . Cytology samples obtained before adjuvant therapies were excluded to evaluate the diagnostic rate of csf cytology more consistently . The breakdown of the patient population was as follows: 25 males and 17 females, with a median age of 55 years (range, 29 to 77 years). The mean observation period was 5 months (range, 1 to 22 months), and the mean number of csf examinations was 9 (range, 2 to 34). All patients underwent an operation for the placement of a ventricular catheter and reservoir as well as consecutive csf collections using the reservoir (fig . To minimize dry artifacts and prevent cell degeneration, samples were delivered to the department of pathology immediately upon collection . Samples were then processed using liquid - based cytology (lbc) (thinprep, cytyc co., boxborough, ma, usa), an automated method of preparation and smearing of cells in a monolayer . Of the 385 csf samples, 54 were processed by a conventional smear method rather than the liquid - based method because those samples were obtained when the liquid - based method was not available for csf cytology . Immunocytochemistry (icc) was performed using a ventana xt automated stainer (ventana co., tucson, az, usa) with an antibody to cytokeratin (1:300, ae1/ae3, dako, carpinteria, ca, usa). Slides were incubated with primary antibody for 32 minutes at 37 followed by a universal secondary antibody for 8 minutes at 37. slides were incubated in streptavidin - horseradish peroxidase d for 16 minutes at 37, and then the substrate, 3,3'-diaminobenzidine tetrahydrochloride (dab) h2o2, was added for 8 minutes, followed by hematoxylin and bluing reagent counterstains at 37. cases without atypical cells suggestive of metastasis were diagnosed as negative for malignancy . A positive diagnosis of malignancy was defined as the presence of atypical cells with cytokeratin immunoreactivity, regardless of the amount (fig . 2). There were some cases that presented with atypical cells on papanicolaou - stained slides, but it was not possible to evaluate many of these cases using cytokeratin icc slides because the cells disappeared during the staining process . In those cases, we termed the diagnosis suspicious for malignancy, and these cases were regarded as positive findings when calculating the diagnostic rates . All slides, including those for icc, were independently reviewed by two pathologists (s.h.k and y.s.b). Between july 2010 and june 2013, 385 csf cytology samples were collected from 42 patients with the presence of a metastatic tumor confirmed by at least two histologic or cytological studies . Cytology samples obtained before adjuvant therapies were excluded to evaluate the diagnostic rate of csf cytology more consistently . The breakdown of the patient population was as follows: 25 males and 17 females, with a median age of 55 years (range, 29 to 77 years). The mean observation period was 5 months (range, 1 to 22 months), and the mean number of csf examinations was 9 (range, 2 to 34). All patients underwent an operation for the placement of a ventricular catheter and reservoir as well as consecutive csf collections using the reservoir (fig . To minimize dry artifacts and prevent cell degeneration, samples were delivered to the department of pathology immediately upon collection . Samples were then processed using liquid - based cytology (lbc) (thinprep, cytyc co., boxborough, ma, usa), an automated method of preparation and smearing of cells in a monolayer . Of the 385 csf samples, 54 were processed by a conventional smear method rather than the liquid - based method because those samples were obtained when the liquid - based method was not available for csf cytology . Immunocytochemistry (icc) was performed using a ventana xt automated stainer (ventana co., tucson, az, usa) with an antibody to cytokeratin (1:300, ae1/ae3, dako, carpinteria, ca, usa). Slides were incubated with primary antibody for 32 minutes at 37 followed by a universal secondary antibody for 8 minutes at 37. slides were incubated in streptavidin - horseradish peroxidase d for 16 minutes at 37, and then the substrate, 3,3'-diaminobenzidine tetrahydrochloride (dab) h2o2, was added for 8 minutes, followed by hematoxylin and bluing reagent counterstains at 37. cases without atypical cells suggestive of metastasis were diagnosed as negative for malignancy . A positive diagnosis of malignancy was defined as the presence of atypical cells with cytokeratin immunoreactivity, regardless of the amount (fig . 2). There were some cases that presented with atypical cells on papanicolaou - stained slides, but it was not possible to evaluate many of these cases using cytokeratin icc slides because the cells disappeared during the staining process . In those cases, we termed the diagnosis suspicious for malignancy, and these cases were regarded as positive findings when calculating the diagnostic rates . All slides, including those for icc, were independently reviewed by two pathologists (s.h.k and y.s.b). Lung was the most common primary site with 22 cases, followed by breast with 6 cases . Of the 385 specimens, 132 were diagnosed as positive for malignancy and 27 were suspicious for malignancy, for a total of 159 specimens considered to have a positive diagnosis of malignancy . Among the 42 patients, 3 were never diagnosed as malignant by cytology examination even though all were confirmed to have cns metastasis on brain tissue biopsy . The positive malignancy diagnosis rates in the other 31 patients ranged from 4.5% to 87.5%, and the mean positive rate was 41.3% . Table 2 demonstrates two representative cases (case nos . 4 and 12) from our series . During a period of two months, these two patients underwent 13 and 15 csf cytology examinations, which yielded positive results in 6 and 10 of the tests, respectively . The intervals between csf cytology examinations ranged from 0 to 13 days and were short enough to enable more meticulous analysis of consecutive diagnostic rates . However, the results appeared random, without a consistent trend . Even within the same day, rapid transport is important for optimal cellular preservation in csf materials, which can be cytolysed quickly . In order to reduce the number of nondiagnostic cases, csf materials should be examined as soon as possible after collection . From a routine diagnostic viewpoint, degeneration is one of the most problematic artifacts when diagnosing cytology slides, as csf specimens tend to degenerate more readily than other cytology specimens . We were able to control artificial factors by reminding clinicians of the importance of rapid processing and encouraging them to submit the samples immediately . Most previous studies concerning the diagnostic rates of csf examination used the lumbar puncture as a diagnosing modality.4 - 6 however, lumbar puncture can be harmful to patients and difficult for clinicians because it is an invasive procedure . It is this for reason that most previous studies regarding the diagnostic accuracy of csf performed only one csf examination per patient . In this study, however, consecutive csf sampling was performed using the ventricular catheter and reservoir from each patient . Although a neurosurgical procedure is required to implant a ventricular catheter in patients, it enables the continuous collection of csf and consecutive analysis . Lbc is now a widely used method for preparing cytology samples and has achieved broad acceptance for most cytology specimens.8 - 11 furthermore, for the diagnosis of metastatic tumors in csf, thin - layer lbc has been suggested as an appropriate diagnostic method.12,13 as in immunohistochemistry, icc improves the diagnostic rates because cytology is often difficult and problematic to evaluate using cellular morphology alone.14 using lbc is more convenient for performing icc than conventional smear techniques, and the diagnostic efficacy of icc on smears processed by thin - layer lbc has been previously validated.15 - 17 up to the present time, there have been several reports regarding the diagnostic accuracy of csf cytology in patients with cns metastasis . Wasserstrom et al.5 reported a sensitivity of 54.4% in initial examination and 91.1% in subsequent examination . Even though we used implanted ventricular catheters when obtaining csf and lbc when preparing csf slides, results of our study showed much lower diagnostic rates than previous studies . The discrepancy between results of previous studies and ours might be due to the different process of gathering csf; unlike previous studies, we tried to evaluate the diagnostic rates of csf cytology using consecutive examination of csf samples from each patient . Moreover, in our study, samples were obtained from patients receiving adjuvant treatments such as chemotherapy and radiation therapy, which may have affected the diagnostic rates of csf analysis . From the viewpoint of daily practice, our results may be more practical and accurate because most patients with cns metastasis are now managed with ancillary treatments.7 we could not analyze the results of csf examinations with statistics of sensitivity or specificity because not all cytology specimens had a concordant tissue biopsy . In other words, the negative findings could not be directly considered as false negatives because we could not completely exclude the possibility that the negative findings resulted from true tumor regression due to adjuvant therapies . However, as shown in table 2, results were distributed unevenly although all examinations were performed within very short intervals, even within the same day in some cases . Therefore, we suggest that the negative findings are not the results of tumor regression but false negative results . If so, the value of 41.3% can be regarded as sensitivity of csf cytology in patients being treated with adjuvant therapies due to cns metastasis . First, several factors influencing the quality of csf cytology specimens should be investigated . In our study, however, this cannot be the reason for the negative results because csf is physiologically acellular . The volume of the submitted specimen can affect the diagnostic accuracy, but unfortunately this aspect was not evaluable because the amount of fluid was not promptly recorded . Dry artifact is one of the most important factors in determining the quality of csf slides . As mentioned earlier, we could maintain the quality of csf cytology by notifying clinicians of the importance of rapid transport . However, specimen transport could not be controlled precisely and evenly because the specimens were transported by different clinicians with different time intervals . There was no significant difference among negative results when grouped according to the sites of primary tumors (data not shown). Taken together, the negative results should be regarded as a multifactorial phenomenon without a specific reason . Temporary csf cytology examinations are no longer sufficient for estimating clinical course because chemotherapy and optional radiotherapy are generally standard treatment modalities in patients with cns metastasis . Although the total number of cases included was not remarkable, this study is noteworthy in that we tried to evaluate the diagnostic rates of csf cytology in a novel way . By analyzing consecutive csf samples obtained within short - term intervals, we were able to evaluate the diagnostic rates of csf examination more precisely and more practically . Although the sensitivity of csf cytology as a diagnostic tool in patients with cns metastasis was lower than expected, even with the icc, we consider this result to be important and instructive as negative results should not be ignored or regarded as tumor regression . Alternatively, continuous follow - up using csf cytology is essential for determining clinical course, and the results must be interpreted in conjunction with clinical and radiological findings.
|
Understanding the biomechanics of the native pcl provides a framework for reconstruction by replicating the anatomy.15) early biomechanical studies characterized the rehabilitationindividual main bundles of the pcl as anterolateral (al) and posteromedial (pm) bundles.16,17) the al bundle is more taut in flexion and more lax in extension; the reverse is true for the pm bundle, which is more taut in extension and more lax in flexion.17,18) in this setting, the al and pm bundles mainly function individually at the flexed and extended positions, respectively . However, more recent biomechanical studies have suggested that, based on length and spatial orientation, the two bundles of the pcl may have a co - dominant relationship rather than a reciprocal one.15,19 - 21) this concept means that both bundles function through the range of motion (rom) in a synergistic fashion rather than a reciprocal one . Mauro et al.19) reported no difference in the in situ forces between the al and pm bundles at any of the flexion angles, using a robotic testing system . Ahmad et al.21) reported that the pm bundle becomes more horizontal with increasing knee flexion and this orientation increased the ability of the pm bundle to resist posterior tibial translation . Using magnetic resonance imaging (mri) and a dual - orthogonal fluoroscopic system, papannagari et al.20) reported that both bundles showed elongation and change of orientation of up to 120 of knee flexion . Race and amis22) conducted the first biomechanical comparison between isometric single and double bundle reconstruction; their results showed over - constraint of the isometric single bundle reconstruction in extension with underconstraint at higher degrees of flexion . The double bundle reconstruction resulted in restoration of the posterior laxity from 0 to 120 to within 1 mm of the intact specimens . Harner et al.8) also reported that double bundle reconstruction resulted in better restoration of posterior stability, compared with single bundle reconstruction in cadaveric knees . However, in some studies,4 - 6,23,24) in terms of posterior stability, few differences were observed between single and double bundle pcl reconstruction, even though some different results were reported with different experimental settings . The influence of the femoral attachment site, as well as the number of bundles, was further evaluated.1,2,7) in a study using variable femoral attachment sites, mannor et al.7) reported that a shallow femoral insertion allows for better control of posterior translation . However, they could not prove the possibility of graft elongation resulting from high graft tension . Shearn et al.1) reported that the placement of a second bundle in the middle or distal position resulted in a significant reduction in al bundle tension and in cooperative load - sharing (with the bundles functioning together). However, placement of the second bundle in a proximal position resulted in reciprocal loading (with one bundle functioning in flexion and one in extension). The majority of studies have reported improved outcomes from preoperative level of function; however, when compared with the preinjury activity status, the results are less successful.15) the objective knee scores seem to lag behind those of subjective self - reported scoring after surgical reconstruction; one possible explanation is residual laxity, which has been demonstrated using many reconstructive techniques.15) most studies have reported residual laxity ranging from 2 to 6 mm indicating that the surgical result will depend upon the surgical technique.25 - 33) few clinical studies comparing the outcomes between single and double bundle pcl reconstruction have been reported . Wang et al.34) reported no significant difference in the functional score or radiologic evaluation . Three studies (houe and jorgensen,35) fanelli and larson,36) and kim et al.37)) also reported no difference in subjective and objective outcomes . Only one recent study, by yoon et al.,38) reported better stability and international knee documentation committee (ikdc) distribution; however, they also stated that it is unclear whether double bundle is definitely superior clinically and functionally because there was no difference in the subjective scores . Pcl injuries have potential for intrinsic healing; several mri studies have reported that the pcl healed with continuity but also with residual laxity.39 - 41) in most pcl injuries, some portion of the pcl, or at least the meniscofemoral ligament, is preserved, therefore, in an acute or subacute stage, the pcl has a higher likelihood of spontaneous healing than the anterior cruciate ligament (acl) does.25) many mri studies have reported that because the ligament is surrounded by a thick synovial sheath that is hardly torn completely and the meniscofemoral ligament remains attached to the lateral meniscus, an injured pcl can heal itself.39 - 42) treatment of the isolated pcl injury should depend on the injury status, which is determined by the amount of posterior laxity, the patient's age and level of activity . In young patients, we can perform cylinder cast immobilization in order to prevent posterior sagging if the instability is less than 8 mm side to the side difference (which means that there is a stepping between the medial tibial and femoral condyles at 90 of flexion of the knee joint) and there is some continuity remaining according to the mri.9,43) however, during cast immobilization, in order to prevent posterior sagging of the proximal tibia, the cast should be changed if the patient feels that his knee, especially the proximal tibia, is moving anteriorly and posteriorly in the cylinder cast . Cylinder cast immobilization is usually maintained for six weeks and then the brace is used with the attachment of two springs with a tibial supporter in order to prevent posterior translation of the tibia for another six weeks.9) another option for conservative treatment of the isolated pcl injury is an immediate rehabilitation and quadriceps strengthening exercise program, especially for elderly patients . We recommend pcl reconstruction in patients with more than grade ii pcl injury, even for isolated pcl injury in young patients.25) the remnant pcl fibers would be helpful for the improvement of vascularization, and therefore, will promote healing of the graft, and the mechanoreceptors will provide mechanical stability . The center of the femoral tunnel was chosen so that the distal edge of the graft was 2 mm apart from the articular cartilage margin, by placing the guide pin 5 - 6 mm proximal to the articular cartilage at the 11 or 11:30 o'clock position (left knee), depending upon the graft diameter . A tibial tunnel could be created by placement of a guide pin just distal to the center of the tibial insertion or just lateral and distal to the center area in the remnant pcl . The graft can then pass along the medial border of the remnant pcl towards the femoral tunnel, which was located anteromedial to the pcl (fig . In the case of healed pcl with residual laxity, tensioning with an al bundle reconstruction using a modified inlay technique could be used, and to get very good stability if the remnant pcl is thick and there is a normal signal in the mri studies when the injury is chronic (more than 12 months). However, this technique is a technically demanding procedure and a bigger surgical scar may be produced.29,30,45,46) for al bundle reconstruction for the single bundle reconstruction, the femoral tunnel should be made at a distal (shallow) and anterior portion . This means that the femoral tunnel should be placed distally (shallow), usually 5 - 6 mm, from the articular margin, and vertically . Remnant pcl fibers may provide a soft tissue cushion effect between the graft and the bone at the entrance to the tunnel, which is helpful to prevent the killer turn effect at the femoral and tibial tunnel orifice . If there is no remnant pcl or a very thin pcl remnant, we should do double bundle reconstruction (fig . 2).47) pcl injuries are frequently combined with posterolateral rotatory instability (plri), which occurs in about 43%-80% of cases.47,48) although the causes of failure of pcl reconstruction are multifactorial, one of the most common causes is a neglected plri.49,50) therefore, identification of concomitant injuries is important in order to obtain a good result . Currently, plri can only be evaluated through a physical examination . In particular, 1 to 2 plri (grade 1, external rotation [er] using a dial test <10 without varus instability; grade 2, er 10 or posterolateral tibial subluxation with grade 0 - 2 varus instability; and grade 3, er 20 or posterolateral tibial subluxation + grade 3 varus instability)48) often goes unnoticed, especially when the tests are performed with the muscle tensed in acute stage patients with pain . Therefore, plri assessment should be performed several times and should become a routine procedure before surgery for the patient under anesthesia.48,51) why is the plri misdiagnosed, especially in grade ii plri? In our opinion, the reason is that in the pcl and posterolateral corner injured patient, the lateral tibial plateau is posterolatearally subluxed at 90 of knee flexion . If a dial test or posterolateral drawer test is performed in this situation, it is difficult to find more er of the leg or subluxation of the posterolateral tibial plateau . Therefore, in pcl and posterolateral corner injured patients, reduction of the knee to the normal position using the dial test and posterolateral drawer test is important for making a diagnosis of plri.51) we determined that a reduction of the knee in the anteroposterior direction would increase the degree of tibial er in combined pcl - posterolateral corner injuries.51) when we performed the dial test in the prone position, this position was also helpful for the same reason . In the prone position, posterior sagging of the proximal tibia would be reduced, which was better than the supine position.51,52) for treatment of plri, grade ii injury could be managed with a posterolateral corner sling (plcs) through the fibular head.48) however, in grade iii plri, anatomical reconstruction would be preferable, as described by laprade and wentorf.53) in contrast to acl rehabilitation, accelerated pcl postoperative rehabilitation is generally undesirable and more conservative methods are recommended than acl reconstruction.54,55) however, the rehabilitation protocol of a pcl reconstruction is not well established and only a slow and conservative rehabilitation is proposed.14) for example, early weight bearing is believed to be hazardous to the pcl because pcl reconstruction is often associated with either a medial or lateral collateral ligament repair or reconstruction and it can cause over - stressing these structures.54,56) anatomically, the tibial plateau is inclined posteriorly and an axial load placed on the tibia by weight bearing at relatively extended positions produces an elemental force in the anterior direction . Therefore, the joint is stabilized somewhat by weight bearing.57,58) in addition, weight bearing can have several benefits . Firstly, the patient would have better static stability when standing on both legs, thereby minimizing the risk of falls . Fourthly, weight bearing itself can be a co - strengthening exercise and proprioceptive training.54,56,59) finally, most patients have a tendency to flex their operated knee to prevent weight bearing.14) this means that a posteriorly directed force can be prevented if weight bearing is performed in the fully extended position . Accelerated rehabilitation does not mean rapid range of motion exercise.14) within 0 to 30 of flexion, the hamstring cannot produce a posterior shear force and the anterior angle of the patellar tendon is always larger than that of the hamstring tendons.60,61) therefore, within this range of motion, co - strengthening could be performed using calf raising and mini - squatting exercise . Quadriceps strengthening extension exercise at angles less than the quadriceps neutral angle produces anterior tibial translation, which is antagonistic to the acl but synergistic to the pcl . Therefore, after a pcl reconstruction, quadriceps strengthening knee extension should be restricted to between 60 of flexion and full extension of the knee.62,63) in current pcl studies, there has been a shift in biomechanics from reciprocal functioning to co - dominance . Surgical devices and reconstructive techniques of the pcl have been developing and a more active approach is used than the past . It is still uncertain whether single or double bundle reconstruction is superior, because of conflicting biomechanical studies and notable limitations of the clinical studies . The remnants of pcl fibers, placement of the femoral tunnel, and combined plri are other hot issues in reconstruction . After the reconstruction of the pcl, a more active and systemic exercise program and early weight - bearing training are increasingly being recognized as important.
|
Use of multiagent chemotherapy pre- and postoperatively has significantly improved the outcome in the last 30 years, leading to a 5-year disease - free survival for patients with localized tumors in the 20% to 60% range . Despite the use of these drugs, approximately 30% of patients with localized disease and 60% of patients with pulmonary metastases succumb to the illness . Cytogenetic analysis has revealed multiple chromosomal rearrangements without a typical translocation, as can be seen in ewing's sarcoma . In recent years, the immunocytochemical subclassification of osteosarcomas has significantly enhanced the accuracy of pathological diagnoses, suggesting that new immunochemical markers could further improve diagnosis and prognosis . Recently, salas et al . Introduced ezrin expression as a prognostic factor for the survival rate of patients with conventional osteosarcoma, correlating its expression with tumor progression . It was also shown that ezrin is useful as an immunohistochemical marker to differentiate between chondroblastic osteosarcomas and conventional chondrosarcomas . However, other osteosarcoma markers are required to further characterize this complex, multifactorial neoplasia . Antibodies to tumor mark are being used to treat different forms of cancers . Among the currently fda approved antibodies, some of them are now under clinical trials to osteosarcoma (http://www.clinicaltrials.org/). The success of the treatment is somewhat related to the antibody origin; in general it is expected that humanized or fully human antibodies are better tolerated than murine monoclonal ones . To isolate such potential biopharmaceuticals, the use of the phage display technique can lead to the isolation of either antibodies or peptides able to discriminate tumor cells . In a traditional approach, the identification of the tumor marker is the first step, after that it is necessary to isolate an antibody against this marker . Using a fab phage display library, these steps can be merged into one, and it is possible to identify antigens without previous knowledge . The use of complex antigens such as cell membranes broadens the possibility of finding differentially expressed markers . However, as a more complex antigen source is used, the techniques employed to separate bound phages from unbound phages become more difficult . This usually makes selection on cell surfaces much more complex than selection using purified antigens . Focusing on this challenge, different selection procedures have been developed . Among these procedures, a method called brasil (biopanning and rapid analysis of selective interacting ligands) was specifically designed to isolate phages able to bind to the cell surface . In order to isolate anti - osteosarcoma fully human fabs, we used a previously constructed combinatorial fab phage display library produced with antibody repertoires from osteosarcoma patients, relying on the fact that these antibody repertoires could be enriched with antibodies against the patients' own tumors . Here, we report the utilization of this library for panning fabs against the surface of osteosarcoma cells . The selection procedure was adapted from that of the brasil method for using a phage antibody library . This is the first report of the use of the brasil method with a human fab library . After three rounds of selection against the cell surface of an osteosarcoma cell line, we were able to identify many reactive fabs, most of them sharing similar v genes . Five fabs were chosen for further analysis, including western blot, cell elisa, and immunocytochemistry . Our data revealed that these fabs recognize a membrane antigen that is more widely expressed in the osteosarcoma cells compared to normal osteoblast and fibroblast cells . These results suggest that these human fabs could be further used to improve the diagnosis and prognosis of osteosarcoma . The human osteosarcoma cell lines u2 os (htb-96) and saos-2 (htb-85), and the fetal normal osteoblast cell line hfob1.19 (crl-1172) were purchased from atcc and cultured as recommended . A short - term culture of normal human fibroblasts was cultured at 37c in 5% co2 with ham's f10 medium supplemented with 100 u / ml of penicillin, 100 g / ml of streptomycin, and 10% fbs . A combinatorial fab phage display library generated from the antibody v regions of eleven osteosarcoma patients, containing 2.7 10 different forms, was constructed previously and used for selection according to the brasil method . Briefly, the cultured cells were collected with pbs and 5 mm edta and then washed with the medium defined for each lineage, resuspended in culture medium containing 1% bsa at a cell density of approximately 1 10 cells per ml, and incubated with 1 10 plaque forming units (pfu) of phage for approximately 1.5 hours on ice with sporadic gentle mixing . After that, the cell - phage suspension was transferred to the top of a nonmiscible organic lower phase (a 9: 1 mixture of dibutyl phthalate: cyclohexane) and centrifuged at 1000 g for 10 minutes at room temperature . The tube was snap frozen in liquid nitrogen, and the cell - phage pellet was used to infect a log - phase culture of escherichia coli (strain xl1-blue). In the selection procedure using the surface of u2-os cells, we also performed a preclearing step before the third selection cycle . To do this, the phages were incubated with normal hfob 1.19 osteoblasts, and, after separation by centrifugation through the organic phase, the supernatant containing the unbound phages (in the aqueous upper phase) was incubated with u2-os osteosarcoma cells as described above . The selected phages were amplified by e. coli infection according to the procedure described elsewhere and were then used in the next selection cycle . Dna was extracted from the bacterial pellet obtained after each round of selection using a qiaprep spin miniprep kit (qiagen), and then used to transform hb2151 e. coli cells for production of soluble fab without the filamentous phage gene iii fusion protein partner . Individual carbenicillin - resistant hb2151 colonies were picked and grown overnight (on) at 37c in a 96 deep well plate in 1 ml sb medium containing carbenicillin (100 g / ml) and glucose (1%). After this incubation, the cultures were used to produce two replica plates: one for a glycerol stock and the second for the production of the soluble fabs themselves . The original on culture plate was centrifuged, and plasmid dna was extracted from the e. coli using the qiaprep kit . Fab production was performed by inoculation of 1.5 ml of sb medium containing carbenicillin (100 g / ml) and glucose (1%) with 50 l of the on culture . Cultures were incubated at 37c, shaking at 250 rpm, until they reached an od of 0.9 at 600 nm . The cultures were then centrifuged, and fresh sb medium containing carbenicillin (100 g / ml) and iptg (2 mm) was added, followed by incubation at 30c for an additional 18 hours . Supernatants containing the soluble fabs were used in the dot blot and elisa assays . For large - scale fab production, the procedure was the same as described above, except that phages were produced in 100 ml of sb medium e. coli culture . Supernatants were concentrated using centriprep 10 filter units (millipore) and buffer exchanged in pbs . Purification of fabs was performed using ni - nta resin (qiagen) under nondenaturing conditions according to the manufacturer's instructions . Sequencing reactions were prepared with reverse primers specific for the vh and vl regions (ch: 5cgcctgagttccacgacacc3, mmb4: 5gcttccggctcgtatgttgtgt3, c: 5agaggagtccagatttca3, and mmb5: 5cgtttgccatcttttcataatc3) and were performed using et terminator (ge - healthcare) in a megabace 500 plus sequencer (molecular dynamics). Alignments were done using igg blast at the ncbi blast server (http://www.ncbi.nlm.nih.gov/blast) and with the program bioedit . The kabat numbering and cdr definitions were adopted from andrew martin's web site (http://www.bioinf.org.uk/abs/). Ninety - six well plates were coated with 100 l of a 10 g / ml total protein solution prepared from osteosarcoma and osteoblast cells as described in the next section . The plates were then blocked with 3% bsa and incubated with 100 l of the induced supernatant from each selected clone . The supernatant from the empty parental plasmid (pcomb3x) e. coli culture was assayed as a negative control . Fab binding was detected with a rat anti - ha (hemagglutinin decapeptide tag) hrp - conjugated antibody from roche, followed by the abts peroxidase substrate . For selecting individual clones, a threshold value was arbitrarily set at ten times greater than the value obtained for the empty vector and at least three times greater than the value obtained for the incubation with proteins from normal osteoblast cells . Cell elisa was performed according to the protocol adapted from williams and sharon (2002). Briefly, polystyrene 96-well tissue culture plates were seeded with 2 10 u2-os, saos-2, or fibroblast cells in 200 l of culture medium defined for each cell lineage supplemented with 10% (v / v) fbs and incubated for 30 hours . The cells were fixed with 4% formaldehyde in pbs for 20 minutes at room temperature followed by two washes with pbs . The washed cells were incubated with 100 l of the induced supernatant from each clone or with the purified fab . Protein extracts from u2-os and fibroblast cells were prepared in cold lysis buffer (0.5% np-40, 0.3% triton x 100, 50 mm tris hcl ph 8.0, 5 mm mgcl2, 0.5 mm edta, 1 mm atp, 1 mm dtt, 10% glycerol) and complete mini - edta - free protease inhibitor cocktail tablets from roche . Total protein extracts were separated by sds - page under reducing conditions and transferred to nitrocellulose membranes (ge - healthcare). After blocking with 5% skim milk tbst at room temperature for 1 hour, the membranes were probed with one of the five purified fabs (0.02 g / ml) for 2 hours at rt and washed 3 times with tbst (50 mm tris - hcl, ph 7.5, 150 mm nacl, 0.05% tween 20). The membranes were then incubated with a rabbit anti - ha (hemagglutinin decapeptide tag) antibody (santa cruz) diluted 1: 1000 for 1 hour, washed again and incubated with anti - rabbit hrp at a 1: 5000 dilution . Bands were visualized using an ecl supersignal west pico chemiluminescent substrate detection kit (thermoscientific). To control loading differences, a rabbit anti - alpha - tubulin antibody (abcam) was used instead of the selected fabs . Cultures of u2-os and human fibroblast cells grew until they reached 7090% confluency on a slide chamber . The cells were then washed twice with pbs and fixed and permeabilized by immersion in precooled methanol for 6 minutes at 20c . After two washes with pbs, the slides were incubated with 2% bsa (w / v) and 5% normal goat serum (v / v) for 30 minutes . After an overnight incubation at 4c with 15 l of purified fabs, the slides were washed and incubated with 1: 200 anti - ha antibody (santa cruz) for 45 minutes, followed by an incubation with a goat anti - rabbit igg - fitc at 1: 2000 (sigma) in a moist chamber in the dark . After addition of dapi i, the slides were observed with an axiolab fluorescence microscope (zeiss) using the applied imaging cytovision software . Archived, formalin - fixed, paraffin - embedded tissue sections (4 m) were deparaffinized in xylene and rehydrated using a series of alcohol and distilled water solutions . Endogenous peroxidases were quenched by incubation with 10 v h2o2 for 10 minutes, followed by microwave antigen retrieval in 10 mm sodium citrate buffer, ph 6.0 . Purified anti - osteosarcoma fabs at 200 g / ml, diluted to 1: 200 (n - h7) and 1: 20 000 (o - g11), were incubated with tissue sections for 1 hour at room temperature . After rinsing with phosphate - buffered saline, the slides were incubated for 30 minutes with rabbit anti - ha antibody (santa cruz), diluted 1: 200 in 1% bsa - pbs, and then incubated with a biotinylated goat anti - rabbit igg (rockland). After the antibody incubations, the slides were washed with tris - based buffer and then incubated with streptavidin - conjugated horseradish peroxidase (lsab+ kit, dako) and dab as the chromogen . The sections were counterstained with harry's hematoxylin and covered with entellan (merck). To select recombinant antibody fragments that bind to osteosarcoma cells, we used a human fab phage display library constructed from pbmcs of eleven osteosarcoma patients using two different cell lines: saos-2 osteosarcoma cells (n fab clones) and u2-os osteosarcoma cells (o fab clones). Both panning approaches were repeated three times . For the u2-os cells, we included a negative selection cycle before the third round, in which the phages were first adsorbed to normal hfob 1.19 osteoblast cells, followed by panning against osteosarcoma cells . One hundred eighty three clones from the second and third rounds of selection from both approaches were screened by dot immunoblot using an anti - ha antibody to identify fab expressing clones . We found that 67% of the n clones and 46% of the o clones gave positive signals, demonstrating that these clones express reactive fabs (data not shown). Individual fab - expressing clones were tested for the ability to bind to osteosarcoma cell proteins by elisa using two different strategies . The first approach evaluated fab binding to fixed osteosarcoma cell monolayers, and the second approach evaluated fab binding to total protein extracts from osteosarcoma cells . Seventy - nine clones from the n system and eighty - eight from the o system were tested . Clones showing an a450 of less than 0.1 (similar to supernatants without fab) were considered nonbinders . The most reactive clones were tested further in another elisa assay using protein extract from osteosarcoma cells and normal osteoblast cells . Triplicates of 27 clones were tested in this second trial, including 16 from the second and 6 from the third rounds of the n system and 2 clones from the second and 3 from the third round of the o system . The results of this assay confirmed the reactivity of the fabs with osteosarcoma cells (figure 1). The vh and vl coding regions of the 20 most reactive clones were determined by sequencing (figure 2). Analysis of the deduced amino acid sequences of the corresponding v genes indicated that all vh and v chains were distinct from the sequences (51 vh and 74 v) previously described from the original library of randomly chosen clones . The vh sequences revealed that all clones belonged to the vh3 family and that their cdr3 varied in length from 6 to 14 amino acid residues . The majority of the clones (12/20) had a vh3 - 7 gene segment and a cdr3h of eight amino acids in length . The presence of the amino acid cysteine (c) at position 79 in framework 3 is a striking characteristic, and it was found in 12 clones harboring the vh3 - 7 gene segment, as can be seen in the n - h7 clone . The amino acid sequences encoded by the v genes also differed from those reported for the unselected repertoire . The o2 v family clones n - e8 and o - c10 had a conservative valine substitution at position 48 (i48v), and clones o - f4 and o - g11 (b3 v family) had a nonconservative phenylalanine substitution at this same position (i48f). This rare mutation is reported to occur in less than 1% of the v sequences, and was present in different clones of the original library . The b3 family clones also presented a previously observed conservative change at the key position 64 (g64a). The predominance of clones harboring the vh3.7 (12/20) and a17 (11/20) gene segments supports the specific ligand selection . Based on the results of the elisa and the dna sequencing, we chose five different fabs for further analysis emphasizing their reactivity . The clones chosen were: n - h7 (vh3 - 7a17, frequency 11/20), n - e8 (vh3 - 23o2, frequency 1/20), n - h10 (vh3 - 20a30, frequency 1/20), o - f4 (vh3 - 23b3, frequency 1/20) and og-11 (vh3 - 74b3, frequency 2/20). The fabs were produced in 100 ml cultures and purified using metal affinity columns before use in further analyses . Immunoblot experiments were carried out for an initial characterization of the molecules in whole cell lysates derived from the osteosarcoma cell line u2-os or from normal fibroblasts that were detected by the chosen fabs . From this analysis, an intense 80 kda band and a weaker 50 kda band were observed for all analyzed fabs, suggesting that all clones recognized the same proteins and that these proteins are present in both osteosarcoma cell lines (saos-2 and u2-os). The same pattern was observed at a lower intensity when normal fibroblasts were probed, suggesting that these proteins are overexpressed in malignant bone cells (figure 3). Further analysis of fab reactivity was addressed by comparing the ability of the antibody fragments to bind to monolayers of osteosarcoma cells and normal fibroblasts by cell surface elisa . Figure 4 shows the confirmation that the purified fabs recognized a protein present in both kinds of cells (tumor and normal human fibroblast). However, the signal obtained was at least twice as strong for the tumor cells as for the normal fibroblasts, suggesting overexpression of the antigen in the osteosarcoma cells . The clones obtained from selection in saos-2 cells (the n system) were tested against saos-2 and u2-os osteosarcoma cell lines . The clones from the o system were assessed using only u2-os cells in addition to the normal human fibroblasts . The antigen - binding specificity of each selected fab was also evaluated by measuring the cell surface binding capacity using an immunofluorescence assay . Considering that the five fabs apparently recognized the same protein, further investigations were done mainly with the n - h7 (figure 5, panels (a) and (b)) and o - g11 (figure 5, panel (c), (d), (e) and (f)) fabs . These fabs were chosen based on the frequency of n - h7, whose vh and vl sequences were shared with 10 other selected clones, and on singularity of o - g11, as it came from the third round of the o system, after depletion on normal osteoblast cells . The immunofluorescence staining pattern suggested that these two fabs interact with a cell membrane component . The staining was dot like for the osteosarcoma cell line u2-os (figure 5, panels (b) and (d)), but only a vague staining was observed for the normal fibroblasts (figure 5, panels (a) and (c)). Immunohistochemistry analyses performed using archived normal bone and osteosarcoma sections confirmed the membrane staining pattern . Panels (e) and (f) of figure 5 show the reactivity of the o - g11 fab in a normal bone section and in an osteosarcoma section, respectively . There was visible staining in the bone marrow adipocytes and in the osteoblasts in the normal tissue (figure 5, panel (e)), but staining was less intense than the staining observed in osteosarcoma tissues (figure 5, panel (f)). This work has focused on the isolation of antibodies against osteosarcoma cells using a human fab phage display library that was constructed from antibody repertoires of osteosarcoma patients . The selection was accomplished using whole cells as the antigen source, with the goal of isolating novel antiosteosarcoma antibodies . This strategy poses an advantage over the traditional strategy using protein extracts, as the library probes the cell surface allowing the identification of protein and nonprotein antigens . Despite some intrinsic difficulties, such as the binding to a rare antigen and the loss of nonbinder phages associated with this approach, is the brasil method, described as a very efficient way to rescue ligand phages . Until now, this technique has been used only with peptide libraries [18, 19]. We performed three rounds of selection, and the reactivity analysis of the second and third rounds revealed that after two rounds we were able to identify fabs that bind to osteosarcoma cells . The ability to select specific tumor binders is usually attributed to the depletion step, but the omission of this step does not impair the isolation of specific binders [21, 22]. Our data suggest that the introduction of a negative selection step (only before the third selection cycle for the o system) did not significantly improve the isolation of specific fabs, since the n and o fabs apparently recognized the same antigen (figure 3). The lack of more effective selection in the o system could also be a consequence of the small number of positive clones in round 2, just prior to the depletion step (table 1). Selected fab clones were chosen based on their fab coding sequences (figure 2) and on their reactivity to tumor antigens assayed as a monolayer of osteosarcoma cells (table 1) and total protein extracted from cells (table 1, and figure 1). These assays were carried out to favor the binding of antibodies that recognize the physiological conformations of the antigen(s). The five clones that were further characterized all recognized the same antigen (figure 3), despite the fact that some of them reacted differently in the cell elisa or protein elisa assays, suggesting that these fabs may recognize different epitopes . Comparing the elisa results (figures 1 and 4), we observed that the results were similar if we used fibroblasts or normal osteoblasts, as negative controls . Also, it is remarkable that the majority of these clones (11 out of 20) harbored the same sequence (a17, for v and vh3.7 for the heavy chain, figure 2). This cannot be attributed to a bias in the fab library, since all of the sequenced clones from rounds two or three had different vh and v sequences compared to the original library . The emergence of clones with a restricted diversity of v gene fragments is a feature that accounts for the selection of specific ligands, as was reported when other antibody phage display libraries were used to isolate high affinity immunoglobulins [22, 24]. Clones sharing vh3 - 7 and a17 were the majority of the clones identified in our selection process . There was one exception among the 20 sequenced clones: clone n - b1, which has the vh3 - 7 gene associated with an a30 v gene . The effect of this rare association on affinity and selectivity can be further addressed . Apparently, all of the five chosen clones, each representing a distinct gene family, recognized the same protein profile . This was also true for fabs selected against different osteosarcoma cell lines, saos2 and u2-os (clones from the n and o systems, resp . ). Similar results have been reported by aryee and coworkers regarding six different scfvs selected against fli1 . The immunodominance phenomenon has been frequently observed in phage display analysis . In two separate studies with melanoma, one using a scfv phage display library constructed from blood from melanoma patients and the other using an fab library, the authors were able to isolate only one positive scfv and fab, respectively [26, 27]. This is in agreement with our results using two different cell lines, saos-2 and u2-os, as the antigen source . This does not exclude the possibility of binding to different epitopes on the same protein, and further epitope mapping must be carried out . Another interesting characteristic was the ability of the selected antibody to bind to the antigen in both native and denaturing conditions (figures 1(a), 1(b) and 3), suggesting a linear rather than a conformational epitope . The immunofluorescence staining pattern (figure 5) was typical for fabs recognizing a membrane - associated ligand, as expected for a cell surface selection procedure . The background in immunohistochemestry was high, and although it was possible to see staining of normal cells, the staining was stronger with the osteosarcoma tissues . The o - g11 fab gave a very strong background even when used as much as 1: 20 000 dilution (estimated concentration of 0.1 ng / ml). Usually the concentration of commercial antibodies is about 200 g / ml, and they are used at dilutions of 1: 501: 200 in immunohistochemistry assays . O - g11 recognized the osteoblasts in a very strong way and also reacted with adipocytes in the bone medulla but did not stain the blood vessel (data not shown). It is difficult to measure the strength of the signal in osteosarcoma cells and compare it to the signal strength from normal controls in cell imaging approaches, such as immunofluorescence and immunohistochemistry . The higher level of the antigen in the osteosarcoma cells was confirmed by cell surface elisa (figure 4). In these assays our results showed that the antigen recognized by these fabs was expressed at a level two times higher in the osteosarcoma cells than in normal tissue . This antigen is a potential marker for osteosarcoma, and investigation into the identity of this antigen should be completed . In conclusion, this work describes the isolation of five different human fabs that recognize osteosarcoma - associated antigens . These monoclonal antibody fragments harbored different vh and vl domains but apparently recognized the same protein . Our data suggest that this protein epitope is found in lower amounts in normal cell lines than in osteosarcoma cell lines and is an immunodominant antigen . As these are fully human antibodies, they can be further characterized, aiming their use as biopharmaceuticals.
|
Probiotic strain e. faecium cmgb16 (isolated from infant faeces) was cultivated in anaerobic conditions, in mrs broth . Enteropathogenic e. coli o28 (provided by national institute of research and development for microbiology and immunology cantacuzino, bucharest) and b. cereus cmgb 102 (microbial culture collection of faculty of biology, microbiology department, university of bucharest) strains were grown in nutrient broth . E. faecium cmgb16 was co - cultivated in the presence of heat - inactivated cultures of e. coli o28 and b. cereus, for 24 hours in mrs broth (man rogosa sharp), in anaerobic conditions, at 37c . The co - cultivation method was performed by inoculating 4 ml mrs broth with 40 l of fresh e. faecium cmgb16 culture corresponding to standard mcfarland 1 (310 cfu / ml) and 400 l of heat - inactivated cultures of e. coli o28/b . Cereus corresponding to standard mcfarland 1 (310 cfu / ml), before inactivation . The heat - inactivation was performed by autoclaving the bacterial cultures at 121c for 15 min . After co - cultivation, the nvc components (sns and cellular fraction) were separated by centrifugation (6,000 rpm, 10 min). The cellular sediment was adjusted to mcfarland 1 (310 cfu / ml) density in pbs (phosphate buffer saline) and along with integral cultures (ic) was heat - inactivated for 15 min at 121c . Heat - inactivated cellular suspensions obtained from the cellular sediments (cs), the ic, and the sn were further used for the immunomodulatory activity assay . Immunomodulatory properties of the obtained nvcs were tested on holoxenic mice (balb / c mouse strain). Each nvc was orally administered (by using a gradate pipette) in three doses of 0.2 ml / dose to three animals / sample, at 24 hours . Blood samples were collected from the retinal artery, by the non - traumatizing retro - orbital puncture method in the inner corner of the eye . Blood samples were collected after 7, 14, and 21 days from the first administration of the heat - inactivated probiotic fractions . The serum concentrations of il-12 and tnf- interleukins were assessed by elisa method, using mouse elisa kit thermo scientific (pierce biotechnology, rockford, uas), following the manufacturers instructions . All experiments were performed in triplicates and absorbance was measured on apollo lb 911 elisa plate reader set at 450 and 550 nm . A standard curve was generated by plotting the average absorbance obtained for each standard concentration on the vertical (y) axis vs. the corresponding il 12/tnf- concentration (pg / ml) on the horizontal (x) axis . Using the standard curve, the il-12/tnf- amount in each sample was determined by interpolating the absorbance values (y - axis) to il-12/tnf- concentration . In this way sensitivity of il 12 mouse elisa kit was <12 pg / ml and the sensitivity of tnf- mouse elisa kit was <9 pg / ml . Probiotic strain e. faecium cmgb16 (isolated from infant faeces) was cultivated in anaerobic conditions, in mrs broth . Enteropathogenic e. coli o28 (provided by national institute of research and development for microbiology and immunology cantacuzino, bucharest) and b. cereus cmgb 102 (microbial culture collection of faculty of biology, microbiology department, university of bucharest) strains were grown in nutrient broth . E. faecium cmgb16 was co - cultivated in the presence of heat - inactivated cultures of e. coli o28 and b. cereus, for 24 hours in mrs broth (man rogosa sharp), in anaerobic conditions, at 37c . The co - cultivation method was performed by inoculating 4 ml mrs broth with 40 l of fresh e. faecium cmgb16 culture corresponding to standard mcfarland 1 (310 cfu / ml) and 400 l of heat - inactivated cultures of e. coli o28/b . Cereus corresponding to standard mcfarland 1 (310 cfu / ml), before inactivation . The heat - inactivation was performed by autoclaving the bacterial cultures at 121c for 15 min . After co - cultivation, the nvc components (sns and cellular fraction) were separated by centrifugation (6,000 rpm, 10 min). The cellular sediment was adjusted to mcfarland 1 (310 cfu / ml) density in pbs (phosphate buffer saline) and along with integral cultures (ic) was heat - inactivated for 15 min at 121c . Heat - inactivated cellular suspensions obtained from the cellular sediments (cs), the ic, and the sn were further used for the immunomodulatory activity assay . Immunomodulatory properties of the obtained nvcs were tested on holoxenic mice (balb / c mouse strain). Each nvc was orally administered (by using a gradate pipette) in three doses of 0.2 ml / dose to three animals / sample, at 24 hours . Blood samples were collected from the retinal artery, by the non - traumatizing retro - orbital puncture method in the inner corner of the eye . Blood samples were collected after 7, 14, and 21 days from the first administration of the heat - inactivated probiotic fractions . The serum concentrations of il-12 and tnf- interleukins were assessed by elisa method, using mouse elisa kit thermo scientific (pierce biotechnology, rockford, uas), following the manufacturers instructions . All experiments were performed in triplicates and absorbance was measured on apollo lb 911 elisa plate reader set at 450 and 550 nm . A standard curve was generated by plotting the average absorbance obtained for each standard concentration on the vertical (y) axis vs. the corresponding il 12/tnf- concentration (pg / ml) on the horizontal (x) axis . Using the standard curve, the il-12/tnf- amount in each sample was determined by interpolating the absorbance values (y - axis) to il-12/tnf- concentration . In this way, the absorbance results were converted in pg / ml concentrations . Sensitivity of il 12 mouse elisa kit was <12 pg / ml and the sensitivity of tnf- mouse elisa kit was <9 pg / ml . The majority of scientific studies use the term probiotic according to the fao / who (food and agriculture organization of the united nations / world health organization) (32) definition, i.e. Live microorganisms, which when administered in adequate amounts could confer a health benefit on the host . Therefore, this definition requires that the probiotic must be viable, with many studies supporting this idea (3336). However, there are some scientific findings supporting the positive effects of the probiotic nvcs on health due to the ability of human immune cells to recognize specific bacterial components and metabolic by - products, generating an immunomodulatory effect that involves malt activation (2). In addition, these heat - killed probiotic cells also induced high levels of il-12 p70 in dendritic cells of mice and the switch to a t helper 1 (th1) immune response . Given the complexity of the phenomena induced by viable and non - viable probiotics, taverniti (38) has proposed the term paraprobiotic defined as non - viable fractions of probiotic origin (inactivated microbial cells or cell fractions), which have been demonstrated to positively affect human / animal health . The study of these paraprobiotics is justified by the opinion of some authors that probiotics could be involved in obesity / metabolic syndrome (39); simultaneously, the specific effects of probiotic components / culture fractions and targets are important to be known in order to define appropriate clinical applications (similarly to the modern, subunitary vaccines or to immunomodulators). During this study we have used probiotic culture fractions stimulated with other inactivated bacterial cultures, to mimic the interspecies interactions established in the intestinal mucosa . In order to include both probiotic and stimulating bacterial culture components found in the final fractions, parabiotic, defined as nvc of microbial origin that exhibit beneficial effects on the health of the human or animal host organism . The serum samples collected after 7, 14, 21 days from the first administration of probiotic fractions were analyzed for il-12 and tnf- serum levels by elisa method . The obtained values represent the average of the determinations performed for each animal batch (fig . Graphic representation of il-12 concentration in the serum of holoxenic mice, collected after: i 7 days from the first oral administration of nvcs; ii 14 days from the first oral administration of nvcs; iii 21 days from the first oral administration of nvcs . Ic, integral culture; cs, cellular suspension; sn, supernatant; a, serum collected from holoxenic mice after oral administration of nvc; b, serum collected from holoxenic mice after oral administration of nvc stimulated with e. coli o28c; c, serum collected from holoxenic mice after oral administration of nvc stimulated with b. cereus; mc, media control serum collected from holoxenic mice after oral administration of mrs; nc, negative control serum collected from holoxenic mice control . The obtained results showed that the age of the animals significantly influenced the serum concentration of il-12 . The highest levels of il-12 were recorded at 7 days after the first administration of the ic and sn nvcs, especially those stimulated with b. cereus (fig . 1). At 14 and 21 days after the first oral administration of probiotic nvcs, the serum concentration of il-12 generally decreased . In exchange, after the oral administration of sn component stimulated with b. cereus and e. coli, the serum concentrations of il-12 were maintained higher in the samples collected after 21 days post - administration . These aspects suggest that b. cereus and e. coli strains stimulate the synthesis and accumulation in the probiotic cultures sn of bacterial molecules potentially involved in the activation of mucosal intestinal cells, such as macrophages or dendritic cells, to synthesize il-12 . However, it is to be noticed that the unstimulated fractions, particularly cs and sn, also induced high levels of il-12, especially at 7 and 14 days after the first administration . Il-12 is a cytokine required for the initiation of the immune response, constituting the connecting bridge between non - specific defense reactions (it activates macrophages and nk cells) and specific immune response . The production of immunomodulatory molecules by probiotic bacteria is thus influenced by the presence of other bacterial species, both gram - positive and gram - negative, which inhabit the gut (autochthonous and allochthonous microbiota), by complex and incompletely understood cross - talk mechanisms . The induction of a late immunostimulatory response by these soluble molecules could suggest that they are resistant to digestive enzymes degradation, and could slowly and gradually diffuse in the submucosa, inducing the activation of malt . This effect was not evident after the administration of cs and ic from the unstimulated nvcs, supporting the hypothesis that the late immunomodulatory effect is due to small, heat - stable, soluble molecules . Studies on peptide fractions (with molecular weight between 2 and 10 da) isolated from lactobacillus helveticus culture (using hplc method) showed their immunomodulatory effects after oral administration in holoxenic mice infected with e. coli o157:h7 (40). Cytokine profile of these mice revealed a stimulation of th2 lymphocyte - mediated response and an increase of the b cells number in the intestine (lamina propria), and thus the concentration of secretory iga . The scientific researches states that probiotics (either viable cells or cellular fragments with antigenic potential) must interact with malt structures (dendritic cells, m cells from the peyer patches) to generate an immunostimulatory effect, the route of antigen internalization being essential for the initiation of an immune response in the gastrointestinal mucosa (11, 28, 41). These observations may explain why the early stimulation of il-12 synthesis at 7 days after the first administration was induced mainly by the ic stimulated fraction, containing strong particulate antigens . Being the dominant cytokine involved in the maturation of cd t cells, il-12 plays an important role in immunomodulation, its synthesis being an essential process in triggering early cytokine cascade activation as a response to adjuvants (42). In the case of tnf synthesis, the obtained results were variable, no specific cytokine profile dependent on probiotic nvcs, stimulating species, or serum harvesting time being identified . However, at all three harvesting intervals, the highest levels of tnf were induced after the administration of the ic fractions stimulated with e. coli (fig ., the most intensive stimulating effect was obtained for sn fraction stimulated with b. cereus, while the un - stimulated cs fraction induced the highest levels of tnf at 14 and 21 days after administration . Graphic representation of tnf concentration in the serum of holoxenic mice, collected after: i 7 days from the first oral administration of nvcs; ii 14 days from the first oral administration of nvcs; iii 21 days from the first oral administration of nvcs . Ic, integral culture, cs, cellular suspension; sn, supernatant; a, serum collected from holoxenic mice after oral administration of nvc; b, serum collected from holoxenic mice after oral administration of nvc stimulated with e. coli o28c; c, serum collected from holoxenic mice after oral administration of nvc stimulated with b. cereus; mc, media control serum collected from holoxenic mice after oral administration of mrs; nc, negative control serum collected from holoxenic mice control . This effect suggests again that the cellular fragments with strong antigenic properties could induce the activation of macrophage cells from the sub - endothelial compartment (the main tnf producing cells). It has been shown that both crude extracts and purified lipoteichoic acids from l. casei and l. fermentum could significantly induce tnf secretion by mouse splenic mononuclear cells (16). This suggests that purified lipoteichoic acids may be a better candidate for clinical use than whole bacteria since they do not contain other bacterial components which might cause side effects (2). The induction of tnf- synthesis by probiotic bacteria, observed in many other studies (28) seems to be necessary in order to establish functional connections between intestinal epithelial cells and the immune cells (b cells, dendritic cells, macrophages) from the lamina propria . Our results, similar to other scientific studies, demonstrate that inactivated soluble and cellular fractions of probiotic cultures, whose composition can be influenced by the stimulation with other microbial species, could induce immunomodulatory effects mediated by cytokines . Further studies are required in order to identify the chemical nature of these so - called parabiotic fractions . The authors have no potential conflicts of interest with any companies / organizations whose products or services may be discussed in this article.
|
Leiomyoma is a benign tumor, which is made up of smooth muscle cells and located mostly in uterus, small bowel, and esophagus . Herein, a prostatic leiomyoma that was pathologically reported after a robot - assisted radical prostatectomy (rarp) procedure is presented . A 70-year - old male patient with a serum prostate specific antigen value of 9.8 ng / ml underwent a transrectal ultrasound (trus) guided prostate biopsy . Pathology revealed prostatic adenocarcinoma with 3 + 3 gleason score in 1 core on the left side . The patient had a history of irritable bowel syndrome and had bilateral inguinal herniorrhaphy operation performed 8 years ago . A transperitoneal rarp procedure with bilateral pelvic lymph node dissection was performed (by dr . Briefly, an incision was made on the anterior peritoneal covering of the douglas' pouch, 1 cm proximal to its reflection on the rectum . Seminal vesicles (svs) and vasa deferentia were dissected . At this stage, a 3 3 cm sized posterior mass lesion protruding from the prostate between svs was identified and dissected (fig . Figure 2 shows the removed specimen with a mass lesion protruding from the prostate located between svs . Postoperative follow - up was uneventful, abdominal drain was removed at the postoperative second day, and patient was discharged on the third day . Transurethral catheter was removed on postoperative day-10 followed by obtaining a cystography that demonstrated no leakage . Pathology was reported as prostate adenocarcinoma, gleason score 3 + 3, tumor size of 5 4 3 mm, left apex, and single focus with clear surgical margins . Posteriorly located mass pathology was reported as a leiomyoma with a size of 3.5 3 2.8 cm . Prostate had a weight of 210 g. microscopy of this mass lesion revealed a fascicular pattern of smooth muscle bundles separated by well - vascularized connective tissue (fig . Smooth muscle cells were elongated with eosinophilic or occasional fibrillar cytoplasm and distinct cell membranes . One to 2 mitotic figures per 10 high power fields in most mitotically active area were observed, and there was no significant atypia (fig . Also a single focus of prostate adenocarcinoma with gleason score 3 + 3, size of 5 4 3 mm, located on left apex, with clear surgical margins was reported . A mass lesion, made up of smooth muscle bundles, is well demarcated from prostate tissue on the left (h&e 4). Smooth muscle cells with bland cytology form fascicules (h&e 40). Immunohistochemically smooth muscle actin is positive (inset 40). At postoperative ninth - month follow - up, patient is fully urinary continent with no safety pad usage . He is able to have penile erection for sexual intercourse with use of phosphodiesterase type 5 inhibitors . Although pure prostatic leiomyoma is rarely seen, it was reported initially in 1876 in the autopsy material by lebel et al . In 1951, kaufman and berneike defined prostatic leiomyomas . In 2016, kristensen et al . Stated that prostatic leiomyomas were reported in <100 cases since it was defined . In addition, the origin of prostatic leiomyoma may reveal as wastes of mllerian duct . However, a certain mechanism of formation of prostatic leiomyoma is still not clearly presented . Robotic surgery for the surgical management of a leiomyoma was previously performed by aoun et al . However, in our case the whole prostate with the posteriorly located leiomyoma was removed with the rarp procedure . The console surgeon in our case was challenged with the identification of a large mass lesion located between the svs as this area has already a limited space . Therefore, it was surgically not difficult to dissect and isolate this mass lesion . However, the presence of this mass lesion made it challenging to open the denonvilliers' fascia due to its close proximity with rectum . At this stage, intra - abdominal pressure was elevated as much as 18 mmhg temporarily to better see the area and a 4 close up magnification was used with the da vinci xi surgical robot . Fourth arm of the robot holding a prograsp forceps was effectively used to lift up the prostate by holding from the svs in an attempt to make the console surgeon to see the area below the mass lesion . It is important to keep in mind that this maneuver might lead to tearing off the svs if too much force is applied as there is no tactile sensation in robotic surgery . A further trick that might also be applied could be using a 30 up lens to better see the area below the mass lesion . Leiomyoma is a benign tumor and has excellent prognosis when complete resection is applied and atypia is not detected . On our case, vandoros et al . Stated that negative surgical margins and absence of metastatic disease at presentation were the only factors predictive of long - term survival . Therefore, prostatic leiomyosarcomas should also be kept in mind in the differential diagnosis . In conclusion, prostatic leiomyomas that are benign mesenchymal smooth muscle tumors might present as a posteriorly located mass lesion between svs that could challenge the surgeon during surgery, which should be kept in mind.
|
The ubiquitous use of heterocycles in the pharmaceutical, agrochemical as well as in the dye and fine - chemical industries has led to the establishment of numerous strategies for their synthesis and functionalisation . Stereodefined heterocycles are also significant components of numerous biologically active natural products . As a result of the widespread prevalence of heterocyclic motifs in synthetic chemistry, alongside the continued drive for efficient, selective synthetic protocols within the chemical community, there is an ongoing requirement for novel asymmetric syntheses of heterocyclic scaffolds . For example, the oxazolidin-4-one core is found in the natural products synoxazolidinone a and b which were isolated from s. pulmonaria and exhibit antibiotic and antifungal activity at low concentrations (figure 1). In addition, oxazolidin-4-ones are found in lipoxazolidinones a, b, and c isolated from a marine actinomycete strain . These naturally occurring oxazolidin-4-ones also exhibit antibacterial activity comparable with the commercial antibacterial agent linezolid (zyvox) that contains a structurally related oxazolidin-2-one core . Therefore, the development of a synthetic strategy for the asymmetric generation of heterocyclic scaffolds of this type is a worthwhile goal . In this manuscript, we describe an isothiourea - catalysed formal [3 + 2] cycloaddition using both racemic and enantioenriched oxaziridines to form stereodefined oxazolidin-4-ones . Building on birman and okamoto s introduction of isothiourea catalysts for kinetic resolutions we have recently established, alongside romo, isothiourea lewis base catalysis for the preparation of a range of synthetically relevant heterocyclic scaffolds . Substituted thfs, dihydrobenzofurans and pyrrolidines have been accessed by an asymmetric intramolecular michael addition / lactonisation process . In addition, stereodefined anti--lactams and dihydropyranones were obtained by related intermolecular michael addition / cyclisation protocols . This methodology was extended using a strategic phsh elimination as part of a cascade process for the synthesis of substituted pyrones and functionalised pyridines . Additionally, asymmetric formal [2 + 2] cycloadditions employing n - sulfonyl imines to form anti--lactams have been studied . However, to date, formal [3 + 2] cycloaddition processes catalysed by isothioureas have not been developed . Oxaziridines have previously been reported as electrophiles for the synthesis of oxazolidin-4-ones by ye and co - workers using ketenes in the presence of either n - heterocyclic carbene (nhc) precatalyst 1 or cinchona alkaloids . The,-disubstituted oxazolidin-4-ones were isolated in good yield and with high diastereo- and enantioselectivity (scheme 1a), although this process is somewhat limited due to the use of synthetically challenging ketenes and their precursors . More recently, feng described chiral bisguanidinium salt 2 for the asymmetric oxyamination of azlactones with concurrent kinetic resolution of the oxaziridine (scheme 1 b). Building upon these precedents, herein we report our results on the isothiourea - catalysed asymmetric formal [3 + 2] cycloaddition of homoanhydrides and oxaziridines to form stereodefined oxazolidin-4-ones (scheme 1c) and their subsequent derivatisations . Formal [3 + 2] intermolecular cycloadditions for the synthesis of oxazolidin-4-ones catalysed by a) nhc precatalyst 1; b) bisguanidinium salt 2; c) hyperbtm 3 . Our investigation began with the lewis base - catalysed reaction of commercially available phenylacetic acid 4 with racemic oxaziridine 5 (table 1, conditions a). Treatment of the acid with pivaloyl chloride and ipr2net to form a mixed anhydride in situ followed by addition of (2s,3r)-hyperbtm 3 and oxaziridine 5 gave high conversion into the desired [3 + 2] oxazolidin-4-one product 6, with a small amount of imine 14 and -lactam 15 (derived from a previously disclosed intramolecular formal [2 + 2] cycloaddition of an ammonium enolate and imine 14) also observed by h nmr spectroscopy (table 1, entry 1). However, imine 14 was difficult to remove from the desired product by column chromatography, resulting in contaminated oxazolidin-4-ones . To probe the origin of imine 14, control experiments demonstrated that treating oxaziridine 5 in ch2cl2 with ipr2net (1 equiv) led to the formation of ipr2(et)n - oxide and imine 14 . To prevent this undesired imine formation through oxidation of the base a number of alternative bases disappointingly, 2,6-lutidine and cs2co3 gave comparable amounts of imine 14 (entries 2 and 3). In the reaction with cs2co3 (entry 3), imine formation is presumably derived from reaction of oxaziridine 5 with chloride ions[7b] generated from the reaction of phenylacetic acid 4 with pivaloyl chloride to form the activated mixed anhydride . To overcome this problem and remove the need for an activation step, homoanhydride 7 was used in place of phenylacetic acid and assessed under similar reaction conditions (table 1, conditions b). Pleasingly, this alternative ammonium enolate precursor resulted in formation of oxazolidin-4-one 6 exclusively in high yield with excellent enantiocontrol, however lower levels of diastereoselectivity were obtained (entry 4). The oxazolidin-4-one diastereomeric mixture 6 a and 6 b was reduced using lialh4 to give diol 16 in good yield maintaining stereointegrity (scheme 2), confirming that the configuration at c(5) is equivalent in both the syn- and anti - diastereomers formed . The absolute configuration was determined by comparison of the specific rotation of diol 16 with literature values (see the supporting information for details). To assess the effect of the oxaziridine on the stereochemical outcome of the process, alternative oxaziridines were investigated using phenylacetic anhydride 7 as the standard ammonium enolate precursor (entries 57). Aromatic halogen substitution in the ortho- and para - position was examined under the optimised conditions and led to high yields of the desired [3 + 2] products 11 and 12, both in approximately 55:45 d.r . But with slightly reduced levels of enantiocontrol for both diastereoisomers . Gratifyingly, the scope of the process could be extended with regards to the n - substituent . Replacing the n - tosyl group with an n - nosyl led to the formation of oxazolidin-4-one 13 in high yield, however slightly reduced ee values were obtained for the syn- and anti - products . [c] determined by hplc analysis . [d] conditions a. [e] conditions b. lialh4 reduction of oxazolidin-4-one 6 . These reaction conditions were next applied to a range of homoanhydrides to assess the scope of the reaction (table 2). Anhydrides with both electron - withdrawing and -donating aromatic substituents were tolerated, giving a range of oxazolidin-4-ones in high yields with approximately 50:50 d.r ., but with excellent levels of enantiocontrol observed for each diastereoisomer 6, 17 and 18 (up to 99% ee). Extended aromatic systems and aromatic groups bearing substituents in the ortho-, meta- and para - position also participated well under the previously optimised reaction conditions giving oxazolidin-4-ones 1922 in good yields again with excellent levels of ee for both diastereoisomers . 3-thiophenylacetic anhydride led to isolation of oxazolidin-4-one 23 in 79% yield but lower levels of ee were obtained for both the syn- and anti - diastereoisomer (87 and 81%, respectively). Pleasingly, the reaction was extended beyond aromatic substitution patterns to include alkenyl oxazolidin-4-one 24, obtained in good yield and high ee (syn- and anti - diastereoisomer). Unexpectedly, p - trifluoromethyl substitution gave oxazolidin-4-one 25 in 49:51 d.r.anti/syn, with both diastereoisomers formed with low levels of enantioselectivity (43% eeanti, 36% eesyn). [c] determined by hplc analysis . Whilst these results are synthetically relevant, their utility for the synthesis of oxazolidin-4-ones is partially limited due to the diastereomeric mixtures of heterocycles obtained . Although this methodology is applicable to the synthesis of enantioenriched diols (scheme 2), further investigations sought to investigate the cause of low diastereocontrol in this process allowing selective access to either syn and anti diastereoisomers . The conversion of ()-oxaziridine 5 into product 6 under the standard reaction conditions was monitored over time by h nmr spectroscopy and the ee of unreacted oxaziridine 5 and oxazolidin-4-one 6 was analysed by chiral hplc analysis (table 3). Notably, over the early part of the reaction the d.r . Of 6 remains fairly constant with the initial d.r . Of 78:22 anti / syn at 1 min, reducing to 71:29 after 4 h at 78 c . The ee of both diastereoisomers of oxazolidin-4-one 6 remain consistently high throughout the duration of the reaction . Interestingly, the ee of the unreacted oxaziridine 5 gradually increased with conversion up to 41% ee at 4 h, which indicates that a partial kinetic resolution was occurring under the reaction conditions . The ee values of 5 obtained experimentally in table 3 correlate with the predicted values based upon the given conversion and d.r . Significantly, high conversion was only achieved after an extended reaction time and upon warming to room temperature, which indicates that one enantiomer of the oxaziridine requires increased temperature to react efficiently with the ammonium enolate . This experiment also provided evidence that chirality transfer from ()-oxaziridine 5 to product 6 was the cause of the low diastereocontrol in this process, which has implications with regard to the mechanism of this isothiourea - catalysed formal [3 + 2] process . Investigation of enantio- and diastereoselectivity over time [a] determined by h nmr spectroscopic analysis . [c] determined by hplc analysis . To further investigate and utilise the chirality transfer in this process the use of an excess of ()-oxaziridine 5 (2 equiv with respect to homoanhydride 7) was trialled (scheme 3). In this case, oxazolidin-4-one 6 was isolated in 71% yield with an improved 75:25 d.r . The remaining oxaziridine 5 was isolated in 42% ee, with the (s, s)-enantiomer in excess . This formally represents a kinetic resolution of ()-5 with 49% conversion with respect to the oxaziridine (as judged by crude h nmr spectroscopic analysis) equating to a selectivity factor s=4 . Use of excess ()-oxaziridine 5 . In light of these results, it was reasoned that using an enantiomerically pure oxaziridine would lead to the formation of a single diastereoisomer of the corresponding oxazolidin-4-one product through complete chirality transfer . To assess this, enantioenriched oxaziridine (r, r)-5 was accessed in 94% ee (following a single recrystallisation) using a modified procedure developed by jrgensen and co - workers (scheme 4). Pleasingly, using enantioenriched oxaziridine (r, r)-5 with phenylacetic anhydride 7 and (2s,3r)-hyperbtm 3 (scheme 5a) gave anti - oxazolidin-4-one 6 a in high yield, ee and excellent d.r . This matched case arises from the ammonium enolate generated with homoanhydride 7 and (2s,3r)-hyperbtm 3 reacting with (r, r)-5 with excellent stereocontrol . Using enantiomeric catalyst (2r,3s)-hyperbtm ent-3, low reactivity and reduced isolated yields however, performing the reaction at 0 c allowed the desired syn - oxazolidin-4-one 6 b to be isolated in 95% yield and 80:20 d.r . (syn / anti), with the major syn product formed in excellent ee (98%) (scheme 5 b). This again suggests complete chirality transfer from the oxaziridine with the configuration at c(5) determined by the catalyst . In the mis - matched case the minor anti - oxazolidin-4-one product was isolated in reduced ee (67%), presumably as a result of a competitive uncatalysed background reaction for this catalytically unfavoured process . Investigation of a) matched and b) mis - matched effects between ammonium enolate and enantiomerically enriched oxaziridine . The results described in scheme 5 lead us to propose a catalytic cycle for the synthesis of oxazolidin-4-ones, shown in scheme 6 . Subsequent deprotonation of 27 to give (z)-ammonium enolate 28, stabilised by a favourable no to *c interaction,[8h, 9d, 27] followed by intermolecular stereoselective -oxidation leads to acyl ammonium 29 . This mechanism provides an alternative to that proposed by ye and co - workers who suggest that for their related nhc - catalysed formal [3 + 2] process the azolium enolate generated is oxidised by an oxaziridine to form a transient epoxide species and an imine, with subsequent collapse of the epoxide and nucleophilic attack onto the imine generating an acyl azolium species that can cyclise into an oxazolidin-4-one . Our observation of a matched / mis - matched effect using enantioenriched oxaziridine suggests the formation of a transient planar imine intermediate in this process is unlikely . However, the possibility of an alternative mechanistic pathway operating in the mis - matched case cannot be ruled out . Proposed mechanism for lewis base catalysed formal [3 + 2] cycloaddition of ammonium enolates with oxaziridines . The significance of the matched / mis - matched effect was further demonstrated through reaction of a range of homoanhydrides with (r, r)-oxaziridine 5 (94% ee) using hyperbtm 3 (table 4). Under the previously optimised conditions, electron - donating and -withdrawing aromatic substituents were easily incorporated resulting in high yields, enantioselectivities and, importantly, high d.r . Of oxazolidin-4-ones 17 a and 18 a, respectively . Substitution in either the ortho- or meta - positions of the aryl ring was also well tolerated, forming oxazolidin-4-ones 19 a, 21 a and 22 a as single diastereoisomers with excellent levels of enantioselectivity . Alkenyl and heteroaryl homoanhydride substituents were also successfully incorporated to give 30 a and 31 a respectively, with high levels of stereocontrol . However, the introduction of a p - trifluoromethyl substituent gave oxazolidin-4-one 25 in a reduced 60:40 d.r.anti/syn, with both diastereoisomers formed in high enantioselectivity (> 99% ee). This suggests that major product anti-25 a is formed with high levels of enantioselectivity but undergoes base - mediated epimerisation at c(5) into syn-25 b. this result also provides a plausible explanation for the unexpected result using the p - trifluoromethyl - substituted homoanhydride with ()-oxaziridine 5, with epimerisation at c(5) in combination with the expected mixture at c(2) leading to the observed drop in ee of both diastereoisomers of 25 (table 2). [c] determined by hplc analysis . To demonstrate the synthetic utility of this [3 + 2] process, removal of the n - tosyl protecting group on oxazolidin-4-ones 6 a and 17 a18 a was achieved with smi2 at low temperature to give the parent heterocycles 3234 in high yields, with complete retention of ee . Further hydrolysis of oxazolidin-4-one 32 with hcl led to formation of (r)-mandelic acid 35 in quantitative yield . Our investigation began with the lewis base - catalysed reaction of commercially available phenylacetic acid 4 with racemic oxaziridine 5 (table 1, conditions a). Treatment of the acid with pivaloyl chloride and ipr2net to form a mixed anhydride in situ followed by addition of (2s,3r)-hyperbtm 3 and oxaziridine 5 gave high conversion into the desired [3 + 2] oxazolidin-4-one product 6, with a small amount of imine 14 and -lactam 15 (derived from a previously disclosed intramolecular formal [2 + 2] cycloaddition of an ammonium enolate and imine 14) also observed by h nmr spectroscopy (table 1, entry 1). However, imine 14 was difficult to remove from the desired product by column chromatography, resulting in contaminated oxazolidin-4-ones . To probe the origin of imine 14, control experiments demonstrated that treating oxaziridine 5 in ch2cl2 with ipr2net (1 equiv) led to the formation of ipr2(et)n - oxide and imine 14 . To prevent this undesired imine formation through oxidation of the base a number of alternative bases disappointingly, 2,6-lutidine and cs2co3 gave comparable amounts of imine 14 (entries 2 and 3). In the reaction with cs2co3 (entry 3), imine formation is presumably derived from reaction of oxaziridine 5 with chloride ions[7b] generated from the reaction of phenylacetic acid 4 with pivaloyl chloride to form the activated mixed anhydride . To overcome this problem and remove the need for an activation step, homoanhydride 7 was used in place of phenylacetic acid and assessed under similar reaction conditions (table 1, conditions b). Pleasingly, this alternative ammonium enolate precursor resulted in formation of oxazolidin-4-one 6 exclusively in high yield with excellent enantiocontrol, however lower levels of diastereoselectivity were obtained (entry 4). The oxazolidin-4-one diastereomeric mixture 6 a and 6 b was reduced using lialh4 to give diol 16 in good yield maintaining stereointegrity (scheme 2), confirming that the configuration at c(5) is equivalent in both the syn- and anti - diastereomers formed . The absolute configuration was determined by comparison of the specific rotation of diol 16 with literature values (see the supporting information for details). To assess the effect of the oxaziridine on the stereochemical outcome of the process, alternative oxaziridines were investigated using phenylacetic anhydride 7 as the standard ammonium enolate precursor (entries 57). Aromatic halogen substitution in the ortho- and para - position was examined under the optimised conditions and led to high yields of the desired [3 + 2] products 11 and 12, both in approximately 55:45 d.r . But with slightly reduced levels of enantiocontrol for both diastereoisomers . Gratifyingly, the scope of the process could be extended with regards to the n - substituent . Replacing the n - tosyl group with an n - nosyl led to the formation of oxazolidin-4-one 13 in high yield, however slightly reduced ee values were obtained for the syn- and anti - products . [c] determined by hplc analysis . [d] conditions a. [e] conditions b. lialh4 reduction of oxazolidin-4-one 6 . These reaction conditions were next applied to a range of homoanhydrides to assess the scope of the reaction (table 2). Anhydrides with both electron - withdrawing and -donating aromatic substituents were tolerated, giving a range of oxazolidin-4-ones in high yields with approximately 50:50 d.r ., but with excellent levels of enantiocontrol observed for each diastereoisomer 6, 17 and 18 (up to 99% ee). Extended aromatic systems and aromatic groups bearing substituents in the ortho-, meta- and para - position also participated well under the previously optimised reaction conditions giving oxazolidin-4-ones 1922 in good yields again with excellent levels of ee for both diastereoisomers . 3-thiophenylacetic anhydride led to isolation of oxazolidin-4-one 23 in 79% yield but lower levels of ee were obtained for both the syn- and anti - diastereoisomer (87 and 81%, respectively). Pleasingly, the reaction was extended beyond aromatic substitution patterns to include alkenyl oxazolidin-4-one 24, obtained in good yield and high ee (syn- and anti - diastereoisomer). Unexpectedly, p - trifluoromethyl substitution gave oxazolidin-4-one 25 in 49:51 d.r.anti/syn, with both diastereoisomers formed with low levels of enantioselectivity (43% eeanti, 36% eesyn). [c] determined by hplc analysis . Whilst these results are synthetically relevant, their utility for the synthesis of oxazolidin-4-ones is partially limited due to the diastereomeric mixtures of heterocycles obtained . Although this methodology is applicable to the synthesis of enantioenriched diols (scheme 2), further investigations sought to investigate the cause of low diastereocontrol in this process allowing selective access to either syn and anti diastereoisomers . The conversion of ()-oxaziridine 5 into product 6 under the standard reaction conditions was monitored over time by h nmr spectroscopy and the ee of unreacted oxaziridine 5 and oxazolidin-4-one 6 was analysed by chiral hplc analysis (table 3). Notably, over the early part of the reaction the d.r . Of 6 remains fairly constant with the initial d.r . Of 78:22 anti / syn at 1 min, reducing to 71:29 after 4 h at 78 c . The ee of both diastereoisomers of oxazolidin-4-one 6 remain consistently high throughout the duration of the reaction . Interestingly, the ee of the unreacted oxaziridine 5 gradually increased with conversion up to 41% ee at 4 h, which indicates that a partial kinetic resolution was occurring under the reaction conditions . The ee values of 5 obtained experimentally in table 3 correlate with the predicted values based upon the given conversion and d.r . Significantly, high conversion was only achieved after an extended reaction time and upon warming to room temperature, which indicates that one enantiomer of the oxaziridine requires increased temperature to react efficiently with the ammonium enolate . This experiment also provided evidence that chirality transfer from ()-oxaziridine 5 to product 6 was the cause of the low diastereocontrol in this process, which has implications with regard to the mechanism of this isothiourea - catalysed formal [3 + 2] process . Investigation of enantio- and diastereoselectivity over time [a] determined by h nmr spectroscopic analysis . [c] determined by hplc analysis . To further investigate and utilise the chirality transfer in this process the use of an excess of ()-oxaziridine 5 (2 equiv with respect to homoanhydride 7) was trialled (scheme 3). In this case, oxazolidin-4-one 6 was isolated in 71% yield with an improved 75:25 d.r . The remaining oxaziridine 5 was isolated in 42% ee, with the (s, s)-enantiomer in excess . This formally represents a kinetic resolution of ()-5 with 49% conversion with respect to the oxaziridine (as judged by crude h nmr spectroscopic analysis) equating to a selectivity factor s=4 . Use of excess ()-oxaziridine 5 . In light of these results, it was reasoned that using an enantiomerically pure oxaziridine would lead to the formation of a single diastereoisomer of the corresponding oxazolidin-4-one product through complete chirality transfer . To assess this, enantioenriched oxaziridine (r, r)-5 was accessed in 94% ee (following a single recrystallisation) using a modified procedure developed by jrgensen and co - workers (scheme 4). Pleasingly, using enantioenriched oxaziridine (r, r)-5 with phenylacetic anhydride 7 and (2s,3r)-hyperbtm 3 (scheme 5a) gave anti - oxazolidin-4-one 6 a in high yield, ee and excellent d.r . This matched case arises from the ammonium enolate generated with homoanhydride 7 and (2s,3r)-hyperbtm 3 reacting with (r, r)-5 with excellent stereocontrol . Using enantiomeric catalyst (2r,3s)-hyperbtm ent-3, low reactivity and reduced isolated yields however, performing the reaction at 0 c allowed the desired syn - oxazolidin-4-one 6 b to be isolated in 95% yield and 80:20 d.r . (syn / anti), with the major syn product formed in excellent ee (98%) (scheme 5 b). This again suggests complete chirality transfer from the oxaziridine with the configuration at c(5) determined by the catalyst . In the mis - matched case the minor anti - oxazolidin-4-one product was isolated in reduced ee (67%), presumably as a result of a competitive uncatalysed background reaction for this catalytically unfavoured process . Investigation of a) matched and b) mis - matched effects between ammonium enolate and enantiomerically enriched oxaziridine . The results described in scheme 5 lead us to propose a catalytic cycle for the synthesis of oxazolidin-4-ones, shown in scheme 6 . Subsequent deprotonation of 27 to give (z)-ammonium enolate 28, stabilised by a favourable no to *c interaction,[8h, 9d, 27] followed by intermolecular stereoselective -oxidation leads to acyl ammonium 29 . This mechanism provides an alternative to that proposed by ye and co - workers who suggest that for their related nhc - catalysed formal [3 + 2] process the azolium enolate generated is oxidised by an oxaziridine to form a transient epoxide species and an imine, with subsequent collapse of the epoxide and nucleophilic attack onto the imine generating an acyl azolium species that can cyclise into an oxazolidin-4-one . Our observation of a matched / mis - matched effect using enantioenriched oxaziridine suggests the formation of a transient planar imine intermediate in this process is unlikely . However, the possibility of an alternative mechanistic pathway operating in the mis - matched case cannot be ruled out . Proposed mechanism for lewis base catalysed formal [3 + 2] cycloaddition of ammonium enolates with oxaziridines . The significance of the matched / mis - matched effect was further demonstrated through reaction of a range of homoanhydrides with (r, r)-oxaziridine 5 (94% ee) using hyperbtm 3 (table 4). Under the previously optimised conditions, electron - donating and -withdrawing aromatic substituents were easily incorporated resulting in high yields, enantioselectivities and, importantly, high d.r . Of oxazolidin-4-ones 17 a and 18 a, respectively . Substitution in either the ortho- or meta - positions of the aryl ring was also well tolerated, forming oxazolidin-4-ones 19 a, 21 a and 22 a as single diastereoisomers with excellent levels of enantioselectivity . Alkenyl and heteroaryl homoanhydride substituents were also successfully incorporated to give 30 a and 31 a respectively, with high levels of stereocontrol . However, the introduction of a p - trifluoromethyl substituent gave oxazolidin-4-one 25 in a reduced 60:40 d.r.anti/syn, with both diastereoisomers formed in high enantioselectivity (> 99% ee). This suggests that major product anti-25 a is formed with high levels of enantioselectivity but undergoes base - mediated epimerisation at c(5) into syn-25 b. this result also provides a plausible explanation for the unexpected result using the p - trifluoromethyl - substituted homoanhydride with ()-oxaziridine 5, with epimerisation at c(5) in combination with the expected mixture at c(2) leading to the observed drop in ee of both diastereoisomers of 25 (table 2). [c] determined by hplc analysis . To demonstrate the synthetic utility of this [3 + 2] process, removal of the n - tosyl protecting group on oxazolidin-4-ones 6 a and 17 a18 a was achieved with smi2 at low temperature to give the parent heterocycles 3234 in high yields, with complete retention of ee . Further hydrolysis of oxazolidin-4-one 32 with hcl led to formation of (r)-mandelic acid 35 in quantitative yield . The asymmetric formal [3 + 2] cycloaddition of ammonium enolates with both ()-oxaziridines and (r, r)-oxaziridines has been developed using a range of 2-aryl and 2-alkenylacetic anhydrides with the commercially available isothiourea catalyst hyperbtm 3 . This process allows access to stereodefined oxazolidin-4-ones that can be readily deprotected or reduced to give enantioenriched building blocks in high yield . Further studies using enantioenriched oxaziridines led to the observation of a matched / mis - matched effect with isothiourea hyperbtm 3, which has been utilised to obtain oxazolidin-4-ones in high d.r . With excellent ee . Ongoing studies within this laboratory are focused upon the continued development of lewis base catalysis . For general experimental details, full characterisation data, nmr spectra, and hplc traces, see the supporting information . The appropriate oxaziridine (1 equiv) and (2s,3r)-hyperbtm 3 (10 mol%) were added to a solution of the appropriate homoanhydride (1.5 equiv) and cesium carbonate (2 equiv) in ch2cl2 (0.2 m) at 78 c . The reaction mixture was stirred at 78 c then warmed slowly to room temperature over 16 h before being quenched with hcl (1.0 m). The reaction mixture was extracted with ch2cl2 (2), the combined organics dried over mgso4, filtered and concentrated in vacuo . The crude residue was purified by column chromatography on silica gel (eluent petrol / et2o 80:20 unless otherwise stated) to afford the desired oxazolidin-4-one . For general experimental details, full characterisation data, nmr spectra, and hplc traces, see the supporting information . The appropriate oxaziridine (1 equiv) and (2s,3r)-hyperbtm 3 (10 mol%) were added to a solution of the appropriate homoanhydride (1.5 equiv) and cesium carbonate (2 equiv) in ch2cl2 (0.2 m) at 78 c . The reaction mixture was stirred at 78 c then warmed slowly to room temperature over 16 h before being quenched with hcl (1.0 m). The reaction mixture was extracted with ch2cl2 (2), the combined organics dried over mgso4, filtered and concentrated in vacuo . The crude residue was purified by column chromatography on silica gel (eluent petrol / et2o 80:20 unless otherwise stated) to afford the desired oxazolidin-4-one . As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors
|
This was a secondary data analysis study using hfs - ii survey data collected from four different national institutes of health funded projects conducted at the university of virginia center for behavioral medicine research between 1998 and 2009 . Details of the methods for several of these projects have been previously published (9,10). All four projects included participants who had type 1 diabetes for at least 1 year and were willing to perform bg measurements at least two times every day . Study 1 had an additional inclusion criterion of having a history of two or more episodes of severe hypoglycemia during the past year . Study 4, a survey of drivers with diabetes, had additional criteria of possessing a legal driver s license and driving at least 10,000 miles per year . In each study, participants completed a battery of questionnaires, including the hfs - ii . Although studies 1, 2, and 3 included the entire hfs - ii scale (i.e., both hfs - b and hfs - w subscales), study 4 only used the hfs - w subscale . Participants in all studies also completed a diabetes history questionnaire, including an item to assess frequency of severe hypoglycemia over the past year . Severe hypoglycemia was defined as a hypoglycemic episode during which bg was so low that self - treatment was not possible because of mental confusion or stupor and external assistance was required . Finally, all four studies included additional psychological questionnaires, including the beck depression inventory (11), the beck anxiety inventory (12), the modified state - trait personality inventory (13), and the short - form (sf) 12 quality - of - life inventory (14). These measures were used to assess the construct validity of the hfs - ii . Only baseline data (i.e., before any intervention) was included for the purposes of the current study . The total number of participants with hfs - ii data was 777, with 289 participants completing the hfs - b subscale and 488 participants completing only the hfs - w subscale . Across the studies, there were no differences in sex composition, mean hba1c values, mean age, or ethnicity . There were differences in mean duration of diabetes [f(3,791) = 10.22, p <0.0005; minimum maximum = 19.626.0 years] and years of education [f(2,661) = 10.9, p <0.0005; minimum maximum = 14.915.9 years], but these did not appear to be clinically meaningful . For the aggregate sample, mean (sd) age was 41.9 (12.6) years, diabetes duration was 23.8 (12.5) years, hba1c was 7.7 (1.4)%, and education was 15.6 (2.5) years . A total of 53.3% of the subjects were female, 44.4% used insulin pumps, 63.1% reported no severe hypoglycemia in the past year, and 95.9% were white . Descriptive statistical analyses, correlations, group comparisons, and cronbach reliability analyses were performed with pasw 18.0.2 (spss, chicago, il). Because factor analyses have not previously been conducted on the hfs - ii, the dimensional structure of the survey was examined with exploratory factor analysis in mplus software (15), using polychoric correlations for handling the categorical nature of the data . Model fit was estimated using a goodness - of - fit statistic, root mean squared error of approximation (rmsea), standardized root mean squared residuals (srmrs), and the tucker - lewis index (tli). Currently, there is much debate in the field about cutoffs for fit indices (16), but, in general, rmsea and srmr values <0.10 indicate acceptable fit (17,18) and tli values> 0.90 indicate acceptable fit (19). Hfs - b and hfs - w subscales were analyzed using the rasch partial credit model (pcm) in winsteps (20). Several statistics from pcm analyses assess item quality and responses . These include 1) infit and outfit statistics that indicate the degree of fit between item endorsement scores and the person s level of the trait being measured, in this case foh; 2) point - measure correlations, which are similar to item - total correlations, with a range of 1 to 1 on the pcm logit scale (low and negative values being problematic); and 3) separation values that indicate the degree of distinguishable trait levels measured by the scale, with high values desirable (e.g., a separation of 2 indicates that only two levels of the trait are distinguishable and a separation of 3 indicates three levels, etc). Separation is computed as the ratio of the test sd corrected for estimation error to root mean squared error (rmse). The total number of participants with hfs - ii data was 777, with 289 participants completing the hfs - b subscale and 488 participants completing only the hfs - w subscale . Across the studies, there were no differences in sex composition, mean hba1c values, mean age, or ethnicity . There were differences in mean duration of diabetes [f(3,791) = 10.22, p <0.0005; minimum maximum = 19.626.0 years] and years of education [f(2,661) = 10.9, p <0.0005; minimum maximum = 14.915.9 years], but these did not appear to be clinically meaningful . For the aggregate sample, mean (sd) age was 41.9 (12.6) years, diabetes duration was 23.8 (12.5) years, hba1c was 7.7 (1.4)%, and education was 15.6 (2.5) years . A total of 53.3% of the subjects were female, 44.4% used insulin pumps, 63.1% reported no severe hypoglycemia in the past year, and 95.9% were white . Descriptive statistical analyses, correlations, group comparisons, and cronbach reliability analyses were performed with pasw 18.0.2 (spss, chicago, il). Because factor analyses have not previously been conducted on the hfs - ii, the dimensional structure of the survey was examined with exploratory factor analysis in mplus software (15), using polychoric correlations for handling the categorical nature of the data . Model fit was estimated using a goodness - of - fit statistic, root mean squared error of approximation (rmsea), standardized root mean squared residuals (srmrs), and the tucker - lewis index (tli). Currently, there is much debate in the field about cutoffs for fit indices (16), but, in general, rmsea and srmr values <0.10 indicate acceptable fit (17,18) and tli values> 0.90 indicate acceptable fit (19). Hfs - b and hfs - w subscales were analyzed using the rasch partial credit model (pcm) in winsteps (20). Several statistics from pcm analyses assess item quality and responses . These include 1) infit and outfit statistics that indicate the degree of fit between item endorsement scores and the person s level of the trait being measured, in this case foh; 2) point - measure correlations, which are similar to item - total correlations, with a range of 1 to 1 on the pcm logit scale (low and negative values being problematic); and 3) separation values that indicate the degree of distinguishable trait levels measured by the scale, with high values desirable (e.g., a separation of 2 indicates that only two levels of the trait are distinguishable and a separation of 3 indicates three levels, etc). Separation is computed as the ratio of the test sd corrected for estimation error to root mean squared error (rmse). Table 1 summarizes the mean total hfs - ii, hfs - b, and hfs - w scores for each study and for the aggregate sample . Scores were significantly higher on the total hfs - ii and hfs - w in study 1, in which inclusion criteria required that individuals had experienced two or more episodes of severe hypoglycemia in the previous year compared with other studies {f(2,282) = 8.46, p <0.0005 (t12[143.4] = 2.43, p = 0.016, t13[128.3] = 3.83, p <0.0005) and f(3,773) = 26.47, p <0.0005 (t12[152.1] = 3.84, p <0.0005, t13[141.5] = 5.40, p <0.0001, t14[174.3] = 7.27, p <0.0001), respectively}. There were no differences in hfs - b (mi = 18.0, sd = 9.4; mp = 17.3 . Sd = 9.2) or hfs - w scores (mi = 22.1, sd = 14.6; mp = 22.1, sd = 13.9) as a result of insulin regimen (injection versus pump) [f(1,259) = 0.32, p = 0.572 and f(1,747) = 0.00, p = 0.951, respectively]. Hfs - b scores were significantly higher for female subjects (m = 19.0, sd = 9.8) than for male subjects (m = 16.8, sd = 8.5) [f(1,281) = 4.07, p = 0.045]. Hfs - w scores were also significantly higher for female subjects (m = 23.4, sd = 14.5) than for male subjects (m = 21.0, sd = 14.0) [f(1,773) = 5.395, p = 0.02]. Years of education were negatively correlated with hfs - b (r = 0.28, p = 0.0001) and hfs - w scores (r = 0.10, p = 0.016). Hfs - ii score means (sd) by study means sharing the same subscript denote statistically significant differences; all p <0.0169 for total hfs - ii comparisons and * total n for total hfs - ii and hfs - b is 279 and 289, respectively . Cronbach coefficients indicated a high level of internal consistency for the total hfs - ii (= 0.94), hfs - b (= 0.85), and hfs - w (= 0.94) scores . Test--retest data were available from one study (study 3) that used a repeated - baseline design, with 2 months between data collection . Temporal reliability was 0.74 for the total hfs - ii, 0.81 for the hfs - b, and 0.63 for the hfs - w scales . As table 2 shows, both the hfs - b and hfs - w correlated positively with measures of psychological distress, including the modified state - trait personality inventory anxiety, anger, and depression subscales, as well as the beck depression inventory and beck anxiety inventory . Hfs - b and hfs - w scores correlated negatively with health - related quality of life, including the sf-12 physical and mental scores . Correlations and mean (sd) hfs - ii scores by measures of validity table 2 also shows that both hfs - b and hfs - w scores were significantly higher for those who had experienced severe hypoglycemia in the past year compared with those who had not [f(1,281) = 8.956, p = 0.003 and f(1,770) = 63.037, p <0.0005, respectively], with effect sizes 0.35 for the hfs - b and 0.58 for the hfs - w . Median hfs - b item scores were 1.27 for those who experienced sh and 1.0 for those who did not experience sh, with interquartile range scores of 0.87 and 0.63, respectively . Median hfs - w item scores were 1.44 for those with a history severe hypoglycemia and 0.94 for those with no history in the past year, with interquartile range scores of 1.13 and 0.89, respectively . Hfs - b scores were higher for those with hba1c 7.5% compared with those with hba1c <7.5% [f(1,268) = 5.34, p = 0.022], with an effect size of 0.28 . Median hfs - b scores were 1.13 for those with hba1c 7.5% and 1.0 for those with hba1c <7.5%, with interquartile range scores of 0.87 and 0.73, respectively . Table 3 summarizes factor analyses results . Fit estimates for the one - factor solution were questionably acceptable [(79) = 1,288.4, p <0.0001; rmsea = 0.14, srmr = 0.13, tli = 0.92] but improved in the two - factor solution [(102) = 973.8, p <0.0001; rmsea = 0.10, srmr = 0.08, tli = 0.95]. As expected, this two - factor solution reflected the two hfs - ii subscales . The (23) = 314.6 between these two models indicates that the two - factor solution fit better . A three - factor model also was tested and fit the data [(112) = 630.1, p <0.0001; rmsea = 0.08, srmr = 0.06, tli = 0.98], with only four hfs - b items loading onto a third factor . Based on study hypotheses and the fit of the two - factor solution reflecting the hfs - ii subscales, irt analysis was performed on the two - factor solution . Exploratory factor analysis results * pcm ranking of the measures is on a scale from 1 (the most frequently strongly endorsed item on each scale) to the highest number on each scale representing the least frequently strongly endorsed item . Some rankings indicate tied measures . In the two - factor solution, 13 of 15 hfs - b items loaded onto the first factor, with coefficients ranging from 0.33 to 0.87 (see table 3). The only items that did not load within this two - factor solution range were hfs - b3 and hfs - b4 . All 18 hfs - w items loaded onto the second factor, with coefficients ranging from 0.43 to 1.04 . The correlation between these two subscales was r = 0.60 (p <0.0005). Optimal assessment is indicated by matching between person trait - level scores and item endorsement scores . Nearly all item endorsement scores matched with individual person trait scores within the range of the highest to lowest scores for both people and items . For hfs - b item endorsement scores, m = 0.00 (by definition) and sd = 0.58 and for person hfs - b trait - level scores, m = 0.86, sd = 0.83 . For hfs - w item endorsement scores, m = 0.00 (by definition) and sd = 0.44 and for person hfs - w trait - level scores, m = 1.01 and sd = 1.26 . For both scales, the mean person trait - level score was slightly lower than mean item endorsement score, and person trait - level variability was greater than item variability for the respective scales, which was acceptable . Items were rank - ordered separately for each subscale from the most frequently strongly endorsed item to the least frequently strongly endorsed item, on average (see table 3). Twelve hfs - b items showed excellent fit (item responses were as expected), with proper ranges of infit values (0.641.28) and outfit values (0.671.09). Point - measure correlations for these items ranged from 0.40 to 0.72, which is excellent . For hfs - b3 and hfs - b4, infit and outfit values indicated less fit than expected, had low point - measure correlations, and were the two most frequently strongly endorsed items, on average . For hfs - b8, outfit was better than expected, and it was the least frequently strongly endorsed item with lower variability compared with other hfs - b items . Separation for the hfs - b was 7.92, indicating nearly eight statistically distinguishable trait levels and excellent discrimination quality . Seventeen hfs - w items showed excellent fit, with ranges of infit values (0.771.25) and outfit values (0.721.27). No other statistics (item endorsement score, point - measure correlation) were extreme, so concern for this item was negligible . Separation for the hfs - w was 9.35, indicating over nine statistically distinguishable trait levels and excellent discrimination quality . Table 1 summarizes the mean total hfs - ii, hfs - b, and hfs - w scores for each study and for the aggregate sample . Scores were significantly higher on the total hfs - ii and hfs - w in study 1, in which inclusion criteria required that individuals had experienced two or more episodes of severe hypoglycemia in the previous year compared with other studies {f(2,282) = 8.46, p <0.0005 (t12[143.4] = 2.43, p = 0.016, t13[128.3] = 3.83, p <0.0005) and f(3,773) = 26.47, p <0.0005 (t12[152.1] = 3.84, p <0.0005, t13[141.5] = 5.40, p <0.0001, t14[174.3] = 7.27, p <0.0001), respectively}. There were no differences in hfs - b (mi = 18.0, sd = 9.4; mp = 17.3 . Sd = 9.2) or hfs - w scores (mi = 22.1, sd = 14.6; mp = 22.1, sd = 13.9) as a result of insulin regimen (injection versus pump) [f(1,259) = 0.32, p = 0.572 and f(1,747) = 0.00, p = 0.951, respectively]. Hfs - b scores were significantly higher for female subjects (m = 19.0, sd = 9.8) than for male subjects (m = 16.8, sd = 8.5) [f(1,281) = 4.07, p = 0.045]. Hfs - w scores were also significantly higher for female subjects (m = 23.4, sd = 14.5) than for male subjects (m = 21.0, sd = 14.0) [f(1,773) = 5.395, p = 0.02]. Years of education were negatively correlated with hfs - b (r = 0.28, p = 0.0001) and hfs - w scores (r = 0.10, p = 0.016). Hfs - ii score means (sd) by study means sharing the same subscript denote statistically significant differences; all p <0.0169 for total hfs - ii comparisons and * total n for total hfs - ii and hfs - b is 279 and 289, respectively . Cronbach coefficients indicated a high level of internal consistency for the total hfs - ii (= 0.94), hfs - b (= 0.85), and hfs - w (= 0.94) scores . Test--retest data were available from one study (study 3) that used a repeated - baseline design, with 2 months between data collection . Temporal reliability was 0.74 for the total hfs - ii, 0.81 for the hfs - b, and 0.63 for the hfs - w scales . As table 2 shows, both the hfs - b and hfs - w correlated positively with measures of psychological distress, including the modified state - trait personality inventory anxiety, anger, and depression subscales, as well as the beck depression inventory and beck anxiety inventory . Hfs - b and hfs - w scores correlated negatively with health - related quality of life, including the sf-12 physical and mental scores . Correlations and mean (sd) hfs - ii scores by measures of validity table 2 also shows that both hfs - b and hfs - w scores were significantly higher for those who had experienced severe hypoglycemia in the past year compared with those who had not [f(1,281) = 8.956, p = 0.003 and f(1,770) = 63.037, p <0.0005, respectively], with effect sizes 0.35 for the hfs - b and 0.58 for the hfs - w . Median hfs - b item scores were 1.27 for those who experienced sh and 1.0 for those who did not experience sh, with interquartile range scores of 0.87 and 0.63, respectively . Median hfs - w item scores were 1.44 for those with a history severe hypoglycemia and 0.94 for those with no history in the past year, with interquartile range scores of 1.13 and 0.89, respectively . Hfs - b scores were higher for those with hba1c 7.5% compared with those with hba1c <7.5% [f(1,268) = 5.34, p = 0.022], with an effect size of 0.28 . Hfs - w scores did not differ, with an effect size of 0.12 . Median hfs - b scores were 1.13 for those with hba1c 7.5% and 1.0 for those with hba1c fit estimates for the one - factor solution were questionably acceptable [(79) = 1,288.4, p <0.0001; rmsea = 0.14, srmr = 0.13, tli = 0.92] but improved in the two - factor solution [(102) = 973.8, p <0.0001; rmsea = 0.10, srmr = 0.08, tli = 0.95]. As expected, this two - factor solution reflected the two hfs - ii subscales . The (23) = 314.6 between these two models indicates that the two - factor solution fit better . A three - factor model also was tested and fit the data [(112) = 630.1, p <0.0001; rmsea = 0.08, srmr = 0.06, tli = 0.98], with only four hfs - b items loading onto a third factor . Based on study hypotheses and the fit of the two - factor solution reflecting the hfs - ii subscales, irt analysis was performed on the two - factor solution . Exploratory factor analysis results * pcm ranking of the measures is on a scale from 1 (the most frequently strongly endorsed item on each scale) to the highest number on each scale representing the least frequently strongly endorsed item . Some rankings indicate tied measures . In the two - factor solution, 13 of 15 hfs - b items loaded onto the first factor, with coefficients ranging from 0.33 to 0.87 (see table 3). The only items that did not load within this two - factor solution range were hfs - b3 and hfs - b4 . All 18 hfs - w items loaded onto the second factor, with coefficients ranging from 0.43 to 1.04 . The correlation between these two subscales was r = 0.60 (p <0.0005). Optimal assessment is indicated by matching between person trait - level scores and item endorsement scores . Nearly all item endorsement scores matched with individual person trait scores within the range of the highest to lowest scores for both people and items . For hfs - b item endorsement scores, m = 0.00 (by definition) and sd = 0.58 and for person hfs - b trait - level scores, m = 0.86, sd = 0.83 . For hfs - w item endorsement scores, m = 0.00 (by definition) and sd = 0.44 and for person hfs - w trait - level scores, m = 1.01 and sd = 1.26 . For both scales, the mean person trait - level score was slightly lower than mean item endorsement score, and person trait - level variability was greater than item variability for the respective scales, which was acceptable . Items were rank - ordered separately for each subscale from the most frequently strongly endorsed item to the least frequently strongly endorsed item, on average (see table 3). Twelve hfs - b items showed excellent fit (item responses were as expected), with proper ranges of infit values (0.641.28) and outfit values (0.671.09). Point - measure correlations for these items ranged from 0.40 to 0.72, which is excellent . For hfs - b3 and hfs - b4, infit and outfit values indicated less fit than expected, had low point - measure correlations, and were the two most frequently strongly endorsed items, on average . For hfs - b8, outfit was better than expected, and it was the least frequently strongly endorsed item with lower variability compared with other hfs - b items . Separation for the hfs - b was 7.92, indicating nearly eight statistically distinguishable trait levels and excellent discrimination quality . Seventeen hfs - w items showed excellent fit, with ranges of infit values (0.771.25) and outfit values (0.721.27). No other statistics (item endorsement score, point - measure correlation) were extreme, so concern for this item was negligible . Separation for the hfs - w was 9.35, indicating over nine statistically distinguishable trait levels and excellent discrimination quality . The survey demonstrated strong internal consistency, with reliability coefficients 0.85 for the total hfs - ii and subscales . Temporal reliability was adequate, ranging from 0.81 (hfs - b) to 0.63 (hfs - w), although it is important to note that foh would not be expected to stay completely stable over time . Previous studies have shown that levels of foh can increase after traumatic experiences with severe hypoglycemia (21) and decrease after interventions that reduce the frequency of hypoglycemia (22,23). Several findings support the validity of the hfs - ii, including significantly higher scores for both subscales in patient populations expected to have higher levels of foh, such as those who experience more frequent severe hypoglycemia . In addition, hfs - b scores, but not hfs - w scores, were higher in patients with poorer glycemic control, indicative of more hyperglycemia . Female subjects also had significantly higher hfs - ii scores, replicating numerous studies that found higher levels of emotional and physical symptoms in female subjects across a broad range of self - report instruments . Construct validity was additionally supported by the positive correlations between the hfs - ii and other valid measures of psychological distress, including anxiety and depression . As expected, higher hfs - ii scores were negatively related to quality of life, with the hfs - w subscale more strongly related to mental and emotional quality of life and the hfs - b subscale more strongly related to physical quality of life . Factor analyses supported a two - factor solution over a one - factor solution, with item loadings justifying the structure and separate scoring of the hfs - b and hfs - w subscales . A recent swedish study (24) found a three - factor solution for the hfs - i in type 1diabetic patients, with the third factor comprising hfs - w items describing worries about being alone during hypoglycemia . The current study tested a three - factor solution for the hfs - ii but did not replicate the swedish findings . The three - factor solution for the hfs - ii did provide slightly better fit, but the third factor comprised a few items on the hfs - b, not the hfs - w, subscale . It is almost always the case that increasing the number of factors results in better fit, although this does not necessarily result in better understanding of a scale . Unfortunately, the hfs - b subscale was not included in some of the datasets analyzed for this study . Additional analysis of datasets with more hfs - b data are needed to determine whether this factor will be confirmed and whether it improves the utility of the hfs - ii . Rasch pcm analyses indicated very good results for the items in the two hfs - ii subscales . Both subscales had excellent separation, reasonable item - to - person matching, and good item - fit statistics, indicating that they are appropriate measures of the constructs represented in the two - factor solution . Two items on the hfs - b (reduce insulin when bg is low and measure bg six or more times per day) yielded very low factor loadings, and the rasch pcm analysis indicated that these items were, on average, the most frequently strongly endorsed . Although sometimes this type of result may indicate appropriate removal of these items from the instrument, this is not recommended for two reasons . Irt analysis indicated that these items tended to be strongly endorsed by most individuals; therefore, the failure to strongly endorse these items may be important information to have about a person s behavioral reactions to low bg levels . Second, maintaining these items, and keeping the hfs - ii consistent across studies and translations, allows researchers to compare results more easily across various populations, translations, and research . The mean scores and comparisons across different patient populations generated by this study may help to guide clinical interpretations of hfs - ii scores . For example, higher hfs - ii scores, on both subscales but especially on the hfs - w subscale, are expected in patients with a recent history of severe hypoglycemia . On the other hand, patients in poorer glycemic control did not exhibit higher hfs - w subscale scores but did exhibit higher hfs - b scores . In addition, whereas hfs - w scores were more strongly related to lower quality of life in terms of emotional distress, hfs - b scores were more strongly related to lower quality of life in terms of physical burden and impairment . The original purpose of the two subscale construction of the hfs was to assess both the behavioral and the affective dimensions of patient experience and reaction to hypoglycemia . These results also support the need to administer the entire hfs - ii scale in order to assess these different dimensions of foh and not just the hfs - w subscale, which has been done in some studies . It still is premature, however, to generalize these findings to translated versions of the hfs - ii, and it is a limitation of this study that only u.s . Additional research is needed to validate other versions of the scale and to compare foh across different cultures and countries . Other limitations of this study include the substantially lower number of hfs - b surveys for analysis and the exclusion of individuals with type 2 diabetes, which was beyond the scope of this article . Future studies are needed of the psychometric properties of the hfs - ii in type 2 diabetes, as well as in pediatric patients and their parents . English version of the hfs - ii is a psychometrically valid and reliable instrument for adults with type 1 diabetes, with potential clinical as well as scientific utility for the assessment of foh.
|
The advent of regenerative approaches in contemporary periodontics has increased patient's treatment options and enhanced the long - term prognosis of many teeth that have advanced periodontal destruction . Preliminary experimental studies have shown that nanosized ceramics may represent a promising class of bone graft substitutes due to their improved osseointegrative properties . Accordingly, a synthetic nanocrystalline hydroxyapatite (ncha) bone graft has been introduced for augmentation procedures in intrabony defects . A special feature of nanostructured materials is an extremely high number of molecules on the surface of material . When ncha was used as a bone graft substitute, rapid healing of critical size defects was observed in animal experiments and in human applications . Ncha has been used in the treatment of metaphyseal fractures in orthopedic surgery, ridge augmentation, and peri - implantitis lesions . Various collagen barriers of mammalian origin, such as bovine and porcine, have been used successfully for guided tissue regeneration guided tissue regeneration (gtr) in human intrabony and furcation defect and gingival recession . Recently, interest has been developed in non - mammalian collagen sources, primarily fish collagen . A bioresorbable collagen barrier membrane (periocol) of fish origin has been developed for gtr applications in human periodontal intrabony and furcation defects . Periocol collagen membrane has been used as a sustained release chlorhexidine chip in chronic periodontitis patients and reported to be resorbed after 30 days . However, collagen membrane when dampened by biological fluid results in a poor membrane resistance to collapse, allowing undesirable cell types to enter the secluded wound area . The collapse may be prevented by means of implantation of bone grafts or bone graft substitutes into the defect to support the membrane, preserving its original position . Performed in periodontal regeneration has suggested that one of the most predictable techniques in improving clinical attachment level (cal) and bone fill is achieved when a combination of graft material and gtr is used. [1315] during periodontal therapy, deep intraosseous defects represent a major challenge for the clinician, often requiring open flap debridement (ofd) alone or combined with bone - regenerative procedures . Various clinical and radiographic studies[9131622] demonstrated significant higher probing pocket depth (ppd) reduction and greater gain in cal in the combined group compared with ofd group . This study was designed to evaluate the efficacy of ncha bone replacement graft (sybograf) in combination with bioresororbable collagen membrane (periocol) compared with open flap debridement alone . Sixteen systemically healthy patients (nine male subjects and seven female subjects), aged between 25 - 65 years were screened after a detailed clinical and radiographic examination from the out patient department of periodontology, manipal college of dental sciences, mangalore . Inclusion of patients either in the test group (10 defects) or control group (10 defects) was determined randomly through the coin flip method . Study inclusion criteria were as follows: systemically healthy patients; presence of atleast one or two radiographically detectable intrabony defects with probing pocket depth 5 mm and radiographic depth of the defect 3 mm; no antibiotics taken prior to six months of initial examination and did not require antibiotic premedication for any systemic condition; no periodontal surgery performed in the areas to be treated within the last 12 months; good level of oral hygiene (plaque index [pi] <1). Subjects with previously implanted materials, natural or synthetic and physical barriers in the selected defects, smokers, pregnant and lactating female subjects; teeth exhibiting mobility exceeding grade ii and teeth with endodontic involvement were excluded from the study . All 16 patients with 20 intrabony defects (9 in maxilla and 11 in mandible), following an initial examination, diagnosis and treatment plan were subjected to phase - i therapy, which comprises of full mouth supragingival and subgingival scaling and root planing . A customized acrylic stents was fabricated on study casts for each patient and trimmed to the height of contour of the teeth, and one vertical groove was prepared to standardize the probe angulation and position [figure 1]. All measurements were recorded to nearest millimeter (mm) with the help of a unc-15 graduated periodontal probe . Clinical parameters (pi, gingival index (gi), ppd, cal, and gingival recession [rec]) were recorded at baseline and 6 month at the six aspects (mesio - buccal, mid - buccal, disto - buccal, mesio - lingual, mid lingual, and disto - lingual) per tooth . Only one site representing the deepest point of the ppd was included in the study . Measuring the probing depth with stent using the apical margin of the customized acrylic stent as the fixed reference point (rp), the following measurements were recorded at the proximal line angle of the tooth with the associated bony defect . A) rp to the gingival margin [gm]; b) rp to the cemento - enamel junction [cej]; and c) rp to the base of the pocket [bop]. The following clinical parameters were recorded using the acrylic stent: a) ppd = [rp to bop] [rp to gm]; b) cal = [rp to bop] [rp to cej]; and c) rec = [rp to gm] [rp to cej]. An intra - oral periapical radiograph was taken for each selected site using the long cone paralleling technique with mm grid scale, at baseline [figure 2] and at 6 months [figure 3] post - surgery . All radiographs were digitalized using the digital camera and transferred to the computer as jpeg image to measure the linear radiographic depth (in mm) of the defect (dd) using software, image j, which was designed by national institute of health (nih) for the image analysis . Preoperative radiograph postoperative radiograph following clinical data collection, a pre - operative mouth rinse with 10 ml 0.2% chlorhexidine gluconate (plakil india) was used by all patients . Area subjected to surgery was anesthetized by nerve block / infiltration depending on the surgical site using local anesthesia . Full thickness flap was raised buccally and lingually until 1 mm bone was exposed in control group, and 2 - 3 mm in the patients of test group . The osseous defect was debrided of granulation tissue and the root surface was planed to remove plaque and calculus, using hand and ultrasonic scalers until a smooth hard consistency was found [figure 4]. The defect's architecture had to be confirmed by direct observation and classified based on the number of bony walls present . Following surgical debridement, no root bio - modification or osseous resective procedures was attempted . Intrabony defect after degranulation in patients selected for test group in addition to ofd, ncha bone replacement grafts having particle size 40 - 50 nm (sybograf) was utilized to fill the defects to the most coronal level of the osseous walls and type - i sterile collagen gtr membrane (periocol) was adapted over the bone graft extended 2 - 3 mm beyond the margin of the defect apically and mesio - distally and 1 mm below the cej [figure 5]. Periocol is an orange - brown colored membrane, measuring a size of 2530 mm, in a sterile double blister pack . The source of collagen in periocol gtr membrane is from the air bladder of fresh water fishes . Bone graft gtr membrane placed primary soft tissue closure was done with interrupted sutures using non resorbable 3 - 0 black silk sutures . Postoperatively, subjects were prescribed antibiotics (amoxicillin 500 mg tid for 7 days) to prevent post - operative infection and analgesics (ibuprofen 400 mg tid for 5 days) for pain management . Patients were instructed to rinse with 0.2% chlorhexidine gluconate (twice daily for 4 weeks). Following surgery, the patients were asked to refrain from tooth brushing, flossing, and interdental cleaning techniques in the treated area for 4 weeks after surgery . At 1 week recall visit, dressing, sutures, and recall appointments were then made at 2 and 4 week for additional follow - up and plaque control . All the patients were recalled at 1, 3, and 6 month post - surgery for follow - up . At 6 month recall visit full mouth pi and gi was recorded . At each recall appointment all the statistical analysis was done using computer software package for statistical analysis, spss version 11.5 (spss inc ., wilcoxon signed rank sum test was used for intragroup comparison in both test and control groups . Mann - whitney u test was used for intergroup comparison between test and control groups . All the statistical analysis was done using computer software package for statistical analysis, spss version 11.5 (spss inc ., wilcoxon signed rank sum test was used for intragroup comparison in both test and control groups . Mann - whitney u test was used for intergroup comparison between test and control groups . All 16 patients completed the 6 month follow - up period . Configuration and distribution of treated intrabony defects are depicted in table 1 . Neither allergic reaction nor suppuration or abscess was observed in any of the patients . Subjects and defect characteristics at baseline the pi and gi values (meansd) showed non - significant difference at baseline and 6 month between the test and control groups as depicted in table 2 . No statistically significant differences were found between groups for any of the investigated parameter (ppd, cal, rec, and dd) at baseline [table 2]. Test and control group at baseline and 6 months at six months, the mean ppd reduction was 4.330.50 mm for the test and 3.221.09 mm for the control group [tables 2 and 3]. The wilcoxon signed rank sum test indicated that both the test (p=0.006) and control (p=0.007) groups showed a significantly greater mean ppd reduction at six months . Analysis by mann whitney u test demonstrated a statistically significantly (p=0.01) greater reduction in mean ppd favoring the test group, and an additional 1.11 mm ppd reduction was observed in test group [table 3]. Comparison of change in clinical and radiographic parameter between test and control group at 6 months statistically significant mean cal gains of 3.780.66 mm and 2.781.09 mm were observed in the test and control groups, respectively, from baseline to 6 month [tables 2 and 3]. There was statistically significantly greater cal gains for the test group (3.78 mm) than the control group (2.78 mm) [table 3]. The magnitude of the observed additional benefit was 1.00 mm in the test group . At six months, the mean increase in rec was 0.550.52 mm and 0.440.52 mm in the test and control groups, respectively [table 3]; although a statistically significant increase in rec was found in both the groups (p=0.025 test; p=0.046 control) [table 3]. None of the sites treated in both test and control groups resulted in an increase in rec of more than 1 mm . The mean gain in radiographic defect fill was recorded as 2.070.67 mm (47.55%) in test and 0.910.21 mm (25.33%) in control group at 6 month [tables 2 and 3]. Statistically significant (p<0.05) gain of radiographic defect fill was recorded in both the test as well as in the control group . At 6 month, statistically significant (p=0.001) greater reduction of radiographic dd was observed in test group compared with the control group [table 3]. There was also an additional 1.16 mm (22.22%) of radiographic bone fill in the test group [table 3]. Bone grafts, their synthetic substitutes, and gtr techniques have been used in an attempt to gain this therapeutic endpoint . The present study was designed to compare the combined effect of bg+gtr (test group) with ofd (control group) in the treatment of intrabony periodontal defects . A clinically and statistically significant improvement in ppd reduction, cal gain, and radiographic defect fill was observed in both test and control groups at 6 month postoperatively compared to baseline, which favored the test group . In the control group, the mean reduction of ppd was 3.221.09 mm and cal gain was 2.771.09 mm at 6 months follow - up visit . In a study by kilic et al, ofd group showed the mean ppd reduction of 3.17 mm, which was in accordance to the results of the present study and cal gain of 2.1 mm which was slightly lower than the present study . The difference in results of ofd group might be influenced by surgical technique, baseline defect characteristics, and operator skill . The reduction in ppd was slightly higher and the cal gain was in agreement with the previous reported study by kasaj et al, that evaluated the clinical efficacy of ncha paste in intrabony defects and reported ppd reduction of 3.91.2 mm and cal gain of 3.61.6 mm . This slightly higher ppd reduction may be due to the effect of combination technique (bg+gtr) used in the present study . Kilic et al, demonstrated that the combination of ha collagen bone graft with eptfe membrane resulted in higher ppd reduction (5.85 mm) and greater cal gain (3.80 mm) compared with the test group results of our study . The higher reduction of ppd might be explained by the higher gingival recession in the above study (2.00 mm) compared to 0.55 mm in the present study . It was suggested that intrabony defect configuration influences the results after gtr and larger amounts of cal gain were reported in deep three - wall defects than two- or one - wall defects following gtr treatment . A systematic review concluded that in two - wall intrabony defect models of periodontal regeneration, the additional use of a grafting material gave superior histological results of bone repair to barrier membranes alone . In the present study, configuration of defects treated were 2 and 2-walled, which may have benefited from the combination technique . Pocket depth reduction, even though not necessarily a result attributed to regeneration, is a major player in decision making in routine periodontal patient care scenarios . Initial pocket depth in the defects treated with bg+gtr in the present study were more than 7 mm, and were reduced to value just slightly above 3 mm depth accepted as manageable by current patient care standard . Intergroup comparison of the results at 6 month showed that there was an additional 1.11 mm ppd reduction and 1.00 mm cal gain in the test group . Trombelliconcluded that additional effect of the combination treatment (gtr + bg) is similar to gtr alone when compared to ofd alone with respect to attachment gain, but results in slightly more ppd reduction and greater gain in hard tissue probing at re - entry surgery . The combined group showed a significantly greater cal gain, lesser alveolar crest reduction, and greater vertical bone gain compared with the gtr alone group . In fact, collagen membranes are characterized by a lack of stiffness when they are dampened by biological fluids . The presence of a physical support under such a material allows the membrane to maintain its position when the flaps are sutured over the defect, exerting pressure onto the membrane itself . It should, however, be pointed out that in the present study the collagen membrane was not fixed by means of bioresorbable sutures or pins . Thus, it cannot be excluded that the membrane was displaced during flap suturing or the healing process and may have acted only for stabilization of the graft particles . Periodontal therapies are usually associated with gingival recession which is of esthetic concern for both patients and clinicians . The rec in the present study showed no statistically significant difference between the test and control sites at baseline and at six months . The increase in rec in present study was lower in both test and control groups compared to the previously reported similar study by sculean et al . The ability of a probe to penetrate into a pocket is related to several factors including probing force and gingival tissue condition . Camargo et al, stated that the improvement in clinical parameter can result in gain in attachment; however, it should be remembered that placement of graft material into the defect may modify gingival tissue consistency and therefore interfere with the penetration of periodontal probe without necessarily having induced any gain in cal . Hence, bone fill data derived from surgical re - entry is important to substantiate routine post - operative measurements due to the above mentioned reason . However, it has certain inherent disadvantages like inducing further resorption at the treated site and inability to ascertain the exact histological nature of the hard tissue . The second surgical procedure is also time consuming and may interrupt the regenerative process if healing is still ongoing . Zybutz et al, concluded that standardized radiographs reliably and permanently describe the hard tissue changes and thus can serve as substitute for probing to bone or re - entry measurements of bone changes . In the present study, a change of the alveolar bone level was detected radiographically using consecutive pre- and post - operative radiographs . Prefabricated film holders may provide projection standardization to a certain degree . In the present study, linear measurement from the crest to the base of the intrabony defect j image software, which can overcome errors in the linear measurement to a certain degree than manual measurements . In the present study, the radiographic defect depth gain was 2.070.67 mm, which represents radiographic defect depth fill of 47% at six months in test group . Kilic et al, reported 1.55 mm gain of radiographic defect depth in test group, which was slightly lower than the present study . Several reports indicate that the bone fill is enhanced by the addition of a graft material to gtr procedures . Present study demonstrated additional 1.16 mm (22%) radiographic defect depth fill in the test group compared with the control group over six month period, although complete regeneration was not achieved . Wenzel et al, reported no increased bone fill between 6 and 12 months may support the six month radiographic analysis of the present study . Question arises whether the radiographically assessed increase in the defect fill in the test group could represent the new bone formation or the presence of residual graft material or both, although ncha was reported to be resorbable . The present study demonstrated statistically significant but slight clinical improvement in cal gain (1.00 mm) in the test group compared with ofd . The most reliable outcome variable for assessing periodontal regeneration is histological analysis; however, due to ethical consideration and patient management limitation, no histological evidence was obtained to establish proof of periodontal regeneration in present study . Combined use of ncha bone graft with collagen membrane resulted in clinically and statistically significant ppd reduction, cal gain and bone fill percentage, compared to ofd alone, in periodontal intrabony defects.
|
Knee osteoarthritis is known to cause not only restrictions in joint functions, but also major problems, such as the wear of articular cartilage and pain due to inflammatory damage to the surrounding tissues1, 2 . If the pain due to osteoarthritis persists chronically, cytokines will increase in the spinal cord due to inflammatory stimulation coming from peripheral regions, and the increase in cytokines will induce inflammatory responses to cause damage to spinal cord nerve cells . If pain signals continuously extend from the peripheral joint regions to the spinal cord, spinal cord nerve cell damage will increase to develop chronic pain along with neuropathic pain, such as hyperalgesia3 . In this case, to regenerate the synapses of damaged spinal cord nerve cells, growth - associated protein-43 (gap-43), which is a substance related to nerve regeneration, increases in the posterior horn of the spinal cord4 . Among the many methods of treating osteoarthritis patients, exercise not only reinforces the regenerative capacity of articular cartilage and improves the collagen synthesis network, but it also strengthens the muscles and ligaments around the knee joints5 . In addition, exercise is known to not only suppress the production of pre - inflammatory cytokines, such as il-6, il-8, and tnf-, and increase the secretion of il-10, which has anti - inflammatory effects to reduce inflammatory responses in the joints and the spinal cord, but it also increases the expression of neurotrophic factors, increased neurotrophic factor expression could promote the gap-43 expression, thereby enhancing the nerve regeneration capacity3, 6, 7 . As such, the purpose of exercise treatment for osteoarthritis patients is to not only enhance joint functions, but also relieve pain, thereby enhancing quality of life . Therefore, the present study was conducted to examine the effects of exercise on the recovery of spinal cord nerve cells damaged due to pain signals, which are a major symptom of osteoarthritis . Experimental procedures were performed in accordance with the protocols established by the institution of animal care and use committee (iacuc) at the daegu university, based on the nih guidelines for the care and use of laboratory animals (nih, 1996). Adult male sprague - dawley rats (810 weeks of age, weight 250300 g, n=40) were used and housed at a controlled temperature at 25 2 c with 12 h light / dark cycle and free access to food and water . Induction of osteoarthritis by monosodium iodoacetate (mia, sigma, st louis, mo, america) was performed briefly, 3 mg mia in 50ul saline was injected through the patella tendon into the right knee joint8 . Injected rats were randomly divided into 4 groups: sham control group without mia injection (sg), control group with injected mia (cg), oa without exercise (neg), oa with exercise (eg). Three weeks after oa induction, exercise group was habituated on motor - driven treadmill at a speed of 10 m / min for 2 days to reduce their stress . The exercise group was submitted to 4-week training program on a treadmill for 5 days / week, 30 min / day, 16 m / min velocity which corresponded to approximately 6070% vo2 max . Spinal cord were removed, postfixed for 30 min, then rinsed and stored in 0.2 m phosphate buffer (pb) overnight . Spinal cord were sectioned with a microtome in serial section of 30 um, collected on slides and sections were performed immunohistochemistry . Briefly, sections were rinsed 5 min and incubated for 1hr rt in tbs (tris - buffered saline) containing 5% donkey serum (sigma aldrich, wien, austria), 1% bsa (bovine serum albumin, sigma - aldrich). The sections were incubated for immunohistochemistry with the primary antibody (rabbit polyclonal gap-43, 1:500, chemion international, usa) overnight at 4c . Subsequently, the sections were rinsed 5 min, after which the abc complex (vector laboratories) was applied to each section for 1hr at room temperature, antibody binding was visualized using a commercially available dab substrate solution (vector laboratories). For quantitative analysis of positive immunoreactivity was measured using computer - assisted image analysis and is reported here as the proportional area of tissue occupied by immunohistochemically stained . Data was calculated by pixel and were analyzed using spss for windows version 18.0 . And expressed as mean standard deviation (sd). In this study, a results of measuring the expression of gap-43, gap-43 was observed in all groups, showed that the significant difference in each group (table 1table 1.the comparison of expression of ngf in spinal cord between four groups unit; pixelexpressions of gap-43 (mean sd)group (n=40)sg (n=10)cg (n=10)neg (n=10)eg (n=10)8,306.6 541.711,558.2 881.618,213.5 603.322,986.4 1239.6sg: sham group; cg: control group; neg: no exercise group; eg: exercise group; mean sd: mean standard deviation . Significant difference from sg ., significantly higher gap-43 expression were found in neg and eg groups . In particular, it was confirmed that the highest expression of gap-43 in the group which performed treadmill exercise . Sg: sham group; cg: control group; neg: no exercise group; eg: exercise group; mean sd: mean standard deviation . If the pain signals generated by the knee joint are continuously delivered to the spinal cord, cytokines, which are an inflammation - inducing substance, will increase in the spinal cord to cause inflammatory responses in the spinal cord so that nerve cells are damaged and the sensory neurons in the spinal dorsal horn become sensitive, resulting in the occurrence of neuropathic pain, such as hyperalgesia4, 9 . When the central nervous system s nerve cells have been damaged, activities for the protection and regeneration of the damaged region increase . Astrocytes, which are neuroglia cells, proliferate, neurotrophic factors, such as ngf, brain - derived neurotrophic factor (bdnf), and neurotrophic-3 (nt-3), increase, and these neurotrophic factors lead to increases in the expression of gap-43, which acts directly in the secretion of neurotransmitters and axonal regeneration10, 11 . In the present study, to examine whether exercise affects the expression of gap-43, which plays important roles in nerve cell regeneration and recovery in osteoarthritic white rats spinal cords, rats were induced to perform treadmill exercises, and the state of the expression of gap-43 in the posterior horn of the spinal cord was examined through immunohistochemical staining . Upon examining the state of the expression of gap-43, it could be seen that gap-43 increased in the cg compared to the sg, and this can be judged as indicating spinal cord nerve cell damage due to osteoarthritis, as presented in a study conducted by orita et al . In addition, orita et al . Observed the gap-43 expression in the spinal cord, which did not clearly increase at the early stage of the onset of osteoarthritis, but it remarkably increased from 14 days after the onset, and the lesion progressed to 28 days after the onset when the experiment terminated . This is consistent with the results of the present study, indicating that the gap-43 expression significantly increased in the neg compared to in the cg . Therefore, gap-43 seems to have increased over time through natural healing to heal the damaged nerve cells . The significantly higher expression could be seen in the eg, which performed exercise, compared to the neg . Based on the results of an analysis of previous studies, this result can be judged as indicating that the damaged nerve cells were actively being recovered as gap-43 increased thanks to exercise . When the above - mentioned results were viewed comprehensively, it could be seen that exercise increased the gap-43 expression in the spinal cord to promote the regeneration of spinal cord nerve cells damaged due to chronic osteoarthritis . Also, the increase in the regeneration of nerve cells damaged due to inflammatory responses is thought to have positive effects on treatment for pain relief.
|
We learned of additional babesiosis cases because they were reported to the new jersey department of health and senior services or because health - care providers contacted the centers for disease control and prevention (cdc) about the diagnosis or treatment of babesiosis . Although babesiosis is not a nationally notifiable disease, some states have made cases of babesiosis reportable . Cases became reportable in new jersey in 1985; however, reporting was discontinued in 1990 because no cases had been reported . Reporting was reinstated in 1995, and 1997 was the first year in which cases were reported to the health department . We defined a potential case of babesiosis as an infection occurring in a symptomatic person whose illness was consistent with babesiosis, most likely was acquired in new jersey, and most likely resulted from a tick bite rather than a blood transfusion . In addition, supporting laboratory data had to be provided and include at least one of the following: identification by light microscopy of intraerythrocytic babesia parasites in a peripheral blood smear, isolation of the parasite from a whole blood specimen (by inoculating hamsters [mesocricetus auratus] intraperitoneally and examining blood smears obtained weekly by tail snip for up to 2 months), demonstration of b. microti dna in a whole blood specimen by polymerase chain reaction (pcr) analysis at a reference laboratory, or demonstration of a babesia - specific antibody titer of at least 1:256 with an indirect fluorescent antibody assay for total immunoglobulin (ig) g. if only serologic data met the diagnostic criteria, the case was considered probable rather than confirmed . A previously healthy 53-year - old woman was admitted to a community hospital on june 24, 1999, because she had 1 week of fever (38.9c39.4c), rigors, a nonproductive cough, an occipital headache, and increasing malaise . Three days before her hospitalization, she started therapy with cefuroxime axetil for presumed bronchitis but did not improve . She had a> 50 pack - year history of smoking and drank two to three beers per day . She lived in burlington county (figure 1) in southcentral new jersey and had not traveled outside the county recently . Although she did not recall recent exposure to deer ticks, she occasionally had seen deer in her backyard and she gardened frequently . The eight counties in which reported cases of babesiosis were acquired from 1993 through 2001 are shaded in gray (the darker the gray, the more cases). The number of cases reported per county is shown under the name of the county . On admission to the hospital, she had a temperature of 39.2c, a blood pressure level in the 80/60 mm hg range, and otherwise unremarkable results on physical examination . She was anemic and thrombocytopenic, with elevated total bilirubin and lactate dehydrogenase values (table). On the basis of a blood smear from june 24, which showed intraerythrocytic ring forms in approximately 5% of the erythrocytes on her peripheral blood smear, treatment for babesiosis the treatment included intravenous clindamycin, 900 mg three times a day, and 650 mg oral quinine three times a day; and she was transfused with two units of packed erythrocytes . A chest radiograph showed diffuse alveolar infiltrates, which were attributed to the adult respiratory distress syndrome (ards). Normal ranges for community hospital (june 24june 27): creatinine level, 0.61.3 mg / dl; total bilirubin level, 0.21.0 mg / dl; indirect bilirubin level, 0.21.2 mg / dl; lactate dehydrogenase level, 91180 u / l . Normal ranges for the hospital of the university of pennsylvania: creatinine level, 0.61.0 mg / dl; total bilirubin level, 0.01.2 mg / dl; indirect bilirubin level, 0.0 - 1.2 mg / dl; lactate dehydrogenase level, 313618 u / l . 25% segmented neutrophils, 33% band forms, 22% lymphocytes, 2% atypical lymphocytes, 8% monocytes . Indirect bilirubin level, 1.4 mg / dl . Indirect bilirubin level, 2.1 mg / dl; serum haptoglobin level, <38 mg / dl (normal range, 60160 mg / dl); results of direct and indirect coombs test, negative . On june 28, she was transferred to the hospital of the university of pennsylvania . When admitted, her blood pressure was 84/52 mm hg, despite therapy with dopamine . She continued therapy for babesiosis for a total of 15 days (the dose of clindamycin was decreased to 600 mg three times a day on june 28). Although the level of parasitemia had decreased to 0.3% by june 29, she had ongoing hemolysis and received six more units of packed erythrocytes during her hospital stay (table). No parasites were noted on a blood smear on july 9, the last day of antibabesial therapy . She had been successfully weaned from inotropic blood - pressure support on july 2 and underwent extubation on july 4 . Additional laboratory testing at cdc provided further evidence that she was infected with b. microti . Serum specimens assayed in parallel, in serial fourfold dilutions, by indirect fluorescent antibody testing for antibody to b. microti (4), had titers of 1:1,024 (june 30, 1999) and 1:16 (july 16, 2000). In addition, pcr analysis of whole blood from june 30, 1999, by using b. microti - specific primers (5), confirmed she was infected with b. microti . Serologic testing performed at the hospital of the university of pennsylvania by enzyme immunoassay for antibody to borr . Complications during her hospitalization unrelated to babesiosis included nosocomial pneumonia, acute tubular necrosis from hypoperfusion, bilateral deep venous thromboses, pulmonary embolism, and thrombocytopenia temporally associated with the initiation of heparin therapy (table). On july 23, after 30 days in the hospital, she was sent home . The 40 cases in our analyses included the case described above, the three cases previously described by eskow et al . We did not include six other reported tick - borne cases that occurred in new jersey residents, because the laboratory data did not meet our criteria or information about the probable state in which infection was acquired was not known or provided . The number of reported cases of babesiosis increased over time (figure 2); 28 (70.0%) of the 40 cases occurred in 2000 or 2001 . The 40 cases were acquired in eight (38.1%) of the state s 21 counties (figure 1). Burlington county, on the inner coastal plain, and ocean county, on the outer coastal plain, which are neighboring counties in southcentral new jersey, accounted for 25 (62.5%) of the 40 cases; these two counties are the 7th (ocean) and 10th (burlington) most populous counties in the state . None of the cases were acquired in the northernmost or southernmost counties of new jersey . Most of the cases were in elderly persons (median age, 67 years; range, 1187 years). Over half of the cases (22 [55.0%]) were in male patients . The median date of diagnosis was july 20 (range, june 10september 9; n=36). Two patients (5.0%) died: an 86-year - old man with multisystem organ failure and an 80-year - old man with ards . However, three patients were reported to be asplenic, 18 to have recalled tick bites, 34 to have been hospitalized, and three to have had lyme disease (no details available). Underlying conditions included hiv infection in one patient, who had a cd4 count of 50; diabetes in five patients; a history of breast or prostate cancer in three patients (no details available); and a condition that led to chemotherapy in one person (no details available). Not all patients were tested with the same methods; however, 34 patients had positive blood smears; for 27 of these patients, the positive smear was the only laboratory result that met our diagnostic criteria . All three cases reported by eskow et al . Were in patients who had negative blood smears (2). One of the two patients who had whole blood inoculated into hamsters had positive results (i.e., the hamsters became parasitemic). Four patients had positive pcr results from a reference laboratory; for one of these patients, these results were the only ones that met our diagnostic criteria . Twelve patients had serologic data that met our criteria; for four patients, these data were the only ones that met our diagnostic criteria . Cdc confirmed the diagnosis of babesia infection in 11 (27.5%) of the 40 cases; specimens from the other 29 case - patients were not sent to cdc . We learned of additional babesiosis cases because they were reported to the new jersey department of health and senior services or because health - care providers contacted the centers for disease control and prevention (cdc) about the diagnosis or treatment of babesiosis . Although babesiosis is not a nationally notifiable disease, some states have made cases of babesiosis reportable . Cases became reportable in new jersey in 1985; however, reporting was discontinued in 1990 because no cases had been reported . Reporting was reinstated in 1995, and 1997 was the first year in which cases were reported to the health department . We defined a potential case of babesiosis as an infection occurring in a symptomatic person whose illness was consistent with babesiosis, most likely was acquired in new jersey, and most likely resulted from a tick bite rather than a blood transfusion . In addition, supporting laboratory data had to be provided and include at least one of the following: identification by light microscopy of intraerythrocytic babesia parasites in a peripheral blood smear, isolation of the parasite from a whole blood specimen (by inoculating hamsters [mesocricetus auratus] intraperitoneally and examining blood smears obtained weekly by tail snip for up to 2 months), demonstration of b. microti dna in a whole blood specimen by polymerase chain reaction (pcr) analysis at a reference laboratory, or demonstration of a babesia - specific antibody titer of at least 1:256 with an indirect fluorescent antibody assay for total immunoglobulin (ig) g. if only serologic data met the diagnostic criteria, the case was considered probable rather than confirmed . A previously healthy 53-year - old woman was admitted to a community hospital on june 24, 1999, because she had 1 week of fever (38.9c39.4c), rigors, a nonproductive cough, an occipital headache, and increasing malaise . Three days before her hospitalization, she started therapy with cefuroxime axetil for presumed bronchitis but did not improve . She had a> 50 pack - year history of smoking and drank two to three beers per day . She lived in burlington county (figure 1) in southcentral new jersey and had not traveled outside the county recently . Although she did not recall recent exposure to deer ticks, she occasionally had seen deer in her backyard and she gardened frequently . The eight counties in which reported cases of babesiosis were acquired from 1993 through 2001 are shaded in gray (the darker the gray, the more cases). The number of cases reported per county is shown under the name of the county . On admission to the hospital, she had a temperature of 39.2c, a blood pressure level in the 80/60 mm hg range, and otherwise unremarkable results on physical examination . She was anemic and thrombocytopenic, with elevated total bilirubin and lactate dehydrogenase values (table). On the basis of a blood smear from june 24, which showed intraerythrocytic ring forms in approximately 5% of the erythrocytes on her peripheral blood smear, treatment for babesiosis was begun on june 25 . The treatment included intravenous clindamycin, 900 mg three times a day, and 650 mg oral quinine three times a day; and she was transfused with two units of packed erythrocytes . A chest radiograph showed diffuse alveolar infiltrates, which were attributed to the adult respiratory distress syndrome (ards). Normal ranges for community hospital (june 24june 27): creatinine level, 0.61.3 mg / dl; total bilirubin level, 0.21.0 mg / dl; indirect bilirubin level, 0.21.2 mg / dl; lactate dehydrogenase level, 91180 u / l . Normal ranges for the hospital of the university of pennsylvania: creatinine level, 0.61.0 mg / dl; total bilirubin level, 0.01.2 mg / dl; indirect bilirubin level, 0.0 - 1.2 mg / dl; lactate dehydrogenase level, 313618 u / l . 25% segmented neutrophils, 33% band forms, 22% lymphocytes, 2% atypical lymphocytes, 8% monocytes . Indirect bilirubin level, 1.4 mg / dl . Indirect bilirubin level, 2.1 mg / dl; serum haptoglobin level, <38 mg / dl (normal range, 60160 mg / dl); results of direct and indirect coombs test, negative . On june 28, she was transferred to the hospital of the university of pennsylvania . When admitted, her blood pressure was 84/52 mm hg, despite therapy with dopamine . She continued therapy for babesiosis for a total of 15 days (the dose of clindamycin was decreased to 600 mg three times a day on june 28). Although the level of parasitemia had decreased to 0.3% by june 29, she had ongoing hemolysis and received six more units of packed erythrocytes during her hospital stay (table). No parasites were noted on a blood smear on july 9, the last day of antibabesial therapy . She had been successfully weaned from inotropic blood - pressure support on july 2 and underwent extubation on july 4 . Additional laboratory testing at cdc provided further evidence that she was infected with b. microti . Serum specimens assayed in parallel, in serial fourfold dilutions, by indirect fluorescent antibody testing for antibody to b. microti (4), had titers of 1:1,024 (june 30, 1999) and 1:16 (july 16, 2000). In addition, pcr analysis of whole blood from june 30, 1999, by using b. microti - specific primers (5), confirmed she was infected with b. microti . Serologic testing performed at the hospital of the university of pennsylvania by enzyme immunoassay for antibody to borr . Complications during her hospitalization unrelated to babesiosis included nosocomial pneumonia, acute tubular necrosis from hypoperfusion, bilateral deep venous thromboses, pulmonary embolism, and thrombocytopenia temporally associated with the initiation of heparin therapy (table). On july 23, after 30 days in the hospital, she was sent home . The 40 cases in our analyses included the case described above, the three cases previously described by eskow et al . We did not include six other reported tick - borne cases that occurred in new jersey residents, because the laboratory data did not meet our criteria or information about the probable state in which infection was acquired was not known or provided . The number of reported cases of babesiosis increased over time (figure 2); 28 (70.0%) of the 40 cases occurred in 2000 or 2001 . The 40 cases were acquired in eight (38.1%) of the state s 21 counties (figure 1). Burlington county, on the inner coastal plain, and ocean county, on the outer coastal plain, which are neighboring counties in southcentral new jersey, accounted for 25 (62.5%) of the 40 cases; these two counties are the 7th (ocean) and 10th (burlington) most populous counties in the state . None of the cases were acquired in the northernmost or southernmost counties of new jersey . The number of reported cases of babesiosis acquired each year, 19932001 . Most of the cases were in elderly persons (median age, 67 years; range, 1187 years). Over half of the cases (22 [55.0%]) were in male patients . The median date of diagnosis was july 20 (range, june 10september 9; n=36). Two patients (5.0%) died: an 86-year - old man with multisystem organ failure and an 80-year - old man with ards . However, three patients were reported to be asplenic, 18 to have recalled tick bites, 34 to have been hospitalized, and three to have had lyme disease (no details available). Underlying conditions included hiv infection in one patient, who had a cd4 count of 50; diabetes in five patients; a history of breast or prostate cancer in three patients (no details available); and a condition that led to chemotherapy in one person (no details available). Not all patients were tested with the same methods; however, 34 patients had positive blood smears; for 27 of these patients, the positive smear was the only laboratory result that met our diagnostic criteria . All three cases reported by eskow et al . Were in patients who had negative blood smears (2). One of the two patients who had whole blood inoculated into hamsters had positive results (i.e., the hamsters became parasitemic). Four patients had positive pcr results from a reference laboratory; for one of these patients, these results were the only ones that met our diagnostic criteria . Twelve patients had serologic data that met our criteria; for four patients, these data were the only ones that met our diagnostic criteria . Cdc confirmed the diagnosis of babesia infection in 11 (27.5%) of the 40 cases; specimens from the other 29 case - patients were not sent to cdc . Our report strengthens the evidence that new jersey is one of the eastern states in which babesiosis is endemic . In addition whether the fact that most of the reported cases occurred in southcentral and northcentral counties reflects the degree of endemicity of babesiosis in various areas of new jersey is unknown . The fact that babesiosis is endemic in new jersey is not surprising, given that lyme disease, the etiologic agent of which also is transmitted by i. scapularis, is highly endemic in new jersey (6,7) and given the geographic proximity of new jersey to areas in the northeast where babesiosis is highly endemic . In a 1996 study, of 100 i. scapularis ticks collected in hunterdon county, new jersey, 43 were infected with borr . Burgdorferi, 5 were infected with b. microti, and 2 were infected with both organisms (8). The increase in reported cases of babesiosis, which began in 1998 (figure 2) and escalated in 2000 and 2001, could indicate an increased risk of b. microti infection and illness . If true, possible reasons for the increased risk could include a growing abundance of local i. scapularis populations or the introduction of a more virulent strain of b. microti (9). However, the increased numbers of reported cases could simply represent an increased awareness of the disease and increased reporting . Even so, the 40 cases of babesiosis that we tallied probably represent only a fraction of the clinical cases of b. microti infection acquired in new jersey from 1993 through 2001 . Presumably, other symptomatic cases (as well as many more subclinical cases) occurred but were not diagnosed or reported . In fact, several other possible symptomatic cases were reported that we did not count because we received insufficient information . Also, as is commonly true for surveillance data, the amount and quality of the information provided to the health department and cdc about the cases varied widely; some of the information might have been inaccurate, and not all of the cases were confirmed by reference laboratories (e.g., not all of the blood smears that were reported as positive were reexamined by a reference laboratory). The laboratory tests cdc offers for babesiosis, when indicated, include examination of blood smears, hamster inoculation, and pcr (5) for parasitologic diagnosis and an indirect fluorescent antibody assay for total immunoglobulin for serologic diagnosis (4). Using pcr for detection of dna from babesia spp . Has not yet become a routine diagnostic method, and the analysis should be conducted by experienced reference laboratories . However, an immunoblot test for igg performed well in a recent evaluation, with a sensitivity of 96% and a specificity of 99% (10). A positive serologic result for igm (11) is insufficient for diagnosis without a positive result for igg . If the igm result is positive but the igg result is negative, a follow - up specimen should be tested . If igg seroconversion is not noted, the igm result likely was a false positive . Future serologic testing might involve recombinant and synthetic antigens (12) rather than whole parasites or soluble antigens . The case we described in detail demonstrates that babesiosis can be life threatening (1,13,14). In fact, two (5.0%) of the 40 case - patients died . In the patient we described, the following conditions developed: severe anemia, for which she was transfused with eight units of packed erythrocytes; hypotension that required inotropic support; ards, which has previously been reported (1317); and various nosocomial complications . The fact that she was ill for approximately 1 week before therapy for babesiosis was initiated might have contributed to the severity of her illness . Although she was treated successfully with clindamycin and quinine, a recent clinical trial indicated that the combination of azithromycin and atovaquone is also effective (18). However, patients with life - threatening babesiosis were excluded from the study . Severely ill patients, such as those with high levels of parasitemia, may benefit from exchange transfusion (1,19). In summary, babesiosis, a potentially serious zoonosis, is endemic in new jersey and should be considered in the differential diagnosis of patients with fever and hemolytic anemia, particularly in the spring, summer, and early fall.
|
As a professor in a clinical department, i am privileged to work with many clinician - investigator trainees . Recently, a new clinical research fellow told me that he had been reading many papers in order to decide which research project he should take . The more he reads, the more confused he feels . In fact, this challenge is not only to new fellows, but also to experienced researchers . In this issue of critical care, dr li and dr quinn and their colleagues published a research article exploring the molecular mechanisms of ventilator - induced lung injury (vili). I would like to use this interesting article as an example, to lead readers who are not experts in this field through a translational process . Mechanical force - induced signal transduction (mechano - transduction) is responsible for many physiological processes in lung development, in maintaining lung functions, and in pathological conditions related to lung diseases, such as asthma, chronic obstructive pulmonary disease (copd), and acute respiratory distress syndrome (ards), especially related to vili . However, very much like the routes in a city, both " good boys " and " bad boys " drive on the same streets . Neutrophil recruitment and activation is an important mechanism for lung tissue injury, which is mediated by a group of small molecules, namely chemokines, especially a subgroup of c - x - c chemokines . Interleukin-8 (il-8) is the best example, which has been shown to be up - regulated by mechanical forces in human lung cells . Rodents do not have the il-8 gene, but produce macrophage inflammatory protein-2 (mip-2) and other c - x - c chemokines . They further questioned that neutrophil migration is mediated by a signal pathway activated by akt (also called protein kinase b). They also used a chemical inhibitor to prevent the activation of akt in mice, prior to their exposure to high volume ventilation and/or hyperoxia . However, it is worth mentioning that the akt pathway is also critically important for proliferation, survival and migration of cell types other than neutrophiles . Based on their recent studies, these researchers suspected that endothelial nitric oxide synthase (enos) activation is also part of the mechanisms responsible for vili . They demonstrated increased phosphorylation of enos and also demonstrated that nitric oxide synthase (nos) inhibitor could attenuate vili . Increased nos expression and/or activity have been shown in multiple lung injury models and clinical samples . The outcome of no related clinical studies, however, is controversial, which warns us for further investigation . As a clinician you may ask why 30 ml / kg of tidal volume was used in this study and you may note that oxygen was used for ventilation . First of all, as experimental biologists, we always try to create a condition that can give definite answers . For example, after serum starvation, add a growth factor into the culture medium to initiate a signal transduction, or start mechanical stretch on statically cultured cells . These protocols help us to reveal the potential of a biological stimulus on a particular biological process . This strategy has also been adapted to animal studies . On the other hand, this may also explain why many experimental findings did not translate to good clinical practices . As a bench scientist, one should try to simulate clinical conditions as much as possible . Recently, clinically relevant models have been emphasized . After going through this interesting paper critically, what have we learnt? First, good literature review may lead to proposal of a testable hypothesis in vili . Secondly, the mechanical force - induced signal transduction by injurious ventilation (high tidal volume and high oxygen tension) could activate pathways that are important for normal functions . Last but not the least, awareness of the significance and limitation of experimental data are crucial for our knowledge translation . Ards = acute respiratory distress syndrome; copd = chronic obstructive pulmonary disease; enos = endothelial nitric oxide synthase; il-8 = interleukin-8; mip-2 = macrophage inflammatory protein-2; no = nitric oxide; nos = nitric oxide synthase; vili = ventilator - induced lung injury.
|
A review of the studies published in the last three decades between 1980 and 2013 reporting on prevalence of childhood overweight and obesity (age 1 - 18 yr) in india was conducted using a systematic approach . As the aim was to present the current scenario in this area, we restricted our search to 1980 and beyond . Literature search was done in available scientific public domains such as google scholar, pubmed, indmed and cochrane systematic reviews using key words such as childhood and adolescent overweight, childhood obesity, epidemiology in india and globally, body mass index (bmi), trend and prevalence . Cross references from identified articles were also used to expand the coverage . Also, websites of official agencies such as iotf, who and centres for disease control and prevention (cdc) were accessed for related information . The first two authors critically reviewed the studies to decide if these could be included based on the criteria detailed in the flow chart indicating the review process (fig . 1). Prevalence in the age group of 1 - 5 yr were obtained only from national surveys; most studies from india reported only on undernutrition in this age group . Finally, 52 studies were selected and were grouped based on the age groups studied and presented as childhood (1 - 12 yr), adolescent (10 - 18 yr) and childhood and adolescent (studies inclusive of both age groups) obesity trends in india according to the year in which that study was published . All reported prevalences were taken directly from the study and no recalculations were performed . Due to the lower obesity prevalence rates in rural or government schools, these were excluded only from the trend analysis (fig . 2) but have been reported in the tables . Thus, to plot the figure demonstrating combined childhood and adolescent obesity trends, only urban prevalences from 42 studies (49 datasets as 7 studies reported multiple datasets in the form of repeat surveys) from 1981 to 2013 were used and the year the study was conducted in was considered for analysis; in case, this was not mentioned, the publication year was included . Flow chart indicative of the review process . Box plots indicating overweight (a), obesity (b) and combined (c) trends in indian children and adolescents (1981 - 2013). Source: refs 91011121314151617181920212223242526272829303132333435363738394041424344454647484950 for each time period, the median of the reported values for the individual studies was calculated along with the quartile limits . Trends for overweight, obesity and combined prevalence in children and adolescents were calculated and presented using box plots (fig . The box plot included the 25 and 75 percentiles and data labels plotted were median values with the minimum and maximum . When multiple cut - offs were used in the same study, only iotf - cole et al 2000 criteria51 were considered to prevent duplication of study data . Also, two outliers5253 were not included in this trend analysis but shown in table i. we further looked at the distribution of prevalence of obesity by sex and area of residence (rural / urban). Childhood (1 - 12 yr) obesity trends in india prior to 2001, prevalence studies reported more on obesity (5 studies) rather than overweight (2 studies) while post-2001, there were almost equal numbers of reported values for both (45 for obesity versus 41 for overweight). Due to this drop in the sample size and number of studies conducted, plotting separate trend graphs for children and adolescents did not show a good trend . Therefore, the results are presented for all 52 studies combined with a total count of 435162 participants . Overweight numbers were available for 43 studies comprising 353738 participants while obesity numbers were reported for 50 studies with 431262 participants . Overall, 52 studies were included based on the defined inclusion and exclusion criteria (fig . 3 . The studies appear to be spread across the country with 16 of 28 states being covered by at least one survey . 3 shows the lack of prevalence data on childhood obesity from many northern and north - eastern states of india . Map of india indicating prevalence (%) of childhood obesity in various states and cities . The most commonly used definition for childhood overweight and obesity in india was iotf - cole et al51 (28 studies) followed by who6162 (10 studies) and cdc63 (8 studies). Others included gomez classification59, and that of must et al60 and rosner et al72 . India specific cut - points were found in the agarwal charts 199273, 200174 [used by indian academy of paediatrics (iap) for growth monitoring in children and adolescents], eliz health path for adolescents and adults (ehpa)75, pandey et al76 cut - points for asian indian adolescents and the data provided by khadilkar et al77 . Of the 52 studies reported in this review, six studies used multiple cut - points . Studies reporting prevalence of childhood and adolescent obesity in india were included as part of table i (1 - 12 yr), table ii (10 - 17 yr) and table iii (combined age group) in accordance to the year the study was published . Adolescent (10 - 18 yr) obesity trends in india childhood & adolescent obesity trends in india (studies inclusive of both age groups) children (table i): the key studies are from the national family health surveys (nfhs) and national nutrition monitoring bureau (nnmb) surveys5455565758 . Fives the prevalence of obesity was below 2 per cent in all the studies . In children above 5 yr, the prevalence of obesity varied between 2 to 8 per cent . Overweight rates were around two times higher and seem to be more in northern and eastern india than in southern india . One study from srinagar52 reported a high prevalence rate of 25 per cent, probably due to the smaller numbers studied and being from affluent families . Adolescent (table ii): the largest study in this age group was the global school based survey in 2007 on 8130 students . Overall, overweight prevalence varied between 3 to 24.7 per cent and obesity ranged from 1.5 to 14 per cent in these 28 studies highlighting the wide variability in their prevalence in india . In most studies, slightly higher prevalence rates were reported in boys, compared to girls . Combined (table iii): a total of 17 studies reported prevalence of overweight / obesity in childhood and adolescence but were combined in such a way that we could not separate the two . The least prevalence of obesity was reported from nagaland (2.3%) and the maximum from new delhi (29%) and both used the iotf - cole et al criteria51 . Sex / gender: khadilkar et al17 reported on affluent indian 2 to 17 yr old children and showed that the prevalence of overweight and obesity was 18.2 per cent by the iotf classification while it was 23.9 per cent using who cut - points and the prevalence was higher in boys . Chhatwal et al18 reported overall prevalences of childhood obesity and overweight in punjab as 11.1 and 14.2 per cent, respectively and again a higher prevalence in boys (12.4 vs 9.9%, 15.7 vs 12.9%). Sidhu and colleagues19 from amritsar reported overweight in 10 per cent among boys and 12 per cent among girls and obesity in 5 per cent boys and 6 per cent in girls . Kotian and co - workers78 reported that the overall prevalences of overweight and obesity were 9.3 and 5.2 per cent, respectively among boys and 10.5 and 4.3 per cent among girls, in a semi urban city in karnataka . Socio - economic status (ses): marwaha et al20, using iotf classification showed that among children in the upper ses the prevalences of overweight and obesity were 17 and 5.6 per cent in boys and 19 and 5.7 per cent in girls, respectively, whereas in the lower ses the values were 2.7 and 0.4 per cent in boys and 2.1 and 0.5 per cent in girls, respectively . Goyal and colleagues9 from gujarat found the prevalence of obesity to be higher in upper ses group as compared to the middle ses . A recent study based on 18,955 school children in chennai21, reported the prevalence of overweight to be 17 per cent while that of obesity was 4.4 per cent among private school children . Conversely, among the government school children the values were 3.1 and 0.5 per cent, respectively using the cole cut - points . In another study from karimnagar, hyderabad, the prevalences of overweight and obesity were 11.9 and 2.7 per cent, respectively among 10 - 16 yr olds22 . While obesity was more in higher ses, factors like family size, residence and parent's education did not contribute to obesity . Place of residence: in a report from kerala23 the prevalence of overweight and obesity among children was shown to increase in urban as well as rural areas . This study reported high prevalence of obesity and overweight among boys especially in urban areas whereas underweight was more common in girls especially in rural areas . Premanath and co - workers24 from mysuru surveyed 43,152 school children from private and government schools using agarwal charts74 . They reported the prevalences of obesity, overweight and underweight to be 3.4, 8.5 and 17.2 per cent, respectively among 5 - 7 yr old children with higher prevalence of obesity seen in private schools . Another study from mysuru using the who cut - points reported obesity prevalence among urban - rural adolescents to be 9.0 and 0.8 per cent, respectively64 . A study from surat, gujarat, showed an increase in prevalence of overweight / obesity in urban males aged 14 - 17 yr25 . These data showed that in india, obesity in children was associated with affluence but the exact prevalence varied based on the definitions used . However, with the rapid epidemiological transition occurring in large metropolitan cities and peri - urban areas, recent studies have shown a steady increase in prevalence among government school children2165 . Despite the limitations related to cut - points and definitions, when 42 prevalence studies (49 datasets) from india were plotted to observe the trends for combined overweight and obesity in indian children and adolescents over the last decade 2). The pooled data after 2010 estimated a combined prevalence of 19.3 per cent of childhood overweight and obesity which was significantly (two - sample z - test, p<0.01) higher than the earlier prevalence of 16 per cent reported in 2001(fig . However, these rates tend to vary widely (as also indicated by the length of the box plots) depending on the cut points used, the sampling frame and time period of the survey596372747577 . A large variation was noted for combined prevalence (overweight + obesity) values reported from different studies ranging from 4.3 to 40.9 per cent . If further stratified by the cut - offs used, looking at studies using iotf cut - offs, the combined prevalence range was 6.98 to 40.9 per cent . Region - wise stratification was done on the basis of the region where the studies were performed, excluding studies that were done across multiple regions . The median value for the combined prevalence based on the number of studies reported from that particular region showed that the combined prevalence was higher in north (20.7%, n = 15) compared to south (15.1%, n=16). The combined obesity prevalence from east india (22.0%, n=4) and west (19.7%, n = 8) could not be used to make a significant conclusion due to the smaller number of studies reported from these areas . We also looked at studies which have been done in the same area with a time interval to assess the trends . Subramanyam et al26 reported on obesity trends in adolescent girls in private schools in chennai and showed that in 1981, overweight was present in 9.6 per cent and obesity in 5.9 per cent of the girls while in 1998, overweight was seen in 9.7 per cent and obesity in 6.2 per cent of the girls . A similar study from the same city in 200227 showed that among children attending private schools the prevalence of overweight / obesity had almost doubled - 17.8 per cent in boys and 15.8 per cent in girls . Gupta et al28 reported in girls aged 11 - 17 yr an unchanged trend in prevalence of overweight (10.9% in 1997, 10.5% in 2003) and obesity (5.5% in 1997, 6.7% in 2003) based on a population - based birth cohort in new delhi . This could be attributed to tracking trends of a cohort study whereas both the studies done in chennai were cross - sectional and in a school based setting . The most commonly used definition for childhood overweight and obesity in india was iotf - cole et al51 (28 studies) followed by who6162 (10 studies) and cdc63 (8 studies). Others included gomez classification59, and that of must et al60 and rosner et al72 . India specific cut - points were found in the agarwal charts 199273, 200174 [used by indian academy of paediatrics (iap) for growth monitoring in children and adolescents], eliz health path for adolescents and adults (ehpa)75, pandey et al76 cut - points for asian indian adolescents and the data provided by khadilkar et al77 . Of the 52 studies reported in this review, six studies used multiple cut - points . Studies reporting prevalence of childhood and adolescent obesity in india were included as part of table i (1 - 12 yr), table ii (10 - 17 yr) and table iii (combined age group) in accordance to the year the study was published . Adolescent (10 - 18 yr) obesity trends in india childhood & adolescent obesity trends in india (studies inclusive of both age groups) children (table i): the key studies are from the national family health surveys (nfhs) and national nutrition monitoring bureau (nnmb) surveys5455565758 . These surveys covered under - five children only . In the older age groups, the study by preetam et al11 from puducherry was the largest . In under - fives the prevalence of obesity was below 2 per cent in all the studies . In children above 5 yr, the prevalence of obesity varied between 2 to 8 per cent . Overweight rates were around two times higher and seem to be more in northern and eastern india than in southern india . One study from srinagar52 reported a high prevalence rate of 25 per cent, probably due to the smaller numbers studied and being from affluent families . Adolescent (table ii): the largest study in this age group was the global school based survey in 2007 on 8130 students . Overall, overweight prevalence varied between 3 to 24.7 per cent and obesity ranged from 1.5 to 14 per cent in these 28 studies highlighting the wide variability in their prevalence in india . In most studies, slightly higher prevalence rates were reported in boys, compared to girls . Combined (table iii): a total of 17 studies reported prevalence of overweight / obesity in childhood and adolescence but were combined in such a way that we could not separate the two . The least prevalence of obesity was reported from nagaland (2.3%) and the maximum from new delhi (29%) and both used the iotf - cole et al criteria51 . Sex / gender: khadilkar et al17 reported on affluent indian 2 to 17 yr old children and showed that the prevalence of overweight and obesity was 18.2 per cent by the iotf classification while it was 23.9 per cent using who cut - points and the prevalence was higher in boys . Chhatwal et al18 reported overall prevalences of childhood obesity and overweight in punjab as 11.1 and 14.2 per cent, respectively and again a higher prevalence in boys (12.4 vs 9.9%, 15.7 vs 12.9%). Sidhu and colleagues19 from amritsar reported overweight in 10 per cent among boys and 12 per cent among girls and obesity in 5 per cent boys and 6 per cent in girls . Kotian and co - workers78 reported that the overall prevalences of overweight and obesity were 9.3 and 5.2 per cent, respectively among boys and 10.5 and 4.3 per cent among girls, in a semi urban city in karnataka . Socio - economic status (ses): marwaha et al20, using iotf classification showed that among children in the upper ses the prevalences of overweight and obesity were 17 and 5.6 per cent in boys and 19 and 5.7 per cent in girls, respectively, whereas in the lower ses the values were 2.7 and 0.4 per cent in boys and 2.1 and 0.5 per cent in girls, respectively . Goyal and colleagues9 from gujarat found the prevalence of obesity to be higher in upper ses group as compared to the middle ses . A recent study based on 18,955 school children in chennai21, reported the prevalence of overweight to be 17 per cent while that of obesity was 4.4 per cent among private school children . Conversely, among the government school children the values were 3.1 and 0.5 per cent, respectively using the cole cut - points . In another study from karimnagar, hyderabad, the prevalences of overweight and obesity were 11.9 and 2.7 per cent, respectively among 10 - 16 yr olds22 . While obesity was more in higher ses, factors like family size, residence and parent's education did not contribute to obesity . Place of residence: in a report from kerala23 the prevalence of overweight and obesity among children was shown to increase in urban as well as rural areas . This study reported high prevalence of obesity and overweight among boys especially in urban areas whereas underweight was more common in girls especially in rural areas . Premanath and co - workers24 from mysuru surveyed 43,152 school children from private and government schools using agarwal charts74 . They reported the prevalences of obesity, overweight and underweight to be 3.4, 8.5 and 17.2 per cent, respectively among 5 - 7 yr old children with higher prevalence of obesity seen in private schools . Another study from mysuru using the who cut - points reported obesity prevalence among urban - rural adolescents to be 9.0 and 0.8 per cent, respectively64 . A study from surat, gujarat, showed an increase in prevalence of overweight / obesity in urban males aged 14 - 17 yr25 . These data showed that in india, obesity in children was associated with affluence but the exact prevalence varied based on the definitions used . However, with the rapid epidemiological transition occurring in large metropolitan cities and peri - urban areas, recent studies have shown a steady increase in prevalence among government school children2165 . Despite the limitations related to cut - points and definitions, when 42 prevalence studies (49 datasets) from india were plotted to observe the trends for combined overweight and obesity in indian children and adolescents over the last decade, it was seen to be increasing (fig . 2). The pooled data after 2010 estimated a combined prevalence of 19.3 per cent of childhood overweight and obesity which was significantly (two - sample z - test, p<0.01) higher than the earlier prevalence of 16 per cent reported in 2001(fig . However, these rates tend to vary widely (as also indicated by the length of the box plots) depending on the cut points used, the sampling frame and time period of the survey596372747577 . A large variation was noted for combined prevalence (overweight + obesity) values reported from different studies ranging from 4.3 to 40.9 per cent . If further stratified by the cut - offs used, looking at studies using iotf cut - offs, the combined prevalence range was 6.98 to 40.9 per cent . Region - wise stratification was done on the basis of the region where the studies were performed, excluding studies that were done across multiple regions . The median value for the combined prevalence based on the number of studies reported from that particular region showed that the combined prevalence was higher in north (20.7%, n = 15) compared to south (15.1%, n=16). The combined obesity prevalence from east india (22.0%, n=4) and west (19.7%, n = 8) could not be used to make a significant conclusion due to the smaller number of studies reported from these areas . We also looked at studies which have been done in the same area with a time interval to assess the trends . Subramanyam et al26 reported on obesity trends in adolescent girls in private schools in chennai and showed that in 1981, overweight was present in 9.6 per cent and obesity in 5.9 per cent of the girls while in 1998, overweight was seen in 9.7 per cent and obesity in 6.2 per cent of the girls . A similar study from the same city in 200227 showed that among children attending private schools the prevalence of overweight / obesity had almost doubled - 17.8 per cent in boys and 15.8 per cent in girls . Gupta et al28 reported in girls aged 11 - 17 yr an unchanged trend in prevalence of overweight (10.9% in 1997, 10.5% in 2003) and obesity (5.5% in 1997, 6.7% in 2003) based on a population - based birth cohort in new delhi . This could be attributed to tracking trends of a cohort study whereas both the studies done in chennai were cross - sectional and in a school based setting . India is a fast growing economy, currently undergoing major epidemiological, nutritional and demographic transitions . These transitions tend to promote obesity in all age groups . However, when one looks at the prevalence of obesity alone, there is no clear secular trend . The median values ranged from 5.5 per cent in 2001 - 2005 to 4.0 per cent in 2006 - 2010 and then rose to 4.6 per cent since 2010 . This suggests that the prevalence of obesity has probably been somewhat constant over the last couple of decades . The prevalence of overweight increased from 9.7 per cent prior to 2001 to 13.9 per cent in studies reported after 2010 . The combined trend followed a similar pattern increasing from 15.9 per cent prior to 2001 to 16.3 per cent from 2001 - 2005 . The value then increased to 17.4 per cent in the 2006 - 2010 period, finally reaching 19.3 per cent in studies reported after 2010 . Hence, there was a trend of increase in overweight among children / adolescents in india . The criteria used for diagnosis of obesity in children and adolescents in developing countries like india have been based on american and european bmi standards51 . In these standards, the> 85 percentile for overweight and> 95 percentile for obesity have been derived from the data from national center for health statistics (nchs)60 and national health and nutrition examination survey (nhanes)79 in usa or from studies in western european countries where bmi> 95 percentile corresponds to> 130 per cent ideal body weight and bmi of> 30 kg / m(ref 8). The cdc growth curves have been developed from an apparently overweight population80 . In an effort to overcome this drawback, cole et al51 used data from several european and asian countries to determine childhood bmi cut - points that corresponded to adult bmi of 25 and 30 kg / m . This criterion has also been adopted by the iotf . However, two studies conducted in india6681 showed the iotf reference classified participants as having a lower weight . Both the studies concluded that the cole criteria were not suitable for indian and south asian children . The who has been persuading paediatricians and governments all over the world to use the who growth charts for identifying underweight and overweight80 . De onis and group82 thus came up with the who 2007 age and gender specific bmi cut - offs as a global standard . In children selected from across the globe it was seen that they grew at an astonishingly consistent pattern up to the age of five years, suggesting that there may not be ethnic differences in the growth pattern of babies and children83 . However, it is likely that the who cut - off will result in higher overweight and or obesity rates1780 . One important limitation of this study was that the trend was plotted using reported prevalence rates which in turn were calculated using various cut - offs . To better understand and compare childhood obesity trends, we need age, gender and country or ethnic specific cut - points from age six onwards to 18 yr to uniformly define childhood overweight and obesity . Also, overweight and obesity studies from important states like haryana, himachal pradesh, uttarkhand, bihar, jharkand and six north - eastern states could not be found in literature . Five studies conducted within the years 1992 - 2006 provided national estimates for pre - school children but many used varying cut - points for overweight and obesity . This practical issue of interpreting the various cut - points is a major obstacle in understanding secular trends in childhood obesity not just in india but also worldwide . A major strength (which may also be interpreted by some as a limitation) of this study was that we included all reported overweight / obesity prevalence studies that were accessible through our comprehensive search strategy . As we aimed to report specifically on data from india we also included reports available as conference proceedings or in indian journals (may not be high impact and indexed). Thus, bearing in mind these limitations, the current available data on childhood overweight and obesity need to be interpreted with caution . One important limitation of this study was that the trend was plotted using reported prevalence rates which in turn were calculated using various cut - offs . To better understand and compare childhood obesity trends, we need age, gender and country or ethnic specific cut - points from age six onwards to 18 yr to uniformly define childhood overweight and obesity . Also, overweight and obesity studies from important states like haryana, himachal pradesh, uttarkhand, bihar, jharkand and six north - eastern states could not be found in literature . Five studies conducted within the years 1992 - 2006 provided national estimates for pre - school children but many used varying cut - points for overweight and obesity . This practical issue of interpreting the various cut - points is a major obstacle in understanding secular trends in childhood obesity not just in india but also worldwide . A major strength (which may also be interpreted by some as a limitation) of this study was that we included all reported overweight / obesity prevalence studies that were accessible through our comprehensive search strategy . As we aimed to report specifically on data from india we also included reports available as conference proceedings or in indian journals (may not be high impact and indexed). Thus, bearing in mind these limitations, the current available data on childhood overweight and obesity need to be interpreted with caution . The present analysis shows that overweight and obesity rates in children and adolescents are increasing not just among the higher socio - economic groups but also in the lower income groups where underweight still remains a major concern . This suggests the need for a balanced and sensitive approach addressing economic and nutrition transitions to effectively tackle this double burden paradox in india.
|
Dyspnea is the aversive and threatening cardinal symptom in prevalent diseases such as asthma and chronic obstructive pulmonary disease (copd) and associated with great individual and socioeconomic burden . In chronic respiratory conditions the adequate perception of dyspnea plays a key role as it has a strong influence on health behavior and course of disease . Notably, the perception of dyspnea is not tightly related to objective lung function but is modulated by cognitive and affective factors [36]. The few available neuroimaging studies investigating the neural processing of dyspnea [714] a dual pathway model has been suggested [15, 16] with one pathway including ventroposterior thalamic areas and sensorimotor cortices processing the sensorimotor aspects of dyspnea . The second pathway including medial - dorsal thalamic areas, insula, amygdala, and cingulate cortex is believed to process the affective aspects of dyspnea . Of all these areas the paralimbic insula with its implication in interoceptive and emotion - related processing seems to play a key role [4, 11, 16, 17]. Notably, recent studies have demonstrated that negative emotions are related not only to increased perception but also to changes in the neural processing of dyspnea . Patients suffering from chronic dyspnea tend to avoid discomfort by reducing daily - life physical activities . In particular the fearful anticipation of dyspnea has been hypothesized to lead up to this spiral of decline . Indeed, recent studies demonstrated that the anticipation of dyspnea is associated with increased physiological fear responses, especially in anxious individuals . Although the fearful anticipation of dyspnea might play a fundamental role for disease progression the underlying brain processes have rarely been studied . Investigations on the anticipation of pain, a similarly aversive bodily sensation, indicate that pain - sensitive areas are already activated during pain anticipation [2325]. Moreover, brain activation during pain anticipation predicts and influences the subsequent perception and neural processing of pain [2729]. Anticipatory changes of brain function in areas with high importance for emotion processing such as insula, anterior cingulate cortex (acc), amygdala, and midbrain / periaqueductal gray (pag) were particularly relevant [26, 30, 31]. If brain activation during the anticipation of dyspnea would indeed influence and shape subsequent dyspnea perception, this might be particularly relevant for a better understanding of dyspnea avoidance behavior in patients suffering from chronic dyspnea and for the development of tailored treatment strategies . Therefore, we used functional magnetic resonance imaging (fmri) to investigate the brain processes underlying the anticipation of resistive - load - induced dyspnea in healthy volunteers . Specifically, we tested the hypotheses that the anticipation of dyspnea is processed in brain areas related to the perception of dyspnea and would involve prominent activations in emotion - related areas . Moreover, we hypothesized that brain activation during dyspnea anticipation would relate to brain activation during subsequent dyspnea perception . We recruited 46 healthy subjects without history of respiratory disease from a large database of genotyped individuals (table 1). Genotype related differences concerning the neural processing of dyspnea as well as habituation effects have been reported elsewhere [32, 33] while the current analyses specifically focus on anticipatory processes . All data were collected on one day and normal lung function (forced expiratory volume in one second in% predicted> 80%) was confirmed by standard spirometry on the day of the experiment . Written informed consent was obtained prior to the study . The study protocol was approved by the ethics committee of the medical association hamburg (pv3662). Volunteers breathed through a face mask connected with an mri compatible pneumotachograph (zan 600 unit, zan messgerte gmbh, oberhulba, germany). The set - up contained ports for recording of end - tidal co2 pressure (petco2) and peak inspiratory mouth pressure (pi) and a two - way nonrebreathing valve . The inspiratory port of the valve was connected to a 2.6 m tube for the easy manual introduction and removal of mr - compatible resistive loads in the scanner environment by the experimenter . This breathing circuit allowed continuous measurements of respiratory parameters including petco2, peak inspiratory pressure, tidal volume (vt), breathing frequency (f), minute ventilation (ve), and inspiratory time (ti). We explained dyspnea to our participants as a sensation of difficult and uncomfortable breathing . In a pretest subjects were placed in a supine position and presented with inspiratory resistive loads of increasing magnitude . Each load was presented for 24 s and dyspnea intensity subsequently rated on a borg - scale (0 = not noticeable to 10 = maximally imaginable). Load magnitude was increased until subjects reliably reported a sensation of severe dyspnea (borg score 5). The respective load was then used to induce severe dyspnea during scanning (mean load resistance = 2.23 kpa / l / s, sd = 1.18). For the baseline condition of mild dyspnea the smallest resistive load that was reliably rated as different from unloaded breathing was used (mean load resistance = 0.25 kpa / l / s, sd = 0.18). Subjects learned the association of colored cues in the shape of a cross and experimental conditions both during a computer - based standardized instruction outside the scanner and during a short test run within the scanner where subjects were also acquainted with the button response system . Thus, subjects were well familiar with the cue, stimulus association prior to the acquisition of functional mri data . Immediately after pretest and standardized instructions, subjects entered a 3-tesla trio - magnetom scanner (siemens, medical solutions, erlangen, germany) with the face mask tightly fitted . Visual cues and borg - scales were projected into the scanner bore via a mirror and condition markers were sent to zan - system using presentation software (neurobehavioral systems, inc ., subjects were presented with the visual color - coded cue for either mild or severe dyspnea followed by the respective load (figure 1). Each anticipatory period lasted for 6 s. then the cue, a thin cross, turned into a solid cross and the preselected load was introduced manually for 24 s as in our previous fmri studies using similar stimuli [11, 12]. Each load was followed by two borg rating scales: one on dyspnea intensity and one on dyspnea unpleasantness during the preceding block . Following the final dyspnea ratings subjects were presented with two additional borg - scales asking to indicate the level of fear experienced on average during the cue conditions (anticipation) of mild and severe dyspnea, respectively (figure 1). Immediately following the brain scan subjects rated the perceived quality of dyspnea on a verbal descriptor list outside the scanner . Imaging was performed on a 3-tesla trio - magnetom scanner (siemens, medical solutions, erlangen, germany) using a standard 32-channel head - coil . For each data volume we acquired 48 continuous axial - slices in descending order with 2 2 mm in - plane resolution, 2 mm slice thickness, and a 1 mm gap using t2-weighted parallel echoplanar imaging (tr = 2870 ms, te = 25 ms, flip angle = 80, and field of view = 208 208 mm) with grappa acceleration (r = 2). Depending on the time spent on ratings subjects needed 1318 min to complete the protocol . Following fmri, we acquired a high - resolution t1-weighted structural brain scan using a standard mp - rage sequence (1 1 1 mm spatial resolution, tr = 2300 ms, te = 2.98 ms, flip angle = 9, and field of view = 256 256, 240 slices). Means of intensity, unpleasantness, and anticipatory fear ratings were compared between mild and severe dyspnea conditions using paired t - tests . Respiratory parameters for each block and condition were analyzed as dependent variables in separate one - way repeated measures anovas across the four conditions (anticipation mild, mild dyspnea, anticipation severe, severe dyspnea) followed by bonferroni - corrected paired t - tests to further explore significant main effects . Analyses were calculated with spss 20.0 software (spss inc ., chicago, il) using a significance level of p <0.05 . All steps of fmri data preprocessing and statistical analysis were carried out using spm8 (http://www.fil.ion.ucl.ac.uk/spm/), with the exception of noise - correction, which was carried out using fsl - melodic 3.0 . From the ten presented blocks of each condition, the first two blocks of each condition (i.e., 2 anticipation mild, 2 mild dyspnea, 2 anticipation severe, and 2 severe dyspnea) served as adaptation phase and did not enter the analyses . A custom template within standard space was created from the t1 images of all participants using the dartel - protocol implemented within spm8 . After normalization to the custom - made t1-template using linear and nonlinear transformations, noise was identified based on a probabilistic independent component analysis . Preprocessed data were whitened and projected into a 40-dimensional subspace using principal component analysis and further decomposed into sets of vectors that describe signal variation across the temporal domain (time courses) and across the spatial domain (spatial maps) by optimizing for non - gaussian spatial source distributions . Each component was categorized as either function - related (resting - state networks or paradigm related) or noise - related (e.g., noise due to respiration, cardiac activity, motion, or scanner drifts) by considering the spatial pattern, the time course, and the power distribution following a heuristic described by kelly et al . . Two independent raters showed high interrater agreement (96.6%, cohen's kappa = 0.8). Noise - corrected functional data were smoothed using an 8 8 8 mm full - width at half - maximum gaussian filter . For statistical analysis data were high - pass filtered with a 128 s cut - off, while serial correlations were accounted for by using an autoregressive model . Data modeling on the first level involved separate regressors for each condition (cue mild, mild dyspnea, cue severe, severe dyspnea, and ratings) based on the canonical haemodynamic response function implemented in spm8 . On the subject - level we contrasted cue severe with cue mild and severe with mild resistive - load - induced dyspnea to extract brain areas that show more activation during the anticipation and perception of severe versus mild dyspnea, respectively . These two contrast images per subject were then entered into separate random - effects group analyses . Next, we investigated how dyspnea - related brain areas that also showed activation during dyspnea anticipation interacted with other brain areas during the anticipation of severe as compared to mild dyspnea . For these psychophysiological interactions (ppi), we extracted the average individual time courses from a volume centered on the peak voxel of the (anticipation severe versus anticipation mild) contrast for each of the investigated areas (left insula, parietal operculum, and cerebellum, see results) and used the anticipation of severe versus mild dyspnea as modulatory experimental factor . Given the assumed prominent role of the insular cortex in processing the affective qualities of perceived dyspnea [11, 16, 39, 40], we investigated the influence of brain activation during dyspnea anticipation on individual average right insular activation during the subsequent perception of resistive - load - induced dyspnea . Individual parameter estimates from the perception contrast (severe dyspnea versus mild dyspnea) served as covariate for the anticipation contrast (anticipation severe dyspnea versus anticipation mild dyspnea). Finally, we were interested how anticipatory fear is related to anticipatory brain activation by using individual ratings of anticipatory fear (fear during anticipation of severe dyspnea minus fear during anticipation of mild dyspnea) as covariate for the anticipation contrast (anticipation of severe dyspnea versus anticipation of mild dyspnea). For statistical inference on our results, we used a two - step approach: first, we tested for significantly increased activation throughout the entire brain exceeding a whole - brain family - wise error corrected threshold of p <0.05 within a cluster of more than 30 contiguous voxels . For the second analysis we chose the following bilateral regions of interest (rois): insula, anterior cingulate cortex, amygdala, and a midbrain - region including the pag . Bilateral masks for insula, anterior cingulate cortex, and amygdala were generated from the automated anatomical labeling (aal) template described by tzourio - mazoyer et al . . A midbrain roi centered on pag was defined using an 8 mm sphere around the average coordinates for pag activation reported by linnman et al . . The selection of these rois was based on results of previous studies on the anticipation of aversive stimuli including pain [26, 30, 31, 4345]. Activation within each roi was considered significant, if exceeding a threshold of p <0.05 after family - wise error correction within the roi . As expected, post hoc t - tests showed significantly increased peak inspiratory mouth pressure and inspiratory time, as well as decreased breathing frequency during severe compared to mild dyspnea . During the two anticipation periods subjects showed similar breathing patterns with no significant differences in respiratory parameters except for petco2, which was slightly lower during the anticipation of severe as compared to mild dyspnea . Similarly, subjective dyspnea ratings confirmed successful induction of mild and severe dyspnea, respectively (figure 2). Ratings for intensity and unpleasantness of resistive - load - induced dyspnea were significantly higher during severe (mean / sd = 4.6/1.3 and 3.5/1.6, resp .) Than during mild dyspnea (mean / sd = 0.8/0.5 and 0.5/0.6, resp . ). Likewise, the anticipatory fear was significantly stronger for severe as compared to mild dyspnea (mean / sd = 2.7/2.5 and 0.4/0.8, resp . ). Verbal descriptor ratings revealed that resistive - load - induced dyspnea was mainly perceived as increased work and effort of breathing . When contrasting the perception of severe dyspnea with mild dyspnea the whole - brain analysis confirmed the activation of a bilateral cortical network with activation peaks in pre- and postcentral cortices, sma, parietal opercular cortex, cerebellum, and right insular cortex (table 3). The roi - based analysis yielded additional significant activation of the left insula (figure 3(a), table 3). For anticipation of severe dyspnea versus anticipation of mild dyspnea the whole - brain analysis yielded significant activation that localized to the bilateral occipital pole and the left parietal operculum and cerebellum (table 4). Further activation was found in bilateral insular cortex, which proved significant for the left anterior insular cortex in the roi - based analysis (figure 3(b), table 4). Activation during dyspnea anticipation and dyspnea perception showed substantial overlap within the parietal operculum and the cerebellum (6th cerebellar lobule), while insular activation during dyspnea anticipation was more anterior compared to insular activation during dyspnea perception (figure 3(c)). Next, we investigated the interactions between anterior insula, parietal operculum, and the 6th cerebellar lobule with other brain areas during the anticipation of dyspnea using ppis . However, the roi - based approach showed significantly increased interactions of left anterior insula and parietal operculum during dyspnea anticipation with the right insular cortex and the acc (figures 4(a) and 4(b)). The left 6th cerebellar lobule showed a significantly increased interaction with bilateral amygdala (figure 4(c)). Furthermore, we looked at the relationship of right insular activation during dyspnea perception with anticipatory brain activation . The roi - based analysis showed that right insular activation during dyspnea perception was significantly correlated with activation in the midbrain / pag during the anticipation of severe versus mild dyspnea (figure 5(a)). Ratings of anticipatory fear revealed a significant positive correlation with anticipatory brain activation within acc and right insular cortex in the roi - based analysis (figure 5(b)). The present study investigated brain activations associated with the anticipation and perception of resistive - load - induced dyspnea in healthy subjects . Our analyses confirmed the involvement of a previously described set of brain areas for the perception of dyspnea [4, 16, 17]. This network included sensorimotor areas (pre- and postcentral gyri, sma, and parietal operculum), bilateral insular cortex, and the cerebellum . Importantly, within the insular, parietal opercular, and cerebellar cortex activation was already increased during the anticipation of dyspnea . Anticipatory and dyspnea - related activation overlapped within parietal operculum and cerebellum, while activation within the insular cortex was more anterior during anticipation as compared to perception of resistive - load - induced dyspnea . During the anticipation of dyspnea, left anterior insula and parietal operculum showed increased connectivity with acc and right insular cortex, while the cerebellum showed increased interaction with the bilateral amygdala . Notably, midbrain / pag activation during dyspnea anticipation correlated with right insular activation during the subsequent perception of dyspnea . Finally, activation in the right insular cortex and acc during the anticipation of dyspnea showed a significant positive correlation with anticipatory fear . Taken together, the present study reveals prominent activation in several emotion - related brain areas during the anticipation of resistive - load - induced dyspnea, which were paralleled by increased anticipatory fear . Thus, both behavioral and functional brain data underline the relevance of affective processes during the anticipation of dyspnea, which in turn partly relate to the subsequent processing of perceived dyspnea . First, conditioning studies demonstrated increased physiological fear responses during the anticipation of dyspneic breathing occlusions and hyperventilation including increased startle reflex magnitudes [21, 22]. The present study extends these findings to increased subjective fear reports and the involvement of fear - related brain areas during the anticipation of resistive - load - induced dyspnea . Second, studies examining the anticipation of other aversive stimuli such as pain [23, 30], restricted breathing, negative affective pictures [43, 44], monetary loss, and hyperventilation cues reported comparable activations in emotion - related brain areas as the present study . These included prominent activations in anterior insula, amygdala, anterior cingulate cortex, and pag . These areas, especially amygdala and insula, have also been described as parts of a salience network for the detection of threatening stimuli . Third, studies comparing anticipation with perception of aversive stimuli such as pain similarly demonstrated overlapping brain activation patterns [2325, 30]. More specifically, the prestimulus connectivity of anterior insula and midbrain / pag and anticipatory activation in anterior insula, anterior midcingulate cortex, and amygdala have been found to influence both, brain activation during actual pain perception and behavioral markers of pain . Fourth, previous studies have linked activation in insula and extended amygdala to the affective unpleasantness of dyspnea [11, 40]. This supports the suggested relevance of these two brain areas for affective responses (e.g., fear) towards upcoming dyspnea, which is further supported by the present correlation between anticipatory fear ratings and anticipatory insular activity . Finally, overlapping activation for dyspnea anticipation and perception localized to the 6th cerebellar lobule . This cerebellar subdivision has been shown in neuroimaging and lesion studies to be relevant for emotional processes [49, 50] including the processing of different aversive stimuli such as pain and negative affective pictures . Although cerebellar activation has frequently been reported for various dyspneic stimuli [8, 9, 5254], its particular contribution to dyspnea perception is only poorly understood . The present observation of anticipatory activity paralleled by strong amygdala interactions is in line with a previously suggested involvement in both, sensorimotor and affective aspects of dyspnea . The present findings suggest a neural correlate for the recently proposed link between anticipatory fear and later avoidance behavior as one underlying cause of negative health outcome in chronic dyspnea . Several clinical studies [6, 55] have demonstrated that dyspnea specific fears or worries about physical exercise are related to worse performance in exercise tests and worse outcome of pulmonary rehabilitation in patients with copd . These findings suggest that irrespective of disease severity anticipatory fear of dyspnea leads to unfavorable health behavior such as avoidance of higher exercise levels . A similar connection between fear of bodily symptoms (e.g., lower back pain), avoidance behavior, and subsequent negative course of disease has already been established in the fear avoidance model of pain . Notably, pain research has already demonstrated the beneficial effects of cognitive behavioral treatments for reducing anticipatory fear of pain and improving the course of disease . Although dyspnea and pain are processed by distinct neural pathways, similarities concerning the emotion - related processes during the anticipation of aversive bodily sensation can be assumed . Therefore, adapting these treatments that have been proven successful in chronic pain to the treatment of anticipatory fear of dyspnea in patients suffering from chronic dyspnea seems promising . Findings of reduced gray matter volume in, for example, acc and amygdala, in patients suffering from chronic obstructive pulmonary disease provide first evidence that chronic dyspnea indeed impacts the neural structure of emotion - related areas, potentially related to anticipatory fear . The following limitations of the present study should be kept in mind: to keep the contingency of anticipation and dyspnea periods, anticipatory fear was not assessed immediately after each anticipation cue . A prompt rating after the anticipation period would certainly allow a more precise assessment of anticipatory fear and would also reflect potential fluctuations over time . Next, we investigated resistive - load - induced dyspnea causing a sensation of increased work and effort of breathing . Thus, our results cannot be generalized to other qualities of dyspnea such as air hunger and chest tightness . Furthermore, our data on predominantly young healthy subjects cannot be generalized to older subjects in general and subjects suffering from chronic dyspnea in particular . Therefore, further research is needed to investigate whether anticipatory fear and respective brain activation patterns within our experimental setting are suitable approximations to understand avoidance behavior in everyday life including reduced physical activity in patients suffering from chronic dyspnea . Respective findings would open a new avenue to behavioral training aimed at reducing anticipatory fear of dyspnea in the treatment of chronic dyspnea . Furthermore, anticipatory midbrain / pag activation was associated with subsequent dyspnea - related activation of the insular cortex . During dyspnea anticipation the prominent involvement of emotion - related areas such as insula, acc, and amygdala is suggested as potential correlate of anticipatory fear of dyspnea, which might underlie the development of unfavorable health behaviors in patients suffering from dyspnea.
|
(previously known as enterobacter sakazakii) is a gram - negative opportunistic pathogen belonging to the enterobacteriaceae family . It is known to cause serious infections including bacteremia, enterocolitis, meningitis and even sepsis, especially in premature newborns . Recently, a case study reporting cystitis caused by c. sakazakii in the elderly has been published . The lethality of cronobacter infections is very high (4080%) and the incidence is relatively low (8.7 per 100 000 low birth weight neonates); however, it is assumed that the number of infections caused by cronobacter is underreported . Antibiotic therapy is effective if applied soon after infection, but resistance against some therapeutics has already been reported . It can be expected that alternative approaches will be needed soon, since the antimicrobial resistance is rising . The resistance of cronobacter strains to higher temperature and osmotic stress during desiccation enables their survival in dried food . In addition, cronobacter strains have adhesive properties and are able to invade human cells . The current threat of antibiotic resistance has led to re - evaluation of bacteriophages as antibacterial agents potentially usable for treatment and/or prevention of bacterial infections . Advantages of this approach are the specificity of phages bypassing the collateral damage induced by antibiotics on natural microflora, and the virtually single - administration efficacy of lytic phages . Phage therapy of staphylococcal and enterococcal infections has already been tested in clinical trials, with few reported unwanted side effects independent of the route of application . Studies testing phage cocktails for the treatment of chronic venous leg ulcers and chronic ear infection are currently in progress . Additionally, promising results of animal experiments show that phages might play a role in the biocontrol of pathogens in clinical medicine . It has been demonstrated in vitro that contamination of powdered milk formulas with cronobacter can be effectively eliminated with selected cronobacter - specific phages . To our knowledge, the potential of phage therapy to control cronobacter infection in animal models of human diseases has not yet been tested; therefore the aim of our study was to prove the effects of phage therapy on cronobacter - induced urinary tract infection (uti) in a murine model . The bacterial strain used in this study was isolated from a food matrix (obtained from food research institute, bratislava) in luria - bertani (lb) medium overnight at 37c . The strain c. turicensis 290708/07 was identified using the biochemical api 20e identification system (biomerieux, marcy - letoile, france) and characterized by molecular methods as described in detail by turcovsky et al . . Strain for phage propagation, isolation and examination throughout the study . For in vivo experiments, bacteria were centrifuged (6000 g/10 min/4c) after overnight cultivation and resuspended in phosphate buffer saline (pbs). The number of colony - forming units was determined by standard plate counts of serial dilutions on lb agar or macconkey agar plates . Phages used in the study were isolated from sewage collected from 2 wastewater treatment plants in petralka and devnska nov ves, bratislava, slovakia (further in text as p2, d2, respectively). Pure phage cultures were obtained by repeated isolation from single plaques grown on indicator strain in double agar overlay plates . A mixture of the 2 phages with the highest lytic activity toward the indicator strain was used in the in vivo experiment . Incubated indicator bacterial lawns were dropped with 10 l (10 pfu / ml) of phage preparation, following incubation at 37c overnight . On the next day, bacterial lawns were examined for lysis zones . The bacterial strains used in this test contained 10 e. coli strains, 24 enterobacter cloacae strains, 2 citrobacter strains and 7 different salmonella enterica strains . Forty - seven c57bl/6ncrl 1011-week - old female mice were used for the experiment (anlab ltd ., prague, czech republic). Animals were housed in a room with a 12/12 h light dark cycle and had ad libitum access to water and food pellets . Animals were divided into 4 groups as follows: crono (n=13) with c. turicensis transurethral application, crono - phage (n=14) with c. turicensis transurethral application and intraperitoneal phage administration, phage (n=10) with intraperitoneal phage administration and a ctrl group (n=10) as a mock - infected control group . All experiments were approved by the ethics committee of the institute of molecular biomedicine, comenius university in bratislava, slovakia . The mice were briefly anaesthetized with isoflurane and instilled via 28 g plastic transurethral catheters (outer diameter 0.35 mm, inner diameter 0.28 mm) with a volume of 100 l containing either 110 colony - forming units / ml of c. turicensis or sterile lb medium in the experimental group . Simultaneously, 100 l of either cronobacter mixture of phages (110 plaque - forming units / ml), or sterile pbs were administered intraperitoneally . Tissues were homogenized in 300 l of sterile pbs using tissuelyser ii (qiagen, hilden, germany), and aliquots were used for cultivation and biochemical analyses . All chemicals were from sigma - aldrich (st louis, usa), if not otherwise stated . Advanced glycation end - products (ages) as markers of carbonyl stress were determined spectrofluorometrically, using the specific fluorescence of schiff base and amadori products after addition of phosphate buffer saline (pbs) at ex=370 nm and em=430 nm directly in homogenate tissues . Thiobarbituric acid reacting substances (tbars) as a marker of oxidative damage of lipids were determined as described by ohkawa et al . . Briefly, 20 l of homogenate, 30 l distilled h2o, 20 l of 0.67% thiobarbituric acid (sigma - aldrich, germany) and 20 l of glacial acetic acid were mixed in 96-well microtitration plate . After 45 minutes of incubation at 94c (mastercycle pro s, eppendorf, hamburg, germany), 100 l of n - butanol (merck, usa) was added and the absorbance was measured after centrifugation (2000 g/10 min/4c) in the upper phase at 532 nm . Ferric reducing activity of the tissue (frat) as a marker of antioxidant status was measured as described by erel et al . . Twenty l of sample was added into 200 l of freshly prepared frat reagent (3 mol / l acetate buffer, ph 3.6; 10 mmol / l of tripyridyl - s - triazine dissolved in 40 mmo / l hcl; 20 mmol / l fecl3; and 6h2o and h2o in ratio 1:1:1:9, respectively) warmed to 37c and measured after 4 min of incubation at 593 nm . Proteins were quantified using the bradford method . As a standard, bovine serum albumin (fermentas, vilnius, lithuania) was used and 5 l of tissue homogenates were mixed with 250 l of bradford reagent (fermentas, vilnius, lithuania). All measurements were done on a sapphire ii instrument (tecan, grdig, austria). Total rna was isolated from tissues using the trireagent (mrc, cincinnati, usa). Concentration and purity of isolated rna was evaluated spectrophotometrically by nanodrop (thermo fisher scientific, usa). One - step rt real - time pcr with specific primers was used for the relative quantification of gene expression (quantitect sybr green rt - pcr kit, qiagen, hilden, germany). Gtccctttcactcactggcc; primer r gagtgcctcttctgccagttc) and monocyte chemoattractant protein-1 (mcp-1; primer f peptidylprolyl isomerase a (ppia; primer f ttcgagctctgagcactgg; primer r ccagtgccattatggcgt) was used as a housekeeping gene . Differences between groups were evaluated with anova and post - hoc student t - test with bonferroni correction of multiple comparison bias . The bacterial strain used in this study was isolated from a food matrix (obtained from food research institute, bratislava) in luria - bertani (lb) medium overnight at 37c . The strain c. turicensis 290708/07 was identified using the biochemical api 20e identification system (biomerieux, marcy - letoile, france) and characterized by molecular methods as described in detail by turcovsky et al . . Strain for phage propagation, isolation and examination throughout the study . For in vivo experiments, bacteria were centrifuged (6000 g/10 min/4c) after overnight cultivation and resuspended in phosphate buffer saline (pbs). The number of colony - forming units was determined by standard plate counts of serial dilutions on lb agar or macconkey agar plates . Phages used in the study were isolated from sewage collected from 2 wastewater treatment plants in petralka and devnska nov ves, bratislava, slovakia (further in text as p2, d2, respectively). Pure phage cultures were obtained by repeated isolation from single plaques grown on indicator strain in double agar overlay plates . A mixture of the 2 phages with the highest lytic activity toward the indicator strain was used in the in vivo experiment . Incubated indicator bacterial lawns were dropped with 10 l (10 pfu / ml) of phage preparation, following incubation at 37c overnight . On the next day, bacterial lawns were examined for lysis zones . The bacterial strains used in this test contained 10 e. coli strains, 24 enterobacter cloacae strains, 2 citrobacter strains and 7 different salmonella enterica strains . Forty - seven c57bl/6ncrl 1011-week - old female mice were used for the experiment (anlab ltd ., prague, czech republic). Animals were housed in a room with a 12/12 h light dark cycle and had ad libitum access to water and food pellets . Animals were divided into 4 groups as follows: crono (n=13) with c. turicensis transurethral application, crono - phage (n=14) with c. turicensis transurethral application and intraperitoneal phage administration, phage (n=10) with intraperitoneal phage administration and a ctrl group (n=10) as a mock - infected control group . All experiments were approved by the ethics committee of the institute of molecular biomedicine, comenius university in bratislava, slovakia . The mice were briefly anaesthetized with isoflurane and instilled via 28 g plastic transurethral catheters (outer diameter 0.35 mm, inner diameter 0.28 mm) with a volume of 100 l containing either 110 colony - forming units / ml of c. turicensis or sterile lb medium in the experimental group . Simultaneously, 100 l of either cronobacter mixture of phages (110 plaque - forming units / ml), or sterile pbs were administered intraperitoneally . Tissues were homogenized in 300 l of sterile pbs using tissuelyser ii (qiagen, hilden, germany), and aliquots were used for cultivation and biochemical analyses . All chemicals were from sigma - aldrich (st louis, usa), if not otherwise stated . Advanced glycation end - products (ages) as markers of carbonyl stress were determined spectrofluorometrically, using the specific fluorescence of schiff base and amadori products after addition of phosphate buffer saline (pbs) at ex=370 nm and em=430 nm directly in homogenate tissues . Thiobarbituric acid reacting substances (tbars) as a marker of oxidative damage of lipids were determined as described by ohkawa et al . . Briefly, 20 l of homogenate, 30 l distilled h2o, 20 l of 0.67% thiobarbituric acid (sigma - aldrich, germany) and 20 l of glacial acetic acid were mixed in 96-well microtitration plate . After 45 minutes of incubation at 94c (mastercycle pro s, eppendorf, hamburg, germany), 100 l of n - butanol (merck, usa) was added and the absorbance was measured after centrifugation (2000 g/10 min/4c) in the upper phase at 532 nm . Ferric reducing activity of the tissue (frat) as a marker of antioxidant status was measured as described by erel et al . . Twenty l of sample was added into 200 l of freshly prepared frat reagent (3 mol / l acetate buffer, ph 3.6; 10 mmol / l of tripyridyl - s - triazine dissolved in 40 mmo / l hcl; 20 mmol / l fecl3; and 6h2o and h2o in ratio 1:1:1:9, respectively) warmed to 37c and measured after 4 min of incubation at 593 nm . Bovine serum albumin (fermentas, vilnius, lithuania) was used and 5 l of tissue homogenates were mixed with 250 l of bradford reagent (fermentas, vilnius, lithuania). All measurements were done on a sapphire ii instrument (tecan, grdig, austria). Total rna was isolated from tissues using the trireagent (mrc, cincinnati, usa). Concentration and purity of isolated rna was evaluated spectrophotometrically by nanodrop (thermo fisher scientific, usa). One - step rt real - time pcr with specific primers was used for the relative quantification of gene expression (quantitect sybr green rt - pcr kit, qiagen, hilden, germany). Genes of interest were tumor necrosis factor - alpha (tnf-; primer f gtccctttcactcactggcc; primer r gagtgcctcttctgccagttc) and monocyte chemoattractant protein-1 (mcp-1; primer f peptidylprolyl isomerase a (ppia; primer f ttcgagctctgagcactgg; primer r ccagtgccattatggcgt) was used as a housekeeping gene . Differences between groups were evaluated with anova and post - hoc student t - test with bonferroni correction of multiple comparison bias . Electron microscopy of used bacteriophages p2 and d2 showed that both are members of the podoviridae family, order caudovirales, with 18020 nm head diameter and 6010 nm long non - contractile tail . Host specificity tests were performed on 41 different strains, including salmonella, e. coli, citrobacter and enterobacter cloacae . Neither of these phages was able to infect citrobacter, salmonella or e. coli strains . Phages showed different ability to lyse enterobacter cloacae strains (p2 25%, d2 38%). Cultivation analysis revealed that bacterial colonies were found only in bladders and kidneys of mice that were injected with cronobacter cells . Mean bacterial count in the kidney was 734 cfu and phage therapy decreased the count by 70% (z=3.06; p=0.002, figure 1a). In the bladder the mean bacterial load was cca 900 cfu in both crono and crono + phage groups (z=0.55; p=0.58; no significant differences were found between the phage and crono + phage groups in the number of phage plaques in the kidney (z=0.32; p=0.75; figure 1c), but were higher in the crono + phage group, although not significant due to high interindividual variability (z=1.53; p=0.13; figure 1d). Ages in renal cortex as a marker of carbonyl stress were not altered by infection with cronobacter, but were significantly reduced by phage therapy in comparison to the infected mice (by 57%; t=2.46; p=0.02; figure 2a). Malondialdehyde as a marker of lipoperoxidation was doubled in the kidneys of infected mice (t=4.15; p=0.0009; figure 2b) and lowered with phage therapy by 39% (t=2.94; p=0.008; figure 2b). Groups did not differ in frat as a marker of antioxidant status in the renal tissue (figure 2c). No significant differences were found in any of the analyzed markers of oxidative stress in the bladder (figure 2d f). Analysis of expression of tnf alpha and mcp-1 revealed that both cytokines were upregulated in the bladder of infected mice (tnf alpha by 72%; t=3.02; p=0.007; mcp-1 by 52%; t=3.03; p=0.007). These differences were reduced by phage therapy (tnf alpha by 35%; t=3.58; p=0.002; figure 3c; mcp-1 by 22%; t=2.53; p=0.02; figure 3d). In the renal cortex only the infection - induced increase in expression of mcp-1 was significant (by 48%; t=2.57; p=0.02; figure 3b). The decrease due to phage therapy was significant for tnf alpha (by 36%; t=2.78; p=0.02; figure 3a). Although seldom life - threatening, chronic uti is associated with high morbidity and thus represents a frequent problem in primary care . It even represents a common cause of sepsis in critically ill or otherwise immuno - compromised patients and may be a cause of nonspecific complaints with negative initial urinalysis in the elderly . In most cases, appropriate choice and dosing of antibiotics or chemotherapeutics is sufficient for successful treatment; however, with increasing incidence of uti caused by resistant strains, the need for alternative options becomes urgent . Host specificity of phages is high and can be narrowed by genetic engineering or by in vitro evolution and selection . The safety profile seems to be far better in comparison to antibiotics, at least according to already published data . Phage particles do not invade or actively affect eukaryotic cells, but may induce a humoral immune response . Long - term studies dealing with safety of phage administration are, nevertheless, needed . However, uti in mice is a suitable model for testing the ability of phage therapy to conquer an infection in vivo, mainly due to physiologically sterile environment and a reproducible read - out parameter in the form of renal colonization . Ascending nephritis was partially prevented in our experiment, indicating that the applied phages could be usable in other infection models . This assumption has to be verified in separate studies, as the conditions in the urinary tract differ from those in other organs or tissues . The observed 70% reduction of cronobacter colonies in the kidneys 24 hours after a single phage dose is consistent with other similar results observing phage efficacy in the treatment of wound infections . The ability of phages to survive in the urinary tract 24 hours after administration has already been shown . There was no difference in cronobacter colonization of the bladder between treated and infected groups . This might indicate that the kinetics of phages after intraperitoneal administration could be improved by choosing another application route . On the other hand, similar to other studies using the transurethral uti model, the variance, especially in the cultivation analysis, is high . In addition to simple reproduction of the results, a similar confirmatory experiment is planned on larger experimental animals, including rats, dogs and other vertebrates . According to our knowledge this is the first study showing that phage therapy decreases oxidative stress in urinary tract infection . It has been shown that phage therapy can attenuate the effects of oxidative burst caused by activated phagocytes . Whether the observed reduction in oxidative stress in our experiment is direct or due to reduced inflammation the clinical significance of this antioxidative effect is questionable, but might gain importance in chronic infections where oxidative damage of tissues plays an important role in the pathogenesis . Data from the presented study show that the phage therapy was effective in the prevention of renal infection in a model of cronobacter - induced urinary tract infection in mice . Inflammation and oxidative stress were reduced in the kidney and partially reduced in the bladder . Future studies should focus on long - term effects and safety, as well as on the potential use of phage therapy of cronobacter infections in models of enterocolitis, meningitis or sepsis.
|
It provides an impervious seal, fills the irregularities and minor discrepancies between the root canal wall and core filling material, and assists in microbial control if microorganisms were left on the root canal walls or in the tubules. [15] ideally, a thin layer of the sealer should be evenly applied to canal walls prior to the placement of the core filling material . The thickness of the endodontic sealer layer is very influential in the quality of the root canal filling. [612] an inadequate sealer coating may result in voids and permit bacterial microleakage which leads to endodontic failure . On the other hand, excess placement of the sealer can result in its extrusion beyond the apical foramen which can prevent or delay healing . Moreover, most sealers dissolve over time and the dissolution is probably responsible for the increase in leakage along the root fillings over time. [1720] therefore, the amount of sealer should be kept to a minimum and should only be found in a thin layer between the gutta - percha and the wall of the canal . Several techniques of sealer placement have been described in the literature, such as the use of a file, lentulo spiral, absorbent paper point, gutta - percha cone, and an ultrasonic file . Each technique may produce different distribution of the sealer onto the canal walls, which may affect the sealing . At present, there is no evidence to suggest that one method is better and reliable than others . Hence, the purpose of this study was to evaluate the influence of three most commonly used methods of sealer placement on the sealing ability of the sealer . One hundred and nineteen (119) human permanent central incisors teeth that had no caries, restorations, or any other noticeable defects were collected, stored in 0.9% isotonic saline, and used in this in vitro study . The crowns of the teeth were removed at the cementoenamel junction by using a hard tissue cutter (exact, germany) under water cooling . The working length was determined by introducing a size 10 k file into the canal until it could be seen at the apical foramen . This length was measured and the working length was set 1 mm short of the resultant measurement . All the teeth were instrumented to a size f3 protaper (dentsply maillefer, switzerland) following the full sequence recommended by the manufacturer . During preparation and between each protaper file, the canals were irrigated with 2 ml of 5.25% naocl by using a disposable syringe and a 25-gauge needle . Also a size 10 hand file was introduced to remove any debris and to ensure the patency of the apical foramen . All root canals were then irrigated with 5 ml of 17% ethylene diamine tetra acetic acid (edta) followed by 5 ml of 5.25% naocl . Finally, the root canals were flushed with distilled water and dried with absorbent paper points . The instrumented teeth were divided randomly into 3 experimental groups of 33 teeth each in addition to 2 groups which served as positive and negative control groups of 10 teeth each [table 1]. Groups, number of specimens, and sealer placement techniques root canal obturation was performed by using the cold lateral condensation technique . After sealer application according to the groups as shown in table 1, the prefitted size 30 master gutta - percha cone was placed . The process was repeated until the spreader penetrated only into the coronal one - third of the root canal space . Excess gutta - percha was removed with a heated instrument and the remainder was condensed vertically with a cold plugger . The teeth were stored in 100% humidity at 37c for 7 days to allow the sealer to set completely . After 7 days the external root surfaces were coated by two layers of nail polish except the coronal orifices . In the positive control group, no sealer was used and the nail polish was applied as the experimental group . While in the negative control group, the instrumented canals were filled with the sealer using rotary lentulo spiral and cold lateral compaction . Then, the external root surfaces were entirely coated with two layers of nail polish, including the coronal orifices . Each tooth was subsequently immersed in an aqueous solution of 2% methylene blue dye with ph 7.0 in an individual container and kept in the incubator at 37c for 3 days . The specimens were then decalcified in 5% nitric acid for 72 h and dehydrated gradually in ascending concentrations of alcohol to 100% . Methyl salicylate was used overnight to clear the teeth . For linear dye penetration assessment, each tooth was sectioned longitudinally by using a hard tissue cutter (exakt, japan). Measurements were done by a blinded assessor under a light microscope (leica, germany) at x20 magnification . The coronal leakage was measured to the nearest 0.01 mm, from the coronal end of gutta - percha, to the most apical extent of dye, taking into consideration the region of highest penetration . This was completed using leica image analyzer software (leica, germany), connected to the microscope . Ten teeth of each experimental group were randomly selected and dye penetration was measured again after 1 week by the same investigator to determine examiner reliability . The data of the first and second measurements were tested using a single - measured intraclass correlation statistic (icc). The difference in the amount of linear dye penetration between groups was compared using anova . The icc was 0.99 (95% ci: 0.991.00) suggestive of a high examiner reliability . Due to technical problems during the experiment, one specimen was lost in group g1, resulting in 32 samples for this group . The positive controls demonstrated complete dye penetration throughout the length of the canal in all teeth . In contrast, the negative controls showed no evidence of leakage in any of the samples . Means of linear dye penetration and standard deviations for all groups are summarized in table 2 . There was no significant difference (p = 0.305) of dye penetration among all groups . One of the objectives of root canal treatment is to provide a hermetic seal of root canal space . This seal is usually produced by using a semisolid or solid core material in a combination with the endodontic sealer . A solid core cannot produce the desired hermetic seal; thus, the endodontic sealer is required to provide three - dimensional obturation . The experimental system of this study was tested by using both positive and negative control groups . The positive control specimens showed total dye penetration throughout the root canal, which indicated that it is absolutely necessary to use a sealer to fill voids and gaps between the core material and the root canal walls and further confirmed the fact that filling the root canal with only the core obturating material without a sealer resulted in an increased leakage . However, the negative control specimens demonstrated no dye penetration, which indicated that two coatings of nail polish were an effective means of preventing dye penetration . The results of this study showed no statistically significant difference (p = 0.305) in microleakage among the three different tested techniques of sealer placement . However, the rotary lentulo spiral group produced the highest value of microleakage and the master gutta - percha coating group had the smallest mean microleakage value . It was expected that the rotary lentulo spiral group will produce a better adaptation of the sealer onto the canal walls with even thickness which in turn leads to a better seal but the results of this study did not support our assumption . First, more amount of sealer was introduced into the canal as compared with other techniques, and as the sealer shrunk during setting, more gaps and voids might had been created that had contributed to the highest value of microleakage . Second, a high volume of the sealer material may also interfere with the placement of additional accessory points which leads to less gutta - percha volume percentage compared to the amount of sealer . Third, the use of rotary lentulo spiral during sealer placement may force some air bubbles into the material that will lead to void formation and microleakage, whereas, the endodontic sealer coating of master gutta - percha cone produced less sealer thickness with less potential void formation compared to the other techniques that eventually might have contributed to the smallest microleakage value obtained by this group . Our results are in accordance with wiemann et al . 's, who compared the influence of four methods, file, lentulo spiral, ultrasonic files, and master gutta - percha, of sealer placement on the sealer sealing ability . In addition, they reported that less sealer was present in the apical third compared to the coronal and middle thirds of the root canal . Kahn et al . Investigated the efficacy of six methods of sealer placement using clear plastic blocks with simulated curved canals . They concluded that the lentulo spiral and the max - i - probe delivery system were the most effective means of sealer placement, followed by ultrasonic and sonic files, and the least effective methods were the paper point and the k file . In this study, the three methods of sealer placement showed comparable results and could be used in clinical practice . However, as the master gutta - percha coating technique had produced the lowest microleakage values, it would be suggested to be used for better results . The master gutta - percha coating technique is the simplest method among the three methods tested and it requires no additional instruments and procedures . Further research perhaps is needed to study the effect of different sealer placement methods with different obturation techniques . Within its limitations, this study showed that the three tested techniques of sealer placement provided a comparable seal . However, the master gutta - percha coating technique could be preferable as it produced the least leakage value, and no extra instrumentation and procedures are needed in its application.
|
Diabetes mellitus is a metabolic disorder in which a combination of hereditary and environmental results in abnormally high blood sugar levels (hyperglycemia). The abnormal high blood sugar level is due to defects in either insulin secretion or insulin action in the body . Diabetes mellitus is characterized by hyperglycemia, lipoprotein abnormalities, raised basal metabolic rate, defect in enzymes, and high oxidative stress which induced damage to pancreatic beta cells . It is the most common endocrine disorder that impairs glucose homeostasis resulting in severe diabetic complications including retinopathy, angiopathy, nephropathy, and neuropathy and causing neurological disorders due to perturbation in utilization of glucose . Currently, in the united states, up to 1 in 3 new cases of diabetes mellitus diagnosed in youth younger than 18 years is t2 dm, with a disproportionate representation in ethnic minorities, occurring most commonly among youth between 10 and 19 years of age . This trend is not limited to the united states but is occurring internationally; it is projected that by the year 2030, an estimated 366 million people worldwide will have diabetes mellitus . The number of individuals with type 2 diabetes mellitus (t2 dm) is increasing with a rate of three new cases every ten seconds, and it is being diagnosed at younger age . Multiple risk factors behind the disease include chronic stress and depression, environmental pollutants and poisons, obesity and overnutrition, and sedentary life style . India having the highest number of diabetic patients in the world, the sugar disease is posing an enormous health problem in the country . Calling india the diabetes capital of the world, the international journal of diabetes in developing countries says that there is alarming rise in diabetes in india . An estimated 3.4 million deaths occur due to consequences of high blood sugar . Who also estimates that 80 percent of diabetes deaths occur in low- and middle - income countries and projects that such deaths will double between 2005 and 2030 . Studies have revealed its use in anti - inflammatory, antimicrobial, antioxidant, and anti tumor process . Various types of preparations, extracts, and individual compounds derived from this species have been found to possess a broad spectrum of pharmacological effects on several organs such as the brain, blood, and cardiovascular and nervous systems as well as on different biochemical processes and physiological functions including proteosynthesis, work capacity, reproduction, and sexual function . Studies are needed to examine the potential use of species of passiflora extract in the prevention of pathologies, such as cardiac ischemia, renal ischemia, and neurodegenerative diseases and diabetes, where oxidative stress damage to protein seems to play a major role . Medicinally, the fruit has been used in amazonia as a preventative for yellow fever, gallstones, rabies, and ulcers . That region also prescribes a leaf decoction for preventing malaria and other fevers and for easing stomach upsets . Passion fruit is proved to have analgesic (pain - reliever), antianxiety, anti - inflammatory, antispasmodic, cough suppressant, aphrodisiac, central nervous system depressant, diuretic, hypotensive (lowers blood pressure), and sedative activities . Besides, it is traditionally reported to possess anticonvulsant, antidepressant, astringent, cardiotonic (tones, balances, and strengthens the heart), disinfectant, nervine (balances / calms nerves), neurasthenic (reduces nerve pain), tranquilizer, and vermifuge (expels worms) activities . It may have promising and powerful effects on neurological disorders and chronic diseases such as heart disease and cancer . So far, no study has been carried out to reveal the antihyperglycemic effect of p. ligularis . This study was undertaken to find out antioxidant and antidiabetic potential in aqueous fruit extract of p. ligularis . Fresh fruits of passiflora ligularis were collected from munnar, kerala, and authenticated by dr . G. v. s. murthy botanical survey of india, tamil nadu agricultural university, coimbatore (voucher number bsi / src/5/23/2012/tech/495). The fruits were washed thoroughly with water and the peel was removed; then the pulp was collected . The aqueous extract was concentrated using a rotary evaporator at room temperature for 3 days to obtain a dark brown pigment and weighed . Phytochemical screening was done for analyzing the presence of secondary metabolites that are responsible for curing ailments [8, 9]. Adult male albino rats weighing about 150200 g were obtained from the animal house of karpagam university, coimbatore, and used for the study . Rats were housed at constant temperature of 22 5c with a 12-hour light, 12-hour dark cycle, and fed on pellets with free access to tap water . All the experiments were carried out according to the guidelines recommended by the committee for the purpose of control and supervision of experiments on animals (cpcsea), government of india . The wistar albino rats weighing between 150 and 180 g were used for the study . 250, 500, 1000, and 2000 mg / kg of the aqueous extract of passiflora ligularis were administered orally to four groups of five animals each . Another group of five rats served as control and this received 1 ml of physiological saline . They were all placed under observation for 24 hours for the signs of lethality, toxic symptoms, behavioral changes, or deaths . Diabetes was induced by a single intraperitoneal injection of streptozotocin (30 mg / kg) in water . Hyperglycemia was confirmed after 72 hrs by the elevated blood glucose and the behavioral changes (excess thirst and frequent urination). The rats with blood glucose level more than 240 mg / dl were used for the study . The glucose tolerance test was studied in the aqueous extract of passiflora ligularis on diabetic rats . The animals were divided into 5 groups (n = 3) as follows: group 1: control rats; group 2: diabetic control rats; group 3: rats treated with 200 mg / kg of aqueous extract of fruit of p. ligularis; group 4: rats treated with 400 mg / kg of aqueous extract of fruit of p. ligularis; group 5: rats treated with 600 mg / kg of aqueous extract of fruit of p. ligularis . Group 1: control rats; group 2: diabetic control rats; group 3: rats treated with 200 mg / kg of aqueous extract of fruit of p. ligularis; group 4: rats treated with 400 mg / kg of aqueous extract of fruit of p. ligularis; group 5: rats treated with 600 mg / kg of aqueous extract of fruit of p. ligularis . Fasting blood sample was drawn from the tail and blood glucose level was measured by using heamoglucostrips in glucometer (life scan, johnson and johnson ltd .) And it was also confirmed by o - toluidine method . For gtt, control and diabetic control rats were given water only . Group 3, 4, 5 rats were treated with their corresponding concentration 200, 400, and 600 mg / kg of aqueous fruit extract of p. ligularis, respectively . Three more blood samples were collected at 60, 120, and 180 minutes after the glucose load . Group 1 served as control, normal healthy rats given normal pelleted diet and 1.0 ml citrate buffer as vehicle, group 2 rats were induced with diabetes by a single intraperitoneal injection of 30 mg / kg bw of streptozotocin and kept without any treatment for 30 days, group 3 rats were induced with diabetes as mentioned in group 2 and treated with glibenclamide (1.25 mg / kg bw) orally through oral intragastric tube, for a period of 30 days, group 4 rats were induced with diabetes as mentioned in group 2 and treated with passiflora ligularis (400 mg / kg bw) orally for a period of 30 days, group 5 rats were treated with passiflora ligularis alone (400 mg / kg bw) orally for a period of 30 days, and the fruit aqueous extract (400 mg / kg) was given orally through intragastric tube for 30 days . The extract was administered orally by intragastric tubes for the study period of 30 days and then they were sacrificed under mild chloroform anesthesia . The organs liver, kidney, and pancreas were collected in saline and used for antioxidant analysis . Serum cholesterol and hdl was estimated by one step method using diagnostic reagent kit manufactured by span diagnostics ltd . Triglycerides were estimated by gpo - pap, end point assay using diagnostic reagent kit manufactured by span diagnostics ltd . The activities of serum aspartate aminotransferase (ast) and alanine aminotransferase (alt) were estimated by using commercially available kits . The activities of serum alkaline phosphatase were also estimated . Total protein and albumin in the serum urea in the serum was estimated by using the diagnostic kit based on the dam method; creatinine in serum was estimated by using the diagnostic kit based on the alkaline picrate method . Bilirubin in serum was estimated by using the span diagnostic kit . In the present study, antioxidant activity of aqueous fruit extract of passiflora ligularis was analyzed in different organs, namely, liver, kidney, and pancreas . After 30 days the rats were sacrificed under mild chloroform anesthesia and the organs were collected in saline liver which was used for the estimation of glycogen . All the tissues were used for estimation of protein, enzymic antioxidants such as superoxide dismutase, catalase, gpx, and nonenzymatic antioxidants such as vitamin c, vitamin e, and reduced glutathione . The statistical comparison among the groups was performed with one - way analysis of variance followed by duncan's multiple range test (dmrt) using spss version 10 (spss, chicago, il). Phytochemicals play an important role in plant defense against prey, microorganism, and stress as well as interspecies protections . Hence, phytochemical screening serves as the initial step in predicting the types of potential active compounds from plants . Phytochemical screening of p. ligularis revealed the presence of various phytochemicals (table 1). In particular the aqueous extract of passiflora ligularis revealed the presence of alkaloids, tannins, phenolic compounds, flavonoids, steroids, cardiac glycosides, terpenoids, and carbohydrates . In acute toxicity study, the experimental rats had slept several hours, after administration of passiflora ligularis extract to the wistar albino rats when compared to normal control rats . But there were no gross behavioral changes or morphological changes like respiratory distress, hair loss, restlessness, convulsions, laxative, coma, weight loss, urination, itching, and so forth . There was no lethality and no toxic reaction was found at any of the doses selected till the end of the treatment . Figure 1 shows the blood glucose levels in gtt of control and experimental groups of rats after oral administration of glucose . The aqueous fruit extract of passiflora ligularis was administered orally (200, 400, and 600 mg / kg, for 15 days) to experimental animals . In diabetic rats, the peak increase in blood glucose concentration was observed after 60 min and it remained high over 120 min . Passiflora ligularis treated diabetic rats showed significant decrease in blood glucose concentration at 60 min and at 120 min interval and the glycemic index was found to be 28.3%, 33.3%, 29.2%, respectively (figure 2). Among the various doses (200, 400, and 600 mg / kg) of p. ligularis on ogtt in normal and diabetic rats, 400 mg / kg brought an effective hypoglycemic effect when compared to other doses . This effect may occur due to reduction in intestinal glucose absorption or induction of glycogenic process along with reduction in glycogenolysis and glyconeogenesis . Therefore, this effective dosage, 400 mg / kg of aqueous fruit extract of p. ligularis, was used for further antidiabetic studies in wistar albino rats . The observed diabetic untreated rats were increased in serum glucose in due to the effect of stz which cause tissue damage in pancreas that destroy cells and result in insulin deficiency . Insulin deficiency ultimately causes increased blood glucose . In diabetic control rats, there is significant elevation of glucose . Streptozotocin causes selective destruction of cells of islets of pancreas and brings an increase in blood glucose levels . It is evident from the present investigation that administration at the dose of 30 mg / kg body weight causes significant diabetogenic response in albino rats . From these results given in table 2, that reduction in blood glucose levels brought by aqueous extract of p. ligularis was quite comparable with reduction brought about by glibenclamide . A significant elevation in hemoglobin and increase in glycosylated hemoglobin noticed in diabetic rats were normalized to near normal with the administration of aqueous fruit extract of p. ligularis and glibenclamide . Reduction in hemoglobin in diabetic rats is due to the interaction of excess glucose with hemoglobin to form glycosylated hemoglobin (table 2). Glycosylated hemoglobin (hba1c) was almost doubled in stz rats and it decreased significantly when treated with p. ligularis and maintains the hemoglobin and glycosylated hemoglobin in their normal range . A significant elevation in serum lipids was observed in diabetic rats when compared with control rats (table 2). In case of insulin deficiency as in diabetes mellitus, lipolysis is not inhibited and therefore this leads to hyperlipidemia . On oral administration of passiflora ligularis fruit extract to diabetic rats for 30 days significantly reversed these values to near normal . This may be due to the increase in insulin secretion by passiflora ligularis which decreases the total cholesterol and total triglycerides and increases hdl level . Table 3 shows the level of hepatic and renal markers; the levels of urea, creatinine, and bilirubin were significantly increased in diabetic group and treatment with passiflora ligularis extract for 30 days significantly reversed these values to near normal . Rise in serum level of ast and alp have been attributed to the damaged structural integrity of the liver . The significant decrease in liver enzymes, namely, ast and alp levels, was noticed after oral administration of aqueous extract of p. ligularis as compared to diabetic animals . It implies the normal functioning and protective effect of p. ligularis liver and supports hepatoprotective nature of p. ligularis . The results from table 3 show that the serum total protein level in diabetic control rats was significantly reduced . Increase in serum protein, that is, the ratio of albumin and globulin in diabetic rats treated with aqueous extract of p. ligularis and standard drug, was observed . Administration of passiflora ligularis fruit extract decreased the level of liver markers in diabetic treated rats . Stz causes damage to liver, kidney, and pancreas as well as the hyperglycemia related changes which may persist in the tissues . The changes on protein levels in tissues such as liver, kidney, and pancreas of the experimental animals are given in table 4 . The level of protein in liver and kidney was decreased in diabetic group on comparison with control group . On treatment with aqueous fruit extract of passiflora ligularis and standard drug glibenclamide to diabetic rats for 30 days the values the reduction of the level of total proteins in induced rats was attributed to localized damage in the endoplasmic reticulum which results in the loss of p450 leading to its functional failure with a decrease in protein synthesis . The rise in protein levels in the treated groups suggests the stabilization of endoplasmic reticulum leading to protein synthesis . In this study, the liver glycogen level was decreased significantly in group ii diabetic rats, compared to glibenclamide as standard and passiflora ligularis treated groups . Liver glycogen content was significantly reduced in stz induced diabetic rats (figure 3). Glycogen is the primary intracellular storage form of glucose and its levels in various tissues are a direct reflection of insulin activity as insulin promotes intracellular glycogen deposition by stimulating glycogen synthase and inhibiting glycogen phosphorylase . The significant increase of liver glycogen level in the extract - treated diabetic groups may be due to reactivation of the glycogen synthase system . The experimental results indicate that the aqueous fruit extract of passiflora ligularis has considerable antidiabetic activity and is capable of maintaining the liver glycogen level . Table 5 demonstrates the results of the antioxidants enzymes levels of sod, catalase, and gpx in experimental rats . These enzymatic antioxidants are significantly decreased in different organs (liver, kidney, and pancreas) due to the inadequacy of the antioxidant defences in combating ros mediated damage and when they are treated with aqueous fruit extract of passiflora ligularis the activity of these enzymes was increased and may help to control the free radicals when compared to diabetic rats and the effect produced by aqueous fruit extract of passiflora ligularis was comparable with that of standard drug glibenclamide . Implication of oxidative stress in the pathogenesis of diabetes is suggested, not only by oxygen free - radical generation, but also due to nonenzymatic protein glycosylation, autooxidation of glucose, impaired glutathione metabolism, alteration in antioxidant enzymes, lipid peroxides formation, and decreased ascorbic acid levels . In addition to gsh, there are other defense mechanisms against free radicals like the enzymes superoxide dismutase (sod), reduced glutathione (gsh), and catalase (cat) whose activities contribute to eliminate superoxide, hydrogen peroxide, and hydroxyl radicals . The decreased activities of cat and sod in diabetic rats may be a response to increased production of h2o2 and o2 by the autoxidation of glucose . These enzymes play an important role in maintaining physiological levels of oxygen and hydrogen peroxide by hastening the dismutation of oxygen radicals and eliminating organic peroxides and hydroperoxides generated from inadvertent exposure to stz . The observed increases in the antioxidant enzymes in diabetic treated rats are due to the presence of secondary metabolites in the aqueous fruit extract of passiflora ligularis . The aqueous fruit extract passiflora ligularis is rich in flavonoid content which provide to have good antioxidant potential and it is able to reverse the changes in diabetic control rats . Table 6 indicates a significant reduction in the nonenzymatic antioxidants like glutathione (gsh) vitamins c and e in diabetic rats when compared with control rats . The levels of these antioxidants were significantly increased in different organs (liver, kidney, and pancreas) of diabetic rats by treating with aqueous fruit extract of passiflora ligularis . It is a direct scavenger of free radicals as well as a cosubstrate for peroxide detoxification by glutathione peroxidases . Oxidative stress in diabetes decreased the level of gsh in different organs of rat when compared to control . Oral administration of aqueous fruit extract of passiflora ligularis for 30 days showed significant elevation in all the nonenzymatic antioxidants values and reached near normal values . This indicates that administration of aqueous fruit extract of passiflora ligularis can reduce the oxidative stress leading to less degradation of gsh due to less production of ros in diabetic stage . Table 7 explains a significant reduction in the lipid peroxidation in liver, kidney, and pancreas of control and experimental animals . In liver, kidney, and pancreas tissues of diabetic rats, lipid peroxidation (lpo) levels hydroxyl radicals are the major active species that cause lipid oxidation and significant biological damage . The ability of the passiflora ligularis extracts to quench hydroxyl radicals seems to be directly related to inhibiting the process of lipid peroxidation . After oral administration of passiflora ligularis extract for 30 days the elevated values restore back to near normal level . Both of the treated groups showed significant decrease in lipid peroxidation, suggesting its role in protection against lipid peroxidation . In conclusion, the result of this study shows that oral administration of the aqueous extract of p. ligularis reduces blood glucose, serum lipids which could be due to improvement in insulin secretion by recovery of pancreatic cells . P. ligularis possesses antioxidant potential which may be used for therapeutic purposes mainly in the prevention of oxidative damage that occurs during diabetes . Presence of alkaloids and flavonoids of p. ligularis has also been found to be beneficial in controlling diabetes and many other diseases as evident from this study . Therefore, it is concluded that the aqueous extract of p. ligularis possesses antidiabetic activity and it may prove to be effective for the management of diabetes.
|
The presence of a passive surface film is key to the exceptional corrosion resistance of stainless steel alloys . Consequently, much effort has targeted the characterization and enhancement of this protective layer, which is often composed, at least partially, of chromia . Such work includes fundamental studies of single crystal surfaces of -cr2o3 to gain atomic scale insight into pertinent properties, e.g., refs (310). To date, however, most of these measurements have been conducted in ultra high vacuum (uhv), limiting their relevance with regard to mechanistic understanding of corrosion performance in engineering environments . Targeting this omission, the current study is concerned with determining the surface structure of -cr2o3(0001) in the presence of h2o vapor through acquisition of surface x - ray diffraction (sxrd) data; water is an essential ingredient for many corrosion phenomena . The structure of -cr2o3(0001) as a function of both h2o partial pressure and temperature has previously been explored by costa et al . Through ab initio modeling . As a starting point for these calculations, a clean surface terminated by a single layer of 3-fold coordinated chromium atoms was assumed, as depicted in figure 1a; this surface termination is labeled cr o3cr on the basis of its first three atomic layers (the subscript indicates the average number of atoms in each 1 1 unit cell). Near room temperature, it was concluded that two other terminations become energetically favorable in the presence of h2o . At lower h2o partial pressures, dissociative adsorption was proposed to be the most likely scenario with each surface cr becoming decorated with two hydroxyls (oh), i.e. (oh)2cr o3; a (oh)cr o3 termination was found to be energetically unfavorable . Increasing the h2o partial pressure resulted in the attachment of an intact h2o molecule to each dihyroxylated cr to form a new surface termination, i.e. (h2o(oh)2)cr o3. (a) schematic illustration of the clean -cr2o3(0001)(1 1) surface employed by costa et al . In their ab initio calculations of the interaction of h2o with this substrate . To the left (right) is a side (plan) view (b) and (c) similar models of stable oh / h2o decorated terminations predicted by costa et al . At hydrogen bonding is indicated by means of dashed lines; the smallest spheres are hydrogen atoms . The 1 1 surface unit cell is indicated in the plan view in part a. parts b and c of figure 1 illustrate the (oh)2cr o3 and (h2o(oh)2)cr o3 adsorbate phases predicted in ref (6), including the location of the acidic hydrogen resulting from dissociative adsorption of h2o . This moiety is bound to the topmost substrate oxygen atoms, forming a second distinct oh species . Hydrogen bonds formed between surface adsorbates (oh and h2o) are also indicated in figure 1, parts b and c. these theoretical structures are consistent with experimental characterization performed under uhv conditions of thin films of -cr2o3(0001) exposed to h2o, in that at room temperature, dissociative adsorption is evident . Moreover, the existence of two distinct oh species, as well as interadsorbate hydrogen bonding, is apparent from vibrational data . Here, the validity of the theoretical study of costa et al . Is explored experimentally . Analysis of sxrd data acquired at a h2o partial pressure of 30 mbar indicates that the -cr2o3(0001) surface is decorated by oh, but not exactly as predicted . This work builds on a previous sxrd study examining the impact of o2 on the surface structure of -cr2o3(0001). Experimental work was carried out at the diamond light source (dls) synchrotron facility, employing the surface village s off - line uhv chamber for sample preparation, and beamline i07 for sxrd measurements . In situ cleaning of the single crystal -cr2o3(0001) sample (supplied by pi - kem ltd .) Involved repeated cycles of ar bombardment and annealing in uhv to approximately 1200 k. low energy electron diffraction (leed), and auger electron spectroscopy (aes) facilities were employed for sample characterization; leed and aes data can be found in supporting information . It should be noted that following acquisition of leed and aes data, the sample underwent a further cycle of ar bombardment and annealing to minimize the possibility of surface damage due to electron beam impingement . Following completion of surface preparation, the sample was exposed to 1000 l (langmuir) of h2o vapor . Prior to dosing, the h2o had been degassed through repeated freeze pump - thaw cycles . The sample was then transferred under vacuum to i07 s diffractometer in eh1, using a custom - built vacuum - suitcase and uhv baby chamber combination . The latter (base pressure 1 10 mbar) incorporates a dome shaped x - ray transparent beryllium window suitable for undertaking sxrd measurements . Once located on the beamline the sample was exposed to a further 1000 l of h2o vapor; henceforth this surface will be referred to as cr2o3h2ouhv . The purpose of dosing h2o prior to commencing diffraction measurements was to mitigate the risk of any surface contamination during the sample transfer process . Sxrd data were collected at an incidence angle of 1 with the substrate at room temperature, using a photon energy of hv = 17.7 kev and a 2d pilatus photon detector . Initially, a systematic series of x - ray reflections was acquired from cr2o3h2ouhv . More specifically, for a given (h, k)-integer, data were measured as a function of l to facilitate generation of so - called crystal truncation rods (ctrs); fractional - order rods (fors) were also surveyed . H, k, and l are the reciprocal lattice vectors, and are defined with reference to the real space (1 1) unit cell of the -cr2o3(0001) surface, described by lattice vectors (a1, a2, a3) which are parallel to the,, directions, respectively . The magnitudes of these lattice vectors are a1 = a2 = a = 4.957, and a3 = c = 13.592, where a and c are the bulk lattice constants . Subsequent to compiling surface diffraction data from cr2o3h2ouhv in uhv, the h2o partial pressure was increased in a stepwise fashion by appropriate backfilling of the baby chamber with h2o . We note that above 1 10 mbar a static volume of h2o was employed rather than obtaining an equilibrium pressure through balancing the rates of h2o inflow and pumping, i.e. The baby chamber was no longer continuously pumped . For each h2o partial pressure, the intensity of the (1, 0, 2.9) reflection was monitored to identify changes in the -cr2o3(0001) surface structure . Selection of this reflection was based upon its sensitivity to such variation as a function of o2 partial pressure . On the basis of these measurements (see below), a further systematic series of x - ray reflections was acquired from -cr2o3(0001) at a h2o partial pressure of 30 mbar; henceforth this surface will be referred to as cr2o3h2o30 mbar . It should be noted that as 30 mbar of h2o is equivalent to 100% relative humidity with the substrate at room temperature, one would expect the surface to be submerged beneath multiple monolayers of h2o in this environment . To facilitate fully quantitative structure determination, the raw diffraction data acquired at uhv and p(h2o) 30 mbar were integrated and corrected to enable plots of structure factor versus perpendicular momentum transfer for each ctr to be compiled . This procedure resulted in a total of 1054 (1142) nonequivalent reflections from six ctrs for cr2o3h2ouhv (cr2o3h2o30 mbar). Concerning fors, no evidence for any surface unit cell other than 1 1 was found . For surface structure determination, we adopted the usual approach of generating simulated sxrd data for a series of potential model structures, and iteratively refining structural (and nonstructural) parameters to find the overall best fit between experiment and theory . Reduced was used to evaluate the goodness of the fit; this is defined as follows: n is the number of measured structure factors, p the number of parameters optimized during fitting, and fiexp(hkl) and fith(hkl) are the experimental and theoretically calculated structure factors, respectively . Behaves such that a value of 1 indicates that experiment and theory are essentially coincident, with agreement decreasing with increasing . Values of significantly less than 1 suggest that the magnitudes of experimental uncertainties have been overestimated . The quoted precision of each fitted parameter is determined by systematically varying the parameter about its optimal value, and for each step optimizing all other parameters, until has increased by 1/(n figure 2 displays the intensity of the (1, 0, 2.9) reflection as a function of increasing h2o partial pressure; please note, as described above, the sample had already been dosed with 2000 l of h2o prior to acquisition of these data . Upon exposure of the sample to 30 mbar of h2o vapor, there is an increase of 20% in the signal . This increase is fully reversible (i.e., there is an 20% decrease in intensity upon reducing the pressure down to 8 10 mbar), which indicates that the change occurring at 30 mbar of h2o is not maintained at lower vapor pressures . The inset in figure 2 compares rocking scans acquired in uhv (1 10 mbar) and 30 mbar, demonstrating the significance of the variation in reflection intensity . Furthermore, this comparison shows that there is no appreciable variation in the width of the reflection, indicating that terrace size is not significantly influenced by the presence of h2o . These data suggest that the presence of 30 mbar of h2o vapor leads to a modification of the surface structure of -cr2o3(0001). This supposition will be confirmed below, through analysis of the ctr data sets acquired from cr2o3h2ouhv and cr2o3h2o30 mbar . Plot of the intensity of the (1, 0, 2.9) reflection as a function of h2o partial pressure; the -cr2o3(0001) sample had been dosed with 2000 l of h2o prior to acquisition of these data . Dashed line is a guide for the eye . Inset displays (1, 0, 2.9) rocking scans acquired at uhv (thin line) and 30 mbar of h2o (bold line). Initially, attention was focused upon the diffraction data acquired from cr2o3h2ouhv . To begin the search for a structural solution, the clean surface structure (cr2o3cleanuhv) determined in recent quantitative leed (leed - iv) and sxrd studies this surface exhibits a topmost partially occupied double layer of cr atoms (cr0.31cr0.61o2.4 from leed - iv, and cr0.22cr0.31o3 from sxrd). Given that the current measurements were undertaken following exposure to 2000 l of h2o, terminations with surface cr atoms bonded to one or more oh / h2o species were tested . It should be noted that h atoms were not explicitly included during generation of simulated of sxrd data, due to their negligible x - ray scattering, i.e. Only an oxygen atom was added for each oh / h2o . Refinement of these oh / h2o decorated structures, including atomic coordinates, site occupation, and a surface roughness parameter (), resulted in values of 1.7, 2.1, and 1.8 for cr atoms bound to one, two, or three oh / h2o species, respectively . For completeness optimization of this structure resulted in a of 1.2, indicating that the sxrd data provide no substantive evidence for adsorbed figure 3 displays a comparison of the experimental ctrs acquired from cr2o3h2ouhv with the best - fit theoretical simulations . To achieve this fit 41 parameters were optimized, i.e. 35 atomic coordinates, a scale factor, a surface roughness parameter, and fractional occupancy factors for cr(1), cr(2), o(1), and cr(3) (these atoms are identified in figure 4); debye waller factors for all atoms were maintained at bulk values, i.e., 0.5 . As may be expected for a value of 1.2, there is a good level of agreement between theory and experiment . In a number of regions away from bragg peaks, however, the uncertainty in the experimental structure factor is relatively large and can encompass zero . Given this situation, which may lead one to question the reliability of the optimum structure, a further structure refinement was undertaken excluding all data points where the error in the structure factor includes zero . Employing this more limited data set did not result in any significant changes in the structural solution, and so was not considered further . Comparison of experimental ctr data (solid markers with error bars), acquired from -cr2o3(0001) in uhv subsequent to exposure to 2000 l of h2o (cr2o3h2ouhv), and theoretical best - fit simulations (solid red lines). Schematic models of the -cr2o3(0001) surface structure determined from sxrd data acquired in uhv, following exposure to 2000 l of h2o (cr2o3h2ouhv). At the bottom (top) the surface geometry emerging from analysis of the data acquired from cr2o3h2ouhv is illustrated in figure 4 . Corresponding atomic coordinates are listed in table 1; all nearest neighbor cr o interatomic distances are physically reasonable . A topmost partially occupied cr double layer is maintained in the optimized structure, although the fractional occupancies of both cr sites are less than those determined previously for cr2o3-cleanuhv; layer occupancies determined from analysis of sxrd data from cr2o3h2ouhv (the present study) and cr2o3-cleanuhv are indicated in figure 4 . Atomic layer spacings perpendicular to the -cr2o3(0001) surface derived from both the present results and the earlier measurements are listed in table 2 . As with the fractional occupancies, as mentioned in ref (7), a plausible explanation for these discrepancies in surface structure is that they arise from small variations in sample preparation methods, e.g. Anneal temperature . Furthermore, it should be remembered that the latest sxrd data were recorded after exposure to 2000 l of h2o, which may have induced surface modification, even though no clear evidence of surface bound oh / h2o was found during analysis of the diffraction data . For example, a proportion of topmost oxygen atoms may in reality be oh s due to reaction with the acidic hydrogen resulting from dissociative adsorption of h2o . The optimum value of the surface roughness parameter (= 0.42), along with lower fractional occupancies of surface layers, may also reflect surface modification induced by h2o exposure; = 0.2 was obtained during fitting of the sxrd data acquired from cr2o3cleanuhv in ref . Greater surface roughness following h2o exposure is apparently consistent with stm images acquired from a thin film of -cr2o3(0001), which suggest that h2o induces geometric disordering within terraces . Fractional occupancy is indicated by a non - integer subscript in the atom column; the overall occupancy of oxygen atoms in the layer containing o(1) is 1.11 0.12, as there are three symmetry equivalent oxygen atoms per (1 1) unit cell . Atomic coordinates for the bulk - terminated cr cr o3-structure are also listed . Figure 4 provides a key to the identity of the atoms, and the axes x, y, and z. an asterisk () indicates that the parameter has been held constant during optimization . Structure determination commenced with refinement of the coordinates of the optimized cr2o3h2ouhv structure . A best - fit of 3.2 was obtained, suggesting that the presence of 30 mbar h2o results in surface modification beyond mere relaxation . Consequently, terminations of the optimum cr2o3h2ouhv structure, where surface cr atoms are bound to one or more oh / h2o species, were tested . Refinement of these oh / h2o decorated structures, resulted in values of 1.1, 2.1, and 2.3 for cr atoms bound to one, two, or three oh / h2o species, respectively, i.e., a structure where each surface cr is bound to a single oh / h2o species is favored . More specifically, it is concluded that oh / h2o is adsorbed atop cr, at a distance of 2.09; off atop adsorption was also tested, but found to increase . A comparison of the experimental ctrs with the best - fit theoretical simulations is shown in figure 5 . Comparison of experimental ctr data (solid markers with error bars), acquired from -cr2o3(0001) at p(h2o) 30 mbar (cr2o3h2o30 mbar), and theoretical best - fit simulations (solid red lines). Also included are theoretically simulated data (broken blue line) for optimum cr2o3h2ouhv geometry . Figure 6 depicts the surface structural model employed to obtain the best - fit displayed in figure 5, in which the oxygen atoms of adsorbed oh / h2o species are labeled with 1, 2, 3, and 4. as illustrated, the best fit was obtained with oh / h2o (o(1) o(4)) located atop cr(1) and cr(2), as well as above any cr(3) and cr(4) atoms available for bonding due to fractional occupation of the topmost oxygen layer (o(1)). It should be borne in mind that the presence of o(3) and o(4) does not result in unphysical interatomic distances, as the fractional occupancy of these atoms is governed by fractional occupancy of o(1). Optimum atomic coordinates are listed in table 3 . Here, again, all nearest neighbor cr o interatomic distances are physically reasonable . During fitting 35 atomic coordinates were varied . In addition, as above, a scale factor, a surface roughness parameter, and fractional occupancy factors for cr(1), cr(2), o(1), and cr(3) were also optimized . Waller factors for all atoms were again maintained at bulk values, i.e. 0.5 . The optimum surface roughness parameter, = 0.39, is very similar to that obtained for cr2o3h2ouhv, indicating that immersion in p(h2o) 30 mbar does not induce further surface roughening . Furthermore, it should be noted that o(1) and o(2) were constrained to have the same fractional occupancies as cr(1) and cr(2), respectively . Similarly, the fractional occupations of o(3) and o(4) were fixed to be equal to the fraction of available cr(3) and cr(4) atoms, respectively . Oh / h2o bond lengths (i.e., cr(1)o(1), cr(2)o(2), cr(3)o(3), and cr(4)o(4)) were constrained to have the same value during optimization . Ball and stick model (side view) of the surface termination of -cr2o3(0001) employed for fitting the sxrd data acquired at p(h2o) 30 mbar (cr2o3h2o30 mbar). Larger (smaller) spheres are oxygen (chromium) atoms; the smallest spheres are hydrogen atoms, which are employed to indicate location of adsorbed oh / h2o . The oxygen atoms of adsorbed oh / h2o species are labeled with 1, 2, 3, and 4. numerical labeling of atoms is employed for identification purposes . Fractional occupancy is indicated by a non - integer subscript in the atom column; the overall occupancy of oxygen atoms in the layer containing o(1) is 1.2 0.09, as there are three symmetry equivalent oxygen atoms per (1 1) unit cell . Atomic coordinates for the bulk - terminated cr cr o3-structure are also listed . An asterisk () indicates that the parameter has been held constant during optimization . Figure 7 summarizes the change in surface termination of -cr2o3(0001) determined through analysis of the sxrd data acquired from cr2o3h2ouhv and cr2o3h2o30 mbar . In the presence of 30 mbar of h2o, each under - coordinated surface the lack of oh / h2o on cr2o3h2ouhv is unexpected given that previous investigations of h2o adsorption on -cr2o3(0001) have revealed the presence of adsorbed oh at room temperature even in uhv; h2o exposures in these earlier studies were significantly lower than those employed in the present work . One possible explanation for this discrepancy is that the impinging x - ray beam could induce adsorbate desorption . Such a process would still occur at p(h2o) 30 mbar, but the oh / h2o overlayer would be dynamically maintained due to the continuous flux of surface impinging h2o molecules . Alternatively, it may be that under uhv conditions the surface coverage of oh / h2o species is simply significantly lower than at 30 mbar (e.g., oh / h2o may only be located at specific defect sites), and so the diffraction data are not sensitive to their presence . This possibility seems to contradict the previous studies, which suggest that adsorption is not restricted to minority sites at room temperature in uhv . However, it should be noted that these studies were undertaken on thin films of -cr2o3(0001), rather than a suitably oriented single crystal . It could very well be that this difference in substrate leads to variation in h2o adsorption, i.e. Thin films of -cr2o3(0001) may display significant concentrations of sites active for dissociative adsorption of h2o that are not present to any significant extent on the single crystal substrate . Finally, it is concluded in ref (4) that surface - bound oh is expected to slowly desorb from -cr2o3(0001) at around room temperature . Such loss of oh, if it occurs, would likely result in sxrd data being acquired in uhv from a surface with a coverage of oh well below saturation . However, this desorption process is probably not the origin of the observed lack of adsorbed oh / h2o on cr2o3h2ouhv . If it were, one might expect an oh / h2o overlayer close to saturation coverage to be maintained on the surface at h2o partial pressures well below 30 mbar, which is not reflected by the plot in figure 2, i.e., would expect increase in diffracted signal to occur at lower p(h2o). Cartoon of the variation in surface termination of -cr2o3(0001) with water partial pressure, as determined through analysis of the sxrd data acquired from cr2o3h2ouhv and cr2o3h2o30 mbar . Concerning the structure determined at p(h2o) 30 mbar, it can be seen that it is inconsistent with the predictions emerging from the calculations of costa et al . They conclude that a (oh)cr o3 termination is energetically unfavorable, contradicting our experimental structure determination . It may be argued that this discrepancy is again due to the influence of the x - ray beam . However, in our opinion, that the x - ray beam would selectively desorb oh / h2o species from each surface cr leaving one remaining is doubtful . One more plausible reason for this difference, as stated in the experimental methods, is that the sxrd data have been acquired from a surface submerged beneath multiple monolayers of h2o, due to the relative humidity being 100% . In contrast, costa et al . Do not explicitly include multiple layers of water in their modeling, which may be the origin of the variation in interfacial structure . An alternative explanation for the divergence between the ab initio predictions and experiment is that the initial clean substrate termination used for the calculations is significantly different to that determined by diffraction . It could be that the more disordered surface found in the experiment hinders the formation of an extended network of oh / h2o hydrogen bonding, which emerges from the first - principles modeling, resulting in cr binding to multiple oh / h2o species becoming energetically unfavorable . Another possible reason for the difference is that there is a significant energy barrier to the attachment of additional oh / h2o to each cr, and so cannot be realized with the substrate at room temperature . Further ab initio modeling, which more closely mimics both the experimentally determined -cr2o3(0001) termination and the measurement environment, is required to test these hypotheses . For example, ab initio molecular dynamics could be employed to better simulate the submerged substrate . Regarding the precise nature of the adsorbed species at 30 mbar of h2o, only the cr(oh / h2o) interatomic distances (i.e., cr(1)o(1), cr(2)o(2), cr(3)o(3), and cr(4)o(4)) provides any direct insight . As indicated above, a value of 2.09, with an error bar ranging from 0.01 for cr(3)o(3) and cr(4)o(4) to 0.07 for cr(1)o(1), has been obtained for this parameter; the spread in the magnitude of the errors is a result of the variation in fractional occupancies (lower occupancy leads to a larger error . ). Oh moiety should be 1.97, increasing to 2.1 for adsorbed h2o . On this basis, one might propose that at 30 mbar of h2o, cr2o3(0001) is decorated with adsorbed molecular h2o rather than oh . However, this deduction must be regarded with caution due to the approach employed for fitting the diffraction data, i.e. To limit the number of parameters optimized, the possibility for each substrate atom to adopt more than one location was not incorporated, even where there were variations in local environment . For example, regarding the cr2o3h2o30 mbar data, this approach results in employing only two atoms (cr(3) and cr(4)) to describe the first subsurface double layer of cr atoms, even though some are bound to o(1) and others to o(3) or o(4) atoms . Given that this change in local coordination is likely to lead to somewhat different atomic coordinates, the cr-(oh / h2o) inter atomic distance (2.09) is less well - defined than indicated above . Consequently, we conclude that it is not possible to uniquely identify the adsorbate (oh or h2o) present on cr2o3h2o30 mbar from the current sxrd data set . However, the weight of other evidence suggests that dissociative adsorption is more likely, i.e. The adsorbate is oh . Comparing the present results to those obtained for the interaction of h2o with other (0001) surfaces of corundum - type metal oxides, of particular interest are near ambient pressure photoemission data from -fe2o3(0001). In that study, it was concluded that as the partial pressure of h2o increases, the surface becomes increasingly decorated with surface oh, attaining a maximum coverage of 1 monolayer at 10 mbar . Adsorbed h2o is also observed, suggested to be located above the oh layer, i.e. A three layer fe2o3(0001)/oh / h2o interface is formed . One might also expect similar layering on -cr2o3(0001) at 30 mbar of h2o, but only a single oh / h2o layer is evident from analysis of the sxrd data . However, it should be remembered that sxrd is sensitive to adsorbed layers displaying order both parallel and perpendicular to the surface plane of the substrate . Hence, the analysis presented here should not be interpreted as indicating that only a single layer of oh / h2o is present on cr2o3(0001) at 30 mbar h2o, but that only this layer is sufficiently ordered to be apparent in sxrd . Again, 30 mbar of h2o is equivalent to 100% relative humidity with the substrate at room temperature, and so the surface is expected to be submerged beneath multiple monolayers of h2o . Another result worthy of mention is the local adsorption geometry of oh obtained from photoelectron diffraction (phd) measurements in uhv performed following exposure of v2o3(0001) to h2o . In contrast to the current study, no evidence for oh atop surface v atoms was found . Instead, only the surface oxygen atoms (equivalent to o(1) in figures 4 and 6) are hydroxylated through attachment of h, presumably derived from h2o dissociation; the location of the dissociated oh fragment is not identified . This difference may be due to the initial v2o3(0001) surface being terminated by vanadyl groups (v = o), rather than under - coordinated v atoms . Of further interest is a brief consideration of the previous sxrd study probing the surface structure -cr2o3(0001) as a function of oxygen partial pressure . It is pleasing to note that away from uhv (p(h2o) 30 mbar (current study), and p(o2) = 1 10 mbar) the optimum surface structures are not identical, i.e. Data have not simply been acquired from similarly contaminated surfaces due to extrinsic components of the ambient environment . For both h2o and o2, adsorption occurs atop under - coordinated surface cr atoms, but the cr o bond distance is significantly shorter in the presence of o2 (1.57 0.03). O distance is consistent with the formation of surface chromyl (cr = o) groups . Furthermore, unlike h2o / oh decorated -cr2o3(0001), the chromyl terminated surface remains intact following reduction of the o2 partial pressure . To summarize, sxrd data have been acquired from -cr2o3(0001) as a function of h2o partial pressure . In uhv, after exposure to 2000 l of h2o, the surface is terminated by a partially occupied double layer of chromium atoms; the lack of adsorbed oh / h2o is concluded to be most likely a result of either adsorption only at defects, or x - ray induced desorption . This surface geometry is largely consistent with those determined in recent leed - iv and sxrd studies of clean -cr2o3(0001) in uhv, although there are differences in the values of atomic coordinates and fractional layer occupancies . At 30 mbar of h2o this result is not consistent with the ab initio calculations of costa et al ., which predict that surface termination evolves as a function of h2o partial pressure at around room temperature as cr o3cr (oh)2cr o3 (h2o(oh)2)cr o3. One possible explanation for this discrepancy between theory and experiment is that the calculations do not explicitly take into account multiple layers of interfacial h2o, which is the expected sxrd measurement environment, as the relative humidity is 100%.
|
The " gold standard " for assessing fibrosis, liver biopsy, is recommended prior to the initiation of antiviral therapy; in addition, it is vital for monitoring fibrosis progression . Unfortunately, this procedure is invasive, prone to complications, including hemorrhage and death, and has a high risk of sampling error . Biochemical markers for liver fibrosis (fibrotest) and necroinflammatory features (actitest) are an alternative to liver biopsy, in patients with chronic hepatitis c . Since the first publication, which included a validation period, those tests have been validated in different populations by the same reference laboratory and by an independent group . The tests combine five components (2-macroglobulin, haptoglobin, apolipoprotein a1, -glutamyl transpeptidase (ggt), and total bilirubin) for fibrotest and same plus alanine aminotransferase (alt) for actitest . The aim of this study was to assess the inter - laboratory variability of fibrotest and actitest, including their six serum liver components, in patients with chronic liver disease, and to identify factors associated with that variability . Our concern was to assess whether the analytical methods adapted on the different analyzers were associated with significant variability in fibrotest and/or actitest values . Moreover, we aimed to compare the variability of fibrotest and actitest in relation to the method of expressing enzymatic activity; in particular, in terms of absolute values or as multiples of the upper limit of normal . Since we and others have demonstrated that current definitions of normal values may be inappropriate [8 - 10] in routine practice, the definition of the upper limit of normal (uln) of alt and ggt varies between laboratories, but is rarely detailed . Because numerous medical guidelines make reference to alt and ggt expressed as multiples of the uln (uln units), variations in the definition of normal may have important practical consequences . The main characteristics of the included patients are outlined in table 1 . According to each patient and laboratory, details of the fibrotest and actitest assays there was no significant difference between centers for fibrotest using ggt expressed in international units [mean (sd) = 0.57 (0.26), range = 0.480.65, f - ratio = 0.27, p = 0.27]. For fibrotest using ggt expressed in uln units [mean (sd) = 0.55 (0.27), range = 0.450.68, f - ratio = 1.26, p = 0.27], there was a significant difference between three centers (center 5 had higher means values than center 2 and 4; p = 0.02 for both comparisons). Fibrotest and actitest variability according to laboratories (centers) and units of enzymatic expression: international units (iu) and upper limit of normal (unl). Characteristics of included patients hcv hepatitis c virus; hiv human immunodeficiency virus; sd standard deviation . There was no significant difference between centers for actitest using alt and ggt expressed in international units [mean (sd) = 0.32 (0.26), range = 0.380.53, f - ratio = 1.21, p = 0.30] and for actitest using alt and ggt expressed in uln units [mean (sd) = 0.44 (0.27), range = 0.270.43, f - ratio = 0.81, p = 0.59). The details of the liver proteins and total bilirubin assays according to each patient and laboratory are outlined in figure 2 . There were no significant differences according to testing center for any of these assays (between centers or versus the reference center): (2-macroglobulin [mean (sd) = 2.89 (1.16) g / l, range = 2.693.33, f - ratio = 0.72, p = 0.67], haptoglobin [mean (sd) = 0.98 (0.58) g / l, range = 0.921.03, f - ratio = 0.07, p = 0.99), apolipoprotein a1 [mean (sd) = 1.30 (0.51) g / l, range = 1.161.42, f - ratio = 1.21, p = 0.30] and bilirubin [mean (sd) = 28.8 (66) micromol / l, range = 15.851.1, f - ratio = 0.51, p = 0.85]. One analyzer (advia) gave lower mean apoliprotein a1 levels [1.06 (0.43) g / l) than the other analyzers [1.33 (0.52) g / l; p = 0.02]. The details of the alt and ggt assays, according to each patient and laboratory and expressed in international or uln units, are given in figure 3 . There was no significant difference between centers for alt expressed in international units [mean (sd) = 70 (47) iu / ml, range = 5786, f - ratio = 1.30, p = 0.25]. However, when the assays used pyridoxal phosphate as in the reference center, the mean alt was higher [78 (50) iu / ml] than assays not using pyridoxal phosphate [60 (42) iu / ml; p = 0.003]. For alt expressed in uln units [mean (sd) = 48 (37), range = 3771, f - ratio = 1.65, p = 0.12], there was a significant difference between center 1 and all centers (p = 0.009 vs center 2, p = 0.008 vs center 3, p = 0.04 vs center 4, p = 0.04 vs center 5, p = 0.02 vs center 6, p = 0.03 vs center 7, p = 0.01 vs center 10 and p = 0.001 vs center 11). There were no significant differences between centers for ggt expressed in international units [mean (sd) = 130 (158) iu / ml, range = 5786, f - ratio = 1.30, p = 0.25] or in uln units [mean (sd) = 109 (121) iu / ml, range = 78154, f - ratio = 1.46, p = 0.17]. However, and despite the use of the same szasz method, one automate (dade behring rxl) gave higher ggt mean values [165 (200) iu / ml] than the others [120 (143) iu / ml; p = 0.06]. Alanine aminotransferase (alt) and -glutamyl transpeptidase (ggt) variability according to laboratory and units of enzymatic expression: international units (iu) and upper limit of normal (unl). Passing - bablok linear regression analyses of all samples between laboratories and the reference center are summarized in table 2 . The intercept and slope between the reference center and other laboratories were excellent for the three proteins with only one decrease for apolipoprotein a1 in a single center using the advia analyzer . For ggt, centers using the rxl analyzer had a higher slope (greater than 1). Passing - bablok analysis between laboratories and reference center (lab 1) for each component concordance rates (kappa statistics) among laboratories are given in table 3; all were statistically significant . When ggt and alt were expressed in international units, fibrotest and actitest kappa statistics were all greater than 0.50 with only 0.8% cases (3 out of the 384 comparisons) with a discordance of more than one fibrosis stage . In contrast, when ggt and alt were expressed in uln units, fibrotest and actitest kappa statistics were lower than 0.50 in 11 comparisons (out of the 16 comparisons versus the reference laboratory) with 5% of cases (21 out of the 384 comparisons) with a discordance of more than one fibrosis stage or greater than one activity grade . Concordance rates (kappa statistics) of laboratories with reference center (lab 1), according to the expression of ggt and alt activities this study showed that the variability of fibrotest and actitest values, among nine different laboratories, was acceptable and without clinical consequences for the prediction of the stage of liver fibrosis or grade of activity . This finding is important since it confirms that those tests can be routinely computed from the results of the six individual components obtained by non - centralized measurements . Online assessment is available using the website . To guarantee the quality of this assessment, it was necessary to identify the factors associated with the variability of the six components . This study confirms that the expression of alt and ggt in multiples of the upper limit of reference values should be avoided . Despite efforts to standardize enzymatic assay methods, homogeneity of alt results has not been achieved as attested by external quality controls, and identical limits of reference values cannot be defined . Many clinicians believe that expression of the results as multiples of the upper limits of reference ranges can reduce inter - laboratory variability . Our study confirms previously observed results, that this method of expression is, in fact, worse than that using international units both for alt and ggt . In our reference center, the reference limit recorded was similar to the described mean value from a recent study and lower than in the other laboratories . If actitest was expressed in a standardized way, using the upper limit of each laboratory for ggt and alt, this induced lower concordance rate than actitest using international units . To increase inter - laboratory coherence in the results of enzymatic activities, standardized assays against a reference method should be employed, with calibration of the assay using a commutable enzymatic material . The values of this calibrator must be assigned by a reference method . For proteins and bilirubin assays this was anticipated for 2-macroglobulin since the same analyzer was used in all laboratories . Although the use of three different analyzers, haptoglobin has the best homogeneity . In fact, the assays of these two proteins are standardized against the crm 470 reference material . This reference product is now used in different measurement procedures to attain results numerically the same, whatever the clinical conditions . For apolipoprotein a1, this is due to the use of a different reference material to standardize the assay . Overall, the data from the laboratories were linearly related with the reference center with a slope close to 1 and a non - significant analytical imprecision; there were few pairs of assays outside the confidence limits and the samples were adequately distributed over the investigated range . As previously observed, when ordinary linear regression (in combination with correlation analysis in the passing bablock method) gave poor estimates, in particular for ggt and alt assays, we found several analytical reasons for the poor performance . Enzymatic measurement with the szasz method (standardized against the original for ggt), and with the standardized method according to the international federation of clinical chemistry (using pyridoxal phosphate for alt), would probably reduce the variability . Because of their predictive values and their reproducibility in different populations, biochemical markers could be used as surrogate markers for liver biopsy both for the initial decision of liver biopsy and for the follow - up of chronic hepatitis c patients . To date, liver biopsy has been considered mandatory for the management of patients infected by hepatitis c virus (hcv). Reviews of morbidity and mortality of intercostal liver biopsy observed a mean occurrence of pain in 30% of patients, 3 out of 1,000 endured severe adverse events, and 3 out of 10,000 died . Even liver biopsy is dependant on the inter- and intra - observer (pathologist) differences . There are also potential problems with liver biopsy sampling variation . In a study with three consecutive samples through a single entry site, only 50% of patients with cirrhosis were scored as cirrhosis on the three samples . It is therefore possible that biochemical markers such as those described may provide a more accurate (quantitative and reproducible) picture of fibrogenic events occurring within the liver . Furthermore, and because treatment is now so effective in patients with genotype 2 or 3 infection, the utility of biopsy in this setting could be challenged . When ggt and alt are expressed in international units, fibrotest and actitest can be computed from different laboratories with acceptable variability . To increase inter - laboratory coherency, standardized methods and enzymatic calibration expression of alt and ggt in multiples of the upper limit of reference values should be avoided . The serum of 24 informed patients (21 with chronic hepatitis c and 3 with decompensated alcoholic cirrhosis) were prospectively collected in the department of hepato - gastroenterology of the piti - salptrire hospital, in paris, france . Sera were separated in the above reference laboratory, conserved at + 4c and distributed to ten different laboratories, in france, within 24 hours . For two laboratories, serum was missing for at least one patient; therefore, these laboratories have been excluded from the core analysis . Sensitivity analyses including these two excluded laboratories did not change the results or conclusions (data not shown). Characteristics of the analyzer, reagents and analytical methods employed used in the nine included laboratories are detailed in table 4 . Eleven different analyzers were used . For the measurement of alt activity, five laboratories used a standardized method according to the ifcc, with pyridoxal phosphate, and four without pyridoxal phosphate . For the measurement of ggt activity, the nine laboratories used the szasz method; including in four a recommended method of standardization . Laboratory analyzers and biochemical methods bn2, rxl, vitros 250: dade behring, marburg, germany . Immage, cx5, cx7: beckman coulter, brea, california, usa . Advia 1650: bayer diagnostics, tarrytown, new jersey, usa . Analytical measurements of 2-macroglobulin and haptoglobin were standardized against the certified international reference material 470 (crm 470). Apolipoprotein a1 assays adapted on the different analyzers were standardized against the reference material of world health organization - international federation of clinical chemistry sp1 - 01 (who - ifcc sp1 - 01), except on the advia - bayer - analyzer (advia). Total bilirubin was assayed by diazoreactions methods . Statistical analysis used multiple measure variance analyses and passing - bablok linear regression analyses for the comparison of inter - laboratory results, and kappa statistics for the predicted histological features . Multiple comparisons used bonferroni (versus control) and tukey - kramer multiple - comparison tests . Number cruncher statistical systems software was used . The linear relationship between laboratories and reference center were assessed with confidence limits for the slope and the intercept and the number of pairs out of bounds; they were used to determine whether there was only a chance difference between the slope and 1 and between the intercept and 0 . Ph, fib, dm, ga, db, pcl, gd, dd, tk, ms, dt and et performed the assays.
|
Regenerative periodontal therapy comprises of procedures which are specially designed to restore those parts of the tooth - supporting apparatus which have been lost due to periodontitis . The regeneration of osseous defects caused by inflammatory periodontal disease continues to provide an ongoing challenge in periodontal therapy . Current alternative lines of treatment include autogenous bone grafts and allografts, guided tissue regeneration, alloplastics, or a combination of techniques . Alloplastic materials are synthetic, inorganic, biocompatible, and/or bioactive bone graft substitutes which are claimed to promote bone healing through osteoconduction . Alloplastic materials such as hydroxyapatite and tricalcium phosphate have been used in the treatment of intrabony defects . However, it has been shown that healing often occurs with encapsulation of the graft material by connective tissue and minimal or no bone formation . These materials differ from other bioactive ceramics in that the rate of bonding to bone can be controlled by varying the chemical composition . Their bioactivity is attributed to the formation of a hydroxyl carbonated apatite (hca) layer on their surface similar to the mineral part of bone . The rate of tissue bonding appears to depend on the rate of hca formation, which follows a sequence of reactions between the implanted material and the surrounding tissues and physiologic fluids . The greater surface of nanostructure ceramics present an incomparable and promising character for orthopedic and dental implant formulations with better osseointegrative properties . By controlling the structural and particle size in the range of nanoscale, some properties of bioactive bioceramic such as osseoconductivity, solubility, and mechanical reliability can be improved . The grain size, large surface area to volume ratio, and the ultra fine structure of nanoscale engineering bioceramics similar to the biological apatite provide surprising functional properties for these materials . Recently, nanoceramics have attracted interest because surface nanostructuring allows for improved cellular adhesion, enhances osteoblast proliferation and differentiation, and increases biomineralization . Recently, researchers in isfahan university of technology have been succeeded to produce bioactive glass in nanoscale size that can be a desired substance in dentistry . Considering the fact that interaction between periodontal cells and bone graft materials are important for periodontal regeneration and according to the possibility of cellular and genetic damage of implanted material for patient and clinician, it should be concerned about the safety of mentioned biomaterials . Specifications and standards have been developed to aid producers, users, and consumers in the evaluation of the safety and effectiveness of dental products . According to iso specifications, implant devices are required to evaluate several tests such as cytotoxicity, subchronic systemic toxicity, skin irritation, intracutaneous reactivity, sensitization systemic toxicity, genotoxicity, chronic toxicity, systemic toxicity, and local effects after implantation . Wilson et al . Studied the test of solid bioglass implant in the soft tissues of rats and rabbits for time periods up to eight weeks . The surface activity in contact with bioglass which is so critical in bone adhesion was not toxic in rat tissues . Studied the cytotoxicity of new bioglass composite after 24 hours in cell culture, using one of the biocompatibility tests . In addition, a significant increase in cellular activity suggested that bioglass composite was able to stimulate cellular activity by creating a favorable micromovement for cell proliferation and growth . The single cell gel electrophoresis (scge) assay, better known as comet assay, is a sensitive technique for detecting single and double strand break at the single cell level in dna of any kind of cells . This test is based on the ability of dna fragments to migrate in a weak electric field in direction of anode, given the nucleolus the appearance of comet tail when visualized by fluorescence microscopy. [1416] pelaez et al . Estimated the genotoxicity of coatings containing bioactive particles on stainless steel by scge assay and significantly lower dna migration in the cells of the cultures was observed . Evaluated the genotoxicity of hydroxyapatite bioceramics using comet assay and showed that dna break increased with increasing of biomaterial concentrations . The aim of this study was to evaluate the genotoxicity of a novel nano bioactive glass and novabone bioglass with control group in gingival fibroblasts cells using scge assay . In this in vitro experimental study, periodontal fibroblasts cells were cultured in their logarithmic phase and the genotoxicity of nano bioactive glass and novabone bioglass was studied in selected cultured cells at biotechnology laboratory of pharmacology of isfahan university of medical sciences . Novel nano bioactive glass was made by sol - gel method in biomaterials laboratory of biomaterials research group at isfahan university of technology . Prepared nano bioactive glass was bioactive and less than 100 nanometer in size based on previous researches . Novabone bioglass (novabone products llc, alachua, fl, usa), a silica - based biocompatible material with particle size ranged between 90 to710 m, has been examined in many studies . Comet test or scge assay was used in order to evaluate the genotoxicity of mentioned biomaterials on c165 fibroblasts cells which was prepared from iran pastor institute in their logarithmic phase . Cells were cultured in rpmi 1640 (paa, vienna, austria) and 10% fetal bovine serum, fbs (gibco, ny, usa), and antibiotic (penicillin, streptomycin), then incubated in atmosphere containing 5% co2 at the temperature of 37 c. before forming a confluent mono layer, the cells were harvested from the culture surface by incubation with 2 cc solution of trypsin (gibco, ny, usa). The cells were counted and they were about 10 under microscope to be added experimental materials in the plates . Nano bioactive glass and novabone bioglass powders were used for preparation of 10 mg / ml concentration . Culture medium supplemented with penicillin and streptomycin the suspension was shaken for 72 hours in shaker incubator, then concentrated samples were centrifuged (10 minutes, 1 800 rpm). The culture medium was aspirated with a syringe and filtered and sterilized for 30 minutes under ultra violet (uv) light . Each test concentration of biomaterials (1, 2, 4, and 5 mg / ml) was placed in a culture plate with total 3 ml cell and culture medium of rpmi1640 . As negative control (c-), the cells were cultured with medium without adding biomaterials . After storing the samples at 37c in a 5% co2 atmosphere during 24 hours, they were centrifuged at 1800 rpm (10 minutes) and supernatant was removed . Finally, the cells were resuspended in culture medium and were used to measure dna damage in an individual cell using the alkaline protocol . Detection of dna damage by alkaline comet assay was used for measurement of the genotoxic activity of the biomaterials using protocol of singh . Cell suspension was mixed with low melting point agarose, lmp (sigma, ny, usa) in equal volume (250 l), and extended it on a slide previously coated with 100 l of 1% normal melting point agarose, nmp (sigma, ny, usa). After gelling at 4 c, the cells were lysed for 60 minutes in a solution of 5 m nacl, 20 cc edta, 1 m tris, 10 ml dimethyl sulfoxide, dmso and 1 cc triton x-100, at ph 10 and 4 c. the slides were washed three times in distilled water for 5 minutes and placed them on a horizontal electrophoresis unit, containing fresh electrophoresis buffer (300 mm naoh, 1 mm ethylene diamine tetraacetic acid, edta with ph 13). After 45 minutes of unwinding at 4 c, electrophoresis was performed for 45 minutes (20 v, 300 ma). The slides were washed 3 times in 400 mm tris buffer (ph 7.5) and stained with ethidium bromide (2 g / ml, 10 minutes). One hundred cells from each sample were selected randomly and analyzed by free comet score software . Observations were made at magnification of x400 using an epifluorescent microscope (ceti) coupled with ccd camera (sony dsc h9). Cells with damaged dna displayed high migration of dna fragments from the nucleus, forming a tail in comet form [figure 1]. By using autocomet software 3 parameters (tail length,% dna in tail, tail moment), microscopic view of concentration of (a) control sample, (b) 2 mg / ml nano bioactive glass, (c) 5 mg / ml nano bioactive glass (magnification of 400) data were analyzed with statistical software spss 11.5 and statistical test, kruskal - wallis h and a complimentary test, mann - whitney test (p = 0.05). Cells were cultured in rpmi 1640 (paa, vienna, austria) and 10% fetal bovine serum, fbs (gibco, ny, usa), and antibiotic (penicillin, streptomycin), then incubated in atmosphere containing 5% co2 at the temperature of 37 c. before forming a confluent mono layer, the cells were harvested from the culture surface by incubation with 2 cc solution of trypsin (gibco, ny, usa). The cells were counted and they were about 10 under microscope to be added experimental materials in the plates . Nano bioactive glass and novabone bioglass powders were used for preparation of 10 mg / ml concentration . Culture medium supplemented with penicillin and streptomycin the suspension was shaken for 72 hours in shaker incubator, then concentrated samples were centrifuged (10 minutes, 1 800 rpm). The culture medium was aspirated with a syringe and filtered and sterilized for 30 minutes under ultra violet (uv) light . Each test concentration of biomaterials (1, 2, 4, and 5 mg / ml) was placed in a culture plate with total 3 ml cell and culture medium of rpmi1640 . As negative control (c-), the cells were cultured with medium without adding biomaterials . After storing the samples at 37c in a 5% co2 atmosphere during 24 hours, they were centrifuged at 1800 rpm (10 minutes) and supernatant was removed . Finally, the cells were resuspended in culture medium and were used to measure dna damage in an individual cell using the alkaline protocol . Detection of dna damage by alkaline comet assay was used for measurement of the genotoxic activity of the biomaterials using protocol of singh . Cell suspension was mixed with low melting point agarose, lmp (sigma, ny, usa) in equal volume (250 l), and extended it on a slide previously coated with 100 l of 1% normal melting point agarose, nmp (sigma, ny, usa). After gelling at 4 c, the cells were lysed for 60 minutes in a solution of 5 m nacl, 20 cc edta, 1 m tris, 10 ml dimethyl sulfoxide, dmso and 1 cc triton x-100, at ph 10 and 4 c. the slides were washed three times in distilled water for 5 minutes and placed them on a horizontal electrophoresis unit, containing fresh electrophoresis buffer (300 mm naoh, 1 mm ethylene diamine tetraacetic acid, edta with ph 13). After 45 minutes of unwinding at 4 c, electrophoresis was performed for 45 minutes (20 v, 300 ma). The slides were washed 3 times in 400 mm tris buffer (ph 7.5) and stained with ethidium bromide (2 g / ml, 10 minutes). One hundred cells from each sample were selected randomly and analyzed by free comet score software . Observations were made at magnification of x400 using an epifluorescent microscope (ceti) coupled with ccd camera (sony dsc h9). Cells with damaged dna displayed high migration of dna fragments from the nucleus, forming a tail in comet form [figure 1]. By using autocomet software 3 parameters (tail length,% dna in tail, tail moment), microscopic view of concentration of (a) control sample, (b) 2 mg / ml nano bioactive glass, (c) 5 mg / ml nano bioactive glass (magnification of 400) data were analyzed with statistical software spss 11.5 and statistical test, kruskal - wallis h and a complimentary test, mann - whitney test (p = 0.05). In this study, maximum damaged% dna and longer tail length were observed in highest concentration of both materials . Both higher number of comet and higher length of migrated damaged dna was found with increasing of concentrations [figure 2]. Mean value of comet parameter in different concentrations of nano bioactive glass and novabone bioglass no statistically significant difference was observed between the concentrations of novabone bioglass (p value = 0.085) with control group and novel nano bioactive glass (p value = 0.437) with control group in the evaluation of% dna in tail parameter . The comparison between cells corresponding to negative control and the concentrations of nano bioglass revealed statistically significant difference (p 0.05) in concentrations of 4 mg / ml and 5 mg / ml in tail length and tail moment parameters [table 1]. Comparison of comet parameters in different concentrations of nano bioactive glass and novabone bioglass with control sample (p 0.05) nano bioactive glass generated statistically significant amount of dna damaged at concentration of 5 mg / ml in tail length and tail moment parameters compared with negative control (p 0.05). The concentration 4 mg / ml revealed statistically significant difference only in tail moment parameter compared with negative control (p 0.05) [table 1]. The comparison between cells corresponding to different concentrations of nano bioactive glass revealed higher mean compared to novabone bioglass in all concentrations by evaluation of tail length parameter and difference was statistically significant (p 0.05) [table 2]. Comparison of comet parameters in different concentrations of nano bioactive glass and novabone bioglass (p 0.05) in comparison, two other parameters (% dna in tail, tail moment) for nano bioactive glass revealed higher mean compared to novabone bioglass in all concentrations but difference showed statistical significance (p 0.05) only in 5 mg / ml concentration [table 2]. In present experiment research, the comet assay was used to detect induction of dna damage in fibroblast cells after 24 hours treatment with novel nano bioactive glass and novabone bioglass . Results showed that dna damage was induced in all tested biomaterials concentrations and the genotoxic effect increased with increasing the concentration [figure 2]. Evaluated the genotoxicity of hydroxyapatite bioceramics using comet assay and showed that biomaterials induced dna break, which increased with increasing the bioceramic concentration . According to this fact, it could be expected that the genotoxicity of biomaterials depends on the amount of concentration and it is so critical to detect the threshold . The comparison between cells corresponding to negative control and the concentrations of nano bioactive glass revealed statistically significant difference (p 0.05) in concentrations of 4 mg / ml and 5 mg / ml in tail length and tail moment parameters [table 1]. Also, no statistically significant difference was observed between the concentrations of novabone bioglass (p value = 0.085) and nano bioactive glass (p value = 0.437) in the evaluation of% dna in tail parameter . According to the moller et al . 's study, the end point measured by the traditional comet assay is a mixture of the length of the comet tail and total dna in tail or by the tail moment (the length of the comet tail multiplied by the intensity of fluorescence in the tail); therefore, this parameter was highlighted in present study . According to the results, concentrations less than 4 mg / ml of novel nano bioactive glass have no genotoxicity effect, whereas biomaterials may have low, medium, or high potential risk to human safety, depending on the type and extent of patient contact . Thus, for investigating the systemic toxic effect of nano bioactive glass and using it in dentistry, higher concentrations of the material are needed to be tested . Pelaez et al ., by scge assay, estimated the genotoxicity of coatings containing bioactive particles on stainless steel and significantly lower dna migration was observed in the cells of the cultures . The present study has an advantage over pelaez's study in evaluation of genotoxicity, because of using several concentrations of biomaterials and determining safety genotoxic threshold for tested materials . In our study, pelaez use olive tail moment parameter for detecting genotoxicity of materials and showed that the coating containing hydroxyapatite particles has lower values of olive tail moment, which indicates less dna damage without statistical difference with other materials . The comparison between cells corresponding to different concentrations of nano bioactive glass showed a higher mean value compared to novabone bioglass in all concentrations by evaluation of tail length parameter . The difference was statistically significant (p 0.05) [table 2]. In comparison, two other parameters (% dna in tail, tail moment), nano bioactive glass showed a higher mean value compared to novabone bioglass in all concentrations but difference showed statistical significance (p 0.05) only in 5 mg / ml concentration [table 2]. These results show pieces of damaged dna, with lower dna percent, have migrated higher distance, so there is no statistical difference between nano bioactive glass and novabone bioglass in concentration less than 5 mg / ml [table 2], which can indicate safety of novel nano bioactive glass in genotoxicity according to the results of this study . Haung et al.s and arun et al.s studies proved the biocompatibility of novel composite bioglasses by other biocompatibility evaluation tests . Arun et al . Investigated the effect of ha - bg on chromosomal aberrations in human lymphocytes which are the other approved biocompatibility tests . However, we applied comet assay, a sensitive technique, to detect induction of dna damage in fibroblast cells . More precise results are gained by choosing fibroblast cells for detecting genotoxicity which are the most periodontal connective tissue cells, and have more contact with our materials, whereas comet assay is a technique for detecting single and double strand break at the single cell level in dna of any kind of cells. [1416] the important point that must be considered in comparison of nano bioactive glass and novabone bioglass is the difference in particle size . Nanoparticles have a higher surface area in comparison to microparticles and thus the amount and rate of ion release for nanoparticles are extremely higher . In other words, the bioactivity of nanoparticles is higher in comparison with the same mass of microparticles . This difference is the main reason for the different genotoxicity of nano bioactive glass and micro bioglass (novabone bioglass) in the concentrations higher than 4 mg / ml . According to the present research, concentrations less than 4 mg / ml of nano bioactive glass produced in iran have no genotoxic effect and there is no statistical difference between nano bioactive glass and novabone bioglass in concentrations less than 5 mg/ ml . Therefore, other biocompatibility tests are needed to approve the application of new nano bioactive glass for regenerative therapy in periodontics.
|
Acute pancreatitis is often managed clinically, not only by specialists in surgery, internal medicine, and emergency medicine but also by general physicians, gastroenterologists, and general surgeons . Consequently, the guidelines have been prepared in order to help these physicians to diagnose acute pancreatitis accurately and to manage patients by means of an appropriate treatment policy, thus improving survival rates . According to the available literature, the mortality rate for patients with severe acute pancreatitis ranged between 30% and 21.4% from 1987 to 1999 . Which cases are likely to be fatal? Which categories of morbidity are likely to become more severe? And under what circumstances should patients be transferred to a special hospital? There is a great need for guidelines that clearly answer these and other questions . Several sets of evidence - based guidelines for the management of acute pancreatitis have been published; those of the atlanta symposium of 1992,1 the united kingdom guidelines of 1998,2 and the santorini consensus conference of 19993 are representative . However, they were based on the evidence available at the time, and the validity of any set of guidelines is shortlived and guidelines need to be revised every 2 years.1 indeed, new evidence is reported almost daily, and guidelines for management in clinical settings are changing nearly as fast, thanks to the remarkable advances in medical equipment and treatment techniques developed in recent years . The international association of pancreatology guidelines4 were most recently published in 2002, but they are concerned solely with the surgical management of acute pancreatitis . The guidelines publishing committee very much hopes that this publication will help clinicians worldwide to become familiar with the guidelines, and the committee hopes that those professionals will offer their comments and criticisms once they have had the opportunity to compare them with the guidelines in use in their own countries . The mortality rate among patients with severe acute pancreatitis remains high, although various current diagnostic criteria, methods of severity assessment, and new treatments have been used at a number of institutions . However, there are inter - institutional differences in the ways in which the disease is managed, due to the lack of evidence - based guidelines . In view of this situation, the guidelines have been formulated with the aim of providing practical management guidelines to clinicians engaged in the management of acute pancreatitis . The working group has striven to ensure that the guidelines will help general clinicians not only to assess the severity of acute pancreatitis promptly but also to manage the disease appropriately and efficiently . The guidelines should also help patients, their families, and the general public to acquire better knowledge of acute pancreatitis, and thereby lead to a better standard of medical management based on mutual understanding between those who provide medical treatment and those who receive it . With evidence - based medicine (ebm) as the core concept, an initial draft of the guidelines was prepared by members of the guidelines preparation committee and the working group, both of which consisted of specialists from the japanese society of abdominal emergency medicine, who searched the available documents and evaluated the evidence they found there5 . Following this process, a guidelines investigation committee consisting of members of the working group, the japan pancreas society, and the research group for intractable diseases and refractory pancreatic diseases was formed to examine the draft guidelines . In addition to the investigation committee, an evaluation committee whose members were drawn from the japanese society of abdominal emergency medicine, the japanese ministry of health, labour, and welfare, and several external institutions was formed to critique the guidelines whenever necessary . Pancreatitis as the key search word, a mesh - based exploration of the ovid medline database (19602004) yielded approximately 28000 items under the headings pancreatitis, acute necrotizing pancreatitis, and alcoholic pancreatitis . The items were then screened to confine the entries to those related to human pancreatitis . This yielded 14821 items in english, and after examination of all the titles and abstracts, 1348 were selected, and a careful examination of the full texts was conducted . Other sources quoted in these selected works, together with works suggested by the specialist members, as well as reports prepared by the research group, were included in the examination . The evidence obtained from each reference item was evaluated in accordance with the scientific classification method used at the cochrane library (table 1),6 and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determined . The relevant terms used are explained the footnote of table 1.6 based on the results obtained from these procedures, recommendation grades of a to e, were determined according to the definitions shown in table 2, and these recommendation grades are mentioned, as required, in the text of the guidelines . Table 1categories of evidence (see footnote for explanation of terms).6 the evidence - based classification used at the cochrane library: oxford centre for evidence - based medicine, levels of evidence (may 2001) (http://www.cebm.net/levels_of_evidence.asp#levels)5 was used as a basis to evaluate evidence presented in each item of literature, and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determinedleveltherapy / prevention, etiology / harmprognosisdiagnosisdifferential diagnosis / symptom prevalence studyeconomic and decision analyses1asr (with homogeneity) of rctssr (with homogeneity) of inception cohort studies; cdr validated in different populationssr (with homogeneity) of level 1 diagnostic studies; cdr with 1b studies from different clinical centerssr (with homogeneity) of prospective cohort studiessr (with homogeneity) of level 1 economic studies1bindividual rct (with narrow confidence interval)individual inception cohort study with> 80% follow - up; cdrvalidated in a single populationvalidating cohort study with good reference standards; or cdr tested within one clinical centerprospective cohort study with good follow - upanalysis based on clinically sensible costs or alternatives; systematic review(s) of the evidence; and including multiway sensitivity analyses1call or noneall or none case seriesabsolute sppins and snnoutsall or none case seriesabsolute better - value or worse - value analyses2asr (with homogeneity) of cohort studiessr (with homogeneity) of either retrospective cohort studies or untreated control groups in rctssr (with homogeneity) of level> 2 diagnostic studiessr (with homogeneity) of 2b and better studiessr (with homogeneity) of level> 2 economic studies2bindividual cohort study (including low - quality rct; e.g., <80% follow - up)retrospective cohort study or follow - up of untreated control patients in an rct; derivation of cdr or validated on split - sample onlyexploratory cohort study with good reference standards; cdr after derivation, or validated only on split - sample or databasesretrospective cohort study, or poor follow - upanalysis based on clinically sensible costs or alternatives; limited review(s) of the evidence, or single studies; and including multiway sensitivity analyses2coutcomes research; ecological studiesoutcomes researchecological studiesaudit or outcomes research3asr (with homogeneity) of case - control studiessr (with homogeneity) of 3b and better studiessr (with homogeneity) of 3b and better studiessr (with homogeneity) of 3b and better studies3bindividual case - control studynonconsecutive study; or without consistently applied reference standardsnonconsecutive cohort study, or very limited populationanalysis based on limited alternatives or costs, poor quality estimates of data, but including sensitivity analyses incorporating clinically sensible variations4case series (and poor - quality cohort and case - control studies)case series (and poor - quality prognostic cohort studies)case control study, poor or nonindependent reference standardcase series or superseded reference standardsanalysis with no sensitivity analysis5expert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on economic theory or first principlesusers can add a minus sign to denote the level that fails to provide a conclusive answer because of: note 1 either a single result with a wide confidence interval (such that, for example, an arr in an rct is not statistically significant but whose confidence intervals fail to exclude clinically important benefit or harm)note 2 or a systematic review with troublesome (and statistically significant) heterogeneitynote 3 such evidence is inconclusive, and therefore can only generate grade d recommendationssr, systematic review; rct, randomized controlled trial; arr, absolute risk ratio by homogeneity, the publishing committee means a systematic review that is free of worrisome variations (heterogeneity) in the directions and degrees of results between individual studies . Not all systematic reviews with statistically significant heterogeneity need be worrisome, and not all worrisome heterogeneity need be statistically significant . As noted above, studies displaying worrisome heterogeneity should be tagged with a minus sign at the end of their designated level clinical decision rule (these are algorithms or scoring systems that lead to a prognostic estimation or a diagnostic category) see note 2 for advice on how to understand, rate, and use trials or other studies with wide confidence intervals met when all patients died before the rx became available, but some now survive on it; or when some patients died before the rx became available, but none now die on it by poor - quality cohort study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both exposed and nonexposed individuals, and/or failed to identify or appropriately control known confounders, and/or failed to carry out a sufficiently long and complete follow - up of patients . By poor - quality case - control study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both cases and controls, and/or failed to identify or appropriately control known confounders split - sample validation is achieved by collecting all the information in a single tranche, then artificially dividing this into derivation and validation samples an absolute sppin is a diagnostic finding whose specificity is so high that a positive result rules in the diagnosis . An absolute snnout is a diagnostic finding whose sensitivity is so high that a negative result rules out the diagnosis good reference standards are independent of the test, and are applied blindly or objectively to all patients . Poor reference standards are haphazardly applied, but are still independent of the test . Use of a nonindependent reference standard (where the test is included in the reference, or where the testing affects the eference) implies a level 4 study better - value treatments are clearly as good but cheaper, or better at the same or reduced cost . Worse - value treatments are as good and more expensive or worse and equally or more expensive validating studies an exploratory study collects information and trawls the data (e.g., using a regression analysis) to find which factors are significant by poor - quality prognostic cohort study, the publishing committee means a study in which sampling was biased in favor of patients who already had the target outcome, or the measurement of outcomes was accomplished in fewer than 80% of study patients, or outcomes were determined in an unblinded, nonobjective way, or there was no correction for confounding factors good follow - up in a differential diagnosis study is more than 80%, with adequate time for alternative diagnoses to emerge (e.g., 16 months, acute; 15 years, chronic) good, bad, and worse refer to the comparisons between treatments in terms of their clinical risks and benefitstable 2japan abdominal emergency society grading system for ranking the recommendations in the clinical guidelinesgrade of recommendationdefinitionagood evidence to support a recommendation for usebmoderate evidence to support a recommendation for usecpoor evidence to support a recommendation or the effect may not exceed the adverse effects and/or inconveniences (toxicity, interaction between drugs and cost)dmoderate evidence to support a recommendation against useegood evidence to support a recommendation against use categories of evidence (see footnote for explanation of terms).6 the evidence - based classification used at the cochrane library: oxford centre for evidence - based medicine, levels of evidence (may 2001) (http://www.cebm.net/levels_of_evidence.asp#levels)5 was used as a basis to evaluate evidence presented in each item of literature, and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determined users can add a minus sign to denote the level that fails to provide a conclusive answer because of: note 1 either a single result with a wide confidence interval (such that, for example, an arr in an rct is not statistically significant but whose confidence intervals fail to exclude clinically important benefit or harm) note 2 or a systematic review with troublesome (and statistically significant) heterogeneity note 3 such evidence is inconclusive, and therefore can only generate grade d recommendations sr, systematic review; rct, randomized controlled trial; arr, absolute risk ratio by homogeneity, the publishing committee means a systematic review that is free of worrisome variations (heterogeneity) in the directions and degrees of results between individual studies . Not all systematic reviews with statistically significant heterogeneity need be worrisome, and not all worrisome heterogeneity need be statistically significant . As noted above, studies displaying worrisome heterogeneity should be tagged with a minus sign at the end of their designated level clinical decision rule (these are algorithms or scoring systems that lead to a prognostic estimation or a diagnostic category) see note 2 for advice on how to understand, rate, and use trials or other studies with wide confidence intervals met when all patients died before the rx became available, but some now survive on it; or when some patients died before the rx became available, but none now die on it by poor - quality cohort study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both exposed and nonexposed individuals, and/or failed to identify or appropriately control known confounders, and/or failed to carry out a sufficiently long and complete follow - up of patients . By poor - quality case - control study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both cases and controls, and/or failed to identify or appropriately control known confounders split - sample validation is achieved by collecting all the information in a single tranche, then artificially dividing this into derivation and validation samples an absolute sppin is a diagnostic finding whose specificity is so high that a positive result rules in the diagnosis . Absolute snnout is a diagnostic finding whose sensitivity is so high that a negative result rules out the diagnosis good reference standards are independent of the test, and are applied blindly or objectively to all patients . Poor reference standards are haphazardly applied, but are still independent of the test . Use of a nonindependent reference standard (where the test is included in the reference, or where the testing affects the eference) implies a level 4 study better - value treatments are clearly as good but cheaper, or better at the same or reduced cost . Worse - value treatments are as good and more expensive or worse and equally or more expensive validating studies test the quality of a specific diagnostic test, based on prior evidence . An exploratory study collects information and trawls the data (e.g., using a regression analysis) to find which factors are significant by poor - quality prognostic cohort study, the publishing committee means a study in which sampling was biased in favor of patients who already had the target outcome, or the measurement of outcomes was accomplished in fewer than 80% of study patients, or outcomes were determined in an unblinded, nonobjective way, or there was no correction for confounding factors good follow - up in a differential diagnosis study is more than 80%, with adequate time for alternative diagnoses to emerge (e.g., 16 months, acute; 15 years, chronic) good, bad, and worse refer to the comparisons between treatments in terms of their clinical risks and benefits japan abdominal emergency society grading system for ranking the recommendations in the clinical guidelines recommendations graded as either a or b indicate high quality . However, those graded as d or e are considered to be unacceptable . It must be borne in mind that such recommendation grades merely represent standards and should not be used to compel adherence to a given method of medical management in an actual clinical setting . The medical management method that is applied should be selected after taking into account the conditions prevailing in the relevant institution (staff, experience, equipment, etc .) And the characteristics of the individual patient . Pancreatitis as the key search word, a mesh - based exploration of the ovid medline database (19602004) yielded approximately 28000 items under the headings pancreatitis, acute necrotizing pancreatitis, and alcoholic pancreatitis . The items were then screened to confine the entries to those related to human pancreatitis . This yielded 14821 items in english, and after examination of all the titles and abstracts, 1348 were selected, and a careful examination of the full texts was conducted . Other sources quoted in these selected works, together with works suggested by the specialist members, as well as reports prepared by the research group, were included in the examination . The evidence obtained from each reference item was evaluated in accordance with the scientific classification method used at the cochrane library (table 1),6 and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determined . The relevant terms used are explained the footnote of table 1.6 based on the results obtained from these procedures, recommendation grades of a to e, were determined according to the definitions shown in table 2, and these recommendation grades are mentioned, as required, in the text of the guidelines . Table 1categories of evidence (see footnote for explanation of terms).6 the evidence - based classification used at the cochrane library: oxford centre for evidence - based medicine, levels of evidence (may 2001) (http://www.cebm.net/levels_of_evidence.asp#levels)5 was used as a basis to evaluate evidence presented in each item of literature, and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determinedleveltherapy / prevention, etiology / harmprognosisdiagnosisdifferential diagnosis / symptom prevalence studyeconomic and decision analyses1asr (with homogeneity) of rctssr (with homogeneity) of inception cohort studies; cdr validated in different populationssr (with homogeneity) of level 1 diagnostic studies; cdr with 1b studies from different clinical centerssr (with homogeneity) of prospective cohort studiessr (with homogeneity) of level 1 economic studies1bindividual rct (with narrow confidence interval)individual inception cohort study with> 80% follow - up; cdrvalidated in a single populationvalidating cohort study with good reference standards; or cdr tested within one clinical centerprospective cohort study with good follow - upanalysis based on clinically sensible costs or alternatives; systematic review(s) of the evidence; and including multiway sensitivity analyses1call or noneall or none case seriesabsolute sppins and snnoutsall or none case seriesabsolute better - value or worse - value analyses2asr (with homogeneity) of cohort studiessr (with homogeneity) of either retrospective cohort studies or untreated control groups in rctssr (with homogeneity) of level> 2 diagnostic studiessr (with homogeneity) of 2b and better studiessr (with homogeneity) of level> 2 economic studies2bindividual cohort study (including low - quality rct; e.g., <80% follow - up)retrospective cohort study or follow - up of untreated control patients in an rct; derivation of cdr or validated on split - sample onlyexploratory cohort study with good reference standards; cdr after derivation, or validated only on split - sample or databasesretrospective cohort study, or poor follow - upanalysis based on clinically sensible costs or alternatives; limited review(s) of the evidence, or single studies; and including multiway sensitivity analyses2coutcomes research; ecological studiesoutcomes researchecological studiesaudit or outcomes research3asr (with homogeneity) of case - control studiessr (with homogeneity) of 3b and better studiessr (with homogeneity) of 3b and better studiessr (with homogeneity) of 3b and better studies3bindividual case - control studynonconsecutive study; or without consistently applied reference standardsnonconsecutive cohort study, or very limited populationanalysis based on limited alternatives or costs, poor quality estimates of data, but including sensitivity analyses incorporating clinically sensible variations4case series (and poor - quality cohort and case - control studies)case series (and poor - quality prognostic cohort studies)case control study, poor or nonindependent reference standardcase series or superseded reference standardsanalysis with no sensitivity analysis5expert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on physiology, bench research, or first principlesexpert opinion without explicit critical appraisal, or based on economic theory or first principlesusers can add a minus sign to denote the level that fails to provide a conclusive answer because of: note 1 either a single result with a wide confidence interval (such that, for example, an arr in an rct is not statistically significant but whose confidence intervals fail to exclude clinically important benefit or harm)note 2 or a systematic review with troublesome (and statistically significant) heterogeneitynote 3 such evidence is inconclusive, and therefore can only generate grade d recommendationssr, systematic review; rct, randomized controlled trial; arr, absolute risk ratio by homogeneity, the publishing committee means a systematic review that is free of worrisome variations (heterogeneity) in the directions and degrees of results between individual studies . Not all systematic reviews with statistically significant heterogeneity need be worrisome, and not all worrisome heterogeneity need be statistically significant . As noted above, studies displaying worrisome heterogeneity should be tagged with a minus sign at the end of their designated level clinical decision rule (these are algorithms or scoring systems that lead to a prognostic estimation or a diagnostic category) see note 2 for advice on how to understand, rate, and use trials or other studies with wide confidence intervals met when all patients died before the rx became available, but some now survive on it; or when some patients died before the rx became available, but none now die on it by poor - quality cohort study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both exposed and nonexposed individuals, and/or failed to identify or appropriately control known confounders, and/or failed to carry out a sufficiently long and complete follow - up of patients . By poor - quality case - control study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both cases and controls, and/or failed to identify or appropriately control known confounders split - sample validation is achieved by collecting all the information in a single tranche, then artificially dividing this into derivation and validation samples an absolute sppin is a diagnostic finding whose specificity is so high that a positive result rules in the diagnosis . An absolute snnout is a diagnostic finding whose sensitivity is so high that a negative result rules out the diagnosis good reference standards are independent of the test, and are applied blindly or objectively to all patients . Poor reference standards are haphazardly applied, but are still independent of the test . Use of a nonindependent reference standard (where the test is included in the reference, or where the testing affects the eference) implies a level 4 study better - value treatments are clearly as good but cheaper, or better at the same or reduced cost . Worse - value treatments are as good and more expensive or worse and equally or more expensive validating studies an exploratory study collects information and trawls the data (e.g., using a regression analysis) to find which factors are significant by poor - quality prognostic cohort study, the publishing committee means a study in which sampling was biased in favor of patients who already had the target outcome, or the measurement of outcomes was accomplished in fewer than 80% of study patients, or outcomes were determined in an unblinded, nonobjective way, or there was no correction for confounding factors good follow - up in a differential diagnosis study is more than 80%, with adequate time for alternative diagnoses to emerge (e.g., 16 months, acute; 15 years, chronic) good, bad, and worse refer to the comparisons between treatments in terms of their clinical risks and benefitstable 2japan abdominal emergency society grading system for ranking the recommendations in the clinical guidelinesgrade of recommendationdefinitionagood evidence to support a recommendation for usebmoderate evidence to support a recommendation for usecpoor evidence to support a recommendation or the effect may not exceed the adverse effects and/or inconveniences (toxicity, interaction between drugs and cost)dmoderate evidence to support a recommendation against useegood evidence to support a recommendation against use categories of evidence (see footnote for explanation of terms).6 the evidence - based classification used at the cochrane library: oxford centre for evidence - based medicine, levels of evidence (may 2001) (http://www.cebm.net/levels_of_evidence.asp#levels)5 was used as a basis to evaluate evidence presented in each item of literature, and the quality of evidence for each parameter associated with the diagnosis and treatment of acute pancreatitis was determined users can add a minus sign to denote the level that fails to provide a conclusive answer because of: note 1 either a single result with a wide confidence interval (such that, for example, an arr in an rct is not statistically significant but whose confidence intervals fail to exclude clinically important benefit or harm) note 2 or a systematic review with troublesome (and statistically significant) heterogeneity note 3 such evidence is inconclusive, and therefore can only generate grade d recommendations sr, systematic review; rct, randomized controlled trial; arr, absolute risk ratio by homogeneity, the publishing committee means a systematic review that is free of worrisome variations (heterogeneity) in the directions and degrees of results between individual studies . Not all systematic reviews with statistically significant heterogeneity need be worrisome, and not all worrisome heterogeneity need be statistically significant . As noted above, studies displaying worrisome heterogeneity should be tagged with a minus sign at the end of their designated level clinical decision rule (these are algorithms or scoring systems that lead to a prognostic estimation or a diagnostic category) see note 2 for advice on how to understand, rate, and use trials or other studies with wide confidence intervals met when all patients died before the rx became available, but some now survive on it; or when some patients died before the rx became available, but none now die on it by poor - quality cohort study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both exposed and nonexposed individuals, and/or failed to identify or appropriately control known confounders, and/or failed to carry out a sufficiently long and complete follow - up of patients . By poor - quality case - control study, the publishing committee means one that failed to clearly define comparison groups and/or failed to measure exposures and outcomes in the same (preferably blinded) objective way in both cases and controls, and/or failed to identify or appropriately control known confounders split - sample validation is achieved by collecting all the information in a single tranche, then artificially dividing this into derivation and validation samples an absolute sppin is a diagnostic finding whose specificity is so high that a positive result rules in the diagnosis . Absolute snnout is a diagnostic finding whose sensitivity is so high that a negative result rules out the diagnosis good reference standards are independent of the test, and are applied blindly or objectively to all patients . Poor reference standards are haphazardly applied, but are still independent of the test . Use of a nonindependent reference standard (where the test is included in the reference, or where the testing affects the eference) implies a level 4 study better - value treatments are clearly as good but cheaper, or better at the same or reduced cost . Worse - value treatments are as good and more expensive or worse and equally or more expensive validating studies . An exploratory study collects information and trawls the data (e.g., using a regression analysis) to find which factors are by poor - quality prognostic cohort study, the publishing committee means a study in which sampling was biased in favor of patients who already had the target outcome, or the measurement of outcomes was accomplished in fewer than 80% of study patients, or outcomes were determined in an unblinded, nonobjective way, or there was no correction for confounding factors good follow - up in a differential diagnosis study is more than 80%, with adequate time for alternative diagnoses to emerge (e.g., 16 months, acute; 15 years, chronic) good, bad, and worse refer to the comparisons between treatments in terms of their clinical risks and benefits japan abdominal emergency society grading system for ranking the recommendations in the clinical guidelines recommendations graded as either a or b indicate high quality . However, those graded as d or e are considered to be unacceptable . It must be borne in mind that such recommendation grades merely represent standards and should not be used to compel adherence to a given method of medical management in an actual clinical setting . The medical management method that is applied should be selected after taking into account the conditions prevailing in the relevant institution (staff, experience, equipment, etc .) And the characteristics of the individual patient . The guidelines are evidence - based and determined with a grade for each medical practice, taking actual conditions into account . The guidelines specify the criteria for the diagnosis of acute pancreatitis and the assessment of its severity that have been prepared by the research group and are in widespread use in japan . Because the guidelines address so many different topics, an index of all works used is included at the end of the series of articles for the convenience of readers.
|
The missouri department of health and senior services conducted this investigation in response to the hospital s identification of an increased number of tracheal aspirates that were positive for b. cereus collected from newborns who were on ventilators during march may, 2011 . All tracheal aspirate culture results obtained in the neonatal intensive care unit (nicu) during january 2010june 2011 were reviewed . Nicu data was also searched for positive b. cereus culture from other specimens, such as blood, body fluids, or tissues . Investigators thoroughly evaluated respiratory management practices in the unit by direct observation, respiratory records review, and an interview with the respiratory therapist . Several environmental cultures were obtained from the flow sensors of the unit s ventilators over the 1-month period . B. cereus isolates were forwarded to the centers for disease control and prevention to be molecularly characterized by using multilocus sequence typing (mlst) (10). The dna was used as a template in pcrs with the primers described on the bacillus cereus mlst web site (www.pubmlst.org/bcereus) for the 7 loci which define the mlst scheme . The sequences for the loci glpf, gmk, ilvd, pta, pur, pyca, and tpi were then assigned allele designations . A greater number of alleles that match between strains indicates a higher level of relatedness (10). Prevalence of b. cereus positive specimens was compared by using the mann - whitney u test . Retrospective analysis of tracheal aspirate culture results showed significant increase (p = 0.039) in b. cereus isolation between march and may, 2011 (figure 1). No bacillus spp . Were isolated from blood, other body fluids, or tissues during the study period . The chart review of the case - patients comprising the cluster of b. cereus colonization revealed that none received a diagnosis of clinical b. cereus infection . All patients were treated with vancomycin or tobramycin, or both, for indications not related to b. cereus in tracheal aspirate . One case - patient died 108 days later without evidence that b. cereus contributed to the outcome . Epidemiologic curve of bacillus spp.positive tracheal aspirates from newborns on ventilators, january 2010january 2012 . Investigation of the ventilation procedures in the nicu revealed that most equipment used for respiratory care was disposable, designated for single - patient use . Telford, pa, usa; www.draeger.us/sites/enus_us/pages/hospital/evita-xl.aspx) was used for mechanical ventilation of infants who were intubated to treat severe respiratory compromise . The draeger evita v500 is a microprocessor controlled ventilator offering both mandatory and spontaneous ventilation modes for adult, pediatric, and neonatal patients . Heated and humidified gas flows from the ventilator unit, through the inspiratory circuit and neoflow air flow sensor to the patient through an endotracheal tube . Upon exhalation, gas flows back through the air flow sensor into the expiratory circuit and returns to the ventilator through the expiratory flow sensor and exhalation valve . In addition to the ventilator, reusable respiratory equipment comprised a proximal air flow sensor, expiratory flow sensor, exhalation valve, and circuit temperature probe . The sensor closest to the newborn s mouth was an air flow sensor located inside the disposable ventilation circuit (figure 2). From 9 environmental cultures obtained from 9 air flow sensors, 1 was positive for bacillus spp ., and was later confirmed as b. cereus by the state public health laboratory . Mlst was performed for 8 b. cereus isolates from case - patients and for 1 environmental isolate from the air flow sensor . One locus for the remaining 5 strains did not yield an amplicon for sequencing after repeated attempts and, thus, could not be assigned a sequence type . The isolates that included sequence type (st) 73 and st94 were closely related to each other because they differed by merely 1 locus, gmk . The strains that were not fully typed because of the inability to obtain sequences for locus pta were also closely related to st73 or st94 because the other loci matched . There was 1 match between strains isolated from 1 case - patient and the air flow sensor, which was st73 . The contaminated air flow sensor was then sterilized by using a steam autoclave . A repeat culture of this sensor after sterilization was negative . We found that air flow sensors were routinely disinfected by placing them in a container with 70% alcohol solution for 60 minutes . After discovery of the air flow sensor contaminated with b. cereus, the disinfection policy was changed . All air flow sensors were first soaked in enzol enzymatic detergent (asp, irvine, ca, usa; www.aspjj.com/us/products/enzol) solution and then sent for steam autoclave sterilization at 134c (273.2f). After implementation of new disinfection and sterilization procedures, no new cases of b. cereus tracheal colonization were identified in the nursery . In this cluster, contaminated proximal air flow sensors were the likely source of tracheal colonization with b. cereus in newborn infants, supported by a genetic match by mlst between a strain isolated from 1 case - patient and the contaminated air flow sensor . B. cereus transmission from contaminated respiratory equipment has been reported in other geographic areas . In the netherlands, an outbreak of b. cereus infections in a pediatric intensive care unit caused by contaminated reusable ventilator air flow sensors switching to disposable air flow sensors stopped colonization with b. cereus in that unit . In canada, an outbreak of b. cereus infections among patients in an adult icu was linked to colonized ventilator circuitry (8). In the united kingdom, reusable ventilator circuits were also identified as the cause of a b. cereus outbreak among intubated nicu patients (9). Our investigation underscores the necessity of close monitoring of occurrences of bacillus spp . In tracheal aspirates since clustering of such cases, b. cereus isolates were either st73, st94, or closely related to those sequence types . St73 and st94 are associated with strains previously described as having caused illness in elderly persons . Strains with st73 were implicated in cases of septicemia (12), and of sepsis and pneumonia (13). Strains with st 94 were recovered from patients with pneumonia (14). B. cereus strains harboring b. anthracis plasmids such as pxo1, have also been associated with severe and fatal respiratory infections (15). All case - patients in our investigation were considered to be colonized with b. cereus without clinical implications . Since all of them received intravenous antimicrobial drugs effective against b. cereus, it is conceivable that the clinical course of those patients could have been different without such treatment . Should not be routinely viewed as clinically insignificant and further testing to determine exact strain should be considered under appropriate clinical and epidemiologic circumstances . Proper disinfection of the entire ventilator circuit as recommended by the equipment manufacturer is crucial in avoiding potentially lethal b. cereus infections.
|
Lung cancer is the second most common cancer in both men and women with an estimated 224,210 cases expected to be diagnosed in 2014 in the united states (us). It is also the leading cause of cancer related deaths in the us accounting for 27% of all cancer related deaths . The majority of lung cancer cases fall under the category of non - small - cell lung cancer (nsclc). Figure 1 shows the selection of the non - small - cell lung cancer cases included in the study . Racial / ethnic disparities have been shown to influence survival outcomes in nsclc [24]. Disparities in survival outcomes among racial / ethnic groups may be attributed to a complex interaction between genetic and lifestyle factors [4, 5]. Compared to non - hispanic whites (nhw), blacks have a higher incidence of lung cancer and more advanced disease at diagnosis with worse survival outcomes [68]. Despite a lower incidence, hispanics are more likely to be diagnosed with advanced disease with poor outcomes compared to nhw [2, 9]. Asian / pacific islanders (api) have a lower incidence of nsclc compared to nhw . Interestingly, previous literature has shown that cancer related mortality is favorable in api compared to other racial / ethnic groups for early stage (stages ia and ib) nsclc [11, 12]. However, survival outcomes in api and other racial / ethnic groups based on the recently published american joint committee on cancer (ajcc) 7th edition have not been evaluated in detail . In this study, our primary objective was to utilize an established large nationwide cancer registry to ascertain racial / ethnic disparities in nsclc clinicopathologic features and survival outcomes . We used the national cancer institute (nci) surveillance, epidemiology, and end result (seer) cancer registry that collects large observational data across 18 cancer registry sites . The database was accessed using the seerstat 8.1.5, http://seer.cancer.gov/seerstat, assessed may 01, 2014 . To be eligible, we identified patients diagnosed between 01/01/2004 to 31/12/2010 with nsclc (icd - o-3 site c34.0c34.9) based on the selected histology codes: squamous and transitional cell: 8051 - 8052, 80708084, and 81208131, adenocarcinoma in situ [ais]: 82508255, nonadenocarcinoma in situ [non - ais]: 8050, 81408149, 81608162, 81908221, 82568263, 82708280, 82908337, 83508390, 84008560, 85708576, and 8940 - 8941, large cell: 80118015, and others: 8010, 80208022, 80308040, 8046, 80908110, 81508156, 81708175, 8180, 8230 - 8231, 82408249, 83408347, 8561 - 8562, and 85808671 . We utilized the time period stated, due to the ability to restage the tumors to the latest ajcc 7th edition using data from the collaborative stage variables . To investigate any existing treatment or tumor racial / ethnic disparities and disease - specific survival (dss), racial / ethnic groups were categorized as nhw, hispanics, blacks, and api . Clinicopathologic characteristics included age at diagnosis, gender, birth country, marital status, tumor grade, tumor size, ajcc stage, and histology . Decade long time intervals <30 years, 3039, 4049, 5059, 6069, 7079, others, a term that is inclusive of divorced, widowed, or separated individuals . Birth within the us or outside was used to monitor the immigration effect . The variable tumor size reflected the size of the tumor mass and was classified categorically to <30 mm, 3050 mm, 5070 mm,> 70 mm or in cases with no recorded tumor mass to no mass was found . All forms of radiation were collectively grouped as radiation received, while all forms of cancer directed surgeries were coded collectively as cases after 2010 were excluded to allow a minimum of 12 months of follow - up period . The kruskall - wallis nonparametric test was employed to examine the differences that may exist among various racial / ethnic groups and tumor characteristics . The difference between the racial / ethnic groups and the reasons for no surgery was measured using fisher's exact test . The end point was dss which was measured in months from the date of diagnosis to death due to lung cancer or censoring, which included either being alive, lost to follow - up, or died due to other causes . Multivariate cox proportional hazard models were used to establish the weight of different characteristics (grade, age at diagnoses, tumor size, histology, marital status, race / ethnicity, gender, radiation, surgery, and radiation / surgery sequence) on prognostic significance contributing to the survival in each respective ajcc stage . The z test was employed to examine the proportional differences that may exist between the referent nhw and other race / ethnic groups . The models were constructed using ibm spss statistical software, version 21.0 (ibm corp . Released 2012, ibm spss statistics for windows, version 21.0, armonk, ny: ibm corp . ). Our database yielded 190,046 patients with nsclc: 145646 (76.6%) nhw, 10350 (5.4%) hispanics, 22525 (11.9%) blacks, and 11525 (6.1%) api (table 1). Compared to nhw stage i diagnosis (17.8%), blacks had the least proportion (12.4%) preceded by hispanics (13.5%) and api (14.3%) (p <0.05). Nhw had the most stage ii diagnosis (13.1%), followed by blacks (12.7%), api (11.7%), and hispanics (11.4%) (p <0.05). Blacks had the highest stage iii diagnoses (20.5%), followed by the referent nhw (18.5%), hispanics (17.7%), and api (17.2%) (p <0.05). Api had the highest stage iv diagnoses (49.3%), followed by hispanics (47.7%), blacks (47.4%), and the referent nhw (42.6%), respectively . Compared to the referent nhw's grades 1 (5.0%) and 2 (16.5%) statuses, blacks had the least amount of grade 1 (3.3%) and grade 2 (14.8%) tumors, while hispanics (5.4%) and api (5.7%) both had relatively greater grade 1 representations, respectively (p <0.05). Regarding high grade tumors, api had significantly the lowest proportions of both grade 3 (25.7%) and grade 4 (1.8%) cases, compared to nhw . Hispanics also had lower grade 3 (26.8%) diagnoses, compared to nhw, while blacks had greater proportions (28.2%). Squamous and transitional cell diagnoses were significantly less common in api (15.8%) and hispanics (19.2%) compared to nhw (23.6%) (p <0.05). Although blacks had greater shares (24.1%), this was nonsignificant . Compared to nhws' ais (4.1%) and non - ais (38.3%) histological diagnoses, hispanics had greater proportions (5.0% and 41.9%), with api having the greatest representation (6.3% and 49.6%). Alternatively, blacks yielded the fewest ais (2.8%) cases in our study (p <0.05). For large cell carcinoma in the referent group (3.4%), both api (2.5%) and hispanics (3.0%) ranked lower, while a greater share was found among blacks (4.1%) (p <0.05). Compared to nhw's later mean age at diagnosis of 68.86 years 11.239, an earlier onset was observed among api (68.05 12.315 years), hispanics (67.40 12.395 years), and blacks (64.65 11.467 years) (p <0.05). Greater than 50% of cases among blacks were seen in the 5th (25.4%) and 6th (31.3%) decades, respectively, compared to the majority of the cases that presented later in the 6th and 7th decades among other ethnicities (p <0.05). In our study, blacks (29.2%) had the highest status, followed by hispanics (15.4%), and nhw (10.5%), with lowest observations noted among api (9.5%). Blacks (32.9%) and nhw (33.0%) had higher others status, with relative lower proportions observed amongst hispanics (29.3%) and api (22.5%) (p <0.05). Finally, married individuals were significantly more common among aip (64.9%) and less common among blacks (33.6%) compared to nhw (33.0%). Significant majority of the api (58.2%) were born outside the united states (us). A greater proportion of hispanics (34.9%), compared to nhw (4.1%), and blacks (1.5%) are born outside (p <0.05). No tumor was found in 0.3% of the black population, compared to (0.4%) nhw (p <0.05). Both nhw (31.0%) and api (27.8%) had the greater proportion of tumor 30 mm, compared to blacks (25.1%) and hispanics (26.7), respectively . A similar trend of proportionality was observed in tumors greater than 30 mm but not more than 50 mm, with api (23.7%) and nhw (22.6%) being higher, compared to blacks (22.0%) and hispanics (21.0%) (p <0.05). Alternatively, blacks had relatively greater proportion of tumors greater than 50 mm, followed by hispanics, nhw, and api, respectively . With regard to stage i nsclc cases, radiation was less frequently utilized in both api (11.0%) and hispanics (12.2%) compared to nhw (16.3%) whereas greater proportions of blacks (18.9%) were treated with radiation (p <0.01). This trend was also observed in stage ii cases, with relatively more nhw (33.9%) and blacks (36.9%) than api (26.5%) and hispanics (28.6%) receiving radiation as part of their treatment (p <0.01). Higher rates of blacks (57.3%) had radiation as part of the treatment in stage iii followed by nhw (55.3%), api (50.5%), and hispanics (48.2%) (p <0.01). Similarly, blacks (44.9%) had the highest proportions of radiation utilization compared to nhw (44.1%), api (41.0%), and hispanics (39.1%) in the stage iv cohort (p <0.01). For ajcc stage i cases, a greater proportion of api (80.4%) were treated with cancer directed surgery compared to hispanics (75.4%), nhw (75.6%), and blacks (65.7%) (p <0.01). Blacks (35.1%) had the lowest rate of surgical treatment in stage ii while nhw (47.3%) had the highest rate followed by api (44.7%) and hispanics (44.7%) (p <0.01). Compared to nhw (17.0%), lower rates of surgical treatment in blacks (12.0%) were observed while api (20.4%) and hispanics (19.4%) had greater proportions that underwent surgery (p <0.01). Nhw (4.5%) had the highest proportion of cancer directed surgery compared to hispanics (3.8%), api (3.6%), and blacks (3.5%) in stage iv nsclc (p <0.01). The most common reason for no surgery for all ethnicities was because it was not recommended . This reason was proportionally more common among api and least among blacks (p <0.05) for all ajcc stages except stage i (p <0.05). In contrast, api had the highest proportion of refusal for surgical treatment in early stage nsclc patients (p <0.05). Multivariate cox proportional models were utilized to analyze the variables contributing to the dss among different ajcc stage . Demographic variables that had improved survival at each ajcc stage were; female gender, and being married, (p <0.05). Immigrants born outside the us had significant improved survival outcome in comparison to us born patients . Patients with stage ii diagnosed at age 7079 (hazard ratio [hr]: 4.077, p <0.05) and> 80 (hr: 5.14, p <0.05) had poor outcomes; patients> 80 years had worsened survival among stage iv (hr: 1.626, p <0.05). Api had a significantly improved survival in stage i (hr: 0.775, p <0.05), stage ii (hr: 0.791, p <0.05), and stage iv (hr: 0.858, p <0.05). This improvement was not observed in stage iii (hr: 0.966, p> 0.1). Unlike api, both hispanics and blacks did not have impact on the survival favorably compared to nhw (table 3). Higher grade was uniformly associated with poor prognosis across all the stages (p <0.05). However both ais and non - ais diagnoses (with the exception of stage ii, hr: 0.966, p> 0.05) were both associated with improved survival compared to the referent squamous and transitional diagnosis, with ais being the more favorable diagnosis (table 2). Iii hr: 0.60, and stage iv: 0.917, p <0.01). Surgical treatment favorably impacted stage i (hr: 0.231), and stage ii (hr: 0.282) survival respectively, (p <0.01). This study utilized the seer database to examine racial / ethnic disparities in nsclc clinicopathologic features and stage - based survival outcomes . Api were more likely to be diagnosed with ais histology but yet presented with late stage disease . Our analysis showed that cancer directed surgery and radiation therapy were significantly less likely to be offered to api compared to nhw . Despite this, compared to nhw, api had increased disease - specific survival for early stage (i and ii) and stage iv nsclc . This analysis determined that survival disparities are also seen in api based on the recent ajcc 7th edition staging system . Previous retrospective analyses have shown api to have decreased mortality compared to nhw for stage i disease, with an overall survival advantage regardless of smoking status which is consistent with our results [79]. Our analysis also found increased survival in api with stage ii disease compared to nhw . Stage iv disease was seen more frequently in api than in nhw with lower rates of cancer directed surgery and radiation therapy . Despite this, there was a survival advantage for api compared to nhw in stage iv nsclc which is consistent with prior studies . Improved outcomes in api may be attributed to favorable demographic and clinicopathologic features demonstrated in our analysis including being married, birth outside of the us, ais histology, and earlier age at diagnosis . Regarding treatment modalities in stage iv, despite improved survival, the api cohort was less likely to receive cancer directed surgery compared to nhw . Pertinently, there was greater proportion of surgery which was not part of the treatment plan . According to chang et al ., api as a group had better overall survival after nsclc diagnosis compared to nhw, and single marital status was associated with decreased survival in the api population, which is consistent with our results . Nsclc is a heterogeneous disease that is influenced by genetic, lifestyle, and socioeconomic elements . These elements are likely major factors in the disparate presentations and outcomes among different racial / ethnic groups . Smoking status is an important prognostic indicator, with an improvement in overall and disease - specific survival in never smokers compared to patients with a smoking history [9, 11]. Response to therapy including surgery, chemotherapy, and radiation is also improved in never smokers even in advanced disease . Unlike nhw and black patients diagnosed with nsclc, a relatively high percentage of never smokers are seen in the api us population . However, besides smoking status, additional factors may account for improved outcomes because asian ethnicity independently is a favorable prognostic indicator for overall survival in both smokers and never smokers . In addition to a higher prevalence of smoking in lower ses groups, they are unlikely to receive adequate health care . In prior observational studies, blacks were less likely to receive surgery, chemotherapy, or radiation for stage iii disease and were less likely to receive chemotherapy for stage iv disease in comparison to nhw [1618]. In our study, cancer directed surgery was less likely to be offered to blacks compared to nhw . However, our study is unique in that it demonstrates that radiation is more significantly likely to be administered to blacks diagnosed with nsclc . Poor access to quality health care is a major factor in racial / ethnic disparities, which have shown that when equivalent health care access is provided, survival outcomes become comparable [3, 13, 19, 20]. Further research is necessary to determine whether lung cancer treatment is suboptimal in api residing in the us . Overexpression of the epidermal growth factor receptor (egfr) leading to aberrant tyrosine kinase mediated signaling is implicated in approximately 70% of nsclc cases and is associated with a poor prognosis; egfr tyrosine kinase inhibitors (tki) were developed as a potential therapeutic option to improve outcomes . A greater understanding of the activity of tki has led to the discovery that the efficacy of these inhibitors is dependent on the presence of egfr activating mutations instead of the degree of egfr overexpression . Egfr activating mutations are seen more commonly in females, ais histology, never or light smokers, and east asians [22, 23]. The prevalence of egfr activating mutations in other racial / ethnic groups such as blacks and nhw appears to be highly variable [2426]. Improved survival in api potentially could be due to the presence of these mutations; however, randomized controlled trials have not shown an overall survival benefit with tki therapy in the adjuvant, stage iii maintenance, first - line metastatic, and second - line treatment settings [2731]. This could have led to incorrect classification of race / ethnicity and tumor classification . In our analysis however, we found the number of missing cases to be proportional among different racial / ethnic groups . In addition, we were not able to account for both genetic and lifestyle factors linked to nsclc including testing for egfr, kras, and alk mutations, familial history, smoking history, and occupational exposure to carcinogens . This is the first seer analysis to utilize the recent ajcc 7th edition to determine survival outcomes in api compared to nhw . Interestingly, in all stages, except for stage iii, there was a significant survival benefit . This may be due to an insufficient sample size but also may be due to disparities in tumor biology and lifestyle factors specific for this stage . Further research is necessary to gain a better understanding of the nsclc outcomes in the api population residing in the us.
|
Diabetes is a metabolic disease that leads to high blood sugar due to either insulin insufficiency, insulin resistance or both . According to the world health organization at least 171 million people (2.8% of the world population) suffered from diabetes in year 2000 . It is expected that more than 70% of total diabetic patients in the world will be from developing countries by year 2030 . The prevalence of type 2 diabetes in iran ranges from 1.3% to 14.5% which will increase as the population ages in both males (10.6%) and females (11.3%). Vascular diseases are one of the most common causes of morbidity and mortality in diabetic patients . Although, there is positive relation between insulin resistance and vascular disease, the exact mechanisms by which diabetes leads to arthrosclerosis is not well- understood . C - reactive protein (crp) and interleukin 6 (il-6) the two most sensitive markers of inflammation have been elevated in patients with type 2 diabetes . In addition, high crp level is shown to be a risk factor for developing type 2 diabetes, which may be atherogenic . Oxidative stress is a component of cellular damage and has an important role in the pathogenesis of a number of human diseases including atherosclerosis . Mechanisms that contribute to increased oxidative stress in diabetes may include not only increased non - enzymatic glycosylation and auto - oxidative glycosylation but also to decreasing antioxidant defence potential . Fao / who, define probiotics as live microorganisms which when administered in adequate amounts confer a health benefit on the host . Lactic acid bacteria (lab) and bifidobacteria are the most common types of microbes used as probiotics . Animal studies showed that lactobacillus gg treatment not only reduces glucose intolerance but also significantly decrease hyperglycemia in streptozotocin induced diabetes rats . Among other beneficial effects of probiotics and prebiotics, lactobacilli and bifidobacteria are the primary probiotic bacteria which are associated with cholesterol reduction, although comparable effect may be produced by other lactic acid bacteria, such as enterococci . It has also been reported that oral administration of heat killed lactobacillus casei to non - obese diabetic (nod) mice reduces the incidence of diabetes, but the mechanism underlying this effect has not been clarified . This study was designed to determine the effect of probiotics on lipid profile, glycemic control, insulin level, oxidative stress and inflammatory markers in patients with type 2 diabetes . This single - blinded clinical trial comprised 40 patients with type 2 diabetes recruited from medical clinic affiliated with shiraz university of medical sciences (sums) shiraz iran . Diabetic patients with fasting blood glucose 126 mg / dl, aged from 25 to 65 years, and diagnosed as having diabetes for less than 15 years were eligible for the study . Exclusion criteria were current smokers, subjects on non - steroidal anti - inflammatory drugs and multivitamin, as well as patients undergoing hormone replacement therapy, and those with any chronic diseases involving kidney, liver, and lung . The research was approved by the ethics committee of sums, and written informed consent was obtained from all patients prior to commencement of the study . Subjects were initially studied during a screening visit after an overnight fast starting from 8 pm in previous evening baseline plasma samples were collected and analyzed for triglyceride, total cholesterol, ldl - c, hdl - c, glucose, insulin, malondialdehyde, hs - crp and il-6 . Using balanced block random sampling, subjects were then divided into two groups of intervention (probiotics) and placebo . Patients in the intervention or treatment group received 1500 mg probiotic capsules twice daily, after lunch and evening meal for 6 weeks . The lactobacillus probiotics contained l. acidophilus, l. bulgaricus, l. bifidum, and l. casei . Patients in placebo group received 1500 mg capsules containing 1000 mg magnesium stearate twice daily for six weeks . Magnesium stearate is generally considered safe for human consumption at levels below 2500 mg / kg per day . According to the fda s subcommittee report on gras (generally recognized as safe) substances (scogs), adding magnesium stearate directly to human food after six weeks of experiment, fasting blood samples were collected and analyzed for all aforementioned parameters . Methods of data gathering demographic data including age, sex, weight, height, body mass index (bmi), and waist to hip ratio (whr) were measured before and after the intervention . Auto - analyzer bio - systems a-25 was used to determine the lipid profile and blood glucose concentration . Elisa method was employed to determine insulin levels, high sensitive crp (hscrp) and il-6 . Comparison between different groups was performed through two independent samples t - test . In the absence of normal distribution, comparison between groups was made using non - parametric wilcoxon on signed ranks and mann - whitney tests . The study was conducted on 34 patients, of which 26 were females and 8 males . There were no significant differences in bmi and whr between placebo and treatment groups (table 1). The mean anthropometric data in the placebo and treatment groups * standard deviation; * * waist to hip ratio; * * * body mass index table 2 shows changes in biochemical markers after probiotic treatment . The fasting blood sugar did not change significantly after probiotic treatment (table2). Serum triglyceride concentration was reduced in probiotic treated group but the change was not significant (table2). There were no significant differences in total serum cholesterol, ldl - c, and hdl - c levels, between probiotic and placebo groups (table2). Fasting plasma insulin level did not change in probiotic group compared to placebo group (table2). The mean parameters in placebo and treatment groups * non - parametric wilcoxon on signed ranks test; insulin - sensitivity measure: quicki (quantitative insulin sensitivity check index): 1/log (glucose0 (mg / dl))+log (insulin0 (mu / ml)); insulin - resistance measures: homa ir (homeostasis model for insulin resistance): insulin0(mu / ml)glucose0 (mmol / l)/22.5, firi (fasting insulin - resistance index): insulin0 (mu / ml)glucose0 (mmol / l)/25, bennetts index: 1/log (glucose0 (mmol / l))log (insulin0 (mu / ml)), insulin / glucose: insulin0 (mu / ml)-to - glucose0 (mmol / l) ratio although mda and il-6 levels were reduced in treatment group, but the changes were not statistically significant (table 2). There were an increase in crp levels in treatment group compared to placebo, but the change was not significant (table2). Insulin - sensitivity was determined through quantitative insulin sensitivity check index (quicki) and insulin - resistance by homa ir, firi, bennett s index and ins / gluc ratio but there were no significant changes in these indices (table 2). Diabetic complication, such as cardiovascular disease on the one hand and the dramatic growth of diabetic incidence on the other, demands a natural and safe solution to control and delay these complications . A strong association has been found between the level of oxidative stress and risk of cardiovascular disease . Oxidative stress not only causes much pathopysiological complication but is also linked to insulin resistance which in turn causes diminished glucose uptake and disposal in peripheral tissues, and increasing glucose production in the liver . It has also been reported that postprandial hyperlipidemia and hyperglycemia are associated with increasing ldl - c oxidation and higher risk for cardiovascular disease . Studies showed that probiotic containing foods may reduce the concentration of serum lipid and decreases both fasting and postprandial blood sugars in human . Mann and spoerry reported that lactic acid bacteria are associated with a marked reduction in the total serum cholesterol . Yun si et al, reported a significant reduction in fasting and postprandial glucose and decreasing hba1c in probiotic (bnr17) treated rats . In the present study, we were not able to demonstrate any significant effect on fasting blood glucose after treating with probiotics . Serum triglyceride concentration was decreased but the change was not statistically significant . The reasons for these unexpected results can be related to either the small sample size or short duration of the study . Observed some strains of lactobacillus acidophilus may decrease cholesterol absorption by enhancing the binding of cholesterol to the intestinal lumen . Other possible cholesterol lowering properties of probiotics are deconjugation of bile by bile salt hydrolyses, binding of cholesterol to cellular surface and coprecipitation of cholesterol with deconjugated bile . This study showed no significant improvement in serum total cholesterol, ldl - cholesterol and or hdl - cholesterol after treating diabetic patients with probiotics . Yadav et al . In their study on diabetic rats reported a marked reduction in pancreatic tissue oxidative damage due to a significant decrease in lipid peroxidation . In another study the same investigators showed that probiotic dahi not only decreases oxidative damage but also increases the antioxidant content and activities of catalase, glutathione peroxidase and superoxide dismutase in diabetic rats . The mechanism by which oxidative stress results in diabetic complications and tissue damage is the overproduction of the reactive oxygen species and reduction of the antioxidant defense function of the body . Lipid peroxidation is one of the main biological targets of oxidative stress, which leads to formation of secondary products such as malondialdehyde that exacerbates oxidative damage . Mda has been found to significantly increase in pathological conditions, which is considered as a common oxidative stress biomarker in recent years . The present study, showed a reduction in mda levels in probiotic - treated group; however, the reduction was not statistically significant . . Showed a significant reduction in blood glucose and mda level in type 2 diabetic patients after consuming probiotic yogurt . Evaluated the functional efficacy of antioxidative properties of probiotic in healthy subjects and found a significant improvement in blood total antioxidant activity (taa) and total antioxidant status (tas) after receiving probiotics . Harisa et al . Also reported a significant decrease in mda concentration after treating diabetic rats with l. acidophilus . Divergent evidence is available on the anti - inflammatory properties of probiotics . While some studies reported beneficial effect, others showed no effect at all . In this study, interleukin-6 (il-6) examined the effect of probiotic bacteria on in vivo cytokine, antibody, and inflammatory responses in allergy - prone infants and showed that infants receiving probiotic had higher plasma levels of crp, and il-10 compared with those in the placebo group . Studied the effect of lactobacillus rhamnosus gg (lgg) on rheumatoid arthritis (ra) patients and reported an increase in serum il-1 beta after lgg treatment with no significant change in il-6, tnf - alpha, myeloperoxidase (mpo), and il-10 . A reduction in oxidative stress and cardiovascular risk factor seems to be an ideal treatment strategy in type 2 diabetic patients . The result of this study demonstrated that a 6 weeks oral treatment with probiotics decreased the concentration of tg, mda, and il-6 level in type 2 diabetic patients; however the change were not statistically significant . These finding could warrant future studies to determine the therapeutic effects of probiotic on diabetic patients.
|
The u.s . Food and drug administration (fda) has approved around 30 antidepressant medications for the treatment of major depression . Among them are selective serotonin reuptake inhibitors (ssris). These drugs change the balance of serotonin in the brain, such as fluoxetine (prozac), paroxetine (paxil), sertraline (zoloft), escitalopram (lexapro), and citalopram (celexa). Another family of medications, selective serotonin and norepinephrine reuptake inhibitors (snris), help increase serotonin and norepinephrine levels in the brain, such as venlafaxine (effexor), duloxetine (cymbalta), and levomilnacipran (fetzima). Still others in this family include bupropion (wellbutrin), vortioxetine (brintellix), mirtazapine (remeron) vilazodone (viibryd), nefazodone (serzone), and trazodone (desyrel). In addition, tricyclics and monoamine oxidase inhibitors, which are two classes of older antidepressants that work by inhibiting the brain s reuptake of serotonin and norepinephrine, are also approved but tend to cause more side effects than the other classes of antidepressants . But pharmacotherapy is nt the only option; two other major classes of treatment are also available psychotherapy and somatic nonpharmacological treatments . In randomized, controlled trials, cognitive - behavioral therapy (cbt) and interpersonal psychotherapy (ipt) repeatedly have been demonstrated to be effective in the treatment of major depressive disorder (mdd). Whether other forms of psychotherapy, such as insight - oriented, psychodynamically based therapy, are effective in major depression remains controversial . Brain stimulation therapies involve activating or touching the brain directly with electricity, magnets, or implants, and the fda has approved three somatic nonpharmacological treatments for depression: electroconvulsive therapy (ect), vagus nerve stimulation (vns), and repetitive transcranial magnetic stimulation (rtms). Ect is generally considered the most effective of all depression treatments, although no head - to - head, randomized, controlled trial has compared it with other interventions . It generally requires inpatient hospitalization, at least initially, and general anesthesia with nine to twelve treatments over a three- to four - week period . Vns and rtms are both fda - approved for treatment - resistant depression; the former requires an invasive surgical procedure . Researchers have conducted relatively few controlled studies of these devices compared with the vast number of pharmacotherapy and psychotherapy treatment trials . With a plethora of drugs and psychotherapy approaches available, let us consider the problem psychiatrists encounter on a daily basis . A 50-year - old academic physician suffers from a classic major depressive episode associated with severe work stress . He has difficulty falling asleep, awakens several times during the night, and rises early with severe anxiety . He has reduced appetite, difficulty concentrating, and trouble enjoying any leisure activities, and he feels pessimistic about the future . He admits to passive contemplations about suicide, with recurring thoughts that if a car jumped the median and landed on his car, it would be an end to his suffering . He has no underlying medical disorder that might be contributing to depression, such as hypothyroidism or drug or alcohol abuse i want to recommend the treatment most likely to be successful in producing a complete remission of his depressive syndrome and relieving him of his considerable misery . What are the known and best - validated predictors of response? Our group has previously reviewed the scientific findings in this area.36 the most reliable predictor is past response, but in this case the patient has never been treated for depression . A positive response in first - degree family relatives is also predictive of a beneficial response to antidepressants, but again, this is not applicable to this patient . Some evidence suggests that certain subtypes of depression respond best to certain treatments monoamine oxidase inhibitors (the first type of antidepressants developed) are believed to be the most effective for patients with so - called atypical depression characterized by hypersomnia, overeating, extreme rejection sensitivity, and feeling better in the morning than later in the day . Combinations of antidepressants and antipsychotics or ect are best for patients with major depression with psychotic features . Surely patient choice is an important consideration, but it will likely be guided by my discussion with the patient . In 2013, mayberg, holtzheimer, dunlop, and craighead) were colleagues of mine for many years, and we continue to collaborate on various projects . Mayberg s study sought to identify a biomarker that could predict which type of treatment would benefit a patient based on the individual s brain activity . Using regional brain glucose metabolism as measured by positron emission tomography (pet) as a proxy for neural activity, her group sought to determine whether baseline resting state activity predicted remission after twelve weeks of treatment with either the selective serotonin reuptake inhibitor escitalopram (10 to 20 mg per day) or sixteen sessions of cognitive - behavioral therapy . The study sample initially comprised eighty - two men and women who were randomized between the two treatments . Of these, sixty - five patients completed the study and thirty - eight had clear outcomes and acceptable pet data . The thirty - eight patients who comprise the analyzable data set were distributed as follows: eleven who went into remission with escitalopram (six non - responders) and twelve who did so with cbt (nine nonresponders). The major finding were that hypometabolism of glucose in the insula, likely reflecting reduced activity of neurons in this brain region, was associated with remission using cbt, and with poor response to escitalopram . Contrariwise, insula hypermetabolism, reflecting increased activity of neurons in this brain region, was associated with remission using escitalopram and with poor response to cbt . The authors conclude that baseline insula metabolism is the first objective marker to guide initial treatment selection in depression first they eliminated from their primary analysis the responders to cbt or to escitalopram who did not go into remission . More specifically, partial responders to escitalopram or cbt were excluded from the analysis . They did so in order to accentuate the differences between the extremes in the depressed population; the results revealed clear differences in glucose metabolism in six regions: the right anterior insula, right motor cortex, left premotor cortex, right inferior temporal cortex, left amygdala, and precuneus . Mean regional activity values for remitters and nonresponders segregated by treatment arm are plotted for the six regions showing a significant treatment outcome analysis of variance interaction effect . Regional metabolic activity values are displayed as region / whole - brain metabolism converted to z scores . Cbt indicates cognitive - behavioral therapy.7 when all six regions were compared, the right insula exhibited the greatest effect as a discriminator of treatment response, followed by the precuneus . When the whole sample was studied, right insular activity was positively correlated with the depression symptom severity scale, and with the hamilton depression rating scale (hrsd) score in the cbt treatment group while right insular activity was negatively correlated with the hrsd in the escitalopram treatment group . If additional research can replicates these results, it suggests that a simple brain imaging test could reliably predict whether a given patient should be treated with psychotherapy or antidepressant medication . It also raises a plethora of additional questions: a wealth of data, now summarized in a research meta - analysis, indicate that mdd patients with a history of child abuse and neglect exhibit a poorer response to pharmacotherapy and psychotherapy and exhibit unique brain imaging differences.8 mayberg s research does not address this critical clinical characteristic in this population.it is somewhat unclear how the six brain regions of interest were identified and why several regions repeatedly identified to be implicated in the pathophysiology of depression either were not selected or exhibited no significant effect, including the hippocampus, subgenual cingulate, and others.it is hard to know what to make of the findings that only the right anterior insula, right motor cortex, left premotor cortex, left amygdala, left precuneus, and right inferior temporal region show dramatic differences in the cbt versus escitalopram induced remission versus nonresponder groups whereas their counterparts, namely the left anterior insula, left motor cortex, right premotor cortex, right amygdala, right precuneus, and left inferior cortex did not . Was a composite of the left and right sides of these structures informative?as the authors themselves point out, the study comprises a relatively small number of patients and our field is replete with pilot study findings that, unfortunately, have not been replicated in larger trials.this study utilized pet instead of the more often used functional magnetic resonance imaging (fmri) technology . As mayberg and her colleagues appropriately point out in their paper, fmri studies have examined regional brain activity and, more recently, resting state connectivity to identify mdd or mdd subtypes, but neither type of imaging has been used to discriminate response either among antidepressants or between antidepressants and psychotherapy.9 a wealth of data, now summarized in a research meta - analysis, indicate that mdd patients with a history of child abuse and neglect exhibit a poorer response to pharmacotherapy and psychotherapy and exhibit unique brain imaging differences.8 mayberg s research does not address this critical clinical characteristic in this population . It is somewhat unclear how the six brain regions of interest were identified and why several regions repeatedly identified to be implicated in the pathophysiology of depression either were not selected or exhibited no significant effect, including the hippocampus, subgenual cingulate, and others . It is hard to know what to make of the findings that only the right anterior insula, right motor cortex, left premotor cortex, left amygdala, left precuneus, and right inferior temporal region show dramatic differences in the cbt versus escitalopram induced remission versus nonresponder groups whereas their counterparts, namely the left anterior insula, left motor cortex, right premotor cortex, right amygdala, right precuneus, and left inferior cortex did not . Was a composite of the left and right sides of these structures informative? As the authors themselves point out, the study comprises a relatively small number of patients and our field is replete with pilot study findings that, unfortunately, have not been replicated in larger trials . This study utilized pet instead of the more often used functional magnetic resonance imaging (fmri) technology . As mayberg and her colleagues appropriately point out in their paper, fmri studies have examined regional brain activity and, more recently, resting state connectivity to identify mdd or mdd subtypes, but neither type of imaging has been used to discriminate response either among antidepressants or between antidepressants and psychotherapy.9 the expanding area of genetics in general, and pharmacogenetics in particular, is also of vital importance . A burgeoning database documents the role of certain genetic variations in vulnerability to mood disorders, and more recently how variations may affect treatment response to different antidepressants . Whether genetic material was collected in mayberg s study is unclear, but this focus is crucial, particularly in view of recent findings in imaging genomics . The lack of random assignment of the mdd patients as regards, for example, the vulnerability gene variants of the serotonin transporter or others, now shown to be associated with clear alterations in regional brain activity, could have confounded the results . This research group has always been willing to take great leaps forward, and they should be applauded for it . Subsequent studies will reveal if the insula is truly the region that predicts response to cbt versus a selective serotonin reuptake inhibitor such as escitalopram or whether other regions or biomarkers also need to be a component of the ultimate formula . This is part of the ongoing and exciting scientific process that is emblematic of the marriage of neuroscience and psychiatry . Ultimately, i believe this work will be judged as crucial in eventually attaining the goal all of us seek: a valid predictor of individual treatment response in depression, still the holy grail in psychiatry research.
|
Nowadays, many x - ray imaging experiments are performed dynamically, meaning that the object s inner structure is a function of time . In material science, the sample is often exposed to various external conditions (e.g. Temperature, pressure, etc .) During the time of a scan . In medicine dynamic tomographic imaging is focused on capturing various temporal changes under realistic conditions [13]. Good examples include the corrosion and oxidation processes in metals, crystal growth, crack healing or fluid flow in a fixed porous body [2, 7, 8, 9]. When an object is scanned dynamically, two main sources of motion should be taken into account . Firstly, motion related to movement or change occurring within the object . For instance, in medical x - ray imaging, a patient s cyclic breathing pattern should be considered . In this case, due to the repeatability, this effect can be accounted for (some motion artifacts can be eliminated through the gating procedure). In material science, however, changes can happen on multiple scales (from coarse to fine), severely fragmented, independent and irregular . This makes it more difficult and in many cases impossible to predict the expected motion . One way of reducing motion artifacts is to scan faster and/or collect less projection data . Such strategies can lead to the second source of motion, those which are related to the acquisition process itself . Nowadays, synchrotron imaging can provide probably the fastest exposure times and rotation speeds [1012]. Consequently, the expected structural changes can be significantly minimized and the obtained projection data can be considered as acquired from an essentially stationary object, although it is a crude approximation in general . The extent of structural differences between time frames depends on how fast the object s structure changes during each scan and how rapid is the acquisition hardware . This, however, is not always possible, e.g. The imaging of fluid flow [2, 3, 7, 8]. Additional difficulties are related to the limited exposure time and the speed of sample rotation . If the angle of radial integration increased (e.g. To reduce the number of projections collected per scan) it leads to blurring artifacts . Those artifacts, up to a certain degree, can be eliminated with state - of - the - art reconstruction algorithms which model the directional blurring effect in the projection space . In this work we do not account for motion related issues, assuming that the exposure time is short and the object is (almost) stationary during the time of scan . We refer to such an approach as four dimensional (4d) tomography (three dimensional spatial coordinates plus time evolution), where 3d snapshots frequently, fast dynamic imaging is associated with a limited number of projections acquired per scan and the reconstruction problem is therefore under - determined and ill - conditioned . Due to poor - conditioning, direct inversion methods fail to work and lead to a strong amplification of noise and loss of resolution in the reconstructed images . Iterative image reconstruction (iir) techniques can approximate inversion by using the error - correcting refinements resulting in improved signal - to - noise ratio (snr) characteristics of reconstructed images . However, the iir for undersampled data is an ill - posed problem and it requires some form of regularity applied to the solution to ensure convergence [14, 15]. Traditionally, the spatial regularity of smoothness (2 norm) or gradient sparsity (1 norm) are employed . The spatial regularization, however, is not well fitted to the dynamic nature of 4d imaging since it completely discards the redundancy of the temporal information . In this paper, we propose a spatio - temporal regularization approach for iir which is specifically adapted to various cases of dynamic imaging where the motion pattern is unknown and/or difficult to predict . Previously, there have been various attempts to improve spatial and temporal resolution in time - lapse tomography by employing a supplementary image as a prior in the reconstruction algorithm [79, 16, 17]. For instance, in order to reconstruct fluid flow propagation through a fixed porous body (e.g. A rock sample), a high resolution pre - scan of the solid porous object is used to improve spatial resolution [79]. Similarly, in medical imaging, a previous scan of the same patient can be also employed [16, 17]. Although these methods can be highly effective in exploiting supplementary data, they cannot be used in many other cases when a supplementary image is not available or uninformative . The majority of time - lapse tomographic experiments in xmt are fully dynamic and without a fixed relationship to the initial state of the object . Therefore, it is difficult to extract any supplementary (useful) information from the data obtained prior to the scan . Various spatio - temporal regularization techniques have been developed recently and the majority of them are based on extracting information from the adjacent time frames only [1820]. This (local) approach assumes that the closest time frames have a higher probability to be structurally similar to the regularized frame (which is true for many fast dynamic experiments). In our approach, we assume that the useful information (e.g. Structurally similar features) might exist in much more distant time frames than simply adjacent ones (depending on the experiment). The core problem is how to identify and use this information in very large temporal xmt data . In order to realize this we use nonlocal regularization on weighted graphs, which can be considered as a generalized case for nonlocal regularization [22, 23]. While spatio - temporal regularization has been done before we demonstrate a novel methodology for application to large datasets (more than 4 10 voxels size) characteristic of xmt . The novelty of our method consists in the generalized form of the spatio - temporal penalty and the special data reduction technique to significantly accelerate calculations . A speed - up of an order of magnitude is achieved which makes our method more feasible for reconstruction of large datasets . The modelled numerical experiment is presented to demonstrate that the proposed method is able to provide better contrast and resolution than the classical nonlocal approach while performing ten times faster . To further demonstrate the applicability of our method it is applied to reconstruction of big 4d datasets characteristic of xmt . Let xnk, where n is the total number of image elements and k is the number of all time - frames, then x:=(x1t, x2t, similarly we define the measured projections vector as b:=(b1t, b2t,,bkt)t and noise component:=(1t,2t,,kt)t . Here therefore the system of linear equations to solve is: (1)[a10 00a2000 ak][x1tx2txkt]=[b1tb2tbkt]+[1t2tkt] note that the block diagonal matrix amknk is time - invariant for many 4d imaging set - ups, that is, a1 = a2 = = ak or a = i a1, where i is the identity and is the kronecker product . This, however, is not optimal for reconstruction of dynamically collected projections and more advanced scanning strategies can be employed [3, 8, 20]. Sparse projection matrix a:nm describes the scanning geometry, it is parallel beam in our case, however a can potentially accommodate more complex geometries, such as fan - beam or cone - beam . The regularized unconstrained least - squares (ls) problem can be formulated as: (2)x=argminx{12ax - b22+r(x)}, where r (x) is the proposed spatio - temporal (st) penalty term and is a regularization parameter which establishes a trade - off between the data and the regularization terms . Similarly to [7, 8], we use a splitting approach [23, 25] to decouple data fidelity and regularization terms into two simpler sub - problems to solve: (3){vn+1=xn-[at(axn - b)]xn+1=argminx(r(x)+2x - x022); x0=vn+1 . The first step in the forward - backward splitting (fbs) algorithm (3) solves the unregularized ls problem (a gradient descent (gd) iteration with a time - step parameter) and the second is a weighted image denoising step . Due to slow convergence of the gd method there have been successful attempts to replace it with faster in convergence methods [7, 8, 18]. Similarly, a conjugate gradient least squares (cgls) algorithm [14, 15] is used instead of the gd method in this paper . In practice, this substitution works well and similar results can be obtained with the cgls - based fbs method, however, the mathematical proof of convergence does not hold anymore . The main value of our method is in the original form of the st penalty r (x) which is outlined in the next section . By taking a nonlocal regularization approach based on weighted graphs we can rewrite the second minimization problem in (3) as: (4)x=argminx(x), (x)=1pvvx(v)p+2x - x022, where v is a set of vertices v of a weighted graph g = (v, e,), p]0, + [is a smoothness degree, is a similarity weight function defined on edges e and x (v) is the weighted local variation of x over the graph . The -weighted p - laplace term in (4) is convenient to operate with since various choices of p lead to well - known nonlocal filters used in image processing [22, 23]. For instance, p = 2 leads to the weighted linear heat diffusion on graphs and p = 1 to the mean curvature or total variation (tv) seminorm on graphs . Two vertices u and v are said to be adjacent if the edge (u, v) e connects them, the weight between u and v is denoted by (u, v): (u, v) e, (u, v) = (v, u). Also (u, v)> 0 if u v and 0 otherwise . Notation u the vertex u b (v), where b (v) is a cubic box (the searching space) size of sx sy sk . Potentially, the box size can be extended to the 4d case (sx sy sz sk), however due to significant computational costs involved it is currently infeasible for large xmt data . Therefore, our regularization is currently in 3d (x, y+time) and it has similarities with the video denoising problem . The major benefit of this realization is that it is relatively fast and can be programmed in a slice - by - slice manner which does not require lots of computer memory for reconstruction and is easily parallelizable . The local variation of the weighted gradient operator x (v) is defined by (5)x(v)=uv(u, v)(x(v)-x(u))2 . The weighted p - laplace operator at a vertex v is defined as (6)px(v)=1puv(u, v)(x(v)-x(u)), where (7)(u, v)=(u, v)(x(v)p-2+x(u)p-2). One can see that for the case p = 2: (u, v) = (u, v) and for p = 1 it is: (8)(u, v)=(u, v)(1x(v)+1x(u)). Both cases are convex and therefore lead to the convex minimization problem (4), which guarantees a unique solution x under a proper choice of parameter . In this paper we use p = 1 which provides a better regularization performance than the linear model p = 2 . Note that the nonlocal tv seminorm (5) is smoothed by a small constant to ensure differentiability: x(v)=uv(ux(v))2+2 . The non - convex case p <1 is not considered in this paper . Therefore for p 1 the system (4) has a unique solution written as: (9)2px(v)+(x - x0)=0, vv, which is equivalent to the following system of algebraic equations: (10)(+uv(u, v))x(v)-uv(u, v)x(u)=x0(v). The linearized gauss - jacobi iterative method can be used to solve the system (10) which also can be considered as the discrete euler - lagrange equation of minimization problem (4) [2123]. Let t be an iteration step, then the fixed point (fp) iteration is used to solve (10): (11)xt+1(v)=x0(v)+uvt(u, v)xt(u)+uvt(u, v), vv . In our case (p = 1), (u, v) as taken as in (8). The iteration procedure (11) can be stopped using criterion x - x <, where is a small constant . In our experiments we use only one iteration of (11) mainly due to regularization performance restrictions . The regularization on graphs for time - lapse reconstruction involves a search for similar vertices in a box b (v). Similar to nonlocal video denoising, a quadratic patch f size of rx ry is used to provide more robust estimation of similarity between vertices u and v (calculation of euclidian distance on patches [22, 23]). The computational complexity of the proposed algorithm can go up to o(n) and therefore becomes infeasible for large xmt datasets . Here we propose a simple approach to significantly accelerate the regularization process on graphs by considering sparsity in the temporal domain . We developed an accelerated regularization on graphs (arg) technique based on two observations: a) the temporal data are likely to be sparse and redundant (some features remain stationary or change only a little over time); b) two vertices are likely to be similar (structurally) if the difference in intensity between them is lower than the maximum level of noise present in the signal . We use these two observations to modify and accelerate the classical regularization algorithm on graphs (rg). We say that the sx, y size of the searching box b (v) must be larger if a feature at the vertex v is changing (e.g. Moving) quickly over time and sx, y of b (v) must be smaller if the feature is almost stationary (e.g. A uniform region or an edge). By reducing b (v) for temporally non - active (stationary) features we drastically reduce our search space . In order to decide if the feature is stationary or not and if the vertex u is similar to v we use the observation (b). While minimizing the cost function (2), we intentionally do not impose any positivity constraints on our solution and therefore x will have negative values on every n - iteration . The maximum noise level present in our reconstructed image can be simply found as = | min (x) | . We also say that the trustworthy intensity differences between vertices u and v are bounded above by l, where l (0, 1] is an empirical constant (we use l = 0.4 for all our experiments). To establish the optimal searching box size bo (v) for v (i, j, k), k = 1, 2,, k we calculate the following measure of temporal sparsity: (12)s(v)=s(v)+1, if |xn(v(i, j, k))-xn(u(i, j, l))|ln, l=1,2,,k, where x is a quadratic average (mean) of intensity values in x in order to reduce the influence of noise in estimation . The sparsity measure s (0, k - 1] (12), where s = 0 corresponds to the most temporally non - sparse v - region and s = k - 1 to the most temporally sparse v - region . In fig . 1 (middle) we demonstrate the calculated measure s for time frame k = 4 (left) of the noisy video sequence of k = 20 frames . The level of temporal sparsity can be clearly seen (dynamic features, like ship and birds, are not sparse, while stationary features are). Then, if we select the lower size of the box bo (v) as sxl = syl and the upper size as sxu = syu, s (v) can be linked to bo (v) (see fig . 1 (right)). We divide the whole interval min(sk) - max(sk) into an equal number of d steps (we use d = 10 in our experiments) and linearly assign values for bo (k) in a way that min(sk) corresponds to s and max(sk) to s respectively . The simple reasoning here is that the larger s values should be related to the smaller sizes of the searching window and vice versa . Finally, the following condition is used to calculate nonlocal weights in (11): (13)n(u, v)={exp(-f(xn(v))-f(xn(u))h2),if|xn(v)-xn(u)|ln0,otherwise . One can see that we reduce the data space substantially by first creating a spatially variant search box bo and next we remove vertices which do not fit our assumptions of similarity using the rule (13). As we will demonstrate later, this approach provides an acceleration by an order of magnitude without impairment of reconstruction quality . Moreover, the averaging across dissimilar features in arg is much reduced and leads to improved resolution . By taking a nonlocal regularization approach based on weighted graphs we can rewrite the second minimization problem in (3) as: (4)x=argminx(x), (x)=1pvvx(v)p+2x - x022, where v is a set of vertices v of a weighted graph g = (v, e,), p]0, + [is a smoothness degree, is a similarity weight function defined on edges e and x (v) is the weighted local variation of x over the graph . The -weighted p - laplace term in (4) is convenient to operate with since various choices of p lead to well - known nonlocal filters used in image processing [22, 23]. For instance, p = 2 leads to the weighted linear heat diffusion on graphs and p = 1 to the mean curvature or total variation (tv) seminorm on graphs . Two vertices u and v are said to be adjacent if the edge (u, v) e connects them, the weight between u and v is denoted by (u, v): (u, v) e, (u, v) = (v, u). Also (u, v)> 0 if u v and 0 otherwise . The vertex u b (v), where b (v) is a cubic box (the searching space) size of sx sy sk . Potentially, the box size can be extended to the 4d case (sx sy sz sk), however due to significant computational costs involved it is currently infeasible for large xmt data . Therefore, our regularization is currently in 3d (x, y+time) and it has similarities with the video denoising problem . The major benefit of this realization is that it is relatively fast and can be programmed in a slice - by - slice manner which does not require lots of computer memory for reconstruction and is easily parallelizable . The local variation of the weighted gradient operator x (v) is defined by (5)x(v)=uv(u, v)(x(v)-x(u))2 . The weighted p - laplace operator at a vertex v is defined as (6)px(v)=1puv(u, v)(x(v)-x(u)), where (7)(u, v)=(u, v)(x(v)p-2+x(u)p-2). One can see that for the case p = 2: (u, v) = (u, v) and for p = 1 it is: (8)(u, v)=(u, v)(1x(v)+1x(u)). Both cases are convex and therefore lead to the convex minimization problem (4), which guarantees a unique solution x under a proper choice of parameter . In this paper we use p = 1 which provides a better regularization performance than the linear model p = 2 . Note that the nonlocal tv seminorm (5) is smoothed by a small constant to ensure differentiability: x(v)=uv(ux(v))2+2 . The non - convex case p <1 is not considered in this paper . Therefore for p 1 the system (4) has a unique solution written as: (9)2px(v)+(x - x0)=0, vv, which is equivalent to the following system of algebraic equations: (10)(+uv(u, v))x(v)-uv(u, v)x(u)=x0(v). The linearized gauss - jacobi iterative method can be used to solve the system (10) which also can be considered as the discrete euler - lagrange equation of minimization problem (4) [2123]. Let t be an iteration step, then the fixed point (fp) iteration is used to solve (10): (11)xt+1(v)=x0(v)+uvt(u, v)xt(u)+uvt(u, v), vv . In our case (p = 1), (u, v) as taken as in (8). The iteration procedure (11) can be stopped using criterion x - x <, where is a small constant . In our experiments we use only one iteration of (11) mainly due to regularization performance restrictions . The regularization on graphs for time - lapse reconstruction involves a search for similar vertices in a box b (v). Similar to nonlocal video denoising, a quadratic patch f size of rx ry is used to provide more robust estimation of similarity between vertices u and v (calculation of euclidian distance on patches [22, 23]). The computational complexity of the proposed algorithm can go up to o(n) and therefore becomes infeasible for large xmt datasets . Here we propose a simple approach to significantly accelerate the regularization process on graphs by considering sparsity in the temporal domain . We developed an accelerated regularization on graphs (arg) technique based on two observations: a) the temporal data are likely to be sparse and redundant (some features remain stationary or change only a little over time); b) two vertices are likely to be similar (structurally) if the difference in intensity between them is lower than the maximum level of noise present in the signal . We use these two observations to modify and accelerate the classical regularization algorithm on graphs (rg). We say that the sx, y size of the searching box b (v) must be larger if a feature at the vertex v is changing (e.g. Moving) quickly over time and sx, y of b (v) must be smaller if the feature is almost stationary (e.g. A uniform region or an edge). By reducing b (v) for temporally non - active (stationary) features we drastically reduce our search space . In order to decide if the feature is stationary or not and if the vertex u is similar to v we use the observation (b). While minimizing the cost function (2), we intentionally do not impose any positivity constraints on our solution and therefore x will have negative values on every n - iteration . The maximum noise level present in our reconstructed image can be simply found as = | min (x) | . We also say that the trustworthy intensity differences between vertices u and v are bounded above by l, where l (0, 1] is an empirical constant (we use l = 0.4 for all our experiments). To establish the optimal searching box size bo (v) for v (i, j, k), k = 1, 2,, k we calculate the following measure of temporal sparsity: (12)s(v)=s(v)+1, if |xn(v(i, j, k))-xn(u(i, j, l))|ln, l=1,2,,k, where x is a quadratic average (mean) of intensity values in x in order to reduce the influence of noise in estimation . The sparsity measure s (0, k - 1] (12), where s = 0 corresponds to the most temporally non - sparse v - region and s = k - 1 to the most temporally sparse v - region . In fig . 1 (middle) we demonstrate the calculated measure s for time frame k = 4 (left) of the noisy video sequence of k = 20 frames . The level of temporal sparsity can be clearly seen (dynamic features, like ship and birds, are not sparse, while stationary features are). Then, if we select the lower size of the box bo (v) as sxl = syl and the upper size as sxu = syu, s (v) can be linked to bo (v) (see fig . 1 (right)). We divide the whole interval min(sk) - max(sk) into an equal number of d steps (we use d = 10 in our experiments) and linearly assign values for bo (k) in a way that min(sk) corresponds to s and max(sk) to s respectively . The simple reasoning here is that the larger s values should be related to the smaller sizes of the searching window and vice versa . Finally, the following condition is used to calculate nonlocal weights in (11): (13)n(u, v)={exp(-f(xn(v))-f(xn(u))h2),if|xn(v)-xn(u)|ln0,otherwise . One can see that we reduce the data space substantially by first creating a spatially variant search box bo and next we remove vertices which do not fit our assumptions of similarity using the rule (13). As we will demonstrate later, this approach provides an acceleration by an order of magnitude without impairment of reconstruction quality . Moreover, the averaging across dissimilar features in arg is much reduced and leads to improved resolution . In this section we present some numerical results with the method given in section 2 . In [7, 8] we have shown that the st regularization which uses more than just adjacent time - frames is able to outperform spatial and some spatio - temporal approaches . When more time - frames are used in regularization therefore in this paper we focus on two issues: first is the quantitative and qualitative performance estimation of the arg method (shorter abbreviation for cgls - arg) in comparison to the normal rg (cgls - rg) method . We provide an omp - c function which is mex - wrapped in matlab environment to perform optimized calculation for arg and rg techniques . We note that it is a 3d version (x, y + time) which is well suited for parallel beam slice - by - slice reconstruction . For smaller data sizes, the 4d implementation can be also feasible and it should provide images with even better snr and resolution . For calculations we used intel xeon cpu 2.26 ghz with 2 processors (4 threads each). To test arg and rg approaches we created a dynamically evolving phantom from high quality tomographic measurements (the phantom is available here). The high resolution data of a mouse tibia sample was acquired at the diamond - manchester branchline (i13) of the diamond light source (dls). In order to simulate the dynamic behaviour of the stationary sample we take 10 vertical slices of 3d reconstructed volume and shift them horizontally using an equidistant step of 15 pixels (see fig . Three time frames (k = 1, 5, 10) of the mouse tibia phantom are shown in fig . The total size of the phantom is 400 400 10 (k) pixels . To avoid the inverse crime of reconstructing on the same grid where projection data was simulated, we used a higher resolution of the phantom on a 800 800 isotropic pixel grid to generate projections with a strip kernel . Gaussian noise was applied to the projection data (5% of a true signal maximum). Reconstructions were calculated on a smaller 400 400 isotropic pixel grid and with a linear projection model . We used 180 and 90 projection angles in [0,) angular interval (assuming parallel beam geometry) to reconstruct the phantom . The root mean square error (rmse) is calculated as (14)rmse(x, x)=e(x - x)2, where x is an exact image sequence and x is a reconstructed one . Before reconstructing the data we found optimal parameters for each method by optimizing rmse for each parameter while keeping other parameters fixed (see table 1). In fig . 4 we show reconstructions (for time frame k = 5 of the phantom in fig . 2 (middle)) with various methods for two cases of limited noisy projections (180 and 90 projections). The main aim here is to show that the accelerated arg method can be competitive (quantitatively) with the classical rg method, while much faster computationally . To reconstruct the data we used various sizes (sx = sy) of the searching window bsx, sy, sk, while sk = 9 remains constant (we used nine temporal frames for every time - frame in regularizion). Because our dynamic phantom (see fig . 2) has significant vertical shifts in time, one should use larger search window sizes (sx = sy) to track the similar edge . The rmse was calculated for all reconstructed phantoms and given in tables 2 and 3 . One can see that the reconstructions with the cgls method are noisy (see fig . The regularization on graphs (rg) is able to reduce noise significantly and sharpen important features . However, the small search window reconstructions (method rg - b9, 9, 9) have a distinctive blocky appearance (insufficient amount of temporal information collected). With a larger search window (rg - b43, 43, 9), reconstructions are much smoother and edges are well preserved . Unfortunately, the computational time is very large for rg - b43, 43, 9 (see tables 2, 3) and therefore the method is impractical . The computation time is drastically reduced with the proposed method (arg - bo,9) while the error is the lowest . Notably, the quality of reconstruction is very similar to the original method (rg - b43, 43, 9), however some small and thin features are better preserved than with rg - b43, 43, 9 . The effect of under and over estimation for various methods can be clearly seen in a 1d plot shown in fig . 5 (by arrows we show the most erroneous regions in the profile recovered by methods rg - b9, 9, 9 and rg - b43, 43, 9). Notably, the rg - b43, 43, 9 method smooths small features while the proposed method recovers them much better (see the parabola shaped region in fig . We conclude that the proposed method (arg - bo) is more feasible for larger datasets due to performance and quality - wise it is similar or better than the classical nonlocal regularization approaches . The main purpose of developing such a spatio - temporal regularization technique (see section section 2) is to apply it to time - lapse xmt data . Due to high resolution detectors and rapid acquisition (x) is very important for iterative minimization of (2). In order to perform fast projection - backprojection operations we use gpu - accelerated open - source package: the astra toolbox . The proposed regularizer is implemented in c, however it can be also realized on a gpu which can provide substantial acceleration . The following time - lapse experiment was performed on the i13 beamline of dls, where multiple fast 3d scans of time - varying sample (melting - freezing ice - cream) were obtained . The ice - cream microstructure consists of three phases, air cells (gas), ice crystals (solid) and unfrozen matrix (liquid) (see fig . 6, 7). The aim of the experiment was to understand how phase content varies with temperature variation . During the thermal cycling the inner structure of a sample is changing (crystals melt or coarsen). Since dynamic changes are easily traceable (controlled sample cooling and heating procedure), this dataset is a perfect case study for our reconstruction technique . Additionally, since our reconstruction method searches for some structural correlations in time it significantly enhances the edges between different phases . Due to poor contrast between ice - crystals and air bubbles one has to recover the edges of the unfrozen matrix as accurately as possible . In fig . 6 one can see reconstructions with three different methods: fbp (filtered back - projection), cgls and the proposed arg method . The time - lapse data size is 2k 2k 1k 6 (k) voxels, and therefore 6 large 3d volumes are reconstructed . We perform 40 iterations of cgls method with one fp iteration (11) for the arg penalty . All parameters for the arg method except and h are selected the same as in table 1 . The computation time of one arg iteration (11) to regularize 6 slices (2k 2k 6 (k)) is 170 seconds (all available time frames are used). The classical rg implementation is not used here due to long computation times (more than 1500 seconds for one iteration). From the reconstructions it can be seen that the direct method (fbp) and cgls both deliver unquantifiable reconstructions due to high noise levels and ring artifacts present . That the arg method is able to suppress noise significantly while also enhance edges between different phases . To test arg and rg approaches we created a dynamically evolving phantom from high quality tomographic measurements (the phantom is available here). The high resolution data of a mouse tibia sample was acquired at the diamond - manchester branchline (i13) of the diamond light source (dls). In order to simulate the dynamic behaviour of the stationary sample we take 10 vertical slices of 3d reconstructed volume and shift them horizontally using an equidistant step of 15 pixels (see fig . Three time frames (k = 1, 5, 10) of the mouse tibia phantom are shown in fig . The total size of the phantom is 400 400 10 (k) pixels . To avoid the inverse crime of reconstructing on the same grid where projection data was simulated, we used a higher resolution of the phantom on a 800 800 isotropic pixel grid to generate projections with a strip kernel . Gaussian noise was applied to the projection data (5% of a true signal maximum). Reconstructions were calculated on a smaller 400 400 isotropic pixel grid and with a linear projection model . We used 180 and 90 projection angles in [0,) angular interval (assuming parallel beam geometry) to reconstruct the phantom . The root mean square error (rmse) is calculated as (14)rmse(x, x)=e(x - x)2, where x is an exact image sequence and x is a reconstructed one . Before reconstructing the data we found optimal parameters for each method by optimizing rmse for each parameter while keeping other parameters fixed (see table 1). In fig . 4 we show reconstructions (for time frame k = 5 of the phantom in fig . 2 (middle)) with various methods for two cases of limited noisy projections (180 and 90 projections). The main aim here is to show that the accelerated arg method can be competitive (quantitatively) with the classical rg method, while much faster computationally . To reconstruct the data we used various sizes (sx = sy) of the searching window bsx, sy, sk, while sk = 9 remains constant (we used nine temporal frames for every time - frame in regularizion). Because our dynamic phantom (see fig . 2) has significant vertical shifts in time, one should use larger search window sizes (sx = sy) to track the similar edge . The rmse was calculated for all reconstructed phantoms and given in tables 2 and 3 . One can see that the reconstructions with the cgls method are noisy (see fig . The regularization on graphs (rg) is able to reduce noise significantly and sharpen important features . However, the small search window reconstructions (method rg - b9, 9, 9) have a distinctive blocky appearance (insufficient amount of temporal information collected). With a larger search window (rg - b43, 43, 9), reconstructions are much smoother and edges unfortunately, the computational time is very large for rg - b43, 43, 9 (see tables 2, 3) and therefore the method is impractical . The computation time is drastically reduced with the proposed method (arg - bo,9) while the error is the lowest . Notably, the quality of reconstruction is very similar to the original method (rg - b43, 43, 9), however some small and thin features are better preserved than with rg - b43, 43, 9 . The effect of under and over estimation for various methods can be clearly seen in a 1d plot shown in fig . 5 (by arrows we show the most erroneous regions in the profile recovered by methods rg - b9, 9, 9 and rg - b43, 43, 9). Notably, the rg - b43, 43, 9 method smooths small features while the proposed method recovers them much better (see the parabola shaped region in fig . 5). From those numerical experiments we conclude that the proposed method (arg - bo) is more feasible for larger datasets due to performance and quality - wise it is similar or better than the classical nonlocal regularization approaches . The main purpose of developing such a spatio - temporal regularization technique (see section section 2) is to apply it to time - lapse xmt data . Due to high resolution detectors and rapid acquisition (x) is very important for iterative minimization of (2). In order to perform fast projection - backprojection operations we use gpu - accelerated open - source package: the astra toolbox . The proposed regularizer is implemented in c, however it can be also realized on a gpu which can provide substantial acceleration . The following time - lapse experiment was performed on the i13 beamline of dls, where multiple fast 3d scans of time - varying sample (melting - freezing ice - cream) were obtained . The ice - cream microstructure consists of three phases, air cells (gas), ice crystals (solid) and unfrozen matrix (liquid) (see fig . 6, 7). The aim of the experiment was to understand how phase content varies with temperature variation . During the thermal cycling the inner structure of a sample is changing (crystals melt or coarsen). Since dynamic changes are easily traceable (controlled sample cooling and heating procedure), this dataset is a perfect case study for our reconstruction technique . Additionally, since our reconstruction method searches for some structural correlations in time it significantly enhances the edges between different phases . Due to poor contrast between ice - crystals and air bubbles one has to recover the edges of the unfrozen matrix as accurately as possible . In fig . 6 one can see reconstructions with three different methods: fbp (filtered back - projection), cgls and the proposed arg method . The time - lapse data size is 2k 2k 1k 6 (k) voxels, and therefore 6 large 3d volumes are reconstructed . We perform 40 iterations of cgls method with one fp iteration (11) for the arg penalty . All parameters for the arg method except and h are selected the same as in table 1 . The computation time of one arg iteration (11) to regularize 6 slices (2k 2k 6 (k)) is 170 seconds (all available time frames are used). The classical rg implementation is not used here due to long computation times (more than 1500 seconds for one iteration). From the reconstructions it can be seen that the direct method (fbp) and cgls both deliver unquantifiable reconstructions due to high noise levels and ring artifacts present . That the arg method is able to suppress noise significantly while also enhance edges between different phases . In this paper, a generalized spatio - temporal regularization technique for time - lapse tomographic reconstruction is introduced . The proposed method has been successfully applied to modelled and real dynamic data resulting in noiseless images with enhanced structures (edges are sharpened while uniform areas are smoothed). The significant benefits of the method are the substantial decrease in reconstruction time (becomes feasible for large xmt dynamic datasets) and the possibility of adding more (potentially all the available) temporal information into the regularization process . The future work includes generalization to 4d regularization and application to other important time - lapse experiments.
|
Between 70% and 80% of adults experience it at least once in their lives.1 the management of clbp comprises a range of strategies, including surgery, drug therapy, and rehabilitative interventions, such as massage therapy.2 massage therapy has the potential to minimize clbp and accelerate the return to normal function.3 the ottawa panel demonstrated that massage interventions affect short - term improvements in subacute and clbp symptoms, decrease disability immediately after treatment, and provide short - term relief when combined with therapeutic exercise and education.4 no clinically meaningful difference between relaxation and structural massage has been observed with regard to relieving disability or symptoms in clbp.57 the benefits of massage therapy are enhanced when it is accompanied by routine physical therapy particularly rehabilitative exercises indicating that massage is an effective treatment for clbp versus placebo and other active treatment options (such as relaxation), especially in the short term.810 a significant aspect of massage in clbp is its ability to relax the patient, which has been linked to hrv . Specifically, short - term relaxation therapy improves autonomic balance and promotes cardiovascular health, decreasing hrv, correlating with blood pressure.11,12 hrv is often applied as an index of balance in the ans; as a relaxation therapy, massage can improve autonomic balance and improve cardiovascular health by establishing a sympathovagal equilibrium, which can help a patient shape his perception of bodily signals.1315 in clbp, as in other chronic illnesses, fluctuations in physical symptoms and emotional states correlate with ia . Moreover, ia, which is one s sense of the physiological condition of his body, might have significant function in mediating self - rated health, particularly in the perception of chronic pain.1619 poor access to bodily signals restricts a patient s ability to integrate them during emotional processing, which, by extension, precludes optimal emotional sr.20 in clbp, the patient experiences reweighting of proprioceptive information, altered sensitivity to exteroceptive stimuli, and disrupted ia of the state of the body.21 also, pain - related changes in cortical areas that are allocated to pain sensation appear to experience stress, which could elicit pain memory.22 together, pain experiences and pain memory affect the maintenance of chronic pain.23 people with chronic pain have difficulty directing their attention away from it; to this end, a mental strategy that incorporates focused attention and distraction with non - painful stimuli or a self - generated sub - nociceptive image positively modulates the perception of pain intensity.24 certain massage techniques, such as rmb, use touch and words to enhance body awareness of physical sensations and emotional states.25 based on these findings, the objective of our study was to determine the relative efficacy of a new massage therapy in reducing pain in clbp as the primary outcome . Also, considering the lack of studies that have correlated clbp with ia and hrv, our secondary purpose was to examine whether and how the decrease in pain is linked to ia and hrv by measuring the cr, which reflects the average stress that is experienced by patients . We hypothesized that a preparatory phase that is pleasant to the touch, before every session of the traditional massage treatment, directs the attention of the patient away from his pain, increasing the efficacy of massage in reducing pain . All participants signed informed consent forms after receiving detailed information on the study s aims and procedures, as per the declaration of helsinki . This study was approved as a clinical trial (clinicaltrials.gov identifier nct02646280) and by the ethical committee of sapienza university of rome (registration number 3791/15). This study was a single - blind, randomized, controlled trial that took place from july 2015 to january 2016 . Patients were recruited from the outpatient rehabilitation clinic of policlinico umberto i hospital, rome . The inclusion criteria were patients aged between 30 and 60 years with a diagnosis of chronic nonspecific lbp for at least 3 months and vas 3 in the last week . The exclusion criteria were acute lbp; lbp due to specific causes; concomitant rheumatic, neurological, or oncological disease; previous back surgery; severe cognitive impairments; and pregnancy . Eligible patients were referred to a physiatrist who provided them with detailed information on the experimental protocol . A standardized, blinded assessment at baseline and at the follow - up was performed by the same examiner to minimize any potential bias when performing the clinical examination and recording the data . The examiner did not have access to the clinical or radiological examination results, maintaining the blinding and limiting the risk of biased observations . Fifty - eight patients were screened, 51 of whom were enrolled and then randomized to the tmg (n=24, mean age: 50.549.13 years) or smg (n=27, mean age: 50.776.80 years) at a 1:1 ratio, according to a computer - generated randomization list (figure 1) using spss 10.1 (spss inc ., the allocation was concealed from the patients and examiner; patients were allocated according to a printed computer - generated list, and each number was covered with a patch by a researcher who was not involved in the patients assessments . The patches were removed successively after the inclusion of each patient into the study by another researcher who did not participate in the patient assessments, revealing the allocation . The following outcome measures were assessed at baseline (t0), at the end of the treatment program (t1), and at the 3-month follow - up (t2). Hrv, based on cr, was measured only during the initial contact and at the last treatment session to detect any change in values after treatment and the t2 . Pain intensity was the primary outcome and was measured using the vas.26 the secondary outcome measures were multidimensional pain intensity per the mpq,27 pain - related disability per the waddel disability index,28 ia per the maia,29 quality of life per the sf-12,30,31 and hrv expressed as cr using a photoplethysmograph (emwave software heartmath hma 6020).32 the vas is a psychometric tool that evaluates pain intensity from 0 to 10 (0= absence of pain and 10= severe pain). The patient expresses his pain intensity by indicating the point along a continuous line from 0 to 10 cm . It allows one to evaluate the sensory, affective, and emotional clinical condition of the patient regarding his pain . The patient is asked to give a score from 0 to 3 for each category . The result of the test consists of 7 scores: pris somatosensory score (035.5), pria affective score (021.3), prie emotional score (04.60), mixed pain rating index score mixed (016.1), nwc (020), ppi (05), and s / a . We considered the total score (mcgill tot) to range from 0 to 78 . The waddel disability index is used to evaluate disability in clbp regarding daily living activities . The questions, divided into 9 items, are answered with a yes or no response, with total scores ranging from 0 to 9 (> 5 indicates significant disability). This index examines a patient s autonomy with respect to lifting, sitting, standing, traveling, walking, sleeping, social life, sex life, and putting on footwear . The maia multidimensional scale was used to assess ia and consists of 32 items, clustered into 8 subscales with a range of 0 to 5 (= greatest level of awareness) for each: n, nd, nw, ar, ea, sr, bl, and t. the sf-12 is a multipurpose, short - form survey that comprises 12 questions, all of which are selected from the sf-36 health survey . The pcs is represented by 4 domains: physical function, pr, bp, and gh . Physical and mh composite scores are computed using the scores on the 12 questions and range from 0 to 100 (worst and best health state, respectively). Hrv is a measurement of cardiac function and reflects heart brain interactions and the dynamics of the ans . A photoplethysmograph records hrv, which is usually influenced by various levels of stress,33 and was used to assess patient compliance and behavior during contact (ie, when the physical therapist touched the patient s back for the first time). Through software that analyzes heart signal patterns, we obtained a parameter, termed the cr, which detects the average stress that is experienced by patients . High cr values indicate greater coherence in the heart signal pattern and, consequently, a rise in hrv, which demonstrates the prevalence of the parasympathetic system (reduction in stress levels); in contrast, low values reflect decreased coherence in heart signal patterns and thus a declining hrv, which signifies the predominance of the sympathetic system (increase in stress levels). All patients were instructed not to take any medications for low back pain (vas <5) (eg, nsaids, muscle relaxants, antidepressants, and corticosteroids) during the study protocol and not to undergo other rehabilitation approaches (those who did so were dropped from the study). During the rehabilitation sessions all enrollees were subjected to contact before massage treatment to measure the basal cr, detected by photoplethysmography of a patient s earlobe: with patient in the prone position, the examiner placed the palm of his hand on sore and painless lumbar regions (6 touches, 3 on each side). We proposed 10 intervention rehabilitative sessions for each rehabilitation group, each lasting 30 min and performed 3 times per week . The number of sessions and the time of each session were chosen, considering routine good clinical medical practice with respect to massage therapy for clbp8 and the simfer guidelines (http://www.simferweb.net). We applied the following massage techniques34 to the lumbar region of patients in both groups (tmg and smg) (figure 2): touch surface (10 min): both hands held open with the fingers gliding slowly over the skin without pressure or direction.deep touch (5 min): both hands held open with the fingers gliding slowly over the skin, with increased pressure in the direction of the muscle bundles . Touching is the maneuver that begins and ends a massage session, consisting of slow and light movements with the surface of the palm making complete contact with the surface of the body . The pt must maintain balance on his feet and should not apply weight to the wrists during the massage.static pressure (5 min): with fists or the palms, compressions are performed perpendicularly to the surface of the muscle above the iliac wings, on the spinous processes, and on the vertebral facets.dynamic pressure (5 min): this technique is similar to static pressure, with the addition of slight friction against the surface of the skin.kneading (5 min): pinching and rolling (pince roule) a maneuver of detachment that affects the skin . The skin is lifted between the thumb and forefinger of both hands together or one hand for small areas, walking the index, middle, and ring fingers, as if testing the density of a soft substance . Touch surface (10 min): both hands held open with the fingers gliding slowly over the skin without pressure or direction . Deep touch (5 min): both hands held open with the fingers gliding slowly over the skin, with increased pressure in the direction of the muscle bundles . Touching is the maneuver that begins and ends a massage session, consisting of slow and light movements with the surface of the palm making complete contact with the surface of the body . The pt must maintain balance on his feet and should not apply weight to the wrists during the massage . Static pressure (5 min): with fists or the palms, compressions are performed perpendicularly to the surface of the muscle above the iliac wings, on the spinous processes, and on the vertebral facets . Dynamic pressure (5 min): this technique is similar to static pressure, with the addition of slight friction against the surface of the skin . Kneading (5 min): pinching and rolling (pince roule) a maneuver of detachment that affects the skin . The skin is lifted between the thumb and forefinger of both hands together or one hand for small areas, walking the index, middle, and ring fingers, as if testing the density of a soft substance . Using the same massage techniques and durations, we added various elements: a preparatory phase that was pleasant to the touch: at the beginning of each massage session, the patient was asked to sense the pleasant contact (comfortable warmth) of the therapist s hands (slight pressure with the palm to the region of the back without pain). Then, the patient had to memorize the sensation of the pleasant touch and relaxation . Afterward, the pt asked the patient to bind the pleasant and pain - free sensation to the painful area . At this point, the pt touched the painful area of the back (figure 3). The session continued with traditional massage.language as therapy: to assess the patient s ability to recount and describe what he felt during the massage . For example, in the initial treatment session, a patient might have been unable to perceive the sensation of heat throughout the painful lower back, perceiving it to be as impenetrable as cement . As the acceptance of and confidence in the massage and pt increase adaptable and as permeable as sand, becoming able to feel the heat throughout his body . During the massage session, the patient had an active role, providing continuous feedback through dialog with the pt . The patient was actively involved in the treatment with regard to emotional and cognitive perception . A preparatory phase that was pleasant to the touch: at the beginning of each massage session, the patient was asked to sense the pleasant contact (comfortable warmth) of the therapist s hands (slight pressure with the palm to the region of the back without pain). Then, the patient had to memorize the sensation of the pleasant touch and relaxation . The pleasant and pain - free sensation to the painful area . At this point, language as therapy: to assess the patient s ability to recount and describe what he felt during the massage . For example, in the initial treatment session, a patient might have been unable to perceive the sensation of heat throughout the painful lower back, perceiving it to be as impenetrable as cement . As the acceptance of and confidence in the massage and pt increase, the same patient reports his back as becoming, becoming able to feel the heat throughout his body . During the massage session, the patient had an active role, providing continuous feedback through dialog with the pt . The patient was actively involved in the treatment with regard to emotional and cognitive perception . The massage was performed by 2 pts who had been trained in the massage treatment techniques for at least 3 years . The pts alternated between treatment groups at a ratio of 1:1 (1 tmg, then 1 smg) to avoid operator - dependent bias . The session was performed in a comfortable and quiet environment, with access to natural light, only in the presence of the pt and the patient . In the tmg, the patient was asked during the session to relax and communicate with the pt only if there were unpleasant sensations during the treatment . Assuming an average reduction in pain of ~2 points in the experimental group (smg) and ~1 point in the control group, as measured on the vas, and a standard deviation of 1.5 and 0.75, respectively (obtained assuming a coefficient of variation of 75% of average reductions), we calculated a requirement of 17 patients per group (pass software) by student s t - test, with a power of 80% and a 0.05 alpha error . With an estimated dropout rate of 10%, the minimum number of patients per group was 19 . However, our cohort was larger (23 versus 27), because we wanted to respect the time limits of the enrollment per the ethics committee (from july 2015 to october 2015) and because we decided to enroll all patients who sought treatment at our clinic to avoid creating a wait list of untreated patients . Because clinical scale scores are ordinal measures, they were summarized using median and quartiles and are reported using box and whisker plots . Whitney u test, whereas within - group comparisons were made using friedman s analysis for data on the 3 assessment times in each group . Our approach also considered the minimal clinically important difference for vas scores.35 patients who abandoned the protocol or refused to be retested at t1 or t2 were considered to have dropped out . Finally, we compared the number of subjects who maintained a meaningful clinical change in pain (30%),36 quantified as a 1.5 cm shift on the vas: for these analyses, the odds ratio (and the relevant 95% confidence interval) was computed by chi squared analysis, for which the p - value was considered to be statistically significant if it was <0.025, because this was a secondary - level analysis . We applied the following massage techniques34 to the lumbar region of patients in both groups (tmg and smg) (figure 2): touch surface (10 min): both hands held open with the fingers gliding slowly over the skin without pressure or direction.deep touch (5 min): both hands held open with the fingers gliding slowly over the skin, with increased pressure in the direction of the muscle bundles . Touching is the maneuver that begins and ends a massage session, consisting of slow and light movements with the surface of the palm making complete contact with the surface of the body . The pt must maintain balance on his feet and should not apply weight to the wrists during the massage.static pressure (5 min): with fists or the palms, compressions are performed perpendicularly to the surface of the muscle above the iliac wings, on the spinous processes, and on the vertebral facets.dynamic pressure (5 min): this technique is similar to static pressure, with the addition of slight friction against the surface of the skin.kneading (5 min): pinching and rolling (pince roule) a maneuver of detachment that affects the skin . The skin is lifted between the thumb and forefinger of both hands together or one hand for small areas, walking the index, middle, and ring fingers, as if testing the density of a soft substance . Touch surface (10 min): both hands held open with the fingers gliding slowly over the skin without pressure or direction . Deep touch (5 min): both hands held open with the fingers gliding slowly over the skin, with increased pressure in the direction of the muscle bundles . Touching is the maneuver that begins and ends a massage session, consisting of slow and light movements with the surface of the palm making complete contact with the surface of the body . The pt must maintain balance on his feet and should not apply weight to the wrists during the massage . Static pressure (5 min): with fists or the palms, compressions are performed perpendicularly to the surface of the muscle above the iliac wings, on the spinous processes, and on the vertebral facets . Dynamic pressure (5 min): this technique is similar to static pressure, with the addition of slight friction against the surface of the skin . Kneading (5 min): pinching and rolling (pince roule) a maneuver of detachment that affects the skin . The skin is lifted between the thumb and forefinger of both hands together or one hand for small areas, walking the index, middle, and ring fingers, as if testing the density of a soft substance . Using the same massage techniques and durations, we added various elements: a preparatory phase that was pleasant to the touch: at the beginning of each massage session, the patient was asked to sense the pleasant contact (comfortable warmth) of the therapist s hands (slight pressure with the palm to the region of the back without pain). Then, the patient had to memorize the sensation of the pleasant touch and relaxation . Afterward, the pt asked the patient to bind the pleasant and pain - free sensation to the painful area . At this point, the session continued with traditional massage.language as therapy: to assess the patient s ability to recount and describe what he felt during the massage . For example, in the initial treatment session, a patient might have been unable to perceive the sensation of heat throughout the painful lower back, perceiving it to be as impenetrable as cement . As the acceptance of and confidence in the massage and pt increase, the same patient reports his back as becoming adaptable and as permeable as sand, becoming able to feel the heat throughout his body . During the massage session, the patient had an active role, providing continuous feedback through dialog with the pt . The patient was actively involved in the treatment with regard to emotional and cognitive perception . A preparatory phase that was pleasant to the touch: at the beginning of each massage session, the patient was asked to sense the pleasant contact (comfortable warmth) of the therapist s hands (slight pressure with the palm to the region of the back without pain). Then, the patient had to memorize the sensation of the pleasant touch and relaxation . Afterward, the pt asked the patient to bind the pleasant and pain - free sensation to the painful area . At this point, language as therapy: to assess the patient s ability to recount and describe what he felt during the massage . For example, in the initial treatment session, a patient might have been unable to perceive the sensation of heat throughout the painful lower back, perceiving it to be as impenetrable as cement . As the acceptance of and confidence in the massage and pt increase, the same patient reports his back as becoming, becoming able to feel the heat throughout his body . During the massage session, the patient had an active role, providing continuous feedback through dialog with the pt . The patient was actively involved in the treatment with regard to emotional and cognitive perception . The massage was performed by 2 pts who had been trained in the massage treatment techniques for at least 3 years . The pts alternated between treatment groups at a ratio of 1:1 (1 tmg, then 1 smg) to avoid operator - dependent bias . The session was performed in a comfortable and quiet environment, with access to natural light, only in the presence of the pt and the patient . In the tmg, the patient was asked during the session to relax and communicate with the pt only if there were unpleasant sensations during the treatment . Assuming an average reduction in pain of ~2 points in the experimental group (smg) and ~1 point in the control group, as measured on the vas, and a standard deviation of 1.5 and 0.75, respectively (obtained assuming a coefficient of variation of 75% of average reductions), we calculated a requirement of 17 patients per group (pass software) by student s t - test, with a power of 80% and a 0.05 alpha error . With an estimated dropout rate of 10%, however, our cohort was larger (23 versus 27), because we wanted to respect the time limits of the enrollment per the ethics committee (from july 2015 to october 2015) and because we decided to enroll all patients who sought treatment at our clinic to avoid creating a wait list of untreated patients . Because clinical scale scores are ordinal measures, they were summarized using median and quartiles and are reported using box and whisker plots . Whitney u test, whereas within - group comparisons were made using friedman s analysis for data on the 3 assessment times in each group . Our approach also considered the minimal clinically important difference for vas scores.35 patients who abandoned the protocol or refused to be retested at t1 or t2 were considered to have dropped out . Finally, we compared the number of subjects who maintained a meaningful clinical change in pain (30%),36 quantified as a 1.5 cm shift on the vas: for these analyses, the odds ratio (and the relevant 95% confidence interval) was computed by chi squared analysis, for which the p - value was considered to be statistically significant if it was <0.025, because this was a secondary - level analysis . Of the 58 patients who were screened, 51 were enrolled and randomized into 2 groups: 24 in the tmg and 27 in the smg . In the tmg, 1 patient dropped out for job - related issues and did not complete the therapy sessions (<5 sessions) or tests (figure 1); thus, the statistical calculation was performed for a sample size of 23 patients in the tmg and 27 patients in the smg . There were no significant differences in age, gender, or bmi at the initial assessment: the demographic and clinical characteristics are shown in table 1 (p>0.05 for all parameters). In addition, there were no statistically significant or clinically meaningful differences at baseline in terms of clinical scale scores between groups at baseline (p>0.05, mann there were significant changes in the novel versus control group for most parameters at the end of the treatment by friedman s analysis (table 2): in the smg, p<0.001 for all parameters, whereas cr and sf-12 scores in the tmg were not significant . By mann whitney u test, the smg had better results: the cr was significant at t1 and t2 (p=0.000 and 0.002), and vas and mcgill ppi scores were significant only at t1 (p=0.005 and 0.013) (figure 4); further, the mcgill tot (figure 5) and pria scores were significant at t1 and t2 (p=0.000 and 0.003 and p=0.001 and 0.002, respectively), as was the waddel index (p=0.034 and 0.044). Differences in mcgill pris and prie scores were significant at t1 (p=0.005 and 0.025). Maia scale scores differed significantly only at t1 for maia - n, maia - ar, and maia - tot (p=0.045, 0.032, and 0.023 respectively). R coefficient between vas and cr was r=0.289 (p=0.042) at t2 and r=0.516 (p<0.001) at t1 . Finally, we compared the number of subjects who obtained a minimum clinically important change in vas score (1.5 cm) that was maintained at t2 . The odds ratio was 7.5 (95% confidence interval: 1.4339.47), which was statistically significant (chi squared = 6.802, p=0.0091). The results of our study are encouraging with regard to our hypothesis that a preparatory phase that is pleasant to the touch directs the attention of the patient away from pain; in combination with conventional techniques, this approach increases the efficacy of traditional massage in reducing chronic pain: the experimental treatment had an effect compared to the traditional treatment . Both approaches in the tmg and smg mitigated pain in clbp, but in the smg, this improvement was much more acute compared with the tmg on all pain scales, with better maintenance at 3 months follow - up (waddell index, mcgill pria, tot, and nwc, as shown in table 2). Considering that the minimal clinically important difference in pain on the vas36 should be at least 1.5 cm for patients with subacute or clbp, the smg met this goal, in contrast to the tmg, as shown in table 2 . Moreover, if we consider the body as a receptive surface, touch through massage can help rebuild inconsistent information between the algic region and cns to overcome the somesthetic and kinesthetic inconsistency in chronic pain.37 other research has confirmed that increasing tactile and somatosensory stimuli during rehabilitation for clbp reduces pain.38 in clbp, tactile processing is disrupted as a neglect - like syndrome;39,40 thus, the request by the pt to the patient to pay attention to how he perceives the massage in areas that are free of back pain and then move these pleasurable sensations to the painful area helps restore adequate tactile sensory perception and recognition for reintegration of total body perception.41 further, with regard to how chronic pain implies a decrease in parasympathetic activation,42,43 we noted a correlation between vas score and cr, indicating that most patients relax in the hands of a pt and that the intensity of clbp decreases to a greater extent, likely through better activation of the vagal system and a rebalancing between the sympathetic and parasympathetic systems (> cr in the smg). Also, ia changed for maia ar and n scores in the smg versus tmg at t1: ar the ability to sustain attention and control body sensation and n the awareness of uncomfortable, comfortable, and neutral body sensations are important indices of the efficacy of the new massage approach . As the body - self neuromatrix theory of pain states, the perception of painful stimuli does not result from the brain s passive registration of tissue trauma but from its active generation of subjective experiences through a network of neurons, known as the neuromatrix.44 for rehabilitation, is important to consider that the neuromatrix, the primary mechanism that generates the neural pattern that produces pain, is genetically determined but modified by sensory experience . In our study, this experience was represented by the preparatory phase that was pleasant to the touch, performed before every session of the traditional massage treatment to direct attention of the patient away from pain . Also, the body - self neuromatrix theory subserves major psychological dimensions that correlate with the ia . With regard to the mpq, the smg experienced a significant reduction in the affective component, which is linked to tension, fear, and the autonomic characteristics of pain . The smg showed significant improvement in perceived quality of life on the sf-12 scale for physical and mental items, whereas the tmg did not experience any notable changes during treatment versus baseline . Patients in the smg appeared to change their perception of pain more extensively, thereby improving their quality of life, even with intensive treatment protocols for shorter times . One of the limitations of this study was that we did not use scales to assess mood or psychological profile at baseline . Also, it lacked a longer follow - up (> 6 months) and a placebo group, preventing us from determining the true relative efficacy of the 2 rehabilitation approaches . Moreover, we cannot exclude the possibility of an attention bias that was related to the number of participants in the smg versus the traditional approach . A new massage technique with a preparatory phase that is pleasant to the touch directs the attention of the patient away from pain, with greater effects compared with the traditional treatment, consistent with the new theoretical framework for clbp.
|
Transdermal drug delivery is a noninvasive route of drug administration into the body through the skin . However, only a few drug candidates have been successfully developed into suitable transdermal formulations because of the formidable skin barrier . The highly lipophilic nature of the skin restricts the permeation of hydrophilic, high molecular weight and charged compounds through the stratum corneum into the systemic circulation . Transdermal iontophoresis is defined as application of an electrical potential that maintains a constant electric current across the skin and enhances the delivery of ionized as well as unionized molecules . It uses an electrode of the same polarity as the charge on the drug to drive ionic drug molecules into the body . The mechanisms of transdermal iontophoresis include electrorepulsion (a charged ion is repelled from an electrode with the same charge), electro - osmosis (convective flow of solvent through a charged pore that occurs in response to the preferential passage of counter ions when the electric field is applied), and current - induced skin permeability increment . One of the major advantages of iontophoretic drug delivery is the ability to readily and precisely control the drug - delivery profile through modulating the current output . Methotrexate (mtx) is an antineoplastic agent used for the treatment of cancer, psoriasis and rheumatoid arthritis . It is used for the treatment of cancer and at low doses, it has immunosuppressive and anti - inflammatory properties and is used for the treatment of psoriasis and rheumatoid arthritis . Various topical forms like ointments, creams and gels[1518] have been tried as the systemic use of this drug causes many side effects mainly, hepatic toxicity and liver damage but are still not available commercially . The drug can be delivered either in solution formulation or through loading on to the hydrogel patches . Incorporation of the drug into hydrogels facilitates drug handling and release and in case of iontophoretic delivery, allows the patient to remain ambulant . It has been reported that the iontophoretic delivery of mtx from hydrogels was more effective than passive delivery from aqueous solution . It has been demonstrated that iontophoresis remarkably improved the transdermal delivery of mtx over passive diffusion . More interestingly, a case of palmer psoriasis treated with iontophoresis of mtx has been reported using current density for iontophoresis beyond the clinically acceptable limits . Although, the results with iontophoresis are promising, none of the papers give a detailed comparison between high and low current density used for iontophoresis . The aim of the present study was to analyze the effects of current density on mtx permeation as well as to assess the skin injury caused by the above - mentioned physical enhancer by histological examination . Mtx was a gift sample from dabur (india), acrylamide was obtained from spectrochem pvt . (india), n, n - methylene bis - acrylamide, potassium chloride and potassium dihydrogen phosphate from sisco research laboratory (india), sodium chloride from e. merck india ltd . (india), dihydrogen - o - phosphate anhydrous from qualikems fine chemicals pvt . Ltd . (india), sodium hydroxide and ethyl acetate from excelar qualigens fine chemicals (india), ammonium persulphate from thomas baker chemicals ltd . Fine chemicals (india). Deionised water having a resistivity of 18 m or greater was used to prepare all solutions and buffers . The hydrogel patches were synthesized using acrylamide monomer by solution polymerization method as described by prasad et al ., 2007 . All experiments were conducted according to the protocol approved by the institutional animal ethics committee (iaec) of all india institute of medical sciences, new delhi, india . White albino mice (n=5 in each group) were procured from aiims and sacrificed . The hair was removed from the abdominal region using an animal hair clipper and the full - thickness skin was excised . Fat adhering to the dermis side was cleaned by using a blunt scalpel and isopropyl alcohol, taking care not to damage the skin . Finally, the skin was washed in tap water and observed physically for any gross damage . The fresh skin was used, for in vitro, attenuated total reflectance - fourier transform infrared (atr - ftir) and histopathological studies . For permeation studies, the mice skin was clamped between the two half - cells of the modified vertical franz diffusion cell with epidermis facing the donor chamber and the area available for permeation was 5.72 cm . The skin was equilibrated for 1h in phosphate buffer saline (ph 7.4) in the receptor chamber and was magnetically stirred throughout the experiment . Mtx - loaded patch was placed over the skin and dc iontophoresis using current density of 0.2 ma / cm was applied for 1 h to the hydrogel patch through silver -silver chloride electrode and having same dimensions as the hydrogel patch to study the effect of low current density iontophoresis . The experiments were done at thermostatically maintained temperature (372c). For mtx quantification in receptor solution, 0.5-ml samples were withdrawn at specified intervals from the receiver compartment and analyzed for the amount of drug by uv - vis spectrophotometer (cary 100 model) at 302 nm . The samples were also analyzed by hplc using waters 1525 binary pump attached to uv detector . The cumulative amount of mtx permeated per unit skin surface area was plotted against time and flux (j) was calculated as: j=(dc / dt) v / a, where v = volume of solution in the receptor compartment of the diffusion cell, a = area of the patch, and dc / dt = change in concentration of drug in the receptor compartment solution of the diffusion cell with time . The percent enhancement in flux was calculated as follows:% enhancement in flux = {(flux with enhancer passive flux)/ passive flux}*100 all experiments were repeated five times and the values are expressed as mean s.d . Statistical comparisons were made using student's t - test and the significance level was set at p<0.05 . For curve fitting, a third order polynomial expression, y = at + bt + ct + d, where y = total amount and t = time, was utilized for a best curve fit to compare the rate of iontophoretic permeation of methotrexate with passive . The samples treated with iontophoresis mentioned above were subjected to atr - ftir spectroscopic study using bio - rad, fts 135, ftir spectrophotometer . The peak height and areas of c - h stretching, c = o stretching and amide peak absorbances were measured for each sample . The albino mice skin was treated with iontophoresis for 1 h and fixed in em fluid . After fixing the samples for 48 h, they were washed with phosphate buffer saline and dehydrated using a graded series of ethanol solutions and finally dipped in acetone . The samples were air dried and mounted on the base plate and then coated with silver using vapor deposition technique . The surface of the skin sample was investigated using cambridge stereoscan model s4 - 10, scanning electron microscope . The iontophoresis - treated skin area (both in vitro and in vivo) was excised after 1 h to study the effect on skin and after 24 h and 48 h in vivo to see the reversal of injury after enhancer application . The excised skin was fixed in 10% formalin and then subjected to processing for histological examination by light microscope . The skin samples were dehydrated by a series of graded ethanol then treated with xylene and finally embedded in paraffin blocks . Skin sections of 5-m thickness were cut and stained with hematoxylin - eosin (hande) stain . The mounting of the stained sections was done in dpx and observed under light microscope using a modified score [table 1 for in vitro scoring]. Mtx was a gift sample from dabur (india), acrylamide was obtained from spectrochem pvt . (india), n, n - methylene bis - acrylamide, potassium chloride and potassium dihydrogen phosphate from sisco research laboratory (india), sodium chloride from e. merck india ltd . (india), dihydrogen - o - phosphate anhydrous from qualikems fine chemicals pvt . Ltd . (india), sodium hydroxide and ethyl acetate from excelar qualigens fine chemicals (india), ammonium persulphate from thomas baker chemicals ltd . Fine chemicals (india). Deionised water having a resistivity of 18 m or greater was used to prepare all solutions and buffers . The hydrogel patches were synthesized using acrylamide monomer by solution polymerization method as described by prasad et al ., 2007 . All experiments were conducted according to the protocol approved by the institutional animal ethics committee (iaec) of all india institute of medical sciences, new delhi, india . White albino mice (n=5 in each group) were procured from aiims and sacrificed . The hair was removed from the abdominal region using an animal hair clipper and the full - thickness skin was excised . Fat adhering to the dermis side was cleaned by using a blunt scalpel and isopropyl alcohol, taking care not to damage the skin . Finally, the skin was washed in tap water and observed physically for any gross damage . The fresh skin was used, for in vitro, attenuated total reflectance - fourier transform infrared (atr - ftir) and histopathological studies . For permeation studies, the mice skin was clamped between the two half - cells of the modified vertical franz diffusion cell with epidermis facing the donor chamber and the area available for permeation was 5.72 cm . The skin was equilibrated for 1h in phosphate buffer saline (ph 7.4) in the receptor chamber and was magnetically stirred throughout the experiment . Mtx - loaded patch was placed over the skin and dc iontophoresis using current density of 0.2 ma / cm was applied for 1 h to the hydrogel patch through silver -silver chloride electrode and having same dimensions as the hydrogel patch to study the effect of low current density iontophoresis . For mtx quantification in receptor solution, 0.5-ml samples were withdrawn at specified intervals from the receiver compartment and analyzed for the amount of drug by uv - vis spectrophotometer (cary 100 model) at 302 nm . The samples were also analyzed by hplc using waters 1525 binary pump attached to uv detector . The cumulative amount of mtx permeated per unit skin surface area was plotted against time and flux (j) was calculated as: j=(dc / dt) v / a, where v = volume of solution in the receptor compartment of the diffusion cell, a = area of the patch, and dc / dt = change in concentration of drug in the receptor compartment solution of the diffusion cell with time . The percent enhancement in flux was calculated as follows:% enhancement in flux = {(flux with enhancer passive flux)/ passive flux}*100 all experiments were repeated five times and the values are expressed as mean s.d . Statistical comparisons were made using student's t - test and the significance level was set at p<0.05 . For curve fitting, a third order polynomial expression, y = at + bt + ct + d, where y = total amount and t = time, was utilized for a best curve fit to compare the rate of iontophoretic permeation of methotrexate with passive . The samples treated with iontophoresis mentioned above were subjected to atr - ftir spectroscopic study using bio - rad, fts 135, ftir spectrophotometer . The peak height and areas of c - h stretching, c = o stretching and amide peak absorbances were measured for each sample . The albino mice skin was treated with iontophoresis for 1 h and fixed in em fluid . After fixing the samples for 48 h, they were washed with phosphate buffer saline and dehydrated using a graded series of ethanol solutions and finally dipped in acetone . The samples were air dried and mounted on the base plate and then coated with silver using vapor deposition technique . The surface of the skin sample was investigated using cambridge stereoscan model s4 - 10, scanning electron microscope . The iontophoresis - treated skin area (both in vitro and in vivo) was excised after 1 h to study the effect on skin and after 24 h and 48 h in vivo to see the reversal of injury after enhancer application . The excised skin was fixed in 10% formalin and then subjected to processing for histological examination by light microscope . The skin samples were dehydrated by a series of graded ethanol then treated with xylene and finally embedded in paraffin blocks . Skin sections of 5-m thickness were cut and stained with hematoxylin - eosin (hande) stain . The mounting of the stained sections was done in dpx and observed under light microscope using a modified score [table 1 for in vitro scoring]. The flux obtained with dc iontophoresis using 0.2 and 0.5 ma / cm current density was 20.571.02 g / cm / h and 36.82.21 g / cm / h, respectively (p<0.05). Similar results have been obtained by cesares - delgadillo, 2010, although they have tried different current densities for a different drug . A third order polynomial was chosen to model the experimental results as the data could not be presented by a quadratic . There was no significant improvement in the least square error by using a higher order polynomial, hence was not used for analysis . The results are presented in figure 1 which shows the effect of dc iontophoresis on the net permeation of methotrexate at a given time calculated by third order polynomial curve fitting . A good correlation between experimental and polynomial simulation it can be observed from the curve that with the passive experiments (drug - loaded hydrogel patch), initially there is an increase in permeation, then there is decline and steady state is obtained . The drug diffusion is via the least resistant pathway, which reaches a saturation, so there is fall in permeation . Moreover, the swelling pattern of the hydrogel (0.4 mole%) is fickian in nature (data not shown), which further supports that diffusion is the main mechanism of drug release . Polynomial curve fitting: effect of dc iontophoresis enhancement of permeation is required to achieve the desired drug levels . From the curve, it can be seen that there is sharp rise in permeation with iontophoresis and then steady level is reached [figure 1]. Atr - ftir spectra of skin sample treated with current of 0.2 ma / cm current density showed all the major peaks of the lipid and protein but with reduced intensity as compared to the control . A decrease of 28.12% and 31.25% in the peak height of asymmetric and symmetric c - h stretching vibration, respectively, as compared to the control, and 37.5% reduction in the ester peak was noticed [table 2]. Furthermore, a decrease of 31.4% and 47.05% was noticed with amide i and amide ii, respectively . With 0.5ma / cm current density iontophoretic samples, a greater reduction of 96.8%, 93.75% and 93.7% [table 2] in asymmetric and symmetric c - h stretching and c = o stretching vibration, respectively, was obtained which was attributed to substantial amount of lipid extraction in the lipid protein domains . Moreover, an increase in the ratio of amide i and amide ii bands from 2.6 to 11 with increase in current density from 0.2 to 0.5 ma / cm was noticed, thus indicating that the hydration levels are associated with iontophoresis and play an important role in increasing the drug permeation . Percentage decrease in peak height for lipids and protein absorption bands after current treatment for 1h the spectra also demonstrated a split in amide ii band into 1553 cm and 1541 cm . The split could be due to the disruption in hydrogen bonding associated with the head of ceramides, breaking interlamellar hydrogen bonding of lipid bilayer and disrupting barrier property of sc, resulting in loosening of lipid - protein domains thus allowing higher flux as compared to the passive treatment . The scanning electron micrographs of dc iontophoresis clearly showed increase in the pore size of the hair follicles [figure 2]. Kajimoto et al ., 2011 have also reported the use of follicular pathways during iontophoresis . Scanning electron micrograph showing increase in hair follicles of the mice skin treated with dc iontophoresis figure 3 depicts a comparison between control, dc (0.2 ma / cm) and dc (0.5 ma / cm). From the histopathological studies it is clear that at higher current density, 0.5 ma / cm, disruption of epidermis in almost half of the sectioned area was noticed [figure 3b] there was severe dermal edema with marked dilatation and loss of appendages and fractured collagen with a dermal score of 18 . The dermal changes were higher as compared to iontophoresis with 0.2 ma / cm current density . Photomicrographs of treated mice skin (in vitro) (a) control, (b) 0.5ma / cm current density (c) 0.2ma / c m current density, (where, a appendageal dilatation, b bullae formation, d destruction of epidermis) (h and e, 200). Iontophoresis using lower current density of 0.2 ma / cm showed focal disruptions of epidermis (less than of sectioned area) and bullae formation [figure 3c] and an epidermal score of 24 was obtained . The dermis showed fractured collagen with moderated edema and mild appendageal damage, thus a dermal score of 12 was obtained . Dc (0.5 ma / cm) resulted in ths of 47 whereas at 0.2 ma / cm dc, ths of 36 was observed indicating lesser skin injury . The severe edema formation is evident as the hydration effects of iontophoresis are responsible for enhanced permeation of the drug . This has been depicted by the ratio of amide i / ii band in atr - ftir spectroscopy described previously . Application of current reduces the resistance of skin and the decreased resistance is reflected in the increased permeability of the skin and therefore increased flux . Current causes epidermal destruction as well as appendageal damage, as we could see in all the histological slides as well as from scanning electron microscopy, therefore shunt pathway for drug permeation become more operative on current application. [3032] to summarize, with 0.5 ma / cm current density, damage was higher as compared to 0.2 ma / cm, which was in correlation with the flux observed . The higher current density provides more electromotive force that increases the flux . In vivo results in mice show that the damages associated with 0.5 ma / cm current density were not reversible in 48 hours [figure 4]. Photomicrograph of mice skin in vivo showing recovery after 48 h of application of iontophoresis (0.5 ma / cm current density), where f focal disruption of epidermis . (h and e, 200) reversibility studies were conducted in vivo after 24 and 48 h of the application of iontophoresis . It was observed that recovery process had started in 24 h and almost total recovery of epidermal as well as dermal changes was found in 48 h with low current density dc iontophoresis, however with iontophoresis using 0.5 ma / cm current density, edema along with focal disruption of the epidermis persisted [figure 4]. The partial denudation of the epidermis with left over basal layer showed a rapid recovery as compared to areas with loss of basal layers as seen with 0.5 ma / cm current density iontophoresis . The flux obtained with dc iontophoresis using 0.2 and 0.5 ma / cm current density was 20.571.02 g / cm / h and 36.82.21 g / cm / h, respectively (p<0.05). Similar results have been obtained by cesares - delgadillo, 2010, although they have tried different current densities for a different drug . A third order polynomial was chosen to model the experimental results as the data could not be presented by a quadratic . There was no significant improvement in the least square error by using a higher order polynomial, hence was not used for analysis . The results are presented in figure 1 which shows the effect of dc iontophoresis on the net permeation of methotrexate at a given time calculated by third order polynomial curve fitting . A good correlation between experimental and polynomial simulation it can be observed from the curve that with the passive experiments (drug - loaded hydrogel patch), initially there is an increase in permeation, then there is decline and steady state is obtained . The drug diffusion is via the least resistant pathway, which reaches a saturation, so there is fall in permeation . Moreover, the swelling pattern of the hydrogel (0.4 mole%) is fickian in nature (data not shown), which further supports that diffusion is the main mechanism of drug release . Polynomial curve fitting: effect of dc iontophoresis enhancement of permeation is required to achieve the desired drug levels . From the curve, it can be seen that there is sharp rise in permeation with iontophoresis and then steady level is reached [figure 1]. Atr - ftir spectra of skin sample treated with current of 0.2 ma / cm current density showed all the major peaks of the lipid and protein but with reduced intensity as compared to the control . A decrease of 28.12% and 31.25% in the peak height of asymmetric and symmetric c - h stretching vibration, respectively, as compared to the control, and 37.5% reduction in the ester peak was noticed [table 2]. Furthermore, a decrease of 31.4% and 47.05% was noticed with amide i and amide ii, respectively . With 0.5ma / cm current density iontophoretic samples, a greater reduction of 96.8%, 93.75% and 93.7% [table 2] in asymmetric and symmetric c - h stretching and c = o stretching vibration, respectively, was obtained which was attributed to substantial amount of lipid extraction in the lipid protein domains . Moreover, an increase in the ratio of amide i and amide ii bands from 2.6 to 11 with increase in current density from 0.2 to 0.5 ma / cm was noticed, thus indicating that the hydration levels are associated with iontophoresis and play an important role in increasing the drug permeation . Percentage decrease in peak height for lipids and protein absorption bands after current treatment for 1h the spectra also demonstrated a split in amide ii band into 1553 cm and 1541 cm . The split could be due to the disruption in hydrogen bonding associated with the head of ceramides, breaking interlamellar hydrogen bonding of lipid bilayer and disrupting barrier property of sc, resulting in loosening of lipid - protein domains thus allowing higher flux as compared to the passive treatment . The scanning electron micrographs of dc iontophoresis clearly showed increase in the pore size of the hair follicles [figure 2]. Kajimoto et al ., 2011 have also reported the use of follicular pathways during iontophoresis . Scanning electron micrograph showing increase in hair follicles of the mice skin treated with dc iontophoresis figure 3 depicts a comparison between control, dc (0.2 ma / cm) and dc (0.5 ma / cm). From the histopathological studies it is clear that at higher current density, 0.5 ma / cm, disruption of epidermis in almost half of the sectioned area was noticed [figure 3b]. There was severe dermal edema with marked dilatation and loss of appendages and fractured collagen with a dermal score of 18 . The dermal changes were higher as compared to iontophoresis with 0.2 ma / cm current density . Photomicrographs of treated mice skin (in vitro) (a) control, (b) 0.5ma / cm current density (c) 0.2ma / c m current density, (where, a appendageal dilatation, b bullae formation, d destruction of epidermis) (h and e, 200). Iontophoresis using lower current density of 0.2 ma / cm showed focal disruptions of epidermis (less than of sectioned area) and bullae formation [figure 3c] and an epidermal score of 24 was obtained . The dermis showed fractured collagen with moderated edema and mild appendageal damage, thus a dermal score of 12 was obtained . Dc (0.5 ma / cm) resulted in ths of 47 whereas at 0.2 ma / cm dc, ths of 36 was observed indicating lesser skin injury . The severe edema formation is evident as the hydration effects of iontophoresis are responsible for enhanced permeation of the drug . This has been depicted by the ratio of amide i / ii band in atr - ftir spectroscopy described previously . Application of current reduces the resistance of skin and the decreased resistance is reflected in the increased permeability of the skin and therefore increased flux . Current causes epidermal destruction as well as appendageal damage, as we could see in all the histological slides as well as from scanning electron microscopy, therefore shunt pathway for drug permeation become more operative on current application. [3032] to summarize, with 0.5 ma / cm current density, damage was higher as compared to 0.2 ma / cm, which was in correlation with the flux observed . The higher current density provides more electromotive force that increases the flux . In vivo results in mice show that the damages associated with 0.5 ma / cm current density were not reversible in 48 hours [figure 4]. Photomicrograph of mice skin in vivo showing recovery after 48 h of application of iontophoresis (0.5 ma / cm current density), where f focal disruption of epidermis . Reversibility studies were conducted in vivo after 24 and 48 h of the application of iontophoresis . It was observed that recovery process had started in 24 h and almost total recovery of epidermal as well as dermal changes was found in 48 h with low current density dc iontophoresis, however with iontophoresis using 0.5 ma / cm current density, edema along with focal disruption of the epidermis persisted [figure 4]. The partial denudation of the epidermis with left over basal layer showed a rapid recovery as compared to areas with loss of basal layers as seen with 0.5 ma / cm current density iontophoresis . It was observed that the transdermal permeation increased with increase in injury caused to the tissue . The higher current density (0.5 ma / cm) increased the mtx flux tremendously, but the reversibility studies did not confirm its skin tolerance as the histological changes were not reversible in 48 h.
|
Growing evidence has shown that early life experiences can have lasting effects on adult health (13). Low birth weight (<2,500 g), an indicator of a compromised fetal growth, has been associated with a higher risk of developing type 2 diabetes (4,5). However, to our knowledge, there are no studies assessing the relation of low birth weight to type 2 diabetes in african american women, a population disproportionately affected by low birth weight (6) and type 2 diabetes (7). In addition, few studies have examined very low birth weight (<1,500 g), which might confer an even higher risk of type 2 diabetes as adult (8). Two major hypotheses have been proposed to explain the observed association between low birth weight and type 2 diabetes: the thrifty phenotype, or fetal programming hypothesis (9,10), and the fetal insulin hypothesis (11). The thrifty phenotype hypothesis states that as a consequence of intrauterine malnutrition, the individual s metabolism is reprogrammed to become nutritionally thrifty . According to this hypothesis, the thrifty phenotype would confer a survival advantage under conditions of nutritional deprivation, but the individual would be more prone to developing diabetes and other metabolic defects as an adult under improved nutritional conditions (9,10). Children born small for gestational age tend to have high serum leptin concentrations during catch - up growth (12), which in turn has been associated with fat accumulation and higher insulin levels in adult life (13,14). The fetal insulin hypothesis states that low birth weight and diabetes are different phenotypes of the same genotype; genetic variants affecting fetal pancreas development would result in both reduced fetal growth, due to deficient insulin secretion, and higher risk of type 2 diabetes later in life because of the same underlying problem of compromised -cell mass (11). Recent results provide support to the fetal insulin hypothesis, as three genetic loci associated with type 2 diabetes (adcy5, cdkal1, and hhex - ide) were also associated with low birth weight (1517), and at least two of the shared loci (cdkal1 and hhex - ide) are involved in -cell dysfunction (18,19). Because the underlying defect would be a deficiency in pancreas development, we would not expect, based on the fetal insulin hypothesis, that increased adiposity is a mediator between low birth weight and type 2 diabetes later in life . In the current study, we assessed the relation of self - reported birth weight to adult risk of type 2 diabetes in the black women s health study (bwhs), a prospective cohort study . In particular, we evaluated whether extremes of the birth weight distribution are associated with an increased risk of incident type 2 diabetes . We also examined whether increased adiposity, as measured by higher prevalence of adult obesity (bmi 30 kg / m), is a potential mediator of the relationship . The bwhs is an ongoing prospective follow - up study of african american women in the u.s . The study began in 1995 when 59,000 women aged 2169 years enrolled through completing health questionnaires . Participants were approximately equally distributed in the northeast, south, midwest, and west . We collected information on demographics, medical and reproductive history, body weight, height, diet, smoking, physical activity, and other factors through the baseline questionnaire . Participants have been followed through biennial questionnaires to collect information on incident diseases and update information on risk factors . Questions about birth weight were asked on the 1997 questionnaire (see below), and thus the present analyses are based on follow - up beginning in 1997 . Among the 24,085 women who provided adequate data on birth weight, we excluded those with diabetes, cancer, myocardial infarction, stroke, or coronary artery bypass graft surgery at baseline or incident diabetes diagnosed before age 30 years, which resulted in a final analytic sample of 21,624 women (fig . Final analytic sample after exclusions . Among the 24,085 women who provided adequate data on birth weight, we excluded those with diabetes (n = 1,319), cancer (n = 677), myocardial infarction (n = 234), stroke (n = 171), or coronary artery bypass graft surgery (n = 25) at baseline or incident diabetes diagnosed before 30 years of age (n = 35), which resulted in a final analytic sample of 21,624 women . On the 1997 follow - up questionnaire, women were asked their birth weight in categories (<4 lb; 4 lb to 5 lb, 8 oz;> 5 lb, 8 oz; do not know) and their exact birth weight in pounds and ounces, if known . We used information from both questions to create four categories of birth weight (very low, <1,500 g; low, 1,5002,499 g; normal, 2,5003,999 g; and high, 4,000 g). We carried out a validation study among 637 bwhs participants born in massachusetts using birth registry data from the massachusetts department of public health to corroborate self - reported data on birth weight . The coefficient of agreement for the categorical data was 0.80, and there were no significant differences across categories of adult bmi at the time of reporting in 1997 (p = 0.57). For exact self - reported birth weight, the pearson correlation coefficient was 0.88, and there were no significant differences across bmi categories (p = 0.38). These results are in agreement with previous studies (21,22) that have shown the validity of retrospectively collected self - reported birth weight information . We also assessed reproducibility of self - reported birth weight in a subset of 776 bwhs participants who completed the 1997 questionnaire two times . The coefficient was 0.86 for categorical birth weight, and the pearson correlation coefficient was 0.96 for exact birth weight . On each of the biennial questionnaires the accuracy of self - reported diabetes was assessed in a sample of 229 women who reported being diagnosed with diabetes, who consented to the release of medical records from their physicians, and whose providers replied to the request . We found the diagnosis of type 2 diabetes to be confirmed in 220 (96%) of the women . Of the nine remaining participants, two had type 1 diabetes, one had metabolic syndrome with no diabetes, one had steroid - induced diabetes, two had gestational diabetes mellitus, and three did not have diabetes . Weight information was updated on each biennial follow - up questionnaire, and it was used to calculate current bmi (weight in kilograms divided by the square of height in meters) using height in 1995 . In validation studies of anthropometric measures conducted among 115 bwhs participants, spearman correlations for self - reported versus technician - measured weight, as well as height, were 0.97, as well as 0.93, respectively (23,24). Information on whether the participant was born preterm was obtained from the 1997 questionnaire through the question, were you born 3 or more weeks early? (yes, no, do nt know). We observed high reproducibility (= 0.86) of self - reported preterm birth based on data from 776 bwhs participants who returned duplicate questionnaires in 1997 . Data on vigorous physical activity (hours / week) were obtained from the 1995 questionnaire and updated in follow - up questionnaires . Information on energy intake (calories per day) was estimated from 1995 and 2001 food frequency questionnaires (25,26) using the diet*calc software, version 1.4.1, from the national cancer institute (27). For assessment of individual socioeconomic status (ses), years of education were ascertained in 1995 and 2003 . Briefly, participants current addresses were linked through geocoding (mapping analytics, rochester, ny) to 2000 u.s . Factor analysis of block group census variables identified six variables (median household income; median housing value; percentage of households receiving interest, dividend, or net rental income; percentage of adults aged 25 years or older who have completed college; percentage of employed persons age 16 years or older who are in occupations classified as managerial, executive, or professional; and percentage of families with children that are not headed by a single female) that were used to calculate an index of neighborhood ses . We compared age - adjusted baseline characteristics across birth weight categories by computing means of continuous risk factors and proportions of categorical variables in each group . We calculated incidence rate ratios (irrs) and 95% cis using age- and period - stratified cox proportional hazards models . We calculated person - years of follow - up as the number of years from 1997 (i.e., baseline of the current study) to first diagnosis of diabetes, death, loss of follow - up, or end of follow - up (2013)whichever came first . Multivariable models included terms for first - degree family history of diabetes (yes or no), preterm birth (yes, no, or do not know), dietary caloric intake (quintiles of kilocalories per day), vigorous physical activity (none, <1 h / week, 14 h / week, or 5 h / week), years of education (12, 1315, 16, or 17 years), and quintiles of the index of neighborhood ses . In secondary analysis, we restricted our models to women not born preterm to make sure any observed association between very low and low birth weight and diabetes is due to fetal growth restriction rather than being born preterm . We used several approaches to assess whether birth weight affects risk of type 2 diabetes through an effect on bmi . First, we compared analyses without and with adjustment for bmi (<25, 2529, 3034, 3539, or 40 kg / m). Second, we performed mediation analysis to estimate the proportion of the association between birth weight and type 2 diabetes that is explained by bmi . We estimated mediation proportion, defined as, and 95% ci using the partial likelihood function (30) of cox models with and without bmi as implemented in the sas mediate macro (31). Third, we conducted bmi - stratified analyses (nonobese women, bmi <30 kg / m, and obese women, bmi 30 kg / m). Finally, we assessed the association of birth weight with incident obesity (bmi 30 kg / m) by estimating irrs adjusted for age, questionnaire cycle, being born preterm, energy intake, vigorous physical activity, years of education (12, 1315, 16, or 17 years), and quintiles of the index of neighborhood ses . The bwhs is an ongoing prospective follow - up study of african american women in the u.s . The study began in 1995 when 59,000 women aged 2169 years enrolled through completing health questionnaires . Participants were approximately equally distributed in the northeast, south, midwest, and west . We collected information on demographics, medical and reproductive history, body weight, height, diet, smoking, physical activity, and other factors through the baseline questionnaire . Participants have been followed through biennial questionnaires to collect information on incident diseases and update information on risk factors . Questions about birth weight were asked on the 1997 questionnaire (see below), and thus the present analyses are based on follow - up beginning in 1997 . Among the 24,085 women who provided adequate data on birth weight, we excluded those with diabetes, cancer, myocardial infarction, stroke, or coronary artery bypass graft surgery at baseline or incident diabetes diagnosed before age 30 years, which resulted in a final analytic sample of 21,624 women (fig . Final analytic sample after exclusions . Among the 24,085 women who provided adequate data on birth weight, we excluded those with diabetes (n = 1,319), cancer (n = 677), myocardial infarction (n = 234), stroke (n = 171), or coronary artery bypass graft surgery (n = 25) at baseline or incident diabetes diagnosed before 30 years of age (n = 35), which resulted in a final analytic sample of 21,624 women . On the 1997 follow - up questionnaire, women were asked their birth weight in categories (<4 lb; 4 lb to 5 lb, 8 oz;> 5 lb, 8 oz; do not know) and their exact birth weight in pounds and ounces, if known . We used information from both questions to create four categories of birth weight (very low, <1,500 g; low, 1,5002,499 g; normal, 2,5003,999 g; and high, 4,000 g). We carried out a validation study among 637 bwhs participants born in massachusetts using birth registry data from the massachusetts department of public health to corroborate self - reported data on birth weight . The coefficient of agreement for the categorical data was 0.80, and there were no significant differences across categories of adult bmi at the time of reporting in 1997 (p = 0.57). For exact self - reported birth weight, the pearson correlation coefficient was 0.88, and there were no significant differences across bmi categories (p = 0.38). These results are in agreement with previous studies (21,22) that have shown the validity of retrospectively collected self - reported birth weight information . We also assessed reproducibility of self - reported birth weight in a subset of 776 bwhs participants who completed the 1997 questionnaire two times . The coefficient was 0.86 for categorical birth weight, and the pearson correlation coefficient was 0.96 for exact birth weight . On each of the biennial questionnaires, we asked about a diagnosis of diabetes in the previous 2 years . The accuracy of self - reported diabetes was assessed in a sample of 229 women who reported being diagnosed with diabetes, who consented to the release of medical records from their physicians, and whose providers replied to the request . We found the diagnosis of type 2 diabetes to be confirmed in 220 (96%) of the women . Of the nine remaining participants, two had type 1 diabetes, one had metabolic syndrome with no diabetes, one had steroid - induced diabetes, two had gestational diabetes mellitus, and three did not have diabetes . Weight information was updated on each biennial follow - up questionnaire, and it was used to calculate current bmi (weight in kilograms divided by the square of height in meters) using height in 1995 . In validation studies of anthropometric measures conducted among 115 bwhs participants, spearman correlations for self - reported versus technician - measured weight, as well as height, were 0.97, as well as 0.93, respectively (23,24). Information on whether the participant was born preterm was obtained from the 1997 questionnaire through the question, were you born 3 or more weeks early? We observed high reproducibility (= 0.86) of self - reported preterm birth based on data from 776 bwhs participants who returned duplicate questionnaires in 1997 . Data on vigorous physical activity (hours / week) were obtained from the 1995 questionnaire and updated in follow - up questionnaires . Information on energy intake (calories per day) was estimated from 1995 and 2001 food frequency questionnaires (25,26) using the diet*calc software, version 1.4.1, from the national cancer institute (27). For assessment of individual socioeconomic status (ses), years of education were ascertained in 1995 and 2003 . Briefly, participants current addresses were linked through geocoding (mapping analytics, rochester, ny) to 2000 u.s . Factor analysis of block group census variables identified six variables (median household income; median housing value; percentage of households receiving interest, dividend, or net rental income; percentage of adults aged 25 years or older who have completed college; percentage of employed persons age 16 years or older who are in occupations classified as managerial, executive, or professional; and percentage of families with children that are not headed by a single female) that were used to calculate an index of neighborhood ses . We compared age - adjusted baseline characteristics across birth weight categories by computing means of continuous risk factors and proportions of categorical variables in each group . We calculated incidence rate ratios (irrs) and 95% cis using age- and period - stratified cox proportional hazards models . We calculated person - years of follow - up as the number of years from 1997 (i.e., baseline of the current study) to first diagnosis of diabetes, death, loss of follow - up, or end of follow - up (2013)whichever came first . Multivariable models included terms for first - degree family history of diabetes (yes or no), preterm birth (yes, no, or do not know), dietary caloric intake (quintiles of kilocalories per day), vigorous physical activity (none, <1 h / week, 14 h / week, or 5 h / week), years of education (12, 1315, 16, or 17 years), and quintiles of the index of neighborhood ses . In secondary analysis, we restricted our models to women not born preterm to make sure any observed association between very low and low birth weight and diabetes is due to fetal growth restriction rather than being born preterm . We used several approaches to assess whether birth weight affects risk of type 2 diabetes through an effect on bmi . First, we compared analyses without and with adjustment for bmi (<25, 2529, 3034, 3539, or 40 kg / m). Second, we performed mediation analysis to estimate the proportion of the association between birth weight and type 2 diabetes that is explained by bmi . We estimated mediation proportion, defined as, and 95% ci using the partial likelihood function (30) of cox models with and without bmi as implemented in the sas mediate macro (31). Third, we conducted bmi - stratified analyses (nonobese women, bmi <30 kg / m, and obese women, bmi 30 kg / m). Finally, we assessed the association of birth weight with incident obesity (bmi 30 kg / m) by estimating irrs adjusted for age, questionnaire cycle, being born preterm, energy intake, vigorous physical activity, years of education (12, 1315, 16, or 17 years), and quintiles of the index of neighborhood ses . Table 1 shows baseline characteristics of participants by birth weight categories . At baseline, of the 21,624 women included in the study, 2.3% had a very low birth weight, 23.9% had low birth weight, 66.0% had normal birth weight, and 7.8% had high birth weight . Age - adjusted baseline (1997) characteristics by birth weight categories over 16 years of follow - up and a total of 263,980 person - years, there were 2,388 incident diabetes cases (table 2). In the multivariate model, very low and low birth weight were associated with an increased risk of type 2 diabetes relative to normal birth weight . Irrs were 1.40 (95% ci 1.081.82) for very low birth weight and 1.13 (1.021.25) for low birth weight . Mediation analysis showed that bmi was not a significant mediator of the association of birth weight with type 2 diabetes . In an analysis restricted to women who were not born preterm, an association of low birth weight with risk of type 2 diabetes was observed similar to that in the overall sample: irr 1.19 (1.041.35). However, there was almost complete overlap between being born preterm and having a very low birth weight, preventing analysis of very low birth weight among women born full term . Irr (95% ci) for diabetes according to birth weight categories in the bwhs: 19972013 * multivariate model: adjusted for age, questionnaire cycle, first - degree family history of diabetes, being born preterm (yes, no, or do not know), activity levels (none, <1 h / week, 14 h / week, or 5 h / week), energy intake (quintiles of kcal / day), neighborhood ses quintiles, and education level (12, 1315, 16, or 17 years). Bmi (<25, 2529, 3034, 3539, or 40 adjusted for age, questionnaire cycle, first - degree family history of diabetes, activity levels, energy intake, neighborhood ses, subject s education level, and bmi (categories). Adjusted for age, questionnaire cycle, first - degree family history of diabetes, being born preterm, activity levels, energy intake, neighborhood ses, subject s education level, and bmi (continuous). The same patterns of risk were found within strata of bmi (bmi <30 vs. 30 kg / m; p for interaction = 0.25). In addition, no significant differences on risk were observed across the five bmi categories (<25, 2539, 3034, 3539, and 40 kg / m; p for interaction = 0.33) (data not shown). To further explore the hypothesis that very low and low birth weight may affect risk of type 2 diabetes through a higher risk of obesity, we assessed the relation of birth weight with incident obesity (bmi 30 kg / m) in a multivariate model adjusting for age, questionnaire cycle, being born preterm, energy intake, vigorous physical activity, years of education, and neighborhood ses . Relative to women with normal birth weight, neither women with very low birth weight, irr 1.01 (95% ci 0.811.26), nor women with low birth weight, 0.91 (0.840.99), had an increased risk of incident obesity; women with high birth weight had a borderline higher risk of incident obesity, 1.12 (1.001.26) (data not shown). Black women, we found that very low and low birth weights were associated with higher risk of incident type 2 diabetes . Although the association with low birth weight was independent of being born preterm, we could not distinguish between very low birth weight and being born preterm, since virtually all with very low birth weight were also born preterm . The association of very low and low birth weight with incidence of type 2 diabetes was not mediated by bmi, as the association remained almost unchanged after adjustment for bmi, mediation analysis did not show significant mediation by bmi, and an association was also present among nonobese women . The observed association also was not explained by variation in ses . With regard to high birth weight, we did not observe an increased risk of incident type 2 diabetes, despite the fact that women with high birth weight tended to have a higher risk of incident obesity relative to women with normal birth weight . Although the relation of birth weight to risk of type 2 diabetes has been assessed in several previous studies (3236), to our knowledge ours is the first report on this relation in african american women, a population with high frequency of low birth weight (6) and high incidence of type 2 diabetes (7). A meta - analysis of 14 studies reported a u - shaped relation of birth weight with risk of type 2 diabetes, with both low birth weight and high birth weight associated with higher risk of type 2 diabetes relative to normal birth weight (4). A more recent and bigger meta - analysis of 31 studies reported an overall inverse relation of birth weight with risk of type 2 diabetes (5), and exclusion of macrosomic infants (> 4,000 g birth weight) had little effect on the overall inverse association (5). However, there was substantial heterogeneity between populations, with few groups, particularly native americans, showing a u - shaped relation of birth weight and risk of type 2 diabetes (5). Our results are consistent with both meta - analyses in showing that low birth weight is associated with higher risk of type 2 diabetes, and we show that this increased risk extends to very low birth weight . However, because of the almost complete overlap between very low birth weight and being born preterm, we could not assess an independent effect of very low birth weight, and it is unclear how much of the observed association is due to being born preterm . We did not find an increased risk of type 2 diabetes for women who had a high birth weight even though they had a higher risk of incident obesity relative to women who had normal birth weight . To date, the relation of high birth weight to type 2 diabetes is unclear, as two meta - analyses provide conflicting findings (4,5). Our results are also consistent with a recent report using data from the national health and nutrition examination survey (nhanes) cycles 20012010, which found that low birth weight but not high birth weight was associated with type 2 diabetes risk factors such as fasting glucose, fasting insulin, and homa in 10,758 u.s . Although the evidence is still limited, it may be that higher adult bmi in persons who had a high birth weight reflects more lean tissue than fat mass (38,39), explaining the apparently paradoxical observation that individuals who had high birth weight had higher bmi as an adult but not higher risk of type 2 diabetes relative to persons who had normal birth weight . Mediation analysis in our study suggested that adult bmi did not play a major role as a mediator of the relation between very low and low birth weight and development of type 2 diabetes in adulthood . This conclusion is supported by other results such as the following: 1) adjustment for bmi did not attenuate the association of very low and low birth weight with risk of type 2 diabetes, 2) very low and low birth weight were associated with increased risk of type 2 diabetes even among nonobese women, and 3) women who had very low and low birth weight did not have an increased risk of incident obesity relative to women who had a normal birth weight . Results from animal models and human studies suggest a multifactorial etiology that includes neuroendocrine alterations (4042), deregulation of lipid metabolism (4345), and pancreatic dysfunction (4648) among others . Recent evidence suggests that low birth weight and type 2 diabetes may share a genetic basis (1517), and at least two of the shared loci (cdkal1 and hhex - ide) have been implicated in -cell dysfunction (18,19). These observations lend support to the fetal insulin hypothesis (49), which states that low birth weight and type 2 diabetes later in life are manifestations of the same genotype, and they are due to impairment of -cell development that is genetically programmed (15). It is noteworthy that regardless of the potential mechanisms, the impact of low birth weight on the risk of type 2 diabetes may be stronger among african americans, as a recent study found a more substantial association between low birth weight and components of the insulin resistance syndrome among african american children than among white children (45). The current study has several strengths including its large size, high rate of follow - up, and ability to control for important confounding variables . Information on birth weight was self - reported many years after the fact, raising the possibility of exposure misclassification . However, our validation study showed high correlations between self - reported birth weight and birth registry data, and there were no differences across bmi categories . Thus, although we cannot exclude a certain degree of misclassification, this was most likely at random and generally would result in attenuation of our findings . While information about type 2 diabetes was also self - reported, a validation study found self - report to have high sensitivity (96%) for diabetes diagnosis . In addition, because the prevalence of undiagnosed diabetes among african american women is ~4% (7) we do not expect a major effect of undiagnosed diabetes on our estimates of risk . With respect to anthropometric measurements, our validation study showed very high correlations between self - reported and technician - measured weight and height . We cannot rule out the presence of residual confounding due to unmeasured variables such as maternal metabolic status during pregnancy . For example, we had no information about maternal gestational diabetes mellitus, which is a risk factor for development of type 2 diabetes in the offspring later in life (50).the current prevalence of gestational diabetes mellitus among african american women is ~4% (51), but based on temporal trends this prevalence was most likely <2% during the time most of the study s participants were born (51). It is unlikely that unmeasured gestational diabetes mellitus, given its low prevalence, had a major impact on our results . Finally, although we cannot establish a causal link between low birth weight and type 2 diabetes in adulthood, taken together our results, most previous observational studies, and results from animal models do suggest a causal role of compromised fetal growth in the development of type 2 diabetes . In summary, this large prospective study of african american women suggests that both very low and low birth weight are associated with a higher risk of incident type 2 diabetes . This relation was not mediated by bmi, suggesting that mechanisms independent of bmi are responsible for the observed association . The prevalence of low birth weight is especially high in african american populations, and this may explain in part the higher occurrence of type 2 diabetes.
|
Iridodialysis commonly occurs secondary to blunt ocular trauma,1 penetrating ocular trauma, and intraocular surgical procedures . In the cases of small iridodialysis the upper eyelid covers iridodialysis superiorly and prevents symptoms . However, temporal iridodialysis is usually symptomatic . In addition to visual problems such as diplopia, glare, and photophobia, cosmetic problems such as polycoria and ectopic pupil might occur due to large iridodialysis . A number of surgical techniques have been described for the repair of iridodialysis.245678 we describe a novel cobbler's technique for repairing iridodialysis in the right eye of an 18-year - old patient . Following peribulbar anesthesia, a fornix - based localized conjunctival peritomy (611 oclock) was performed in the right eye of a patient with traumatic iridodialysis extending from 7 oclock to 10 oclock position in the inferotemporal quadrant [figure 1]. A partial thickness scleral tunnel was created 1.5 mm from the limbus along the extent of the iridodialysis . A limbal paracentesis was created with a stiletto knife at the 2 oclock position, and intracameral pilocarpine was injected into the anterior chamber to place the iris tissue on the maximal stretch . The 26-gauge needle was passed through the paracentesis and the 10 oclock end of the scleral groove engaging the root of the iris . The needle was withdrawn into the anterior chamber and taken out at the 9.30 oclock position engaging the root of the iris again . The prolene suture was pulled out forming a loop through which the free end of the suture was passed to lock the loop . This step was repeated multiple times until multiple loops laid over the scleral bed [figure 2]. These loops were then tied [figure 3] and the conjuctival peritomy was closed using 8 - 0 vicryl sutures . Preoperative photograph showing a corneal scar inferiorly and a large iridodialysis from 7 oclock to 10 oclock position illustration of passage of the 10 - 0 polypropylene suture from iris to sclera with multiple suture loops lying over the scleral bed illustration of suture tied at 7 oclock position first postoperative day photograph of the same eye after iridodialysis repair postoperative photograph 3 weeks following surgery functional symptoms, such as glare and monocular diplopia, result from the polycoria of a pseudo - pupil created by the iridodialysis . Typically, these complaints are most commonly seen when iridodialysis is located in the nasal, temporal, or inferior quadrants, as was seen in our patient . Cosmetic deformities associated with iridodialysis can affect self - esteem adversely and thus have a major psychosocial impact on the patient.910 various methods for surgical repair of iridodialysis2345678 have been described in literature . Most of these procedures require more surgical maneuvers and anterior chamber is often not stable while repairing large iridodialysis . The advantages of cobbler's technique for repairing iridodialysis as described above include: (1) it is performed through a small paracentesis wound; (2) the anterior chamber remains stable throughout; (3) multiple sutures can be passed without withdrawing the needle from anterior chamber; (4) large dialysis can be repaired easily; (5) the shape of the iris can be controlled; (6) only one suture knot is required at the end of the incision which can be easily be buried within the sclera groove minimizing the likelihood of late suture erosion . Our novel cobbler's technique for iridodialysis repair allows a maximally functional and cosmetic result . This technique was named cobbler's technique since it bears great similarity to the way a cobbler repairs shoes.
|
Cardiovascular disease (cvd) burden is substantially higher in chronic kidney disease (ckd) compared to non - ckd patients . In the end - stage renal disease (esrd) population, cardiovascular mortality is the leading cause of death, and despite the recently reported improvement in survival rates, cvd in this group remains unacceptably high . The increase in cardiovascular risk starts early on in ckd, with a lower estimated glomerular filtration rate (egfr) shown to be independently associated with increased cardiovascular risk even at the stage of microalbuminuria . Ckd patients are therefore justifiably considered in the highest - risk group classification for cvd and, in fact, their risk of dying from a cardiac cause actually exceeds the risk of reaching esrd . They are attributed to a rather complex interplay of uremia - associated risk factors that are superimposed, as the disease progresses, on the already high burden of cvd traditional factors that characterizes the ckd population . Subclinical atherosclerosis, as measured by noninvasive methods such as ultrasonically determined carotid intima - media thickness (cimt), is a valid predictor of coronary heart disease and vascular events in asymptomatic individuals . This is particularly important in the ckd group where the classic cardiovascular risk score approach underestimates the atherosclerotic burden . Additionally, novel early atherosclerosis biomarkers, as well as possible therapeutic targets, are greatly needed in ckd patients . Matrix metalloproteinases (mmps) may fall into this category of both useful markers and targets in ckd disease . Mmps are a large family of endopeptidases that function under tight control, remodeling the extracellular matrix (ecm) and regulating the activity of many important non - ecm molecules including adhesion molecules, cytokines, and growth factors . They are classified according to their substrate specificity, sequence similarity, and domain organization into six groups: collagenases (mmp-1, mmp-8, mmp-13, and mmp-18), gelatinases (mmp-2, mmp-9), stromelysins (mmp-3, mmp-10), matrilysins (mmp-7, mmp-26), membrane - type mmps (mmp-14, mmp-15, mmp-16, mmp-24, mmp-17, and mmp-25), and other mmps (mmp-12, mmp-19, mmp-20, mmp-21, mmp-23, mmp-27, and mmp-28). Their proteolytic activity is regulated at transcriptional and posttranslational levels but also at the tissue level by endogenous inhibitors, known as tissue inhibitors of metalloproteinases (timps 14). In vascular physiology and pathophysiology, they hold a prominent role by remodeling the ecm scaffold of the vessel wall and as regulators of the biological activity of nonmatrix molecules, including angiotensin - i, endothelin, tnf-, and others [1315]. Based on the emerging role of mmps in vascular remodeling and their increased expression and activation under inflammatory and oxidative stress conditions, many studies have shown mmps imbalance to be a key event in atherosclerosis, arterial aneurysmal formation, and plaque instability . Circulating levels of various mmps have been associated with both clinical manifestations of cvd [16, 17] and subclinical atherosclerosis [1820] or even as predictors of outcomes following revascularization [21, 22]. Additionally, increased expression of mmps was observed at tissue level, in human carotid, coronary, and aortic atherosclerotic lesions [2325]. Currently, the focus is on clarifying their exact role in the disease state and exploiting them in innovative diagnostic and research methodologies, as well as using them for prevention and therapy of vascular disease [2830]. In ckd, a plethora of underlying factors, with preeminent toxic uremic milieu and the increased levels of proinflammatory cytokines, oxidative stress, and acidosis, maintain a state of persistent low - grade inflammation, especially in esrd, with the addition of dialysis - related factors [31, 32]. Although this state of chronic inflammation in ckd renders mmps attractive candidates for studies in this population and despite the mounting evidence of their role in cvd, the association between mmps and subclinical atherosclerosis in ckd patients has not been systematically studied . To this effect, we performed a systematic literature review and evaluation of the evidence associating circulating levels of mmps with subclinical atherosclerosis outcomes in ckd patients . The electronic databases scopus, pubmed, and google scholar were searched from inception until may 2015 using the keywords: atherosclerosis, metalloproteinases, kidney diseases, and hemodialysis either in the title or the abstract or using medical subject headings (mesh) terms . Inclusion criteria were ckd cohort or case - control studies involving ckd patients, reporting as one of the outcomes of interest, the relationship of circulating measurement of mmps or their tissue inhibitors (timps), and markers of atherosclerosis (i.e., imt, plaque number, or similar atherosclerotic outcomes). The included studies were identified after two reviewers (andreas kousios, panayiotis kouis) independently screened the title and abstract of the obtained electronic search results and final selection was based on full text evaluation . Two reviewers (andreas kousios, panayiotis kouis) independently extracted data regarding the studies' design, characteristics of the included ckd population, methodology for circulating mmps levels determination, and assessment of atherosclerosis outcomes . The direction and magnitude of the association were recorded, as well as additional information such as method of statistical analysis and adjustment for potential confounders . The newcastle - ottawa scale for observational studies, which evaluates the selection of participants, the comparability of different groups, and ascertainment of exposure and outcome of interest, was utilized for the quality assessment of the included studies . In addition, a more detailed quality assessment was carried out regarding the methodology of atherosclerosis outcome evaluation based on the mannheim consensus criteria for carotid intima - media thickness and plaque assessment . 6218 items were excluded from further analysis based on title and abstract, while the remaining 106 were retrieved for full text assessment . Studies with overlapping populations were cross - checked and final selection was based on the number of ckd participants . Among the reports assessed in full text, 32 were literature reviews, 6 were commentaries or editorials, and another 4 were animal studies . Additionally, 12 studies did not provide data on serum concentrations of mmps or their tissue inhibitors, 31 studies did not provide evidence on atherosclerosis related outcomes while 4 studies did not comprise a ckd population, and another one involved an overlapping population with another study . In summary, out of the total 106 reports retrieved, 16 reports were included in the qualitative synthesis and, among these, a total of 9 studies provided enough data to be included in the quantitative synthesis (figure 1, prisma diagram). The studies that were excluded at the last step prior to quantitative synthesis and the reason for their exclusion are presented in supplementary table 1 (in supplementary material available online at http://dx.doi.org/10.1155/2016/9498013). Four studies were carried out in europe while the remaining studies were performed in the usa (two), africa (two), and asia (one). All the studies were observational and the majority of them included a ckd subgroup of participants along with age - matched healthy controls . Weber et al . Evaluated the association of mmps with atherosclerosis outcomes only in ckd stages iii and iv while snchez - escuredo et al . Overall, the nine studies reviewed here involved a total of 1061 participants, of whom 858 were ckd patients and 203 were healthy controls . Of the ckd patients, the association between mmp-2 and timp-1 with atherosclerosis was the most frequently assessed (four studies) with mmp-9 also assessed in three . Seven studies used cimt as the atherosclerosis outcome and two of them also used an atherosclerosis score and carotid plaque number [37, 38]. The two studies included that did not measure cimt provided data on the relationship between mmps or their tissue inhibitors and aortic and coronary artery calcification and carotid plaque presence . Characteristics of studies, including atherosclerotic outcome assessed, are shown in table 1 . Mmp-2 was found to have a positive association with cimt even after adjustment for multiple confounders in three studies [3941] and a positive association with abdominal aortic calcification but not with coronary artery and thoracic aortic calcification . The relationship of timp-1 with cimt was less consistent as only one of the three studies evaluating this relationship reported a statistically significant positive association; however, it did not account for different confounders . Similarly, weber et al ., who evaluated the relationship between timp-1 and calcification at coronary and aortic sites and included adjustment for multiple confounders, reported no statistically significant association either . Mmp-9 was found to be positively and strongly associated with cimt, atherosclerosis score, and number of carotid plaques in a ckd population by addabbo et al . But this relationship was not confirmed in two additional studies evaluating mmp-9 and cimt [39, 40]. Mmp-10 was only assessed in two studies and both of them reported a positive association with cimt in hd subgroups [38, 42] but only one of them reported a similar association in a non - hd, ckd subgroup . Evaluated the relationship of papp - a with plaque presence and reported a significant positive association in a population of hd patients awaiting kidney transplant (or: 4.45; ci: 1.2216.2; p value: 0.023). Papp - a was not found to be associated with cimt in a more recent study also involving hd patients . Among the tissue inhibitors of mmps evaluated in this review (i.e., timp-1 and timp-2), only timp-2 showed some evidence of a negative association with atherosclerosis as pawlak et al . Reported a negative association after adjusting for confounders between timp-2 and cimt, although in a more recent study by the same group this finding was not repeated . The quality assessment of the included studies was performed according to the newcastle - ottawa scale and the results are presented in table 2 . Overall, the included studies were characterized by good methodology and this offers some reassurance that the results presented have not been substantially influenced by bias . However, due to the substantial variability in the methodology and equipment used for the evaluation of atherosclerosis outcome, an additional table was constructed with particular emphasis on the modalities and the measurement and reporting methods used by each study (table 3). In concordance with the mannheim consensus, most studies assessed atherosclerosis in longitudinal view on the far wall and common carotid artery (cca) was the most commonly used anatomical site followed by carotid bulb (cb) and the internal carotid artery (ica). However, few studies reported whether measurements were obtained at the end of diastole or whether measurement was obtained in a blinded fashion . This systematic review evaluated the published evidence on the association between circulating levels of mmps and subclinical atherosclerosis in ckd patients . Furthermore, the vast majority of studies were also characterized by a small sample size as most of them included less than 100 ckd patients . Cimt was the main measure of subclinical atherosclerosis reported and mmp-2 and timp-1 were the most commonly assessed metalloproteinases . Although the number of studies providing the same data on mmp-2 was too small for a formal meta - analysis, the overall consistent direction and magnitude of the association of mmp-2 with cimt reported in the different studies suggest that this is positively associated with subclinical atherosclerosis in ckd patients . It is however important to note that two out of the four studies reporting on mmp-2 were in hemodialysis patients only . On the contrary, most of the studies that evaluated timp-1 and subclinical atherosclerosis did not find any significant relationship, while for the remaining mmps, the low number of studies identified does not allow for any inferences regarding their association with subclinical atherosclerosis . Studies involving ckd patients that did not use atherosclerosis measures as an outcome were excluded at the last step, prior to quantitative synthesis, in order to limit the results of this study to objective atherosclerosis measures as opposed to clinical or self - reported measures such as history of cvd . Notably, in these studies, circulating levels of mmp-2 were associated with previous history of cvd in a non - hd ckd population and in a peritoneal dialysis (pd) population, providing further supporting evidence for mmp-2 association with cvd in ckd (supplementary table 1). For consistency, we also excluded studies that had measured mmp expression in vessel tissue instead of circulating concentrations . Although tissue expression level is a direct evidence of mmp implication in the pathophysiology of atherosclerosis, it is not easily transferrable in the clinical setting as a biomarker . Interestingly, only one study was found to report an association between serum measurements of mmps and atherosclerosis markers in pediatric ckd patients, making a separate review of these findings not possible . Overall, although this approach limits the number of informative studies reviewed here, it allowed us to answer the more precise question on the association between circulating mmps and subclinical atherosclerosis in adult ckd patients . Regulation of mmps expression and activity in physiological or pathological vascular remodeling is induced by hemodynamics, injury, inflammation, and oxidative stress [15, 47, 48]. In ckd, a condition where these processes are enhanced, it is expected that mmp dysregulation is intensified, particularly in late ckd stages and hd . Persistent, low - grade inflammation in ckd is attributed to the production of proinflammatory cytokines combined with their decreased renal clearance, the ckd - associated metabolic acidosis, the uremic milieu induced oxidative and carbonyl stress, the chronic or frequent recurrent infections, and thrombotic events . In addition, dialysis - related factors, such as membrane biocompatibility, water and dialysate purity, and microbiological quality, further contribute and sustain inflammation in esrd . This uremia - inflammation interplay in ckd underlies the accelerated atherosclerosis and increased imt, the arterial stiffening, and increased vascular calcification of both intima and media and impairs the vascular repair process with the detrimental consequences of neointimal hyperplasia . Moreover, plaque morphology, composition, and vulnerability differ in ckd, as coronary and carotid plaques of ckd patients were shown to be more calcified, more unstable, and frequently ruptured and containing less fibrous tissue [5052]. Central to the pathogenesis of these processes and plaque formation are the endothelial cell (ec) dysfunction and vascular smooth muscle cell (vsmc) migration and their phenotypic shift to a more proliferative and secretory state [49, 53]. Their cleaving of ecm and non - ecm molecules induces the pathogenic phenotypic shift of ecs and vsmcs and facilitates increased endothelial inflammation and permeability, intimal - medial thickening, fibrosis, calcification, and stiffening [26, 54]. Mmps 1, 2, 8, 9, and 12 are mostly implicated in these processes with mmp-2 and mmp-9 having a prominent role . In later stages of atherosclerosis, mmps contribute to reducing the atherosclerotic plaques' fibrous cap, thus rendering plaques more unstable and prone to rupture . In ckd patients, only few studies have examined the levels of circulating mmps compared to controls demonstrating increased circulating mmp levels in ckd, particularly those of mmp-2, mmp-9, and mmp-10 [57, 58]. Additionally, mmp-2 and mmp-9 were shown to be upregulated focally in uremic vessels in two studies by chung et al . [59, 60]. Mmp-2 was upregulated in arteries of esrd patients and activated mmp-2 was strongly correlated with arterial stiffness in dialyzed patients (supplementary table 1). Mmp-2 and mmp-9 were upregulated in diabetic ckd arteries and correlated with stiffening and endothelial dysfunction (supplementary table 1). As research is ongoing on the development of cardiovascular risk markers in ckd patients, mmps stand to serve as potential biomarkers for atherosclerosis and cardiovascular risk assessment in this high risk group . In order for a potential biomarker to be approved for clinical use, it needs to be confirmed through rigorous testing of multiple subjects and testing should be characterized by reproducibility, good sensitivity, and specificity . The limited number of studies identified in this review reflects the fact that the level of evidence is still quite low for use of mmps as biomarkers for atherosclerosis in ckd patients, although the accessibility and relatively low cost of circulating mmps measurements along with knowledge of the disease mechanisms argue about the benefit of additional and larger studies involving ckd patients . Moreover, such studies would provide further insight into their contribution to the higher cvd burden in ckd and, more importantly, would pave the way for their use in therapeutic interventions or even their targeted and specific inhibition . Although the majority of the studies reviewed here are characterized by good overall methodology according to the newcastle - ottawa scale criteria, we have identified additional parameters relating to the performance of atherosclerosis assessment that vary between studies and may introduce additional variability in the estimated relationship between circulating mmps and subclinical atherosclerosis . As most of the studies used cimt and plaque measurements as surrogates for subclinical atherosclerosis, it is important to highlight the necessity of a homogenized approach for image acquisition, data analysis, and reporting methods, as well as the use of unified criteria to distinguish early atherosclerotic plaques from increased imt . With regards to imt measurement, the manheim carotid intima - media thickness and plaque consensus report proposes the site of measurement to be the far wall of the cca . Mean imt values across the cca may be less susceptible to errors compared to maximum values and composite measures of imt and plaque should be avoided . Plaque assessment should include the location, thickness and area, and plaque number and should be scanned in longitudinal and cross sections . In most of the reviewed studies, although imt was measured in the far wall of cca, there was considerable variability in methodology and poor plaque assessment . Furthermore, circulating levels of mmps are influenced by environmental, genetic, disease, and drug related factors and although evaluating each of these factors individually is beyond the scope of this review; they need to be carefully examined in future study designs involving ckd populations . Additionally, variations in sample collection methodology and preanalytical care have been found to significantly affect mmps levels with serum samples reported to have higher mean values compared to plasma samples [64, 65]. The majority of the included studies in this review had measured mmps levels in serum [36, 3843], with only two studies using plasma [35, 37]. Although we cannot exclude the possibility of such discrepancies in explaining part of the heterogeneity in the results, it seems unlikely that they would explain all of it as similar heterogeneity exists in the results obtained from studies that used serum . Also, variations in mmps levels could arise from the status of recruited patients as it is suggested that hemodialysis may affect mmp levels, especially mmp-2, mmp-9, and their inhibitors [66, 67]. Additionally, all studies included patients with a history of cvd . However, only six out of the nine studies reported the prevalence of cvd history in their patients groups which ranged between ~8% and 80%, while the cross - sectional design of the studies further limits the causal inferences that could be made . Finally, none of the studies performed a priori power analysis in order to estimate the appropriate sample size and the possibility of publication bias cannot be excluded as almost no study included in this review reported only a negative association between mmps levels and subclinical atherosclerosis . Despite the extensive study of mmps and their role in the atherosclerotic process in both animal models and human studies, there are disproportionately fewer published studies of the atherogenic effects of mmps in patients with ckd . This is in keeping with a well described phenomenon of underrepresentation of ckd patients in cardiovascular disease studies despite the growing global burden of kidney disease and the high prevalence of ckd among cvd patients . Nonetheless, based on their central role in arterial wall remodeling, mmps demonstrate great potential for further studies in ckd, a condition where the main drivers for mmp dysregulation, such as inflammation and oxidative stress, are intensified . Their linkage to early atherosclerotic change, reflected in established but often not easily accessible subclinical atherosclerosis markers, provides the basis for mmps use as biomarkers or even as pharmacological targets of cardiovascular disease in ckd patients . To this effect, we have systematically reviewed the literature and critically appraised all studies addressing the association of various mmps with subclinical atherosclerosis in ckd patients . We aimed to help structure the knowledge derived from human studies in the field and identify potential candidate mmps for further research . Future research initiatives in this field are thus urgently needed and would benefit by addressing the methodological issues identified in this review, during the study design process . Overall, these findings are highly relevant in view of the undiminished interest in mmps and the need for novel approaches to address the significant problem of cvd in chronic kidney disease . In summary, the published evidence reviewed here demonstrates that circulating mmps levels could potentially be of use as biomarkers of subclinical atherosclerosis in adult ckd populations . Mmp-2 shows the greatest promise although most of the other mmps or their tissue inhibitors are mostly understudied in the ckd population and no inferences about their potential can be made . Studies characterized by larger and well defined ckd populations and involving several mmps and a consistent and homogenized assessment of different measures of subclinical atherosclerosis such as imt and plaque burden are urgently needed.
|
Gitelman syndrome (gs) is an autosomal recessive salt - losing tubulopathy (omim 263800) characterized by hypokalemic metabolic alkalosis, hypomagnesemia and hypocalciuria . Gs is caused by mutations in the slc12a3 gene encoding the na cl co - transporter (ncct) of the distal convoluted tubule (dct). To date,> 240 slc12a3 mutations have been identified in gs [3, 4]. As dct - mediated salt reabsorption accounts for only 5% of the filtered sodium load, gs has normally been described as having a mild salt - wasting phenotype that is often not detected until adolescence or early adulthood [3, 5, 6]. Bartter syndrome (bs) is a heterogeneous autosomal recessive salt - wasting condition that tends to present earlier in childhood with a more severe phenotype including significant salt wasting, polyuria and failure to thrive . Mutations affecting the na2clk co - transporter (nkcc2; omim 601678) or the renal outer medullary potassium channel (romk; omim 241200) in the thick ascending limb (tal) often present antenatally with polyhydramnios, prematurity and severe salt wasting requiring significant electrolyte supplementation [8, 9]. Hyperprostaglandin e syndrome following the description of elevated prostaglandin e2 (pge2) levels in such cases . It was this discovery that led to the successful treatment of these patients with the cyclo - oxygenase inhibitor indomethacin, which remains an important part of therapy along with salt and water supplementation . Type iii bs results from mutations that affect the basolateral chloride channel (clc - kb) in the dct and tal (omim 607364). Type iva bs with sensorineural deafness is the result of mutations in the barttin subunit of the clc - ka and clc - kb channels, which are expressed in the tal and inner ear (omim 602522). Digenic mutations of both the clc - ka and clc - kb channels have also been described causing bs with sensorineural deafness (type ivb bs; omim 613090). Type v bs results from mutations leading to upregulation of the calcium sensing receptor (casr) and therefore hypocalcemia and hypercalciuria in addition to the typical salt - losing phenotype (omim 601198) [15, 16]. Most recently, the combination of epilepsy, ataxia, sensorineural deafness and salt wasting tubulopathy similar to gs has been associated with mutations of the inward - rectifying potassium channel kir 4.1 (east syndrome; omim 612780). We describe two female siblings presenting in infancy with hypokalemic metabolic alkalosis, severe failure to thrive, polyuria and increased pge2 excretion . Both siblings revealed a dramatic clinical response to indomethacin including improvements in growth and polyuria . . However, genetic studies later confirmed a diagnosis of gs with the identification of compound heterozygous mutations in slc12a3 . The first case is a caucasian female born at term weighing 3.2 kg (appropriate for gestational age). This was the mother's first child with no history of spontaneous losses, consanguinity or family history of renal disease . She first came to medical attention at the age of 5 months for failure to thrive with a weight of 4.8 kg and length of 59 cm (height sds 1.2, weight sds 2.1; figure 1). She was solely breast fed and thus supplementary formula feeds were introduced over the next month, but her weight fell further to 4.7 kg . At this time, she was reported to feed hourly with frequent vomiting, but no diarrhea . A history of polyuria was noted by the parents with frequent changing of wet diapers . Gross motor delay was also noted as she had only just begun to roll and had significant head lag . The treating pediatrician arranged for admission to the local hospital for further investigations and management . (a) case 1 (birth2 years); arrow indicates start of indomethacin . (c) case 2 (birth2 years); arrow indicates start of indomethacin . Present); arrow indicates increase in dose of indomethacin . Growth profile of cases . (a) case 1 (birth2 years); arrow indicates start of indomethacin . (c) case 2 (birth2 years); arrow indicates start of indomethacin . Her chemistry profile demonstrated severe hyponatremia (na 124 mmol / l) and a hypokalemic (k 2.1 mmol / l), hypochloremic (cl 72 mmol / l) metabolic alkalosis (ph 7.59, hco3> 45 blood urea nitrogen (bun) and creatinine were within normal limits at 2.8 mmol / l and 29 mol / l, respectively . Mmol / l (fractional excretion 0.63%) and urine potassium 23.2 mmol / l (fractional excretion 81%). Urine calcium: creatinine (uca: cr) ratio was elevated at 6 mmol: mmol with a normal serum calcium (2.53 mmol / l). She was normotensive despite elevated plasma renin and aldosterone levels at 44 ng / l / s (normal range 0.130.87 ng / l / s) and 5795 renal ultrasound was normal with no evidence of dysplasia, cysts, stones or nephrocalcinosis . She was initially treated with intravenous normal saline and added potassium chloride to stabilize the electrolyte abnormalities . She was also commenced on oral supplementation of magnesium glucoheptonate (6 mg / kg / day of elemental mg) and potassium chloride (5.5 mmol / kg / day). With increasing doses of supplements, her hypokalemia, hypomagnesemia and metabolic alkalosis gradually improved over the next few months . However, at 1 year of age, her growth remained poor (height sds 2.5, weight sds 2.9; figure 1). Consequently, the decision was made to start oral indomethacin (2 mg / kg / day divided bid). Over the next 612 months, she showed an excellent response to indomethacin with less polyuria, improved motor development and marked catch - up growth (current height sds 0.37, weight sds 1.05; figure 1). Her uca: cr ratio, which was initially elevated, has been in the hypocalciuric range (<0.05 mmol: mmol) since the age of 2 years . Her current regimen at 8 years of age includes indomethacin (3.5 mg / kg / day divided bid), potassium chloride (3.5 mmol / kg / day divided tid), amiloride (0.8 mg / kg once daily) and magnesium glucoheptonate (13 mg of elemental mg / kg / day). She consumes large quantities of high salt foods including feta cheese and olives on a daily basis . Her most recent bloodwork at 8 years of age shows stable electrolytes and blood gas values (na 138 mmol / l, k 3.6 mmol / l, cl 99 mmol / l, mg 0.75 mmol / l, ph 7.40, hco3 29 mmol / l). Mol / l [estimated glomerular filtration rate (egfr) 84 ml / min/1.73 m]. Case 2 is the second child (female) born to the same parents at 36 weeks gestation weighing 2.5 kg (appropriate for gestational age). Given her older sister s history (case 1), blood work was drawn at 1 week of age which demonstrated mild hyponatremia (132 mmol / l) and metabolic alkalosis (ph 7.64, hco3 30 mmol / l). The bun was mildly elevated at 5.3 mmol / l, consistent with volume depletion, and creatinine normal at 20 her first uca: cr ratio at 4 months of age was in the normal range (0.74 mmol: mmol) with a normal serum calcium (2.72 mmol / l). Sodium chloride supplementation (1 mmol / kg / day) was initiated at 1 week . She did not require potassium chloride supplementation (1 mmol / kg / day) until 5 months of age when she became persistently hypokalemic (k 2.9 mmol / l). Indomethacin (2 mg / kg / day) was commenced at 1 year of age given for failure to thrive (height sds 3.7, weight sds 3.9). Her growth response to indomethacin was appreciable, but less marked than that of her sister . However, her growth has improved with a gradual increase in the dose to 3 mg / kg / day from 2 years of age (current height sds 1.96, weight sds 1.11; figure 1). Magnesium glucoheptonate supplementation was also started at 2 years of age (3 mg of elemental mg / kg / day) with the evolution of hypomagnesemia (serum mg 0.66 she has required multiple admissions to hospital for exaggerated electrolyte imbalances including severe hypokalemia (k <2.5 mmol / l) in association with routine childhood infections . Her uca: cr is now persistently in the hypocalciuric range (<0.05 mmol: mmol). Her current treatment regime at 5 years of age includes potassium chloride (3.8 mmol / kg / day divided bid), magnesium glucoheptonate (4.7 mg / kg / day of elemental mg divided tid), indomethacin (3.8 mg / kg / day divided bid) and amiloride (0.8 mg / kg once daily). Electrolytes and blood gas have been stable on this regimen (current na 137 mmol / l, k 3.6 mmol / l, cl 100 mmol / l, mg 0.81 mmol / l, ph 7.4, hco3 30 mmol / l). Of note the most recent serum creatinine was normal at 41 mol / l (egfr 94 ml / min/1.73 m). Genetic testing identified biallelic slc12a3 mutations in both siblings: c.473 g> a encoding p.r158q and c.631_642del (p.r211_e214del) (figure 2). The c.473 g> a mutation has been previously described in a child with gs while the c.631_642del mutation has not been previously reported . The slc12a1, kcnj1, clcnka, clcnkb, bsnd genes were also screened with no mutations identified . The c.473 g> a mutation was found to be maternal in origin and c.631_642del paternal . The father is of normal height (180 cm, sds 0.44); however, the mother is short (150 cm, sds 2.05). Slc12a3 gene displaying known exons with mutations identified in the cases marked . Following the molecular analysis, both sisters were electively admitted to hospital to determine prostaglandin (pge2) excretion while off indomethacin therapy . We felt that this admission would clarify the need for long - term indomethacin therapy in both patients, given this therapy is normally prescribed for cases of bs and carries significant long - term risks of renal and gastrointestinal toxicity . Indomethacin was held for 48 h prior to admission (washout period), but regular supplements were continued in both siblings . Upon admission, initial bloodwork revealed severe hypokalemia (2.5 mmol / l in both) with metabolic alkalosis (case 1: hco3 32 mmol / l, case 2: hco3 33 mmol / l). Both siblings were polyuric upon presentation (case 1: 5.5 ml / kg / h, case 2: 8.8 ml / kg / h). Twenty - four - hour urine prostaglandin e2 (pge2) excretion was significantly elevated at 2059 ng / day/1.73 m in case 1 and 3609 ng / day/1.73 m in case 2 (normal range 48394 ng/24 h/1.73 m). After a bolus of normal saline (20 ml / kg) and following 48 h of intravenous fluids (maintenance rate), urine pge2 excretion decreased to normal ranges in both siblings (case 1: 374 ng/24 h/1.73 m, case 2: 312 ng/24 h/1.73 m in case 2). Based on these results, a decision was made to reintroduce indomethacin at their previous doses . It was thought unlikely that the siblings would be able to consume sufficient oral fluids and salt supplementation to replicate the effects of the intravenous volume expansion achieved in hospital . The polyuria and electrolyte / acid base derangements again improved within 1 week of restarting therapy . The classic description of gs is of a benign salt - wasting condition most often diagnosed in adulthood [1, 3]. However, in more recent literature, gs appears to be responsible for a wider spectrum of disease than initially appreciated [4, 19, 20]. A limited number of reports have emerged describing children affected as early as the neonatal period [21, 22]. Also mentioned within larger cohort descriptions of gs are cases presenting at <2 years of age with symptoms including growth delay, hypotonia and muscular spasms from severe hypomagnesemia [4, 19, 20]. Previous case series have suggested that males may be more severely affected than females . Aside from the severity of our described gs cases, there are some interesting biochemical findings worthy of discussion, in particular the demonstration of raised urinary pge2 excretion in both siblings . Increased pge2 is typically associated with nkcc2 or romk channel mutations resulting in antenatal bs where patients present in the neonatal period with a history of polyhydramnios, prematurity and severe salt wasting . In contrast, patients with gs tend to have normal pge2 levels as described by lthy et al . . It has been thought that this discrepancy in pge2 levels explains why children with bs normally require non - steroidal anti - inflammatory drug therapy in addition to salt and fluid supplementation whereas children with gs do not [6, 20]. Nonetheless, improved growth in response to indomethacin therapy in gs has been described in the literature [21, 24]. Our demonstration of raised urine pge2 level confirms that indomethacin is a rational therapy in patients with more severe salt - wasting phenotypes associated with slc12a3 mutations . Another feature in both patients was the initial absence of hypocalciuria, which has previously been considered a discriminating feature of gs [6, 20, 25]. More recent case series of patients with slc12a3 mutations have demonstrated variability in urine calcium excretion [4, 23]. Interestingly, case 1 demonstrated hypercalciuria upon presentation and case 2 had normal urinary calcium excretion . To our knowledge thus, we confirm that urinary calcium excretion cannot be relied upon as a diagnostic feature in gs and that some patients with initially high or normal urinary calcium excretion will eventually develop hypocalciuria . We would like to acknowledge some limitations in the genetic analysis of the described cases . We were unable to perform quantitative or semi - quantitative techniques such as multiplex ligation probe amplification screening . As a result, it is possible that a large deletion, duplication or rearrangement could have been missed . Also, we did not screen for mutations in the casr given the absence of hypocalcemia and development of hypocalcuria . In conclusion, given the range of phenotypic expression in the salt - losing tubulopathies, genetic testing is the only method capable of confirming the precise nature of the underlying tubular defect . Previously proposed discriminating features such as urine calcium excretion, hypomagnesemia and age of presentation have all been shown to be variable in gs and may evolve with time as illustrated by our cases . Despite this, we would suggest that the identification of slc12a3 mutations should not preclude pediatric patients with a more severe salt - wasting phenotype from a trial of indomethacin.
|
Obesity epidemic continues its worrying global progression although significant advances have been achieved in the knowledge of its causes and consequences . This condition, in concert with glucose intolerance / type 2 diabetes, dyslipidemia, and metabolic syndrome, widely contributes to what has been recently defined as prosperity's plague . A complex system of social, psychological, physiological, and biological factors has to be considered in order to successfully control this plague and prevent from its further spread [2, 3]. From a physiological point of view, it is fundamental to understand the specific relative importance of long - term and short - term mechanisms involved in the regulation of energy balance . Food intake and daily overconsumption may have a predominant impact on body weight regulation, and this led large interest to focus on appetite / satiety balance as one of the key potential therapeutic targets . Multiple sites in the gastrointestinal (gi) tract, including the stomach, proximal and distal small intestine, colon, and pancreas, are involved in the short - term regulation of energy homeostasis, which basically controls what, when, and how much we eat within a single day or a single meal . In addition to mechanoreceptors and chemoreceptors, which are activated during a meal and signal to the brainstem through the vagal nerve, several gut - derived peptides and lipid mediators have a role in the regulation of food intake and energy homeostasis . The only recognized hunger gut peptide this peptide is mainly produced by the stomach and directly influences the number of meals consumed per day though it has probably no direct effect on meal size . However, the stomach plays an essential mechanical role in the regulation of satiety perception and meal termination . It is, in fact, the first organ to receive the bolus of food . Here, the food ingested is rapidly homogenized, partially digested, and finally delivered to the small intestine . Importantly, gastric distension and gastric emptying via the pylorus are finely regulated in order to match food delivery to the actual gut digestive and absorptive capacity . As a consequence, gastric competence can be considered as the first limiting step of gi ingestive and digestive capacity and thus represents a relevant target for obesity prevention and treatment . Motility and physical mechanisms involved in gastric - mediated satiety have been extensively studied and successfully targeted in recent years [10, 11]. However, it is still unknown whether the gastric mucosa also releases any biochemical signal that may influence satiety in the very short term of meal consumption . In an attempt to explore this possibility, the serial analysis of gene expression (sage) method was used to identify the early transcriptional changes induced by a low - fat (lf) or high - fat (hf) meal in the gastric mucosa . The discovery potential of sage was determinant for choosing this technology instead of other comparable transcriptomic methods . Sage, indeed, is a powerful and reliable sequencing - based technique which allows to detect the regulation of novel transcripts as well as characterized genes, as we have already shown in a number of previous studies [13, 14]. A total of 140 male c57bl6 mice (12-week - old) were purchased from charles river canada inc . And 12450b: 10% calories from fat, 70% from carbohydrate, and 20% from protein; 3.85 kcal / g) and tap water were served ad libitum . In the last day of the acclimatization, the body weight paired mice were randomly distributed into seven groups and fasted for 12 hours during darkness of the light cycle . On the experimental day, the other mice were fed ad libitum with high - fat (hf, research diet no . 12492: 60% calories from fat, 20% from carbohydrate, and 20% from protein; 5.24 kcal / g) or lf meal and sacrificed 30 min, 1 h, and 3 h after the beginning of the meal . The amount of macronutrients and energy ingested was recorded . In total, seven groups of mice under isoflurane anesthesia (fasting, hf 30 min/1 h/3 h, and lf 30 min/1 h/3 h) were alternatively exsanguinated by cardiac puncture after cervical dislocation . Stomach was opened vertically and flushed clean with saline, and the mucosa was removed by scrapping with a glass microscope slide . The samples were rapidly frozen in liquid nitrogen and stored at 80c until rna extraction . All animal experimentation was conducted in accordance with the requirements of the canadian council on animal care and approved by the animal protection committee of laval university . The seven serial analyses of gene expression (sage) libraries were constructed as previously described . Total rna was isolated from pooled stomach mucosa for each group (n = 20) by trizol (invitrogen canada inc ., burlington, on). The quality of total rna was monitored by microcapillary electrophoresis (bioanalizer 2100, agilent technologies, mississauga, on). Polyadenylated rna was extracted (oligotex mrna mini kit, qiagen inc ., mississauga, on), annealed with the biotin-5-t18 - 3 primer, and converted to cdna (cdna synthesis kit, invitrogen canada inc . )., pickering, on), and the 3 restriction fragments were isolated with streptavidin - coated magnetic beads (dynal biotech llc, brown deer, wi) and separated into two populations . Each population was ligated to one of two annealed linkers and extensively washed to remove unligated linkers . The tag beside the most 3nlaiii restriction site (catg) of each transcript was released by digestion with bsmfi (new england biolabs ltd . ). The blunting kit from takara bio inc . (otsu, japan) was used for the blunting and ligation of the two tag populations . The resulting ligation products containing the ditags were amplified by pcr and digested with nlaiii . The purified ditags were self - ligated to form concatemers using t4 ligase (invitrogen canada inc . ). The isolated 500 bp to 1800 bp concatemers were isolated by agarose gel, and the resulting dna fragments were ligated into the sphi site of puc19 and cloned into omnimax 2t1 competent cells (invitrogen canada inc . ). White colonies were picked up, and the concatemer inserts were finally sequenced by the applied biosystems 3730 (foster city, ca). Identification of the transcripts was obtained by matching the 15 bp (sequence at the last catg + 11 bp tags) with sagemap, unigene, and genbank databases . Classification of the transcripts was based upon the updated information of the genome directory found at the tigr website (http://www.tigr.org/), the source (http://genome-www5.stanford.edu/cgi-bin/source/sourcesearch), and the omim (http://www.ncbi.nlm.nih.gov/) as well as previously published literatures . We have previously shown that the sage method is very reproducible with r = 0.96 between two sage libraries constructed from the same total rna pool . First strand cdna was synthesized using 5 g of pooled rna of each experimental group in a reaction containing 200 u of superscript iii rnase h - rt (invitrogen canada inc . ), 50 ng of random hexamers, 300 ng of oligo - dt18, 50 mm tris - hcl ph 8.3, 75 mm kcl, 3 mm mgcl2, 5 mm dithiothreitol, 0.5 mm deoxynucleotides triphosphate, and 40 u human rnase inhibitor (roche) in a final volume of 50 l . The resulting products were then treated with 1 g of rnase a for 30 minutes at 37c and purified thereafter with qiaquick pcr purification kits (qiagen). The cdna corresponding to 20 ng of total rna was used to perform fluorescent - based real - time pcr quantification using the lightcycler real - time pcr apparatus (roche inc ., nutley, nj) and the faststart dna master sybr green kit (roche diagnostics). Reading of the fluorescence signal was taken at the end of the heating to avoid nonspecific signal . Oligoprimer pairs that allow the amplification of approximately 250 bp were designed by genetools software (biotools inc ., gene name, genbank accession numbers, and regions used for the primer pairs were the following: chymotrypsin - like elastase family member 3b (elastase 3, cela3b), nm_026419, 189385; amylase 2a1, pancreatic (amy2a1), nm_001042712, 8481039; pancreatic lipase (pnlip), nm_026925, 8401067; major urinary protein 1 (mup1), nm_031188, 127405; protein disulfide isomerase associated 3 (pdia3), bc033439, 9941222; zymogen granule membrane protein 16 (zg16), nm_026918, 348522 . The mrna levels were calculated using a standard curve of crossing point (cp) versus logarithm of the quantity and expressed as the number of copies per microgram of total rna . The lightcycler 3.5 program provided by the manufacturer (roche inc .) Was used to calculate the cp according to the second derivative and double - correction method previously described by luu - the et al . . The standard curve with efficiency coefficient e = 2 was established using known cdna amounts of 0, 10, 10, 10, 10, and 10 copies of atp synthase o subunit . When the anova revealed a significant interaction between diet and time, the contrast analysis was performed to identify the significant difference between the hf and lf groups from the same time points (p <.05). For the sage data, the comparative count display (ccd) test was used to identify the transcripts which were significantly differentially expressed (p .05) between the groups with more than a two - fold change, as previously described by lash et al . . Q_rt - pcr data were analyzed by the two - tailed student's t - test (p <.01) for the time points formerly determined by the sage method . Food and energy intakes are presented in figure 1 as cumulative and 30 minutes average consumption . As expected, cumulative energy as well as protein and fat intakes were higher, whereas carbohydrate intake was lower in the hf groups compared to lf (figure 2(a)). Interestingly, a distinct pattern of feeding behavior between lf- and hf - fed mice can be observed by comparing the average 30 minutes consumption of the two groups (figure 1(c)). Mice assigned to lf meal ate a moderate amount of food during one hour, after which their consumption decreased to a minimum intake . In contrast, the hf group consumed a large amount of meal in the first 30 minutes although the intake dropped in the following 30 minutes, reaching the minimum level at 1 h. however, the hf - group mice ingestion increased again in the last two hours . Seven sage libraries were generated to identify the transcripts differentially modulated in mouse gastric mucosa by the following experimental conditions: fasting; lf or hf meal at 30 min, 1 h and 3 h since the beginning of consumption (lf 30 m/1 h/3 h and hf 30 m/1 h/3 h, resp . ). Among the 56382 sage tag species detected, a total of 35 transcripts were significantly regulated by lf and hf feeding compared to fasting, whereas 19 were specifically modulated by hf compared to lf . The most represented group includes transcripts coding for digestive enzymes and secretory pathway components (table 1). Among the modulated mrnas were amylase 2a1, pancreatic lipase, carboxyl ester lipase, elastase 1 and 3, and carboxypeptidase a1 and b1 . Globally, three of them have lipolytic functions, nine code for proteolytic enzymes and one gene is involved in carbohydrate digestion . In addition, two genes involved in zymogen granule secretion were regulated, namely syncollin and zymogen granule membrane protein 16 . Interestingly, most of these genes showed a common pattern of regulation since their expression was downregulated at lf 30 m and 1 h, as well as at hf 1 h and 3 h, compared to fasting . Moreover, the expression of these transcripts tended to increase at lf 3 h though the up - regulation was statistically significant only for six of them, such as amylase 2a1, chymotrypsinogen b1, and pancreatic lipase related protein 1 . Remarkably, for 13 out of the 15 tags considered, the specific differential regulation between lf 3 h and hf 3 h achieved statistical significance . There is, therefore, a common downregulation of these transcripts following both lf and hf feeding although a temporal delay between the two groups can be observed . In addition, 3 hours after the beginning of the lf meal, their transcription tended to increase at higher levels than those observed at the fasting state ., the mrnas coding for the heat shock protein 70 (hsp70) 1a and expressed sequence tag (est) hsp70 1b were both upregulated by the lf meal, and the latter also by the hf meal, at 1 h following the beginning of ingestion . Gene expressions of cysteine - rich protein 1, metallothionein 2, and est wd repeat domain 92 were reduced at lf 3 h compared to fasting, whereas onzin mrna levels significantly decreased at hf 3 h. moreover, hf specifically modulated the transcription of protein disulfide isomerase associated 3 and est elastase 2a / neutrophil elastase, respectively, up- and downregulated at 3 h. the results also showed the differential regulation of two transcripts coding for proprotein convertase proteins (furin and kallikrein) and an interesting new candidate as potential regulator of energy metabolism, namely mup 1 (table 2). In addition, lf and hf feeding significantly regulated 12 novel transcripts with no match in public databases (table 3). In particular, the tags ggagaacagcg and ctgactcaaat were specifically modulated by hf feeding compared to lf and could represent potential targets for further characterization studies . To validate the sage results, the q_rt - pcr analysis was also performed for some of the genes differentially regulated by feeding . The chosen genes are representative of the functional groups discussed . As presented in figure 3, the q_rt - pcr results globally confirmed the changes in expression level as well as the significant modulation highlighted by the sage method . The main regulated functional group is represented by digestive enzyme - coding genes, many of which are mostly expressed by the pancreas . In addition, two transcripts involved in the secretory pathway, syncollin, and zymogen granule membrane protein 16 were also modulated . Many of the physiological changes induced by food intake should arise within minutes . Therefore, the digestive enzymes and regulatory factors are normally synthesized and packed in secretory granules at rest, ready to be released when food ingestion and appropriate neurohumoral stimuli occur . Following the meal, another cycle of synthesis and packaging prepares the zymogenic cells to the next secretory events . Concordantly, the present results showed a decreased transcription of digestive enzyme - coding and secretory genes following the start of ingestion, when the cells are more likely to invest energy in secretion . Moreover, in the lf - fed mice, the reinduction of these genes that occurred 3 hours after the beginning of intake seems a reasonable event, particularly if referred to their feeding pattern (figure 2). Conversely, the digestion of a high - calorie and high - energy density meal, including its rate of emptying from the stomach, normally takes a longer time to be accomplished [20, 21]. The latter point may explain the delayed and prolonged downregulation of digestive transcripts in the hf group, which also suggests that the reinduction of transcription observed at lf 3 h may have started later in the hf - fed mice . Interestingly, though all the mice had ad libitum access to food, feeding behavior and total ingestion were dissimilar between lf and hf groups (figures 1 and 2), possibly explaining the differences in the transcriptional regulation of digestive enzymes . However, the levels of digestive enzymes and secretory proteins might as well influence the intake . A physiological redundant excess of digestive capacity characterizes the gi system and guarantees the effectiveness of nutrition . Moreover, the excess capacity for nutrient uptake, including the excess of surface, specialized cells, digestive enzymes, and other secretory products, is proportionally related to body weight . Hence, this may also contribute to compromise the efficient control of appetite / satiety balance in overweight and obese subjects . The stomach may represent a primary target for the control of meal size and satiation . Eventually, surgical options which physically affect gastric capacity and emptying mechanisms successfully modify the eating behavior and metabolic profile of obese patients though they still are invasive and lifestyle - affecting methods . Likewise, mechanisms other than mechanical may also affect gastric volume and emptying rates to regulate satiation during meal consumption . Presently, there still is a paucity of literature addressing the specific effects of hf intake on the neurohormonal control of gastric capacity and motility mechanisms . Therefore, the search for these pathways was the principal aim of the current study . In particular, it would be useful to explain the specific role of these genes in the stomach and, most interestingly, their differential regulation in response to fasting and feeding . Considering the high level of transcription, such as for amylase 2a1 at fasting and lf 3 h in contrast, it is hard to explain how the digestive enzymes, normally active at a neutral ph, could conceivably work in such an acidic milieu . However, it should also be considered that these proteins are often released as precursors and eventually activated by specific signals or the appropriate ph . This was not the first time that the expression and activity of pancreas - related genes were detected in the stomach and other nonpancreatic components of the gi system . Terada and colleagues had already showed the expression of alpha - amylase, trypsin, chymotrypsin, and pancreatic lipase in normal and pathologic epithelial cells of gastric mucosa by immunohistochemistry and western blotting . They had also proved their enzymatic activity in stomach specimens, although to a far lesser extent than in pancreas . In that report, the authors explained the presence of pancreatic enzymes in nonpancreatic tissues as a result of the common embryonic origin (foregut) shared by the gastroenteric tissues . In addition, the mrna expression levels of representative genes have been further confirmed by q_rt - pcr in the present study . It can be hypothesized that the digestive enzymes expressed by the gastric mucosa would combine with the bolus of homogenized and partially digested food that finally reaches the small intestine . In normal conditions, the digestive enzymes would be in excess, but enough to guarantee the effectiveness of digestion in case of insufficient pancreatic secretion . The redundant production of these proteins along the digestive tract was also suggested by our previous study of the duodenum transcriptome, where analogue experimental conditions had been applied . In the intestine, the same pancreas - related transcripts were modulated (n = 9) but showed the opposite trend, being upregulated at lf 1 h and hf 3 h. interestingly, in both the duodenal and gastric mucosa, the regulation of digestive gene expression presented a temporal delay between the lf and hf groups . The mucosal epithelium is a primary barrier, which defends the whole organism from external dangerous agents eventually ingested . Moreover, uncontrolled acid secretion, inflammation, oxidative stress, and the epithelial damages consequently engendered can compromise the physical and functional integrity of the mucosal barrier . Among the transcripts differentially regulated in the gastric mucosa, seven metallothionein 2 [24, 25], hsp70 (1a and 1b) [26, 27], and protein disulfide isomerase associated 3 genes [28, 29] code for multiple - task proteins, which can show chaperone activity and/or be involved in cell redox homeostasis control and apoptosis regulation . The latter is a very important role, since gastric epithelium is subject to constant renewal . The epithelial cells, in fact, rapidly turnover (13 days in humans), undergoing a cycle of division and differentiation before succumbing to apoptosis [9, 30]. In this study, est hsp70 1b was upregulated by both lf and hf at 1 h, and the same trend was observed for hsp70 1a . However, for the latter, the hf 1 h increase did not reach a statistical significance . Interestingly, a polymorphism of hsp70 1b gene has been recently associated with obesity - related traits, thus stimulating further questions about its acute modulation by food intake . In the present study, the gene coding for mup1 was specifically downregulated at hf 30 m compared to lf . In previous transcriptomic studies conducted with the sage method, mup1 gene was also significantly regulated by feeding in the duodenum mucosa and hypothalamus of mice [13, 14]. However, recent studies in mice have surprisingly revealed that mup1 is also involved in glucose and lipid metabolism, and that it might play an important role in the regulation of energy expenditure . These findings raise the interest about the specific role of this molecule at the tissue level but also as a potential modulator of energy balance . Globally, the most regulated class of genes was the one coding for proteolytic enzymes, particularly the serine - protease type . This group of proteases is highly represented in nature and shows numerous and functionally diverse functions, ranging from digestion and coagulation to apoptosis and immunity . In addition to the digestion - related genes described above, feeding regulated two other transcripts coding for highly important serine proteases, namely kallikrein and furin . Est kallikrein 1 was specifically regulated by hf 3 h compared to lf, whereas furin was downregulated at lf 1 h. these two molecules act as proprotein convertases in distinct regulatory pathways . The first cleaves kininogen to produce kinin peptide, whereas furin processes the precursors of a large variety of proteins, including growth factors and receptors . Interestingly, the specific pathways involving kallikrein - kinin [37, 38] and other proteins of furin family [39, 40] are presently being studied for their potential contribution to obesity and cardiovascular disorders . The present study was the first to analyze the global transcriptional changes acutely induced in mouse stomach mucosa by feeding and, in particular, by different nutritional stimuli . The principal aim was to identify new signals specifically induced by hf intake in the short term of meal consumption . Given the weakest satiation power of hf compared to lf foods, these signals may represent potential pharmacological targets for the early modulation of appetite / satiety balance . In this study, both lf and hf regulated gene expression in gastric mucosa, and 17 known genes in addition, a number of novel tags were significantly regulated, some of which may be good objects for future characterization studies . However, a lower number of genes was regulated in the stomach compared to duodenum, when the same experimental conditions have been applied . This may suggest that gastric mucosa has a restricted role in the acute regulation of food intake and mainly centered on meal initiation than meal size / termination control . Another plausible hypothesis is that satiation signals eventually raising from the mucosa could be induced earlier than 30 min after the beginning of the meal, at least at the transcriptional level . Although it is still uncertain whether gastric mucosa releases an early molecular signal specifically involved in satiation control, the present study contributed to highlight some potential mediators of this process . In addition, the characterization of novel regulated genes could stimulate future investigations . Since signals secreted by gastric mucosa may be the optimal targets for appetite control and obesity therapeutic strategies, further research efforts are deserved . The paper has been approved by all listed authors and there is no conflict of interest that would prejudice its impartiality . M. r. de giorgio analyzed and interpreted the sage data, and drafted the paper . M. yoshioka and j. st - amand conceived the study, designed it and critically revised the paper . J.
|
Complications arising from difficult or failed tracheal intubation remain a leading cause of anaesthetic morbidity and mortality despite recent developments in airway management strategies . It has been observed that in 96%98% of cases airway can be managed with conventional rigid laryngoscope blades . It is only in 2%4% of cases that alternative techniques and equipment for endotracheal intubation are required . However, in the emergency medicine department and intensive care unit this may reach up to 20% . There is no single factor or combination of factors that can definitely predict difficult intubation . Hence, one has to be always prepared to manage a situation of unanticipated difficult airway . In an attempt to reduce the morbidity and mortality associated with such a scenario many novel devices such as airtraq and c - mac video laryngoscope (vl) have been introduced into clinical practice . The airtraq laryngoscope (prodal, meditec, viczaya, spain), has a preformed curvature and a channel for installation of the endotracheal tube (ett). It is an optical intubation device that provides a view of the glottic opening without aligning the oral, pharyngeal and laryngeal axes . The c - mac vl, on the other hand, is a fourth generation vl (karl storz gmbh and co. kg, tuttlingen, germany) which has the cmos (complementary metal oxide semiconductor) technology to provide a clear image quality . It has standard macintosh blade with a distal camera at two - thirds of its length which makes it an excellent tool for training of novice . It has been successfully used for visualisation of the larynx in various difficult airway cases . The literature demonstrates that airtraq is very useful in difficult situations such as those precluding the sniffing position . However, it is not clear whether the newly developed vl with standard macintosh blade can achieve the same degree of success rate and intubation time in similar situations . Hence, the aim of this study was to compare airtraq aided intubation with standard blade c - mac vl, in terms of success rate and intubation time as primary end points, and glottic view, ease of intubation and haemodynamic response as secondary end points, in patients without predicted difficulty in intubation and with the head in the neutral position . Following approval from the institutional ethical committee (d1960/fm), 60 american society of anesthesiology (asa) grade i and ii patients of either sex, aged between 20 and 60 years, body mass index 30 kg / m, mallampati (mp) i and ii, posted for elective surgery under general anaesthesia during the year 20132015 were included in the study . Patients with predicted difficult laryngoscopy and intubation (mp class iii or iv, inter - incisor distance <3.5 cm, thyromental distance <6 cm) and cervical spine injury were excluded from the study [figure 1]. They were then randomly divided into two groups of thirty patients each using a computer - based random number generator (www.randomization.com) to be intubated using standard macintosh blade c - mac vl (group cm) with a stylet or airtraq size-3 laryngoscope (group at). Informed written consent for the anaesthesia technique, especially the intubation device and application of manual inline stabilisation (mils) during intubation was obtained from the patients before the procedure . The learning curve was achieved by the researcher with both the equipments by performing 20 intubations in mannequins followed by 10 intubations in patients before the commencement of study . Monitors including pulse oximetry, non - invasive blood pressure, electrocardiogram and end - tidal carbon dioxide (etco2) were attached . Patients were pre - medicated with midazolam 0.03 mg / kg, ondansetron 0.10 mg / kg and fentanyl 1.5 g / kg intravenously . Anaesthesia was induced with propofol 2 mg / kg / iv and relaxation achieved with vecuronium 0.1 mg / kg / iv . Laryngoscopy was done with either c - mac vl or airtraq device as per the study protocol and intubated with a cuffed ett . Anaesthesia was maintained using a mixture of o2 and n2o in the ratio of 40:60% along with isoflurane (0.5 mac) as inhalational anaesthetic and vecuronium as a muscle relaxant . Laryngoscopy was done initially in the neutral position with mils, and the percentage of glottic opening (pogo) score was recorded . If the pogo score was 2, intubation was attempted with or without application of optimal external laryngeal manipulation (oelm) and bougie and the intubation time was recorded . If on laryngoscopy the pogo score was <2, then laryngoscopy was done in sniffing position and intubation was done with or without application of oelm and bougie [figure 2]. The primary end points were intubation time and success rate, whereas the secondary endpoints were number of attempts, requirement for optimisation, pogo score, ease of intubation and haemodynamic changes . It was assessed on a score of 14 (75%100%, 50%75%, 25%50% and 0%25%). The duration of intubation attempt was defined as the time taken from the insertion of the blade beyond the incisors until four square wave patterns of etco2 on the monitor . The ease of intubation was graded on three - point scale (grade i - no external manipulation, grade ii - external manipulation required, grade iii - failure to intubate). The haemodynamic parameters included recording of the heart rate (hr) and mean arterial pressure (map) at 1, 3 and 5 min . Surgery was allowed to commence only after the collection of the last haemodynamic data at 5 min post - intubation . Failure was defined if the patient could not be intubated in three attempts . In such cases, after completion of the surgery, the patient was monitored in the recovery room and complications noted if any . Algorithm for airway management sample size was calculated by taking 10.0 s as the clinically relevant difference in intubation time (1= 19.6, 2 = 30.4 s; where 1 and 2 are means) with the common standard deviation (sd) of 13.0 s from a pilot study on ten patients per group . Using type i error = 0.05, and type ii error = 0.2, it was required to include 28 patients per group (ps power and sample size calculator - version 3.0.43; dupont wd, plummer wd). Considering 5% drop - out, it was decided to include thirty patients per group . Statistical analysis was performed using graph pad prism 5.00 (graph pad software, san diego, ca, usa). Results are presented in number, percentage, mean and sd or frequencies (%) as appropriate . Continuous data were compared using student's t - test, categorical data using fisher exact test and chi - square () test . Considering the multiple comparisons, post hoc bonferroni correction was applied and p </2 (0.025) was set for significance for primary end points . Both the groups were comparable with respect to age, sex, weight, asa grade thyromental distance, inter - incisor distance or mp grading [table 1]. There was no significant difference in the incidence of successful intubation in both the groups . The mean time for tracheal intubation was 14.9 12.89 sec in group cm as compared to 26.3 13.34 sec in group at . 80% of patients were intubated in the first attempt without the requirement of oelm or bougie, whereas in group at 76% of patients were intubated in the first attempt without external manipulation or aid (p = 0.73). The majority of patients had grade i and ii ease of intubation in both the groups . All the intubations were successful in the neutral position except one in group at that failed despite obtaining sniffing position and application of optimisation manoeuvres . One patient had grade iii ease of intubation in group at, who could not be intubated despite obtaining sniffing position and was declared failure . No significant complications were observed with the use of either of devices except three cases of minor bleeding with the use of airtraq [table 2]. There was a significant rise in the hr from the pre - induction to 1-min post - intubation in both the groups (cm; p = 0.005 and at p = 0.014). The increase in hr was significantly higher in group at than group cm at 1 and 3 min . However, it came down to pre - induction value within 5 min of intubation in both the groups . There was no significant intergroup and intragroup variations in map (group cm; p = 0.565 and group at; p = 0.295) [table 3]. In the present study, we compared the efficacy of airtraq laryngoscope with that of standard macintosh blade c - mac vl . It was observed that intubation with the c - mac vl using conventional macintosh blade required less time as compared to intubation with airtraq, with minimal haemodynamic alteration during endotracheal intubation . The majority of patients required 1020 s for intubation with c - mac as compared to 1030 s with the airtraq, which was similar to the previous reports . Since the demographic profile of the patients in both the groups was comparable and the laryngoscopy was performed by the same researcher, the increased time taken with airtraq could be primarily due to the limitations of the device . Although both these devices were rigid, the macintosh blade had an advantage over the other device . The anaesthesiologists are usually acquainted in using macintosh blade while performing rigid laryngoscopy from the very first day of their anaesthetic practice . As a result, the researcher could probably handle easily the real time finer adjustments required if any during laryngoscopy and intubation with c - mac vl . On the other hand, the airtraq optical device, which has a preformed curvature and a channel for installation of ett, probably permitted limited scope for finer adjustments with the ett during intubation . The whole assembly, with the device along with the ett had to be manipulated for adjustments . That probably led to increase in number and duration of intubation attempts, leading to an overall increase in time to intubation with airtraq . However, it may be argued that a learning curve was achieved with both the device before conducting the study . The learning curves are achieved primarily in handling the device and learning the technique of intubation . The expertise is achieved early with macintosh blade because of regular and frequent use . In the present study, all the intubations were successful in the neutral position except one in airtraq group that failed despite obtaining sniffing position and application of optimisation manoeuvres . In a recent editorials, it has been mentioned that in videolaryngoscopy, the success of intubation depends not only on the view obtained, but on the ease of insertion of the ett . Accordingly, since the ease of intubation between these two devices was similar, the success rate was also similar in our study . Further, mcelwain and laffey documented that the alignment of all the three axes, oral, pharyngeal and laryngeal (sniffing position) during intubation with these devices was not required . They compared c - mac vl, airtraq, and macintosh laryngoscopes in patients undergoing tracheal intubation with cervical spine immobilization (neutral position) and observed no significant difference in success rate between c - mac vl and airtraq . Similarly, in the present study, mils was applied to the patients to mimic cervical spine immobilisation and no difference in the success rate for intubation was observed . In the present series, the difference in the total number of attempts required for intubation in each group was not statistically significant . Further, the number of patients intubated in first and second attempt with both the devices without any external manipulation was almost similar except one patient that required the third attempt in the airtraq group . Most of the previous studies have also reported minimal requirement for additional manoeuvres during intubation with these devices . The laryngeal view in the present study was compared using pogo score, where no significant difference was observed between the two devices . This may be due to the reason that glottic view in both of these devices was based on indirect prismatic view or distally placed camera, obviating the role of axis alignment in obtaining a good view . However, their study was based on mannequins, whereas the present study was a human trial . In both the groups, a significant increase in hr was observed from its baseline value after 1 min post - intubation but had returned to baseline within 5 min . The fluctuations in hr were more pronounced in the airtraq group as compared to the c - mac vl group . This was probably due to relative increase in duration of time to intubation and increase in number of attempts with airtraq . However, the increase in map did not reach up to the level of significance with either of the devices . Mcelwain and laffey in their study also found a significant change in hr and bp from baseline, with no intergroup differences . As with most of the studies, there were some limitations in the present study . First, although patients were blinded to the device being used, it was impossible to blind the anaesthesiologist to the device being used . Therefore, it was not a double - blind study and hence, there could be some element of bias . However, to minimise the level of biases the intubation was performed by the same anaesthesiologist throughout the study . Second, the patients in the c - mac vl group were intubated with a stylet . Therefore, the applicability or advantage of these devices in actually difficult scenarios could not be assessed . We conclude that c - mac vl is a better device than airtraq in terms of intubation time with similar success rate for intubation in the neutral position with mils . The clinical implication of the present study is that both the devices would be advantageous while intubating patients with restricted head and neck movement such as patients with cervical spine fracture . Further, the c - mac vl may be a better device in patients as it requires less time for intubation with less haemodynamic alterations as compared to the airtraq . However, further larger clinical trials in patients with normal and difficult airways are necessary to confirm these initial findings.
|
In 2014, it is estimated that there are 608,620 bladder cancer survivors living in the united states, and an additional 74,690 cases will be diagnosed . Neoadjuvant chemotherapy (nc) followed by radical cystectomy (rc) is now considered the standard of care for muscle - invasive bladder cancer after numerous trials demonstrated a survival benefit, most notably in patients with advanced pathologic stage disease [24]. For highly selected patients, bladder - sparing surgery such as transurethral resection of bladder tumor (turbt) [5, 6] or partial cystectomy (pc) [710] may provide similar oncologic outcomes to rc while maintaining bladder and sexual functions . Of the two bladder - sparing options, pc has advantages over turbt as a third of patients are understaged with turbt and pc allows for full thickness examination of the bladder wall and concurrent lymphadenectomy resulting in more accurate staging and prognosis . Our institution previously reported on 111 patients who received neoadjuvant methotrexate - vinblastine - doxorubicin - cisplatinum (m - vac) chemotherapy followed by turbt . Of the 60 patients achieving ct0, 15 subsequently underwent pc and 17 underwent rc . Ten - year metastasis - free survival for the 15 patients who underwent pc was 73% with 53% of patients having their bladders intact, compared to the 65% 10-year metastasis - free survival for patients undergoing rc . Similarly in a prospective trial conducted by sternberg et al ., 104 patients with muscle - invasive bladder cancer underwent turbt after 3 cycles of m - vac chemotherapy and 49% of the cohort achieved ct0 after nc . Of these 104 patients, 13 patients with a solitary lesion underwent pc, while 39 patients underwent rc . For patients undergoing pc, 5-year survival was 69% with 4 patients alive after a median follow - up of 88 months (range 16158) compared to 5-year survival of 46% with 15 patients alive after a median follow - up of 45 months (range 4172) for patients undergoing rc . We herein report our contemporary experience with a highly select cohort of patients who received neoadjuvant chemotherapy followed by pc performed for curative intent at a single tertiary institution . In this institutional review board - approved retrospective study, we identified patients who underwent pc at memorial sloan kettering cancer center from 1995 to 2013 (n = 331). Only patients who underwent nc for urothelial cell carcinoma of the bladder followed by pc with curative intent were included in our study (n = 36). These were not consecutive cases and all patients underwent restaging turbt at our institution prior to and after nc with cystoscopic mapping of bladder tumor / scar . All patients were followed up postoperatively with imaging and cystoscopy every 3 months for 2 years with widening of surveillance interval after . We recorded data for clinical and pathologic variables including age, gender, race, tumor size and focality, histology, presence of carcinoma in situ (cis), cross - sectional imaging, type and duration of nc, clinical and pathologic stages according to american joint committee on cancer 2010 tnm staging 7th edition, surgical margin (sm), disease status, and cause of death . Survival outcomes included recurrence - free survival (rfs) which was defined as freedom from recurrence after pc, advanced recurrence - free survival (arfs) which was defined as freedom from recurrence after pc beyond salvage with intravesical therapy or rc, and overall survival (os). Kaplan - meier survival estimates were generated with time measured from the date of pc to the date of event (recurrence, advanced recurrence, and death) or last follow - up . Using univariate cox regression for continuous and log - rank text for categorical variables, we analyzed variables for association with rfs, arfs, and os . All probabilities were two - sided, and a p value <0.05 was considered significant for all analyses . All data were analyzed using stata version 12.0 (statacorp, college station, tx, usa). Median age for the cohort was 70 years old (interquartile range (iqr) 58.876.8). All tumors were solitary, less than 5 cm in diameter, and 22 (61%) had a variant histology . Six tumors were located in the anterior wall, 19 in the lateral wall, 5 in the posterior wall, 3 in the base / trigone, and 3 in a diverticulum . Chemotherapy characteristics are described in table 1; most patients received platinum - based chemotherapy with 20 patients (56%) having received gemcitabine and cisplatin combination . Unilateral ureteral reimplantation was performed in 7 patients at the time of pc to achieve sm in all cases . Margin status was evaluated by intraoperative frozen sections at pc in all patients . As shown in table 1, prior to nc, 22 (61%) patients had ct2 disease, 21 (58%) all patients were clinically restaged after nc (tables 1 and 2) with 21 (58%) patients achieving ct0, 3 (8%) having ctis, and 4 (11%) having cn+ . Of the 4 patients with cn+ after nc, 3 had cn+ before nc, and information prior to nc was unavailable for 1 patient . As shown in tables 1 and 3, pc pathologic findings were pt0 in 18 (50%) patients, ptis in 6 (17%), pn+ in 4 (11%), and sm+ in 3 (8%). The sm+ was perivesical in 1 patient with pt3 disease and ptis at margin in 2 patients with pt3 disease and pt2 disease . All 3 patients with sm+ experienced recurrence and died of disease (dod) at 5, 10, and 43 months . Of the 21 patients who were ct0 after nc, 7 (33%) had residual bladder disease in the pc specimen (table 3). At last follow - up, 19 (53%) patients had recurrence, 15 (42%) had advanced recurrences, 10 (28%) died of disease, and 1 died of another cause . Twenty (56%) patients were with no evidence of disease (ned) after median follow - up of 17 months (iqr 9.438.2), with 15 having had no recurrences . Two of these 4 patients underwent intravesical bacillus calmette - guerin (bcg) treatment at 8 and 23 months after pc and the other 2 patients underwent rc at 23 and 43 months after pc . Four were alive with disease (awd): 2 patients having disease in the pelvis and 2 patients having disease in retroperitoneum . Of the 19 (53%) patients who experienced recurrence (table 4) 9 had recurrence in the bladder with 6 in the bladder only . Of the 9 patients with bladder cancer recurrences, 5 were at the resection site and 2 had sm+ at pc . Of the 6 patients with bladder - only recurrences, 2 patients had ctis, received bcg therapy, and have been ned to date; 2 patients had ct2 and ct1/ctis tumors, underwent rc, and remained disease free; 1 patient had ctis and received bcg but developed distant metastases (lung and adrenal) without further bladder recurrences 7 years after pc and eventually died of disease . Another patient developed persistent ct1/ctis disease that was managed with repeating turbt and bcg before a failed attempt at rc and later died of disease . As shown in table 5, median time to recurrence was 23 months (iqr 5.966.2), median time to advanced recurrences was 66 months (7.2not reached), and median time to death was 79 months (20.6not reached). Kaplan - meier survival estimates for 2- and 5-year rfs, arfs, and os were 37% and 28%, 58% and 51%, and 71% and 63%, respectively (figure 1). Clinical stage> ct2 was associated with both worse rfs (p = 0.03) and arfs (p <0.01). After nc, the presence of cis was associated with worse os (p = 0.04) and cn+ was associated with worse rfs (p <0.01), arfs (p <0.01), and os (p <0.01). Following pc, presence of pt2 disease was associated with worse rfs (p = 0.02) and arfs (p = 0.01), pn+ was associated with worse rfs (p = 0.04), and sm+ on final pathology was associated with worse rfs (p = 0.01), arfs (p = 0.04), and os (p <0.01). Our findings have been consistent with those of the literature with regard to oncologic outcomes in patients undergoing pc after nc . In our series, 74% of patients were downstaged after nc with 58% having a complete clinical response . Of the patients who achieved ct0 after nc, 7 (33%) had evidence of residual disease within the resected specimen at pc, which is close to 30% of understaging with turbt alone reported by our institution's herr and scher study . Two- and 5-year overall survival were 71% and 63%, respectively, which were comparable to oncologic outcomes of other studies involving pc after nc [5, 11, 12] and rc . In our study, at last follow - up 19 patients (53%) had experienced recurrence and 24 (67%) were alive with 22 patients (61%) having retained an intact bladder . Nine patients had recurrence in the bladder with 5 at the suture line . In rc series by stein et al ., local pelvic recurrence only occurred in 6%13% of cases depending on radical cystectomy pathology and in our series 5 (14%) patients had recurrence in the pelvis with only 2 having isolated pelvic recurrences . Both of these patients with pelvic - only recurrences had negative surgical margins at pc with only 1 patient having recurrence on the ipsilateral side of the previous tumor . For our study, advanced recurrence was defined as presence of disease that cannot be treated with salvage intravesical therapy or rc, which differs from previous reports of disease recurring in the bladder muscle and beyond [7, 8]. We believe that, with the improved quality of surveillance cross - sectional imaging and follow - up cystoscopies, disease control can still be achieved despite recurrences . This was evident in the 6 patients with isolated bladder recurrence as only 1 patient experienced disease progression and died of disease . We also noted that 53% of patients who experienced recurrence had no disease in bladder and hence it is unclear whether a rc would have altered their disease course . In our previous report by holzbeierlein et al ., the authors noted that presence of cis preoperatively was associated with local recurrence and sm+ and pn+ were associated with advanced recurrence, as defined by muscle invasion and beyond . Though this series differs for lack of association of cis with recurrence, we noted similar findings with sm+ and pn+ . All 3 patients with sm+ on final pathology experienced recurrence and died of diseasewith sm+ being associated with worse rfs, arfs, and os on univariable analysis . Similarly, 4 patients had cn+ after nc with 2 eventually having pn+ at pc . Of those 2 patients with pn+, one was awd at 7.3 months of follow - up and the other died of disease at 16.8 months of follow - up . Cn+ after nc was associated with worse rfs, arfs, and os on univariable analysis . Unlike in kassouf anderson cancer center series, the need for ureteral reimplantation is not an exclusion criterion for pc at our institution . In this series, we performed 7 unilateral ureteral cases of reimplantation and we were able to achieve sm in 4 patients and the rest had pt0 disease . In terms of the concerning voiding dysfunction after pc, none of the patients in this series underwent any additional procedures for diminished bladder capacity . Our study is limited by its small size, retrospective nature, surgical selection bias, and relatively short follow - up . Additionally, patients did not receive a uniform nc regimen; 4 (11%) patients had evidence of clinical nodal involvement after nc, and 22 patients (61%) had a variant histology including some with recognized aggressive nature such as small cell (25%) and micropapillary (14%). Also though none of our patients underwent any additional procedures for voiding dysfunction, we do not have long - term quality of life or medication usage data . In this contemporary institutional series, pc after nc in highly selected patients with muscle - invasive bladder cancer provides acceptable oncologic outcomes comparable to those in previously published reports.
|
In 2000, the department of health for england recommended the creation of crisis resolution and home treatment teams (crhts). The aim was to reduce the number and length of hospital admissions through provision of intensive home support for people experiencing acute mental health crises who would otherwise be admitted to hospital (department of health, 2000). Crhts were given the task of assessing all potential hospital admissions and deciding whether or not admission is required . Gate - keeping was seen as pivotal to their success (national audit office, 2007), in the belief that, without it, other professionals would continue to admit people to hospital as before (mcglynn, 2006). From the start, relationships with other parts of the service were likely to be confrontational and, according to mcglynn (2006), this issue has probably resulted in more friction than anything else between teams and between professional groups (mcglynn, 2006, p. 15). A report for the audit office (morgan, 2006) found that crht presence during assessment was thought by both crht members and ward managers to increase the likelihood of home treatment (ht) being considered as an alternative to admission . However, crht involvement was considered unnecessary in 30% of the assessments . A national survey (onyett et al ., 2008) found inconsistency in performance of the gate - keeping function, with 21% of teams gate - keeping 50% or fewer proposed admissions and inter - team difficulties the main obstacle to fidelity to the crht model (middleton et al ., 2008). Despite these shortcomings, crhts have been linked to reduced hospital admissions, service user satisfaction (e.g. Barker et al ., 2011) and however, the evidence is patchy, and other studies report increased compulsory admissions and little or no effect on bed usage (e.g. Tyrer et al ., 2010). An analysis of national data found no significant differences in admissions between primary care trusts with and without crhts, prompting speculation that gate - keeping fidelity might explain the differences (jacobs & barrenho, 2011). A recent systematic review concluded that, given the weak evidence base, there was no compelling evidence of either crhts effectiveness or the assumption that they are the best way of reducing admissions (hubbeling & bertram, 2012). The new teams were largely funded through ward closures (lodge, 2013), and decline in the number of nhs in - patient beds has continued (buchanan, 2013) to the point that many now believe that the current focus on preventing hospital admissions is driven more by bed shortages than the needs of patients . The crht role and gate - keeping, in particular, remains controversial (lodge, 2013). It is this role which we examine in more detail here, using material drawn from a broader, critical review of crht services in one strategic health authority region (rhodes & giles, 2011). To provide an overview of services, policies and practices across the region.to identify the main differences between different providers / localities . To provide an overview of services, policies and practices across the region . To identify the main differences between different providers / localities . To provide an overview of services, policies and practices across the region.to identify the main differences between different providers / localities . To provide an overview of services, policies and practices across the region . To identify the main differences between different providers / localities . The study took place over 6 months in 2010 and involved: (i) a descriptive overview of crht services in the region, followed by (ii) more detailed analysis of three sites . Face - to - face interviews, using a semi - structured questionnaire, were conducted with a key informant (service manager / team leader) from each service provider at participants place of work . Topics covered: the local configuration of services; policies and practices; team composition; services provided; clinical assessments; how caseloads, gate keeping and referral pathways were managed . Three sites exemplifying different approaches to provision were selected for detailed study: site 1 appeared to follow most closely mental health policy implementation guidance (department of health, 2001); site 3 was the only service to include explicitly social distress in its criteria for client acceptance; site 5 had disbanded the crht and absorbed its functions into a newly configured acute mental health team . The team leader, a mental health nurse, approved mental health professional (amhp) and psychiatrist were interviewed at each site . Interviews were conducted by one interviewer in phase one and three in phase two; all were involved in subsequent data analysis . Interviews lasted 12 h, were audio - recorded (with participants permission) and fully transcribed . Topics included: identity and purpose, gate - keeping, early discharge, out - of - hours cover, referrals, role of psychiatrist, risk assessment and management, multidisciplinary working, relationships with other parts of the service, care plans and co - ordination, confidentiality, serious untoward incidents and safety issues . Material from phase 1 was used to produce descriptive summaries of service provision at each site . In phase 2, data from each site were analyzed separately to produce a detailed description of services and their operation in each site . Transcripts were coded by three researchers who met frequently to agree descriptive and later analytical themes . Descriptive themes remain close to the primary studies; analytical themes go beyond the primary studies and generate new interpretive constructs, explanations or hypotheses (thomas & harden, 2008). Team leaders were sent a brief description of their service and asked to identify omissions or factual inaccuracies; they were also invited to comment on the final report . Face - to - face interviews, using a semi - structured questionnaire, were conducted with a key informant (service manager / team leader) from each service provider at participants place of work . Topics covered: the local configuration of services; policies and practices; team composition; services provided; clinical assessments; how caseloads, gate keeping and referral pathways were managed . Three sites exemplifying different approaches to provision were selected for detailed study: site 1 appeared to follow most closely mental health policy implementation guidance (department of health, 2001); site 3 was the only service to include explicitly social distress in its criteria for client acceptance; site 5 had disbanded the crht and absorbed its functions into a newly configured acute mental health team . The team leader, a mental health nurse, approved mental health professional (amhp) and psychiatrist were interviewed at each site . Interviews were conducted by one interviewer in phase one and three in phase two; all were involved in subsequent data analysis . Interviews lasted 12 h, were audio - recorded (with participants permission) and fully transcribed . Topics included: identity and purpose, gate - keeping, early discharge, out - of - hours cover, referrals, role of psychiatrist, risk assessment and management, multidisciplinary working, relationships with other parts of the service, care plans and co - ordination, confidentiality, serious untoward incidents and safety issues . Material from phase 1 was used to produce descriptive summaries of service provision at each site . In phase 2, data from each site were analyzed separately to produce a detailed description of services and their operation in each site . Transcripts were coded by three researchers who met frequently to agree descriptive and later analytical themes . Descriptive themes remain close to the primary studies; analytical themes go beyond the primary studies and generate new interpretive constructs, explanations or hypotheses (thomas & harden, 2008). Team leaders were sent a brief description of their service and asked to identify omissions or factual inaccuracies; they were also invited to comment on the final report . About eight of the 11 services invited to take part accepted . Of the three that declined, one was undergoing re - organization, one was subject to external investigation, the third cited pressure of work . Phase 1 revealed wide variation in approach and provision between sites and between teams in the same site, reflecting variation in historical development of services, geographical areas and populations served . Despite these differences, all teams were experiencing tensions within the role itself: internal tensions, in managing the distribution of resources between different functions, and external inter - professional and inter - team tensions at both ends of the client pathway on admission, in respect of gate - keeping, and on discharge, as a result of delays in the discharge pathway . Teams reported tension between gate - keeping assessment and ht, with the former drawing resources away from the latter at times of high demand . Given their immediacy and urgency, gate - keeping assessment (what one person termed front end work) tended to take precedence, with the result that resources for ht could become squeezed . This, in turn, could influence gate - keeping decisions, in that ht can only be offered if there are the resources to provide it . In the words of one person, if you get lots of referrals, then you re doing lots of front end stuff (amhp, site 11) if you get lots of referrals, then you re doing lots of front end stuff (amhp, site 11) the gate - keeping role and disputes over assessments of service user risk (of harm to self and/or others) were an enduring source of inter - professional and inter - team tension . Relationships with other parts of the service, in particular cmhts, were often reported to be strained . Community practitioners questioned the legitimacy of crht expertise to conduct gate - keeping assessments, given their partial knowledge of clients and lack of a long term perspective, in particular knowledge of trigger factors and coping strategies that may have been disrupted in the period leading up to crisis . As one cmht leader (site 5) explained: the last place we want our person to be is in hospital so we do our best to not get them to that point we put extra services in, we put extra visits in . It s a frustrating thing being told no by somebody who has never even met the patient . So we do our best to not get them to that point we put extra services in, we put extra visits in . It s a frustrating thing being told no by somebody who has never even met the patient . Where hospital admission was considered inevitable, gate - keeping was regarded as a bureaucratic impediment that unnecessarily prolonged the admission process for service users who were already highly distressed . By contrast, crht workers complained that cmht care coordinators had a lower toleration of risk.our threshold for risk is much, much higher than other bits of the service and they sometimes have a lot of trouble understanding and accepting why we havent taken (a person) on . (social worker, site 1) our threshold for risk is much, much higher than other bits of the service and they sometimes have a lot of trouble understanding and accepting why we havent taken (a person) on . (social worker, site 1) failure to gate - keep (i.e. To assess) all hospital admissions was often blamed, by crht workers, on attempts to by - pass the crht and have people admitted to hospital directly . However, they acknowledged that it was not possible for crht workers to attend all assessments, in particular mental health act assessments for compulsory admission . Gate - keeping assessment introduced an element of duplication, and service user feedback highlighted repeated assessment as a persistent complaint.the service user was being asked questions that the care coordinator could answer or was already documented elsewhere in their notes . (team leader, site 8) the service user was being asked questions that the care coordinator could answer or was already documented elsewhere in their notes . (team leader, site 8) the short - term nature of crht intervention is dependent on rapid flow of clients through the service and transfer back or on to other services . All teams were experiencing delays in the discharge pathway to community care, and this was a source of inter - team tension and mutual recrimination.sometimes we end up where the two the bits of the service are i would nt say squabbling but disagreeing as to whether it s appropriate for them (to take a person). (psychiatrist, site 1) sometimes we end up where the two the bits of the service are i would nt say squabbling but disagreeing as to whether it s appropriate for them (to take a person). (psychiatrist, site 1) the crhts dealt with the backlog by reducing involvement to occasional telephone contact in order to release resources for new clients . Many teams reported large numbers of clients, for whom active intervention had ceased, who were simply awaiting discharge to community services what many referred to as the green zone . In some areas, inpatients not needing intensive ht were discharged directly into the green zone, bypassing the active case load altogether . Thus, two crhts found themselves acting as a buffer between acute and community services, absorbing excess work when neither service had capacity to accept new clients or take back old . Clients new to the service could sometimes wait weeks, even months, for the allocation of a cmht care coordinator . These problems can be traced, in part, to mutual lack of understanding of the different teams working cultures.there is a basic difference in working practices, with crht specialising in chaotic and constantly changing situations requiring immediate and flexible action, whereas cmhts have a diary - based schedule of regular pre - booked visits up to three weeks ahead . The consequence is great difficulty in arranging joint visits in general and joint discharge planning in particular, as this entails the cmht worker re - juggling existing appointments . (team leader, site 11) there is a basic difference in working practices, with crht specialising in chaotic and constantly changing situations requiring immediate and flexible action, whereas cmhts have a diary - based schedule of regular pre - booked visits up to three weeks ahead . The consequence is great difficulty in arranging joint visits in general and joint discharge planning in particular, as this entails the cmht worker re - juggling existing appointments . (team leader, site 11) crisis resolution and home treatment teams perceived themselves to be (and operated as) an extension of the acute service, as reflected in professional backgrounds and experience of staff, working practices and culture . Crhts were generally established at the same time as ward closures and ward staff had simply been transferred to the new teams . Familiarity with the culture and routines of the acute service facilitated relations with in - patient staff, but there was little shared experience and background with cmht staff . Relationships with cmhts were reported to work most effectively where senior practitioners had experience of working in both settings, had regular contact with cmht leaders and/or routinely attended cmht meetings . However, regular attendance was only reported at one site (11). As with gate - keeping, interviewees observed that, with the creation of specialist crhts, community practitioners have had fewer opportunities to develop crisis management skills and, the less confident they are in dealing with crises, the more conservative they may become in their management of risk . This, in turn, fuelled disputes between specialist and non - specialist teams over client transfer from one to another . Support for this view was found in criticism of community service timidity and unwillingness to take on higher risk clients and cmht complaints that they were asked to accept clients who were discharged too early . Where referrers have learned to trust the judgments of gate - keepers, disputes about acceptable risk are likely to be fewer . Trust develops over time, and team stability on both sides of the interface was important; in one site (8), for example, the most stable cmhts were reported to have developed more trusting relationship with the crht than those with higher staff turnover . Experienced workers were reported to have the highest thresholds for risk and to be most likely to recommend ht as an alternative to admission . Despite the use of standard assessment tools, risk assessment was said to retain a strong element of personal judgment, and is therefore likely to be sensitive to changing service capacity to cope with demand . In some teams, there were complaints that the crht was being used inappropriately as an out - of - hours and weekend service for cmhts. (t)here is a tendency to see us as an out - of - hours extension of their service we get referrals purely because it s the weekend; we get referrals from care co - ordinators if they re going on a fortnight s holiday . (site 1, nurse) (t)here is a tendency to see us as an out - of - hours extension of their service we get referrals purely because it s the weekend; we get referrals from care co - ordinators if they re going on a fortnight s holiday . (site 1, nurse) elsewhere, these situations were regarded as genuine gaps in service provision, with collaborative working extended to cmht clients needing out - of - hours and week - end support . This was a grey area subject to local negotiation over appropriate roles, and where a degree of flexibility seemed desirable . Significantly, there was most flexibility where senior crht workers had personal experience of cmht work . Teams reported tension between gate - keeping assessment and ht, with the former drawing resources away from the latter at times of high demand . Given their immediacy and urgency, gate - keeping assessment (what one person termed front end work) tended to take precedence, with the result that resources for ht could become squeezed . This, in turn, could influence gate - keeping decisions, in that ht can only be offered if there are the resources to provide it . In the words of one person, if you get lots of referrals, then you re doing lots of front end stuff (amhp, site 11) if you get lots of referrals, then you re doing lots of front end stuff the gate - keeping role and disputes over assessments of service user risk (of harm to self and/or others) were an enduring source of inter - professional and inter - team tension . Relationships with other parts of the service, in particular cmhts, were often reported to be strained . Community practitioners questioned the legitimacy of crht expertise to conduct gate - keeping assessments, given their partial knowledge of clients and lack of a long term perspective, in particular knowledge of trigger factors and coping strategies that may have been disrupted in the period leading up to crisis . As one cmht leader (site 5) explained: the last place we want our person to be is in hospital so we do our best to not get them to that point we put extra services in, we put extra visits in . It s a frustrating thing being told no by somebody who has never even met the patient . So we do our best to not get them to that point we put extra services in, we put extra visits in . We get to the point where there is no other option it s a frustrating thing being told no by somebody who has never even met the patient . Where hospital admission was considered inevitable, gate - keeping was regarded as a bureaucratic impediment that unnecessarily prolonged the admission process for service users who were already highly distressed . By contrast, crht workers complained that cmht care coordinators had a lower toleration of risk.our threshold for risk is much, much higher than other bits of the service and they sometimes have a lot of trouble understanding and accepting why we havent taken (a person) on . (social worker, site 1) our threshold for risk is much, much higher than other bits of the service and they sometimes have a lot of trouble understanding and accepting why we havent taken (a person) on . (social worker, site 1) failure to gate - keep (i.e. To assess) all hospital admissions was often blamed, by crht workers, on attempts to by - pass the crht and have people admitted to hospital directly . However, they acknowledged that it was not possible for crht workers to attend all assessments, in particular mental health act assessments for compulsory admission . Gate - keeping assessment introduced an element of duplication, and service user feedback highlighted repeated assessment as a persistent complaint.the service user was being asked questions that the care coordinator could answer or was already documented elsewhere in their notes . (team leader, site 8) the service user was being asked questions that the care coordinator could answer or was already documented elsewhere in their notes . The short - term nature of crht intervention is dependent on rapid flow of clients through the service and transfer back or on to other services . All teams were experiencing delays in the discharge pathway to community care, and this was a source of inter - team tension and mutual recrimination.sometimes we end up where the two the bits of the service are i would nt say squabbling but disagreeing as to whether it s appropriate for them (to take a person). (psychiatrist, site 1) sometimes we end up where the two the bits of the service are i would nt say squabbling but disagreeing as to whether it s appropriate for them (to take a person). (psychiatrist, site 1) the crhts dealt with the backlog by reducing involvement to occasional telephone contact in order to release resources for new clients . Many teams reported large numbers of clients, for whom active intervention had ceased, who were simply awaiting discharge to community services what many referred to as the green zone . In some areas, inpatients not needing intensive ht were discharged directly into the green zone, bypassing the active case load altogether . Thus, two crhts found themselves acting as a buffer between acute and community services, absorbing excess work when neither service had capacity to accept new clients or take back old . Clients new to the service could sometimes wait weeks, even months, for the allocation of a cmht care coordinator . These problems can be traced, in part, to mutual lack of understanding of the different teams working cultures.there is a basic difference in working practices, with crht specialising in chaotic and constantly changing situations requiring immediate and flexible action, whereas cmhts have a diary - based schedule of regular pre - booked visits up to three weeks ahead . The consequence is great difficulty in arranging joint visits in general and joint discharge planning in particular, as this entails the cmht worker re - juggling existing appointments . (team leader, site 11) there is a basic difference in working practices, with crht specialising in chaotic and constantly changing situations requiring immediate and flexible action, whereas cmhts have a diary - based schedule of regular pre - booked visits up to three weeks ahead . The consequence is great difficulty in arranging joint visits in general and joint discharge planning in particular, as this entails the cmht worker re - juggling existing appointments . (team leader, site 11) crisis resolution and home treatment teams perceived themselves to be (and operated as) an extension of the acute service, as reflected in professional backgrounds and experience of staff, working practices and culture . Crhts were generally established at the same time as ward closures and ward staff had simply been transferred to the new teams . Familiarity with the culture and routines of the acute service facilitated relations with in - patient staff, but there was little shared experience and background with cmht staff . Relationships with cmhts were reported to work most effectively where senior practitioners had experience of working in both settings, had regular contact with cmht leaders and/or routinely attended cmht meetings . However, regular attendance was only reported at one site (11). As with gate - keeping, the problem of delayed discharge revolved around disputes about risk . Interviewees observed that, with the creation of specialist crhts, community practitioners have had fewer opportunities to develop crisis management skills and, the less confident they are in dealing with crises, the more conservative they may become in their management of risk . This, in turn, fuelled disputes between specialist and non - specialist teams over client transfer from one to another . Support for this view was found in criticism of community service timidity and unwillingness to take on higher risk clients and cmht complaints that they were asked to accept clients who were discharged too early . Where referrers have learned to trust the judgments of gate - keepers, disputes about acceptable risk are likely to be fewer . Trust develops over time, and team stability on both sides of the interface was important; in one site (8), for example, the most stable cmhts were reported to have developed more trusting relationship with the crht than those with higher staff turnover . Experienced workers were reported to have the highest thresholds for risk and to be most likely to recommend ht as an alternative to admission . Despite the use of standard assessment tools, risk assessment was said to retain a strong element of personal judgment, and is therefore likely to be sensitive to changing service capacity to cope with demand . In some teams, there were complaints that the crht was being used inappropriately as an out - of - hours and weekend service for cmhts. (t)here is a tendency to see us as an out - of - hours extension of their service we get referrals purely because it s the weekend; we get referrals from care co - ordinators if they re going on a fortnight s holiday . (site 1, nurse) (t)here is a tendency to see us as an out - of - hours extension of their service we get referrals purely because it s the weekend; we get referrals from care co - ordinators if they re going on a fortnight s holiday . (site 1, nurse) elsewhere, these situations were regarded as genuine gaps in service provision, with collaborative working extended to cmht clients needing out - of - hours and week - end support . Subject to local negotiation over appropriate roles, and where a degree of flexibility seemed desirable . Significantly, there was most flexibility where senior crht workers had personal experience of cmht work . Some areas had attempted to redress the balance between gate - keeping, crisis resolution and ht by dropping at one site, for example, the crht had been re - launched as the intensive home treatment team to signal its renewed focus . Elsewhere, involvement in hospital discharge planning had been reduced to protect resources for ht . This had a knock - on effect for other services, notably the cmht, which had to redeploy its own staff to provide extra support to patients on early discharge . Another strategy was to separate the gate - keeping role from the provision of ht . However, at the site (site 5) where this had been introduced, ht workers were also required to work on inpatient wards, with the result that resources for ht were not protected . Strategies to enforce the gate - keeping role included: a formal requirement of gate - keeping for all potential in - patient admissions; use of the incident reporting system to draw attention to lapses in protocol; investigation of all admissions that were not gate - kept, and the use of high status professionals, such as team leaders and consultant psychiatrists, to arbitrate in disputes . The problem of delayed discharge was tackled in three sites by introducing a formal requirement for community teams to accept all crht clients referred to them within a set time period . However, community team leaders complained that this does not take account of resources within the receiving services, with the result that the problem may simply be shifted from one part of the system to another . A bold attempt to address these problems was the decision on the part of one service (site 8) to drop the gate - keeping requirement and allow direct access to ht to the accident and the local hospital emergency liaison team and to cmhts . Initial fears of being swamped by inappropriate referrals had not materialized and the few clients judged not to have needed intensive ht had been quickly passed on to other services . These initiatives had released resources for ht and thereby increased the likelihood of meeting ht episode targets . Crisis resolution and home treatment teams were conceived and introduced as extensions of the acute mental health service . The emphasis was on acute sector goals reducing inpatient admissions and increasing patient through - put by reducing average length of stay . However, successful fulfillment of the crht role is not possible without close collaboration with community services, in particular cmhts, and it is this dimension that seems to have been neglected in the original conception and operation of the crht function . Shortage of in - patient beds increases the need for early discharge and pressure to reduce admissions, resulting in more clients in intensive ht, which in turn creates pressure for early discharge to cmhts . As acute sector resources are squeezed, there is greater pressure on other services to take on more ill, more vulnerable and higher risk clients and, as these strains reverberate throughout the system, cmhts may find themselves pressed to take on not only more clients but clients who pose higher risks and are more difficult to discharge back to primary care . For crhts, the balance between gate - keeping and ht can become difficult to sustain, with the former dominating to the detriment of the latter just when it is most needed . Rather than being perceived primarily as gatekeepers to the acute service, protecting the scarce resource of hospital beds, it may be better to view the crht as an integral part of mental health service provision as a whole, as a resource for clients awaiting discharge or seeking to avoid hospital admission that is equally available to both acute and community services . The evidence presented above suggests that co - operative relationships between crht and cmht practitioners work best when: (i) senior crht members have experience of working in community as well as acute services and have regular contact with cmht leaders; (ii) low staff turnover enables a level of trust to develop between the crht and acute and community teams and (iii) there is a degree of flexibility in working arrangements, for example crht provision of temporary weekend cover to vulnerable cmht clients . Previous research has focused on the boundary - spanning role (ability to work across group or organizational boundaries) of psychiatrists in the acute sector (middleton et al ., our findings suggest that boundary - spanning is also important for crht workers in general, especially team leaders, and between the crht and community service . Co - operation in the management of risk depends on trust between workers and between teams, and levels of trust seemed to be greatest where both workers and teams had a history of working together . Mature teams with a dedicated consultant psychiatrist were more effective gate - keepers than their counterparts . Our study suggests that staff retention may be an important factor in the development of inter - team and inter - professional trust . However, in the context of an aging mental health workforce and imminent loss of many experienced workers, the findings of a recent investigation (huxley et al ., 2011) that significant numbers of community mental health workers report an intention to leave (especially within the more recently established specialist teams such as crhts) should be cause for concern . We were impressed by the strong service ethic and dedication of experienced staff working with some of the most difficult and vulnerable people in society, often in very challenging circumstances . To conclude, crhts are providing more than simply hospital in the community . A better way of thinking about their role would be to see it as bridging the hospital - community interface, intervening at the sharp end of community care and facilitating early discharge by providing community - based rehabilitation . Our research suggests that the model is likely to be most effective when there is successful collaboration built on mutual trust between acute, crht and community services . In a climate of shrinking resources and the exit of experienced practitioners from the mental health workforce, this may be difficult to sustain as demand outstrips supply and each part of the service attempts to protect its resources, with service users the inevitable losers . The study, as a whole, may not have done justice to what is a complex pattern of provision . Services were in the process of change, sometimes radical change and it is likely that all will be subject to further change, given current funding constraints and national health service reorganization . The findings presented represent common themes across sites, for which data saturation was achieved . We were unable to explore the views of all stakeholders, in particular general practitioners and accident and emergency staff, both of whom are an important source of referrals to the crht service . No carers were interviewed and only three service users who may not have been representative and whose views have therefore been omitted from this analysis . The study, as a whole, may not have done justice to what is a complex pattern of provision . Services were in the process of change, sometimes radical change and it is likely that all will be subject to further change, given current funding constraints and national health service reorganization . The findings presented represent common themes across sites, for which data saturation was achieved . We were unable to explore the views of all stakeholders, in particular general practitioners and accident and emergency staff, both of whom are an important source of referrals to the crht service . No carers were interviewed and only three service users who may not have been representative and whose views have therefore been omitted from this analysis.
|
The term metabolic syndrome refers to the simultaneous onset and progression of factors known to trigger atherosclerosis, such as obesity, dyslipidemia, hypertension, impaired fasting glucose, and impaired glucose tolerance1, 2 . For example, it has been shown that the risks of cardiac disease and type 2 diabetes and their mortality rates increase when metabolic syndrome is present3,4,5 . Physical inactivity and sedentary behavior as daily habits are considered major causes of metabolic syndrome6, and it has been reported that the lack of physical activity itself can be a risk factor for early death from atherosclerotic cardiovascular disease7, 8 . Therefore, increasing physical activity in daily life is considered important for preventing metabolic syndrome9, 10 . Studies on physical activity and metabolic syndrome reported that the prevalence of metabolic syndrome was lower in groups with high levels of physical activity than in inactive groups, showing an inverse correlation11, 12 . Meanwhile, physical activity level is also influenced by sociodemographic characteristics13 . According to a study comparing occupation and physical activity, physical activity level was low among office workers with primarily sedentary tasks and little physical activity at work14, 15 . Furthermore, office workers were reported to have inactive leisure activities after work in addition to sedentary behaviors in the workplace16, 17 . Bauman et al.18 analyzed the sedentary time at work and at home in 20 countries using the international physical activity questionnaire (ipaq) and showed that the probability of sitting down for more than 9 hours per day was more than three times greater with low physical activity than it was with high physical activity . The association of physical inactivity at work and in daily life with the prevalence of metabolic syndrome has been shown in various studies . Moreover, a study by mndez - hernndez et al.19 showed that the risk of metabolic syndrome decreased by 0.75-fold in a group with more than 3 hours of physical activity at work compared with those in a group that did not . Choi et al.20 also reported that those with sedentary tasks and low physical activity levels among 1,001 u.s . Workers had a higher risk of abdominal obesity, which is the essential identifying factor of metabolic syndrome . In addition, a study by kim et al.21, which analyzed the risk of metabolic syndrome for each occupational group in south korea, revealed that the relative risk for metabolic syndrome was 1.25-fold higher among office workers than it was among non - office workers, and that their physical activity level was low . In other words, the risk of metabolic syndrome can be associated with physical activity levels according to a person s occupation . However, although sociodemographic characteristics, such as occupation type of task, and work environment, affect cardiovascular disease and diabetes are important factors in metabolic syndrome22,23,24, studies elucidating the effect of preventing metabolic syndrome by taking into account the physical activity level of white - collar workers with primarily sedentary tasks are lacking . Therefore, the present study examined the relationship between physical activity level and metabolic syndrome by considering the daily physical activity level of white - collar workers . General characteristics, physical activity levels, and metabolic syndrome factors were assessed in 385 male white - collar workers who participated in the 2013 seoul metabolic syndrome . Management campaign (may, 2013). After excluding those who did not participate in the survey for measuring physical activity or blood testing, 331 male white - collar workers were selected as study subjects . The study was approved by the ethics and research committee for research involving human beings of the institution in which the study was performed . Height and weight were measured using an electronic scale (inbody4.0, biospace, seoul, south korea). For waist circumference, the midpoint of the subcostal region and the upper iliac crest on both sides was measured to the nearest 0.1 cm in the standing position using a measuring tape . Blood pressure was measured once in the right arm using an electronic hematomanometer (ft-700r, jawon medical, gyeongsan, south korea) in a sitting position after 10 minutes of rest . When the reading was abnormal, blood pressure was remeasured after another 10 minutes of rest . For blood testing, venous blood was collected on an empty stomach after the patient had fasted for more than 10 hours, after which fasting glucose, high - density lipoprotein (hdl) cholesterol and triglycerides were measured . Physical activity levels of the study subjects were measured by a long - form, self - administered version of the ipaq questionnaire25 . The level of physical activity was calculated from the data obtained in the present study based on the score conversion system of the ipaq . The activity level measured with the ipaq was divided into low, moderate, and high physical activity, as follows: 1 . Low physical activity: no activity was reported or some activity was reported but not enough to meet categories 2 or 3 . 2 . A. 3 or more days of vigorous - intensity activity of at least 20 minutes per day . B. 5 or more days of moderate - intensity activity and/or walking for at least 30 minutes per day . C. 5 or more days of any combination of walking, moderate - intensity, or vigorous - intensity activities achieving a minimum of at least 600 met - min / week . 3 . A. vigorous - intensity activity of at least 3 days per week and accumulation of at least 1,500 met - min / week . B. 7 or more days of any combination of walking or moderate- or vigorous - intensity activity accumulation of at least 3,000 met - min / week . Metabolic syndrome diagnostic criteria consisted of the 5 components suggested by national cholesterol education program treatment panel iii (ncep - atp)26 . The waist circumference classifications for asian populations suggested by the who were consulted27 . Subjects were diagnosed with metabolic syndrome if three or more of the following conditions were met: hdl 40 mg / dl, triglycerides 150 mg / dl, sbp and dbp at rest 130 or 85 mmhg, fasting glucose 100 mg / dl, or waist circumference 90 cm . To examine the general characteristics of the study subjects, means and standard deviations were calculated from their body measurements, and metabolic syndrome factors (continuous variables) and engaging in drinking and smoking (categorical variables) were expressed as frequencies and percentages . To observe the differences between metabolic syndrome - related factors according to physical activity level, one - way analysis of variance was performed . To verify the associations between metabolic syndrome variables and physical activity level, odds ratios was calculated using logistic regression analysis . The level of statistical significance () the comparison of groups according to physical activity level did not show differences in age, weight, and height among groups . Regarding metabolic syndrome factors, waist circumference and triglycerides were significantly lower in the moderate and high physical activity groups than in the low activity group (p<0.05 and p<0.05, respectively). Hdl cholesterol was significantly higher in the moderate and high physical activity groups than in the low activity group (p<0.05). Although there were differences in systolic and diastolic blood pressure and fasting glucose level between the physical activity levels, they were not significant (table 1table 1.general characteristics of the participants and their metabolic syndrome variables according to level of physical activityphysical activitylowmoderatehigh(n=111)(n=115)(n=105)age (years)48.1 7.347.8 7.248.8 6.0weight (kg)169.9 6.4170.6 5.6170.2 5.4height (cm)71.0 9.070.2 9.469.9 7.7physical activity***1,367.6 960.83,604.2 1,579.1 7,219.9 3,296.8 smokes, n (%) 60 (54.1)61 (53.0)46 (43.8)drinks, n (%) 54 (48.8)63 (54.8)48 (45.7)ms factorwc (cm)*82.8 7.180.5 7.8 80.7 6.6 tg (mg / dl)*163.1 124.0127.2 69.8 132.6 113.2 hdl (mg / dl)**49.3 12.753.3 12.8 54.2 12.5 sbp (mmhg)134.5 13.7 132.3 15.7 132.4 14.9 dbp (mmhg)84.1 9.0 82.4 10.3 81.9 10.4 fg (mg / dl)97.1 22.8 92.6 12.1 91.9 14.9 data are shown as mean standard deviation values unless otherwise indicated . A: low physical activity; b: moderate physical activity; c: high physical activity; dbp: diastolic blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; ms: metabolic syndrome; sbp: systolic blood pressure; tg: triglycerides; wc: waist circumference . * p<0.05, * * p<0.01, * * * p<0.001). Data are shown as mean standard deviation values unless otherwise indicated . A: low physical activity; b: moderate physical activity; c: high physical activity; dbp: diastolic blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; ms: metabolic syndrome; sbp: systolic blood pressure; tg: triglycerides; wc: waist circumference . * p<0.05, * * p<0.01, * * * p<0.001 in the relationship between physical activity and metabolic syndrome factors, waist circumference and fasting glucose showed negative correlations (p<0.001 and p<0.05, respectively), whereas hdl cholesterol showed a positive correlation (p<0.05). However, triglycerides, systolic blood pressure, and diastolic blood pressure did not show significant relationships (table 2table 2.association between physical activity and metabolic syndrome factorswctghdlsbpdbpfgphysical activity 0.176***0.0500.113 * 0.0000.0650.135*dbp: diastolic blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; sbp: systolic blood pressure; tg: triglycerides; wc: waist circumference . * p<0.05, * * * p<0.001). Dbp: diastolic blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; sbp: systolic blood pressure; tg: triglycerides; wc: waist circumference . * p<0.05, * * * p<0.001 the prevalence of metabolic syndrome according to the level of physical activity was 25.2% for the low physical activity group, 13% for the moderate physical group, and 14.3% for the high physical group; it was significantly lower in the moderate and high physical activity groups (p<0.05). The prevalence of metabolic syndrome according to an hdl cholesterol level 40 mg / dl was 27.0% in the low physical activity group, 13.9% in the moderate physical activity group, and 9.5% in the high physical activity group (p<0.001). Fasting glucose also showed significant differences, with the prevalences of metabolic syndrome being 29.7% in the low physical activity group, 20.0% in the moderate physical activity group, and 16.2% in the high physical activity group (p<0.05). However, waist circumference, triglycerides, blood pressure, and other variables did not show differences (table 3table 3.prevalence of metabolic syndrome according to level of physical activityphysical activitymetabolic syndrome*wctghdl***bpfg*90 cm 150 mg / dl40 mg / dl130 or 85 mmhg 100 mg / dllow (n=111)28 (25.2)21 (18.9)36 (32.4)30 (27.0)78 (70.3)33 (29.7)moderate (n=115)15 (13.0)16 (13.9)31 (27.0)16 (13.9)65 (56.5)23 (20.0)high (n=105)15 (14.3)12 (11.4)23 (21.9)10 (9.5)61 (58.1)17 (16.2)total (n=331)58 (17.5)49 (14.8)90 (27.2)56 (16.9)204 (61.6)73 (22.1)data are shown as numbers (%). Bp: blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; tg: triglycerides; wc: waist circumference . Bp: blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; tg: triglycerides; wc: waist circumference . * p<0.05, * * * p<0.001 the odds ratio for metabolic syndrome according to the level of physical activity was 2.03 (95% ci, 1.014.09) in the low physical activity group . This group had a greater risk of developing metabolic syndrome than the group with a high level of physical activity (table 4table 4.odds ratio of having metabolic syndrome according to level of physical activityadjustedor(95% ci)high physical activity1.00moderate physical activity0.85(0.391.85)low physical activity2.03(1.014.09)ci: confidence interval; or: odds ratio). Ci: confidence interval; or: odds ratio with respect to metabolic syndrome factors according to the level of physical activity, the odds ratio for hdl cholesterol level 40 mg / dl was 3.52 (95% ci, 1.627.67), with the low physical activity group having an increased risk compared with the high physical activity group, and the odds ratio for fasting glucose 100 mg / dl increased to 2.36 (95% ci, 1.194.66). However, waist circumference, triglycerides, and blood pressure factors did not show significant associations (table 5table 5.odds ratio of having metabolic syndrome variables according to level of physical activityphysical activitywc90 cm tg150 mg / dlhdl40 mg / dlbp130 or 85 mmhgfg100 mg / dlor (95% ci)or (95% ci)or (95% ci)or (95% ci)or (95% ci)high1.001.001.001.001.00moderate1.24 (0.552.80)1.18 (0.622.24)1.55 (0.663.61)1.76 (0.993.13)1.23 (0.602.53)low1.86 (0.864.02)1.73 (0.923.25)3.52 (1.627.67)0.89 (0.511.54)2.36 (1.194.66)bp: blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; or: odds ratio; tg: triglycerides; wc: waist circumference). Bp: blood pressure; fg: fasting glucose; hdl: high - density lipoprotein cholesterol; or: odds ratio; tg: triglycerides; wc: waist circumference the present study examined the relationship between physical activity level and metabolic syndrome in male white - collar workers by dividing the workers into low, moderate, and high physical activity groups according to ipaq classification . The study results showed that the moderate and highly active groups showed significant differences compared with the low activity group in waist circumference, triglycerides, and hdl cholesterol, which are the risk factors for metabolic syndrome . The study also showed that the level of physical activity was associated with waist circumference, fasting glucose, and hdl cholesterol . Furthermore, the prevalence of metabolic syndrome was low for workers with moderate and high physical activities compared with those with low physical activity . Previous studies have already proven that physical activity and exercise play a crucial role in preventing metabolic syndrome, a complex cardiovascular disease28, 29, and moderate or vigorous physical activity is recommended for health promotion and prevention of chronic disease30 . However, adults generally do not engage in physical activity or exercise of moderate intensity or higher, and a lifestyle with primarily sedentary behavior is prevalent31 . A study on the prevalence of metabolic syndrome showed that the risk of metabolic syndrome decreased as the level of physical activity increased32 . Moreover, decreased physical activity has been shown to be associated with metabolic syndrome factors such as obesity, hypertension, diabetes, and dyslipidemia33,34,35, and a group with high levels of physical activity had a lower incidence of metabolic syndrome compared with those in an inactive group, showing a negative correlation11 . Similar to previous studies, the present study showed that for metabolic syndrome factors according to the level of physical activity in male white - collar workers, waist circumference and triglycerides were significantly higher in the group with low physical activity than they were in the moderate or high physical activity groups, while hdl cholesterol was significantly lower in the low physical activity group than it was in the moderate or high activity group . In addition, with respect to the association between physical activity level and metabolic syndrome, waist circumference and fasting glucose showed a negative correlation, whereas hdl cholesterol showed a positive correlation . These results indicate that although not all of the factors of metabolic syndrome showed clear differences according to the level of physical activity in public office workers, moderate and high levels of physical activity are effective in decreasing risk factors for metabolic syndrome in white - collar workers compared with low levels of physical activity . This suggests that reducing sedentary lifestyles and inactivity and increasing the level of physical activity in daily life an important for white - collar workers who are at risk of metabolic syndrome due to a sedentary work environment . A previous investigation of 7,432 adults using the ipaq showed that a group that exercised more than 3 times per week (20.3%) had a lower prevalence of metabolic syndrome than a the group without physical activity (36.2%)36 . A prospective cohort study of 874 middle - aged men and women showed a lower prevalence of metabolic syndrome in a group with high physical activity levels12, and the odds ratio for metabolic syndrome prevalence tended to decrease as the level of physical activity increased37 . In a study by zhu et al.38 of 11,239 adults examined as part of the third national health and nutrition examination survey (nhanes iii) in the u.s ., when a group without physical activity was given a value of 1, the odds ratio for the prevalence of metabolic syndrome in a group with high physical activity was 0.41 times (95% ci, 0.310.54) greater in males . In a study by chung39, when a group that engaged in regular exercise more than 5 times per week was given a value of 1, the odds ratio a group without any exercise increased by 1.7 times (95% ci, 1.02.8). In the present study, the overall prevalence of metabolic syndrome was 17.5% in male public office workers; according to the physical activity level, the prevalence of metabolic syndrome was higher in those with low physical activity (25.2%) than in those with moderate (13.0%) or high (14.3%) activity . The odds ratio for metabolic syndrome was 2.03-fold higher in the group with low physical activity (95% ci, 1.014.09) compared with the high physical activity group . As the physical activity level decreased in public office workers whose work mainly involved sedentary tasks, the risk of metabolic syndrome incidence also tended to decrease . This indicates that the level of physical activity is important for decreasing the risk of metabolic syndrome . However, because the study was a cross - sectional study on white - collar workers within a certain region, it is limited in terms of predicting the incidence of metabolic syndrome according to physical activity level . Furthermore, we did not analyze any job - related factors, such as employment history, position, and work stress, which is another limitation of the present study . Further analysis of such factors may reveal further indicators of being at risk for metabolic syndrome and other health conditions . In conclusion, the present study showed that low physical activity is associated with a higher prevalence of metabolic syndrome in white - collar workers whose work primarily involves sedentary tasks . Therefore, this suggests that increasing the level of physical activity is important for preventing metabolic syndrome in office workers with relatively low physical activity.
|
Affected subjects are usually more than 5 years of age, and there is a predisposition in females . In dogs, insulin resistance (ir) is suspected when hyperglycemia is still detected despite administration of insulin doses greater than 1.0 to 1.5 iu / kg . Definitions of resistance to exogenously administered insulin vary, but all are based on the dose insulin administered and the resultant blood glucose concentrations . Ir is caused by an increase in circulating counter regulatory hormones (glucagon, glucocorticoids, catecholamines and growth hormone). These stress - related diabetogenic hormones increase as a result of concurrent diseases, endocrine disorders or exogenous administration . Progesterone (p4) also induces ir by stimulating growth hormone (gh) production in mammary glands . Increases in circulating p4 concentration are associated with exogenous administration and physiologic conditions such as diestrus and pregnancy . In pregnant and non - pregnant bitches, increases in gh are related to increases in circulating p4 and appears to be secondary to synthesis of gh in mammary glands . It has been clearly demonstrated that p4 can stimulate mammary gh hypersecretion during the non - pregnant luteal phase . Elevated gh plasma concentrations are characterized by the absence of a pulse pattern and insensitivity to stimulation and inhibition tests, with the exception of inhibition by the progesterone antagonist ru486 . In hypophysectomized dogs, no absence or decrease in plasma gh concentrations selman et al . Demonstrated that mammary glands were effectively the source of gh concentrations . In human and felines, increased gh concentrations have been observed after progestin treatment . Aglepristone, which is the first p4 receptor blocker licensed for veterinary use, has been successfully used for pregnancy interruption, pyometra medical therapy and treatment of feline fibroadenomatous mammary hyperplasia . Aglepristone binds to uterine p4 receptors with affinity three times greater than p4 itself in bitches and nine times greater in queens . Aglepristone does not modify plasma concentrations of p4, but indirectly induces uterine contractions and cervix dilatation after multiple injections . . Demonstrated that aglepristone in dogs reduces the length of p4 secretion by cl and accelerates the luteolytic process, and that this effect persists for about 6 to 8 days . Several side effects have been observed after administration of aglepristone, such as anorexia, restlessness, depression, vomiting, diarrhea decrease in body temperature and local inflammatory reaction after injection . The present study was conducted to investigate the use of aglepristone for the treatment of insulin - resistant diabetes mellitus during the luteal phase . All bitches included in the study were diabetic subjects under insulin therapy that were referred to our veterinary teaching hospital over a period of two years for insulin - resistant diabetes mellitus that developed during mid - luteal phase of the estrous cycle (25th~30th day of diestrus). The luteal phase was established by vaginal cytology examined upon hematoxylin - eosin staining and blood p4 concentrations . Criteria for selection of patients were: glycemia persistently> 200 mg / dl over a 12 h period, despite treatment with more than 1.5 iu / kg bid of insulin; clinical and laboratory findings (p4> 2 ng / ml) indicative of diestrus . Diet, training, environmental factors and the insulin protocol administration were similar for all subjects . Exclusion criteria were the presence of other disorders or treatments that can cause insulin resistance . Eight intact bitches of different breeds and ages (9 to 15 years; mean standard deviation [sd]: 10.9 1.46 years) met the inclusion criteria, as treatment group (group t; n = 8) and were therefore classified as having a p4 induced insulin - resistant diabetes mellitus (table 1). The control group (group c; n = 6) was composed by six diabetic bitches of mixed breeds and ages (8 to 12; mean sd: 10 1.41) under insulin therapy in the same phase of the estrous cycle (25th~30th day of diestrus, table 2). The study was carried out in accordance with the italian legislation on animal care (dl 116/92). Blood samples (4 ml) for the determination of p4 concentration (a commercial available radioimmunoassay - ria for canine) and gh (commercially available ria for canine and porcine gh; linco research, usa) were collected before and after treatment with aglepristone by cephalic venipuncture and immediately transfer to ice - chilled edta - coated tubes for gh determination, as well as to tubes without anticoagulant for p4 determination . All samples were centrifuged at 4 for 10 min, after which plasma was stored at -25 until assayed . Blood samples for determination of the pulsatile plasma profile of gh were collected at 15 min intervals between 8:00 am and 14:00 pm before aglepristone administration and five days after the last aglepristone treatment . Serial blood glucose curves were performed on day 0, 5, 12 and 20 after the beginning of treatment . All subjects were treated with porcine insulin zinc suspension (caninsulin; intervet, italy) as reported in table 1 . Bitches in group t were treated with 10 mg / kg subcutaneously (sc) aglepristone (alizin; virbac, italy) on day 1, 2, 9 and 17 in diestrus bitches . The control group received porcine insulin zinc suspension 1 iu / kg (caninsulin; intervet) as well as saline solution (0.3 ml / kg, sc) on days 1, 2, 9, 17 . Differences among groups were assessed by anova, and a p <0.05 was considered to indicate statistical significance . All bitches included in the study were diabetic subjects under insulin therapy that were referred to our veterinary teaching hospital over a period of two years for insulin - resistant diabetes mellitus that developed during mid - luteal phase of the estrous cycle (25th~30th day of diestrus). The luteal phase was established by vaginal cytology examined upon hematoxylin - eosin staining and blood p4 concentrations . Criteria for selection of patients were: glycemia persistently> 200 mg / dl over a 12 h period, despite treatment with more than 1.5 iu / kg bid of insulin; clinical and laboratory findings (p4> 2 ng / ml) indicative of diestrus . Diet, training, environmental factors and the insulin protocol administration were similar for all subjects . Exclusion criteria were the presence of other disorders or treatments that can cause insulin resistance . Eight intact bitches of different breeds and ages (9 to 15 years; mean standard deviation [sd]: 10.9 1.46 years) met the inclusion criteria, as treatment group (group t; n = 8) and were therefore classified as having a p4 induced insulin - resistant diabetes mellitus (table 1). The control group (group c; n = 6) was composed by six diabetic bitches of mixed breeds and ages (8 to 12; mean sd: 10 1.41) under insulin therapy in the same phase of the estrous cycle (25th~30th day of diestrus, table 2). The study was carried out in accordance with the italian legislation on animal care (dl 116/92). Blood samples (4 ml) for the determination of p4 concentration (a commercial available radioimmunoassay - ria for canine) and gh (commercially available ria for canine and porcine gh; linco research, usa) were collected before and after treatment with aglepristone by cephalic venipuncture and immediately transfer to ice - chilled edta - coated tubes for gh determination, as well as to tubes without anticoagulant for p4 determination . All samples were centrifuged at 4 for 10 min, after which plasma was stored at -25 until assayed . Blood samples for determination of the pulsatile plasma profile of gh were collected at 15 min intervals between 8:00 am and 14:00 pm before aglepristone administration and five days after the last aglepristone treatment . Serial blood glucose curves were performed on day 0, 5, 12 and 20 after the beginning of treatment . All subjects were treated with porcine insulin zinc suspension (caninsulin; intervet, italy) as reported in table 1 . Bitches in group t were treated with 10 mg / kg subcutaneously (sc) aglepristone (alizin; virbac, italy) on day 1, 2, 9 and 17 in diestrus bitches . The control group received porcine insulin zinc suspension 1 iu / kg (caninsulin; intervet) as well as saline solution (0.3 ml / kg, sc) on days 1, 2, 9, 17 . Differences among groups were assessed by anova, and a p <0.05 was considered to indicate statistical significance . Prior to aglepristone administration, the mean serum p4 concentrations averaged 9.25 3.15 and 10.50 2.06 ng / ml in group t and group c, respectively (p> 0.05) (tables 1 and 2), while the mean plasma gh concentrations were 2.37 0.17 g / l in group t and 1.80 0.11 g / l in group c (p <0.05). Following treatment, the plasma gh concentration in group t was significantly lower 1.7 0.6 g / l (tables 3 and 4); however, in group group c it was 1.68 0.07 g / l, which was not a significant difference (table 4). At the end of treatment, the mean p4 serum concentrations were 8.37 2.24 and 9.33 1.79 ng / ml in group t and group c, respectively (tables 5 and 6). The final p4 values of group t and c did not differ significantly . In ir subjects (group t), no significant variations in glycemia mean values were observed between day 0 and day 5 (p <0.05). At day 12 and 20, the mean concentration of blood glucose was significantly lower (p <0.05) than on day 0 (table 5). In the control group (table 6), between the animals, blood glucose means concentrations were not significant (p> 0.05). On day 20, diabetes mellitus was well controlled in all the bitches (group t; table 5). This results in group t allowed us to keep insulin dosage less than 1 iu / kg during the following 6 weeks, while before the aglepristone treatment the mean insulin dosage was 1.98 0.68 iu / kg (tables 1 and 5). Glucose is the main source of energy for all body tissue, except cardiac and skeletal muscle . Blood glucose concentration is a reflection of gastrointestinal absorption, glycogenolysis, gluconeogenesis and glucose consumption by tissues . Glucose production and its metabolism occur as a result of interaction of hormones, cytokines and intracellular transport . Several glucose transporters have been identified, such as glut-4 in skeletal muscle, cardiac and adipose cells, as well as other glucose transporters (glut-1; glut-2) independent from insulin action in the brain, liver, kidney, placenta, sperm, adipocytes and erythrocytes . Increasing blood glucose concentrations stimulate insulin secretion, while low blood glucose concentrations suppress insulin secretion and stimulate production of various hormones (glucagon, epinephrine, norepinephrine, growth hormone, cortisol). There is growing evidence suggesting that gh modulates insulin sensitivity via multiple mechanisms due to the influence of crosstalk between gh / insulin - like growth factor-1 (igf-1) and insulin signaling, including reduced tyrosine kinase (tk) activity . However, insulin resistance alone appears likely to cause diabetes, once only few bitches in diestrus develop canine diabetes mellitus, which is undoubtedly a multifactorial disease, because there is growing evidence suggesting that gh modulates insulin sensitivity by multiple mechanisms, due to the influence of crosstalk between gh / insulin - like growth factor1 (igf-1). Pregnancy is associated with ir in humans and dogs, which occurs in response to suppression of the intracellular transport of glucose and its increasing concentration in blood . P4, estradiol, growth hormone, placental lactogen and placental cytokines all play important roles in causing insulin resistance . There are several causes of resistance to exogenous insulin that do not lead to ir, such as improper handling and administration of insulin . Somogyi effect, which occurs when pronounced hyperglycemia develops in response to severe insulin - induced hypoglycemia, may also cause misdiagnosis of insulin resistance . In diabetic patients, sudden severe insulin - induced hypoglycemia results in development of protective mechanisms involving secretion of catecholamines, glucocorticoids, glucagon, and gh, which lead to pronounced hyperglycemia . Actually, in subjects showing somogyi effect, the activity of insulin is high . In our cases, gestational diabetes mellitus is a clinical condition characterized by a variable degree of glucose intolerance that can develop during pregnancy, parturition and diestrus . During pregnancy it is likely that gestational diabetes mellitus exerts a negative impact on fetuses and can compromise pregnancy and newborn viability . A high risk of adverse fetal events, including abortion, small unthrifty pups and overly large pups (macrosomia), has been described in diabetics bitches . Vascular effects of diabetes may reduce placental blood supply, contributing to abortion or poorly - grown pups . Pregnant bitches show greater insulin resistance than non - pregnant diestrous bitches . During the luteal phase basal gh secretion and p4 concentrations the canine mammary gland expresses genes encoding gh, and its expression is strongly stimulated by p4 . The long exposure to high circulating levels of p4 during the luteal phase may even result in excess gh with acromegaly and/or diabetes mellitus in bitches . Previous studies identified foci of hyperplastic ductular epithelium of the mammary gland as the site of origin of gh excess induced by progestins . These observations are consistent with the central role of progestins in gh gene expression in canine mammary gland and allow for a target endocrine therapy with progesterone receptor blockers with progestin - induced mammary - derived gh hypersecretion . Some authors have also found that administration of antiprogestin resulted in decreased plasma gh concentrations and normalization of plasma igf - i concentrations in bitches with progestin - induced acromegaly . The insulin - antagonist action of gh (progestin - induced hypersecretion of gh) may result in hyperglycemia and diabetes mellitus . Additionally, treatment with aglepristone (ru 46534) was useful to control the hyperglycemia levels in diestrus bitches, which was clearly demonstrated by the p4 levels (> 2 ng / ml) at the end of the aglepristone treatment . Our findings are in agreement with those of watson et al ., who found that administration of the mifepristone resulted in a decreased gh plasma concentration in bitches with progestin - induced acromegaly . . Showed lower progesterone levels after aglepristone administration, which was likely related to acceleration of the luteolytic process . The gradual decline of progesterone observed in treated dogs suggested that antiprostagen triggers an anticipated, physiological - like luteolytic process . In our opinion, the results of this prospective study suggest that aglepristone represents an effective therapeutic choice . Nevertheless, the best and definitive treatment for insulin resistance due to progesterone is gonadectomy as soon as possible, while the use of aglepristone should be reserved only for cases in which surgery is not possible or authorized by the owners . Ovariohysterectomy promotes a quick drop in p4 levels, which is of great interest to managing diabetic bitches . In conclusion, the results of the present study demonstrated that aglepristone treatment significantly decreased blood glucose concentration in bitches with progestin - induced insulin - resistance.
|
There is evidence to suggest that certain weight - loss practices (for example, skipping breakfast, restricting intake, self - initiated dieting) and weight loss are associated with impairments in various cognitive processes, including memory, attention and processing speed . One study reported slower reaction times to salient food words on a food stroop task in weight - loss maintainers compared with non - dieting normal weight and obese individuals . Reasons for the decrements in cognitive performance during dieting, weight loss or weight maintenance in these studies are not fully understood but may be due to alterations in blood glucose levels (as a result of skipping meals, restrictions in food intake), preoccupying thoughts of food and weight and emotional reactivity to salient cues . Despite these findings, minimal to no cognitive impairment and improvements in executive / attention functioning and memory have been observed in other studies investigating the effects of weight loss on cognitive function . Research over the last decade suggests that low - carbohydrate (l - cho) diets are a viable option in the treatment of obesity . Although the effects of these diets on weight and cardiovascular disease risk factors are well described, less is known about secondary outcomes, such as cognitive functioning, that are also important to those deciding which type of weight - loss diet to employ . Given that l - cho ketogenic diets are known to affect brain function as evidenced by their ability to suppress seizure activity, it is reasonable to speculate whether l - cho and high - carbohydrate (h - cho) diets differ in their effects on cognitive function under other circumstances like dieting and weight loss . One study in obese women (n=21) who consumed either a very - low - calorie ketogenic or non - ketogenic liquid formula diet for 28 days showed that attention and information processing did not differ as a function of diet; however, psychomotor and problem - solving performance were adversely affected in those consuming a ketogenic diet, primarily during the first week of dieting . A more recent study in overweight and obese women (n=19) showed that those consuming an energy - restricted, l - cho diet for 3 weeks performed worse on a memory - based task but better on an attention - vigilance task than those consuming an energy - restricted h - cho diet . To our knowledge, only one study has compared the effects of consuming an energy - restricted l - cho or h - cho diet on cognitive function in overweight and obese adults (n=106) for a period over 4 weeks . In this study, participants were instructed to consume less than 20 g of carbohydrate per day for the first 8 weeks . After 8 weeks, they could increase their intake to less than 40 g of carbohydrate per day for the remainder of the study . Although both diet groups showed improvements in speed of processing after 8 weeks, the l - cho group displayed a smaller improvement than the h - cho group . There were no differences between groups in either working memory or speed of processing after 1 year . The purpose of this study was to compare the effects of two weight - reducing dietary approaches (l - cho vs h - cho diets) on attention, information processing, reaction time, short - term memory and executive function in overweight or obese men and women over a 6-month period . All study participants were enrolled in three - center, two - year randomized controlled trial comparing the effects of l - cho and h - cho diets for the treatment of obesity . A detailed description of the recruitment and screening procedures and assessments used in the parent study are available elsewhere . Individuals reporting psychiatric conditions, pre - existing health problems (for example, chronic diseases such as diabetes, hypertension, cardiovascular disease, stroke), use of prescription medications, regular alcohol, tobacco or other drug use were excluded from the study . The current study was a sub - study of the larger study and only involved the philadelphia site . All participants at this site (n=106) were invited to participate in assessments of cognitive functioning before and after 1, 4, 12 and 26 weeks of treatment and 47 participants agreed to participate . Participants were randomized to treatment conditions and consumed a self - selected diet while participating in a comprehensive behavioral weight control program . Group sessions varied between the two treatment conditions only in the type of diet plan that was prescribed . Participants in the l - cho condition were instructed to follow a diet that was restricted in carbohydrate and unlimited in fat and protein . Participants were provided with information on l - cho diets as well as numerous suggestions for meal plans . Instruction was consistent with the four recommended phases described in dr atkins' new diet revolution . Participants in the h - cho condition were encouraged to consume a diet consistent with the dietary guidelines for americans (that is, 30% of calories from fat, 15% from protein and 55% from carbohydrate). Participants were instructed to make changes in dietary intake that included reducing fat and increasing the consumption of fruits, vegetables, breads and cereals . Suggested caloric intakes for men and women were set at 15001800 kcal d and 12001500 kcal d, respectively . 1 assessment was based on a previous study showing impairments in cognitive function 1 week after initiation of a l - cho diet . A minimum of one 30 min training session was required before the baseline assessment to familiarize participants with the computer tasks . Together with study staff each participant reviewed written instructions describing the procedures for completing the four computer - based performance tasks . Participants were given the opportunity to ask questions and to briefly practice each task in order to demonstrate that they understood how to complete the task . If a participant was unable to demonstrate comprehension of a particular task during the initial training session, (s)he would be given one additional opportunity to practice that particular task and demonstrate understanding (that is, there was a maximum of two training sessions). On testing days, participants were instructed to consume lunch at noon from a list of suggested foods with known macronutrient compositions (consistent with the dietary prescriptions of the group to which they were randomized), eat a standard l - cho snack (3% cho, 180 calories) 2 h later, and to abstain from alcohol . Testing was conducted approximately 2 h following consumption of the snack to ensure that all participants were in the same fed state . Upon arrival, participants were asked to provide a urine sample (to assess ketones) and to complete a check - in questionnaire (to assess adherence to the pre - session procedures) as well as a vas questionnaire (to assess hunger, craving and anxiety). The stim complete system (compumedics neuroscan) was used, and the assessment battery included: the color and food stroop task (attention and information processing); the continuous performance task (cpt, attention and reaction time); word recall (verbal short - term memory) and the wisconsin card - sorting task (problem solving, set - shifting and cognitive flexibility). Test order was randomly administered, and the performance battery took approximately 30 min to complete . Comparisons between treatment group means over time were conducted with proc glimmix in sas v. 9.3 (sas institute inc ., cary, nc, usa). This procedure was designed for generalized linear mixed models, also called random coefficients or multilevel / hierarchical models . To build the models, baseline (visit=0) next, time was coded as 1, 4, 12 and 24 (visit months) and entered as a continuous variable . Overall trends for time were evaluated using linear and up to third order polynomial terms, and differences in trajectories between treatment groups were tested with interaction terms with dummy (0/1) coding for treatment groups . To accommodate the dependence caused by repeated measures for each subject over visits, initial models were parameterized with random intercepts and slopes along with the covariance between the variance components . Lack of significant p - values for regression coefficients as well as confidence intervals including zero for variance / covariance components led to final or reduced models with only random intercepts and linear or curvilinear (quadratic) fixed time slopes . Differences between groups were based on the p - values from the fixed' effects using =0.05 as level of statistical significance . Significant time (p<0.05) by condition interactions were followed up with comparison between lsmeans at each time point employing bonferroni adjustment for multiple comparisons (p<0.0125). Comparisons between treatment group means over time were conducted with proc glimmix in sas v. 9.3 (sas institute inc ., cary, nc, usa). This procedure was designed for generalized linear mixed models, also called random coefficients or multilevel / hierarchical models . To build the models, baseline (visit=0) next, time was coded as 1, 4, 12 and 24 (visit months) and entered as a continuous variable . Overall trends for time were evaluated using linear and up to third order polynomial terms, and differences in trajectories between treatment groups were tested with interaction terms with dummy (0/1) coding for treatment groups . To accommodate the dependence caused by repeated measures for each subject over visits, initial models were parameterized with random intercepts and slopes along with the covariance between the variance components . Lack of significant p - values for regression coefficients as well as confidence intervals including zero for variance / covariance components led to final or reduced models with only random intercepts and linear or curvilinear (quadratic) fixed time slopes . Differences between groups were based on the p - values from the fixed' effects using =0.05 as level of statistical significance . Significant time (p<0.05) by condition interactions were followed up with comparison between lsmeans at each time point employing bonferroni adjustment for multiple comparisons (p<0.0125). The sample consisted of 47 (25 males, 22 females) participants who were 70% caucasian, 28% african american, 2% others, with a means.d . Age of 47.48.7 years and body mass index of 35.33.4 kg m. there were no significant differences between participants in the l - cho (n=22) or the h - cho (n=25) groups on any baseline variable . Participants in the h - cho group lost 0.61.0%, 3.41.6%, 7.44.3% and 9.75.6% of their baseline body weight at 1, 4, 12 and 24 weeks, respectively . Participants in the l - cho group lost 0.51.6%, 4.02.1%, 8.53.8% and 11.45.6% of their baseline body weight at 1, 4, 12 and 24 weeks, respectively . There were no significant differences in weight loss between groups at any of the assessment points . However, there was a significant main effect for time (p<0.0001) and a significant interaction between time and condition (p=0.0002) for urinary ketones . Compared with the h - cho group, urinary ketones increased to a greater extent in the l - cho group, particularly during the first week on the diet, and gradually declined over time, suggesting good adherence to l - cho prescriptions, which increased carbohydrate intake over time (figure 1). There was a significant main effect for time (p<0.02) and a significant quadratic effect for time (p<0.05) for the percentage of correct responses made on the color stroop task . The percentage of correct color responses significantly increased over time in both the h - cho and l - cho groups, but there was no difference between the groups (figure 2). There were no significant effects on accuracy as a function of word type (that is, neutral or salient foods) on the food stroop over time or between groups . There were no significant differences over time or between groups in response time or number of correct responses on the cpt . The dependent measures for this task were percentage of correct responses and number of incorrect responses . There were no significant differences in the percentage of correct responses or number of incorrect responses over time or between groups . There were no significant changes in the performance (that is, mean response time or number of errors) over time or between groups . Participants in the h - cho group lost 0.61.0%, 3.41.6%, 7.44.3% and 9.75.6% of their baseline body weight at 1, 4, 12 and 24 weeks, respectively . Participants in the l - cho group lost 0.51.6%, 4.02.1%, 8.53.8% and 11.45.6% of their baseline body weight at 1, 4, 12 and 24 weeks, respectively . There were no significant differences in weight loss between groups at any of the assessment points . However, there was a significant main effect for time (p<0.0001) and a significant interaction between time and condition (p=0.0002) for urinary ketones . Compared with the h - cho group, urinary ketones increased to a greater extent in the l - cho group, particularly during the first week on the diet, and gradually declined over time, suggesting good adherence to l - cho prescriptions, which increased carbohydrate intake over time (figure 1). There was a significant main effect for time (p<0.02) and a significant quadratic effect for time (p<0.05) for the percentage of correct responses made on the color stroop task . The percentage of correct color responses significantly increased over time in both the h - cho and l - cho groups, but there was no difference between the groups (figure 2). There were no significant effects on accuracy as a function of word type (that is, neutral or salient foods) on the food stroop over time or between groups . There were no significant differences over time or between groups in response time or number of correct responses on the cpt . The dependent measures for this task were percentage of correct responses and number of incorrect responses . There were no significant differences in the percentage of correct responses or number of incorrect responses over time or between groups . There were no significant changes in the performance (that is, mean response time or number of errors) over time or between groups . There was a significant main effect for time (p<0.02) and a significant quadratic effect for time (p<0.05) for the percentage of correct responses made on the color stroop task . The percentage of correct color responses significantly increased over time in both the h - cho and l - cho groups, but there was no difference between the groups (figure 2). There were no significant effects on accuracy as a function of word type (that is, neutral or salient foods) on the food stroop over time or between groups . The dependent measures were response time and number of correct responses . There were no significant differences over time or between groups in response time or number of correct responses on the cpt . The dependent measures for this task were percentage of correct responses and number of incorrect responses . There were no significant differences in the percentage of correct responses or number of incorrect responses over time or between groups . The dependent measures were mean response time and number of errors . There were no significant changes in the performance (that is, mean response time or number of errors) over time or between groups . This study investigated the cognitive effects of l - cho and h - cho weight - reducing diets over a 6-month period . The main findings from this study are: (1) weight loss has neither a positive or negative effect on cognitive function and (2) l - cho and h - cho weight - loss diets have similar effects on cognitive performance . Although others have reported some improvement in executive / attention functioning and memory with weight loss, little improvement was observed in the current study . More specifically, with the exception of improved accuracy over time in both groups on the color stroop task, assessing attention and information processing, there were no significant differences in performance over time or between groups on tasks assessing attention and reaction time (cpt), short - term memory (word recall) or problem solving (wisconsin card - sorting task). In the most restrictive period of the current study (weeks 112), participants in the l - cho group consumed 20 g of carbohydrate . Carbohydrate intake gradually increased by 5 g per day per week, depending on the rate of weight loss, for the remainder of the study . To our knowledge, only one other study has investigated the effects of consuming 2040 g of carbohydrate as part of an energy - restricted diet on cognitive function in humans . In this study, participants were randomized to either a h - cho diet (that is, 46% carbohydrate) or a l - cho diet consisting of 920 g of carbohydrate per day for the first 8 weeks of the study and no more than 40 g of carbohydrate per day for the remaining 44 weeks of the study . Although there were no differences in working memory between the groups at 8 weeks, there were greater improvements in the speed of processing in the h - cho diet group compared with the l - cho group . There were, however, no differences in working memory or speed of processing between groups after 12 months . Those data along with findings from the current study suggest an overall minimal impact of l - cho weight - loss diets prescribing 20 g of carbohydrate per day or more on cognitive function . It is important to note that these findings are limited to relatively healthy, overweight and obese, middle - aged adults and to the cognitive processes assessed in these studies . Other studies suggest that l - cho diets restricting carbohydrate intake to less than 20 g per day can affect performance in both positive and negative directions depending on the cognitive function assessed . One non - randomized study, in which participants completely withdrew from carbohydrates for the first week of the study, consumed 58 g of carbohydrate during the second week, and consumed 1016 g of carbohydrate during the final week of the study, showed that individuals consuming l - cho diets displayed faster reaction times on the cpt than those consuming a h - cho diet (that is, dietary guidelines for americans). In contrast, performance on memory tasks was worse in the l - cho group compared with the h - cho group . In addition, participants consuming a h - cho diet displayed a practice effect over time and consistently responded faster to non - food words compared with food words on the stroop task, whereas those consuming a l - cho diet did not show a consistent practice effect and displayed little difference in reaction time as a function of word type . In another randomized study that prescribed either a h - cho diet (that is, 52% carbohydrate) or a l - cho diet consisting of 10 g of carbohydrate a day, no differences in performance were observed between groups at any time on the stroop task or another task requiring sustained attention (digit vigilance task) but participants consuming the l - cho diet performed worse on a task requiring mental flexibility (trail making task) between baseline and week 1 on the diet . These studies suggest that under conditions of more severe carbohydrate restriction, cognitive performance can either be enhanced or impaired depending on the type or complexity of the task . This study had several strengths including a randomized design and dietary conditions (that is, self - selected foods, dietary prescriptions that followed popular weight - reducing diet strategies) that simulated a real - life setting . As such, the present findings can be more easily generalized to similar populations in the real world . In addition, all participants were given a standardized snack at a set time to ensure that they were all in the same metabolic state during testing . Further, weight loss was the same between groups so there was no confound of differential weight loss between the groups . Despite these strengths, the study has several weaknesses including a small sample size and a limited array of cognitive tasks . Larger sample sizes would allow for a greater diversity in participants (that is, ethnic background, age and so on) and a better ability to detect subtle differences in cognitive performance between groups . It is also possible that the testing parameters in this study were not stringent enough to tease out differences in cognitive performance or elicit differential responding between groups . Previous research has shown poorer performance on complex cognitive tasks but not on more basic cognitive tasks following l - cho intake . A larger array of cognitive tasks would provide a better understanding of the types of mental functioning that can potentially be affected by diets with different macronutrient compositions . Although it is possible that the initial training session raised baseline performance, which might make it difficult to detect changes in subsequent performance, we do not feel that it made a significant impact because of the brevity of the training session . In conclusion, these findings suggest that individuals participating in a 6-month behavioral weight - loss program randomized to either a l - cho (that is, dr atkins' new diet revolution) or a h - cho (that is, dietary guidelines for americans) diet experienced similar effects on cognitive performance . Performance on the color stroop task improved over time in all participants but there were no differences in performance between groups . There were no differences in performance over time or between groups on any other task (that is, the food stroop, cpt, word recall or wisconsin card sorting task).
|
Diabetes is a major public health concern in the united states because of its prevalence, considerable morbidity and mortality, and economic burden with total medical costs of 245 billion dollars in 2012 alone [1, 2]. In 2010, the prevalence rate of diabetes in the us was 9.3%, affecting older population (65 years or older) even more dramatically with the rate of 25.9% . Diabetes is associated with serious complications, including coronary heart disease, stroke, kidney failure, neuropathy, blindness, and amputation, and was the seventh leading cause of death in 2010 [1, 2]. Obesity is a major risk factor for t2d [2, 3], and the risk of diabetes increases directly with bmi [2, 4, 5]. According to national center for health statistics (nchs) more than one - third of us adults (34.9 percent) were obese in 2011 - 2012 . The medical care costs of obesity in the united states are staggering, totaling about $147 billion dollars in 2008 alone . Weight loss is important therapeutic goal in obese patients with t2d, because even moderate weight loss (5%) improves insulin sensitivity [2, 8]. Bariatric surgery is the most effective weight - loss therapy and has considerable beneficial effects on diabetes and other obesity - related comorbidities [2, 911]. Weight - loss surgery by laparoscopic sleeve gastrectomy (sg) leads to a 4065% reduction in excess weight and, amazingly, 56% of patients achieve resolution in their type 2 diabetes and 37% see improvement in their t2d symptoms . Laparoscopic gastric bypass (gb) is a more intense surgery that typically results in a 6070% loss of excess weight and is also characterized by improvement or resolution of diabetes [9, 12, 13]. The objective of this study was to provide insight into the mechanism by which gut / stomach rerouting leads to weight loss and the improvement or resolution of diabetes . In metabolomics, an individual's metabolic state is profiled by multiplexed measurement of many low - molecular - weight metabolites . Discrete groups of chemically related metabolites (e.g., amino acids) are quantified in a biological sample . In contrast, nontargeted analysis is a more qualitative approach that surveys as many different metabolites as possible . Using primarily targeted approaches, multiple studies have identified higher levels of branched - chain and aromatic amino acids in insulin - resistant, obese, and t2d individuals . More recent studies demonstrated that higher levels of these amino acids are predictive of progression to t2d as well as future insulin resistance and hyperglycemia [14, 1822]. Recently, gall and colleagues used nontargeted approach to identify plasma metabolites associated with development of insulin resistance and/or glucose intolerance . Two top - ranked metabolites were an organic acid, -hydroxybutyrate (-hb), and a lipid, 1-linoleoyl - glycerophosphocholine (l - gpc). Proposed fasting -hb and l - gpc levels as new biomarkers to help predict dysglycemia and t2d [14, 24]. This nontargeted global metabolomic profiling represents new tool that allows the comprehensive survey of metabolism and metabolic networks to gain insight into phenotype and identify biomarker candidates . So far this approach was used to find a way to predict the progression to t2d as well as future insulin resistance and impaired glucose tolerance by serum analysis of insulin - resistant, obese individuals who progressed to t2d . We took an opposite approach utilizing bariatric surgery tool as the most promising way to affect weight loss and to rectify t2d symptoms in morbidly obese patients . It is not known whether metabolic response is the same for all bariatric procedures, nor is it known whether there are any differences between nondiabetic and t2d patients . 15 patients represented three disease - surgery groups: nondiabetic (non - t2d) receiving sg and t2d receiving either sg or gb surgery (table 1). Blood samples were collected over the course of treatment for each patient at the following times: at baseline (bl) prior to dieting / surgery, 14 days after baseline with adherence to strict preoperation weight - loss liquid diet (preop diet), and 28 days after surgery recovery after bariatric surgery (postop). Blood samples were collected in serum separator tubes, allowed to stand at room temperature for 1520 minutes, centrifuged at 2500 rpm for 10 minutes at 4c, aliquoted, snap frozen in liquid nitrogen, and stored at 80c until analysis . (durham, nc), using two independent platforms: ultrahigh performance liquid chromatography / tandem mass spectrometry (uhplc - ms / ms) optimized for basic species or acidic species, and gas chromatography / mass spectrometry (gc / ms). General platform methods are described in details in online supplemental data section (see supplementary methods and materials available online at http://dx.doi.org/10.1155/2016/3467403). Following log transformation and imputation with minimum observed values for each compound, repeated measures 2-way anova with posttest contrasts was used to identify biochemicals that differed significantly between experimental groups and across study time points with statistical cut - offs for p value (p <0.05). Multiple comparisons were accounted for by estimating the false discovery rate using q - values of less than 5% (q <0.05). Genome - wide association studies have identified many t2d susceptibility genes [14, 26] but generally failed to improve risk prediction over that provided by routine clinical measures [14, 27]. Global nontargeted analysis performed in this study is the first study to provide the insight into mechanism by which bariatric surgery leads to weight loss and resolution or improvement of t2d . This approach might also be used to identify t2d biomarker candidates and find new, cost effective treatments that can replace surgery itself . Since metabolomic profiling generates a wealth of data that must be parsed to extract information, we chose statistical cut - offs at both the level of individual metabolites p values and the level of multiple testing across the 476 metabolites detected in the serum samples q - values . By narrowing in on metabolites meeting the conservative criteria of p <0.05 and an estimated false discovery rate of less than 5% (q <0.05), we were able to reduce the complexity of the dataset and observed a number of statistically significant changes that occurred in common in nondiabetic and t2d patients with sg or gb . Furthermore, we were able to identify concerted changes of related metabolites that pointed to areas of metabolism that were affected by standard preop diet as well as by bariatric surgery itself . A list of all 476 metabolites detected and heat map of the statistical comparisons across time and patient groups are presented in online supplemental tables a1 and a2 . Comparison of serum profiles at baseline, following a preop weight reduction diet, and after weight - loss surgery revealed several key metabolic differences as highlighted below . Fat mobilization and oxidation were the key signatures associated with preop diet . Prior to surgery, patients were subjected to 2-week clear liquid diet that promoted weight loss on the order of 35% of body weight . The preoperative liquid diet is a 14-day high protein, very low calorie diet (vlcd) designed to deplete glycogen and fat stores in the liver or shrink the liver which is lifted to access the stomach during surgery . This vlcd includes 800 kcal with 80 g protein and typically produces a 1020-pound weight loss . High protein drinks with less than 200 calories and at least 20 g protein are consumed 3 - 4x daily; no solid food is allowed on this diet . In addition, at least 64 ounces of sugar - free decaffeinated clear liquids a day are recommended along with a multivitamin and a calcium + vitamin d supplement . Medications, such as antihyperglycemics, are adjusted during this preoperative weight - loss phase to account for decreased calorie and carbohydrate intake . The study found that patients who follow a preoperative liquid diet effectively reduced visceral fat and achieve greater weight loss . Examination of preop metabolic profiles, serum samples taken immediately before surgery, showed a profound mobilization of fat as attested by statistically significant elevations of ketones, monoacylglycerols, oleate, and an acyl - carnitine (online supplemental table a3, figure 1). These are compounds associated with lipolysis and fatty acid oxidation which suggested that a major metabolic effect of the preop diet was to stimulate fat tissue triglyceride hydrolysis, transport of fatty acids to the liver, and subsequent liver fatty acid oxidation and ketogenesis to supply energy substrates for peripheral tissues . The elevation of the markers associated with lipolysis and ketone production was transient and, in most cases, returned to near baseline levels by day 28 postsurgery time point . These results suggest that 35% weight loss experienced by patients during preop diet is largely due to the consumption of adipose reserves for energy production . Another interesting observation is that preop diet led to a transient elevation of alpha - hydroxybutyrate (-hb) and its precursor alpha - ketobutyrate (online supplemental table a3, figure 1). -hb is a sensitive biomarker of insulin resistance [23, 24] which suggests that both nondiabetic and t2d patients experienced a temporary relative increase in insulin resistance during preop diet . Compounds that changed in a statistically significant manner after 28 days of recovery from bariatric surgery, relative to baseline, were more numerous and diverse than observed in response to the preoperation diet . 62 compounds in the postsurgery to baseline comparison represented p <0.05 and showed q <0.05 in at least one of the disease - surgery groups (online supplemental table a4). 28 compounds showed p and q - value cut - offs across all three disease - surgery groups at the 28-day postsurgery sample collection time point relative to baseline . 13 of the compounds that changed across all three groups had fold - change increases including 100-fold + increases for trans - urocanate, cis - urocanate, pyroglutamylvaline, and heme in most or all of the groups . The remaining fifteen compounds that changed across all three groups were reduced at the postsurgery time point compared to baseline . Levels of ascorbate and various tocopherols were substantially reduced with ascorbate showing a 12.5-fold or greater decrease in each of the groups (online supplemental table a4, figure 2). Difficulty in absorbing micronutrients, such as vitamin c, following bariatric surgery has been reported previously [29, 30] and appeared to be confirmed at a shorter follow - up time point in this study . Weight - loss surgery led to concerted changes in compounds related to sulfur - containing amino acid metabolism that were largely shared across the groups . Glutathione (gsh) is a tripeptide comprised of glutamate, cysteine, and glycine . These amino acids along with the recycling intermediates cys - gly and 5-oxoproline were increased in all groups following surgery (online supplemental table a4), suggesting a greater potential availability of substrates for gsh production . Oxidized forms of glutathione and cysteine, such as the mixed heterodimer cysteine - glutathione and glutathione homodimer gssg, were elevated following surgery (online supplemental table a4, figure 2) and could be a sign of increased oxidative stress following surgery . However, an alternate interpretation is that a greater availability of glutathione and sulfur - containing amino acids following weight - loss surgery led to the greater formation of these oxidized compounds . Pyruvate the terminal product of glucose metabolism via the glycolysis pathway dropped sharply after bariatric surgery (online supplemental table a4, figure 3), likely indicating its more efficient mitochondrial utilization . The reduction of pyruvate was matched by increases in fumarate, in all t2d patients, and malate perhaps indicating an inadequate supply of acetyl - coa, which is derived from pyruvate, relative to the level of tca cycle components . However, levels of the glycolytic intermediate 3-phosphoglycerate (3-pg) increased after surgery as did nonglycolytic products glycerol and serine potentially derived from 3-pg . In addition to changes in pyruvate production, glucose usage via the pentose phosphate pathway (ppp) was also shifted following bariatric surgery . The ppp is a key source of pentose sugars used for nucleotide synthesis as well as nadph which is used for reductive synthesis reactions and regeneration of reduced glutathione . Ppp intermediates and derivative pentose sugars, including ribulose-5-phosphate and xylulose-5-phosphate that are isobars that cannot be differentiated by our platform, and their nonphosphorylated products, such as xylulose, were significantly increased in all groups following surgery (online supplemental table a4, figure 3). Glucose carbons, via glucose-6-phosphate, may have been directed toward the pentose phosphate pathway in the face of the proposed decrease in glycolysis pathway activity . For example, at baseline, metformin was detected in 100% of the t2d sg patient samples, 60% of the t2d gb samples, and none of the nondiabetic sg samples . After bariatric surgery, metformin was only detected in 20% of the t2d sg and gb serum samples . Postsurgery serum glucose levels decreased relative to baseline but this change only reached statistical significance (p <0.05) in the t2d sg group (online supplemental table a4, figure 3). In total, the results suggest that bariatric surgery affected glucose metabolism through glycolytic and nonglycolytic pathways similarly for all three of the disease - surgery groups . Each of the patient groups experienced an increase in serum heme levels around 100-fold compared to their respective baseline levels following surgery (online supplemental table a4). A couple of interesting possibilities, such as a reduced level of heme breakdown by heme oxygenase (ho) or an increased level of synthesis by 5-aminolevulinate synthase (ala synthase), could explain these changes . The understanding of ho-1 function has evolved beyond a simple disposal of heme to include cytoprotective, anti - inflammatory, and antioxidant functions . For instance, endogenous carbon monoxide produced by ho-1 engages multiple signal transduction pathways to confer antiapoptotic and anti - inflammatory effects and biliverdin and bilirubin are potent antioxidants . Ho activation has been shown to have insulin sensitizing and anti - inflammation effects in t2d . So the increase in heme and biliverdin following surgery could represent an increase in heme oxidation by ho leading to greater antioxidant protection and insulin sensitivity . On the other hand, the greater availability of glycine, which shows a relative deficiency in t2d [23, 32], could also serve as the basis for greater heme production by ala synthase the rate - limiting enzyme of heme formation whose expression is repressed by glucose . On the other hand, biliverdin catabolism which can reflect red blood cell turnover and heme disposal was less evident following surgery as indicated by reductions in bilirubin zz and its ee photoisomer (online supplemental table a4). Together, these exciting results suggest that bariatric surgery may promote antioxidant defense and insulin sensitivity through both increased heme synthesis and ho activity or expression . Diabetes and obesity are chronic conditions associated with elevated oxidative / inflammatory activities with a continuum of tissue insults leading to more severe cardiometabolic and renal complications including myocardial infarction and end - stage - renal damage . A common denominator of these chronic conditions is the enhanced levels of cytokines like tumour necrosis factor - alpha (tnf-), interleukin (il-6), il-1beta, and resistin, which in turn activates the c - jun - n - terminal kinase (jnk) and nf-b, pathways, creating a vicious cycle that exacerbates insulin resistance, type-2 diabetes, and related complications . Emerging evidence indicates that heme oxygenase (ho) inducers are endowed with potent antidiabetic and insulin sensitizing effects besides their ability to suppress immune / inflammatory response . Importantly, the ho system abates inflammation through several mechanisms including the suppression of macrophage - infiltration and abrogation of oxidative / inflammatory transcription factors like nf-b, jnk, and activating protein-1 . Thus, ho system could be explored in the search for novel remedies against t2d and its complications . Proposed using fasting -hb and l - gpc levels as new biomarkers to help predict dysglycemia and t2d [14, 24]. Both were detected in this study but postsurgery results do not bear out an improvement in insulin resistance based on these markers . -hb is positively but l - gpc is negatively correlated with insulin resistance, so a postsurgery signature of improved insulin sensitivity would be expected to show a decrease of -hb and an increase of l - gpc . Our findings showed an opposite pattern: -hb was increased during the liquid weight - loss diet and then returned to near baseline levels after the surgery, while l - gpc levels showed significant postsurgery decrease across all three disease - surgery groups (online supplemental table a4, figure 1). There could be several reasons for this to occur, including the assumption that -hb will drop after bariatric surgery is incorrect, or the 28-day time point is too soon to register a change . For the t2d subjects, there is the potential that metformin therapy also altered the baseline levels of -hb and l - gpc . Large increases in histidine derivatives were possibly due to altered gut microbiome composition or increased liver histidine - ammonia lyase activity . Histidine and several catabolites, such as imidazole propionate and urocanate isomers, both trans- and cis - urocanate, were significantly elevated (p <0.05, q <0.00001, including 100-fold + increases for trans - urocanate and cis - urocanate) in all three groups (online supplemental table a4, figure 4). Histidine is classified as an essential amino acid but gut bacteria can synthesize it, perhaps using precursors supplied by the human host . These markers may be an indication of changes in gut microbiome as the direct participation of the rat intestinal flora in the degradation of urocanate to imidazole propionate has been demonstrated previously . Although the sample size was very small, these results suggested that histidine metabolites could also be important marker candidates to monitor metabolic changes associated with weight - loss surgery . Recently, ryan and colleagues found that vertical sleeve gastrectomy that led to weight loss and improvement of diabetes also resulted in changes in the gut bacteria . The researchers observed changes in several key bacterial groups that have been previously linked to the risk of t2d, and these changes were related to increase in circulating of bile acids that are known to bind to the nuclear receptor fxr . Interesting is the researches proposal that manipulating the gut bacteria might be another way to mimic the surgery . On the other hand, urocanate is also formed in the liver by histidine - ammonia lyase (hal) which converts histidine into urocanate and ammonia . Interestingly, hal gene expression in hepatocytes can be stimulated by glucagon, so it is also possible that the increase of urocanate following surgery reflects a change in circulating glucagon levels . Cis - urocanate has interesting immunosuppressive properties that are believed to help protect the skin during sun exposure and perhaps sites distal from the skin . Little is known about imidazole propionate but it is a reported constituent of urine and has been proposed as a marker of intestinal dysfunction . It may be useful to validate the ability of trans - urocanate, cis - urocanate, and imidazole propionate to serve as markers to monitor bariatric surgery in a larger independent cohort of patients and targeted quantitative assay . It will also be interesting to determine what, if any, utility such markers have for predicting long - term patient outcomes following surgery . Comparing the postsurgery to the preoperation diet time point revealed 18 compounds that met the p and q - value cut - off criteria across all three disease - surgery groups (online supplemental table a5). Thirteen were increased postsurgery samples relative to the samples collected at the preoperation diet time point and trans - urocanate, cis - urocanate, and pyroglutamylvaline displayed 100-fold or greater increases in nearly all of the groups . Ascorbate and 1-linolenoylglycerol showed the greatest reductions among the 5 compounds that decreased in postsurgery samples relative to preoperation diet samples following surgery, but these reductions could also reflect altered gut absorption of these vitamins in addition to their consumption via the quenching of reactive oxygen species . There were 29 additional compounds that represented p <0.05 in all groups but did not reach q <0.05 for all of the disease - surgery combinations . Histidine and several catabolites, such as imidazole propionate and urocanate isomers, were increased in t2d patients and the urocanate isomers were also likewise increased in nondiabetic patients after surgery (online supplemental tables a4 and a5). Again, these results suggest that histidine metabolites could be important markers to monitor metabolic changes associated with weight - loss surgery . Global metabolomic analysis was used to evaluate the changes occurring in nondiabetic and t2d patients experiencing either less extreme sleeve gastrectomy or a full gastric bypass . This study allowed gaining insights into the metabolic changes during both the preoperation weight - loss diet and early postsurgery recovery that accompany bariatric surgery . To identify metabolic changes that were conserved across nondiabetic and t2d patients and different bariatric surgery procedures sleeve gastrectomy (sg) versus gastric bypass (gb)the metabolomic data collected for each disease - surgery combination were filtered according to statistical cut - offs for p value (p <0.05) and to establish an estimated false discovery rate of less than 5% (q <0.05). It is important to point out that, despite age and sex difference, t2d status or bariatric surgery procedure, and coexistence of other associated diseases, all patients demonstrated striking similarity in major metabolome changes associated with preoperation weight - loss diet and bariatric surgery itself . The preoperation weight - loss diet was associated with a strong lipid metabolism signature related to triglyceride hydrolysis, fatty acid oxidation, and ketone formation . Glucose metabolism via glycolytic and nonglycolytic pathways appeared to share a similar response across all patients regardless of baseline t2d status or the bariatric surgery procedure . Glycolysis pathway appeared to be suppressed and perhaps led to an accumulation of the tca cycle components: malate and fumarate . Such increases might indicate a greater demand for pentose sugars and nadph and the redirection of glucose-6-phosphate away from glycolysis . Increased heme levels were a likely sign of improved antioxidant defense via the action of heme oxygenase and liver function through increased heme biosynthesis in the liver . The simultaneous postsurgery disappearance of vitamin c and surge in oxidative stress markers such as allantoin and cysteine - glutathione disulfide suggest that micronutrient status should be monitored and supported by nutritional supplementation . This initial study provided a broad understanding of how metabolism changed globally in morbidly obese subjects following weight - loss surgery . Future serum metabolomic profiling studies focusing on baseline and 28 days (or other) after surgery with a greater number of patients in each group might help to further resolve differences between diabetic and nondiabetic patients . Additionally, profiling of baseline and postsurgery fecal samples might provide a more focused manner to interrogate changes associated with gut and microbiome function . Finally, the significance of this study lays in the exploration of future treatments for obesity and t2d that can mimic bariatric surgery weight loss and improvement and resolution of t2d.
|
Pelvic inflammatory disease (pid) is a polymicrobial infection of the upper genital tract (ugt). The diagnosis is made clinically; no single test or study is sensitive or specific enough for a definitive diagnosis . Pid should be suspected in at - risk patients who present with pelvic or lower abdominal pain with no identified etiology and who have cervical motion, uterine, or adnexal tenderness . Chlamydia trachomatis is one of the commonly implicated bacterial microorganisms; however, other microorganisms may be involved . Most women can be treated successfully as outpatients with a single dose of a parenteral cephalosporin plus oral doxycycline, with or without oral metronidazole . Delay in treatment may lead to major sequelae, including chronic pelvic pain, ectopic pregnancy, and infertility . Hospitalization and parenteral treatment are recommended if the patient is a pregnant woman [1, 2]. The microorganisms that are implicated in pid are thought to spread in the following three ways: intra - abdominally, traveling from the cervix to the endometrium, through the salpinx, and into the peritoneal cavity (causing endometritis, salpingitis, tuboovarian abscess, or pelvic peritonitis);through the lymphatic systems, for example, infection of the parametrium from an intrauterine device (iud); through hematogenous routes, for example, with tuberculosis, although this is rare.the diagnosis of pid is based primarily on clinical evaluation . Because of the potential for significant consequences if treatment is delayed, physicians should treat patients on the basis of clinical judgment without waiting for confirmation from laboratory or imaging tests . Intra - abdominally, traveling from the cervix to the endometrium, through the salpinx, and into the peritoneal cavity (causing endometritis, salpingitis, tuboovarian abscess, or pelvic peritonitis); through the lymphatic systems, for example, infection of the parametrium from an intrauterine device (iud); through hematogenous routes, for example, with tuberculosis, although this is rare . The objective of this study is to analyze molecular factors that may help to make the diagnosis and prognosis of pid in the different stages of the disease . A systematic review was conducted using pubmed of the national center for biotechnology information (ncbi). The article search focused on covering all scientific publications of pid and related molecular factors published between 1996 and 2010 . Reference lists of pid publications were utilized to identify relevant literature and reviewed for completeness of already found publications . The study selection was done in two stages: during the first phase, all publications involving a component of pid and molecular factors were included . The study selection at this point was done using abstracts or full publications if the abstract did not give sufficient information . At the second phase, complete publications were reviewed and their suitability with respect to the research objective was assessed . The cellular paradigm of chlamydia pathogenesis states that the host response to chlamydiae is initiated and sustained by epithelial cells, which are the primary targets of chlamydial infections . They secrete chemokines that recruit inflammatory leukocytes to the site of infection and cytokines that induce and augment the cellular inflammatory response, and these mediators induce direct damage to the tissues . At the time of reinfection, host cell release of chemokines leads to recruitment of chlamydia - specific immune cells that rapidly amplify the response . The release of proteases, clotting factors, and tissue growth factors from infected host cells and infiltrating inflammatory cells leads to tissue damage and eventual scarring the cellular paradigm makes no distinction between damage induced by professional innate immune cells (neutrophils and monocytes) and adaptive lymphocyte populations but assumes that both cell populations contribute to the pathogenesis . Chronic chlamydial infections are common and would lead to ongoing release of mediators that promote continued influx of inflammatory cells, damage to host epithelium, scarring, and, ultimately, fibrosis and scarring . Because reinfection with chlamydiae occurs frequently, repeated inflammatory responses may lead to repeated insults to the tissues and may promote tissue scarring . Among the molecular factors reviewed is the chlamydia heat shock protein 60 (chsp60), which has been investigated as a potential antigen responsible for the induction of delayed type hypersensitivity - induced disease . Later studies conducted in a guinea pig model of trachoma revealed a protective role for vaccination with chsp60 . Although human studies have revealed elevated antibody counts to chsp60 in those with more severe disease [10, 11], this may simply reflect increased exposure to chlamydia through chronic or repeated infection . A recent large prospective study of women with pid did not reveal a correlation of increased antibody counts to chsp60 with worse outcome . In a prospective cohort study involving women at high risk of c. trachomatis infection, cohen et al . Found that at baseline and after adjustment for age and other potential confounding variables, production of interferon (ifn)- by peripheral - blood mononuclear cells (pbmcs) stimulated with chsp60 strongly correlated with protection against incident c. trachomatis infection . . Found that low pbmc ifn- and high interleukin (il)-10 responses to chsp60 were markers for increased risk of chlamydial infection and pid . In human immunodeficiency virus - seropositive women, a cd4 lymphocyte count of <400 cells / mm was determined to be an independent risk factor for c. trachomatis pid . Chlamydia - specific cd4 t1 helper cell (th1)-ifn--producing cells are key mediators of host defense; a goal for vaccine development should be to determine chlamydia antigens and adjuvants that induce a strong cd4 th1 memory response . A persistent chsp60 antibody response was correlated with having culture- or ligase chain reaction - positive oviduct samples after treatment, which suggests that antibody positivity is a useful marker of chronic infection . These data indicate that prolonged or repeated exposure to chlamydiae leads to increased risk for disease and increased detection of anti - chlamydial antibodies, rather than directly implicating antibody formation in the pathogenesis . Although high antibody responses to chsp60 have been correlated with increased susceptibility to chlamydial pid [10, 15], ifn- responses to this highly conserved protein have been correlated with protection among the same group of women . Researchers have begun to determine the cellular receptors involved in c. trachomatis - induced stimulation of cytokine release . Toll - like receptors (tlrs) act as pathogen - recognition receptors that enable cells to recognize conserved bacterial, viral, and fungal structural elements . In vitro, c. trachomatis infection of hek cells transfected with the adaptor molecule myd88 and the pathogen molecular pattern receptors tlr2 and tlr4/md-2 revealed that tlr2 was required for il-8 secretion and that the role of tlr4/md-2 was minimal . This was reproduced with chlamydial infection of immortalized human ectocervical epithelial cells . Confocal microscopy experiments revealed that both tlr2 and myd88 colocalize with the intracellular chlamydial inclusion, suggesting that tlr2 is actively engaged in signaling from this intracellular location . There is a protective role for tlr2 deficiency in genital tract infection sequelae due to c. trachomatis . Examination of human tissue samples for the various tlrs has revealed that the mrna for tlr2 is highly expressed in fallopian tubes and the cervix . Thus, tlr2 may be a primary pathogen - recognition receptor available in the lower genital tract and oviducts to drive the pathology - inducing inflammatory response to chlamydial infection . Whilst nucleic acid amplification tests can effectively diagnose uncomplicated lower genital tract (lgt) infections, they are not suitable for diagnosing ugt pathological sequelae . Several studies have demonstrated a correlation between antibody responses to chsp60 and pathologic sequelae in women [1921], including a significant association between the presence of antibodies to chsp60 and pid [10, 21, 22]. These data have led to the development of a commercial enzyme - linked immunosorbent assay (elisa) screening test based on chsp60 (medac, hamburg, germany). Studies evaluating the diagnostic potential of the medac chsp60 elisa test have demonstrated conflicting results, and thus the ability of the chsp60-based assay to distinguish various c. trachomatis disease stages may be limited [23, 24]. Have identified several chlamydial antigens that could be used to discriminate between uncomplicated lgt infection and ugt pathology due to c. trachomatis . Four amino acid bands allow physicians to distinguish between lgt infection and ugt pathology in affected women . Two possible candidates were identified for each of band a (ct147 and ct314), b (ct727 and ct396), and c (ct157 and ct423). Band a, reactive in 38% of c. trachomatis - infected samples, was identified as two possible candidate proteins: ct147 (conserved hypothetical protein: 162.1 kda) and ct314 (dna - directed rna polymerase beta chain: 154.9 kda). Only ct147 has previously been shown to elicit a humoral response as expected from the protein's localization to the inclusion membrane of the elementary body (eb). Ct314 functions as a transcriptional regulator and would not be expected to be presented to the host immune system at any stage during the chlamydial developmental cycle or infection process . The two candidate proteins for band b are ct727 (p - type atpase) and ct396 (hsp70). P - type atpases constitute a superfamily of cation transport enzymes that mediate transmembrane exchange of all biologically significant cations . In contrast, hsp70 is associated with outer membrane complexes of ebs and was originally thought to play a role in either attachment or entry of the eb into host cells [28, 29]. One of the candidate proteins for band c, ct157, contains two phospholipase d (pld) domains and is a member of the pld superfamily, which includes enzymes that have high catalytic activity and are involved in phospholipid metabolism . Plds, which are known to hydrolyze phospholipids to phosphatidic acid, may be essential for the formation of particular types of transport vesicles or be strongly involved in signal transduction . Ct423, the second protein candidate for band c, contains three functional domains (two cbs domains and one transporter - associated domain) that are implicated in intracellular targeting and trafficking as well as protein - protein interactions . Sensitivity and specificity of the identified antigens in various combinations showed the a or b or c format to be the most efficacious for diagnosing uncomplicated lgt infection . The addition of antigen d to the panel (a or b or c or d) was shown to increase the sensitivity to 79% . However, given the overall prevalence of antigen d in samples from c. trachomatis - infected patients, the diagnostic potential of antigen d for specifically identifying lgt infections is limited due to the high c. pneumoniae cross - reactivity demonstrated within ugt patients . Moreover, this suggests that antigen d could possibly be more useful as a marker of general chlamydial infections rather than of a particular stage of infection . A small study conducted by kuo et al . Showed that the chemokine receptor deletion mutation ccr5-32 correlated significantly with protection from tubal damage . Endocervical epithelial cells released il-1 after infection, and the induced proinflammatory cytokine cascade could be inhibited by specific anti - il-1 antibodies . The addition of an il-1 receptor antagonist to the cultures completely eliminated tissue destruction induced by infection, indicating a direct role for this cytokine in the pathogenesis . Other potentially important factors are matrix metalloproteinases (mmps), which are expressed by neutrophils and monocytes and are involved in proteolysis and resynthesis of extracellular matrix . Studies in humans also indicate a role for mmps and neutrophils in the pathogenesis of tissue damage . Fallopian tube epithelial cells infected in vitro with c. trachomatis produce mmp-2, and infected oviduct stromal cells produce mmp-9 . An interrelated protease mechanism involves two interesting markers, cathepsin b and cystatin c. cathepsin b belongs to the family of lysosomal cysteine proteases and is active in acidic environments . It has also been found to be secreted as an extracellular contributor to degrade extracellular matrix (ecm) molecules or as a regulator involved in cell death modulation [37, 38]. It has been shown that cathepsin b mediates hepatic inflammation and injury caused both by apoptosis and the production of proinflammatory chemokines . Previous studies have shown that cathepsin b plays a critical role in the tumor necrosis factor (tnf)--triggered apoptotic cascade and promotes cell death through participation in the extrinsic pathway in which caspase-8 causes the release of active cathepsin b from lysosomes; consequently, cathepsin b increases the cytosol - induced release of cytochrome c from mitochondria [40, 41]. In contrast, nagai and his colleagues found that cathepsin b could inhibit neuronal cell death that was induced by cystatin c . However, foghsgaard et al . Found that proteolytic enzyme families, for example, cathepsin b and cysteine proteases, regulate apoptosis and play opposite roles in malignancies by reducing tumor cells by means of their proapoptotic features and by enhancing tumor cells through their known facilitation of invasion . Cystatin c, an endogenous cysteine protease inhibitor, is a nonglycosylated low molecular weight (13 kda) secretory protein produced by nucleated cells . It has been found in a variety of human tissues but is mainly found in extracellular body fluid and serum [4345]. Clinically, a patient's altered cystatin c level in bodily fluid or serum is monitored or used to predict the progression of diseases [4750]. A high concentration of cystatin c has been reported in patients with hepatic disease, and it has therefore been suggested that cystatin c could be used as a marker for monitoring liver functions and the progression of liver fibrosis . Cystatin c is also used as a predictor for the reduction in kidney function, which may be associated with increased inflammation or adverse pathophysiological consequences [51, 52]. Tsai et al . Have found a significantly increased expression of cathepsin b but a decreased expression of cystatin c as well as an imbalance in the equilibrium between cathepsin b and cystatin c in patients with pid . Thus, significantly low levels of cystatin c and significantly high levels of cathepsin b in the serum of patients with pid before they received treatment were found . In addition, the ratio of the cathepsin b level to the cystatin c level in the serum of patients with pid increased significantly before the patients received treatment compared with after they had received treatment according to the protocol suggested by the centers for disease control and when compared with healthy controls . Although this regulatory mechanism needs further investigation, it has been suggested that the detection of serum levels of cathepsin b and cystatin c, as well as the serum ratio of cathepsin b to cystatin c, can provide useful clinical information for pid . From the bacterial point of view, nine surface - exposed c. trachomatis polymorphic membrane proteins (pmps) are encoded via a multigene family yielding pmpa to pmpi . Pmps represent 13.6% of the coding capacity of the c. trachomatis genome, suggesting that they have a critical role in biology and virulence [55, 56]. These findings imply either a role for these specific pmps in inflammation or simply that women with pid have sustained and increased exposure due to repeated or chronic infection . Have suggested that pmpa plays a role in the pathology of ugt, although these data were nonsignificant . In addition, pmpd may stimulate host cell inflammatory responses, and it is possible that an increased antibody titer to pmpd reflects increased exposure to these potentially pathogenic ligands . In the study by taylor et al ., increased inflammation and reproductive sequelae were found among women with high antibody titers to pmpd . Overall, expression of the pmpd antibody appeared to have minimal effects on inflammation and reproductive sequelae in this study . In addition, the authors found that women with antibody reactivity to pmpi were more likely to have ugt infection (ugti). Endometritis was also more frequent in this group, although these results were nonsignificant (table 1). Several molecular factors have been investigated in the past years for their application in the early detection and identification of chronic pid caused by c. trachomatis infection . Although there is already a diagnostic method (medac chsp60 elisa test), its utility is limited, and there is no other commercial method known to date . The other discussed host molecular factors are thought to be of interest as new potential markers in the diagnosis at different stages of the disease; however, further investigation and clinical trials will have to be carried out . Membrane proteins in c. trachomatis, which are known to be related to inflammation and chronic pid, may be candidates for commercial antibody development for avoiding harmful infections.
|
It is the most common endemic mycosis in the united states.1 it is most prevalent around the valleys of the mississippi and ohio rivers.2 in endemic areas, 50%80% of people have evidence of previous exposure to histoplasma.3 the fungus grows as a mold in the soil and when its microconidia are inhaled, causes infection and grows as a yeast in the host tissues . Most infected people remain asymptomatic or complain of a self - limiting flu - like illness . Up to 25% of people infected with human immunodeficiency virus will develop disseminated histoplasmosis, with considerable morbidity and mortality.3 infection outside endemic areas and atypical presentations represent a diagnostic challenge . We present a case of progressive disseminated histoplasmosis manifesting as a wasting syndrome with hypercalcemia, mimicking a metastatic cancer . A 65-year - old, type 2 diabetic man presented with a 2-month history of constipation, polyuria, and unexplained weight loss of 54 lb . He had lived in west pennsylvania until 13 years earlier, when he had moved to the texas panhandle area where he presented with the above complaints . On physical examination, laboratory test results revealed a hemoglobin of 10.6 (normal range 1216) g / dl and a white blood cell count of 3.5 10 cells / l (normal range 4.010.6 10 cells / l). Biochemistry tests showed a creatinine of 3.2 (normal range 0.51.4) mg / dl, serum calcium of 12.4 (normal range 8.410.3) mg / dl, and albumin of 3.5 (normal range 3.75.1) g / dl . The patient s parathyroid hormone level was low at 6 (normal range 11.054.0) pg / ml and serum protein electrophoresis showed a normal pattern . Body computed tomography showed bilateral adrenal enlargement and a mass lesion at the base of the tongue (figure 1). Magnetic resonance imaging of the brain showed three left - sided brain lesions (figure 2). Biopsies of the tongue lesion and the left adrenal gland showed necrotizing granulomas containing budding yeast forms, consistent with histoplasmosis (figures 35). Histoplasmosis is rarely diagnosed in the texas panhandle area and we were unable to tell whether his presentation represented a reactivation of an old infection or progression of a newly acquired infection . After adequate intravenous hydration, the patient s kidney function tests and serum calcium level reverted to normal . The patient received a 4-week course of liposomal amphotericin b and was subsequently started on itraconazole . Dissemination of h. capsulatum is common in the early stages of this fungal infection.1 symptomatic acute dissemination develops in immunocompromised patients.2 they present with a febrile illness that can be complicated by severe sepsis, acute respiratory distress syndrome, and disseminated intravascular coagulopathy . On the other hand, chronic progressive disseminated histoplasmosis is typically reported in middle - aged and elderly men who are not immunosuppressed.3 they present with a wasting syndrome, long - standing fever, and night sweats . The infection may involve multiple organ systems, including the gastrointestinal tract (with resulting ulceration), adrenal glands (precipitating adrenal insufficiency), the reticuloendothelial system (causing hepatosplenomegaly), bone marrow (leading to pancytopenia), the central nervous system, and the lungs . On rare occasions, progressive disseminated histoplasmosis has been associated with hypercalcemia, and this is attributed to increased 1, 25 dihydroxyvitamin d production from the fungal granulomas.410 a medline search (january, 1946 to november, 2012) identified seven reported cases of disseminated histoplasmosis presenting with hypercalcemia . The clinical presentation, risk factors that predisposed to histoplasmosis, and patient outcomes are reported (table 1). Upon reviewing the cases and in comparison with the case at hand, the following features were noted . Like our patient, most patients were middle - aged and elderly men with a limited degree of immunosuppression . Presenting symptoms varied, with pulmonary complaints in two cases, gastrointestinal symptoms in two, wasting syndrome in three, including ours, and musculoskeletal complaints in another . Hypercalcemia was symptomatic in some cases and an asymptomatic laboratory abnormality in others . In all cases, the diagnosis was difficult to make, and in three cases was established post mortem . Two of the three patients who died, ie, the first and second cases, did not receive antifungal therapy, and treatment was delayed in the third patient who died, ie, the fourth case . Diagnosis of histoplasmosis relies on a multifaceted approach.11 histopathological examination, cultures, antigen and antibody detection, and molecular methods are commonly used in different combinations to establish the diagnosis . A recent multicenter study evaluated the above - mentioned tests in the diagnosis of disseminated histoplasmosis and reported their corresponding sensitivities, ie, 74% for cultures, 76% for histopathology, 92% for antigen detection in urine and/or serum using a third - generation enzyme immunoassay, and 75% for antibody detection combining immunodiffusion and complement fixation assays.11 use of molecular methods in the diagnosis of histoplasmosis has been reported, but remains uncertain and is awaiting further study.12 the high sensitivity of antigen detection is plagued by significant cross - reactivity with other fungal antigens . Cross - reaction occurs in 90% of patients with blastomycosis and in 60% of patients with coccidioidomycosis.13 testing both urine and serum yields better sensitivity . Furthermore, testing cerebrospinal fluid and bronchoalveolar lavage fluid might improve sensitivity in diagnosing central nervous system and pulmonary infections.14 it is worth mentioning that failure to detect histoplasma antigens does not rule out the diagnosis, and repeating the test in patients with progressive illness should be considered.3 severity of illness dictates antifungal treatment options and duration of therapy . For moderate to severe infection, liposomal amphotericin b for 12 weeks followed by a 12-month course of itraconazole is recommended.15 for milder cases, itraconazole for one year is indicated . For histoplasmosis of the central nervous system, liposomal amphotericin b for 46 weeks followed by itraconazole for at least one year and until cerebrospinal fluid abnormalities and antigenemia or antigenuria resolve is recommended.15 antigen levels in serum or urine should be measured during therapy for progressive disseminated histoplasmosis and central nervous system infection, and for 12 months afterwards . Ten percent to 15% of patients experience a relapse.16 diagnosis and treatment in this group of patients follows the above outlined principles, but also includes long - term itraconazole maintenance therapy . Our work has some limitations, not the least of which is the fact that it is a single case report . Furthermore, the diagnosis was based on a compatible clinical presentation and histopathological examination that could not be confirmed by culture, serology, or antigen detection . Further research is needed to develop readily available tests, probably molecular diagnostic methods, with higher sensitivity and specificity to diagnosis histoplasmosis as well as other mycosis . Acute disseminated infection presents with a sepsis syndrome, whereas chronic dissemination presents as a wasting syndrome . We reported here a case of chronic disseminated histoplasmosis presenting with multiple mass lesions, weight loss, and hypercalcemia, mimicking metastatic cancer . In addition to malignancy, granulomatous disease, including fungal infection, should be considered in patients with similar presentation.
|
The human epidermal growth factor receptor 2 gene (her2) encodes a 185-kd transmembrane glycoprotein receptor (p185her2) and is amplified in 25%-30% of human breast . Patients with her2 overexpression exhibit shorter disease - free survival (dfs) and overall survival (os). Trastuzumab (herceptin; f. hoffmann - la roche ltd, basel, switzerland) is a humanized murine monoclonal antibody that binds specifically to the extracellular domain of the her2 protein . The survival benefit from trastuzumab has beenwell established in numerous clinical trials of patients with early and metastatic breast cancer who had overexpression of her2 . The use of trastuzumab either in monotherapy or combination with chemotherapy and endocrine therapy all resulted in survival benefit . Trastuzumab is most frequently combined with chemotherapy agents including paclitaxel, docetaxel, vinorelbine, gemcitabine and carboplatin, and also provides a survival advantage to women who have been previously treated with chemotherapy for metastatic disease . Furthermore, efficacy has been observed following continuation of trastuzumab after trastuzumab progression according to data from a phase randomized study [german breast group (gbg)-26]. In china, the first clinical trial using trastuzumab in metastatic breast cancer was a phase trial published in 2003 . However, while the trastuzumab in combination with chemotherapy has been a standard regimen for over ten years, and its usage was limited by its high cost . However, more widespread use resulted from a public welfare project for trastuzumab was managed by the china cancer foundation in august 2011 . Thus, in the past 2 or 3 years there has been no large - scale study of trastuzumab in advanced breast cancer in china . In this observational study, the majority of data were collected over the past two years (72/90 patients; 80.0%). Since pertuzumab and t - dm1 have not been approved in china, trastuzumab and lapatinib remain the only available anti - her2 targeted therapies for chinese patients . In this article, we evaluated the outcome of patients with advanced breast cancer who received trastuzumab treatment in routine clinical practice . This observational study focused on the efficacy and safety of trastuzumab combined with chemotherapy for first - line treatment and beyond progression upon trastuzumab treatment of her2-overexpressing advanced breast cancer . Women with advanced (either metastatic or locally advanced) measurable disease and her2-overexpressing breast cancer who had at least one dose of trastuzumab were eligible for this study . Her2-positivity was defined as 3(+) staining in immunohistochemistry (ihc) or amplification of fluorescence in situ hybridization (fish, ratio 2.0) if the ihc staining score was 2(+), a life expectancy 3 months and performance status [on the eastern cooperative oncology group (ecog) scale] 2 . In addition, a cardiac evaluation with echocardiography had to show an ejection fraction value 50% at baseline . Patients were excluded if they had clinically significant cardiac disease, infection, bleeding disorder, abnormal pulmonary function, or other significant medical conditions . The study was approved by the ethics committee of beijing cancer hospital (beijing, china) and informed consent was obtained from all patients before starting treatment . The study observed 90 patients with her2-overexpressing advanced breast cancer from january 2006 to september 2014, and there were 72/90 (80.0%) cases from september 2012 to september 2014 . Nine of 90 (10.0%) patients were initially diagnosed with advanced breast cancer, and the rest 81 (90.0%) experienced metastatic diseases after breast cancer surgery, wherein 23/81 (28.4%) patients underwent re - biopsy at a metastatic tumor site . Patients were aged between 31 - 73 years (median, 51 years) at diagnosis . Patients who had received either first - line trastuzumab combined with chemotherapy or trastuzumab treatment beyond progression were enrolled . Trastuzumab was given 4 mg / kg (in 82 patients) or 8 mg / kg (in 8 patients) loading dose, followed by 2 mg / kg weekly or by 6 mg / kg per 3 weeks respectively . The chemotherapy regimen was administered according to normal clinical practice and advanced breast cancer guidelines, and trastuzumab was continued after first - line trastuzumab progression unless the patients refuse treatment for cost, side effects or other factors, in which case chemotherapy agents were changed from first - line chemotherapy agents . History, physical examination, ecog status, blood cell count and serum chemistry were assessed at baseline and repeated before each cycle . A left ventricular ejection fraction (lvef) measurement was performed at baseline by echocardiography and reassessed every three months . Tumor measurement was performed by computed tomography (ct) scan or magnetic resonance imaging (mri), and was repeated every two cycles of treatment (by 2 months), upon which pathology was reviewed, especially for patients who were not initially treated in the department of breast oncology, peking university cancer hospital . The secondary end points included os, objective response rate (orr), and adverse events (aes). The tumor response rate was evaluated using the response evaluation criteria in solid tumors criteria version 1.1 . Pfs and os were calculated as the time from the first trastuzumab administration to progression and death at the last valid observation point . Aes were graded according to the national cancer institute common terminology criteria for adverse events version 3.0 (ctcae 3.0). The pfs and os at specific time points were estimated using spss software (version 19.1; spss inc ., the pfs was calculated as time from the date of treatment to the first recurrence of disease at local, regional, or distant site or death . The kaplan - meier method and the log - rank test were used to analyze potential prognostic factors . The cox proportional hazards regression model was used for the analyses taking into account all variables simultaneously . Women with advanced (either metastatic or locally advanced) measurable disease and her2-overexpressing breast cancer who had at least one dose of trastuzumab were eligible for this study . Her2-positivity was defined as 3(+) staining in immunohistochemistry (ihc) or amplification of fluorescence in situ hybridization (fish, ratio 2.0) if the ihc staining score was 2(+), a life expectancy 3 months and performance status [on the eastern cooperative oncology group (ecog) scale] 2 . In addition, a cardiac evaluation with echocardiography had to show an ejection fraction value 50% at baseline . Patients were excluded if they had clinically significant cardiac disease, infection, bleeding disorder, abnormal pulmonary function, or other significant medical conditions . The study was approved by the ethics committee of beijing cancer hospital (beijing, china) and informed consent was obtained from all patients before starting treatment . The study observed 90 patients with her2-overexpressing advanced breast cancer from january 2006 to september 2014, and there were 72/90 (80.0%) cases from september 2012 to september 2014 . Nine of 90 (10.0%) patients were initially diagnosed with advanced breast cancer, and the rest 81 (90.0%) experienced metastatic diseases after breast cancer surgery, wherein 23/81 (28.4%) patients underwent re - biopsy at a metastatic tumor site . Patients were aged between 31 - 73 years (median, 51 years) at diagnosis . Patients who had received either first - line trastuzumab combined with chemotherapy or trastuzumab treatment beyond progression were enrolled . Trastuzumab was given 4 mg / kg (in 82 patients) or 8 mg / kg (in 8 patients) loading dose, followed by 2 mg / kg weekly or by 6 mg / kg per 3 weeks respectively . The chemotherapy regimen was administered according to normal clinical practice and advanced breast cancer guidelines, and trastuzumab was continued after first - line trastuzumab progression unless the patients refuse treatment for cost, side effects or other factors, in which case chemotherapy agents were changed from first - line chemotherapy agents . History, physical examination, ecog status, blood cell count and serum chemistry were assessed at baseline and repeated before each cycle . A left ventricular ejection fraction (lvef) measurement was performed at baseline by echocardiography and reassessed every three months . Tumor measurement was performed by computed tomography (ct) scan or magnetic resonance imaging (mri), and was repeated every two cycles of treatment (by 2 months), upon which pathology was reviewed, especially for patients who were not initially treated in the department of breast oncology, peking university cancer hospital . The secondary end points included os, objective response rate (orr), and adverse events (aes). The tumor response rate was evaluated using the response evaluation criteria in solid tumors criteria version 1.1 . Pfs and os were calculated as the time from the first trastuzumab administration to progression and death at the last valid observation point . Aes were graded according to the national cancer institute common terminology criteria for adverse events version 3.0 (ctcae 3.0). The pfs and os at specific time points were estimated using spss software (version 19.1; spss inc ., the pfs was calculated as time from the date of treatment to the first recurrence of disease at local, regional, or distant site or death . The kaplan - meier method and the log - rank test were used to analyze potential prognostic factors . The cox proportional hazards regression model was used for the analyses taking into account all variables simultaneously . All 90 patients received at least one dose of trastuzumab, but 5 patients only received one dose of trastuzumab for observing safety profile only . The duration of follow - up was from january 2006 to september 2014, and the median followup duration was 50 months (range, 8 - 352 months). This cohort had more aggressive disease and only 9 patients received trastuzumab in an adjuvant setting . In total, 37.78% of cases were hormone receptor negative, 59.26% had lymph node metastasis at initial diagnosis after surgery, and 9 patients had initial advanced disease with multiple site metastasis . Twenty - nine (32.22%) patients were diagnosed with lung metastasis and 56 (62.22%) with liver metastasis, while 80.00% had invasive metastasis (both lung and liver involvement), and 3 or more metastatic sites were evident in 35.56% of patients . Furthermore, 65.43% (53/81) of patients experienced a relapse within 3 years, and 77 (85.56%) patients had already undergone adjuvant chemotherapy with anthracycline and/or taxane . At the time of trastuzumab treatment, 43 (47.78%) patients had progressed after one or more extensive prior palliative chemotherapy regimens for a metastatic setting, 4 had initial advanced disease; 20 as second - line, 15 as third - line, and 8 for beyond third - line treatment . The first - line or subsequent lines of trastuzumab was used as the initial anti - her2 therapeutic agent in different patient settings . There were 47 patients received trastuzumab as first - line therapy, after progression from first - line trastuzumab treatment, the number of patients who continued trastuzumab treatment as second - line, thirdline and beyond therapy were 34,14, and 6, respectively . In total, there were 920 treatment cycles in this group of patients, the median number was 8 cycles (range, 2 - 70 cycles), and 49 (54.4%) patients received trastuzumab for more than 8 cycles . For second - line treatment, only 3 patients were treated longer for more than 1 year, with 15,18, and 18 cycles, respectively . For third - line treatment, only 3 of 14 patients were treated with more than 5 cycles (2 patients underwent 5 cycles and 1 patient underwent 8 cycles), while for fourth - line treatment and beyond the median number of cycles, it was very low at 3 cycles (range, 2 - 5 cycles). For chemotherapy agents, at first - line treatment, 56 patients received paclitaxel / docetaxel, paclitaxel was given 175 mg / m in the first day (d 1), or 175 mg / m divided in d 1 and the eighth day (d 8), every 3 weeks (q3w), and docetaxel was given 75 mg/ m, d 1, q3w; 19 patients received vinorelbine (30 mg / m, d 1and d 8, q3w); 11 received gemcitabine (1,000 mg / m, d 1 and d 8, q3w); and 27 patients received capecitabine [1,000 mg/ m, d 1-d 14, twice per day (bid)]. The most frequently used combination regimens were taxane plus platinum in 12 patients, paclitaxel / docetaxel plus capecitabine (tx) in 9 patients, paclitaxel / docetaxel plus gemcitabine (tg) in 5 patients, and vinorelbine plus capecitabine (nx) in 7 patients . In the secondline and third - line setting, chemotherapy agents were different from first - line agents . We also analyzed 44 patients treated with single agent chemotherapy and compared with 41 patients treated with combination chemotherapy . A total of 85 patients could be evaluated for efficacy of first - line trastuzumab in advanced disease, resulting in a median pfs of 10 months (range, 2 - 59 months), a median os from the date of trastuzumab treatment to the date of death from any cause of 16 months (range, 2 - 70 months), and a median os after metastasis or initially local advanced disease of 22 months (range, 2 - 116 months). The median os from initially diagnoses was 50 months (range, 8 - 352 months) (table 2). Pfs and os of first - line trastuzumab treatment (n=85) complete response (cr) in first - line trastuzumab treatment was achieved in 5/85 (5.9%) patients, and partial response (pr) in 37/85 (43.5%), while 28/85 (32.9%) experienced stable disease (sd). Response of trastuzumab in different lines (n=85) the impact of several prognostic characteristics on orr and pfs was analyzed, focusing on the subgroups of patients continuing trastuzumab treatment after first - line trastuzumab therapy, or those who received trastuzumab in different disease conditions, and/or those who were administered trastuzumab in parallel with a single or combination chemotherapy agent . The efficacy for continuing trastuzumab treatment after disease progression and trastuzumab in different disease statuses really influenced the results . Patients who progressed after their initial trastuzumab treatment continued to receive trastuzumab, and their response rates are shown in table 3 . Among 34,14 and 6 patients who continued using trastuzumab in the second - line, third - line and beyond fourth - line settings, respectively, 1 achieved cr, 10 achieved pr in the second - line, and 2 achieved pr in the third - line . While no orr was obtained after this point, longer therapeutic cycles were employed in the early lines of trastuzumab treatment (table 3), with concomitant longer pfs . Patients with different therapeutic cycles (> 6 cycles vs. 6 cycles) showed statistically different pfs (p = 0.007; figure 1). Progression - free survival (pfs) of different cycles of first - line trastuzumab treatment (p=0.007). There were 47/85 (55.3%) patients treated with trastuzumab in the first relapse disease . The orr (cr+pr) for disease was 57.4%, with a cr of 10.6% (5/47) and a pr of 46.8% (22/47). The trastuzumab treatment achieved high responses in patients without previous chemotherapy for advanced disease, and better pfs was obtained compared with later disease treatment (p=0.004; figure 2). Progression - free survival (pfs) of first - line trastuzumab treatment initiated at different disease lines (p=0.004). No major prognostic impact was detected for hormone receptor status or age, or for other factors that may influence efficacy such as the site of metastasis or the number of metastatic sites . Because in this cohort, 80.00% of patients had liver and lung metastasis, and 64.44% had more than two sitesof metastasis . Different chemotherapy agents were not analyzed in this study, because 62.22% of patients underwent taxanebased chemotherapy, and thus, this population subgroup was imbalanced . Regarding the chemotherapy regimen, the pfs of patients undergoing single agent chemotherapy was not statistically different compared with those receiving combination chemotherapy treatment (p=0.305; figure 3). Progression - free survival (pfs) of first - line trastuzumab treatment, single / sequential single agent vs. multiple agents (p=0.305). A safety analysis was performed in all 90 patients who received at least one dose of trastuzumab, however, most patients were treated with chemotherapy simultaneously so chemotherapyrelated side effects such as hemotological effects are not presented here . Nine patients ceased treatment because of the following side effects: angina pectoris in 3 patients (1 of whom stopped treatment immediately), liver failure (multiple liver metastasis) in 1, lung injury in 2, serum creatinine increase in 1, thrombus in 1, and finger necrosis in 1 . Furthermore, 8 patients refused further treatment because of high costs, and 15 were diagnosed with brain metastases during the treatment period . The other most common treatment - related adverse events were chill in 11 (12.2%) patients, and fever in 15 (16.6%). Most treatment - related adverse events were mild to moderate, except in 5 patients who stopped treatment immediately, and most occurred during the first drug infusion . All 90 patients received at least one dose of trastuzumab, but 5 patients only received one dose of trastuzumab for observing safety profile only . The duration of follow - up was from january 2006 to september 2014, and the median followup duration was 50 months (range, 8 - 352 months). This cohort had more aggressive disease and only 9 patients received trastuzumab in an adjuvant setting . In total, 37.78% of cases were hormone receptor negative, 59.26% had lymph node metastasis at initial diagnosis after surgery, and 9 patients had initial advanced disease with multiple site metastasis . Twenty - nine (32.22%) patients were diagnosed with lung metastasis and 56 (62.22%) with liver metastasis, while 80.00% had invasive metastasis (both lung and liver involvement), and 3 or more metastatic sites were evident in 35.56% of patients . Furthermore, 65.43% (53/81) of patients experienced a relapse within 3 years, and 77 (85.56%) patients had already undergone adjuvant chemotherapy with anthracycline and/or taxane . At the time of trastuzumab treatment, 43 (47.78%) patients had progressed after one or more extensive prior palliative chemotherapy regimens for a metastatic setting, 4 had initial advanced disease; 20 as second - line, 15 as third - line, and 8 for beyond third - line treatment . The first - line or subsequent lines of trastuzumab was used as the initial anti - her2 therapeutic agent in different patient settings . There were 47 patients received trastuzumab as first - line therapy, after progression from first - line trastuzumab treatment, the number of patients who continued trastuzumab treatment as second - line, thirdline and beyond therapy were 34,14, and 6, respectively . In total, there were 920 treatment cycles in this group of patients, the median number was 8 cycles (range, 2 - 70 cycles), and 49 (54.4%) patients received trastuzumab for more than 8 cycles . For second - line treatment, only 3 patients were treated longer for more than 1 year, with 15,18, and 18 cycles, respectively . For third - line treatment, only 3 of 14 patients were treated with more than 5 cycles (2 patients underwent 5 cycles and 1 patient underwent 8 cycles), while for fourth - line treatment and beyond the median number of cycles, it was very low at 3 cycles (range, 2 - 5 cycles). For chemotherapy agents, at first - line treatment, 56 patients received paclitaxel / docetaxel, paclitaxel was given 175 mg / m in the first day (d 1), or 175 mg / m divided in d 1 and the eighth day (d 8), every 3 weeks (q3w), and docetaxel was given 75 mg/ m, d 1, q3w; 19 patients received vinorelbine (30 mg / m, d 1and d 8, q3w); 11 received gemcitabine (1,000 mg / m, d 1 and d 8, q3w); and 27 patients received capecitabine [1,000 mg/ m, d 1-d 14, twice per day (bid)]. The most frequently used combination regimens were taxane plus platinum in 12 patients, paclitaxel / docetaxel plus capecitabine (tx) in 9 patients, paclitaxel / docetaxel plus gemcitabine (tg) in 5 patients, and vinorelbine plus capecitabine (nx) in 7 patients . In the secondline and third - line we also analyzed 44 patients treated with single agent chemotherapy and compared with 41 patients treated with combination chemotherapy . A total of 85 patients could be evaluated for efficacy of first - line trastuzumab in advanced disease, resulting in a median pfs of 10 months (range, 2 - 59 months), a median os from the date of trastuzumab treatment to the date of death from any cause of 16 months (range, 2 - 70 months), and a median os after metastasis or initially local advanced disease of 22 months (range, 2 - 116 months). The median os from initially diagnoses was 50 months (range, 8 - 352 months) (table 2). Pfs and os of first - line trastuzumab treatment (n=85) complete response (cr) in first - line trastuzumab treatment was achieved in 5/85 (5.9%) patients, and partial response (pr) in 37/85 (43.5%), while 28/85 (32.9%) experienced stable disease (sd). The impact of several prognostic characteristics on orr and pfs was analyzed, focusing on the subgroups of patients continuing trastuzumab treatment after first - line trastuzumab therapy, or those who received trastuzumab in different disease conditions, and/or those who were administered trastuzumab in parallel with a single or combination chemotherapy agent . The efficacy for continuing trastuzumab treatment after disease progression and trastuzumab in different disease statuses really influenced the results . Patients who progressed after their initial trastuzumab treatment continued to receive trastuzumab, and their response rates are shown in table 3 . Among 34,14 and 6 patients who continued using trastuzumab in the second - line, third - line and beyond fourth - line settings, respectively, 1 achieved cr, 10 achieved pr in the second - line, and 2 achieved pr in the third - line . While no orr was obtained after this point, longer therapeutic cycles were employed in the early lines of trastuzumab treatment (table 3), with concomitant longer pfs . Patients with different therapeutic cycles (> 6 cycles vs. 6 cycles) showed statistically different pfs (p = 0.007; figure 1). Progression - free survival (pfs) of different cycles of first - line trastuzumab treatment (p=0.007). There were 47/85 (55.3%) patients treated with trastuzumab in the first relapse disease . The orr (cr+pr) for disease was 57.4%, with a cr of 10.6% (5/47) and a pr of 46.8% (22/47). The trastuzumab treatment achieved high responses in patients without previous chemotherapy for advanced disease, and better pfs was obtained compared with later disease treatment (p=0.004; figure 2). Progression - free survival (pfs) of first - line trastuzumab treatment initiated at different disease lines (p=0.004). No major prognostic impact was detected for hormone receptor status or age, or for other factors that may influence efficacy such as the site of metastasis or the number of metastatic sites . Because in this cohort, 80.00% of patients had liver and lung metastasis, and 64.44% had more than two sitesof metastasis . Different chemotherapy agents were not analyzed in this study, because 62.22% of patients underwent taxanebased chemotherapy, and thus, this population subgroup was imbalanced . Regarding the chemotherapy regimen, the pfs of patients undergoing single agent chemotherapy was not statistically different compared with those receiving combination chemotherapy treatment (p=0.305; figure 3). Progression - free survival (pfs) of first - line trastuzumab treatment, single / sequential single agent vs. multiple agents (p=0.305). A safety analysis was performed in all 90 patients who received at least one dose of trastuzumab, however, most patients were treated with chemotherapy simultaneously so chemotherapyrelated side effects such as hemotological effects are not presented here . Nine patients ceased treatment because of the following side effects: angina pectoris in 3 patients (1 of whom stopped treatment immediately), liver failure (multiple liver metastasis) in 1, lung injury in 2, serum creatinine increase in 1, thrombus in 1, and finger necrosis in 1 . Furthermore, 8 patients refused further treatment because of high costs, and 15 were diagnosed with brain metastases during the treatment period . The other most common treatment - related adverse events were chill in 11 (12.2%) patients, and fever in 15 (16.6%). Most treatment - related adverse events were mild to moderate, except in 5 patients who stopped treatment immediately, and most occurred during the first drug infusion . However, the most widely - used treatment for advanced breast cancer in china is trastuzumab as a result of a public welfare project in 2011 . Thus, there remains the need to find new combinations or new schedules to prolong clinical benefit and survival of this subset of patients . In this observational study, we evaluated the use of trastuzumab in advanced her2-positive breast cancer, and our data represent important information on the application, efficacy, and safety of trastuzumab in clinical practice . Our study found that high response rate was more frequently attained in earlier therapy, like disease in the firstline cr achieved in 5/85 (5.8%) patients, but only one cr in the second - line setting . Besides, in this cohort, there was a high proportion of patients with aggressive diseases coupled with liver and lung metastasis, more multiple sites of metastasis and more previous rounds of chemotherapy for advanced disease, but we still can see the response and prolonged patients survival . Therefore, patients can be treated in some aggressive situations . In a report from france, of 1,234 patients with metastatic breast cancer treated with chemotherapy between 2001 and 2010,217, 38% had liver metastases at first occurrence of advanced breast cancer, and the median os was 45.2 months . Another phase trial (m77001) of first - line trastuzumab with docetaxel demonstrated an orr of 61% [95% confidence interval (95% ci),50%-71%],6 crs (7%) and 50 prs (54%), with stable disease observed in 27% . This result also indicated that trastuzumab had a high response as a first - line treatment . The patients who continued trastuzumab beyond disease progression achieved modest responses, as observed in an original pivotal trial (also an extension study), in which 247 patients were enrolled and the orr was 11% . Additionally, our data also showed that patients receiving two or more trastuzumab - containing regimens survived significantly longer than those who discontinued trastuzumab in disease progression . Here we presented a pfs that was significantly longer following more than six cycles of trastuzumab treatment (9 months vs. 16 months; p=0.007). This is especially inspiring under the current circumstances since pertuzumab and t - dm1 are not available in china for metastatic breast cancer patients as alternative options foranti - her2 treatment . Therefore, trastuzumab could be a maintenance therapy for these patients, especially in first to third lines . An italian retrospective analysis identified a trend for better survival from the start of trastuzumab treatment in patients continuing beyond disease progression compared with those who halted the drug [hazard ratio (hr)=0.78; 95% ci: 0.58- 1.32], although the response rate tended to be lower with each subsequent line . In this trial, orr in the first - line, secondline, third - line and fourth - line setting was 35%,16%,15%, and 0%, respectively, which is similar to our data . However, in the gbg 26/big 3 - 05 phase study, a significant survival benefit for treatment beyond progression with trastuzumab was not demonstrated . Nevertheless, another retrospective study reported no clinical benefit from continuing trastuzumab beyond progression in metastatic breast cancer . In this study, vinorelbine - based salvage therapies were retrospectively investigated in 60 patients progressing during initial treatment with a trastuzumab - based regimen . Twentynine patients receiving vinorelbine - based salvage treatment and continuing trastuzumab had an orr of 21% . In the 31 patients who stopped trastuzumab, these data imply that the efficacy of trastuzumab would continue across multiple lines of therapy, and it also had limitations . However, our results also showed that there is a difference between early trastuzumab treatments compared with later usage . These findings revealed that the orr became sequentially worse though disease progression from the first-, second-, thirdline setting and beyond at 31.8%,10.6%,7.1%, and 0%, respectively . A similar study reported that women with her2- overexpressing metastatic breast cancer had progressed after one or two chemotherapy regimens, 8 achieved cr and 26 achieved pr, with an orr of 15% in the intent - to - treat population . The median duration of response was 9.1 months, and the median duration of survival was 13 months . This also suggested that anti - her2 therapy should be used as early as possible . The most frequently used chemotherapy agents were paclitaxel, docetaxel or vinorelbine, gemcitabine and even carboplatin . There is no evidence to indicate a preferred chemotherapy regimen in the first - line setting for advanced breast cancer treatment . In the above mentioned german study, the orr was the highest in the subgroup receiving trastuzumab together with chemotherapy (60%). Our study found that in her2-positive patients, a taxane - based regimen presented a better pfs but not os benefit compared with nontaxane- based regimens when combined with trastuzumab . However, a relatively high proportion of patients who received taxane were included in our study, which could bias the results . This implies that all of the described drugs should be considered as alternative firstline options . Another interesting result found in our study was that there was no difference in pfs between patients treated with either single / sequential - single chemotherapy or combined chemotherapy . This observation was also showed in the bcirg 007 study, which presented a response rate of 72% for both docetaxel plus trastuzumab (th) and docetaxel plus carboplatin and trastuzumab (tch) groups treatment regimens, and median os of 37.1 and 37.4 months, respectively . This differed from another study, which showed that docetaxel plus capecitabine and trastuzumab (txh) treatment demonstrated significantly longer pfs, with a median of 17.9 months compared with 12.8 months with th, which translates to a gain of around 5 months . These findings suggested that for metastatic breast cancer, single / sequential - single chemotherapy rather than combined chemotherapy should be considered to attain survival benefit and a better quality of life for patients . No additional adverse events were observed in our study compared with previous results, for example, cardiotoxicity was evident in 3/90 (3%) patients in our study, which was similar to a report of single agent use of trastuzumab in which 2% of patients exhibited cardiotoxicity . The most common treatment - related adverse events were chill and fever, which were similar to another published result . In conclusion, trastuzumab combined with chemotherapy was active and well tolerated as a first - line treatment for patients with her2-overexpressing advanced breast cancer . Even for patients who progressed upon trastuzumab treatment, continued trastuzumab treatment still showed efficacy but not as good as that observed for first - line therapy . Earlier administration and longer duration of trastuzumab treatment tended to have more clinical benefits for advanced breast cancer patients . Furthermore, trastuzumab combined with a single chemotherapy agent delivered similar efficacy compared with combined chemotherapy, and should be considered as an option to achieve survival benefit and a better quality of life for patients.
|
The diabetes heart study (dhs) is a community - based study of the genetic and epidemiological contributions to diabetic heart disease in which siblings concordant for type 2 diabetes mellitus (t2 dm), as well as unaffected family members, were recruited from internal medicine and endocrinology clinics in western north carolina . The dhs study design has been described in detail previously (18). To summarize, entry criteria required index patients diagnosed with t2 dm after age 34 years and no historical evidence of diabetic ketoacidosis . Relevant to the study reported here, this is a community - based cohort that reflects a cross section of families with diabetes - affected members in our region . The study was approved by the institutional review board at the wake forest school of medicine, and all subjects provided written informed consent for all study protocols . The participant examinations were conducted in the general clinical research center of the wake forest baptist medical center and included interviews for medical history and health behaviors, including smoking history, and anthropometric measurements . Weight and height were measured to the nearest 0.1 kg and 0.5 cm, and resting blood pressure was recorded . Hypertension was defined as current use of any antihypertensive medication or a resting systolic blood pressure greater than 140 mmhg or resting diastolic blood pressure greater than 90 mmhg . Fasting laboratory assays for total cholesterol, hdl cholesterol, triglycerides, glucose, and hemoglobin a1c were obtained . Diabetes was defined by self - reported history of adult onset of diabetes, fasting glucose 126 mg / dl or greater, or use of insulin or oral glucose - lowering medications . All scans were performed on two single - slice subsecond helical ct scanners equipped for retrospective cardiac gating and capable of 500-ms temporal resolution (hispeed lx with the smart score cardiac scan package; general electric medical systems, milwaukee, wi). Participants were placed supine on the ct couch over a quality - control calibration phantom (image analysis, columbia, ky). After a scout image of the chest was obtained, a helical volume of the entire heart during suspended respiration at end inspiration was obtained with the following parameters: 3-mm slice thickness, 26-cm display field of view, retrospective cardiac gating, 120 kv, 240 ma, and ct scan pitch adjusted to heart rate, as previously described (20). To further improve the precision of the calcium score, a replicated scan was performed immediately after the initial scan so that the average of the two scores could be calculated . The reproducibility of the calcium score was high (spearman correlation coefficient r = 0.98) between the first and second calcium scores . The amount of coronary calcium was scored using a modified agatston method with the traditional 130-hounsfield units threshold and a minimum lesion definition of 0.52 mm . A previously published work showed this method has very high correlation with the electron - beam ct derived measure of coronary calcium (r = 0.98) and high agreement when categorizing individuals based on their coronary calcium score (20). The primary outcome, cardiovascular mortality, was recorded for an average of 7.4 years (range 412) after cac screening . At intervals of 9 to 12 months, an interviewer contacted each participant or a family member by telephone to inquire about well - being . For participants who had died, interviews were conducted with the next - of - kin, and copies of death certificates were obtained . A search by social security number in the national social security death index was also performed to determine the vital status of subjects lost to follow - up . Cardiovascular death was defined as death as a result of myocardial infarction, congestive heart failure, cardiac arrhythmia, sudden cardiac death, peripheral vascular disease, or stroke as annotated on death certificates . Noncardiovascular death was defined as death due to cancer, infection, end - stage renal disease, accident, alzheimer s dementia, or others, including obstructive pulmonary disease, pulmonary fibrosis, or liver failure . We used tests for discrete variables and one - way anova for continuous variables to test for differences in demographic and risk factors between surviving and deceased participants . Subjects were separated into five groups on the basis of cac scores derived from baseline ct scans (cac scores 09 1099, 100299, 300999, and 1,000). Only one subject with a cac score of 0 died of cardiovascular causes; hence, for statistical validity and robustness, we selected the above cac categories . Logistic regression was used to estimate odds ratios (ors) for cvd mortality for each cac group . The discriminatory capacity of cac was assessed by using the area under the receiver operating characteristic curve (auc) c statistic as an index of model performance (21). The c statistic reflects the concordance of predictions with actual outcomes in rank order, with a c statistic of 1.0 indicating perfect discrimination (21). The nri index (17) was also determined and compared with the distribution of risk with framingham risk score (frs) variables (model 1) versus frs+cac (model 2). The predicted risk for cvd mortality was categorized into prespecified categories as 0% to <7%, 7% to <20%, and 20% using logistic regression models . These categories were chosen to indicate 1% annual mortality as being low risk, 13% as intermediate risk, and 3% as high risk . The nri is estimated as {[(number of events reclassified higher number of events reclassified lower)/number of events] [(number of nonevents reclassified higher number of nonevents reclassified lower)/number of nonevents]}. Additional analyses were performed to test for interactions between cac and race and sex . In a separate analysis that used cac score as a continuous variable, the base 2 logarithm of the sum of the cac score plus 1 (log2 [cac + 1]) was used . The choice of base 2 for the logarithm allowed examination of how a doubling of the calcium score affects cvd mortality, because each unit difference in the log - transformed cac score represents a doubling of the score . All models were adjusted for age, sex, race, smoking, total and hdl cholesterol, systolic blood pressure, and antihypertensive medications . In additional analyses, all statistical analyses were performed using jmp 8 software (sas institute, cary, nc). The diabetes heart study (dhs) is a community - based study of the genetic and epidemiological contributions to diabetic heart disease in which siblings concordant for type 2 diabetes mellitus (t2 dm), as well as unaffected family members, were recruited from internal medicine and endocrinology clinics in western north carolina . The dhs study design has been described in detail previously (18). To summarize, entry criteria required index patients diagnosed with t2 dm after age 34 years and no historical evidence of diabetic ketoacidosis . Relevant to the study reported here, this is a community - based cohort that reflects a cross section of families with diabetes - affected members in our region . The study was approved by the institutional review board at the wake forest school of medicine, and all subjects provided written informed consent for all study protocols . The participant examinations were conducted in the general clinical research center of the wake forest baptist medical center and included interviews for medical history and health behaviors, including smoking history, and anthropometric measurements . Weight and height were measured to the nearest 0.1 kg and 0.5 cm, and resting blood pressure was recorded . Hypertension was defined as current use of any antihypertensive medication or a resting systolic blood pressure greater than 140 mmhg or resting diastolic blood pressure greater than 90 mmhg . Fasting laboratory assays for total cholesterol, hdl cholesterol, triglycerides, glucose, and hemoglobin a1c were obtained . Diabetes was defined by self - reported history of adult onset of diabetes, fasting glucose 126 mg / dl or greater, or use of insulin or oral glucose - lowering medications . All scans were performed on two single - slice subsecond helical ct scanners equipped for retrospective cardiac gating and capable of 500-ms temporal resolution (hispeed lx with the smart score cardiac scan package; general electric medical systems, milwaukee, wi). Participants were placed supine on the ct couch over a quality - control calibration phantom (image analysis, columbia, ky). After a scout image of the chest was obtained, a helical volume of the entire heart during suspended respiration at end inspiration was obtained with the following parameters: 3-mm slice thickness, 26-cm display field of view, retrospective cardiac gating, 120 kv, 240 ma, and ct scan pitch adjusted to heart rate, as previously described (20). To further improve the precision of the calcium score, a replicated scan was performed immediately after the initial scan so that the average of the two scores could be calculated . The reproducibility of the calcium score was high (spearman correlation coefficient r = 0.98) between the first and second calcium scores . The amount of coronary calcium was scored using a modified agatston method with the traditional 130-hounsfield units threshold and a minimum lesion definition of 0.52 mm . A previously published work showed this method has very high correlation with the electron - beam ct derived measure of coronary calcium (r = 0.98) and high agreement when categorizing individuals based on their coronary calcium score (20). The primary outcome, cardiovascular mortality, was recorded for an average of 7.4 years (range 412) after cac screening . At intervals of 9 to 12 months, an interviewer contacted each participant or a family member by telephone to inquire about well - being . For participants who had died, interviews were conducted with the next - of - kin, and copies of death certificates were obtained . A search by social security number in the national social security death index was also performed to determine the vital status of subjects lost to follow - up . Cardiovascular death was defined as death as a result of myocardial infarction, congestive heart failure, cardiac arrhythmia, sudden cardiac death, peripheral vascular disease, or stroke as annotated on death certificates . Noncardiovascular death was defined as death due to cancer, infection, end - stage renal disease, accident, alzheimer s dementia, or others, including obstructive pulmonary disease, pulmonary fibrosis, or liver failure . We used tests for discrete variables and one - way anova for continuous variables to test for differences in demographic and risk factors between surviving and deceased participants . Subjects were separated into five groups on the basis of cac scores derived from baseline ct scans (cac scores 09, 1099, 100299, 300999, and 1,000). Only one subject with a cac score of 0 died of cardiovascular causes; hence, for statistical validity and robustness, we selected the above cac categories . Logistic regression was used to estimate odds ratios (ors) for cvd mortality for each cac group . The discriminatory capacity of cac was assessed by using the area under the receiver operating characteristic curve (auc) c statistic as an index of model performance (21). The c statistic reflects the concordance of predictions with actual outcomes in rank order, with a c statistic of 1.0 indicating perfect discrimination (21). The nri index (17) was also determined and compared with the distribution of risk with framingham risk score (frs) variables (model 1) versus frs+cac (model 2). The predicted risk for cvd mortality was categorized into prespecified categories as 0% to <7%, 7% to <20%, and 20% using logistic regression models . These categories were chosen to indicate 1% annual mortality as being low risk, 13% as intermediate risk, and 3% as high risk . The nri is estimated as {[(number of events reclassified higher number of events reclassified lower)/number of events] [(number of nonevents reclassified higher number of nonevents reclassified lower)/number of nonevents]}. Additional analyses were performed to test for interactions between cac and race and sex . In a separate analysis that used cac score as a continuous variable, the base 2 logarithm of the sum of the cac score plus 1 (log2 [cac + 1]) was used . The choice of base 2 for the logarithm allowed examination of how a doubling of the calcium score affects cvd mortality, because each unit difference in the log - transformed cac score represents a doubling of the score . All models were adjusted for age, sex, race, smoking, total and hdl cholesterol, systolic blood pressure, and antihypertensive medications . In additional analyses, all statistical analyses were performed using jmp 8 software (sas institute, cary, nc). Among 1,443 participants in the dhs cohort, 224 nondiabetic subjects and 96 subjects with missing data were excluded: 61 for cac score, 25 for total and hdl cholesterol, 3 for systolic blood pressure and antihypertensive medications, and 7 for smoking history . The participants were a mean age of 61 years,> 50% were women, and 16% were african american . A total of 86% participants (963 of 1,123) had a cac score 10, and 23% of african american participants (42 of 181), 12% of caucasians (114 of 942), 21% of women (128 of 607), and only 5% of men (28 of 516) had a cac score <10 . Risk factors were nearly equally distributed between the cvd mortality and no mortality groups, except for higher glucose and triglyceride levels in the cvd mortality group . Significant differences were found between the two groups, with higher mean cac scores, higher prevalence of cac scores 1,000, higher hemoglobin a1c levels, and longer diabetes duration in the cvd mortality group (table 1). Baseline demographic characteristics and risk factors stratified by cardiovascular mortality in the dhs cohort during 7.4 years of follow - up, 92 cvd deaths were identified: myocardial infarction (n = 40), coronary artery disease (n = 24), cardiac arrest (n = 12), congestive heart failure (n = 12), and stroke (n = 4), as annotated in death certificates . There was an increased incidence of cvd mortality across higher categories of cac (p <0.0001; supplementary fig . 1). In a multivariate analysis, adjusted for age, sex, race, smoking, total and hdl cholesterol, systolic blood pressure, and antihypertensive medications, the ors (95% ci) for cvd mortality using cac scores 09 as a reference group were cac 1099: 2.93 (0.7419.55); cac 100299: 3.17 (0.7022.22); cac 300999: 4.41(1.1529.00); and cac 1,000: 11.23 (3.2471.00; fig . 1). In additional analyses, after further adjusting for duration of diabetes, and hemoglobin a1c, the results were qualitatively similar (supplementary table 1). Or for cardiovascular mortality with higher cac scores in the dhs cohort compared with cac score <10 in a full model . The auc for the prediction of cvd mortality was 0.70, using traditional framingham risk variables, and increased to 0.75 (p = 0.0001) with the addition of cac to the model (fig . Receiver operating characteristic curve analysis depicting auc with and without cac to predict cvd mortality . (a high - quality color representation of this figure is available in the online issue .) Cross - tabulations of the 7.4-year estimated mortality using the models with and without cac are reported in table 2 . The addition of cac to the predictive model resulted in reclassification of 28% of the sample . The nri was 0.12 for events and 0.01 for nonevents, achieving an nri for the entire study cohort of 0.13 (95% ci 0.070.19; p <0.02; table 2). Overall, 161 individuals in the entire cohort were reclassified to a higher risk category, with an event rate of 13.7%, and 159 were reclassified to a lower risk category, with an event rate of 6.9% . The 7.4-year event rate for the entire cohort was 8.2% . Among intermediate - risk individuals, 53 (10%) were reclassified as high risk, and 144 (28%) were classified as low risk (nri 0.34 [0.280.40]; p <0.001). In model 1 (frs alone), 54% of the cohort was classified in the highest or lowest risk categories compared with 61% in model 2 (frs+cac). An additional 24% of those who experienced events were reclassified as high risk, and an additional 14% without events were reclassified as low risk using model 2 . Risk of cardiovascular mortality at 7.4 years predicted by models with and without cac in dhs a separate analysis found no significant interaction between cac and race (p = 0.5) and cac and sex (p = 0.7) in the prediction of cvd mortality . In addition, a separate sensitivity analysis using cac as a continuous variable in a full model showed cac was a significant predictor of cvd mortality (p = 0.0001). After adjustment, a doubling of the cac score resulted in a 24% increase in the risk of cvd mortality . In another analysis, the odds for cvd death increased by 71% in patients with diabetes for every increase in cac grouping from 10 to 99 to 100 to 299, 300 to 999, and 1,000 (p = 0.0001; supplementary table 1). Among 1,443 participants in the dhs cohort, 224 nondiabetic subjects and 96 subjects with missing data were excluded: 61 for cac score, 25 for total and hdl cholesterol, 3 for systolic blood pressure and antihypertensive medications, and 7 for smoking history . The participants were a mean age of 61 years,> 50% were women, and 16% were african american . A total of 86% participants (963 of 1,123) had a cac score 10, and 23% of african american participants (42 of 181), 12% of caucasians (114 of 942), 21% of women (128 of 607), and only 5% of men (28 of 516) had a cac score <10 . Risk factors were nearly equally distributed between the cvd mortality and no mortality groups, except for higher glucose and triglyceride levels in the cvd mortality group . Significant differences were found between the two groups, with higher mean cac scores, higher prevalence of cac scores 1,000, higher hemoglobin a1c levels, and longer diabetes duration in the cvd mortality group (table 1). During 7.4 years of follow - up, 92 cvd deaths were identified: myocardial infarction (n = 40), coronary artery disease (n = 24), cardiac arrest (n = 12), congestive heart failure (n = 12), and stroke (n = 4), as annotated in death certificates . There was an increased incidence of cvd mortality across higher categories of cac (p <0.0001; supplementary fig . Adjusted for age, sex, race, smoking, total and hdl cholesterol, systolic blood pressure, and antihypertensive medications, the ors (95% ci) for cvd mortality using cac scores 09 as a reference group were cac 1099: 2.93 (0.7419.55); cac 100299: 3.17 (0.7022.22); cac 300999: 4.41(1.1529.00); and cac 1,000: 11.23 (3.2471.00; fig . 1). In additional analyses, after further adjusting for duration of diabetes, and hemoglobin a1c, the results were qualitatively similar (supplementary table 1). Or for cardiovascular mortality with higher cac scores in the dhs cohort compared with cac score <10 in a full model . The auc for the prediction of cvd mortality was 0.70, using traditional framingham risk variables, and increased to 0.75 (p = 0.0001) with the addition of cac to the model (fig . Receiver operating characteristic curve analysis depicting auc with and without cac to predict cvd mortality . (a high - quality color representation of this figure is available in the online issue .) Cross - tabulations of the 7.4-year estimated mortality using the models with and without cac are reported in table 2 . The addition of cac to the predictive model resulted in reclassification of 28% of the sample . The nri was 0.12 for events and 0.01 for nonevents, achieving an nri for the entire study cohort of 0.13 (95% ci 0.070.19; p <0.02; table 2). Overall, 161 individuals in the entire cohort were reclassified to a higher risk category, with an event rate of 13.7%, and 159 were reclassified to a lower risk category, with an event rate of 6.9% . The 7.4-year event rate for the entire cohort was 8.2% . Among intermediate - risk individuals, 53 (10%) were reclassified as high risk, and 144 (28%) were classified as low risk (nri 0.34 [0.280.40]; p <0.001). In model 1 (frs alone), 54% of the cohort was classified in the highest or lowest risk categories compared with 61% in model 2 (frs+cac). An additional 24% of those who experienced events were reclassified as high risk, and an additional 14% without events were reclassified as low risk using model 2 . Risk of cardiovascular mortality at 7.4 years predicted by models with and without cac in dhs a separate analysis found no significant interaction between cac and race (p = 0.5) and cac and sex (p = 0.7) in the prediction of cvd mortality . In addition, a separate sensitivity analysis using cac as a continuous variable in a full model showed cac was a significant predictor of cvd mortality (p = 0.0001). After adjustment, a doubling of the cac score resulted in a 24% increase in the risk of cvd mortality . In another analysis, the odds for cvd death increased by 71% in patients with diabetes for every increase in cac grouping from 10 to 99 to 100 to 299, 300 to 999, and 1,000 (p = 0.0001; supplementary table 1). The current study examined the utility of cac in predicting cvd mortality in a biracial sample of diabetes - affected subjects with a mean follow - up of 7.4 years . Cac predicted cvd mortality independent of framingham risk factors and the presence of any cac (cac 10) predicted risk for cvd mortality compared with participants with no or minimal cac (cac 09). Further, the addition of cac to traditional risk factors resulted in a significant improvement in the classification of risk for the prediction of cvd mortality . An important feature of this study design is that the results likely reflect real trends of mortality in this region . The dhs is an observational study in which the participants are representative of our community . Mortality has not been affected by confounders such as an imposed clinical trial design or selective inclusion or exclusion of diabetes - affected participants based on the presence or absence of clinical characteristics . Several studies have shown that cac can be used as a cvd event risk stratification tool in the general population because it has prognostic power beyond the framingham risk factors (13,14,22,23). However, few data exist on the prognostic value of cac for cvd events and none for cvd mortality among diabetes - affected participants . In this analysis of a high - risk diabetes - affected population, cac provides added insight into the prognosis of cvd - related mortality . In a study of 510 asymptomatic t2 dm subjects from west london, the adjusted risk for cvd events during a mean follow - up of 2.2 (sd 0.4) years was 58.05 (95% ci 12.28274.48) among participants with cac 1,000 compared with participants with no cac (24). Cac was categorized into four segments (100, 101400, 4011,000, and> 1,000 agatston units), and the adjusted overall rate of death and nonfatal myocardial infarction by cac categories was 0% (n = 0), 2.6% (n = 2), 13.3% (n = 4), and 17.9% (n = 5), respectively (p <0.0001), which are similar to our findings of cvd mortality rates ranging from 1 to 16% by cac categories (supplementary fig . 1). The investigators found that cac predicted events more accurately than the frs (auc 0.92 for cac vs. 0.60 for frs, p <0.0001), similar to our findings (fig . 2). In the prospective evaluation of diabetic ischaemic disease by computed tomography (predict) study (25), designed to evaluate cac as a predictor of cvd events in t2 dm, 589 t2 dm subjects were monitored for a median of 4 years and 66 cvd events were identified . Hazard ratios relative to cac (010) were cac 11100, 5.4 (p = 0.02); 101400, 10.5 (p = 0.001); 4011,000, 11.9 (p = 0.001); and> 1,000, 19.8 (p <0.001). The current analysis extends and adds to this body of literature because it involved a larger cohort of t2 dm (n = 1,123) with longer follow - up (mean 7.4 years) and focused on cvd mortality as the primary end point . In a prior report from the dhs, we showed that cac was an independent predictor of all - cause mortality (16). Using a similar approach to risk assessment, we observed an estimated or> 6.7 when highest cac was compared with lowest cac for all - cause mortality . In this report we have extended this observation to focus on cvd - related mortality, where it is striking that we observed a doubling of an or> 11 for cvd - associated death . We have further included conventional risk factors from the components of the frs and shown that this substantial risk is observed when accounting for frs . We have also shown that auc analysis of mortality risk significantly improves predictive value beyond frs components, even in this high - risk t2 dm sample . Further, we have incorporated nri analysis to show that cac reclassifies individuals with intermediate frs, which is statistically significant . Each of these elements is new to this current study and represents a significant step forward in understanding of mortality in the population of diabetes - affected individuals . Multivessel coronary atherosclerosis is often present before ischemic symptoms occur and before treatment is instituted (3). A delayed recognition of various forms of cvd worsens the prognosis for survival in diabetes . Several studies (24,26,27) indicate that in diabetes, traditional risk factors predict cac but not other prognostic markers such as an abnormal myocardial perfusion . Abnormal myocardial perfusion has been validated as a prognostic tool in the general population (28), however, it has poor specificity in diagnosing cvd in diabetes (29). Similarly, carotid intimal medial thickness has been found to be inferior to cac in the prediction of cvd events (12). Meaningful cac burden (400) is high among patients with diabetes compared with randomly selected nondiabetic control subjects matched for cvd risk factors (8), indicating that cac can be used as a simple, rapid, noninvasive measure of atherosclerosis in diabetes . These findings suggest that cac is a more reliable indicator of cvd risk than the established cardiovascular risk factors, probably because measuring the atherosclerotic plaque burden takes into account risk factors (both known and unknown) and their possible interactions . We compared characteristics of patients with diabetes cac 09 versus cac 10 to examine other factors potentially contributing to this increased risk of mortality and found that patients with diabetes with higher cac scores had longer diabetes duration, were older, more likely to be men (51% vs. 18%), and had higher mean systolic blood pressure (data not shown). However, even after adjustment for systolic blood pressure, antihypertensive medications, diabetes duration and hemoglobin a1c, results were qualitatively similar (supplementary table 1), highlighting the significance of cac as an independent risk predictor . The strength of this study is the inclusion of a large population of t2 dm participants with meticulous standardized measures of cac and data collection leading to generalizability in the diabetes population . In addition to showing high risk associated with high levels of cac, we found a subset of t2 dm participants with none or minimal cac scores who had a low risk for cvd mortality . Another feature of this study is that the addition of cac to traditional risk factors leads to a clinically and statistically significant overall reclassification of 28% of participants with a significant reclassification in the intermediate - risk category . However, limitations need to be acknowledged . The dhs does not include patients with type 1 diabetes, but previous studies show that both forms of the disease have increased coronary calcification compared with nondiabetic subjects (7,8). Thus, the results of the current analysis may be applicable in insulin - dependent diabetic patients as well . In addition, the selection of participants from a single center may limit the generalizability of results; however, studies from different regions have also reached similar conclusions (24,25). In conclusion, there is an epidemic of obesity and diabetes and its aftermath of micro- and macrovascular complications, necessitating multiple approaches that include better risk stratification strategies and novel therapies . This study indicates that cac imaging can identify high- and low - risk diabetic individuals . Second, cac scoring can be used to reclassify intermediate - risk diabetic subjects into higher- and lower - risk categories . Lastly, although diabetes is a cvd risk equivalent, there is residual cardiovascular risk that is amply captured by a cac score above and beyond the traditional framingham risk variables . In addition, cac identifies a subgroup of patients with diabetes who are at low risk for cvd mortality . Further, the cac score provides an objective quantifiable measure of disease severity to both patient and physician and has the potential to modify behavior . However, implementation of aggressive medical management in patients with diabetes with advanced calcification leading to decreased mortality remains to be determined . These issues, plus cost considerations and radiation exposure, underscore the need for further evaluation of imaging technology to maximize potential benefit in terms of identifying disease and instituting intensive therapy in this high - risk patient population.
|
Comparative effectiveness research (cer) in diabetes is increasingly important, given the wide range of treatment options available to patients with type 2 diabetes (t2d). Over the years, the goals of diabetes management have expanded beyond glycemic control to include the management of metabolic and cardiovascular comorbidities according to several international guidelines.15 several newer classes of antihyperglycemic agents, including glp-1 ras and sodium glucose cotransporter inhibitors, have been suggested to provide additional benefits, such as weight loss . Both the american association of clinical endocrinologists guidelines and the american diabetes association recommend a patient - centered approach to guide choice of pharmacological agents.2,6 considerations include efficacy, cost, potential side effects, weight, comorbidities, hypoglycemia risk, and patient preferences . Both bodies recognize that glp-1 ras have robust a1c - lowering properties, are usually associated with weight loss and blood - pressure reductions, and are available in several formulations . The risk of hypoglycemia with glp-1 ras is low, and they reduce fluctuations in both fasting and postprandial states . Glp-1 ras are a growing class of glucose - lowering drugs that improve glucose homeostasis by enhancing the endogenous secretion of insulin induced by meal ingestion, inhibiting glucagon secretion, and slowing gastric emptying . Notably, they also suppress food intake and appetite, through central effects.7 since the first glp-1 ra was approved in 2005, the number of injectable agents in this class has increased from exenatide twice daily (ebid [exenatide bis in die]) to include liraglutide (lira) once daily, exenatide once weekly (eqw [exenatide quaque week]), albiglutide (albi) qw, and dulaglutide (dula) qw . Given the wide choices of glp-1 ra agents, cer can be a useful tool to aid health care decision makers weigh up the benefits and harms associated with different treatment options . A common cer approach is to synthesize the available randomized controlled trial (rct) evidence in a meta - analysis to provide a comprehensive view of the relative efficacy of the treatment options . The standard direct meta - analysis method is limited to evaluating the relative efficacy of treatments in a pairwise manner, where all the trials included in the direct meta - analysis compare the same intervention with the same control . Many trials are either placebo - controlled, include an active control that does not represent the current standard of care, or may not be comparable to the active arm in a treatment decision - making context . In the absence of head - to - head trials, indirect comparisons can be made using a common control arm to bridge the gap, provided that the randomized comparisons within each trial are preserved.8,9 network meta - analysis (nma), an extension of the standard meta - analysis methods, calculates the relative effects for all treatments in the evidence network in one simultaneous analysis.1012 nma is different from pairwise meta - analysis in the sense that there is not only one type of treatment comparison, but multiple treatment comparisons . Therefore, the nma output provides a comprehensive evidence base that allows decision makers to compare the effects from any two treatments within the network, including the relative - effect estimates between treatments that have not been compared in head - to - head trials . Nmas can also provide more precise estimates of treatment differences than can be obtained from pairwise meta - analysis, since more of the data are used.1012 there are several published meta - analyses evaluating the clinical profile of glp-1 ras;1319 however, these analyses either had limited data for more recent us food and drug administration - approved glp-1 ras, including qw formulations, did not apply the nma methods to compare the relative efficacy of glp-1 ras, used a frequentist nma method, or did not control for baseline a1c . Therefore, we performed a bayesian nma of placebo - controlled and active - controlled randomized trials to assess the relative effect of lira, albi, dula, ebid, and eqw, with a particular focus on glycemic control . We identified eligible studies by searching medline, embase, and the cochrane library from inception up to december 31, 2014, using pertinent keywords, and restricted our results to published rcts in the english language . We included open - label and double - blind rcts comparing one glp-1 ra with another, at any dose or with a control (placebo, oral antihyperglycemic drugs), for adults with t2d . For inclusion, studies had to fulfill the following criteria: 1) placebo - controlled or active - comparator rcts comparing eqw, ebid, dula, lira, or albi in patients with t2d inadequately controlled with current therapy; 2) reported outcome of percentage of patients achieving a1c <7% target; 3) provided mean change in a1c from baseline with standard error or 95% confidence interval [ci]; and 4) to be included in the base - case analysis, outcomes needed to be reported at 6-month follow - up (included range 2432 weeks). Data were from full - text publications for all glp-1 ra rcts used for product registration in the us . For some studies, it was necessary to supplement the data extraction with information from clinical trial - registry records.20 the outcome data extracted included the percentage of patients with a1c below target of 7% at follow - up and change from baseline in a1c at follow - up . Change in a1c from baseline was most commonly reported on a modified intent - to - treat basis where the population was defined as the set of patients who were randomized, received at least one dose of study medication, and had at least one postbaseline a1c measurement . For the a1c target outcome, trials reported the percentage of patients reaching treatment targets on an evaluable case basis, whereby only the subset of patients with a1c> 7% at baseline was evaluated . For the nma, we pooled data by glp-1 ra agent: albi, dula, ebid, eqw, and lira . Other control arms were included in the evidence networks to preserve randomization, and these were pooled by treatment class as follows: placebo, dpp4 inhibitor, insulin, metformin, sulfonylurea, and thiazolidinedione . The nma approach was as per the uk s national institute for health and care excellence (nice) decision support unit recommendations for bayesian nma.21 this methodology is widely used for synthesizing clinical trial data for health - technology appraisal or regulatory purposes.2224 the bayesian statistical model applies monte carlo simulations, which converge the direct (a versus b) and indirect (a versus c, c versus b) evidence with the likelihood - effect estimate, and provides a modeled comparison between a versus b versus c. the underlying assumption of this approach is that the comparator group for the interventions (ie, c) is similar among the indirect - comparison trials . Continuous outcomes were analyzed using a normal model with an identity link, and dichotomous outcomes were analyzed using a binomial model with logit link . Both fixed - effect and random - effect models were investigated . Fixed and random - effect models were fitted to the data via bayesian markov chain monte carlo methods using winbugs 1.425 and were run in for a minimum of 100,000 iterations to ensure convergence . These samples were used to calculate the median / mean and the 95% credible interval (cri), which is the interval from the percentiles 2.5 to 97.5 . The cri, distinct from the ci, is the bayesian equivalent of the frequentist 95% ci, and is used to assess statistically significant differences, which is consistent with the approach used by nice in evaluating effectiveness data . Medians are presented as the best estimate for the central value, since means may be overly influenced by outliers . The pooled summary measure for continuous end points an estimate of how well the predicted values fitted the observed data set was provided by the mean residual deviances (total residual deviance divided by number of data points), as well as the deviance information criteria (dic) output from winbugs.21 models with a good fit would have a total residual deviance close to the number of data points . The dic is used to compare different models for the same likelihood and data, and the model with the lowest dic was deemed to best predict a replicate data set of the same structure to that observed.26,27 there were no major differences in dic when comparing fixed - effect with random - effect models . Fixed - effect models assume that differences across trials do not impact on the treatment effects, and that variation in the outcomes reported are due to differences between patients within a trial . Random - effect models assume that variation in the outcomes reported are due both to differences between patients within a trial and differences across trials.2830 therefore, results from the random - effect nma models have been presented in this paper, since these better take into account sources of uncertainty . Covariate analyses were conducted to explore the effect of baseline a1c and use of background treatment that may confound the a1c end point.31 previous meta - analyses have shown that there is a correlation between baseline a1c and change in a1c over follow - up.32 therefore, a continuous study - arm level variable for baseline a1c was included in the model, centered at the mean baseline a1c across all study arms, the assumption being that the baseline a1c has the same impact on effects across all treatments . In a further covariate analysis, a continuous study - arm level variable for percentage of patients on oral therapy as background (0100%) and a dummy - indicator variable for use of insulin as background treatment (1, insulin included in background; 0, insulin not used as background treatment) were included to account for differences in background treatment . Note that covariate meta - analysis adjusts for differences between study arms, and as aggregated data are used in the covariate meta - analysis, the results should not be used to make predictions about individual patients . Some studies were of a longer duration, and a few studies did not provide sufficient endpoint data at 6-month follow - up in either the full - text publication or the clinical trial - registry record . For the base - case analysis, we used all studies that reported the outcomes of interest between 24 and 32 weeks of follow - up . A sensitivity analysis was conducted using all studies regardless of the follow - up time . In addition to the nma, standard direct meta - analysis was also conducted in stata version 14.33 we pooled studies using fixed- and random - effect models, using the random - effect method of dersimonian and laird, where the estimate of between - study heterogeneity is taken from the fixed - effect mantel haenszel or inverse - variance model.30,34 the direct meta - analysis was conducted to supplement the nma results and to investigate potential inconsistencies between the direct and indirect estimates . We identified eligible studies by searching medline, embase, and the cochrane library from inception up to december 31, 2014, using pertinent keywords, and restricted our results to published rcts in the english language . We included open - label and double - blind rcts comparing one glp-1 ra with another, at any dose or with a control (placebo, oral antihyperglycemic drugs), for adults with t2d . For inclusion, studies had to fulfill the following criteria: 1) placebo - controlled or active - comparator rcts comparing eqw, ebid, dula, lira, or albi in patients with t2d inadequately controlled with current therapy; 2) reported outcome of percentage of patients achieving a1c <7% target; 3) provided mean change in a1c from baseline with standard error or 95% confidence interval [ci]; and 4) to be included in the base - case analysis, outcomes needed to be reported at 6-month follow - up (included range 2432 weeks). Data were from full - text publications for all glp-1 ra rcts used for product registration in the us . For some studies, it was necessary to supplement the data extraction with information from clinical trial - registry records.20 the outcome data extracted included the percentage of patients with a1c below target of 7% at follow - up and change from baseline in a1c at follow - up . Change in a1c from baseline was most commonly reported on a modified intent - to - treat basis where the population was defined as the set of patients who were randomized, received at least one dose of study medication, and had at least one postbaseline a1c measurement . For the a1c target outcome, trials reported the percentage of patients reaching treatment targets on an evaluable case basis, whereby only the subset of patients with a1c> 7% at baseline was evaluated . For the nma, we pooled data by glp-1 ra agent: albi, dula, ebid, eqw, and lira . Other control arms were included in the evidence networks to preserve randomization, and these were pooled by treatment class as follows: placebo, dpp4 inhibitor, insulin, metformin, sulfonylurea, and thiazolidinedione . The nma approach was as per the uk s national institute for health and care excellence (nice) decision support unit recommendations for bayesian nma.21 this methodology is widely used for synthesizing clinical trial data for health - technology appraisal or regulatory purposes.2224 the bayesian statistical model applies monte carlo simulations, which converge the direct (a versus b) and indirect (a versus c, c versus b) evidence with the likelihood - effect estimate, and provides a modeled comparison between a versus b versus c. the underlying assumption of this approach is that the comparator group for the interventions (ie, c) is similar among the indirect - comparison trials . Continuous outcomes were analyzed using a normal model with an identity link, and dichotomous outcomes were analyzed using a binomial model with logit link . Both fixed - effect and random - effect models were investigated . Fixed and random - effect models were fitted to the data via bayesian markov chain monte carlo methods using winbugs 1.425 and were run in for a minimum of 100,000 iterations to ensure convergence . These samples were used to calculate the median / mean and the 95% credible interval (cri), which is the interval from the percentiles 2.5 to 97.5 . The cri, distinct from the ci, is the bayesian equivalent of the frequentist 95% ci, and is used to assess statistically significant differences, which is consistent with the approach used by nice in evaluating effectiveness data . Medians are presented as the best estimate for the central value, since means may be overly influenced by outliers . The pooled summary measure for continuous end points an estimate of how well the predicted values fitted the observed data set was provided by the mean residual deviances (total residual deviance divided by number of data points), as well as the deviance information criteria (dic) output from winbugs.21 models with a good fit would have a total residual deviance close to the number of data points . The dic is used to compare different models for the same likelihood and data, and the model with the lowest dic was deemed to best predict a replicate data set of the same structure to that observed.26,27 there were no major differences in dic when comparing fixed - effect with random - effect models . Fixed - effect models assume that differences across trials do not impact on the treatment effects, and that variation in the outcomes reported are due to differences between patients within a trial . Random - effect models assume that variation in the outcomes reported are due both to differences between patients within a trial and differences across trials.2830 therefore, results from the random - effect nma models have been presented in this paper, since these better take into account sources of uncertainty . Covariate analyses were conducted to explore the effect of baseline a1c and use of background treatment that may confound the a1c end point.31 previous meta - analyses have shown that there is a correlation between baseline a1c and change in a1c over follow - up.32 therefore, a continuous study - arm level variable for baseline a1c was included in the model, centered at the mean baseline a1c across all study arms, the assumption being that the baseline a1c has the same impact on effects across all treatments . In a further covariate analysis, a continuous study - arm level variable for percentage of patients on oral therapy as background (0100%) and a dummy - indicator variable for use of insulin as background treatment (1, insulin included in background; 0, insulin not used as background treatment) were included to account for differences in background treatment . Note that covariate meta - analysis adjusts for differences between study arms, and as aggregated data are used in the covariate meta - analysis, the results should not be used to make predictions about individual patients . Some studies were of a longer duration, and a few studies did not provide sufficient endpoint data at 6-month follow - up in either the full - text publication or the clinical trial - registry record . For the base - case analysis, we used all studies that reported the outcomes of interest between 24 and 32 weeks of follow - up . A sensitivity analysis was conducted using all studies regardless of the follow - up time . In addition to the nma, standard direct meta - analysis was also conducted in stata version 14.33 we pooled studies using fixed- and random - effect models, using the random - effect method of dersimonian and laird, where the estimate of between - study heterogeneity is taken from the fixed - effect mantel haenszel or inverse - variance model.30,34 the direct meta - analysis was conducted to supplement the nma results and to investigate potential inconsistencies between the direct and indirect estimates . In total, 29 glp-1 ra core registration trials were identified covering 18,543 patients, which included seven trials for albi,3541 six trials for dula,4247 four trials for ebid,4851 six trials for eqw,5257 and six trials for lira5863 (table s1). Seven of these trials provided head - to - head comparisons of glp-1 ras (table 1).41,42,47,52,56,57,63 given the results of the direct meta - analyses, different inferences can be made depending on which set of head - to - head trials is used, eg, dula versus eqw via ebid controlled trials or via lira controlled trials (table 1). This demonstrates the need for an nma to provide a comprehensive assessment of the comparative effectiveness of the glp-1 ras . The base - case nma consisted of 23 trials reporting outcomes at approximately 6-month follow - up (figure 1, network 1). The six trials excluded from the base case either reported data at 52 weeks (lead-3, harmony-1, 2, 4, and 5) or 104 weeks (harmony-3). The sensitivity analysis included all 29 trials (figure 1, network 2). Across all analyses, the random - effect models had a better fit compared with the fixed - effect models in terms of dic and average residual deviance . The covariate random - effect models, where treatment effects were adjusted for baseline a1c, had a similar fit to the unadjusted random - effect models . While baseline a1c was not a statistically significant predictor of differences in treatment effects, the direction of effect indicates that study arms with a higher baseline a1c will show a larger effect on a1c compared with study arms with lower baseline a1c . Baseline a1c does not appear to be a confounding factor in analysis of the <7% target end point . However, based on model fit and observations from other analyses,32 the random - effect model adjusted for baseline a1c is likely to provide the most robust results, since this takes into account some of the heterogeneity between studies . Table 2 shows the results of the random - effect analysis of all the antihyperglycemic drugs compared with placebo and compared with one another . Compared with placebo, all the antihyperglycemic drugs included in the network had statistically significantly lower a1c at follow - up . There were no statistically significant differences among albi, dula, and lira, compared to eqw . Compared with ebid, dula, eqw, and lira had a significantly better effect on a1c . For the odds of reaching the <7% target, all glp-1 ras in the network had significantly higher odds of reaching the <7% target compared with placebo . Dula, eqw, and lira had higher odds of reaching target compared to albi . Lastly, the odds of reaching <7% target were not significantly different between albi and ebid (table 2). Table 3 shows the probability of reaching the target <7% a1c, number needed to treat (nnt), number of patients reaching target per 100 treated, and absolute change in a1c from base case for each treatment group across all analyses . Nnt is the number needed to be treated in order to observe one event of interest, and the lower the nnt (closest to 1), the more effective the treatment . We estimate that for every two patients treated with a glp-1 ra, one will meet the <7% a1c target within 6 months . Patients are more likely to reach the <7% target at 6 months with dula, eqw, and lira compared to albi . For every 100 patients treated, nine more will reach the <7% target if treated with dula, eqw, and lira compared to albi (table 3). The base - case nma excluded six studies (five studies for albi and one for lira) because they had longer follow - ups and did not report a1c outcomes at 6 months . A sensitivity analysis was conducted to examine the impact of inclusion of these six studies on the relative treatment effects of glp-1 ras . This resulted in lower treatment effects for albi compared with the base - case results, although the difference in effect was not significant (figure 2). The treatment effects for the other glp-1 ras were largely unchanged between the 6-month base - case and sensitivity analyses . It was also noted that the inclusion of longer - term studies resulted in a lower treatment effect for sulfonylureas . This result would be due to the inclusion of the harmony-3 study, which included a glimepiride arm and reported end points after 104 weeks . Such a finding is consistent with other studies, in that although sulfonylurea treatment can result in a rapid initial response, the effectiveness diminishes over time, resulting in a gradual increase in a1c.6466 an additional covariate analysis (results not shown) was undertaken to take into account differences in the background treatment across trials . This incorporated two variables: the percentage of patients on an oral antidiabetes drug at baseline and the use of insulin as part of the background treatment . Use of a background oral antidiabetes drug was not a significant predictor of treatment effect . There were insufficient studies to assess whether background insulin could have been a potential effect modifier . When comparing the direct glp-1 ra head - to - head results shown in table 1 with the nma results in table 2, the results are largely consistent . The direct results comparing dula, eqw, and lira versus ebid had corresponding statistically significant results in the random - effect base - case nma for the comparisons of albi, dula, and eqw versus lira, the random - effect base - case nma did not produce statistically significant results, although statistically significant differences (p<0.05) were reported in harmony-7 (lira better than albi) and duration-6 (lira better than eqw). It was noted that both harmony-7 and duration-6 had an open - label design and unmatched administration of study drugs (daily versus weekly). In the course of conducting the analysis, it was noted that award-1 and moretto et al51 reported that the efficacy of 10 g ebid was not significantly different from placebo (odds ratio versus placebo 1.46, [95% ci 0.942.26], and 2.14, [95% ci 0.994.63], respectively). As the treatment - effect ci for moretto et al overlapped the cis estimated from the other three ebid trials (figure 3) and given the study size (56 and 59 patients in the exenatide and placebo arms, respectively), we attribute the lack of significance to a lack of power to detect differences between study arms . Award-1, on the other hand, included sufficient numbers of patients to detect differences . The upper bound for the ci lay below the lower bound for the cis estimated from buse et al,48 defronzo et al,49 and kendall et al50 (figure 3). One potential explanation for the difference in effects across these trials is lack of blinding for the ebid arm in award-1: placebo was given qw to match the dula arms, but there was no dummy - placebo injection to match the bid dosing for exenatide . In harmony-2, it was noted that the 50 mg albi arm was not as effective as the 30 mg albi arm at achieving the <7% a1c target (40.2% versus 49%). Note that the data for the harmony-2 study were taken from the clinical trials registry, as the study was not published in full at the time of this analysis . There may be unreported factors that would explain this result, but our analysis reflects the data as they were reported at the time of writing . The base - case nma excluded six studies (five studies for albi and one for lira) because they had longer follow - ups and did not report a1c outcomes at 6 months . A sensitivity analysis was conducted to examine the impact of inclusion of these six studies on the relative treatment effects of glp-1 ras . This resulted in lower treatment effects for albi compared with the base - case results, although the difference in effect was not significant (figure 2). The treatment effects for the other glp-1 ras were largely unchanged between the 6-month base - case and sensitivity analyses . It was also noted that the inclusion of longer - term studies resulted in a lower treatment effect for sulfonylureas . This result would be due to the inclusion of the harmony-3 study, which included a glimepiride arm and reported end points after 104 weeks . Such a finding is consistent with other studies, in that although sulfonylurea treatment can result in a rapid initial response, the effectiveness diminishes over time, resulting in a gradual increase in a1c.6466 an additional covariate analysis (results not shown) was undertaken to take into account differences in the background treatment across trials . This incorporated two variables: the percentage of patients on an oral antidiabetes drug at baseline and the use of insulin as part of the background treatment . Use of a background oral antidiabetes drug was not a significant predictor of treatment effect . There were insufficient studies to assess whether background insulin could have been a potential effect modifier . When comparing the direct glp-1 ra head - to - head results shown in table 1 with the nma results in table 2, the results are largely consistent . The direct results comparing dula, eqw, and lira versus ebid had corresponding statistically significant results in the random - effect base - case nma . For the comparisons of albi, dula, and eqw versus lira, the random - effect base - case nma did not produce statistically significant results, although statistically significant differences (p<0.05) were reported in harmony-7 (lira better than albi) and duration-6 (lira better than eqw). It was noted that both harmony-7 and duration-6 had an open - label design and unmatched administration of study drugs (daily versus weekly). In the course of conducting the analysis, it was noted that award-1 and moretto et al51 reported that the efficacy of 10 g ebid was not significantly different from placebo (odds ratio versus placebo 1.46, [95% ci 0.942.26], and 2.14, [95% ci 0.994.63], respectively). As the treatment - effect ci for moretto et al overlapped the cis estimated from the other three ebid trials (figure 3) and given the study size (56 and 59 patients in the exenatide and placebo arms, respectively), we attribute the lack of significance to a lack of power to detect differences between study arms . Award-1, on the other hand, included sufficient numbers of patients to detect differences . The upper bound for the ci lay below the lower bound for the cis estimated from buse et al,48 defronzo et al,49 and kendall et al50 (figure 3). One potential explanation for the difference in effects across these trials is lack of blinding for the ebid arm in award-1: placebo was given qw to match the dula arms, but there was no dummy - placebo injection to match the bid dosing for exenatide . In harmony-2, it was noted that the 50 mg albi arm was not as effective as the 30 mg albi arm at achieving the <7% a1c target (40.2% versus 49%). Note that the data for the harmony-2 study were taken from the clinical trials registry, as the study was not published in full at the time of this analysis . There may be unreported factors that would explain this result, but our analysis reflects the data as they were reported at the time of writing . In this nma, we combined direct and indirect evidence from 29 rcts involving 18,542 patients with t2d to estimate the relative efficacy among licensed glp-1 ras on the gold standard measure of diabetes control a1c . We made several key observations: 1) glp-1 ras were superior to placebo in improving a1c, with moderate confidence in estimates; 2) relative efficacy was similar among longer - acting glp-1 ras, and absolute reduction in a1c at 6 months was consistent among dula, eqw, and lira and was estimated to be within the range 0.9%1.4%; and 3) using nnt, we estimated that for every two patients treated with a glp-1 ra, one will meet the <7% a1c target within 6 months . Compared to direct evidence from head - to - head studies, evidence generated from this nma allows for a more accurate assessment of glp-1 ra relative efficacy on a class - wide level, which is especially important for population - health decision makers.21 although direct evidence can provide health care decision makers with a crude sense of relative efficacy, such comparisons often lack details on the relative magnitude of treatment effects, are biased due to open - label trial design, and lack statistical power due to small sample size . The inconsistent results yielded from numerous direct comparisons also make it difficult for health care decision makers to reach definitive conclusions on a treatment decision . While nmas are useful in quantifying treatment effects from clinical studies, meta - analysis results can vary depending on the trials included in the network, the statistical methods applied, and the consideration of covariates to account for trial - design differences . Our network analysis was a comprehensive analysis of the a1c outcome across all us - licensed glp-1 ras . Our results are corroborated by other published meta - analyses of glp-1 ras, which showed that patients with t2d can expect to improve their a1c with glp-1 ra therapy.14,16,19 however, our analysis completes the evidence for glp-1 ras, since other analyses either did not cover all currently available glp-1 ras in the us,1317,19 limited study inclusion to placebo or specific active controls or combinations,14,16,17 or did not conduct an nma to provide comparisons of all glp-1 ras against one another.13,1517 furthermore, some studies did not use an established nma method, such as the bayesian method recommended by the nice decision support unit,21 and/or the nma did not control for study - arm baseline a1c which varied across rcts.19 although baseline a1c was not found to be a statistically significant covariate in this study, other studies have shown that baseline a1c value could impact the magnitude of a1c reduction where higher reductions are associated with higher baseline a1c values.32 the implications of consistent glycemic control help clinicians design individualized treatment plans . While new drug therapies target the multiple defects that together contribute to diabetes, the possibility of improved control through glp-1 ras may lead to improved patient outcomes beyond glycemic control . American association of clinical endocrinologists guidelines recommend initiating treatment with metformin in patients with entry a1c> 7.5% plus a second agent, with preference given to treatments with low potential for hypoglycemia and weight - loss effects.67 therefore, glp-1 ras are ranked hierarchically first before other options in this regard . In addition, increased a1c has been associated with microvascular and macrovascular complications, and lowering a1c to below or around 7% has been shown to reduce microvascular and neuropathic complications of t1d and t2d.68,69 most recently, this class has been shown to reduce major adverse cardiac events in large cardiovascular - outcome trials . Altogether, these findings, along with the known glycemic effects and beneficial secondary effects, may compel clinicians to use these agents in patients requiring robust and sustained control of their hyperglycemia, while addressing concerns of weight gain and hypoglycemia typically seen with traditional agents . While important, the impact of a glp-1 ra on a1c reduction is just one consideration when selecting the best treatment for a patient . Karagiannis et al16 provided a direct meta - analysis of weekly glp-1 ras that also covered other important outcomes, such as weight change and gastrointestinal and injection - site reactions . However, the analysis did not provide head - to - head or indirect comparisons, and there were insufficient results for eqw, which had a large clinical program design comparable with others in the class . A recent nma by sun et al18 focused on gastrointestinal adverse events, specifically nausea, vomiting, and diarrhea, and indicated that these effects are associated with glp-1 ras . More recently, zaccardi et al19 performed an nma of weekly glp-1 ras using the frequentist approach, and reported no differences between eqw and a maintenance dose of dula (1.5 mg) for a1c or on all three metabolic outcomes (blood pressure, blood lipids, and c - reactive protein), and both treatments reduced a1c to a greater extent than albiglutide . Managing blood glucose is fundamental to caring for people with t2d . With newer glucose - dependent agents, such as glp-1 ras, cer is an increasingly important tool, given the wide range of treatment options available in each class . It allows health care decision makers to evaluate the efficacy and safety of multiple treatment options simultaneously . Such methods as nma have been well recognized as useful tools to evaluate the relative merits of treatments when direct head - to - head studies are not available . In this comparative - effectiveness analysis, the nma method was used to integrate placebo- and active - controlled trial data to assess the relative efficacy of us - approved glp-1 ras . The nma approach has an advantage in that it preserves randomized comparisons and gives each trial an appropriate weighting, while including data from both direct (head - to - head) studies and indirect studies (eg, via placebo). Inferences that are based on the direct evidence alone ignore a substantial part of the available clinical evidence . An nma that includes both direct and indirect evidence provides a more comprehensive assessment of efficacy, and is less prone to study - selection bias . The value of nma to cer is that it allows us to assess the magnitude of an intervention s effect and its consistency across trials, as opposed to a vote - counting approach, which infers the presence, or not, of an effect based on the statistical significance of results in each study.30,70 despite its strengths, this method is not without challenges.71,72 therefore, our findings should be interpreted in light of the following limitations . One criticism of nmas is that the methodology can lack transparency and results can be difficult to reproduce . Recent guidelines have helped standardize methods to improve confidence in nmas.73 for our analysis, we followed the nice decision support unit recommendations that were developed in collaboration with leading academics for conducting and reporting nmas, and used validated code that is available in the public domain.21 another limitation is that the nmas rely on the assumption that data are consistent across trials . However, this is a problem associated with data synthesis in general and not just (network) meta - analysis . Problems with consistency may arise if the inclusion criteria are too broad, such that the trial populations are not comparable clinically . For example, treatment - nave patients may have a higher response to treatment compared with patients for whom one or more lines of treatment have failed . There may also be undetected heterogeneity across trials that may arise from study bias, eg, poor quality, or small study bias where the trial results appear to be outliers . Some heterogeneity is to be expected, and some differences across clinical studies may reflect differences in real - world practice . There may be imbalances in the distribution of unobserved or unmeasured effect modifiers that have the potential to confound the comparative estimates among glp-1 ras . Also, we did not consider whether differences between safety outcomes across glp-1 ras impact on treatment efficacy, though this has been considered elsewhere.18 finally, our nma included non - glp-1 ra drugs (eg, metformin, sulfonylureas, insulin) as control arms or additional arms from the glp-1 ra trials . These arms are required to connect the network of evidence across the glp-1 ra trials that are the focus of this analysis . While our analysis suggests lower relative efficacy of non - glp-1 ras versus glp-1 ras, the analysis does not include all available evidence for the non - glp-1 ra drugs . In this comparative - effectiveness analysis, the nma method was used to integrate placebo- and active - controlled trial data to assess the relative efficacy of us - approved glp-1 ras . The nma approach has an advantage in that it preserves randomized comparisons and gives each trial an appropriate weighting, while including data from both direct (head - to - head) studies and indirect studies (eg, via placebo). Inferences that are based on the direct evidence alone ignore a substantial part of the available clinical evidence . An nma that includes both direct and indirect evidence provides a more comprehensive assessment of efficacy, and is less prone to study - selection bias . The value of nma to cer is that it allows us to assess the magnitude of an intervention s effect and its consistency across trials, as opposed to a vote - counting approach, which infers the presence, or not, of an effect based on the statistical significance of results in each study.30,70 despite its strengths, this method is not without challenges.71,72 therefore, our findings should be interpreted in light of the following limitations . One criticism of nmas is that the methodology can lack transparency and results can be difficult to reproduce . Recent guidelines have helped standardize methods to improve confidence in nmas.73 for our analysis, we followed the nice decision support unit recommendations that were developed in collaboration with leading academics for conducting and reporting nmas, and used validated code that is available in the public domain.21 another limitation is that the nmas rely on the assumption that data are consistent across trials . However, this is a problem associated with data synthesis in general and not just (network) meta - analysis . Problems with consistency may arise if the inclusion criteria are too broad, such that the trial populations are not comparable clinically . For example, treatment - nave patients may have a higher response to treatment compared with patients for whom one or more lines of treatment have failed . There may also be undetected heterogeneity across trials that may arise from study bias, eg, poor quality, or small study bias where the trial results appear to be outliers . Some heterogeneity is to be expected, and some differences across clinical studies may reflect differences in real - world practice . There may be imbalances in the distribution of unobserved or unmeasured effect modifiers that have the potential to confound the comparative estimates among glp-1 ras . Also, we did not consider whether differences between safety outcomes across glp-1 ras impact on treatment efficacy, though this has been considered elsewhere.18 finally, our nma included non - glp-1 ra drugs (eg, metformin, sulfonylureas, insulin) as control arms or additional arms from the glp-1 ra trials . These arms are required to connect the network of evidence across the glp-1 ra trials that are the focus of this analysis . While our analysis suggests lower relative efficacy of non - glp-1 ras versus glp-1 ras, the analysis does not include all available evidence for the non - glp-1 ra drugs . This is a comprehensive assessment of the comparative effectiveness of us - licensed glp-1 ras in terms of a1c . Glp-1 ras are superior to placebo in improving glycemic control, with a consistent absolute reduction in a1c at 6 months, ranging from 0.9% to 1.4%, among dula, eqw, and lira . In terms of nnt, we estimate that for every two patients treated with a glp-1 ra, one will meet the <7% a1c target within 6 months of commencing glp-1 ras . These glp-1 ras in particular should thus be considered a viable addition to oral antidiabetes therapy in the appropriate patient.
|
Epidemiological investigation indicates that parkinson disease (pd) patients experience more falls than either age - matched healthy controls or individuals with other neuropathologies, including spinal disorders, epilepsy, multiple sclerosis, stroke, and motor neuron disease . For patients with pd, fall occurrences and increased fear of falling are frequent in situations with complex or threatening context, with contact with an obstacle presenting a major cause of falls among pd [1, 3]. Task demands, such as the inherent characteristics of the obstacle to be crossed as well as constraints imposed by the general environment surrounding the obstacle and task, contribute to context and exacerbate motor disturbances amongst pd patients . Previous studies have shown that neurotypical adults adopt conservative strategies for standing [6, 7], walking, and obstacle crossing when behaving in a context that threatens increased physical consequences as a result of a fall . In contrast, pd patients have exhibited increased postural instability and gait disturbance when concurrently challenged with a cognitive or motor demand . It is probable that threatening context may exacerbate any obstacle negotiation deficits that exist for pd patients . While pd pharmacotherapy reduces classical parkinsonian symptoms, some functional movement parameters remain insensitive to dopamine replacement [13, 14]. Furthermore, improvements enabled by pd medication can be compromised by challenging context [15, 16]. This compromise can lead to instability during standing and walking in activities of daily living, increasing fall risk . The purpose of this study was to investigate changes in obstacle crossing behaviour amongst the meds on and meds off pd patients in response to task context . We had patients step over a walking - surface obstacle in two contexts: at floor level and on a raised walking platform, previously identified as sufficient to threaten participants' sensorimotor system, and elicit changes in motor strategy [6, 9]. We hypothesized that threatening context would have stronger influence on obstacle crossing than dopamine replacement, resulting in obstacle negotiation deficits amongst both meds on and meds off pd patients . Ten participants with idiopathic pd (pd; age: 69.7 10.3 years) and ten age - matched controls (ctrl; age: 68.8 8.4 years) served as subjects . The human research ethics committee of the university of lethbridge had previously approved all procedures . All pd patients were receiving dopaminergic and associated medication as pd management (table 1), and each pd subject was tested meds off (> 12 h removed from last dose) and meds on (between 1 h and 2 h following regular dose) in the same laboratory visit (same day). All patients were tested in the off then on order for patient's practicality and comfort . Quality of on condition was confirmed by patient's self - report and clinical assessment . The unified parkinson disease rating scale motor scores (updrs - iii) assessed at time of testing are provided in table 1 . Participants started in a standing posture at the beginning of a 4.7 m long, 0.6 m wide walkway, with each foot positioned such that the lateral malleolus was aligned with the centre line of a separate force plate (kistler products). Threatening context was imposed by increasing the potential negative result of a fall, as empirically established in previous human movement studies [69]. In the high condition, the test walkway was solidly supported 0.7 m above the ground, and the force plates were raised to an equal height on a hydraulic lift . In the low condition, the walkway was outlined on the laboratory floor with continuous tape borders (figure 1). A ramp (0.9 m length, 5 angle of declination) was positioned at the start of the walkway, flush with the anterior edge of the lowered force plates, to allow for gradual vertical displacement from low force platform height (0.09 m) to low walkway height (0.00 m). The obstacle was a rigid foam block (0.15 m high, 0.60 m wide (perpendicular to gait path), and 0.15 m long), approximately equal in height and length to a north american concrete parking curb . All participants wore a safety harness for all trials, and that harness was tethered to an overhead rolling coupling to prevent falls to the ground . Participants also wore vision - occluding goggles (plato, translucent technologies, toronto, on) that initially concealed the presence or absence of the gait obstacle, to control for the preplanning of obstacle negotiation strategy . During practice trials, participants were familiarised with the preparatory stimulus (opening of the goggles) and the imperative stimulus (audio signal). In experimental trials, once the investigator had positioned the obstacle (for obstructed trials) or feigned placing the obstacle (nonobstructed trials), a second experimental investigator informed the participant that a new trial was set to begin . At a random interval following this instruction, the imperative stimulus sounded 0 ms, 500 ms, or 1000 ms after goggles opening, with all subjects receiving the same number of trials at each latency (n = 3) in the same random order . Subjects walked at a self - selected speed along the walkway in each of the high and low conditions, performing a block of 18 trials in each condition (36 trials total). Obstacle trials were further randomized in each threat condition, such that 9 of 18 trials in each threat condition involved obstacle negotiation and nine were nonobstructed trials . Obstacle position was chosen at a point on the walkway equal to or greater than three stride lengths from the point of gait initiation for each subject, as determined during practice trials . This positioning allowed participants to transition from gait initiation to a stable gait pattern and provided adequate time for obstacle negotiation behaviour to reach a stable level . A fixed posture with arms loosely crossed in front of the body was used to limit obstruction of markers . Participants were outfitted with passive infrared - reflective markers at the following anatomical locations: bilaterally at the anterior end of the shoe, the lateral malleolus, the posterior end of the shoe, the lateral epicondyle of the femur, the greater trochanter, the ulnar styloid, the lateral epicondyle of the humerus, and the acromion process and unilaterally at the sternal notch and the forehead . A single marker was also placed in the top center of one sagittal face of the obstacle . Positional data were collected using a 6-camera infrared motion analysis data collection system (peak motus 2000, peak performance technologies, englewood, co), with a collection frequency of 120 hz . Synchronized digital video recordings of each trial were made in the sagittal and frontal planes for qualitative scoring of obstacle negotiation . Kinetic data for gait initiation were also captured from the force plates at a collection frequency of 600 hz, in synchrony with an analog signal split from the audio imperative stimulus . Behavioural coding of obstacle contact was completed from video by three individual judges and corroborated with kinematic analysis of the obstacle marker displacement . Trials where a participant contacted the obstacle were removed from further kinematic analysis as were any trials that could not be successfully postdigitized . Given these reductions, the total number of trials included in kinematic analyses was pd off74, 69; pd on76, 65; ctrl79, 75 for low and high conditions, respectively . Kinetic and kinematic data were processed using custom algorithms (matlab, the mathworks, natick, ma, usa). Raw displacement data were visually inspected and interpolated as required then filtered using a fourth - order butterworth low pass digital filter with a cutoff frequency of 10 hz . Pertinent kinematic measures assessing obstacle approach and obstacle negotiation in both the lead limb (first limb across obstacle) and the trail limb (second limb across obstacle) are illustrated in figure 2 . They include the precrossing measure of horizontal distance from rear edge of obstacle to trail toe off (dpre), the crossing measure of vertical distance between top of obstacle and lead toe (dvert), and the postcrossing measure of horizontal distance from front edge of obstacle to lead heel strike (dpost), along with determinations of crossing step length (sl) from trail toe off to lead heel strike and horizontal velocity (cvcom) of whole body centre of mass at crossing . Gait initiation rate was expressed as a time (unload time), being the difference in time between the imperative stimulus signal and a zero vertical force reading from one of the force plate pair . Separate analyses were used to examine group and threat effects in the obstacle contact frequency counts . A mixed model manova comparison was conducted on the kinematic measures, with the followup between group (pd off versus ctrl; pd on versus ctrl) threat (low versus high) univariate anovas and within group (pd off, and pd on) threat (low versus high) repeated measure anovas performed, with a corrected level of significance of = .017 for multiple comparisons . Unobstructed walking trials in low and high threat conditions were considered as a baseline in the current study . Group mean values for horizontal velocity at the centre of mass are shown in figure 3 . Pd off subjects had a slower com horizontal velocity than ctrl subjects (f(1, 18) = 80.76, p <.001; ctrl = 1.01 m / s; pd off = 0.58 m / s). Univariate follow - up tests revealed that these measures were supported by group threat interactions ((f(1, 18) = 4.90, p <.05). Pd on walked slower (f(1, 18) = 25.75, p = .00; ctrl = 1.01 m / s; pd on = 0.72 m / s) than ctrl subjects . A group threat interaction indicated that the manipulation of postural threat affected gait velocity amongst pd on subjects differently than ctrl subjects (f(1, 18) = 5.25, p <.05). Pd on demonstrated significantly slower walking speed in the high condition . A significant main effect for threat on com velocity (f(1, 18) = 12.11, p <.05) was revealed through the multivariate analysis . Group and group threat effects did not exist (f(1, 18) = 2.48, p>.05 and f(1, 18) = .92, p>.05, resp . ). There were no group or threat - based differences for gait initiation rate during obstructed trails (figure 4(a)). Pd off did produce significantly lower com velocities during obstacle approach compared to ctrl (f(1, 18) = 11.350, p = 0.003). All three groups decreased com approach velocity in the high condition (figure 4(b); pd on / ctrl: f(1, 18) = 15.632, p = .001; pd off / pd on: f(1, 18) = 17.944, p = .002). Larger decreases in com approach velocity amongst pd patients in the high condition led to a threat group interaction in the pd on / ctrl comparison (f(1, 18) = 11.408, p = .003). Pd off had a high frequency of obstacle contacts in the high condition; in total, 21.3% of trials compared to 9.9% observed in low ((1) = 4.05, p <.05). Pd on also made more frequent obstacle contact in high (observed in 18.3% of trials) than in low (5.9% of trials) ((1) = 5.49, p <.05). Conversely, ctrl had few obstacle contacts in both the high (8.5% observed) and low (6.3% observed) conditions, and these differences did not reach significance ((1) = 0.32, p>.05). Kinematic parameters for low and high condition obstacle crossing are presented in table 2 . Pd off was significantly slowed in obstacle crossing velocity compared to ctrl (f(1, 18) = 11.317, p = .003), regardless of threat condition . Both pd off and ctrl reduced cvcom (f(1, 18) = 14.481, p = .001) while negotiating the obstacle in the high condition . Compared to ctrl participants, pd off used a smaller precrossing margin (dpre; f(1, 18) = 10.941, p = .004) with a smaller crossing step (sl; f(1, 18) = 10.993, p = .004) in both conditions . Pd off and ctrl both tended to reduce dpre in the high condition (f(1, 18) = 3.897, p = .064). In contrast, ctrl increased postobstacle horizontal clearance of the lead heel in the high condition (dpost; 33 8 cm, as compared to 23 5 cm in low), where pd off produced horizontal heel clearance values of similar small magnitudes in either condition (15 2 cm in low, 14 2 cm in high). Pd on and ctrl both decreased the crossing velocity in the high threat condition (f(1, 18) = 25.988, p <.001). Pd on used smaller crossing steps than ctrl (sl; f(1, 18) = 45.247, p <.001), but both groups decreased crossing step length in the high condition (f(1, 18) = 12.671, p = .002). In contrast, pd on used a smaller preobstacle margin than ctrl in both threat conditions (dpre; f(1, 18) = 9.510, p = .006). Postobstacle lead heel horizontal clearance approached a group threat interaction (f(1, 18) = 5.130, p = .036), with pd on leaving smaller lead heel clearance in the high condition (11 2 cm, compared to 16 2 cm in low), while ctrl increased lead heel clearance in high obstacle crossing (33 8 cm, compared to 23 5 cm in low). Pd off and pd on used significantly slower whole body com obstacle crossing velocity (cvcom; f(1, 9) = 10.252, p = .010) in the high condition . Pd patients also used a smaller crossing step in the high condition (sl; f(1, 9) = 17.663, p = .002), with pd on using smaller crossing steps than pd off in both conditions (f(1, 9) = 30.111, p <.001). Both groups exhibited non - significant decreases in precrossing toe clearance, vertical clearance, and postcrossing heel clearance in the high condition . The results of this study agreed with our hypotheses, indicating that threatening context challenged locomotion amongst people living with the parkinson disease and that obstacle crossing errors were increased, while obstacle crossing kinematics, specifically obstacle clearance distances and velocity, was decreased during threatened context trials . In addition, motor improvements potentiated amongst pd patients through conventional pharmacotherapy were not uniformly maintained in the threatening context . Pd on used small preobstacle clearance margins and small crossing steps to negotiate the obstacle . Previous studies have established that pd motor deficits are manifest in multiple aspects of gait, including initiation, steady state, and termination . We suggest that the changes in obstacle avoidance behaviour observed among pd patients in the threatening context may be the result of constraints induced when some attention is directed toward a threatening environment . Previous studies have used dual task paradigms to elicit similar obstacle negotiation deficits among neurotypical populations [23, 24]. The main finding of this study is that threatening context appears to be detrimental for pd patients . In healthy adults, perception and classification of threat the diversion of attentional resources to threatening context may lead to an attentional resource conflict, as previous studies have suggested that patients have adapted to use directed attention to initiate and control movements [10, 11, 26]. Subdividing attention may exceed available capacity, especially amongst moderate to severe pd patients, who have been shown to have decreased executive function . It is possible that the increased errors in the high condition are the result of arousal and anxiety induced by threatening context . Increased anxiety may also be a partial product of the safety precautions that surround the high condition, namely, the need for the overhead tether . Previous studies from our laboratory [79] and others have shown that anxiety - provoking contexts can lead to kinematic changes in behaviour . One limitation of the current study is the lack of state or trait anxiety measures, including fear of falling, amongst participant groups . Previous research has shown that the pd patients exhibit higher levels of anxiety and a heightened fear of falling in threatening contexts . While it is possible that the errors observed amongst pd patients completing threatened trials in this study are a partial result of raised anxiety, we did not observe changes in success rates between the low and high conditions for healthy normal adults . This finding contradicts previous research and suggests that the threat manipulation imposed in this study was not sufficient to invoke performance - inhibiting anxiety amongst the non - parkinson participants . It is possible that both attentional interference and increased anxiety contribute to the deficits observed amongst pd patients in the threatening context and that some portion of the diverted attention is consumed by perception and interpretation of threatening context . Our results show that current pharmacological treatment of pd allowed patients to achieve fewer obstacle contact errors and improve gait kinematics, though these improvements failed to reach levels equal to control participants . Furthermore, threatening context appeared to have the capacity to limit medication benefits, reducing obstacle crossing success rates and crossing kinematics for meds on pd patients to similar levels as meds off pd patients . Previous work has indicated that temporal aspects of gait (e.g., stride cadence and stride event durations) are less sensitive to dopamine replacement [13, 30]. Given the critical importance of gait cadence and response timing in obstacle negotiation, it follows that this activity may still be deficit for meds on pd patients if cadence and timing are only moderately improved with medication . One limitation of the current study is incomplete information on levodopa dosage levels, eliminating the possibility to fully consider dose - response relationships or possible confounders for persistent meds on deficits . Despite this limitation, it is possible that the increased deficits observed for medicated pd in the threatening environment reflect a situational dysfunction in the nondopaminergic neural processes at work in this environmental context . We believe that executive attentional resources are the nondopaminergic assets that are being overloaded by concurrent attentional demands from perceived environmental threat and directed focus on task control . Our findings show that obstacle negotiation amongst pd patients is compromised in a threatening context . Pd patients exhibited more obstacle contacts, decreased obstacle crossing clearance margins, and decreased approach and crossing velocities when walking in a threatening condition . Conventional pd pharmacotherapy failed to reduce obstacle contacts or increase obstacle clearance in the threatening context . Interference resulting from the attention diverted to threatening context plus the directed attention used by pd patients to initiate and control movement may be the cause of obstacle negotiation deficits.
|
Adult onset retinoblastoma is a rare intraocular malignancy that has been previously reported in the literature.12 many of the reported cases have been treated with enucleation due to the advanced nature of the disease . Focal therapy and chemotherapy have also been attempted, but with poor outcomes.34 here we report a case of adult onset retinoblastoma, which initially responded very well to chemotherapy; however, massive recurrence of the tumor necessitated enucleation of the eye . A 30-year - old female diagnosed elsewhere with choroidal melanoma with retinal detachment, presented to our emergency department with complaints of seeing black spot in front of the right eye accompanied with intermittent flashes for 20 days . On examination, the best - corrected visual acuity (bcva) was 6/9 in the right eye and 6/5 in the left eye . Intraocular pressure measured with goldmann applanation tonometry was 11 and 15 mmhg in the right and left eye, respectively . Fundus examination of the right eye revealed a large endophytic yellowish white, well - demarcated mass, with surface vascularity, located in the temporal quadrant extending up to the macula along with the presence of multiple subretinal yellowish infiltrates inferiorly [figure 1a]. There was overlying exudative retinal detachment involving the inferior portion of the retina reaching the macula . A provisional diagnosis of adult onset retinoblastoma with subretinal seeding and exudative retinal detachment was made . The patient underwent ocular ultrasound examination of the right eye which revealed a dome - shaped mass with homogenous internal structure, high surface reflectivity, and variable low to medium internal reflective echoes, with a basal circumference of 11.1 mm and height of 5.8 mm and the presence of an exudative detachment reaching up to the macula . Magnetic resonance imaging (mri) of brain also revealed a retinoblastoma in the right eye with no evidence of extraocular or optic nerve invasion . The patient subsequently underwent six cycles of chemotherapy (carboplatin, vincristine, and etoposide) combined with transpupillary thermotherapy over a period of 6 months with regular monthly follow - up . After the third cycle, the tumor mass started showing excellent regression [figure 1b]. As some residual activity was present at the end of six cycles, she underwent two more cycles of chemotherapy and by the end of 8 months, the tumor had regressed completely leaving a flat scar [figure 1c]. The lesion was quiescent for a period of about 10 months . On follow - up, 10 months after the last treatment, bcva was 6/9 in the right eye and fundus examination revealed a regressed tumor with the presence of multiple small new tumor foci in the periphery [figure 1d] which were treated with laser using indirect ophthalmoscopy and transconjunctival cryotherapy . She was followed - up for a period of 2 years and in the event of new tumor foci [figure 2a], she was given focal therapy (either transpupillary thermotherapy or cryotherapy) subsequently resulting in tumor regression [figure 2b]. After 2 years, at a follow - up visit, the bcva had decreased to 6/60 in the right eye and fundus examination revealed significant media haze due to massive vitreous seeding [figure 2c] and the presence of complicated cataract along with a substantial increase in the tumor size [figure 2d]. As the tumor showed further progression over the next 2 - 3 months, the patient was advised to undergo enucleation with ball implant with the aim of preventing further tumor spread and she agreed . Histopathologic examination of the enucleated globe revealed a moderately differentiated retinoblastoma with choroidal invasion of more than 3 mm and presence of tumor cells in the anterior fibers of the sclera ., she was advised 6 cycles of adjuvant chemotherapy; however, patient was not keen to undergo treatment and underwent just one cycle of chemotherapy and then discontinued treatment . On her last follow - up visit, 6 months later, the socket was healthy and the left eye remains normal . (a) presence of a large endophytic lesion with surface vascularity and overlying exudative retinal detachment and numerous subretinal infiltrates inferiorly . (b) significant resolution of the exudative retinal detachment with marked reduction in the tumor size, the vascularity and the inferior subretinal infiltrates following three cycles of chemotherapy . (c) complete regression of the tumor resulting in a scar at the end of eight cycles of chemotherapy . (d) presence of the scarred tumor along with small active tumor foci in the inferior and nasal periphery at 10-month follow - up after tumor regression color fundus photos of the right eye showing . (a) presence of larger peripheral active tumors along the old inactive scarred tumors . (c) significant media haze due to vitreous seeding and complicated cataract, with hazy view of the disc and the tumor . (d) large tumor masses in inferior periphery with extensive surface vascularity and exudative retinal detachment presence of calcification on ultrasonography and computerised tomography (ct) scan is not mandatory for diagnosis of retinoblastoma in adults as seen in the present case and also in other reports.4 the behavior of adult onset retinoblastoma is very similar to the childhood disease . Enucleation is the primary modality of treatment in adults,15 mainly due to the large tumor size and the late presentation . Though there have been reports of spontaneous regression6 as well as tumors showing initial response when treated with brachytherapy and or cryotherapy, they may recur34 eventually leading to enucleation . What was unique to our case was that it showed excellent response initially and had near normal vision and then failed therapy with reactivation necessitating enucleation . Whether it is the genetic make - up of the adult onset retinoblastoma that makes it difficult to salvage the eye, attempts to salvage the globe in adult onset retinoblastoma with chemoreduction and focal therapy may be possible; however, regular long - term follow - up is needed for potential recurrence, which mandate timely intervention.
|
Healthy skin protects against the effects of environmental hazards, such as ultraviolet radiation in sunlight, low humidity, and wind.2 dry skin affects many people, occurring when skin loses its water content, causing the skin to appear dry, rough, and scaly, possibly with reddening, cracking, and itching.3 when the skin becomes dry, the epidermal layer loses its ability to retain moisture . Without protection or treatment, the skin cannot repair itself, leading to persistently dry skin.4 several treatments can be used to restore dry skin or protect it from dryness . A topically applied moisturizer is the main treatment, which makes the epidermal layer of the skin softer and more pliable by enhancing hydration and decreasing water evaporation . Application of an occlusive mask to the skin can also improve hydration and protect against water loss from the epidermis.5 masks can be produced from various sources . Cellulose masks obtained from natural sources, such as bacteria, are of interest because of their low toxicity and biodegradable properties . Acetobacter xylinum, a bacterium, can produce acid from glucose and synthesize cellulose.6 it creates cellulose from sugars and related substrates via the pentose cycle.7 bacterial cellulose has been widely used as a stabilizer in foods and cosmetics . In the form of a film, it can be used in surgical procedures and for dental implants.8 recently, bacterial cellulose obtained from acetobacter xylinum culture was characterized and found to be composed of long, smooth, and oriented fibrils and to exhibit considerable thermal stability.9 therefore, it was of interest for use as a bacterial cellulose cosmetic device, in particular as a facial mask . The objectives of this study were to determine the in vivo efficacy of a cellulose mask obtained from acetobacter xylinum in changing skin characteristics and to evaluate user satisfaction after a single application . If a product can provide the expected results and achieve a high level of user satisfaction after single use, it is likely that the user will purchase that product again . Briefly, broken - milled rice (oryza sativa) was used as the feeding substrate and distilled water was used as a medium for growth of acetobacter xylinum . Under appropriate incubation, the bacterium could synthesize cellulose . The cellulose with absorbed water obtained was cut into a face shape with holes for the eyes, nose and mouth at the correct positions . The finished products were sterilized by steam in an autoclave at 121c for 15 minutes . The manufacturer reported that the masks were nonirritant and satisfactory when studied in 16 thai women.10 thirty healthy thai volunteers aged 2140 years participated in testing of the efficacy of the cellulose mask for improvement of skin characteristics . Twenty - three, five, and two volunteers were in the age ranges of 2125, 2630, and 3140 years, respectively . The sample size was estimated to be sufficient to detect a difference between two population means when the probability of type i error () and that of type ii error () was set at 0.05 and 0.20, respectively . The study was carried out with the approval of the ethics committee of the faculty of pharmaceutical sciences at prince of songkla university, songkhla, thailand . All volunteers gave their informed written consent and underwent testing for any skin irritation that might be caused by the cellulose mask before the study . No skin irritation occurred when the cellulose mask was applied to the lateral arm for 24 hours, so all volunteers were able to be included in the study . The experiment was done in a laboratory room where the temperature and relative humidity was controlled at 25c and 50%, respectively . For the first test, volunteers in the group were assigned to apply moist towels to the face for 25 minutes, while volunteers in the other group were assigned to apply the trial masks to the face for the same time period . One week later the experiment was repeated, with the volunteers changing over to the alternative treatment . Skin moisture, sebum, elasticity, texture, dullness, and desquamation levels were assessed before applying the sample and five minutes after removing it using a tool normally used as part of routine skin counseling (moritex corporation, tokyo, japan).11 the skin counseling system consists of a touch screen computer with a sensor and a scope to evaluate sebum, moisture, elasticity, texture, and dullness of the skin . The values obtained are reported as percentages, and ranked as low, medium and high, in comparison with reference values in a population of the same age range provided by the manufacturer . To evaluate desquamation, a 2 cm 1 cm the sticker was applied to the experimental area of skin for one minute and then peeled off . Afterwards, the surface of the sticker containing a sample of the skin from each volunteer was attached to the lens window of the scope, which was then used to rate the condition of the skin . Texture, dullness, and desquamation were ranked as a, b, or c good, fair, or poor, respectively, when compared with reference values . At the end of the study, all volunteers completed a questionnaire rating their degree of satisfaction with the cellulose mask on a five - point scale (excellent = 5, good = 4, fair = 3, poor = 2, very poor = 1). The paired t - test and t - test were used to identify statistically significant differences in skin characteristics before and after using the trial product and between the trial product and the control, respectively . Briefly, broken - milled rice (oryza sativa) was used as the feeding substrate and distilled water was used as a medium for growth of acetobacter xylinum . Under appropriate incubation, the bacterium could synthesize cellulose . The cellulose with absorbed water obtained was cut into a face shape with holes for the eyes, nose and mouth at the correct positions . The finished products were sterilized by steam in an autoclave at 121c for 15 minutes . The manufacturer reported that the masks were nonirritant and satisfactory when studied in 16 thai women.10 thirty healthy thai volunteers aged 2140 years participated in testing of the efficacy of the cellulose mask for improvement of skin characteristics . Twenty - three, five, and two volunteers were in the age ranges of 2125, 2630, and 3140 years, respectively . The sample size was estimated to be sufficient to detect a difference between two population means when the probability of type i error () and that of type ii error () was set at 0.05 and 0.20, respectively . The study was carried out with the approval of the ethics committee of the faculty of pharmaceutical sciences at prince of songkla university, songkhla, thailand . All volunteers gave their informed written consent and underwent testing for any skin irritation that might be caused by the cellulose mask before the study . No skin irritation occurred when the cellulose mask was applied to the lateral arm for 24 hours, so all volunteers were able to be included in the study . The experiment was done in a laboratory room where the temperature and relative humidity was controlled at 25c and 50%, respectively . For the first test, volunteers in the group were assigned to apply moist towels to the face for 25 minutes, while volunteers in the other group were assigned to apply the trial masks to the face for the same time period . One week later the experiment was repeated, with the volunteers changing over to the alternative treatment . Skin moisture, sebum, elasticity, texture, dullness, and desquamation levels were assessed before applying the sample and five minutes after removing it using a tool normally used as part of routine skin counseling (moritex corporation, tokyo, japan).11 the skin counseling system consists of a touch screen computer with a sensor and a scope to evaluate sebum, moisture, elasticity, texture, and dullness of the skin . The values obtained are reported as percentages, and ranked as low, medium and high, in comparison with reference values in a population of the same age range provided by the manufacturer . To evaluate desquamation, a 2 cm 1 cm the sticker was applied to the experimental area of skin for one minute and then peeled off . Afterwards, the surface of the sticker containing a sample of the skin from each volunteer was attached to the lens window of the scope, which was then used to rate the condition of the skin . Texture, dullness, and desquamation were ranked as a, b, or c good, fair, or poor, respectively, when compared with reference values . At the end of the study, all volunteers completed a questionnaire rating their degree of satisfaction with the cellulose mask on a five - point scale (excellent = 5, good = 4, fair = 3, poor = 2, very poor = 1). The paired t - test and t - test were used to identify statistically significant differences in skin characteristics before and after using the trial product and between the trial product and the control, respectively . The cellulose mask was a translucent patch which could be fitted onto the face as demonstrated in figure 1 . The skin sebum level after moist towel application was 51.43 12.24% and after using the trial cellulose mask was 50.57 12.09% . The skin elasticity level after moist towel application was 44.30 12.73% and after using the trial cellulose mask was 46.70 8.78% . The skin moisture content after moist towel application was 47.33 7.81% and after using the trial cellulose mask was 61.23 10.84% . It was also noted that, after using the cellulose mask, skin moisture levels increased by between 7% and 28%, without changes in the other parameters, ie, sebum and elasticity levels, as shown in table 1 . Data for skin texture and dullness and keratin desquamation are also reported in table 1 . There was no significant difference between grades obtained for skin texture after moist towel application and those after application of the cellulose mask . Skin transparency improved in eight of the 30 volunteers (26.7%) when using the cellulose mask . However, there was no detectable change in degree of pigmentation between the two treatments . Signs of keratin desquamation were not significantly different after moist towel application, but changed from grade b c to grade a in seven cases (23.3%) after using the cellulose mask . All the volunteers completed and returned their satisfaction questionnaires, the answers to which are reported in table 2 . These results indicate that a single application of the cellulose mask did not significantly reduce sebum levels or increase elasticity of the skin (p> 0.05). However, it did significantly enhance moisture uptake (p <0.05). The water content in formulations or devices used for skin hydration is an important consideration.12 like many moisturizers, cellulose masks can absorb moisture from the environment.13 using the cellulose mask, absorption of moisture by the skin occurred due to the high concentration gradient of water between the mask and the skin . The occlusive effect of the cellulose mask administered to facial skin for 25 minutes can reduce transepidermal water loss,14 with efficacy of moisture uptake varying according to the skin condition of the individual volunteers . The increased skin moisture content achieved by the cellulose mask did not improve skin texture, dullness, and desquamation significantly when compared with moist towel application (p> 0.05). However, a minority of the volunteers did achieve improved skin transparency and desquamation after applying the cellulose mask, the reasons for which are unclear . It is possible that different subjects responded differently to hydration after topical application of the cellulose mask depending on their general health, skin condition, age, gender, and possibly other factors . In a previous study, it was reported that eight of thirty - four volunteers had a significantly greater reduction in eye puffiness after application of caffeine gel than after placebo (p <0.05), while most volunteers did not show a differential response to these two products.15 the results from our questionnaires demonstrated that the odor, color, and texture of the cellulose masks were acceptable to the subjects, the majority of whom rated the cellulose mask comfortable to use and able to provide skin hydration within an acceptable period . Overall, user satisfaction with the cellulose mask was rated as good . In the future, it is possible that cosmetically active compounds, eg, for skin - whitening and antiageing, will be able to be incorporated into such cellulose masks as nanoformulations, which are likely to meet user demands further.16,17 the cellulose mask derived from acetobacter xylinum could be used as a natural cosmetic product in order to increase moisture uptake in the skin . Single application of the cellulose mask significantly enhanced moisture uptake by the skin when compared with moist towel application (p <0.05). However, it did not change skin characteristics to a significant degree . The responses to the satisfaction questionnaire used in this trial suggest that the cellulose mask is acceptable to users.
|
Cryptococcus is a human fungal pathogen that is responsible for the majority of fungal meningitis cases in immunocompromised and immunosuppressed people [12, 13]. Cryptococcus can remain dormant without producing any clinical symptoms for years and can be activated once the immune system of the host gets weakened [12, 14]. However, this fungus can undergo transition between the yeast and various other morphological forms (fig . The single genetic locus (the mat locus) that encodes one of the two idiomorphic alleles determines whether the cell is of the mata or the mat sexual types . Nuclear fusion occurs prior to or at the basidium, which is a swollen structure at hyphal tip (fig . 1) [15, 18]. Meiosis and sporulation subsequently occur at the basidium . In case of bisexual mating, cell fusion takes place between haploid cells of opposite mating types, mata and mat, as shown in fig . Is followed by the formation of a dikaryotic heterokaryon (zygote), which then generates dikaryotic hyphae with fused clamp cells . The two parental nuclei remain congressed but unfused until the formation of the basidium [15, 18]. Again, meiosis and sporulation occur at the basidia . For the discussion of mitochondrial dna inheritance, we will mostly focus on the bisexual mating of cryptococcus, as progeny from unisexual mating between two mat cells are shown to inherit mitochondrial dna from either parent (table 1). Molecular and cell biological studies on cryptococcus bisexual mating have led to the discovery of the essential roles of the pheromone sensing mitogen - activated protein kinase (mapk) pathway in sexual reproduction . Some of these components involved in this pathway are encoded in the mat locus [30, 31]. For more detailed information on the molecular events of mating, please refer to the following reviews [19, 20, 32, 33]. In the majority of higher eukaryotes, mitochondrial dna is inherited from only one of the two parents involved in the mating . Given that bisexual mating involves the fusion between two isogamous cells of the a and mating types, the observation that mitochondrial dna inheritance is uniparental from the mata parent is mesmerizing [25, 26]. The authors expected a biparental mitochondrial inheritance as bisexual mating involves the fusion of two isogamous cells . Surprisingly, their results showed that the mitochondrial dna of the progeny tested was inherited uniparentally from the mata parent in a cross between the mata and the mat cells . To differentiate the mitochondrial genotype of the mata or the mat parent, the authors used two different varieties of cryptococcus, known as serotype a and serotype d, as the mating partners . These two serotypes have different mitochondrial genotypes, which can be easily distinguished by restriction fragment length polymorphism of the mitochondrial ribosomal rna subunit region . The results for mitochondrial inheritance in c. neoformans involving various crosses are summarized in table 1 . To examine when the mitochondrial dna inheritance pattern is determined during mating process, the authors obtained various cell types generated at different stages of mating (cell fusion products, vegetative blastospores, hyphae, and meiotic basidiospores, as shown in fig . 1) by collecting cells at locations with varied distances from the original site of parental yeast cells . The authors expected that cells generated nearer to the original mating site would be heteroplasmic; that is, mitochondria of these cells were a mix of two types of mitochondria originated from both the parents . Surprisingly, the authors found that the sampling location, which reflects different cell type or different stages of mating, did not have any measurable effect on the uniparental mitochondrial dna inheritance pattern observed . To avoid any complication in mitochondrial inheritance due to potential differences in mating behavior of different serotypes, follow - up experiments using strains of the same serotype but carrying different mitochondrial dna was conducted . Strains were generated by dissecting vegetative haploid uninuclear blastospores budded off from dikaryotic hyphae (fig . The nucleus of a blastospore could come from either one of the two parental nuclei from the dikaryotic hyphae . However, the mitochrondrial genome of the blastospores would primarily be from the mata parent, based on the previous study . Thus, the authors could potentially switch the mitochondrial genome of a mat strain to a different one by crossing this mat strain with a mata strain with the desired mitochondrial genome, and then dissect blastospores containing the mat nuclei . Using such strategies, a serotype d mat strain with a serotype a mitochondrial dna (from a serotype a mata strain) could be generated, or vice versa . Subsequently, such strains derived from blastospores could be crossed with other strains having the same nuclear genetic background (same serotype) with their native mitochondria . Crosses between these strains with the same nuclear genetic background would avoid any potential biases introduced by using strains of different serotypes (table 1). The results from analyzing the mitochondrial dna in the progeny from crosses of these strains again showed the uniparental mitochondrial dna inheritance from the mata parent . Consistent with the previous study by the same authors, the use of hyphae, blastospores, or basidiospores all gave the same result of uniparental mitochondrial dna inheritance from the mata parent . To understand the factors affecting uniparental mitochondrial inheritance in cryptococcus, various environmental factors and chemicals have been tested, including temperature, ultraviolet (uv) irradiation, 5-adc (a methylation inhibitor), and ammonium chloride (an inhibitor of ubiquitination). The use of 5-adc or ammonium chloride did not have any effect on the inheritance pattern whereas strong uv irradiation and high temperatures did seem to have an effect (table 1). In these crosses, the frequency of mitochondrial inheritance from the mat parent increased compared to that of control, which was done at room temperature . Ploidy also seems to affect mitochondrial inheritance . In crosses between haploid and diploid parental strains (mata mat/ or mat mata / a), the number of progenies that were not homoplasmic for the mitochondrial dna from the mata or the mata / a parent were significantly higher than in a typical bisexual cross involving two haploid parents, although the majority of the progeny still inherited mitochondrial dna from the mata or the mata / a parent . This is surprising as one would expect more extreme uniparental mitochondrial dna inheritance from the diploid mata / a parent given that mata / a diploid cells are larger than mat haploid cells . Their result supports that cell size is not an important factor in determining mitochondrial inheritance pattern in cryptococcus . In the majority of eukaryotes the simplest explanation for this phenomenon is that the mating partner with the greater cytoplasmic content contributes towards mitochondrial inheritance . The quantitative difference of mitochondria eventually gives the gamete with larger cytoplasm a replicative advantage . This morphological / size difference between mating partners is conceptually simple for the understanding of mitochondrial inheritance in organisms where matings involve anisogamous partners . However, the molecular mechanisms underlying mitochondrial inheritance even in these organisms appear to be much more complicated, as will be discussed below . The uniparental mitochondrial inheritance pattern observed in organisms where mating involves isogamous partners cannot be simply explained by the quantitative difference in cytoplasm (or the mitochondria) of the mating partners . Many hypotheses have sought to explain the predominantly uniparental mitochondrial inheritance trend across various kingdoms of eukaryotes . No single hypothesis or mechanism has been able to satisfactorily explain this wide - spread phenomenon . Because an egg is much bigger than a sperm, it was assumed that the uniparental mitochondrial inheritance in mammals was simply due to the failure of mitochondria from the sperm to enter the egg . However, studies utilizing electron microscopy and molecular techniques have shown this not to be the case . Mitochondria in the sperm midpiece (middle segment of spermatozoa that consists of mitochondria) are present in a newly fertilized egg and are likely eliminated later . Elimination of the mitochondria from sperm is proposed to be mediated by ubiquitination, a process of degradation of protein tagged with ubiquitin . Sperm mitochondria can already be tagged with ubiquitin during spermatogenesis prior to fertilization; studies on rhesus, bovine, and human have shown that ubiquitination of sperm mitochondria might be responsible for the uniparental mitochondrial inheritance in mammals . Another proposition about uniparental mitochondrial inheritance is the dilution effect of sperm mitochondria in the oocyte . The fertilized egg contains about 50~100 mitochondria from sperm midpiece, whereas the oocyte contains 10 to 10 mitochondria . During each replication cycle, the sperm mitochondria become further diluted due to the replicative advantage offered by the high copy number of mitochondria from the oocyte . An alternative hypothesis to explain the targeted elimination of sperm mitochondrial was proposed based on the mitochondrial theory of aging . According to this theory, production of atp by oxidative phosphorylation, the major function of mitochondria, is inimical for its own maintenance due to the generation of free radicals during electron transport . Fertilization requires the sperm to be highly mobile, which demands a large amount of atp, whereas the egg cell remains immobile and, thus, minimizes oxidative damage by repressing oxidative phosphorylation . Hence, the sperm sacrifices its mitochondrial genome due to oxidative damage, whereas the female mitochondrial genome is protected so it can be transmitted faithfully to offspring . Similarly, elimination of mitochondrial dna from one parent through exclusion of its cytoplasm during fertilization has also been proposed for plants . In s. cerevisiae mating in s. cerevisiae involves fusion of two isogamous cells of mating types a and, and the mitochondrial inheritance pattern in cells derived from the zygote is biparental sometimes and uniparental at other times [42 - 44]. Mitochondrial inheritance in s. cerevisiae depends on the position where the first bud arises from the zygote . If the first bud arises from the center of the zygote, then it contains mitochondrial dna from both parents; if the first bud arises from the end position of the zygote, then it contains mitochondrial dna from only one of the parents . The choice of parents depends on which parental end of the zygote the bud arises from . For instance, about 80% of the first end buds are pure for uniparental mitochondrial genotype . In case of first center buds, indeed, such inheritance pattern requires that the parental mitochondrial dna not be mixed completely in the zygote . Consistently, the mixing of the mitochondrial dna in the zygote has been found to be a slow proces . Limited mixing and non - random sorting of mitochondrial dna in s. cerevisiae were also documented in another study . Through labeling of mitochondrial proteins by vital dye and gfp, the authors found that there was complete mixing of the mitochondrial proteins from both the parents in the zygote . In contrast, the mitochondrial dna remained localized to one place in the zygote . For zygotes that contained mitochondria from both parents, most of their mitotic progeny were pure for mitochondrial dna from one parent or the other by around 20 generations . The authors suggested that sorting of the mitochondrial dna in the progeny is a non - random process; otherwise it would take more than 20 generations to reach homoplasmic state with just one mitochondrial dna type . Given the findings in saccharomyces, uniparental mitochondrial inheritance in isogamous species like the fungus c. neoformans and the alga chlamydomonas reinhardtii is surprising . In the unicellular alga c. reinhardtii however, mitochondrial dna inheritance is uniparental from the mt parent [45, 46]. The latter study examined the identity of mitochondrial dna in single zygote cells by nested pcr followed by restriction digestion . To determine the timing of the elimination of mt mitochondrial dna, single zygotes from matings were isolated at various time points and the identity of their mitochondrial dna however, only the mt parent's mitochondrial dna was detected in zygotes by 12 hr . Thus, elimination of mitochondrial dna from one parent after the formation of zygote takes time and is not an immediate process . Although mating in c. neoformans involves fusion of two isogamous cells, the mitochondrial inheritance is uniparental from the mata parent, similar to what is observed in c. reinhardtii . It is not known whether mitochondrial dna from the mat parent gets transferred to the zygote, and, if it does, when it is destroyed or eliminated during sexual development . Although mechanisms underlying the uniparental mitochondrial dna inheritance in cryptococcus are still unclear, it is conceivable that it must be intimately associated with the mating process . Indeed, disruption of the mat cell identity gene, sxi1, changes the mitochondrial dna inheritance pattern from uniparental to biparental . The cross between a wt mata strain and a mat sxi1 mutant resulted in mitochondrial inheritance from either the mata or the mat parent . The corresponding sex specific homeodomain gene sxi2a in mata strains is also crucial for the uniparental mitochondrial dna inheritance (table 1). This is consistent with previous findings that sxi1 and sxi2a form a heterocomplex to direct sexual development after the cell fusion event during bisexual mating (fig . 1). The fact that sxi1 or sxi2a do not impair unisexual mating may explain the biparental mitochondrial inheritance during unisexual mating (unpublished results) [19, 24]. Despite the apparent importance of these two sex specific transcription factors, how their hetero - complex controls the uniparental mitochondrial inheritance in bisexual mating remains unknown . Some may function at pre - zygotic stages, while some may function at post - zygotic stages . One hypothesis for the uniparental mitochondrial inheritance in c. neoformans was that the nucleus from the mat cell migrates unidirectionally to the mata cell, leaving behind its mitochondria as a result . Mcclelland and his colleagues in 2004 demonstrated that there was indeed unidirectional migration of the nucleus into a cell based on cytological evidence . In contrast, nuclear migration after hyphal fusion (anastomosis) between compatible mating types in another basidiomycetous fungus coprinus cinereus, is bidirectional . The resulting coprinus dikaryon contains both parental nuclear genomes, but its cytoplasmic content could be from either parent . Consequently, the mitochondria inherited in the coprinus dikaryon rely on the mitochondria of the recipient mycelia . Hence, one possible post - zygotic mechanism that controls mitochondrial dna inheritance in c. neoformans is based on the observation that after nuclear migration and conjugation between a and cells, preferential dikaryotic hyphal formation takes place only from the end of the original mata parent (fig . 1). This phenomenon is analogous to the budding from saccharomyces zygotes where the mitochondrial dna of the progeny depends on the position of the bud from the zygote . Thus, uniparental mitochondrial inheritance in cryptococcus from the mata parent could be the result of the position of the emerging dikaryotic hyphae from the mata side of the zygote . Consistent with these observations, it has been proposed that incomplete mixing of the cytoplasmic content and the preference of hyphal formation from the mata parent side determine the uniparental mitochondrial inheritance in cryptococcus . To test this hypothesis, the incubation temperature after the early stages of mating was increased, presumably right after a and cells fuse to form a zygote . High temperatures inhibited growth of dikaryotic hyphae, and induced the fusion between the two parental nuclei in the dikaryon to become a diploid . Yet again, uniparental mitochondrial inheritance from the mata cell was observed, refuting the original hypothesis . It was assumed that the zygote formed a diploid after cell and nuclear fusion of the two parental a and cells, and that the diploid did not go through the filamentous stage and cytoplasmic mixing occurred . However, it is possible that there might be incomplete cytoplasmic mixing in the diploid cells, or that subsequent cytokinesis occurred prior to sufficient cytoplasmic mixing . Furthermore, diploids could be derived from the original zygote, or dikaryotic hyphal compartments subsequently formed from the zygote . Thus, diploids obtained might not reflect the state of the original zygote prior to filamentation . The temperature increase needs to be controlled at the right moment after cell fusion to prevent the emergence of filament . It is difficult, if not impossible, to control a heterogeneous population undergoing mating and to stop the process of every mating pair at the same stage where cell fusion has just occurred . Thus, some zygotes might well be on their way of sending emerging hyphae, or had already done so, when the temperature increased . By this time, the mitochondrial dna inheritance pattern of the collected cells might have been already determined as expected from normal matings . So, to test the contribution of incomplete mixing of the cytoplasmic content, or the preference of hyphal formation from the mata parent side of the initial zygote to mitochondrial inheritance, techniques allowing exact control of developmental stages of zygotes are going to be critical . Selective degradation of the mat mitochondrial dna in the zygote through the action of sxi1 and sxi2a complex is also proposed to explain the unidirectional and uniparental mitochondrial inheritance in cryptococcus [24, 29]. According to this hypothesis, deletion of the sxi1 or the sxi2a gene may prevent such degradation, resulting in the biparental mitochondrial inheritance as shown in table 1 . However, this hypothesis still needs to be vigorously tested as other events of mating controlled by this heterocomplex might also yield the same results . In the majority of eukaryotes, mitochondrial dna is inherited uniparentally [5, 10]. The simplest explanation for this phenomenon is that the mating partner with the greater cytoplasmic content contributes towards mitochondrial inheritance . The quantitative difference of mitochondria eventually gives the gamete with larger cytoplasm a replicative advantage . This morphological / size difference between mating partners is conceptually simple for the understanding of mitochondrial inheritance in organisms where matings involve anisogamous partners . However, the molecular mechanisms underlying mitochondrial inheritance even in these organisms appear to be much more complicated, as will be discussed below . The uniparental mitochondrial inheritance pattern observed in organisms where mating involves isogamous partners cannot be simply explained by the quantitative difference in cytoplasm (or the mitochondria) of the mating partners . Many hypotheses have sought to explain the predominantly uniparental mitochondrial inheritance trend across various kingdoms of eukaryotes . No single hypothesis or mechanism has been able to satisfactorily explain this wide - spread phenomenon . Because an egg is much bigger than a sperm, it was assumed that the uniparental mitochondrial inheritance in mammals was simply due to the failure of mitochondria from the sperm to enter the egg . However, studies utilizing electron microscopy and molecular techniques have shown this not to be the case . Mitochondria in the sperm midpiece (middle segment of spermatozoa that consists of mitochondria) are present in a newly fertilized egg and are likely eliminated later . Elimination of the mitochondria from sperm is proposed to be mediated by ubiquitination, a process of degradation of protein tagged with ubiquitin . Sperm mitochondria can already be tagged with ubiquitin during spermatogenesis prior to fertilization; studies on rhesus, bovine, and human have shown that ubiquitination of sperm mitochondria might be responsible for the uniparental mitochondrial inheritance in mammals . Another proposition about uniparental mitochondrial inheritance is the dilution effect of sperm mitochondria in the oocyte . The fertilized egg contains about 50~100 mitochondria from sperm midpiece, whereas the oocyte contains 10 to 10 mitochondria . During each replication cycle, the sperm mitochondria become further diluted due to the replicative advantage offered by the high copy number of mitochondria from the oocyte . An alternative hypothesis to explain the targeted elimination of sperm mitochondrial was proposed based on the mitochondrial theory of aging . According to this theory, production of atp by oxidative phosphorylation, the major function of mitochondria, is inimical for its own maintenance due to the generation of free radicals during electron transport . Fertilization requires the sperm to be highly mobile, which demands a large amount of atp, whereas the egg cell remains immobile and, thus, minimizes oxidative damage by repressing oxidative phosphorylation . Hence, the sperm sacrifices its mitochondrial genome due to oxidative damage, whereas the female mitochondrial genome is protected so it can be transmitted faithfully to offspring . Similarly, elimination of mitochondrial dna from one parent through exclusion of its cytoplasm during fertilization has also been proposed for plants . In s. cerevisiae, mitochondrial dna inheritance is biparental . Mating in s. cerevisiae involves fusion of two isogamous cells of mating types a and, and the mitochondrial inheritance pattern in cells derived from the zygote is biparental sometimes and uniparental at other times [42 - 44]. Mitochondrial inheritance in s. cerevisiae depends on the position where the first bud arises from the zygote . If the first bud arises from the center of the zygote, then it contains mitochondrial dna from both parents; if the first bud arises from the end position of the zygote, then it contains mitochondrial dna from only one of the parents . The choice of parents depends on which parental end of the zygote the bud arises from . For instance, about 80% of the first end buds are pure for uniparental mitochondrial genotype . In case of first center buds, only 30~45% are pure for one parental genotype . Indeed, such inheritance pattern requires that the parental mitochondrial dna not be mixed completely in the zygote . Consistently, the mixing of the mitochondrial dna in the zygote has been found to be a slow proces . Limited mixing and non - random sorting of mitochondrial dna in s. cerevisiae were also documented in another study . Through labeling of mitochondrial proteins by vital dye and gfp, the authors found that there was complete mixing of the mitochondrial proteins from both the parents in the zygote . In contrast, the mitochondrial dna remained localized to one place in the zygote . For zygotes that contained mitochondria from both parents, most of their mitotic progeny were pure for mitochondrial dna from one parent or the other by around 20 generations . The authors suggested that sorting of the mitochondrial dna in the progeny is a non - random process; otherwise it would take more than 20 generations to reach homoplasmic state with just one mitochondrial dna type . Given the findings in saccharomyces, uniparental mitochondrial inheritance in isogamous species like the fungus c. neoformans and the alga chlamydomonas reinhardtii is surprising . In the unicellular alga c. reinhardtii, mating involves the fusion of two isogamous cells, mt and mt . However, mitochondrial dna inheritance is uniparental from the mt parent [45, 46]. The latter study examined the identity of mitochondrial dna in single zygote cells by nested pcr followed by restriction digestion . To determine the timing of the elimination of mt mitochondrial dna, single zygotes from matings were isolated at various time points and the identity of their mitochondrial dna was examined . However, only the mt parent's mitochondrial dna was detected in zygotes by 12 hr . Thus, elimination of mitochondrial dna from one parent after the formation of zygote takes time and is not an immediate process . Although mating in c. neoformans involves fusion of two isogamous cells, the mitochondrial inheritance is uniparental from the mata parent, similar to what is observed in c. reinhardtii . It is not known whether mitochondrial dna from the mat parent gets transferred to the zygote, and, if it does, when it is destroyed or eliminated during sexual development . Although mechanisms underlying the uniparental mitochondrial dna inheritance in cryptococcus are still unclear, it is conceivable that it must be intimately associated with the mating process . Indeed, disruption of the mat cell identity gene, sxi1, changes the mitochondrial dna inheritance pattern from uniparental to biparental . The cross between a wt mata strain and a mat sxi1 mutant resulted in mitochondrial inheritance from either the mata or the mat parent . The corresponding sex specific homeodomain gene sxi2a in mata strains is also crucial for the uniparental mitochondrial dna inheritance (table 1). This is consistent with previous findings that sxi1 and sxi2a form a heterocomplex to direct sexual development after the cell fusion event during bisexual mating (fig . 1). The fact that sxi1 or sxi2a do not impair unisexual mating may explain the biparental mitochondrial inheritance during unisexual mating (unpublished results) [19, 24]. Despite the apparent importance of these two sex specific transcription factors, how their hetero - complex controls the uniparental mitochondrial inheritance in bisexual mating remains unknown . Some may function at pre - zygotic stages, while some may function at post - zygotic stages . One hypothesis for the uniparental mitochondrial inheritance in c. neoformans was that the nucleus from the mat cell migrates unidirectionally to the mata cell, leaving behind its mitochondria as a result . Mcclelland and his colleagues in 2004 demonstrated that there was indeed unidirectional migration of the nucleus into a cell based on cytological evidence . In contrast, nuclear migration after hyphal fusion (anastomosis) between compatible mating types in another basidiomycetous fungus coprinus cinereus, is bidirectional . The resulting coprinus dikaryon contains both parental nuclear genomes, but its cytoplasmic content could be from either parent . Consequently, the mitochondria inherited in the coprinus dikaryon rely on the mitochondria of the recipient mycelia . Hence, one possible post - zygotic mechanism that controls mitochondrial dna inheritance in c. neoformans is based on the observation that after nuclear migration and conjugation between a and cells, preferential dikaryotic hyphal formation takes place only from the end of the original mata parent (fig . This phenomenon is analogous to the budding from saccharomyces zygotes where the mitochondrial dna of the progeny depends on the position of the bud from the zygote . Thus, uniparental mitochondrial inheritance in cryptococcus from the mata parent could be the result of the position of the emerging dikaryotic hyphae from the mata side of the zygote . Consistent with these observations, it has been proposed that incomplete mixing of the cytoplasmic content and the preference of hyphal formation from the mata parent side determine the uniparental mitochondrial inheritance in cryptococcus . To test this hypothesis, the incubation temperature after the early stages of mating was increased, presumably right after a and cells fuse to form a zygote . High temperatures inhibited growth of dikaryotic hyphae, and induced the fusion between the two parental nuclei in the dikaryon to become a diploid . Yet again, uniparental mitochondrial inheritance from the mata cell was observed, refuting the original hypothesis . It was assumed that the zygote formed a diploid after cell and nuclear fusion of the two parental a and cells, and that the diploid did not go through the filamentous stage and cytoplasmic mixing occurred . However, it is possible that there might be incomplete cytoplasmic mixing in the diploid cells, or that subsequent cytokinesis occurred prior to sufficient cytoplasmic mixing . Furthermore, diploids could be derived from the original zygote, or dikaryotic hyphal compartments subsequently formed from the zygote . Thus, diploids obtained might not reflect the state of the original zygote prior to filamentation . The temperature increase needs to be controlled at the right moment after cell fusion to prevent the emergence of filament . It is difficult, if not impossible, to control a heterogeneous population undergoing mating and to stop the process of every mating pair at the same stage where cell fusion has just occurred . Thus, some zygotes might well be on their way of sending emerging hyphae, or had already done so, when the temperature increased . By this time, the mitochondrial dna inheritance pattern of the collected cells might have been already determined as expected from normal matings . So, to test the contribution of incomplete mixing of the cytoplasmic content, or the preference of hyphal formation from the mata parent side of the initial zygote to mitochondrial inheritance, techniques allowing exact control of developmental stages of zygotes are going to be critical . Selective degradation of the mat mitochondrial dna in the zygote through the action of sxi1 and sxi2a complex is also proposed to explain the unidirectional and uniparental mitochondrial inheritance in cryptococcus [24, 29]. According to this hypothesis, deletion of the sxi1 or the sxi2a gene may prevent such degradation, resulting in the biparental mitochondrial inheritance as shown in table 1 . However, this hypothesis still needs to be vigorously tested as other events of mating controlled by this heterocomplex might also yield the same results . It is possible that no one single mechanism can fully explain the uniparental mitochondrial inheritance pattern seen in majority of eukaryotes . For example, the oxidative theory for mammalian mitochondrial inheritance is unable to explain why there is uniparental mitochondrial inheritance even during in vitro fertilization where the oxidative damage to sperm cell is nominal . In case of mammals, both size differences during gametogenesis and ubiquitin tagging of sperm mitochondria during spermatogenesis prior to the cell fusion event contribute to the uniparental mitochondrial inheritance . It is puzzling why one or the other events predominate in various species . In c. neoformans cell size is not an important factor in determining mitochondrial inheritance and there is still a lack of convincing evidence to support the hypothesis regarding selective degradation of the mat mitochondria . First, the use of methylation inhibitor (5-adc) or ubiquitination inhibitor (ammonium chloride) did not influence the mitochondrial inheritance pattern in bisexual mating . Second, the ectopic integration of sxi1 or sxi12a into mata or mat cells, respectively, prior to mating produced a minimal impact on the mitochondrial inheritance during mating . However, one common theme that can be extracted from all these hypotheses is that mating events and critical mating components like sxi1 and sxi2a are going to be the determining factors of the mitochondrial inheritance . Transmission of mitochondrial dna can be controlled at various checkpoints during sexual development including the prezygotic stages and postzygotic stages . Techniques allowing controlled manipulation of these developmental events will help shed light on the mechanisms of mitochondrial inheritance.
|
Atherosclerotic stenoses of the coeliac, superior mesenteric and inferior mesenteric arteries are common . In a retrospective review of 980 angiographic studies by thomas et al . However, extensive collateral vessels often form between the territories of these major arteries, such that compensatory blood supply is achieved in the setting of single vessel stenosis . Most cases of symptomatic chronic mesenteric ischaemia therefore occur in the setting of 2 or 3 mesenteric arteries being affected . Mesenteric blood flow normally increases from 25% of total cardiac output to 35% or more after a meal, but in the absence of sufficient perfusion, ischaemia ensues with anaerobic glycolysis and lactate production by intestinal enterocytes . Cell death occurs due to disruption of membrane pumps, leading to reduced epithelial barrier function and translocation of intestinal bacteria into the bloodstream . This initiates a local inflammatory response that in turn leads to the classic symptoms of post - prandial pain and nausea with subsequent anorexia, avoidance of meals and weight loss . Chronic mesenteric ischaemia is a rare condition, however, with only 13 of 980 patients in the study by thomas et al . Therefore, it may be overlooked by gastroenterologists in favour of more common luminal or functional differential diagnoses . We present a case where a diagnosis of chronic mesenteric ischaemia was delayed due to atypical symptomatology, leading to consecutive cognitive errors by the treating clinicians . A 67-year - old man presented to clinic with 4 months of increasing diarrhoea and weight loss from 74 to 60 kg . He opened his bowels up to 8 times a day with loose motions, though without associated blood or mucus, and had not improved with trials of gluten - free and lactose - free diets . Prior to this his past history was significant for klinefelter's syndrome requiring parenteral testosterone replacement, 2 previous lumbar laminectomies, and chronic obstructive pulmonary disease with a 30 pack - year history of cigarette smoking that had ceased 4 years prior . These included full blood count; renal function and liver function tests; serum levels of iron, vitamin b12, folate and albumin; erythrocyte sedimentation rate and c - reactive protein; thyroid function tests; serology for human immunodeficiency virus hepatitis b and hepatitis c; stool cultures and parasite screening, and anti - tissue transglutaminase antibodies . Computed tomography (ct) scans of his chest, abdomen and pelvis revealed only a 1-cm left adrenal adenoma which appeared benign, uncomplicated cholelithiasis and atheroma within the abdominal aorta . Gastroscopy and colonoscopy were macroscopically unremarkable, with biopsies of the stomach, duodenum, terminal ileum and colon showing no abnormalities . On a second clinic review 2 months later, his symptoms had progressed to include nausea beginning 1 h after meals, persisting for several hours and causing secondary anorexia . Further outpatient tests included a nuclear medicine gastric emptying study with a negative result; although faecal calprotectin via the quantum blue method was elevated at 145 g / g, indicating a high probability of inflammation in the gastrointestinal tract . Three weeks later, prior to a planned clinic appointment, he was admitted to the hospital with ongoing nausea and diarrhoea which was impossible to be managed at home with anti - emetic and anti - diarrhoeal medications . New symptoms included cramping lower abdominal pain associated with the nausea, radiating to the back . Due to the elevated calprotectin, ct enteroclysis of the small bowel was performed to assess for crohn's disease, with a negative result . Further blood tests ensued with negative results including lipase, lactate, anti - nuclear antibodies, rheumatoid factor, complement levels, igg subclasses, vasoactive intestinal peptide and gastrin, cortisol and protein electrophoresis . Urine tests for electrophoresis, 24-hour catecholamines and 5-hydroxyindoleacetic acid were unremarkable, as were faecal elastase and ct of the brain . His symptoms improved significantly during a 14-day hospital admission without any change to medications . He was highly anxious, and further history revealed recent major psychosocial stressors, as well as several episodes of left leg pain upon mobilising that the patient ascribed to referred pain from his previous laminectomies . He was therefore given a presumptive diagnosis of a diarrhoeal predominant irritable bowel syndrome with a possible contribution of neuropathic pain radiating from his back . Amitriptyline 12.5 mg daily was started, as well as a diet low in fermentable oligosaccharides, disaccharides, monosaccharides and polyols (fodmaps). His symptoms improved further over several days, and an outpatient psychiatric review was arranged . However, mild abdominal pain recurred on the evening prior to planned discharge and his abdomen was auscultated by junior medical staff, with a vascular bruit heard in the epigastrium . Mesenteric vessel ultrasound demonstrated> 70% stenoses in the coeliac and superior mesenteric (fig . 1) vessels, though as his symptoms abated again over the next 24 h the significance of these was initially unclear . He represented several days later with severe abdominal pain, elevated white cell count of 16 10/l and c - reactive protein of 52, though with normal serum lactate and lipase . His arterial carboxyhaemoglobin was measured for the first time and was elevated at 5.2% . Upon questioning, the patient admitted to having restarted smoking at home 6 months prior, corresponding to the onset of his symptoms, but abstaining whilst in hospital . Mesenteric ct angiography demonstrated short 90% ostial stenoses of the coeliac and superior mesenteric arteries (fig . 2) as well as an occluded left common iliac artery . The inferior mesenteric artery was patent . His diagnosis was revised to one of chronic mesenteric ischaemia due to two - vessel atherosclerosis, with his left leg pain also being due to arterial insufficiency . Fluoroscopically guided balloon dilatation and insertion of 2 self - expanding stents (6-mm and 7-mm diameter) into the superior mesenteric artery over a guidewire was performed (fig . It was intended that collateral vessels from the reperfused superior mesenteric artery would subsequently supplement blood flow to the territories of the stenosed coeliac artery . Immediate relief in abdominal symptoms ensued, and aspirin 100 mg daily and clopidogrel 75 mg daily were commenced to prevent stent thrombosis . At 1 month after discharge, he was still free from abdominal symptoms, had stopped smoking and gained 5 kg of weight . He is planned for open revascularisation of his left leg via femoral bypass in the future . This patient was subject to diagnostic delay for several reasons, exemplifying common cognitive errors described in clinical medicine . Firstly, his symptoms consisted primarily of diarrhoea and nausea for the majority of his illness, with pain being a very late feature . This is unusual: in one retrospective review of 54 cases of mesenteric ischaemia, pain was present in 98% of patients, with diarrhoea only in 24.5% and nausea in 2% . However, this is not specific for inflammatory bowel disease as calprotectin is raised in myriad intestinal conditions such as infections, malabsorptive syndromes and neoplasms . Secondly, the patient's diagnostic work - up was coordinated by gastroenterologists, which led to two further cognitive errors being applied: the availability heuristic, whereby clinicians regular experience with intra - luminal aetiologies such as inflammatory bowel disease, rather than vascular aetiologies, biased the initial investigations, and ascertainment bias, whereby clinicians investigated for conditions (such as inflammatory bowel disease) that they hoped to find due to their familiarity with subsequent treatment . Thirdly, clinicians were falsely reassured by unremarkable previous abdominal imaging including 2 ct scans and ultrasound . Also falsely reassuring was the absence of biochemical markers of malnutrition such as anaemia or hypoalbuminaemia; as well as frank lactataemia . However, serum lactate levels are rarely raised in chronic mesenteric ischaemia due to the capacity of the liver to metabolise lactate delivered via the portal vein . As such, serum lactate is elevated only in cases of critical transmural ischaemia . Fourthly, the patient's improvement during the hospital stay in the setting of psychosocial stressors engendered a diagnosis of a functional gut disorder and the dual cognitive errors of fundamental attribution error, whereby clinicians frustrated by an exhaustive course of investigation attributed symptoms to the patient's personal characteristics, as well as we retrospectively theorise that his symptoms improved in the hospital due to smoking cessation, leading to a lower blood carboxyhaemoglobin to oxyhaemoglobin ratio and thereby improving tissue perfusion . The treatment of chronic mesenteric ischaemia centres around revascularisation: lifestyle modifications such as eating small frequent meals, proton pump inhibition and a low - fat diet are only adjuncts, and medical therapy such as long - term anticoagulation is reserved only for patients who cannot undergo revascularisation . The goals of treatment are symptom relief, weight restoration and the prevention of progression to acute mesenteric ischaemia and intestinal infarction . . Found that endovascular and open surgical revascularisation techniques were associated with statistically similar rates of peri - operative mortality (odds ratio 0.78, 95% ci 0.401.50, p = 0.45). Though associated with longer hospital stays, surgical revascularisation was associated with better long - term patency in 8 studies where this was reported, with a statistically significant odds ratio of 3.57 compared to endovascular revascularisation (95% ci 1.836.97, p = 0.0002). However, in this case it was felt that as the vascular stenosis involved only a short ostial segment, endovascular therapy was the best first - line option especially in a malnourished patient in whom wound healing after open procedures would be theoretically impaired . Reported technical success rates of endovascular treatment are high at 85100% with short - term symptomatic relief in 8095% of patients . Though in - stent restenosis may be a future problem in up to 60% of cases over 2 years, several single - centre series describe favourable outcomes when symptomatic restenosis is treated with further endovascular interventions . Peck et al . Reported 13 of 49 (28.6%) patients undergoing endovascular intervention undergoing repeat endovascular procedures at a median time of 15.5 months . Of these 13 patients, 9 remained completely revascularised and asymptomatic at 3 years after initial intervention . The remaining 4 underwent successful subsequent surgical revascularisation, 3 of whom remained completely revascularised and asymptomatic at 3 years after initial intervention (1 died of an unrelated cause). Even if surgical intervention were needed for restenosis, this is theoretically associated with a lower risk of peri - procedural complications compared to first - line surgical therapy as the patient will have undergone an intervening period of nourishment and reconditioning . The choice to combine balloon angioplasty and stenting for our patient is supported by a systemic review of 328 patients undergoing endovascular intervention in 16 studies suggesting that, while not reaching statistical significance, this approach trends toward higher initial technical success compared to angioplasty alone (92 vs 83%, p = 0.09) but decreased restenosis rates compared to stenting alone (26 vs. 35%, p = 0.10). This case highlights the importance of recognising atypical presentations of gastrointestinal conditions as well as considering causes for diarrhoea outside the gut lumen . Importantly, it serves as an illustration of multiple cognitive errors to which clinicians may be susceptible in practice . Awareness of the possibility of such errors allows clinicians to reflect critically on their diagnostic reasoning in difficult cases and reduce diagnostic delay.
|
Bidirectional ventricular tachycardia (bvt) is defined as a tachycardia showing beat - to - beat alternation in the qrs axis . The rate is typically between 140 and 180 bpm, with a frontal plane axis varying between 20 and 110. the most common causes of bvt include catecholaminergic polymorphic ventricular tachycardia and cardiac glycoside toxicity . Other previously described etiologies include myocarditis, long qt syndrome type 7, congenital cardiomyopathies, cardiac tumors, and acute cardiac allograft rejection . Cardiac sarcoidosis is characterized by myocardial inflammation and interstitial fibrosis that can lead to slowed conduction and macro re - entrant arrhythmias . We report a case of bvt in a patient with cardiac sarcoidosis and briefly discuss the proposed mechanisms underlying bvt . A 73-year - old man with history of chronic pulmonary sarcoidosis was seen for an annual checkup, during which ventricular bigeminy was identified on a 12-lead electrocardiogram . Subsequent holter monitor assessment showed multiple premature ventricular beats and several short runs of non - sustained ventricular tachycardia (vt), with two different qrs morphologies (fig . 1). A cardiac magnetic resonance tomography with delayed gadolinium showed a curvilinear region of patchy mid - myocardial enhancement within the inferolateral left ventricular myocardium near the base, consistent with cardiac sarcoidosis (fig . 2). The left and right ventricular ejection fractions were 47% and 37%, respectively . A nuclear myocardial perfusion study using single - photon emission computed tomography showed no myocardial perfusion defects on stress or rest imaging, ruling out ischemia . A fasting 18-fluorodeoxyglucose positron emission tomography (pet) demonstrated increased uptake in the same area of the myocardium that had shown late gadolinium enhancement, consistent with active cardiac sarcoid (fig . The patient was elected to have an implantable cardioverter defibrillator (icd) placed for prevention of sudden cardiac death . He had not experienced any vt episodes during the one - year follow - up . One of the proposed mechanisms of bvt include elevated intracellular calcium, causing delay after depolarization in anatomically separate parts of the conducting system . Proposed that two separate foci, with different rate thresholds for delayed after depolarization induced ventricular bigeminy, were present in a rabbit model . This would effectively double the heart rate, increasing the overall ventricular rate above the second threshold . Once this had developed, the two competing sites would simply alternate on a beat - to - beat basis . This is likely the mechanism underlying bvt observed with digitalis toxicity and catecholaminergic polymorphic vt . The other proposed mechanisms for bvt include an alternating bundle branch block related to bifocal automaticity and inscribed in opposite directions, or scar - mediated reentry around a circuit with two alternating exit sites . Described a mechanism including retrograde conduction over the mid septal fascicular pathway, with alternating block in the left anterior or posterior fascicles, to explain polymorphic fascicular vt patterns . Scarring is typically patchy, with a predilection for the basal septum, anterior wall, and perivalvular regions of the left ventricle . It may also be confluent, affecting the right ventricular epicardium or endocardium . In sarcoidosis, it is plausible that multiform or bidirectional premature ventricular contractions (pvcs) are due to multiple exits from the areas of inflammation and/or scarring . Conduction disturbances in cardiac sarcoidosis are not uncommon, and often affect the his - purkinje system . In our case, the patient had an intraventricular conduction delay at baseline, with prolonged qrs complexes at relatively low atrial rates (fig . The majority of the retrospective data suggest that immunosuppression reduces the burden of arrhythmias, especially in the early phases of the disease . Previous case series have reported various success rates with vt ablation in patients with cardiac sarcoidosis, likely due to the small number of patients in each series, with varying degrees of disease burden . The most common circuit for vt in one report was reentry in the peritricuspid area, which can be safely ablated . In another study, abolishing all inducible tachycardias was not always feasible because of septal intramural circuits, extensive right ventricular scarring, or sites of origin in close proximity to the left anterior descending, the ramus intermedius arteries, or the para - hisian region, which prohibit safe ablation . In the current case, it is likely that the presence of a septal focus leads to alternate exits into the right or left ventricle which shows the observed electrocardiogram pattern . Although the septal involvement was not visible by imaging until a year after diagnosis, it might have been present initially, but was microscopic in nature . This is consistent with previous autopsy studies that have shown a heterogeneous distribution of sarcoid granulomas in the myocardium . The recent expert consensus document is an excellent resource for management and risk stratification for cardiac sarcoidosis patients . Icd implantation for primary prevention is commonly performed due to the high burden of vt events (estimated incidence rate of 15% per year) in patients with cardiac sarcoidosis . In the current case, icd implantation was recommended due to the high burden of nonsustained vt episodes, left and right ventricular dysfunction, and the presence of fibrosis and active inflammation by imaging studies.
|
Neonatal diabetes mellitus (ndm) is a rare monogenic form of diabetes starting within the first 6 months of life 13 . The disease has an incidence of about 1:100,000260,000 live births and can be permanent (pndm), requiring lifelong treatment, or may be transient (tndm), in which case the diabetes may spontaneously remit (or be so mild as not to require treatment), but will often relapse, usually during adolescence 35 . A genetic diagnosis has been made in up to 90% of these patients 7 . In the majority of them (around 70%), it was found that a genetic or epigenetic alteration in the tndm locus on chromosome 6q24 causing the overexpression of two imprinted genes 7 . Less frequently, activating mutations of the genes kcnj11 and abcc (accounting for 10% and 13% of the cases, respectively) may result in tndm 7 . Mutations in these genes lead to a gain - in - function of the pancreatic atp - sensitive potassium (katp) channel, which is critical in the regulation of insulin secretion by the beta cell 3,6,8,9 . The beta cell katp channel is an octameric complex composed of four pore - forming subunits: channel - building inwardly rectifying potassium - channel subunits (kir6.2) encoded by the kcnj11 gene, and four regulatory sulfonylurea - receptor subunits (sur1) and encoded by the abcc8 gene 10,11 . These subunits regulate the metabolic activity of the channel, which is shut down in response to an increase in intracellular atp, leading to insulin secretion . Gain - in - function mutations of either of these genes keep the channel in open conformation and impair insulin secretion 1012 . Most patients with kcnj11 mutations treated with insulin can be transferred to sulfonylurea (su) with a remarkable improvement in metabolic control and patient's quality of life 13 . Sulfonylureas close katp channels, through an atp- independent route, improving insulin secretion and representing a suitable therapeutic alternative for patients with kcnj11 mutations 10 . For these reasons, identification of katp channel mutation can have a major impact on the treatment's choice . This is an example about how molecular diagnosis can influence the clinical management of the patients . Herein, we report on a case of ndm in a caucasian boy, who presented severe diabetic ketoacidosis (dka) at 17 days of life . The genetic screening showed a heterozygous missense mutation (c.679 g> a) in the kcnj11 gene which leads to the replacement of lysine with glutamic acid at position 227 (e227k) of the atp sensitive potassium channel . An 11-day - old caucasian boy was admitted to the neonatal care unit with complaints of poor weight progression, suppurative conjunctivitis, and mucoral candidiasis . He was the second child of a 21-year - old woman (gravida 2, para 1) without history of diabetes, and was born through cesarean section at 38 weeks of pregnancy due to preeclampsia . Apgar score was 5/9/10; birth weight was 2890 g (p15), length 47 cm (p15) and head circumference 34.5 cm (p50) 14 . On physical examination, the infant exhibited axial hypotonia and weak suction reflex, demanding a nasogastric tube in order to be feed . At 17 days the child became irritable, drowsy, dehydrated, tachypneic, tachycardic with poor peripheral perfusion; rectal temperature was 37.8c . He was started on intravenous vancomycin after isolation of a methicillin - resistant staphylococcus from the axillary suppurative adenitis . Blood tests revealed a glycemia of 1412 mg / dl with high levels of ketonemia; serum sodium was 172 mmol / l; potassium 3.9 mmol / l, and the ph was 7.0 . After initial treatment with intravenous 0.9% saline serum, he was started on intravenous insulin perfusion (0.01 u / kg / h) in a 0.45% saline serum supplemented with 15 meq / l of potassium chloride . Three days later, the insulin perfusion was stopped and the child was transferred to a subcutaneous protocol of intensive insulin therapy, consisting in a once daily administration of insulin glargine (1 u / day), and insulin lyspro every 6 h. further investigations revealed that there was no evidence of pancreatic exocrine failure . Transfontanelar and abdominal ultrasounds; electroencephalography and brain magnetic resonance imaging showed no relevant findings . An interatrial communication ostium secundum, associated with enlargement of right cavities was found in the echocardiogram . C - peptide was 0.37 ng / ml (0.804.20); auto antibodies against islet cell (ica), decarboxylase of glutamic acid (gad), and insulin were all negative . The infant was referred to a tertiary hospital due to instability of his metabolic control, alternating episodes of hypoglycemia with hyperglycemia . Two months later, insulin administration was stopped, given that glycemia was always within normal levels with minimal amounts of insulin . At this stage, the c - peptide was already normal . At the age of 9 months, his growth had declined from p10 to p<1 . The e227k mutation found in our patient is a gain - function mutation that results in both impaired atp sensitivity and higher intrinsic the e227k mutation has been reported in several other patients with tndm but also in a few with pndm reflecting the phenotypic variability of kcnj11 mutations (table1). The reason why the same mutation causes a relapsing / remitting form of diabetes in some patients whereas in others it produces a permanent diabetes is unclear 15 . It was not demonstrated a clear relationship between the clinical phenotype and the magnitude of the impairment of the atp - sensitive potassium (katp) channels . Tndm may result from a reduction in insulin requirements at the time of remission due to changes in beta cell turnover or to compensatory alterations (at the level of the beta cell, pancreas, or whole body), overcoming the lower effectiveness of the atp sensitive potassium channel . Therefore, the genetic background of the patient as well as other still unrecognized environmental factors may play an important role in the phenotypic expression of the mutation . On the other hand, the apparent clinical variability may result from confounding factors: patients diagnosed during puberty or early adulthood may have had a period of hyperglycemia that was missed during the neonatal period . Clinical data of patients with heterozygous e227k mutation wks, weeks; mth, months; yrs, years; dka, diabetic ketoacidosis; mody, maturity - onset diabetes of the young . The e227k may be inherited from affected parents, or occurs as de novo mutation . In our study, the mutation is present in the affected child but also in his asymptomatic mother, suggesting that there was not a complete co - segregation of the mutation with diabetes . This situation has also been described previously (table1). In the majority of tndm and pndm cases caused by kcnj11 mutations 3,13, including e227k mutations 11, metabolic control was achieved by replacing insulin therapy with sulfonylureas, which are well - known katp channel inhibitors (table1). This finding supports the idea that if our patient has a relapse of diabetes, he may achieve optimal glycemic control with oral sulfonylurea treatment, strengthening the importance of the molecular diagnosis even if neonatal diabetes remits . The expression of kcnj11 in the central nervous system and skeletal muscle explain the neurological features associated with syndromic forms of pndm, such as developmental delay, muscle weakness, and epilepsy 16,17 . However, neurological features were also identified in patients with nonsyndromic forms of pndm and tndm who carried kcnj11 mutations as speech delay, autistic spectrum disorder, and learning disability . Until now it is difficult to assure whether these complications are a consequence of the mutation or whether environmental and/or other genetic factors are involved 6 . In the case herein reported, the infant exhibited axial hypotonia and weak suction reflex, that may be caused by the mutation or / and may be due to exposure to hyperglycemia and ketosis during the first days of the child's life 1,3,18 . Further studies are necessary to clarify the etiology of neurological impairment in tndm patients who carried kcnj11 mutations and to access the effectiveness of su in improving the neurological development . In conclusion molecular diagnosis should be performed in order to identify those patients who may benefit from su therapy . Further investigation is required to understand clinical heterogeneity and the incomplete co - segregation of the kcnj11 mutation with diabetes, and also the molecular mechanisms underlying the biphasic course of tndm.
|
Community oriented program for control of rheumatic diseases [who - ilar copcord] study from the rural population of western india has reported about 5.5% prevalence of osteoarthritis . Prevalence of osteoarthritis increases as the age advances . With an increase in aging population, the burden of this disease is going to be substantial on society at large . Currently palliative management through analgesics and non - steroidal anti - inflammatory drugs is the mainstay of pharmacotherapy . The use of which is also apprehended due to serious side effects; particularly on long - term use . Only option left for patients is either conservative non - pharmacological measures or radical surgical interventions . Abfn02 is developed on the foundation of a classical ayurvedic formulation which is indicated for degenerative diseases and arthritis . Both these ingredients are reputed as rasayana (rejuvenative / reparative) drugs in ayurvedic literature . The study is aimed at evaluating the long - term (six month) efficacy and safety of abfn02 and compares it with glucosamine sulphate . Glucosamine sulphate is widely used natural product consumed world over for the treatment of osteoarthritis which has also demonstrated to have disease modifying benefits . Therefore it was thought appropriate to compare it with abfn02 the natural product from ayurveda . This csir - nmitli government of india funded project was founded on the principles of reverse pharmacology for the development of globally competitive herbal product inspired from ayurveda . Total 112 patients of osteoarthritis of knee were allocated at two clinical centers during the period july 2006 to march 2007 . All patients were in the age group of 40 to 75 years, ambulant and seeking medication for their ailment . This was a randomized comparative open clinical study of 24 weeks with the assessor blind . Patients were evaluated before treatment (baseline), at periodic intervals (2, 4, 6, 12, 14, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). The clinical study was conducted as per the good clinical practices by international conference of harmonization guidelines, declaration of helsinki and national regulatory norms . Ethics committee approval from respective institutions and patient's informed written consent was obtained before initiation of the study . Diagnosis of osteoarthritis of the knee was made using clinical classification of american college of rheumatology criteria . All patients having knee pain, with visual analogue scale for pain (pain - vas) more than 4 on scale of 10; either at rest or on activity in last 24 h and having radiological evidence of osteoarthritis were included for the study . Pregnant or lactating women of child bearing potential and not following adequate contraceptive measures, patients with known hypersensitivity to bhallatak and history of allergic diatheses with vesication and chronic alcoholics were excluded . Patients having severe disabling arthritis, active peptic ulcer, bleeding ulcer, severe renal, hepatic, hematopoietic disease or cardiac insufficiency were not included . Patients on treatment of anticoagulants, hydantoin, lithium, corticosteroids, analgesics, anti - inflammatory drugs, methotrexate, colchicine and having received intra - articular steroid injection and any investigational drug within a month preceding the study were excluded . Subjects with positive rheumatoid factor (ra test) were excluded since rheumatoid arthritis on rare occasions may initially present as a single / pauciarticular disease . Investigational drug amrut bhallatak (abfn02) was specially prepared at shree dhootpapeshwar ltd . By a classical method described in brihat nighantu ratnakar and glucosamine sulphate (gs) was also made available by meyer organics in the form of 750 mg tablet each . The size, shape, color and texture of both these tablets of abfn02 and gs were comparable and were supplied in a similar container with a coded label . Purity of the product was ensured for heavy metal content, pesticide residue, microbial load and aflatoxins contamination as per who guidelines . Ld50 of abfn02 was> 2000 mg / kg body weight confirmed in two species mice and rats . The incremental pulse dosage schedule was inspired from classical vardhamana - prayoga and earlier exploratory study whereas; same dose continuous dosage schedule was akin to standard schedule of glucosamine . Group (a): glucosamine sulphate (gs), 750 mg twice / day for 24 weeks (n = 35), group (b): abfn02, 750 mg twice / day for two weeks, 1500 mg twice / day for next two weeks, 2250 mg twice / day for further two weeks, subsequently no drug for six weeks, subsequently no drug for six weeks, such a drug and non - drug phases of six weeks each were repeated . (n = 39), group (c): abfn02 750 mg twice / day for 24 weeks (n = 38) akin to gs drug schedule . (to consume tablets with milk in the morning, after breakfast and at night after dinner; to drink plenty of water, avoid fasting, spicy, hot and salty food items, prolonged working outdoor under the sun, prolonged working near the fire and keeping awake late at night). All patients were evaluated primarily on the scale of pain vas and western ontario and macmaster universities osteoarthritis index (womac) before treatment (baseline), at periodic intervals (2, 4, 6, 12, 14, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria for clinical evaluation were change in status of knee arthritis, walking time, patients and physician global assessment, paracetamol consumption and health assessment questionnaire (haq). Both womac and haq crd pune versions are validated modified versions for indian use and details of their use and scoring are available at the website (www.rheumatologyindia.org). A special case record form was also made to document patient's prakruti and ayurvedic evaluation . All patients were screened and evaluated for organ function safety before treatment (baseline), at periodic intervals (4, 6, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria were, urinary c - terminal tellopeptides of collagen type ii (urinary ctx - ii), tumor necrosis factor alpha soluble receptor i and soluble receptor ii (tnf -sri and srii). Twelve patients were randomly selected for pre and post treatment magnetic resonance imaging (mri) assessment . The semi quantitative mri assessment was done by blinded assessor for 15 parameters (articular cartilage integrity, subcondral bone marrow abnormality, subarticular cyst, subarticular bone attrision, marginal osteophytes, medial meniscal integrity, lateral meniscal integrity, anterior cruciate ligament integrity, posterior cruciate ligament integrity, medial collateral ligament integrity, lateral collateral ligament integrity, synovitis / effusion, intra - articular loose bodies, periarticular cyst, bursitis). All patients who were allocated were assessed at every visit for potential drug related events and were also asked for any adverse event experienced during the treatment period . All these symptoms were checked against baseline symptoms and recorded in a separate form of adverse events . Diagnosis of osteoarthritis of the knee was made using clinical classification of american college of rheumatology criteria . All patients having knee pain, with visual analogue scale for pain (pain - vas) more than 4 on scale of 10; either at rest or on activity in last 24 h and having radiological evidence of osteoarthritis were included for the study . Pregnant or lactating women of child bearing potential and not following adequate contraceptive measures, patients with known hypersensitivity to bhallatak and history of allergic diatheses with vesication and chronic alcoholics were excluded . Patients having severe disabling arthritis, active peptic ulcer, bleeding ulcer, severe renal, hepatic, hematopoietic disease or cardiac insufficiency were not included . Patients on treatment of anticoagulants, hydantoin, lithium, corticosteroids, analgesics, anti - inflammatory drugs, methotrexate, colchicine and having received intra - articular steroid injection and any investigational drug within a month preceding the study were excluded . Subjects with positive rheumatoid factor (ra test) were excluded since rheumatoid arthritis on rare occasions may initially present as a single / pauciarticular disease . Investigational drug amrut bhallatak (abfn02) was specially prepared at shree dhootpapeshwar ltd . By a classical method described in brihat nighantu ratnakar and glucosamine sulphate (gs) was also made available by meyer organics in the form of 750 mg tablet each . The size, shape, color and texture of both these tablets of abfn02 and gs were comparable and were supplied in a similar container with a coded label . Purity of the product was ensured for heavy metal content, pesticide residue, microbial load and aflatoxins contamination as per who guidelines . Acute animal toxicity study carried under oecd guidelines ld50 of abfn02 was> 2000 mg / kg body weight confirmed in two species mice and rats . The incremental pulse dosage schedule was inspired from classical vardhamana - prayoga and earlier exploratory study whereas; same dose continuous dosage schedule was akin to standard schedule of glucosamine . Group (a): glucosamine sulphate (gs), 750 mg twice / day for 24 weeks (n = 35), group (b): abfn02, 750 mg twice / day for two weeks, 1500 mg twice / day for next two weeks, 2250 mg twice / day for further two weeks, subsequently no drug for six weeks, subsequently no drug for six weeks, such a drug and non - drug phases of six weeks each were repeated . (n = 39), group (c): abfn02 750 mg twice / day for 24 weeks (n = 38) akin to gs drug schedule . (to consume tablets with milk in the morning, after breakfast and at night after dinner; to drink plenty of water, avoid fasting, spicy, hot and salty food items, prolonged working outdoor under the sun, prolonged working near the fire and keeping awake late at night). Investigational drug amrut bhallatak (abfn02) was specially prepared at shree dhootpapeshwar ltd . By a classical method described in brihat nighantu ratnakar and glucosamine sulphate (gs) was also made available by meyer organics in the form of 750 mg tablet each . The size, shape, color and texture of both these tablets of abfn02 and gs were comparable and were supplied in a similar container with a coded label . Purity of the product was ensured for heavy metal content, pesticide residue, microbial load and aflatoxins contamination as per who guidelines . Ld50 of abfn02 was> 2000 mg / kg body weight confirmed in two species mice and rats . The incremental pulse dosage schedule was inspired from classical vardhamana - prayoga and earlier exploratory study whereas; same dose continuous dosage schedule was akin to standard schedule of glucosamine . Group (a): glucosamine sulphate (gs), 750 mg twice / day for 24 weeks (n = 35), group (b): abfn02, 750 mg twice / day for two weeks, 1500 mg twice / day for next two weeks, 2250 mg twice / day for further two weeks, subsequently no drug for six weeks, subsequently no drug for six weeks, such a drug and non - drug phases of six weeks each were repeated . (n = 39), group (c): abfn02 750 mg twice / day for 24 weeks (n = 38) akin to gs drug schedule . (to consume tablets with milk in the morning, after breakfast and at night after dinner; to drink plenty of water, avoid fasting, spicy, hot and salty food items, prolonged working outdoor under the sun, prolonged working near the fire and keeping awake late at night). All patients were evaluated primarily on the scale of pain vas and western ontario and macmaster universities osteoarthritis index (womac) before treatment (baseline), at periodic intervals (2, 4, 6, 12, 14, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria for clinical evaluation were change in status of knee arthritis, walking time, patients and physician global assessment, paracetamol consumption and health assessment questionnaire (haq). Both womac and haq crd pune versions are validated modified versions for indian use and details of their use and scoring are available at the website (www.rheumatologyindia.org). A special case record form was also made to document patient's prakruti and ayurvedic evaluation . All patients were screened and evaluated for organ function safety before treatment (baseline), at periodic intervals (4, 6, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria were, urinary c - terminal tellopeptides of collagen type ii (urinary ctx - ii), tumor necrosis factor alpha soluble receptor i and soluble receptor ii (tnf -sri and srii). Twelve patients were randomly selected for pre and post treatment magnetic resonance imaging (mri) assessment . The semi quantitative mri assessment was done by blinded assessor for 15 parameters (articular cartilage integrity, subcondral bone marrow abnormality, subarticular cyst, subarticular bone attrision, marginal osteophytes, medial meniscal integrity, lateral meniscal integrity, anterior cruciate ligament integrity, posterior cruciate ligament integrity, medial collateral ligament integrity, lateral collateral ligament integrity, synovitis / effusion, intra - articular loose bodies, periarticular cyst, bursitis). All patients who were allocated were assessed at every visit for potential drug related events and were also asked for any adverse event experienced during the treatment period . All these symptoms were checked against baseline symptoms and recorded in a separate form of adverse events . All patients were evaluated primarily on the scale of pain vas and western ontario and macmaster universities osteoarthritis index (womac) before treatment (baseline), at periodic intervals (2, 4, 6, 12, 14, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria for clinical evaluation were change in status of knee arthritis, walking time, patients and physician global assessment, paracetamol consumption and health assessment questionnaire (haq). Both womac and haq crd pune versions are validated modified versions for indian use and details of their use and scoring are available at the website (www.rheumatologyindia.org). A special case record form was also made to document patient's prakruti and ayurvedic evaluation . All patients were screened and evaluated for organ function safety before treatment (baseline), at periodic intervals (4, 6, 16, 18 weeks) during treatment and after completion of treatment (24 weeks). Other secondary criteria were, urinary c - terminal tellopeptides of collagen type ii (urinary ctx - ii), tumor necrosis factor alpha soluble receptor i and soluble receptor ii (tnf -sri and srii). Twelve patients were randomly selected for pre and post treatment magnetic resonance imaging (mri) assessment . The semi quantitative mri assessment was done by blinded assessor for 15 parameters (articular cartilage integrity, subcondral bone marrow abnormality, subarticular cyst, subarticular bone attrision, marginal osteophytes, medial meniscal integrity, lateral meniscal integrity, anterior cruciate ligament integrity, posterior cruciate ligament integrity, medial collateral ligament integrity, lateral collateral ligament integrity, synovitis / effusion, intra - articular loose bodies, periarticular cyst, bursitis). All patients who were allocated were assessed at every visit for potential drug related events and were also asked for any adverse event experienced during the treatment period . All these symptoms were checked against baseline symptoms and recorded in a separate form of adverse events . Total allocation of 120 patients was planned and was randomized in three groups using standard software program . Demographic data and baseline information was analyzed by descriptive method and is presented with summary statistics (n, mean, standard deviation, range) for continuous variables, whereas counts and percentages for categorical variables . Pain - vas and womac score, the change in value to endpoint are calculated as difference and are compared between the groups . The changes within groups and comparison with other groups are estimated by analysis of variance with kruskal wallis test . When change between groups was significant post hoc friedman test was applied . For all secondary variables like health assessment questionnaire score, mean changes from baseline to each time points and comparison with other groups were analyzed by anova with krusakal wallis test . When change between groups was significant post hoc friedman test were applied . For categorical variables like physicians global assessment,% reduction in pain by vas score and changes in knee status all other continuous data like lab data were analyzed by anova with post hoc test when the differences between groups were significant . The safety analysis consists of all patients who were allocated into the study, who have received at least one intervention of the study medication and have evaluable safety data . All values are reported based on two - sided and all the statistical tests are interpreted at 5% level of significance . Total 123 patients were screened for enrollment [figure 1] of which 11 patients could not be enrolled for various reasons such as, blood investigations showed positive ra factor (3), revealed cardiovascular disorders (2), lack of radiological features expected for inclusion (1) and patients did not turn up for enrolment (4), whereas one patient decided not to initiate the study . All the three treatment groups matched for age, sex ratio, height, weight, mean bmi and prakruti types [tables 1 and 2]. Age of the patients ranged between 41 to 73 years, female patients were more in all the three groups ranging between 60 and 77% . The major type of prakruti found amongst all was pitta - kapha (57/112); it was also the major type in each of the three interventional groups . Flow of patients participation in three arm study of abfn02 (pulse dosage regimen and continuous dosage regimen) and glucosamine sulphate (gs; standard dosage regimen) the adherence was measured depending on the continuation of the treatment for six months . Adherence over six months to the drug intervention was overall 83% however group a (receiving glucosamine sulphate) had 74.3% adherence where as for groups b and c (receiving abfn02) had 87.75% adherence which was statistically significant . Total pain - vas after four weeks of treatment showed statistically significant drop in all the three groups; with group a having 16.9% drop, group b 21.1% drop and group c 22.4% drop . Subsequently in all the three groups, percent drop in total pain vas score went on increasing and at the end of 24 weeks; it was 57.3% in group a, 58.4% in group b and 58.5% in group c [figure 2]. Percentage grade - wise pain vas response in individual patients showed good to excellent (> 50%) in 53.8% of patients in group a, while 63.7% in group b, and 66.7% in group c. however the difference between the groups was not statistically significant . Reduction in total mean pain vas comparison of change in total mean pain vas score between the groups; group a: glucosamine sulphate standard dosage regimen, group b: abfn02-pulse dosage regimen, group c: abfn02-continuous dosage regimen . Statistical assessment by anova kruskal wallis test, p <0.05 significant, from 4 week till 24 week, in each group from baseline . Between groups, p> 0.05 not significant total score for womac index includes a semi - quantitative estimation of pain, stiffness and difficulty in activity . After six weeks, a significant drop in womac index score was observed that is 31.6% in group a, 32.5% in group b and 30.7% in group c. subsequently there was a gradual drop in mean womac index . At 24 weeks, reductions were 59.1% in group a, 60.8% in group b and 64.1% in group c [figure 3]. The response in womac index gradual drop in total score of womac index at different time intervals for all the three groups; group a: glucosamine sulphate standard dosage regimen, group b: abfn02-pulse dosage regimen, group c: abfn02-continuous dosage regimen . Statistical assessment by anova kruskal wallis test, p <0.05 significant, from 6 week till 24 week, in each group from baseline . Between groups, p> 0.05 not significant secondary objectives were clinical, laboratory and imaging . Median paracetamol consumption over 24 weeks were 10.5 tablets (range 0 to 150 tablets) for group a, 22 tablets (range 0 to 100 tablets) for group b and 24 tablets (range 0 to 110 tablets) for group c. haq score drop [group a (47%), group b (49%), group c (52.7%)] and morning stiffness reduction [group a (77.9%), group b (60.2%), group c (62.2%)], were observed from baseline after treatment in both abfn-02 (group b and group c) and gs (group a) however there was no intergroup difference of statistical significance . Walking time for 50 feet measured in minutes, physician global assessment, patient global assessment, and knee status which were assessed according to gradations such as mild, moderate and severe were also improved from baseline after treatment in all the three groups however again there was no intergroup difference of statistical significance (data not shared). The laboratory parameters evaluated were urinary ctx - ii, and serum tnf- sr - i, sr - ii . Urinary ctx - ii values had post treatment reduction in all the groups; group a (467.02 338.38 to 321.38 221.56), group b (390.18 184.93 to 329.00 187.79), group c (372.08 239.35 to 371.30 244.11) however since the standard deviation was wide, statistical difference is not applied . Tnf- sr - i and sr - ii values remained in normal range for pre and post treatment evaluation; tnf- sr - i, group a (2.41 0.85 to 2.77 0.95), group b (2.67 0.80 to 2.74 1.10), group c (2.33 0.73 to 2.46 0.60) and tnf- sr - ii group a (7.77 2.58 to 7.23 2.32), group b (7.11 2.61to 7.16 6.27), group c (6.93 2.22 to 5.87 1.91). One out of two patients in glucosamine sulphate group had mri improvement in bone marrow swelling and bone attrition, while four out of six patients taking abfn-02 had improvement seen on mri on account of bone marrow swelling, synovitis and bursitis . The average values of total and differential leucocytes count, platelet count, hemoglobin, blood urea nitrogen, serum creatinine, serum bilirubin, serum glutamic oxaloacetic transaminase [sgot], serum glutamic pyruvic transaminase [sgpt], alkaline phosphatase, s. uric acid, all were within normal limits before and after treatment . However, the rise in liver aminotransfereses (sgpt and/or sgot) was observed in 9/39 patients of group b and 5/38 of group c whereas 2/35 in group a. the rise in liver aminotransfereses to the tune of three to five fold of upper limit of normal [uln] was observed in 4/9 patients in group b and 1/5 in group c. all these patients were asymptomatic and were detected on scheduled laboratory investigations in the later visits . These patients were followed up carefully and all of them recovered within six weeks after discontinuation of medicine without any active intervention . The commonest adverse events reported were itching / skin rashes / eruption and epigastric pain followed by diarrhea, burning micturation and other as listed [table 3]. This active comparator controlled study of 24 weeks duration demonstrates the effectiveness of ayurvedic herbal product (abfn02) in osteoarthritis . Abfn02 which has bhallatak (semecarpus anacardium) as a main ingredient, known to produce intolerance and toxic effects was better adhered to than glucosamine sulphate (gs) which is considered as a natural product / dietary supplement sold over the counter . Better adherence to abfn02 may be attributed to abiding to the ancillary clinical instructions desired for the intake of bhallatak - based formulations (vide supra), the improvisation of traditional dosage form (avaleha - electuary) into the convenient tablet form and fidelity to the classical manufacturing process for the development of the product (abfn02). The classical manufacturing process probably subdues the potential toxic phenols present in the pericarp of bhallatak seed, mainly responsible for the toxic effects . Total pain vas (visual analogue score) was calculated after taking an average of pain vas of both the knee (right and left) on activity and at rest has shown statistically significant improvement from baseline in all the three groups . Although abfn02 had an edge over gs there was no significant superiority of one over other . Similarly proportion of patients with> 50% total pain vas score reduction was found to be higher with abfn02 (44/67) over gs (14/26). Total womac index (semi - quantitative estimation of pain, stiffness and difficulty in activity measures) and haq score have also shown statistically significant reduction from baseline in all the three groups with higher reduction in abfn02 over gs . In this study, we have observed consistently significant symptom modifying effects with abfn02 as well as with glucosamine sulphate . It has been reported that the symptomatic effect size of glucosamine varies greatly depending on the formulation used and the quality of clinical trials . All the three categories clinical, laboratory and imaging evaluated for secondary objective variables have shown improvement in all the three groups however notable are urinary ctx - ii and mri for disease modifying effects . The ctx - ii values have demonstrated wide standard deviation in all the three groups pre and post treatment . However not withstanding with the statistical application the quantum of average drop in ctx - ii value is larger in group a (gs) than in group b and c (abfn02). This observation is difficult to explain in view of the conflicting clinical evidence against gs for disease modifying activity and traditional reputation of the abfn02 ingredients having rasayana (reparative and reconstructive) activity as well as our exploratory study results of carryover effects . Our previous exploratory study of six weeks duration in 45 patients of oa knee noted substantial pain relief in these patients . Also persistence of therapeutic effect was reported in majority of these patients after withdrawal of the drug . Patients who had reappearance of pain showed reproducibility of the effect on reintroduction of the drug . Pharmacokinetics and drug metabolism play important role in the bioavailability and eventual efficacy of gs . Interestingly in this study, patients were advised to take the medicines with milk and were also advised to abide with certain ancillary ayurvedic instructions (vide supra) which are obligatory when a product has a semecarpus anacardium as a major ingredient . To avoid bias in this randomized comparative study these instructions were recommended to all the three groups including group a receiving glucosamine sulphate . In the imaging modality of mri although only eight patients could be evaluated before and after treatment of six months; four out of six patients taking abfn-02 had improvement seen on mri on account of bone marrow swelling, synovitis and bursitis indicating directionality towards disease modifying potential of the product . The study formulation abfn02 which has only two ingredients bhallatak (semecarpus anacardium) and guduchi (tinospora cordifolia) have independently demonstrated their activity in degenerative disorders and arthritis . No serious and severe clinical adverse event was reported by any patient in this six month study of 112 patients . All the laboratory investigations undertaken for assessment of safety profile were within normal range before, during and after treatment . Evidently the rise of sgot and sgpt was primarily in the later visits of drug interventions . Although five patients (6.5%) had rise in aminotranferases to the tune of three to five fold of uln; all these patients were asymptomatic and liver enzymes came back to normal within six weeks off the drug without any sequelae . In the earlier exploratory study of six weeks duration, we had observed similar asymptomatic and reversible rise in liver enzymes in 3/45 patients when the effective dose of bhallatak had crossed the dose of 20 gms bhallatak rm / day (raw material) beyond 5 week of the study . For the present study the precaution was taken by limiting the highest possible daily dose of 18 gms bhallatak rm / day in a pulse dose regimen gradually stepped up over six weeks . Do we need to give longer gap of more than six weeks of duration when drug is repeated in the pulse dose incremental regimen? Whether we should limit long - term continuous administration of bhallatak formulations even for relatively lower dose? Other clinical study having semecarpus anacardium and tinospora cordifolia in combination with other traditional herbs have demonstrated efficacy in osteoarthritis however here also 2/19 patients receiving bhallatak in combination have shown rise in liver enzyme sgpt . It is imperative to remind tinospora cordifolia another equal amount of ingredient in the abfn02 has well demonstrated hepatoprotective activity . Notably our independent long - term (120 days) animal toxicity study has not demonstrated any significant liver damage on histopathology . Interestingly, methotrexate the drug of choice amongst disease modifying antirheumatic drugs used conventionally in clinical practice is monitored for its liver toxicity and the effective dose is titrated against liver transaminases . Captivatingly the incidence of methotrexate induced increases in serum alanine aminotransferase (alt) is approximately 14%, while the incidence of increases into the abnormal range of aspartate aminotransferase (ast) is 8%in non - malignant diseases on oral use and the abnormality of liver enzymes usually resolves within one month of discontinuation . Current study, earlier exploratory study, other concurrent clinical study and congruent experimental evidence suggests promising role for bhallatak based formulations in the management of osteoarthritis . However the potential hepato - toxicity demands thorough phytochemical analysis for identification and optimization of phyto - actives and minimization of phyto - toxic components . Experimental studies with identified in - vitro and in - vivo models for better insight in mechanisms of action would help further improvise this age old classical ayurvedic product and evaluate its disease modifying role in the management of osteoarthritis.
|
Approximately 30% of individuals over 65 yr of age fall at least once a year (tinetti, 2003). Falling is a major public health and medical problem that can cause serious injuries including fracture, brain injury, and even death . As aging progresses, muscle mass, muscle strength, and joint range decrease and strides narrow as walking speed declines . Stimulus response time and nerve conduction velocity decrease owing to changes in the nervous system, which leads to reduced balance ability . This decline in physical function reduces lower extremity strength, balance, and flexibility, thereby causing frequent falling during walking (huh et al ., 2010; jeoung, 2014; kressing et al ., in korea, 21.441.6% of elderly patients receiving home care and 30.3% of elderly patients in nursing homes who have experienced falls (gu et al ., 2006), in who over 65 yr elderly, falling were higher prevalence than other elderly disease (kim and lee, 2006). Of community - dwelling elderly persons, 43% reported being fearful of falling, while 44% reported activity restrictions (robertson et al ., 2002). Almost half of older adults transitioning to frailty had a fear of falling (kressing et al ., 2001). Fear of falling is not only the immediate result of falls but also a risk factor for falls which creates a vicious cycle between falls and fear of falling . Various complex health problems arise in 50% of the elderly who have experienced falls; 10% of them require medical treatment and 5% experience fracture . Since 50% of the elderly individuals who are admitted to the hospital for fall - related injuries die within 1 yr, falling is a major cause of morbidity and mortality in the elderly (tinetti and powell ., 1993). Since falling induces pain, restricts activities, and disables independent living, fear of falling and the restriction of social activities due to falling greatly reduce well - being and quality of life . As such, falling not only leads to physical damage in the elderly but can create serious problems for social well - being; therefore, studies on fall prevention and intervention are required . Recent research implicates fear of falling as a contributor to physical dependence among elderly persons (tinetti and powell ., 1993), while other studies supported the close association among exercise, physical performance, and fear of falling (li et al ., 2005). The risk of falling can reportedly be reduced for those who exercise regularly, but few studies have examined its correlation with physical fitness . The purpose of this study was to examine the correlation between physical fitness and falling fears in the elderly . A total of 173 elderly women who were 6585 yr old were recruited from a welfare center in inchon city . All potential participants underwent a comprehensive explanation of the proposed study, its benefits and inherent risks, and the expected time commitment . Medical information (health status and medications) was obtained from participants using a questionnaire . The subjects were excluded if they were not able to walk without a cane or other assistive device or had known conditions and musculoskeletal problems limiting their safe participation in this study . The physical fitness test for seniors was developed by roberta & jessie and included a 6-min walk test, grip strength, 30-sec arm curl test, 30-sec chair stand test, back scratch and chair sit and reach test, 8-foot up and go, unipedal stance, and body mass index . This study approached fear of falling in two ways: (1) direct questioning focused on perceptive fear of falling; and (2) the korean version of the fall efficacy scale - international (kfes - i) to measure the confidence of avoiding falling during daily activities using the level of concern about falling . The kfes - i has 16 items, each of which is scored from one to four for a total score of 1664 . According to the cut point suggested by delbaere et al . (2004), we considered patients with a score 23 as having a higher level of concern over falling . Statistical analysis was performed using spss for windows version 21 (ibm spss inc ., a correlation analysis was conducted to examine the correlation between fall efficacy and physical fitness factors, and the correlated physical fitness factors were divided into quartiles to analyze the differences between groups . To investigate the differences in fall efficacy between physical fitness items, one - way analysis of variance (anova) was performed . A total of 173 elderly women who were 6585 yr old were recruited from a welfare center in inchon city . All potential participants underwent a comprehensive explanation of the proposed study, its benefits and inherent risks, and the expected time commitment . Medical information (health status and medications) was obtained from participants using a questionnaire . The subjects were excluded if they were not able to walk without a cane or other assistive device or had known conditions and musculoskeletal problems limiting their safe participation in this study . The physical fitness test for seniors was developed by roberta & jessie and included a 6-min walk test, grip strength, 30-sec arm curl test, 30-sec chair stand test, back scratch and chair sit and reach test, 8-foot up and go, unipedal stance, and body mass index . This study approached fear of falling in two ways: (1) direct questioning focused on perceptive fear of falling; and (2) the korean version of the fall efficacy scale - international (kfes - i) to measure the confidence of avoiding falling during daily activities using the level of concern about falling . The kfes - i has 16 items, each of which is scored from one to four for a total score of 1664 . According to the cut point suggested by delbaere et al . (2004), we considered patients with a score 23 as having a higher level of concern over falling . Statistical analysis was performed using spss for windows version 21 (ibm spss inc ., a correlation analysis was conducted to examine the correlation between fall efficacy and physical fitness factors, and the correlated physical fitness factors were divided into quartiles to analyze the differences between groups . To investigate the differences in fall efficacy between physical fitness items, one - way analysis of variance (anova) there was a significant correlation between 6-min walk, 30-s chair stand test, 30-s arm curl test, chair sit and reach test, back scratch test, and 8-foot up and go test scores, unipedal stance, grip strength, and fall efficacy (p<0.05) (table 2). The mean fall efficacy was 25.499.4, higher than the fall efficacy risk score (<23). Analysis of fall efficacy after the division of each physical fitness item into quartiles showed that fall efficacy was lower as physical fitness increased . Moreover, the group with the highest level of physical fitness (> 75%) had the lowest risk of fall efficacy compared to the group with the lowest level of physical fitness (<25%). The group with high physical fitness (> 75%) according to the 6-min walk, 30-s chair stand test, 30-s arm curl test, and 8-foot up and go test scores and grip strength had lower fall efficacy points than the cut point suggested by delbaere et al . Risk of falling in the elderly includes not only the result of falling itself but also the high chance of injury accompanying falls . Analysis of the correlation between physical performance and fear of falling in this study showed that they have a strong correlation and that fear of falling decreases as physical fitness level increases . Studies have reported a strong correlation between muscle strength and balance with falling (howland et al ., 1993; lawrence et al ., that is, balance ability and falling are decided by how the body copes with a sudden postural disturbance in which an individual maintains a correlation between the instant reaction and the balance ability of the upper and lower body (higuchi et al ., 2004; jeoung, 2014; walker et al, 1991). For this reason, muscle strength declines and the incidence of falling becomes more frequent as aging progresses . The results of this study also verified that muscle strength, cardiovascular endurance, and agility are highly associated with a fear of falling as shown in previous studies . Therefore, a regular exercise program that can enhance muscle strength, muscle endurance, cardiovascular endurance, and agility should be emphasized.
|
A 45year old woman was admitted to our hospital and surgery was planned for right staghorn calculus (figure 1). Ultrasound showed multiple calculi in the right kidney; 38 mm in the pelvis, 21 mm in the lower pole and 16 mm in the upper pole with moderate hydronephrosis . Intravenous urography showed right renal staghorn calculus with delayed excretion suggestive of impaired right renal function . Ray showing the burden of calculi in the right kidney . Under general anesthesia, initial ureteric the procedure was carried out with the patient in prone position using a c arm and bull's eye technique . Lower pole puncture was done and the stones in the lower calyx, middle calyx and pelvis were cleared . An upper pole puncture was done under c arm guidance and bile was observed gushing out of the needle when the stiletto was removed . A 20 fr foley catheter was kept as a percutaneous nephrostomy tube and the patient was put on antibiotics according to urine culture and sensitivity along with metronidazole . In the immediate post operative period, the patient was closely monitored with parameters such as pulse rate, blood pressure, abdominal girth monitoring, water balance and nasogastric tube aspirate . The patient had two episodes of vomiting in the immediate post operative period and mild distension of the abdomen . An ultrasound was performed twenty four hours after surgery and revealed minimal collection in the gall bladder fossa (<10 ml) with pelvic collection (<50 ml). A 72 hour scan was done which showed resolution of the gall bladder fossa collection . The patient had no signs of peritonitis and responded well to conservative line of management . She was discharged home on post operative day five and was followed up after two weeks with renal function test and liver function tests which were within normal limits . According to clavien dindo grading system for surgical complications this case fits into grade 2 . Percutaneous nephrolithotomy is the treatment of choice for large (> 2 cm) renal staghorn calculi [1, 2]. It constitutes a small number of all complicated visceral injuries during pcnl . Till date, only six cases have been documented in literature . Other organ injuries such as spleen, liver and colon have been documented, with gall bladder injuries being the least common . A well distended gall bladder is in close proximity to the right kidney and medial right sided percutaneous renal access may increase the risk of gallbladder injury . It is significant to bear in mind that gall bladder injury is not a common complication but is still commonly encountered in thin individuals . Most of the cases in the literature have undergone immediate cholecystectomy . In our case, pcnl was not abandoned and the patient did not undergo cholecystectomy; our case was instead managed conservatively . In the post operative period, close monitoring is required, both clinical and by means of ultrasound . If there is deterioration in the clinical scenario, then immediate cholecystectomy has to be done . In our case, the leak subsided and spontaneous closure of perforation occurred, most probably due to the use of a two piece diamond tip needle, which is supposed to be less traumatic as compared to other conventional needles.
|
Crohn's disease, first described in 1922, is characterized by segmental granulomatous inflammation of the intestinal tract that frequently involves the cutaneous tissues as well . Cutaneous crohn's disease (ccd) is synonymous with metastatic crohn's disease (mcd). A 20-year - old woman, mother of a 1.5-year - old child, presented with a swelling in the genitalia of 6 months duration . Cutaneous examination revealed a single, non - tender, pedunculated, polypoid growth, about 6 7 cm, hanging from the left labium minus [figure 1]. However, many scars were seen on the medial aspect of both the thighs, which were attributed to pruritic ulcers in childhood, details of which were unavailable . Systemic examination, including the eyes and oral mucosa, did not reveal any abnormality . Filariasis being endemic in cuddalore district of tamil nadu, elephantiasis of external genitalia due to filariasis, besides, lymphogranuloma venereum and granuloma inguinale were also considered . (a) single, non - tender, pedunculated, polypoid growth, about 6 7 cm, hanging from the left labium minus (p) and minimal swelling of the left labium majus, (b) multiple knife - cut ulcers on the external genitalia, in the inguino - crural fold, and in the interlabial creases a clinical diagnosis of soft fibroma was entertained and an excision biopsy of the nodule was undertaken . Histolopathological examintion (hpe) revealed multiple non - caseating granulomas, edema, and dense lymphocytic infiltration in the dermis . Multiple non - caseating granulomas in the dermis (g) (a) h and e, 20; (b) h and e, 40 a week later, at the time of suture removal, the patient presented with multiple typical knife - cut ulcers on the external genitalia, in the inguino - crural fold, interlabial creases, and natal cleft, leaving no doubt in the diagnosis of ccd [figure 3]. Biopsy from knife cut ulcers could not be carried out since the patient was not willing to undergo the procedure . She did not have any intestinal symptoms or pain abdomen at any time in the past or present . Ulcers on the external genitalia in the inguino - crural fold, (a) interlabial creases, and (b) natal cleft on investigation, she was found to have hypochromic microcytic anemia (hb: 10.5 gm / dl) and mild neutrophilic leucocytosis . Other relevant investigations including mantoux test, ultrasonogram of the abdomen, and chest radiograph were not contributory . Both enzyme - linked immunoassay (elisa) test for hiv and vdrl test were negative . The patient was referred to a gastroenterologist for further work up, and no gastrointestinal involvement was reported . With this background, ciprofloxacin 500 mg bid . For 10 days in addition to oral prednisolone at 30 mg / day, which was gradually tapered over a period of 6 weeks . She reported after 2 weeks with ulcers showing signs of healing, and by 6 weeks, they resolved . However, she reappeared 2 years later with massive swellings of both the labia majora, more marked on the left labium majus . She gave a history of having had a full - term normal child, 3 months earlier, delivered by an elective lower segment caesarean section (lscs) in view of the edema of the labia majora [figure 4]. Ccd is relatively rare with fewer than 100 cases reported in the literature . Two - thirds of the patients were women with a mean age of onset at 34.5 years, though our patient had lesions much earlier at 20 years of age . Vulvar involvement in cd may be by virtue of contiguity as a direct extension of intestinal involvement or non - contiguous (metastatic) in which there is no connection between the vulva and the bowel . In a review by andreani et al ., 25% of vulvar cd did not have any intestinal involvement at the time of vulvar lesion . It is in these cases that making a correct diagnosis becomes difficult, as was the experience of the present authors, who also missed the correct clinical diagnosis initially . Mucocutaneous manifestations occur in up to 44% of patients, but they do not necessarily mirror intestinal involvement akin to our patient, who did not have any intestinal symptoms at any time . No intestinal involvement was found in the present case, similar to that in other reports . Skin manifestations in cd can be categorized as either histologically specific or non - specific (reactive). Specific lesions are characterized by non - caseating granulomas, similar to those seen in the intestinal lesions . Nonspecific or reactive skin manifestations include entities like pyoderma gangrenosum, erythema nodosum, and oral aphthae . However, such non - specific manifestations were not observed in the present case . Among patients with ccd, chronic edema leads to firm coalescing papules and fibrotic nodules, which could be mistaken for lymphatic obstruction . Tuberculosis and filariasis, more common conditions in this part of south india, were also considered initially, before the biopsy report was available . The differential diagnosis of granulomatous vulvar lesions includes conditions like sarcoidosis, foreign body implantation, hidradenitis suppurativa, mycobacterial, or deep fungal infections and granuloma inguinale that were ruled out by the hpe and other relevant investigations . Treatment of cd requires systemic administration of various antibiotics, immunosuppressive agents, and anti - inflammatory agents such as corticosteroids, azathioprene, sulfasalazine, or 6-mercaptopurine . Infliximab and adalimumab, cyclosporine, and mycophenolate mofetil have been found beneficial by various authors in addition to surgical intervention for fistulae . She was advised frequent reviews by the gastroenterologist to help in early identification of gastrointestinal involvement and complications and its management, but she was lost to follow - up; however, she resurfaced 2 years later with another child of 3 months age and no specific complications except for the massive swelling of the labia majora.
|
Voluntary exercise has been found to mitigate harmful consequences of stress on the brain and to prevent the expression of depression and anxiety - like behavior .increased activity of brain - derived neurotrophic factor (bdnf) signaling is suggested to be an important factor mediating the benefits seen after running.in agreement, stress and depression have been found to decrease bdnf expression [2, 3]. Corticotrophin - releasing factor (crf) is the major hypothalamic mediator of stress and is also involved in the etiology of depression and anxiety - like behavior [4, 5] and has been found to be downregulated in the mouse hypothalamus following exercise [6, 7]. Crf acts through the seven transmembrane, g - protein - coupled receptor crf receptor 1 (crfr1), initiating the release of cortisol in humans and corticosterone in rodents from the adrenal gland . The cloning of a second crf receptor (crfr2) [911], existing as two primary splice variants (crfr2 and crfr2), was followed by the discovery of three additional crf family members, the urocortin 1 (ucn1), urocortin 2 (ucn 2) [13, 14], and urocortin 3 (ucn 3). In general, there is a limited overlap in the distribution of crf and the crf receptor subtypes and of the urocortins, suggesting separate but complementary functional roles . The physiological roles of crfr2 in the brain are still somewhat elusive, but most reports in the literature suggest involvement in dampening the body's response to stress . Thus, mice deficient in crfr2 (crfr2 /) exposed to restraint stress show rapid and elevated acth levels compared to control animals, and behavioral studies show an increase in anxiety - like behaviors, possibly due to increased crf mrna levels in the central nucleus of the amygdala . However, studies using agonists and antagonists against crfr2 indicate that the attenuation of depression and anxiety - like behavior in relation to activated crfr2 is complex . Thus, the effects has been found to be diverse, site specific, and depending on the stress level and experimental model as well as being different between genders . The lateral septum (ls), a brain area important in the shaping of coping responses to stress and found to modulate the activity in the amygdala, exhibits the highest density of crf2 in the brain . Here, we have studied crfr2 and bdnf in the female mouse ls using quantitative real - time reverse transcriptase polymerase chain reaction (qrt - pcr) in an exercise paradigm . Brain punch biopsies from young female mice exposed to voluntary exercise and nonexercised age- and sex - matched controls were analyzed for expression levels of transcript for bdnf and crfr2 in ls . In addition, crf mrna was studied in the central nucleus of amygdala (cea), as this is a key site for the integration of central stress circuits . Finally, we monitored the exercise - induced effects on morning corticosterone and leptin levels in plasma as well as the weight of abdominal fat mass . The experiment was performed in 20 nave, 5-week - old c57/bl6 female mice (scanbur, sollentuna, sweden). All experimental procedures in animals were approved by the animal care and use committee at linkping university and in accordance with the european communities council directive guidelines . The mice were housed individually under standard conditions with free access to water and food under a 12-h light and 12-h dark cycle (lights on at 07:00 am). The experimental groups (n = 10) had access to a wheel (: 13 cm) for three weeks, and the housing of the control group (n = 10) remained unchanged . Vaginal smears were used to assess the stage in the estrous cycle and all females were in the estrous phase at the end point of the experiment . The amount of running was on average 8,000 revolutions per day with peaks during the proestrus phase . For analysis of gene expression by qrt - pcr, the mice were euthanized after three weeks at 9.00 am by means of decapitation . Blood was immediately withdrawn from the right ventricle by heart puncture, collected in edta containers (sarstedt ab, landskrona, sweden) and centrifuged at 7,000 g (4c; 10 min). The brains were dissected out, sliced, and put on ice, and punch biopsies were collected under a microscope using an air - powered punching machine following a microdissection protocol . Total rna was extracted using rneasy lipid tissue mini kit (qiagen, sollentuna, sweden)including dnase treatment and rna was reversely transcribed to cdna (applied biosystems, foster city, calif, usa). Quality control of rna extraction was performed on each brain area using the agilent rna 6000 nano assay protocol (http://www.agilent.com/chem/labonachip/) according to their protocol . Real - time rt - pcr was performed on an applied biosystems 7900 fast real - time pcr system using taqman fast universal pcr master mix according to the manufacturer's instructions (applied biosystems, stockholm, sweden). The taqman gene expression assays used were: bdnf = mm 01334042-m1; crfr2 = mm 00438303-m1; b - actin = mm 00607939-s1 and gapdh = mm 99999915-s1 as endogenous controls . Each gene was normalized with the corresponding average of b - actin and gapdh expression in the same animal and expressed as the fold difference in relation to the control group . Morning corticosterone was measured by means of an enzyme immunoassay (oc - teia), according to the manufacturer's instruction (ids nordic, herlev, denmark). Assay sensitivity was 0.55 ng / ml . Leptin concentration was measured by means of bead - based xmap luminex technology (austin, tex, usa), using a commercially available kit (electrabox, tyres, sweden) according to the manufactures protocol . Data were acquired as mean fluorescence intensity, collected by the star station software program (applied cytometry systems, dinnington, sheffield, uk). Data were analyzed with anova followed by student's t - test to ascertain which group differed significantly from controls . Here, we report a 3-fold increase in bdnf gene - expression levels in the ls following three weeks of voluntary running (p <0.05) (figure 1). To our knowledge, this is the first demonstration that bdnf mrna levels in the female ls are markedly increased following long - term exercise . Bdnf has a multitude of actions on neurons, and dysfunction of this neurotrophin may modulate mood . Exercise has been found to induce bdnf - mediated increase of neurogenesis, and increased bdnf gene - expression and protein following acute or long - term exercise results in mood benefits and enhanced memory [3, 21]. However, studies of exercise - induced effects on bdnf in other brain areas and circuits other than hippocampus are limited . In addition, we studied the effect after voluntary exercise on crfr2, since the ls harbors substantial levels of crfr2 and since this receptor has been reported to mediate coping responses during the recovery phase after stress [4, 22]. In the present study, crfr2 gene - expression was, however, not altered after three weeks exercise nor was cea expression of crf mrna although we found a trend towards an increase in crfr2 (figure 1). Plasma concentrations of morning corticosterone were decreased by approximately 18% compared to the control group (15,3 1,6 ng / ml; 12,6 2,4 ng / ml, p <0.01) (figure 2), which may suggests that it is possible that a part of the hpa - axis is inhibited by voluntary long - term exercise . However we used female mice, since anxiety and depression are twice as common in females, and there is accumulating evidence that the crf system also outside hypothalamus is differently regulated when comparing female and male rodents . The amount of voluntary running in females is closely correlated to the levels of sex hormones . We observed what others also have found that the average frequency of running where higher during the proestrus phase when there is a peak in estrogen levels . We chose to collect the brains the day at estrus when estrogen levels are low, since it is known that bdnf is regulated by this sex hormone itself at least in the hippocampus . Thus, bdnf - synthesizing neurons express estrogen receptors, and the bdnf gene contains an estrogen responsive element, suggesting possible interactions between estrogen and bdnf regulation [25, 26]. Our working hypothesis was that since acute exercise initiates the activation of the hpa - axis, crfr2 might be activated to counteract the crf / crfr1 system in the amygdala through the ls . Thus, the activation of the crf system in the amygdala is tightly correlated to stress and anxiety - like behavior . However, neither crfr2 nor crf mrna were changed after three weeks running . Taken together, if crfr2 and ls are involved in the strategies of stress coping, it seems that long - term voluntary exercise is a situation when ls crfr2 and cea crf are not activated . <0.05) (figure 2), in parallel with a 30% reduction in fat mass (p <0.001). Food intake and water consumption was not measured in the present study, but previous studies of mice using the same experimental model showed no difference in food intake in exercised animals versus controls, and no difference between groups in total body weight, similar to what we observed . Leptin is a 16 kda protein hormone and a product of the obese gene that has been found to be correlated with the lipid content of the cells and plays an important role in regulating food intake and energy expenditure . It has been shown in both humans and mice that weight loss is associated with a decrease in plasma leptin . As already mentioned, we did not observe any changes in total body weight but a decrease in perigonadal fat pads . A decrease in abdominal fat in combination with no weight loss is probably due to an increase in muscle weight after long - term exercise . It is possible that the decrease of plasma leptin in the present study is correlated to the decrease in perigonadal fat . However, further studies are needed, since the mechanisms responsible for regulating leptin expression and protein are complex and not fully understood at least not in females . In summary, these data show for the first time that long - term voluntary exercise increases bdnf gene expression but not crfr2 in the ls or crf in the cea in young healthy female mice . Although our data show that the bdnf gene is activated by exercise in the ls, the limitation is that we did not measure bdnf protein levels . However, it is possible that exercise may promote ls neuronal survival through increased bdnf, but this needs to be further elucidated . In addition, to what extent this is related to an effect on depressive and anxiety - like behavior remains to be analyzed and would be an intriguing future perspective.
|
Regulation of body weight and adiposity relies on a homeostatic system balancing energy intake with energy expenditure . Well - documented evidence gathered during the past 35 years has established that induction of thermogenesis in brown adipocytes of mice and rats can reduce obesity (rothwell and stock, 1979). The maintenance of body temperature by brown adipose tissue (bat) thermoregulation utilizes energy stores in proportion to ambient temperature (kozak, 2010). Importantly, bat - based non - shivering thermogenesis may be important in humans as well (yoneshiro and saito, 2015). Therefore, adiposity may be regulated by the capacity of the individual to manipulate brown adipocyte phenotypes at reduced temperature, thereby constituting a strategy to reduce metabolic efficiency (jaroslawska et al ., 2015). During the past decade, accumulating data have demonstrated that the gut microbiota impacts body weight and energy homeostasis (tremaroli and bckhed, 2012). Microbial diversity as well as the relative proportions between the members of main phyla firmicutes and bacteroidetes have been associated with regulation of obesity in both mice and humans (ley et al ., 2005, the gut microbiota is important for energy harvest on a polysaccharide - rich diet (bckhed et al ., 2004) and also contributes to diet - induced obesity (dio) by modulating different pathways involving triglyceride storage and fatty acid oxidation (bckhed et al ., 2007). Interestingly, microbiota from lean twins can protect against obesity induced by microbiota from obese twins, when transferred to mice (ridaura et al . Bile acids (bas) produced by hepatocytes, stored in the gall bladder and released into the gut after a meal, are metabolized by the gut microbiota to generate an array of ba species such as secondary bas, e.g., lithocholic and deoxycholic acid (sayin et al ., 2013). These can activate nuclear receptor farnesoid x receptor (fxr) and g - coupled receptor tgr5, located on ibat, to regulate thermogenesis (prawitt et al . Recent studies have linked changes in the gut microbiota in a cold environment to the thermogenic potential of brite cells through enhanced type 2 cytokine signaling by the innate immune system (lee et al ., 2015, chevalier et al ., 2015). Here we show, in contrast to the role of brite cells in determining resistance to dio in c57bl/6j mice at reduced temperature (surez - zamorano et al ., 2015), that acute changes in energy balance in mice fed a high - fat diet at 12c is associated with changes in the gut microbiota, increased ba metabolism, and induction of ibat thermogenesis . We fed mice with high - fat diet (hfd) and chow diet (chd) at thermoneutrality and at reduced ambient temperatures to assess the effects of reduced temperature on cold - induced energy expenditure and development of dio . At 12c and 17c, the reduced fat mass and adiposity (figures 1a, 1b, s1a, and s1b) together with increased food intake in mice fed either hfd or chd resulted in increased energy expenditure (figures 1c and 1d), demonstrating that reduced temperature blocks dio . Reduction of ambient temperature from 29c to 17c and 12c induced ibat and inguinal fat (ing) uncoupling protein 1 (ucp1) mrna and protein expression in mice fed either chd or hfd (figures 1e1h and s1c). However, ucp1 expression in ing was only 6% of that observed in ibat . In addition, pgc1a (peroxisome proliferator - activated receptor coactivator 1-alpha) and adrb1 (beta3-adrenergic receptor) expression, which are associated with improved metabolism, was significantly induced in ibat and ing by cold (figures s1d and s1e). Reduced cellular energy levels lead to increased phosphorylation of ampk and was associated with increased phosphorylation of acc and increased expression of cpt1a, indicating increased hepatic fatty acid oxidation (figures 1i1k). At 12c mice had decreased expression of biomarkers of hepatic lipogenesis (figure s1f), a phenotype associated with reduced plasma cholesteryl esters (ces) and triacylglycerols (tags) in mice fed hfd at 12c compared to 29c (ces, 12c 6,102.5 446 versus 29c 8,421.1 490.7, p <0.05; tags, 12c 155.1 50.4 versus 29c 409.4 43.4, p <0.05). Consistent with reduced adiposity, glucose tolerance was improved in mice fed hfd at 12c compared to 17c or 29c and was similar in both hfd- and chd - fed mice at 12c (figure 1l). Reduced ambient temperature also improved insulin tolerance of mice on either hfd or chd (figures s1 g and s1h). The improved glucose tolerance was associated with increased glut4 (glucose transporter type 4) mrna and protein levels in ibat and skeletal muscle (figures s1i s1k). Induction of irs1 (insulin receptor substrate 1) mrna at 17c reflected the improved insulin tolerance at reduced ambient temperature (figure s1l). Furthermore, expression of pepck (phosphoenolpyruvate carboxykinase) and g6pc (glucose-6-phosphatase catalytic subunit) mrna levels was increased in liver of mice housed at 17c and 12c (figures s1 m and s1n), indicating increased hepatic gluconeogenesis, which provides energy for thermogenesis in the cold (himms - hagen, 1995). To directly investigate the impact of diet and ambient temperature on mouse gut microbiota, the variable region 4 (v4) of bacterial 16s rrna genes was amplified by pcr and sequenced using the illumina miseq platform . We observed 4,090 distinct otus (from 9,442,775 reads; ranging from 75,344 to 159,323 reads per sample). To investigate how diet and ambient temperature affected the microbiota phylogenetic richness in each caecum sample, we analyzed the -diversity, as assessed by rarefication and phylogenetic diversity (figure 2a). Similar to previous reports, we found that diet is a key factor in shaping phylogenetic diversity (hildebrandt et al ., 2009, turnbaugh et al ., 2009) and observed that the caecal microbiota of mice on chd had higher phylogenetic diversity compared with mice on hfd . We next performed principal coordinate analysis (pcoa) of unweighted unifrac distances between the caecum samples from the different groups to determine the effects of diet and ambient temperature on the microbiota . A clear separation between the communities, driven by diet, was observed at the first principal coordinate (x axis), which explained 27% of the variance (figure 2b). The second principal coordinate (y axis) accounted for 13% of the variance and separated the communities by ambient temperature within the diets (figure 2b). Moreover, the communities of mice maintained at 12c separated from those at 17c and 29c independently of the diets with the strongest effect in the hfd groups (figure 2b). Analysis at the phylum level indicated that the caecal microbiota was dominated by five major phyla: actinobacteria, bacteroidetes, firmicutes, proteobacteria, and verrucomicrobia (figure 2c). Mice fed hfd at 12c and 17c were associated with a bloom of proteobacteria and a reduction in bacteroidetes and an increase in firmicutes (figure 2c). Shifts in bacteroidaceae, rikenellaceae, and s24 - 7 (all bacteroidetes), particularly in s24 - 7 on chd and bacteroidaceae on hfd, were observed (figure 2d). The increase in firmicutes under all conditions was due to increases in clostridiaceae, lachnospiraceae, and ruminococcaceae (figure 2d). Interestingly, a bloom in erysipelotrichaceae was observed in both diets, but only at 29c (figure 2d). The bloom in proteobacteria at reduced temperature was largely accounted for by desulfovibrionaceae (figure 2d), which has been previously associated with metabolic health (caesar et al ., 2015). To identify taxonomic differences in the microbiota composition of mice fed hfd or chd and challenged by differences in the ambient temperature and to identify specific bacterial taxa or species - level phylotypes that contribute to the adiposity phenotype, we applied linear discriminant analysis (lda) effect size (lefse) with lda score> 2 (segata et al ., 2011). This analysis revealed 46 discriminative features in the chd - fed mice (figure s2a) and 34 in the microbiota of hfd - fed mice (figure s2b). Similar otus belonging to class bacilli in particular orders turicibacterales and lactobacillales, the genus allobaculum in the family erysipelotrichaceae, as well as the genus rc4 - 4 in the family peptococcaceae (figures s2a and s2b) were increased in mice maintained at 29c independent of diet . The microbiota of mice fed hfd maintained at 12c was enriched in a corriobacteria such as adlercreutzia, number of clostridia from the mogibacteriaceae and ruminococcaceae families, and desulfovibrionales such as desulfovibrio (figure s2b). Similar changes were observed in mice fed chd maintained at 17c (figure s2a), all of which were lean and glucose tolerant . Reduced ambient temperature caused a robust induction of hepatic enzymes engaged in the conversion of cholesterol to primary bas, including cyp7a1 (cholesterol 7alpha - hydroxylase), cyp8b1 (sterol 12alpha - hydroxylase), and cyp27a1 (sterol 27-hydroxylase), as well as in taurine production and taurine conjugation to bas (figures 2e, s2c, and s2d). Accordingly, the ba profile was drastically altered and dominated by unconjugated ba (ca, and -, mca) at 29c in mice fed a hfd, whereas primary taurine - conjugated bas, i.e., tca, tmca, and tmca, were elevated in plasma of mice maintained at 12c on both diets (figures 2f2h). Fgf21 was 7- and 2.5-fold upregulated in ibat at 12c on a hfd and chd, respectively (figure s2e). Furthermore, type 2 iodothyronine deiodinase expression, which is associated with increased thermogenesis, was induced at reduced temperature (figure s2e), as previously observed (de jesus et al ., 2001). The tgr5 receptor, which binds to microbially produced secondary bas (kawamata et al ., 2003), was induced at 12c while thyroid hormone receptor beta was not (figures s2e s2 g). To investigate whether the gut microbiota and bas were altered in response to reduced temperature or reduction in obesity, we performed a kinetic experiment and analyzed the microbiota in mice that were fed hfd for 4 weeks at 29c and then transferred to 12c for 6 days . Increased fat mass and adiposity after 4 weeks of a hfd at 29c was not affected by reduced ambient temperature (figures 3a and 3b), and the increased demand for fuel was satisfied by a 20% increase in food intake within 2 days of cold exposure (figure 3c). Cold exposure induced ucp1 expression 5-fold in ibat after 1 day at 12c (figure 3d), similar to the increase observed after 4 weeks at 12c (compare with figure 1e). The induction of ucp1 in ing was very low and therefore not associated with the initial response required for survival in the cold (figure 3d). The gut microbiota and ba composition were shifted to the cold - adapted state within 1 day, demonstrating that these changes were independent of reduced adiposity (figures 3e3h). The bas profile, already modified 1 day after cold exposure, was dominated by conjugated bas (tca, tmca, tmca, and tmca), whereas the levels of unconjugated bas (mca, mca, and mca) were reduced compared to 29c (figure 3e). Analysis on caecal microbiota composition showed a significant decrease in the phylogenetic diversity already 2 days after cold exposure compared to 29c (figure 3f). At the phylum level, deferribacteres increased and verrucomicrobia decreased within 1 day of cold (figure 3 g). Bacteroidetes increased and firmicutes decreased, but not until after 6 days at 12c (figure 3 g), to increase the bacteroidetes / firmicutes ratio (figure 3h). At the family level, the most abundant phylotypes affected by cold exposure were bacteroidaceae, rikenellaceae, porphyromonadaceae, deferribacteraceae, lactobacillaceae, clostridiaceae, and peptostreptococcaceae (figure s3a). The fraction of others, such as s24 - 7, clostridiales, lachnospiraceae, ruminococcaceae, erysipelotrichaceae, and desulfovibrionaceae (figure s3a) did not change when mice were transferred to cold for 6 days, suggesting that these microbial phylotypes are associated with hfd feeding . Similar to the initial cold - exposure experiment for 4 weeks, we observed that adlercreutzia and bacteroides were increased after 6 days of cold exposure (figure s3b). The firmicutes, lactobacillus, clostridiaceae, genus smb53, dehalobacterium, peptostreptococcaceae, and mogibacteriaceae decreased at 12c (figure s3b). Long - term cold exposure induced a bloom in proteobacteria, particularly in desulfovibrionaceae (figure s2b), but it did not change during the short - term exposure at 12c (figure s3a). These data suggest that in parallel with ucp1 induction, changes in microbiota and bas occur when ambient temperature is reduced, but independent of changes in adiposity . To assess the capacity of the gut microbiota from mice maintained at reduced ambient temperature to modulate the development of dio mice colonized with microbiota from donors kept at 12c had reduced fat mass and adiposity as well as significantly higher expression of ucp1 and dio2 mrna and protein in ibat compared with mice colonized with microbiota from 29c (figures 4a4e). Expression of adrb3, pgc1a, and fgf21was not altered in ibat (figure 4c); no changes in gene expression were detected in ing of recipient mice (figure 4f). The glucose response was improved in the recipient mice colonized with microbiota from donor kept at 12c, but no differences occurred in glut4 protein levels in muscle and ibat (figures 4 g, s4a, and s4b). Recipient mice, colonized with microbiota from donors kept at 12c, had increased hepatic expression of cyp8b1 and cyp7b1 (25-hydroxycholesterol 7alpha - hydroxylase) and csd (cysteine sulfinic acid decarboxylase), leading to an altered ba profile (figures s4c and 4h). These mice had an increased proportion of conjugated, and a reduced proportion of primary unconjugated, bas (ca, cdca, and mca) and secondary bas (dca and udca) in the plasma (figure 4h). Gut microbiota transferred from donors housed at 12c influenced hepatic lipid metabolism, inducing ampk phosphorylation augmenting lipid -oxidation in liver compared with microbiota from 29c (figures 4i4k and s4d). Nonetheless, lipid analysis showed a modest increase in total tag in plasma in mice colonized with microbiota from donor kept at 12c (figure s4e). These results suggest that functional differences between microbiota of mice kept at 12c and 29c can be transferred to recipient mice kept at 23c . A primary and essential task of all endothermic animals is to maintain a normal body temperature by inducing thermogenesis in response to cold . Here, we demonstrate that reducing ambient temperature from 29c to 12c or even 17c also protects the host from dio, an effect that is associated with increased ucp1 expression in ibat . However, recent studies have shown that the pathway for activating thermogenesis may be more complex than the traditional model based on ibat thermogenesis . Thermogenesis occurs not only in ibat, but also by the induction of brite cells in wat at 29c by administration of interleukin 4 (qiu et al ., similarly, the thermogenic program in ibat may be activated by bas at 29c (zietak and kozak, 2016). Recently, it was shown that the depletion of the microbiota by antibiotic treatment or gf conditions stimulates the induction of brite cells by enhanced type 2 cytokine signaling from eosinophil infiltration (surez - zamorano et al ., 2015). Here, we show that both the acute and chronic exposure to reduced ambient temperature leads to induction of ucp1 in ibat and rapid changes in the composition of the gut microbiota and ba metabolism . The results suggest that the induction of cold - mediated thermogenesis involves the activation of ibat thermogenesis by a mechanism involving modulation of ba metabolism and ampk phosphorylation by the gut microbiota . A key question is whether the improved obesity / diabetic phenotype of mice with dio reared in the cold is dependent on the effects of the gut microbiota . We observed that cold exposure is linked to altered caecal microbiota and that mice on both diets shared microbial phylotypes associated with changes in ambient temperature . Bacteria belonging to bacilli and erysipelotrichaceae, usually associated with obesity (turnbaugh et al ., 2009), were enriched in mice at 29c, whereas adlercreutzia and desulfovibrio, associated with leanness (caesar et al ., 2015, goodrich et al ., 2014), were increased at 12c . Changes in the composition of gut microbiota occurring within 1 day of exposure at 12c and in the absence of changes in adiposity suggest that the changes in microbiota are driven by changes in temperature rather than merely reflecting obesity . The major microbiota changes occurring in parallel with induction of ucp1 were reduced firmicutes apparent after 1 day and an increase in bacteroidetes after 6 days, changes previously linked with protection against obesity (ley et al ., 2005, turnbaugh et al ., 2008). (2015), we identified a decreased abundance of verrucomicrobia and an increased abundance of deferribacteres when mice were exposed to cold, suggesting that altered abundance of members in these phyla contribute to the cold - induced phenotype . Changes in other bacteria after longer cold exposure may be in response to altered adiposity of the host . The mechanism by which the gut microbiota influences adiposity may include modulation of ba metabolism (sayin et al ., 2013). Bas are microbial - derived metabolic regulators, which can suppress dio through increased energy expenditure (watanabe et al ., 2012). Here we show that lower ambient temperature increased production of bas and expression of genes related to ba synthesis . The increased levels of conjugated bas may be attributed to reduced levels of lactobacillus, which has high deconjugation capacity upon cold exposure . These observations were confirmed in the kinetics study where conjugated bas were increased and lactobacillus was decreased after 1 day at 12c . The increased prevalence of taurine species in the cold might antagonize fxr receptor (sayin et al ., 2013) and protect against dio as fxr - deficient mice are resistant to dio (prawitt et al ., 2011a). In agreement with inhibition of fxr signaling in the cold - exposed animals, we observed increased expression of enzymes involved in ba synthesis and increased ba pool size . The cold - exposed mice had a ba profile that resembled that of gf mice, which also are resistant to dio and have increased expression of phosphorylated ampk in the liver (bckhed et al ., 2007). Ampk activation inhibits fxr activity (lien et al ., 2014) and also promotes energy expenditure . Accordingly, we observed increased expression of phosphorylated acc as well as downstream cpt1a expression, which is associated with increased fatty acid oxidation and energy expenditure . Importantly, we observed this phenotype both following cold - exposure as well as after microbiota transfer, suggesting that the phenotype is linked to the altered microbiota . In the current study, cold exposure at 12c causes a strong and rapid induction of the brown adipose phenotype in ibat, but not in ing, an increased whole - animal energy expenditure, and a complete suppression of dio . We demonstrated that transplantation of caecal material from mice reared at 12c to gf recipients improved their metabolic phenotype . (2015) demonstrated that transplantation of caecal material from cold - exposed mice reduced obesity and improved insulin sensitivity . However, the brown adipocyte phenotype in ing wat in our study is minor (1%5%) compared to the robust ibat thermogenic phenotype . Our investigations suggest that changes in the gut microbiota in response to the cold exposure mediate ba metabolism, possibly through changes in ampk and fxr signaling, to complement sympathetic signaling in the regulation of thermogenesis in ibat and resistance to dio . Protocol i. breeding pairs of c57bl6/j (b6) mice were obtained from the jackson laboratory . Adult b6 mice at 1220 weeks of age were divided into 6 groups (n = 810 mice / group). Three groups were ad libitum fed hfd (58% energy in kcal from fat, ain-76a 9g03 research diets); another three groups received chd (11% energy in kcal from fat, 5053, rodent diet 20, labdiet). Mice were single - housed with a 12 hr light/12 hr dark cycle at environmental temperatures of 12c, 17c, and 29c for 4 weeks . B6 mice at 8 weeks of age were individually housed at 29c and ad libitum fed a hfd for 4 weeks (n = 6 mice). Thereafter, mice were transferred to 12c for 1, 2, 4, and 6 days and received ad libitum a hfd (n = 6 mice / time point). For both protocols, mice were anaesthetized with an overdose of cocktail composed of ketamine / xylazine / chlorpromazine administered subcutaneously to collect blood samples by cardiac puncture . Blood samples were centrifuged for 10 min at 2,400 rpm and stored at 20c . Mice were sacrificed by cervical dislocation, and tissues and caecal content were quickly removed and stored at 80c for further analysis . Animal experiments performed at different temperatures were approved by the local committee for the ethical treatment of experimental animals of warmia - mazury university (nr 38/2011), olsztyn, poland . Fat mass and lean mass were measured by nuclear magnetic resonance (nmr, bruker). Food intake was calculated on a weekly basis and expressed as the amount of energy in kj . At the end of the experiment bacterial gdna was extracted using the genematrix stool dna purification kit (eurx) from the caecum of mice fed hfd and maintained at 17c or 29c . Genomic dna from caecum of mice fed hfd at 12c and chd at 12c, 17c, and 29c was isolated using the repeated bead beating (rbb) method (salonen et al ., 2010). Details about 16s rrna amplification, sequencing, microbiota data analysis, and ba analyses are provided in supplemental experimental procedures . The data are expressed as mean sem and analyzed using graphpad prism 6.0 . Statistical differences for single variables were analyzed by mann - whitney test or one - way anova and tukey s multiple comparison post hoc test for three groups (29c, 17c, and 12c) the level of significance was set at p <0.05; p <0.05; p <0.01; p <0.001; p <0.0001 . M.z . Was involved in design of the experiment and performed physiological and molecular phenotypes and participated in writing the manuscript; p.k .- d . Was involved in design and performed experiments concerning microbial profiling and transplant experiments and participated in writing the manuscript; l.h.m . And m.s . Designed the initial hypothesis and participated in the design and the writing of the manuscript; f.b . Was involved in design and interpretation of experiments concerning microbial profiling and transplant experiments and participated in the design and the writing of the manuscript.
|
The peptide sequence of anastomosis photocaged 1 (apc1) contains seven lysine residues that are protonated at neutral ph, keeping the peptide soluble and in its monomeric unfolded state . As will be shown, a sol - gel phase transition can be initiated by triggering the folding of the peptide into an amphiphilic -hairpin . Once folded, apc1 is designed to rapidly self - assemble into a fibrillar hydrogel network, where each fibril is composed of a bilayer of -hairpins that are intermolecularly hydrogen - bonded along the long - axis of a given fibril, figure 1b (transition i) and 2b . Earlier studies in our lab support this proposed mechanism where the formation of the hydrophobic interface that defines the fibril bilayer provides most of the thermodynamic driving force for self - assembly . We, and the pochan laboratory, have shown that hydrogels formed from hairpin peptides display shear - thin / recovery rheological behavior . When these gels experience a shear stress, such as that delivered by a syringe plunger, some of the interactions that stabilize their fibril network can be disrupted allowing the material to flow . When the application of shear stress ceases, the network heals and the gel recovers (figure 1b, transition ii). As will be shown, apc1 exhibits similar behavior, allowing its syringe - based delivery . To induce the final gel - sol transition that allows the material within the sutured vessel to dissolve, we sought to disrupt the hydrogel network by destabilizing the hydrophobic interior of its fibrils, figure 2b . Apc1 incorporates a photocaged glutamic acid, namely 4-methoxy-7-nitroindolinyl glutamic acid [e(mni)] on its valine - rich face, which would reside in the hydrophobic bilayer of the peptide fibril . When the gel is irradiated with 365 nm light, or alternatively through 2-photon irradiation at 720 nm, the cage is released introducing a negatively charged glutamate side chain into the hydrophobic bilayer, which is energetically unfavorable . This locally disruptive interaction is additive and should result in the global destabilization of the fibril network defining the gel state, thus initiating the final gel - sol transition (figure 1b, transition iii and figure 2a). The mni cage, chosen for its efficient aqueous photolysis and cytocompatibility, is incorporated at position 14 of apc1's primary sequence . This is a central position on the hairpin's hydrophobic face that corresponds to a fully buried site within the fibril bilayer . Incorporating the cage at this position necessitates the placement of a glycine residue on the opposing strand of the hairpin at position 7 . In the self - assembled state, the small glycine provides a hole on the hydrophobic face of one folded hairpin into which the caged side chain from a neighboring hairpin can reside . This lock and key side chain packing arrangement accommodates the large photocage within the tight steric constraints of the bilayer interior . For example, aryl residues can be found in sheet interiors with their aromatic side chains laying over a glycine residue in a neighboring strand . The formation of favorable - interactions between the aromatic side chain and the glyl - amide backbone drives this fold . Although the extended length and flexibility of the caged side chain could allow for multiple modes of packing, molecular modeling shows that in the context of the apc1 hairpin, the proposed lock and key arrangement results in a well - packed hydrophobic face that is conducive to bilayer formation (figure 2b). Figure 2c shows a cut - away view of one monolayer formed from three hairpins . Here, the caged side chain from one hairpin lays over the glycine of a neighboring hairpin below it, with the indoline group making hydrophobic contacts with proximal valine side chains . The top - most hairpin in the assembly shown in panel c highlights the glycine hole into which a photocaged side chain could be placed if an additional hairpin were to join the fibril assembly . In addition to apc1, a second peptide was designed to study the positional effect of cage placement on gel performance . Peptide apc2 contains the [e(mni)] residue at position 16, which is slightly closer to the hairpin's c - terminus . Two control peptides were also prepared, namely capc1 and capc2, which contain uncaged glutamate residues at positions 14 and 16, respectively . The ability of apc1 and apc2 to fold and associate into -sheet rich assemblies was monitored using circular dichroism (cd) spectroscopy . In water at 5 c, the cd spectra of 1 wt% solutions of apc1 and apc2 indicate that the peptides are unfolded (figure 3a). However, figure 3b shows that folding and self - assembly can be triggered by adding ph 7.4 buffer that contains nacl to the aqueous peptide solution and increasing the temperature to 25 c for apc1 and to 37 c for apc2 . The nacl screens the lysine point charges and increasing the temperature drives the hydrophobic effect, both of which favor folding and assembly . The exact temperatures needed to induce gelation was determined by monitoring the mean ellipticity at 216 nm as a function of temperature, figure s3 . In these cd experiments, self - supporting hydrogels of both peptides (ph 7.4, 150 mm nacl) form directly in the cuvette . Spectra of both peptides in the gelled state display distinct minima at 216 nm, which is indicative of sheet secondary structure . Also evident in the spectra are absorptions due to the indoline cage, which occur in the near uv - cd (240 - 380 nm). This indicates that in the unfolded state of each peptide, the achiral aromatic indoline ring resides in an achiral environment, that is, it is solvent exposed . However, when the peptides fold and assemble, the ring is placed into a chiral environment, such as that provided by the fibril's hydrophobic interior . Importantly, under the same solution conditions that support apc1 and apc2 assembly, the control peptides capc1 and capc2 remain unfolded, figure s4 . This suggests that the control peptides' negatively charged glutamate side chains are not accommodated within the hydrophobic interior of the fibril bilayer and thus, peptide folding and assembly are disfavored . Importantly, it also supports the assertion that if the glutamate's negative point - charge were to be unmasked when the peptides are in the folded and assembled fibrillar state, that this event should be disruptive . Oscillatory rheology was employed to study the rheological behavior of each gel under experimental conditions that mimic its use during the anastomosis procedure . Here, the storage modulus (g), a measure of the gels' mechanical rigidity, is monitored in the rheometer under environmental conditions that mimic: (1) the initial (sol - gel) formation of the hydrogel in the syringe; (2) shear thinning of the material during injection with subsequent hydrogel recovery in the vessel lumen; and (3) the disruption of the gel network (gel - sol) by uv photolysis after suturing . Monitoring gel behavior in a rheometer, although not exactly capturing the gel's response during the actual anastomosis procedure, allows quantitative and reproducible measurement of gel mechanical properties under highly controlled conditions . I, the rate of hydrogel formation (sol - gel) is assessed by monitoring the evolution of g after peptide folding and assembly is triggered . Apc1 forms a semi - rigid gel within the first few minutes that further rigidifies with time (g2,500 pa after 30 minutes). After completion of the initial time sweep, 1000% strain is applied to the material for 30 seconds in regime ii to mimic syringe delivery of the gel . This application of strain results in an immediate decrease in g indicative of shear thinning that results in a viscous gel capable of flow . After the 30 seconds, the applied strain is decreased allowing the apc1 gel network to recover to about 75% (1900 pa) of its original rigidity . Lastly, using an optically clear parallel plate in the rheometer, the recovered hydrogel is subjected to irradiation by uv light (365 nm) for the first 10 minutes of regime iii . The data clearly show that the gel network is rapidly degraded with an almost immediate decrease of g to 180 pa . Taken together, the rheological data suggests that apc1 is capable of triggered gelation, shear - thin delivery via syringe and rapid post - delivery recovery . Importantly, irradiation by uv rapidly disrupts the gel network affording a viscous material, which should be capable of dissolution when exposed to the shear of blood flow . Figure 3d shows the same experiment for the apc2 gel, where a significant lag phase before the onset of gelation is observed . However, with time, apc2 forms a gel that is significantly more stiff (20,000 pa) then that formed from apc1 . In regime ii, the apc2 gel shear thins but is unable to self - heal effectively and recovers only about 5% of its original mechanical rigidity . Irradiation in regime iii although apc2 initially forms a rigid gel, its inability to recover after being shear thinned precludes it use in the anastomosis procedure . Overall, this rheological data indicates that the positional placement of the photocage within the peptides' primary sequence is important . Here, incorporation of the cage near the hairpin's terminus hampers the ability of its network to recover . The rheological data shows that irradiation of the recovered apc1 gel leads to a significant decrease in g presumably as a result of releasing the glutamate cage . This was confirmed by following the fate of caged apc1 during photolysis by uv spectroscopy and lcms, which showed nearly complete release of the mni cage and evolution of corresponding carboxylate - containing peptide within 90 seconds of irradiation, figure s8 . In figure 4, transmission electron microscopy (tem) shows the morphology of fibrils isolated from a 1 wt% apc1 hydrogel before (a) and after (b) irradiation . Before irradiation, the hydrogel network is composed of long fibrils whose lengths are distributed over a range of 150 nm to over 1000 nm, figure 4c . Irradiation results in the formation of small fibril segments as shown in panels (b) and (d). The average length of these fibrils is on the order of 150 nm demonstrating that the majority of longer fibrils have been converted to smaller segments as a result of photolysis . Further, cd spectroscopy of the irradiated gel shows an attenuation of -sheet signal at 216 nm, which is consistent with the disruption of the fibril network, figure s9 . The fact that some small fibrils persist may be due to either incomplete release of the cage, or that a population of the uncaged peptide remains in the fibrillar state . At any rate, the rheological data demonstrates, and as will be confirmed in the in vivo studies, this level of fibril disruption is sufficient to ensure the necessary gel - sol phase transition . The ability of the apc1 hydrogel to serve as a temporary aid in the suturing process was assessed in a mouse femoral artery end - to - end anastomosis model . This challenging microsurgical setting tests the gel with regards to ease, safety, precision, and speed of arterial anastomosis . The mouse femoral artery is approximately 200 microns in diameter and, conventionally, is anastomosed via a technically challenging and time - consuming no - touch under - water suturing technique . In contrast, the apc1 hydrogel is designed for facile administration directly to the in situ vessel to distend the lumen and add stability to the vessel wall . This should enable more precise and quick placement of stitches, resulting in increased vessel patency . In this model, an incision is made in the groin crease of mice to expose the femoral artery, which is dissected and subsequently clamped, figure 5a . Optical coherence tomography (oct) of the vessel cross - section shows that the lumen is collapsed, figure 5b . Without the aid of a stent or luminal filler an intraluminal injection of a 2 wt% apc1 hydrogel was administered by syringe to both severed ends of the vessel, distending the lumen (figure 5c) and mechanically supporting the vessel wall after injection, figure 5d . A longitudinal cross - section oct image of the proximal (left) and distal (right) ends of the vessels after injection with the apc1 hydrogel is shown in figure 5e . Vascular distention caused by the gel helped maintain a cylindrical vessel shape, facilitating identification of a single vessel wall leading to more uniform suture spacing and closure . Further, hydrogel can be applied between the vessels, aiding their approximation (see video s1). Vessel ends can be inserted into the gel, where local thinning occurs proximal to the vessels during their movement within the gel . The needle can be passed directly through the optically clear gel to place the sutures . Upon placement of the final suture, the external gel is washed away, and the vessel is irradiated at the suture site for 2 minutes using a hand - held 365 nm led uv light to remove the interior gel . Resumption of blood flow after removing the clamps clears the disrupted gel as evidenced by volume doppler oct (figure 5f) and blood flow speed measurements, figure s10 . The efficacy of the final gel - sol phase transition is critical since remaining solid material could lead to thrombus formation, diminished perfusion and tissue ischemia . Thus, vessel patency was assessed in a series of experiments that monitor vascular perfusion . First, high - resolution micro - ct was used to follow the perfusion of a polymeric contrast agent (microfil) one hour after gel - based end - to - end anastomosis of the femoral artery and resumption of blood flow . Figure 6a - c and video s2 show that polymer completely fills the distal tibial and fibular vessels as well as the plantar arch on the footpad and the digital branches to the toes . Separate experiments in which animals were dissected to directly observe polymer distribution support the ct data (figure 6d - f), confirming occlusion free vascular patency throughout the entire extremity that is similar to the contralateral control limb . Lastly, perfusion of a near - infrared dye was followed throughout an explanted hind limb after irradiating a gel that had been implanted into the femoral artery, figure 6g - i . The leading edge of the dye (green arrow) immediately penetrates the limb from its initial injection site (yellow arrow), quickly penetrating another major vessel (white arrow, h) and distant vascular regions and surrounding tissue (i). Taken together, these experiments indicate that the peripheral vascular and capillary bed is well perfused without any evidence of luminal narrowing or occlusion due to gel remnants . We also investigated gel biocompatibility, where histology shows a similar peri - vascular inflammatory response in vessels anastomosed with or without gel, a result of surgical tissue traumatization and post - operative healing, figure s11 . Further, subcutaneously injected gel produced no gross local inflammation and a typical foreign - body response that resolved, figure s12 . Designing soft materials from self - assembling peptides allows their bulk properties to be engineered at the molecular level for specific applications . Physical attributes endeared to the peptide monomer are translated to the properties of the self - assembled gel network . The multiple phase transitions of apc1, which enable its use in facilitating the anastomosis of ultra - small vessels, are due to the exact placement of natural and non - natural amino acids within its sequence that render the peptide, and its corresponding gel, responsive to environmental change . Thus, de novo peptide design can afford a self - assembled material that represents a promising alternative to currently available non - injectable stents . General methods describing the synthesis and analytical characterization of the photocaged glutamic acid and all peptides, as well as detailed procedures for all of the experiments employed in this study (including the number of animals used and replicates) can be found in the supplementary information in the online version of the paper . The supplementary information also contains afm, additional rheological studies, histological analysis, and videos showing the gel - aided anastomosis and three - dimensional reconstruction of hind - limb vasculature.
|
Cognition is defined as information processing in one s brain and ability to judge and make decisions, and it covers various concepts such as attention, memory, executive planning, insight, and problem solving1, 2 . For normal cognitive function, the integration of sensory information, visual perception, and language ability is required first, and loss of attention and of memory impair cognitive function, such as problem solving and reasoning ability3 . In rehabilitation training program, the adaptive approach, which focuses on recovery of damaged cognitive function in the brain, is one of the common approaches in cognitive rehabilitation . It is based on the theory that neuroplasticity reorganizes the damaged cerebral cortex, and it focuses on recovery of the damaged cognitive function and minimizing the effects of the damage4 . As a method of functional brain imaging for brain wave testing, many different innovative methods of radiological examination including the electroencephalogram, positron emission tomography, magnetic resonance imaging, functional magnetic resonance imaging, and single - photon emission computerized tomography have been used, and these methods can be used to confirm the brain s functional changes by comparison with normal brains5 . Compared with other experimental brain imaging methods, brain wave measurement is a commonly used as a noninvasive method for analyzing the changes in brain functions directly within a short period of time, and providing a variety of useful information with data from a short examination6 . It is also an electronic neurophysiological experiment method that can be used to investigate the brain s functional status in real - time while focusing on a specific assignment . This is applicable to various patients suffering from brain damage, alcoholism, and/or depression, and it can be used to analyze brain functions objectively . It makes it especially easy to observe the process of spatiotemporal changes, and therefore, it is very useful for measuring cognitive load in real time7 . Neurofeedback (nfb) brain wave training based on the principle of brain plasticity is a relatively novel method for cognitive rehabilitation . This method involves training to adjust brain waves within a specific range, and the optimum brain wave adjustment improves the level of awakening and affects various functional elements of the patient . Therefore, understanding brain waves should be among the highest research priorities8, 9 . The beta wave improves concentration and reaction time when activated with a brain wave between 1235 hz . Through beta wave activation, nfb training aims to improve cerebral function by enabling patients to activate this brain wave by reinforcing or suppressing certain frequencies based on visual and auditory feedback7, 10 . Previous research has shown that nfb is effective in improving cognitive functions including visual perception, memory, and concentration in patients with brain injuries, such as traumatic brain injury or stroke11, 12 . However, research on cognitive rehabilitation through nfb on existing stroke patients has been limited to single case studies, and sufficient studies on its effectiveness and clinical usability have not been conducted . This study investigated the changes of a brain wave and visual perception following nfb and the manner in which these changes affect daily life in stoke patients . Also, we aimed to indicate the effective therapeutic method to clinicians engaged in the cognitive rehabilitation of patients with stroke . The participants were recruited from among 28 stroke patients who received occupational and physical therapy and were hospitalized at a general hospital in kyeongki province, republic of korea, from june to july 2013 . Participant selection criteria included that the patient should be hemiparalytic from a stroke within the previous 3 months to 1 year, be able to follow verbal instructions, and be able to communicate at a certain level . In addition, participants were chosen from among patients who were able to perform all the tests and had experienced light cognitive function failure that was scored between 18 and 23 on the mini - mental state examination (mmse). A subject was eliminated if he / she had diplegia, never attended a school, was biased, or had experienced nfb within the past year . Furthermore, all subjects who participated in this trial provided a signed written consent form after having the expected result and the side effects fully explained . A total of 27 subjects eventually completed the intervention and testing: 13 from the nfb group and 14 from the control group . Nfb training was conducted over a period of 6 weeks, considering the hospitalization period . As the participants were recruited successively, the training was conducted over a 9-week period . The control group received occupational and physical therapy for half an hour 5 times a week for 6 weeks . The nfb group received the same number of traditional rehabilitation sessions as the control group with extra nfb training, respectively, for half an hour 5 times a week for 6 weeks . All of the protocols used in this study were approved by sahmyook university . Before participation, the procedures, risks, and benefits were explained to all of the participants, who gave their informed consent . The participants rights were protected according to the guidelines of sahmyook university . To perform the nfb training, a neurocomp system (neurocybernetics inc ., encino, ca, usa), composed of a repeater, a monitor for the clinician and the patient, computer, electroencephalography (eeg) sensor, cables, and poles, was used for nfb . The poles used in nfb training were attached to the scalp, and data were recorded on an oscillograph . The location of the poles followed the international 1020 electrode system, and the distance between each pole was 1020% of the whole circumference5, 13 . The nfb training method used in this research was a beta - smr training method and was conducted with the patient s eyes open . The reward brain wave was set with either an smr wave (1215 hz) or mid - beta wave (1518 hz) depending on the location of the cerebral cortex . The inhibitory brain wave was set with both a delta wave (0.54 hz) and high - beta wave (2236 hz)7, 8, 12 . The training time for a single trial was set at 30 minutes, during which a 3-minute training module was conducted 10 times . For monopolar type training, a pole or nfb sensor was attached to a certain part of the scalp (c5 or c6) within the lesion area, and the remaining 2 poles were attached to both ears with the participant seated on a comfortable chair . We used 4 games that had a low level of difficulty and were intriguing including space race, mazes, island, and boxlight . Participants played the games by watching the monitor with the poles attached, and his / her awakening level was controlled . For the space race game, the spaceship was set to move forward and backward depending on his / her level of brain wave activation . A quantitative analysis of the brain wave data was performed using the complexity 2.0 software (laxtha inc ., checked for any artifact inflow, and data for 180 seconds obtained from pattern observation with the nfb system from the raw data of the measured brain excluding the first 10 seconds - were used for the analysis . Since delta waves between the 0.54 hz are likely to be contaminated with noise such as eye blinking (24 hz) and head movement due to an unstable body position (0.51 hz), the range of 450 hz from the entire brain wave domain was also extracted for the analysis . The fast fourier transform (fft) filtering method was conducted to convert the raw data into frequencies . The x axis represents the frequency and y axis represents the power value, which shows spectral analysis of evoked potentials in brain . The output value is the absolute band power, which is the square of the signal amplitude . The relative band power is the absolute power ratio of a particular frequency band on values of absolute band power between 0 and 1, and could be in percentage (0100%). This relative band power analysis was used to adjust for the difference in skull thickness between test subjects and individual brain waves due to the degree of tension during measurement . The motor - free visual perception test (mvpt) was used for visual perception evaluation . It contains a total of 36 items with four multiple - choice response options worth 1 point each, adding up to a maximum score of 36 . The mvpt is a standardized evaluation tool for individuals 1880 years of age and measures six different parts of visual perception functions . There are 5 items for visual discrimination (vd), 5 items for form constancy (fc), 8 items for visual memory (vm), 11 items for visual closure (vc), and 4 items for spatial relation (sr). Moreover, the processing time to complete each item is measured for all items (35 items) except for item 4 . The mvpt can be used on patients with damaged physical function who have difficulty with writing, and the confidence level of test - retest reliability for the mvpt r=0.770.8315 . The differences in the brain wave and visual perception within a group before and after the treatments were tested using the paired t - test, whereas differences between groups were tested using the independent t - test . For all data, the general characteristics of participants are shown in table 1table 1.general characteristics of the subjectsnfbcongender (male / female)8/511/3age (years)62.97.263.69.3lesion side (right / left)9/48/5duration (months)10.63.212.52.7mmse (score)19.82.520.53.7all variables are presented as the meansd . Nfb: neurofeedback training group; con: control group; mmse: mini - mental state examination . The brain wave values and visual perception changes before and after nfb training are shown in table 2table 2.comparison of brain waves and mvpt in each groupitemsubtestnfbconprepostprepostbrain waverelative beta wave*11.324.5215.455.51 * 8.583.8011.327.37(%)relative mid - beta wave2.171.022.811.32**1.530.612.171.61relative high beta wave*4.221.716.082.03 * 3.371.904.433.60acq * (hz)0.20850.07770.34170.25230.19170.04510.29220.2976mvptraw score***20.764.3423.464.48**24.005.4325.215.17**(score)vd5.691.647.150.89**5.851.796.001.70fc2.530.963.150.80 * 3.211.053.640.84*vm4.301.794.691.93**5.351.445.501.45vc6.001.776.691.75**6.571.606.921.89sr2.231.012.690.85**3.001.173.140.86time (second)*7.761.316.991.38***7.222.066.872.07**all variables are presented as meansd . * nfb: neurofeedback training group; con: control group; acq: attention concentration quotient; mvpt: motor - free visual perception test; vd: visual discrimination; fc: form constancy; vm: visual memory; vc: visual closure; sr: spatial relation; time: visual perceptual processing time . Brain wave measurement before and after nfb training revealed a statistically significant difference for the nfb group s relative beta wave value and attention concentration quotient (acq) (p<0.05). Comparison of the difference before and after the interventions between the two groups revealed that the nfb group s relative wave values and acqs were significantly different (p<0.05). For the nfb group, there were differences in vd, fc, vm, vc, and sr before and after the experiment . Comparison of the differences before and after the interventions between the two groups revealed significant differences in mvpt raw score and processing time (p<0.05). Nfb: neurofeedback training group; con: control group; mmse: mini - mental state examination all variables are presented as meansd . * p<0.05; * * p<0.01; * * * p<0.001 . Nfb: neurofeedback training group; con: control group; acq: attention concentration quotient; mvpt: motor - free visual perception test; vd: visual discrimination; fc: form constancy; vm: visual memory; vc: visual closure; sr: spatial relation; time: visual perceptual processing time nfb is developing along with technical development of quantitative eeg, computer devices, and individual medical protocols . While performing assignments that require more attention than in a steady state, alpha waves are controlled and beta waves are increased; vitalization of beta wave reflects cognitive function improvement14, 16 . The smr waves in beta waves were found to be in an appropriately steady state and to maintain attention and wakefulness . Promotion of smr wave activity is also used in a treatment to relieve impulsivity and involuntary movements17 . Smr - beta wave training is an effective interventional approach for treatment of attention and cognitive impairment, whereas nfb training supports and improves the neurophysiological function level . Performance of eeg before and after nfb training revealed statistically significant differences in the nfb group s relative beta wave value and acq (p<0.05). Comparison of the differences before and after the interventions between the two groups revealed significant differences in the nfb group s relative beta wave values and acqs compared with the control group (p<0.05). Relative beta wave value went up when attention increased, and acq reflects improvements in attention . The results of this study indicate that the increased relative beta wave value and aco resulted in significant improvement compared with the control group . Lopez - larraz et al.18 reported that nfb increased cognitive ability and concentration for various diseases, and gevensleben et al.19 claimed that nfb using the beta wave is effective for improvement of concentration, although their research was performed with adhd patients . In this study, we observed that nfb led to notable differences in attention and concentration after the intervention . This difference may have been due to the neurobiological reaction to nfb, which affects the beta wave and the concentration brain waves . Thus, nfb would be a prevailing choice for patients who require attention and concentration training . Visual perception is a process in which the central nervous system integrates visual information to adapt to the environment and converts the information to cognitive concepts for decision - making . This process has a hierarchical structure consisting of oculomotor control, visual fields, visual acuity, visual attention, visual scanning, pattern recognition, and visual memory, and the highest visual percptual process in the hierarchy is visual cognition2 . Through training of visual scanning, visuospatial orientation, and visual judgment, the damaged visual perception functions of stroke patients can be improved to enhance recognition ability and activities of daily living . Regarding visual perception before and after nfb, both the nfb group and control group showed statistically significant differences in mvpt raw score and processing time . For the nfb group, there were differences in vd, fc, vm, vc, and sr before and after the intervention . Comparison of the differences between the two groups revealed significant differences in the mvpt raw score and processing time (p<0.05). Nfb training was found to be more effective in changing visual perception change compared with traditional rehabilitation training (p<0.05). The nfb program is considered to have been more effective in improving visual perception ability because the training was on watching and focusing with the eyes . More research into the development of an attention and concentration training program that fits the rehabilitation purpose of not only stroke patients but also patients with other illnesses is necessary . In addition, post - test check - ups should be performed to determine how long the changes last . Standardized and more elaborate eeg measurement and analysis are required to provide sufficient evidence for neurofeedback brain wave training.
|
Prolactinomas are pituitary adenomas that secrete prolactin . These represent the most common hormone - secreting adenomas occurring in the pituitary gland, accounting for around 40% of all clinically recognized pituitary adenomas . They are diagnosed more frequently in women than in men, especially between the ages of 20 and 40 years, because premenopausal women are sensitive to hypogonadism, which manifests as infertility and menstrual disorders, whereas postmenopausal women are already hypogonadal and men may ignore or not recognize symptoms of hypogonadism manifesting as decreased libido, impotence, or erectile dysfunction . Moreover, galactorrhea is rare for both postmenopausal women and men (and is also relatively rarer than hypogonadism in premenopausal women), so symptoms due to tumor growth such as headache or visual field loss can represent chances for diagnosis in postmenopausal women or men . Herein, we present the case of a 44-year - old nulliparous woman who had experienced irregular menstruation cycles for about 10 years and developed both pituitary prolactinoma and endometrioid endometrial carcinoma . In premenopausal women, hyperprolactinemia causes hypogonadism by inhibiting the secretion of gonadotropin - releasing hormone, which in turn suppresses luteinizing hormone levels and can cause menstrual disorders ranging from amenorrhea, oligomenorrhea and chronic anovulatory cycle to short luteal phases of the menstrual cycle [35]. Chronic anovulatory menstrual cycle is the most common cause of long - term exposure of the endometrium to endogenous estrogen without adequate opposition from progestins, which can lead to endometrioid endometrial carcinoma [6, 7]. Thus, in this case, pituitary prolactinoma may have caused the chronic anovulatory cycle and indirectly led to the development of endometrioid endometrial carcinoma . A nulliparous 44-year - old woman with a 10-year history of irregular menstrual cycles presented with massive abnormal uterine bleeding, shortness of breath, and exhaustion . She had experienced abnormal uterine bleeding for about 1 year, and it had increased over the previous 10 days . She had no past illnesses of note, including no history of hypertension or glucose intolerance, and no special history of taking pharmacotherapies . On presentation, she was obese with a height of 152 cm and weighing 73.0 kg . Vital signs were stable, with: blood pressure, 152/96 mm hg; heart rate, 88 beats / min; axillary temperature, 100.2f; and oxygen saturation by pulse oximetry, 99% (room air). General physical examination revealed hirsutism without any other signs of androgen excess such as acne, male pattern baldness, or lowering of the voice, and there was no evidence of galactorrhea . Gynecological examination revealed an almost normal - sized uterus, impalpable bilateral adnexa, and unremarkable vagina and vulva . Ultrasonographic examination and magnetic resonance imaging (mri) showed thickening of the endometrium and collapse of the junctional zone . Both ovaries appeared normal and no fluid was evident in the pelvic cavity (fig . Surgical resection was planned for the endometrial carcinoma . While waiting for the operation, correction of anemia by iron supplementation and exploration of the reasons for irregular menstruation endocrinological survey yielded the following results: serum prolactin, 243.8 ng / ml (institutional normal range, 4.128.6); luteinizing hormone, 2.0 miu / ml (follicular phase, 1.713.3); follicle - stimulating hormone, 7.2 miu / ml (follicular phase, 4.511.0); estradiol, <25.0 pg / ml (follicular phase, 40.7224.0); testosterone, 23 ng / dl (normal, 956); growth hormone, 0.05 ng / ml (normal, 0.281.64); adrenocorticotrophic hormone, 16.2 pg / ml (normal, 7.263.3); thyroid - stimulating hormone, 2.95 iu / ml (normal, 0.384.31). Marked hyperprolactinemia led us to suspect pituitary prolactinoma, and mri of the hypophysis was therefore performed . T1-weighted mri showed an 8.4 7.8-mm tumor in the right anterior lobe of the hypophysis (fig . No evidence of headache or visual field loss was present, so surgery did not seem to be indicated for the pituitary prolactinoma . A few days later, total abdominal hysterectomy was performed with bilateral salpingo - oophorectomy and pelvic and para - aortic lymphadenectomy . Histological examination confirmed grade 2, well- to moderately differentiated endometrioid endometrial carcinoma tumors with less than half myometrial invasion and without involvement of any other organs, including regional lymph nodes . During the 10 months of follow - up, serum prolactin levels have been stable at around 160 ng / ml, and no signs of recurrence of endometrial carcinoma have been present . The prognosis of advanced - stage endometrial carcinoma is still poor relative to early - stage carcinoma, although many improvements have been made in treatment modalities such as surgery, chemotherapy, radiotherapy and others in recent years . Remembering risk factors for endometrial carcinoma, detecting patients in high - risk groups, and dealing properly with them, are thus important for catching early - stage patients and decreasing the morbidity and mortality rates of this life - threatening disease . In particular, in endometrioid endometrial carcinoma, which comprises about 80% of endometrial carcinomas, long - term exposure to excess estrogen unopposed by progestin is well known as the most important risk factor [7, 8]. Chronic anovulatory menstrual cycle remains the most common cause of long - term, unopposed exposure of the endometrium to endogenous estrogen [6, 7]. Many endocrinological disorders cause ovulatory disorders, with polycystic ovary syndrome (pcos) as the most representative . Because the patient was obese with hirsutism, the ovulatory disorder was initially attributed to pcos . Although the causes of hyperprolactinemia vary widely, marked hyperprolactinemia over 200250 ng / ml is usually due to pituitary prolactinoma or pregnancy, and this was also evident in the present patient . In premenopausal women, hyperprolactinemia causes hypogonadism by inhibiting secretion of gonadotropin - releasing hormone followed by suppression of luteinizing hormone levels and can cause menstrual disorders ranging from amenorrhea, oligomenorrhea and chronic anovulatory cycle to short luteal phases of the menstrual cycle . As mentioned above, chronic anovulatory cycle can be a risk factor for endometrioid endometrial carcinoma, and this patient had a 10-year history of irregular menstruation . Pituitary prolactinoma could thus have indirectly resulted in endometrioid endometrial carcinoma through chronic anovulatory cycle in this case . Indeed, some anecdotal evidence from similar cases suggests a relationship between hyperprolactinemia and endometrioid carcinoma [1012]. In this case, obesity could also have been a cause of ovulatory disorder, in addition to pituitary prolactinoma . Obesity is thought to have various carcinogenic effects other than ovulatory disorder for endometrial carcinoma . However, cases of endometrial carcinoma correlating with hyperprolactinemia have involved younger patients compared to the more common obese cases without hyperprolactinemia [10, 12]. Pituitary prolactinoma could thus have been more important than obesity as a cause of carcinoma in this case . One apparent inconsistency is that plasma estrogen concentrations on presentation were subnormal, while estrogen exposure is theoretically needed for carcinogenesis . Actually, we do not have any information about her hormone levels (including prolactin) prior to her presentation to our hospital, after irregular menstruation had been ongoing for a long period . However, some studies have proposed that increased plasma estrogen concentration is not important for carcinogenesis; rather, long - term exposure to low concentrations of estrogen unopposed by progesterone (that is, under conditions of progesterone deficiency) plays an essential role [6, 7, 11]. Another area of uncertainty involves the direct effect of prolactin on the endometrium, rather than the indirect effect mentioned above . Although some studies have reported that serum concentrations of prolactin are significantly elevated in patients with endometrial carcinoma compared to healthy individuals [13, 14] and that prolactin receptors are expressed in both normal endometrial and carcinoma tissue [14, 15], the direct effects of prolactin on the endometrium, in terms of proliferative or differentiative effects, remain unclear . The utility of correcting hyperprolactinemia using dopamine agonists for the purpose of preventing the development of endometrial carcinoma has yet to be determined . In the present case, levels of serum prolactin have remained stable and no evidence of recurrent endometrial carcinoma has been identified during follow - up . In conclusion, hyperprolactinemia indirectly induces endometrioid endometrial carcinoma after causing chronic anovulation . In patients with irregular menstruation and chronic anovulation that may be attributable to hyperprolactinemia, exploration of both the hypophysis and endometrium
|
Nephrogenic adenoma is a rare lesion of the urinary bladder that may arise and induced by many inflammatory insults such as recurrent infections, recurrent renal stone, intravesical therapy, bladder diverticula, renal transplantation, foreign bodies, chemical agents, radiation therapy, and other chronic irritative factors . In 1954, mostofi reported that the urinary bladder epithelium had the ability to transform into several morphologic types under appropriate stimulation and suggested that squamous and glandular metaplaisa of the urothelium is seen frequently in association with chronic infection . Nephrogenic adenoma (nephrogenic metaplasia) shows a male predominance with a male to female ratio of 2:1, and occurs over a wide age range (4 - 81 years). Although most common in adults, approximately 10% of nephrogenic adenomas have been observed in children . In 1950 friedman and kuhlenbeck described eight such cases as nephrogenic adenoma resembling aberrant tubules of the kidney . The origin of the tumor is uncertain, and many believed that it might originate from embryonic mesonephroid tissue . The majority of reports indicate that this type of lesion is due to urothelial injury as a result of previous surgery or long - term inflammation . Immunosuppressive therapy as in renal transplantation and intravesical drug (bcg) infusion are suspected causes in nephrogenic adenoma . The clinical and cystoscopic characteristics of nephrogenic adenoma are not diagnostic so cytomorphology, and immunohistochemistery study are needed to differentiate nephrogenic adenoma from malignant lesions, and to avoid erroneous therapeutic approach . Nephrogenic adenoma is typically positive for cytokeratin 7 (ck7), -methylacyl coa racemase (amacr) (p504s), pax2 and epithelial membrane antigen (ema), and are usually negative for p63, cytokeratin 20 (ck20), and prostatic specific antigen (psa). A 55-year - old female was admitted to shahid faghihi hospital, shiraz, iran with chief complaint of irritative lower urinary tract symptoms and intermittent gross hematuria . Four years ago she had developed renal stone, and had been subjected to percutaneous nephrolithotomy . Her urine analysis showed red urine containing a large number of red and white blood cells, and few bacteria . Cystoscopic examination revealed a sessile 33 centimeters lesion in the left lateral wall of bladder . Microscopic examinations of hematoxilin eosin - stained slides showed irregular proliferation of small tubules, which were lined by single - layer low cuboidal epithelium in myxoid and inflammatory background in the lamina propria (figure 1). There were also some cord - like structures and single cell proliferation . The tissue sections deparaffinized and treated with 3% hydrogen peroxide and antigen retrieval was done . The slides were then stained with a polymer - based detection system (dako`s envision system). Immunohistochmistery study showed positive reactivity for p504, cd10, ema and ck7 (figures 2, 3, 4), but negative reactivity for psa, p63 and ck20 (figures 5, 6). After five months follow up the patient showed decreased complaints, but she did not completely recovered and she did not come back for treatment either . Nephrogenic adenoma is a rare bladder lesion presented with well - defined mass located mostly beneath the epithelium . In the past, it was believed that nephrogenic adenoma represented metaplasia of the urinary epithelium in response to inflammatory process . However, it has been demonstrated to result from urothelial shedding, and implant in injured area . Adenocarcinoma of the bladder was reported to occur two year after nephrogenic adenoma in a 25-year - old man . Few reports have examined the use of immunohistochemical findings in the diagnosis of nephrogenic adenoma . Alsanjary et al . Studied the morphological and immunohistochemical features for differential diagnosis of nephrogenic adenoma from clear cell adenocarcinoma . Immunohistochemical study can differentiate nephrogenic adenoma from malignant process, and define the origin of adenoma . Immunohistochmistery studies have shown that pax2 was positive only in remnant of fetal renal tubules and nephrogenic adenoma, and negative in malignant process such as prostatic adenocarcinoma . Cytoplasmic staining for ck7 and absence of staining for psa is in favor of nephrogenic adenomaalpha - methylacyl - coa racemase (amacr, p504s), which is the most useful marker for the diagnosis of prostatic adenocarcinoma, is detected in nephrogenic adenoma of urinary bladder . There are some problems in the differential diagnosis of nephrogenic adenoma from clear cell carcinoma of bladder, because it shows foci with tubular, cystic and papillary configuration, but no dysplastic changes . Olivia and young reviewed 80 cases of nephrogenic adenoma, which showed a trend of male predominance . Jalpota reported an extensive involvement of bladder by nephrogenic adenoma in patient with renal allograft transplant . Nephrogenic adenoma is a benign metaplastic response to urothelial injury, and may mimic malignant process . In the present case bladder biopsy was done with high suspicion for malignant lesion . However, immunohisthochmical examination of the biopsy revealed positive findings for ck7, ema, cd10 and amacr, and negative findings for psa, p63 and ck20 . The clinical and cystoscopic characteristics of nephrogenic adenoma are not diagnostic so cytomorphology, and immunohistochemistery study are needed to differentiate nephrogenic adenoma from malignant lesions and to avoid erroneous therapeutic approach . Some cases of nephrogenic adenoma are associated with diagnostic difficulty using certain histologic features, since they may mimic some features of malignant lesions.
|
Disrupted in schizophrenia 1 (disc1) was initially discovered at the breakpoint in a balanced chromosomal translocation t (1; 11) segregating with major mental conditions, such as schizophrenia, bipolar disorder, and major depression in a scottish pedigree (millar et al ., 2000). Since then, accumulating evidence from genetic studies indicated that disc1 is not only associated with schizophrenia and mood disorders, but also other psychiatric disorders of neurodevelopmental origin, such as autism, asperger syndrome, and agenesis of the corpus callosum (hennah et al ., 2003; hodgkinson et al ., 2004; callicott et al ., 2005; kilpinen et al ., 2008; song et al ., 2008, 2010; although recent genome wide association studies (gwas) have not found disc1 as a key genetic risk factor for patients met the current diagnostic criteria for schizophrenia (purcell et al ., 2009; stefansson et al ., 2009; mathieson et al ., 2011), it is noted that variations of disc1 influence anatomical and functional endophenotypes even in control subjects (thomson et al ., 2005; di giorgio et al ., 2008; prata et al collectively, genetic variation of disc1 may confer vulnerabilities to a wide range of neurodevelopmental psychiatric conditions by affecting brain maturation, thereby modifying brain function . Consistently, extensive biological studies indicate that disc1 plays a role in multiple cellular processes during and after brain development (chubb et al ., 2008; brandon and sawa, 2011). In fact, many protein binding partners of disc1 are associated with various molecular pathways that regulate fundamental cellular processes for brain development and function (table 1). Nonetheless, it is still unknown which functional aspects of disc1 directly affect molecular mechanisms underlying disease susceptibility . How can we utilize accumulating biological data of disc1 to discover novel therapeutic targets and biological markers for major mental conditions? Here, we will review disc1-associated molecular pathways which have the potential to be novel therapeutic targets, with particular focus on well documented disc1 pathways involved in cerebral cortex development and function (figure 1). We will also discuss the potential link of disc1 pathways and environmental factors, such as immune / inflammatory responses, to explore therapeutic interventions based on understanding disease mechanisms of genetic and environmental interaction . Disc1 may function as an anchoring molecule to regulate various molecular pathways via interaction with said protein interactors in a context dependent manner . Various disc1-mediated pathways with many binding partners and environmental factors synergistically affect proper cerebral cortex development and function . For reviews of the other disc1 interactors, disrupted in schizophrenia 1 plays a critical role for the regulation of cell proliferation in the developing cerebral cortex via the canonical wnt signaling pathway (mao et al ., 2009). The data suggested that disc1 inhibits the activity of glycogen synthase kinase 3 beta (gsk3) via protein interaction, thereby stabilizing -catenin which is required for proper progenitor proliferation through wnt pathway . The same group later reported that dix domain containing-1 (dixdc1), a homolog of the wnt signaling genes disheveled axin, interacts with disc1 to co - modulate gsk3/-catenin signaling for proper cell proliferation (singh et al ., 2010). Accumulating evidences have shown that gsk3 signaling may be involved in various neuropsychiatric disorders, such as schizophrenia, autism, and alzheimer s disease, suggesting that gsk3 appears as a prominent therapeutic target for mental disorders (bachmann et al . In fact, lithium, the mood stabilizer which is commonly used for the treatment of bipolar disorder, is known to inhibit gsk3 activity (stambolic et al ., 1996). The other psychoactive drugs, such as clozapine, risperidone, and valproic acid, have also been reported to affect gsk3 activity (stambolic et al ., 1996; kang et al ., 2004; li et al ., 2007; rowe et al ., 2007). Nonetheless, since gsk3 regulates various downstream effectors, which are not only implicated in the wnt pathway, but also other signaling required for cellular development, such as sonic hedgehog and notch signaling pathways (hur and zhou, 2010), it is important to examine specific gsk3-mediated pathways relevant to disease mechanisms to find novel therapeutic strategies . In this regard, it may be ideal to focus on disc1-mediated gsk3 pathways, especially those in association with other genetic risk factors, to explore disease - associated molecular mechanisms . For instance, collapsin response mediator protein-2 (crmp-2)/dihydropyrimidinase - like-2 (dpysl2), a susceptibility gene for schizophrenia (nakata et al ., 2003), is reported to be a potential protein interactor of disc1 by yeast - two - hybrid screening (camargo et al ., 2007). Interestingly, crmp-2/dpysl2 is known to be phosphorylated by gsk3 for the regulation of axon outgrowth (yoshimura et al ., 2005). Many groups have consistently reported that knockdown of disc1 using rna interference (rnai) impaired radial neuronal migration in the developing cerebral cortex (kamiya et al ., 2005, 2008;, 2010; singh et al ., 2010; young - pearse et al ., 2010; ishizuka et al ., findings from these studies suggest that disc1, along with many protein binding partners, regulate neuronal migration via centrosome and microtubule - dependent mechanisms . Of note, some of these binding partners are known as risk or causative genes for various neuropsychiatric disorders . These include nuclear distribution element - like (ndel1) and pericentriolar material 1 (pcm1), risk genes for schizophrenia, and bbs4, a causative gene for bardet biedl syndrome that frequently accompanies impaired cognition, mental retardation, and psychosis (burdick et al ., 2008; kamiya et al ., 2008; amyloid precursor protein (app) also interacts with disc1 to recruit disc1 to the centrosome for regulation of neuronal migration (young - pearse et al ., 2010). Furthermore, disc1 is a component of the lis1/dynein motor complex (kamiya et al ., 2005). Mutations in human lis1 gene cause classical lissencephaly resulting in mental retardation (pilz et al ., 1998). Consistently, lis1 heterozygous knockout mice in which lis1 expression is reduced, display disorganization of proper cortical layer formation and behavioral abnormalities, such as impaired spatial learning and motor function, indicating that this is a good animal model for human lissencephaly caused by lis1 haploinsufficiency (hirotsune et al ., 1998). Interestingly, the prenatal administration of alln, a calpain inhibitor which prevents the degradation of lis1, is effective to ameliorate neuronal migration defect and improve motor coordination in this animal model (yamada et al ., 2009). Although mental disorders undoubtedly have genetic complexities and could not be explained by the simple haploinsufficiency model as the case of lissencephaly, elucidation of risk genes, and/or molecules in their interactome, specifically ones with enzymatic activity, may offer hope for novel treatment interventions for neuropsychiatric disorders . In this regard, endo - oligopeptidase activity of ndel1 is quite interesting from a drug discovery viewpoint (hayashi et al ., 2005). As a matter of fact, inhibitors of angiotensin - converting enzyme (ace), an exopeptidase, are currently being used to treat hypertension and renal disease (izzo and weir, 2011), making peptidase activity an attractive drug target . Although endogenous substrates for ndel1-oligopeptidase in brain development remain unknown, in vitro experiments identified several oligopeptides, such as neurotensin and bradykinin, as potential targets for ndel1 (camargo et al ., 1983). Interestingly, neurotensin has a modulatory effect on neurotransmitter systems, including dopaminergic neurons, which may be involved in the pathophysiologies of schizophrenia (boules et al ., 2007). Posttranslational modifications, which affect the functional diversity of target proteins, could also have potential as novel drug targets and biological markers in the disc1 pathways . We have recently reported that phosphorylation of disc1 at serine 710 is a molecular switch signaling from cell proliferation to neuronal migration in the developing cerebral cortex (ishizuka et al ., 2011). By utilizing in utero electroporation, this study has shown that a phosphor - dead mutant disc1 can rescue only the proliferation defect elicited by disc1 knockdown, whereas a phosphor - mimic mutant of disc1 can exclusively recover impaired migration . The question arises whether the phosphorylation of disc1 at serine 710 may be involved in the pathophysiologies of major mental disorders, such as schizophrenia . It is obviously impractical to investigate the phosphorylation status of disc1 in the developing human brain from subjects at risk of developing schizophrenia . Nonetheless, recent progress in induced pluripotent stem (ips) cell technology will open new avenues to characterize such findings from preclinical studies using patient - derived neuronal cells, which might in turn identify biological markers for major mental disorders . Disrupted in schizophrenia 1 impacts upon brain development may be a challenge for treatment intervention . However, synaptic deficits revealed by the disc1 pathway offer some potential for development of targeted pharmacologic intervention . Subsequent findings underline roles for disc1 in regulating dendritic spines of the glutamate synapse (hayashi - takagi et al ., 2010). Rac1 is activated by karilin-7, leading to increased spine size following nmda glutamate receptor activation . However, disc1 appears to interact with karilin-7, preventing access to and activation of rac1 until nmda receptor activation promotes release of kal-7 and spine enlargement . Pharmacologic tools to modulate the karilin-7/disc1 interaction might be a means to regulate spine maintenance . Traf2- and nck - interacting kinase (tnik) represents another potential pharmacological target in the disc1 protein interaction network . Tnik is found in postsynaptic densities and regulates c - jun kinase, the actin cytoskeleton and a number of wnt pathway effectors (fu et al ., 1999; genetic association studies have found single - nucleotide polymorphisms of tnik associated with schizophrenia (potkin et al ., 2009; shi et al ., 2009). Tnik mrna expression was increased in the dorsolateral prefrontal cortex of schizophrenia subjects (glatt et al ., 2005) and in lymphoblasts of monozygotic twins discordant for bipolar disorder (matigian et al ., 2007). A yeast - two - hybrid screen using disc1 as bait identified tnik as an interactor (camargo et al ., 2007). Subsequently, tnik and disc1 were shown to interact in mouse brain (wang et al ., 2011). Disc1 was found to inhibit the kinase activity of tnik, an action that could be reproduced by a small peptide derived from the disc1 interaction site . This disc1 peptide led to increased actin polymerization and decreased expression of a number of postsynaptic density proteins, including psd95, stargazin, ampa receptor subunit glur1 and tnik, itself (wang et al ., 2011). Microbial infections have been recognized as environmental factors responsible for the increased incidence of schizophrenia and associated disorders (brown and derkits, 2010; sham et al ., 1992; torrey and yolken, 2003). These reports have been supported by the epidemiological findings of an association between elevated cytokines in maternal serum and schizophrenia in the offspring (delisi and wyatt, 1982; patterson, 2007; miller et al ., 2009). Subsequently, it has been demonstrated that it is the maternal immune response to a microbe that may contribute to the increased risk of schizophrenia . The role of cytokines in innate immune response makes them promising candidates for studying their functions in disruption of fetal brain development in vulnerable individuals (dantzer et al ., 2008). Most studies with prenatal immune activation have thus far used wild - type mice and rats . However, recently, there have been several reports on developing and characterizing animal models based on combining prenatal immune activation with genetic mutations relevant to schizophrenia (ibi et al ., 2010; ehninger et al ., we have been studying possible roles for disc1 in modulation of poly i: c - induced immune activation in pregnant mice to mimic prenatal in utero exposure to viruses as a model of gene environment interactions relevant to schizophrenia (abazyan et al ., our findings have suggested that disc1 may be involved in mediating neuroimmune interplay in this mouse model . Given the extended interactome of disc1, it is not surprising that this protein is at the crossroads of the signaling transduction pathways activated by immune factors . One can envision multiple interactions between the pathways impacted by mutant disc1 and activated by cytokines and/or bacterial lipopolysaccharide (lps) and poly i: c itself via cytokine receptors or toll - like receptors (tlr) expressed by neurons or glia cells, respectively . One of the major common pathways is the phosphoinositide-3 kinase / akt - signaling network (pi3k / akt) that is activated by cytokines and poly ic and has been demonstrated to interact with disc1 partners (camargo et al ., 2007). Another example is interactions with gsk3, a key regulator of the host inflammatory response and the production of pro- and anti - inflammatory cytokines (hayden et al ., 2006). As described above, disc1 inhibits gsk3 activity through a direct interaction (mao et al ., 2009). We also found altered poly i: c - induced phosphorylation of gsk3 in mutant disc1 newborn mice that might at least in part explain altered basal and poly i: c - induced production of cytokines in fetal brains and resultant affective behaviors in adult offspring (abazyan et al ., 2010). These observations are consistent with an emerging role for gsk3 in inflammation - associated depression and anxiety (jope, 2011). Many immune effects of gsk3 are related to its regulation of critical transcription factors, including nuclear factor kappa - light - chain - enhancer of activated b cells (nf-b; hayden et al ., 2006). A family of tlrs acts as primary sensors that detect a wide variety of microbial components and elicit innate immune responses . All tlr signaling pathways culminate in activation of nf-b, which controls the expression of an array of inflammatory cytokine genes . Stimulation with tlr ligands triggers the rapid phosphorylation of specific serine residues of inhibitor of b (ib) proteins by the ib kinase (ikk) complex . Phosphorylated ib proteins are subsequently polyubiquitinated and degraded, allowing nf-b to move into the nucleus . This so - called canonical pathway is involved in tlr - mediated induction of inflammatory cytokines such as tumor necrosis factor- (tnf-) and interleukin-6 (il-6; hayden et al ., prior studies with disc1 have demonstrated that disc1, particularly a nuclear isoform of the protein, can play an important role in regulation of transcription activity in the nucleus (sawamura et al ., 2008). We found that expression of mutant disc1 in n2 a neuronal cells led to delaying a recovery of ib after tnf--induced phosphorylation and ubiquitination of ib. This prolonged degradation due to expression of mutant disc1 seems to suggest that perturbation in functions of disc1 could also affect (e.g., stimulate) pro - inflammatory signaling transduction cascades in neurons . In addition to immune signaling pathways, disc1 and perhaps other candidate genes can play a significant role in the cellular processes utilized by microbes during their life cycles (carter, 2009). It has been proposed that the involvement of disc1 in the control of the microtubule network might be important both in viral traffic and in the rerouting of microtubules to the vacuoles formed by t. gondii (carter, 2009). Recent clinical trials of anti - inflammatory add - on therapy in schizophrenia have demonstrated superior beneficial treatment effects when antipsychotics were co - administered with anti - inflammatory compounds, as compared with treatment outcomes using antipsychotics alone (meyer et al ., 2011). However, a broad non - specific anti - inflammatory or immunosuppressive treatments that may have several unwanted effects such as increased sensitivity to infections (meyer et al ., 2011). Ultimately, future therapeutic approaches will result from deciphering intracellular pathways that underlie convergence of environmental influences and genetic predisposition and their influence on neurodevelopmental processes . Disrupted in schizophrenia 1-mediated pathways play multiple roles for critical cellular processes through many protein binding partners in a context dependent manner . Nonetheless, it is still unknown which functional aspect of disc1 directly affects molecular mechanisms underlying disease susceptibility . Are all disc1 functions in such cellular events implicated in disease processes or are only some specific functional aspects critical? This is a tremendously difficult question, because the molecular disposition of disc1 is complex as reflected by multiple isoforms at both mrna and protein levels (ishizuka et al ., 2006 nonetheless, biological functions of disc1 are currently being explored without waiting for the complete identification of disc1 isoforms, resulting in the identification of multiple roles of disc1 in various functional contexts . In fact, in addition to the roles in cerebral cortex we reviewed here, disc1 also contributes to brain development and function in other brain regions, such as hippocampal regions (enomoto et al ., 2009; kim et al ., 2009; meyer and morris, 2009). Further investigations with advanced genetic engineering techniques, which allow us to dissect region and cell type - specific disc1 functions in a temporal manner, might contribute to more clearly elucidate disc1 functions relevant to psychiatric disorders . As complete functional recovery is unlikely for neurodevelopmental disorders, such as schizophrenia, developing preventive strategies is particularly important . Indeed, if the findings on microbial etiologies and resultant immune dysfunction are replicated, simple public health measures may prove beneficial in diminishing the incidence of infections during pregnancy to prevent an appreciable proportion of schizophrenia cases . For example, influenza vaccination, improved hygiene to prevent t. gondii infection, and antibiotics to treat genital / reproductive infections are feasible strategies already employed (brown and derkits, 2010). The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Multicystic dysplastic kidney (mcdk) is a relatively common developmental anomaly in infants and children, and its overall prognosis is good in older children . Although mcdk is grossly " cystic " in appearance, it is not one of the inherited renal cystic diseases, but a kind of renal dysplasia, in which cystic elements are found along with immature, undifferentiated, primitive tissue (1). In contrast, a malignant rhabdoid tumor of the kidney (mrtk) is one of the most lethal neoplasms of early life, and the mortality rate exceeds 80% (2). Mrtk usually arises from perihilar renal parenchyma and infiltrates into the medulla, renal sinus, and collecting system . The recurrence rate is high, and the tumor tends to metastasize to the lung, liver, and brain (2, 3). There have been some reports concerning mrtk and mcdk presenting individually and mcdk presenting with wilms tumor (4). However, a combined case of these two diseases has not been reported to date . Therefore, the authors present a case of mrtk combined with mcdk in a 5-yr - old girl with a literature review . A 5-yr - old girl who was previously diagnosed with mcdk at birth by abdominal sonography presented with a huge palpable mass on the right side of her abdomen . No symptoms were noted until a huge mass was palpated two weeks prior to presentation . Abdominal sonography and computed tomography (ct) were performed, and they revealed an increased cystic lesion extensively replacing the right kidney and a newly - developed amorphous portion in the cystic lesion, compared to the previous radiologic findings at birth (fig . The cut surface showed numerous cystic and semisolid masses in the cortex and medulla (fig . Some of the neoplastic cells had eccentric nuclei and large, round, eosinophilic cytoplasmic inclusions . In the remaining parenchyma the tumor cells were non - cohesive, large, round - to - polygonal cells with vesicular nuclei and prominent nucleoli (fig . The immunohistochemical stains of the rhabdoid tumor cells were positive for cytokeratin, vimentin, ini1, and epithelial membrane antigen and negative for desmin and smooth muscle actin (fig . Ultrastructurally, the tumor cells had poorly formed intercellular junctions, a fair amount of mitochondria, and were filled with lipid droplets (not shown). Generally, kidney abnormalities are classified by quantity, location, morphology, differentiation, and genetic disorder . Among them one in 4,300 live births is estimated to have unilateral mcdk (6), and few occur in syndromes of multiple malformations . In contrast, mrtk is a rare malignant tumor of the kidney, and it accounts for about 2 - 3% of kidney tumors (3). Mrtk also tends to occur in young infants and is one of the most lethal neoplasms in early life (7). Before 1981, investigators thought mrtk was a kind of wilms tumor; however, haas et al . They reviewed 111 cases of rhabdoid tumors of the kidney by analyzing microscopic findings, immunohistochemical stains, and electron microscopic findings of the cases . Unlike with a wilms tumor, they found that some of the tumor cells originated from primitive cells . Some investigators suggested that mrtk might originate from widely - distributed precursor cells or neuroepithelial cells (7). There has not been a report about a case of mcdk presenting concurrently with mrtk with an examination of the cause of their coexistence and their pathophysiology to date . Embryologically, dysplastic kidney disease, which is induced by a metanephron abnormality, is irreversible, and the severity of disease and affected areas are varied (5). Mcdk is a common disease in infants, yet the pathophysiology of mcdk is not well understood . One hypothesis is that mcdk results from an abnormal induction of the metanephric blastema by the ureteric bud (5). Embryologically, mcdk may result from abnormal renal morphogenesis, likely due to abnormalities of developmentally expressed genes (1). Until now, pax2, bcl2, and galectin-3 genes were thought to be related with the occurrence of mcdk, and chromosome t(6:19)(p21:q13.1) abnormality - induced cytogenetic change (8). Those genes are associated with oncogenesis and their high level of expression can accelerate the proliferation of dysplastic cysts, which causes some patients' multicystic dysplastic kidney to continue to propagate (8, 9). On the other hand, about 15% of mrtks they arise embryologically from the stromal cell, mesenchymal cell, neuroectodermal cell, or germ cell . It is reported that genetically 90% of rhabdoid tumors have a 22q11.2 chromosomal translocation, and a mutation or deletion of smarcb1, hsnf5/iml, and ddt1 genes (10). According the theory of pathogenesis, the two kinds of disease are probably related to stem cell mutation . Distinctions should be made among mcdk, wilms tumor, mrtk with a cystic pattern, and other diseases affecting the kidney . The pathologic findings in this case revealed a typical mcdk that coincided with embryonic tubules, glomeruloid structures, and immature cartilage . In addition, immunohistochemical stains were positive for cytokeratin, epithelial membrane antigen, and vimentin, but negative for smooth muscle actin . Therefore, it was diagnosed as mcdk coexistent with mrtk (11). By electron microscopy, tumor cells of usual cases of mrtk form sheetlike patterns, have poorly formed intercellular junctions, abundant mitochondria, and lipid droplets in the cytoplasm, especially prominent aggregates of filaments . However, in this case, the cytoplasm did not have prominent aggregates of filaments . Therefore, the diagnosis of mrtk should be given only after thorough investigations by light microscopy, immunohistochemical stains, and electron microscopy . Age is a highly significant prognostic factor, and the younger the patient, the better the prognosis . Subjects older than five years are less responsive to chemotherapy, suggesting a poor prognosis (12). However, when the disease is combined with hypertension or a malignant tumor, the patient is more likely to have a poor prognosis (13). After being diagnosed with mcdk, the patient needs regular follow - up to ensure that the cystic tumor is regressing or to uncover any evidence that a new neoplasm is developing . Until now, there have already been reports of mcdk simultaneously occurring with renal cell carcinoma, mesothelioma, and wilms tumor (14). The prognosis of mrtk is related to the stage, lymph node metastasis, sex, nuclear diameter, and other factors . In this case, because the patient was 5 yr old, the tumor was stage i, and the cells had a medium nuclear size (2 - 4 m), according to the mrtk prognosis markers, the patient might have belonged to the favorable prognostic group . It is difficult to evaluate the patient's prognosis when there are two different diseases present at the same time . Hence, a prognosis should be related to the more serious disease, if two diseases occur simultaneously . In conclusion, the authors believe that this case, mcdk combined with mrtk found in an infant, is the first of its kind to be reported, and we consider that this occurrence can become a new disease entity in infantile renal disease in the future . According to the literature, finally, early development of one could have affected the course of the other . By reviewing more cases and studies, pathogenetic and prognostic evidence of mcdk combined with mrtk
|
Computed tomography (ct) remains the preferred diagnostic method for the chronic subdural hematoma (csdh)3). Chronic sdh has a variety of imaging characteristics in ct; low, intermediate, or high density relative to brain parenchyma3,6). Chronic sdh frequently appears to be mixed density7,9). With current high - resolution ct scanners, acute trauma on the patients with csdh may develop acute bleeding over the csdh, which would produce mixed density10). Repeated episodes of acute bleeding may result mixed densities of sdh . In other words, we retrospectively examined the medical records and ct scans of 259 consecutive patients who diagnosed as csdh from january 2006 to december 2011 . We excluded 17 patients who diagnosed by magnetic resonance imaging (mri) only before surgery . The csdhs were classified into four groups; hypodensity (<25 hu), homogeneous isodensity (25 - 35 hu), layered type, and mixed type on the basis of ct scans (fig . Although we examined the history of head trauma minutely, the etiology was identifiable in only 122 patients (50.4%). Statistical analysis was performed using the chi - square test or fisher's exact test . For the statistical significance, we divided the etiology into either known or unknown groups . The density of csdh was isodense in 115 patients, hypodense in 31 patients, mixed in 79 cases, and layered in 17 cases (table 1). Mixed or layered types were more common in the oldest age, while isodense or hypodense sdhs were more common the age of less than 70 years (p=0.0002 by fisher). The csdh was on the left side in 115 patients, on the right side in 70 patients, and bilateral 40 patients (table 2). Bilateral hematomas tended to be hypodense, while isodense one tended to locate on the left side (p=0.015 by fisher). The etiology could be identified in 67.7% of the hypodense hematomas, while the cause was obscure in 59.5% of the mixed hematomas (p=0.047 by chi - square). The preferred surgical technique was single burr - hole drainage under local anesthesia (table 4). We performed craniotomy for 2 patients with mixed density hematomas and one patient with isodense hematomas ., we used an endoscopy to suck out the semisolid clot around the corner of the hematoma cavity . The density of csdh was isodense in 115 patients, hypodense in 31 patients, mixed in 79 cases, and layered in 17 cases (table 1). Mixed or layered types were more common in the oldest age, while isodense or hypodense sdhs were more common the age of less than 70 years (p=0.0002 by fisher). The csdh was on the left side in 115 patients, on the right side in 70 patients, and bilateral 40 patients (table 2). Bilateral hematomas tended to be hypodense, while isodense one tended to locate on the left side (p=0.015 by fisher). The etiology could be identified in 67.7% of the hypodense hematomas, while the cause was obscure in 59.5% of the mixed hematomas the preferred surgical technique was single burr - hole drainage under local anesthesia (table 4). We performed craniotomy for 2 patients with mixed density hematomas and one patient with isodense hematomas ., we used an endoscopy to suck out the semisolid clot around the corner of the hematoma cavity . There are some reports that the hypodensity was the most common type in ct scanning3,6). However, isodense csdhs were often reported as more common than the hypodense lesions1,5,7,9). It may depend on the patient population, resolution of the ct scanner, and methods of density classification . Mixed density was relatively common, being roughly one third of cases in this study . A layered type of the hematoma density may result from prolonged recumbency, which separates the blood components and fluid8,20). If the patient maintains lying position for a long time, more heavier components sink by the gravity . Elderly people are more likely to stay lying down for a long period of declining physical activity . The blood components are separated by gravity and layered density is appeared in the ct scan . Theoretically, the mixed density results from three hypotheses . The first situation is in hyper - acute bleeding; the difference between solid clot and liquid blood may produce the mixed density15). The second situation is in subacute sdhs; resolving hematoma may appear peripheral hypodensity with central hyperdensity during transitional period9). Fibrinolysis in csf is activated from the outside to the inside in order after trauma . The change into the hypodensity is faster in the peripheral region than in the center, where the density of hematoma remains hyperdense for a long time . However, these two situations are relatively short to get the mixed density images in the ct scans . It is well known that the repeated microhemorrhages were responsible for the enlargement of csdh2,11). The bleeding from the sinusoidal vessels of the outer neomembrane makes the hematoma grow without coagulation13). Even though the csdh continue to enlarge, it may remain asymptomatic, when the reserving capacity was remained or well balanced . The hematoma pressure was 15 cmh2o or below in a half of unilateral csdhs, especially in the elderly18). Although some patients with csdh are still asymptomatic, they are prone to fall or slip down . If they slip, even though the injury itself is trivial, it may tear the cortical bridge veins or fragile vessels in the neomembrane . Repeated trauma may cause acute bleeding, which would make a lump or a layer of hyperdensity within hypo- or isodense hematoma . Like the repeated microhemorrhages from the outer membrane, repeated trauma may cause acute bleeding over the csdh as a mechanism of hematoma enlargement10). Sometimes repeated trivial trauma may cause a subdural hygroma, which became a csdh . Although the ages of the sdhs were different, such a chronic - on - chronic sdh may produce the mixed density . Membranes were frequently observed within the sdhs, especially in hematomas with the mixed density2,16). The acute - on - chronic sdhs tend to produce so - called multi - lobule type membrane, while chronic - on - chronic sdhs would produce multi - layer type membrane . Mixed or layered types were more common in the oldest age, while isodense or hypodense sdhs were more common the age of less than 70 years . This uneven distribution result from not only the fact that the reserving capacity is maximal in the oldest age, but also the oldest patients are vulnerable to repeated trauma . Also, elderly patients cannot remember their trivial trauma events because of cognitive impairment . The oldest age implies brain atrophy and too high reserving capacity, which may cause overlapping hematomas or recurrence . Bilateral hematomas tended to be hypodense, while isodense one tended to locate on the left side, in this study . A definite history of head injury was often obtained only in a half of cases, and more than 90% of previous head injuries were mild12). Considering the facts that mixed types were more common in elderly patients and the cause of trauma was obscure in the mixed hematomas, we could deduce mixed types occurred by multiple trivial trauma in elderly people . Burr - hole drainage is sufficient for most patients and this became the procedure of choice7,11,14). We could remove the hematoma by single or two burr - holes in most cases . We used double burr - holes with saline irrigation in only a few patients . In patients with mixed density csdh, even in acute - on - chronic sdhs the clot was not so hard due to preexisting hemolytic activity of the csdh . We placed a soft silicon drain in all cases, which was usually removed within 2 days . Semisolid clot was usually drained out or resolved within a few days with or without urokinase or tissue plasminogen activator . Septation within the hematoma was usually not complete in either multi - lobule or multi - layer hematomas . Craniotomy may be necessary for those instances in which the subdural collection reaccumulates, the brain fails to expand, or there is solid hematoma11). Mixed density of csdh results from multiple episodes of trauma, especially in the oldest age . The etiology was frequently obscure in the mixed density csdhs, since it was hard to remember all the trivial traumas . Although there were membranes within the hematoma, burr - hole was usually enough to drain the hematomas.
|
Gastrointestinal stromal tumors (gists) are the most common mesenchymal, nonepithelial tumors of the gastrointestinal tract in adults between 40 and 50 years of age [1, 2]. As per seer analysis, only 1% of 1,458 gist cases are esophageal in origin, with an incidence of 5170% in the stomach; 2536% in the small intestine; 57% in the colon, rectum and appendix, and 13% in the esophagus [1, 2, 3]. They are generally small and asymptomatic, but occasionally can be large and produce dysphagia . A review of the literature revealed a case of a large esophageal gist presenting with dyspnea . However, here we report a rare case of a small esophageal gist in a patient with dyspnea who presented with a mediastinal mass on chest x - ray and was initially diagnosed by a pathologist as having leiomyosarcoma and referred for chemotherapy . 1). A ct scan of the chest with contrast revealed a hypodense, soft tissue mass / lymphadenopathy in the posterior mediastinum measuring 2.0 3.0 cm, contiguous with the esophagus (fig . 2), suggestive of neoplastic etiology . Further imaging with pet revealed a mediastinal soft tissue mass / lymph node and a standardized uptake value (suvmax) of 5.1 . The patient underwent a bronchoscopy and mediastinoscopy with fine - needle aspiration of the mass . Pathology showed increased cellularity with moderate nuclear atypia and pleomorphism with a mitotic count of 23 mitoses/10 high - power fields . The ki67 index was 35% and, finally, the sample was reported as spindle cell well - differentiated leiomyosarcoma (fig . The patient was referred to us for further management . Given the possibility of a gist, thoracotomy findings showed the mass in the posterior mediastinum, which was dissected free from the trachea and inferior aspect of the aorta . Six weeks after surgery, a repeated pet - ct scan showed no recurrence . On further follow - up gists are rare, accounting for 0.13.0% of all gastrointestinal neoplasms and 5.7% of sarcomas . Initially, gist applied to neoplasms displaying only c - kit (cd117), but the diagnosis is based on histopathology and immunohistochemistry . A total of 95% of gists express kit or dog 1 and have mutations in kit or platelet - derived growth factor receptor, polypeptide . The kit - positive cells in abdominal soft tissues include mast cells in the wall of the gastrointestinal tract; the interstitial cells of cajal (intestinal pacemakers) around the myenteric plexus were thought to be the origin of gists . Gists typically present in adults 4050 years of age and predominantly in the stomach and intestine . A comprehensive review of 11 case reports (table 1) and case series with esophageal gists showed that only 1 patient presented with dyspnea and a large posterior mediastinal mass (27 cm); 3 further masses were detected on routine chest x - ray [3, 4]. Our patient presented with vague, progressive shortness of breath, with the unusual finding of a small mediastinal mass on chest x - ray . Esophageal gists commonly present with dysphagia but bleeding, perforation, back pain, anorexia, regurgitation and weight loss have been reported . Dyspnea with the finding of a small tumor on chest x - ray is rare . Further, pet - ct can help to differentiate gists from sarcoma, but our case showed an suvmax of 5.1 which can misclassify it as sarcoma [3, 8]. Initial biopsy and testing created a diagnostic dilemma because immunohistochemistry did not include cd117 immunostaining and diagnostic imaging was inconclusive . We present this case to raise physician awareness of such a rare presentation, so that the possibility of gists is considered in these situations, and cd117 testing be done if sarcoma histology is obtained . Surgery is the mainstay of treatment of localized gists; targeted therapies like imatinib have shown overall survival benefit in high - risk patients after surgery [9, 10]. And in unresectable and metastatic disease, it has been approved as primary treatment . The pdgfra mutation d842v, sporadic wild - type gists, mutations with succinate dehydrogenase or braf - mutated gists are unlikely to respond to imatinib . Ongoing trials involve sorafenib, nilotinib, pazopanib, regorafenib and cediranib for advanced gists [11, 12, 13, 14, 15]. Future trials with combined or sequential use of tyrosine kinase inhibitors with other medications and personalized therapy after tumor molecular subtyping are promising in the management of gists . Our case report highlights the consideration of gists in the differential diagnosis of posterior mediastinal masses and emphasis on the necessity of cd117 staining in those situations which can alter the therapeutic and prognostic implication for the patient.
|
Systemic lupus erythematosus (sle) is a chronic systemic inflammatory disease affecting mainly women during childbearing age . Although life expectancy has improved significantly, no changes in morbidity and mortality related to cardiovascular disease (cvd) have been observed in sle patients in the past decades [2, 3]. In addition to traditional risk factors, many lupus - specific factors are linked to the increased risk of cvd observed in sle [46]. Obesity - associated systemic inflammation is characterized by increased circulating proinflammatory cytokines and activation of several kinases that regulate inflammation [79]. Recent evidence supports that obesity - induced inflammation is mediated primarily by immune cells such as the macrophages and t lymphocytes present in metabolic tissues . Adipose tissue derived cells can produce inflammatory cytokines, such as tumor necrosis factor alpha (tnf-), interleukin (il) 6, and il-10 [10, 11]. Tnf- and il-6 are proinflammatory cytokines associated with an increased insulin resistance, inhibition of insulin receptor autophosphorylation, and signal transduction . Upregulation of il-10 locally or systemically reduces atherosclerosis development in mouse models [1315]. The aim of this study was to evaluate the association between obesity, measures of body fat content, and serum tnf-, il-6, and il-10 in csle . Fifty - two consecutive csle patients, recruited from the pediatric rheumatology outpatient clinic of the state university of campinas were included in this study . Patients were included in the present study if they (i) fulfilled at least four criteria of the american college of rheumatology (acr); (ii) were below 18 years of age at disease onset; and (iii) had a follow - up duration of at least 6 months (time necessary to evaluate damage index). Fifty - two healthy volunteers (caregivers or students) matched by age, gender, and sociodemographic characteristics were included as a control group . This study was approved by the ethics committee at our institution, and the informed written consent was obtained from each participant and/or legal guardian . All patients had their medical histories and clinical, and serological characteristics entered at the time of csle diagnosis into special computer database programs . Features included in this protocol were age at the onset of disease (defined as the age at which the first symptoms clearly attributable to sle occurred), age at diagnosis (defined as the age when patients fulfilled four or more of the 1987 revised criteria for the classification of sle), and follow - up time (defined as the time from disease onset until december 2012). Total doses and length of use the of corticosteroids since the onset of disease were calculated by careful review of the medical charts . The cumulative dose of corticosteroids used was calculated by the sum of the daily dosages versus the time (days) of treatment . We also calculated the cumulative corticosteroid dose adjusted by weight by summing up the daily corticosteroid dose per weight at each routine visit . Disease activity was measured by the systemic lupus erythematosus disease activity index (sledai). Sledai scores range between 0 and 105, and the scores of 3 were considered as active disease . Adjusted sledai scores over time were calculated by careful review of the medical charts and preview exams . Cumulative sle - related damage in all patients was determined by using the systemic lupus international collaborating clinics (slicc)/acr damage index (sdi). Body mass index (bmi) was calculated as weight (kg) divided by height (m) squared (kg / m). Criteria used to define nutritional status were based on the world health organization (who) criteria . Bmi cutoff points for brazilian children and adolescents were used for individuals between 2 and 18 years . Percentual body fat (pbf), fat mass, and lean mass were obtained by dxa scan (hologic discovery wii), through whole body auto fan beam . This scan determines total fat mass and total lean mass in kilograms in addition to total fat mass and total lean mass as a percentage of total body mass . Blood samples were collected from peripheral veins of all individuals in dry tubes and left to clot at room temperature for 30 minutes . Blood samples were then centrifuged for 15 minutes at 3000 rpm, and the serum was then stored in aliquots at 80c for future use . We did not collect blood samples from individuals during an episode of acute or chronic infection . Commercially available kits from r&d systems (london, uk) were used for the measurement of serum tnf-, il-6, and il-10 levels by enzyme - linked immunosorbent assay (elisa), carried out in accordance with the manufacturer's instructions . The minimum detectable dose (mdd) was 0.106 pg / ml for tnf-, 0.039 pg / ml for il-6, and 3.9 pg / ml for il-10 . All the data were tested for their normal distribution (kolmogorov - smirnov test). Mann - whitney u test was used to compare anthropometric measure and laboratory studies between patients and controls . Spearman's correlation was used to correlate continuous variables (e.g., tnf- levels, sledai, and sdi scores). For all analyses, statistical analysis was carried out using ibm spss statistics 16.0 software (spss / ibm, chicago, il, usa). Forty - seven (90.3%) were women with mean age of 17.6 years (standard deviation (sd) 3.7 years). The control group consisted of 52 controls (47 women) with mean age of 18.2 years (sd 6.4). Patients and healthy controls were statistically comparable in terms of age and sex (table 1). Bmi was similar between patients (median 21.74 kg / m; range: 16.131.12 kg / m) and controls (median 21.43 kg / m; range: 14.3628.54 kg / m) (p = 0.101). Sixteen (31%) csle patients were overweight compared to 6 (11.5%) controls (p = 0.018). We did not observe an association between bmi and sledai, sdi, and cumulative corticosteroid dose . On whole body analysis, we observed a median fat mass of 22.38 kg (range: 7.67 kg36.62 kg), a median lean mass of 35.49 kg (range: 25.31 kg52.14 kg), and a median pbf of 34.1% (range: 12.154.4%) in csle . In the trunk region we observed a median fat mass of 8.62 kg (range 2.98 kg17.59 kg), median lean mass of 16.80 kg (range: 11.24 kg26.19 kg) and a pbf of 42.3% (range: 12.154.4%). Serum tnf- (p = 0.004), il-6 (p = 0.002), and il-10 (p <0.001) levels were significantly increased in csle patients when compared to healthy controls (table 2). We observed higher serum tnf- levels in obese csle patients when compared with nonobese csle patients (p = 0.036), obese controls (p = 0.039) and non - obese controls (p <0.0001) (table 3). No difference in serum tnf- levels was observed between obese and non - obese healthy controls (p> 0.05). We observed an association between tnf- and pbf (p = 0.046) and total fat mass on trunk region (p = 0.035) analyzed by dxa scans . No association between serum il-6 and il-10 levels and sledai or sdi scores was observed . In addition, no difference in these cytokine levels in csle patients and controls with and without obesity was observed . Adipose tissue is known to be capable of secreting cytokines such as tnf-, il-6, and il-10 . Therefore, the purpose of this study was to assess whether the levels of these cytokines were increased in obese csle when compared to nonobese csle and healthy controls . The observation that obese csle patients had higher serum tnf- levels when compared to nonobese csle and healthy controls is the major finding of our study . In addition, we observed that serum tnf- levels correlated with pbf and total fat mass in trunk region in csle . Recent studies have demonstrated that increased adipose tissue mass contributes towards an increase in chronic inflammation [26, 27]. Chronic inflammation is further enhanced by inflammatory markers produced in the liver and in other organs . Recently, it has been demonstrated that obesity is associated with a low - grade inflammatory process, characterized by increased circulating levels of proinflammatory cytokines such as tnf-, il-6, and acute - phase proteins (crp) [2932]. The mechanism underlying increased inflammation in the setting of obesity remains unclear, but it is known that mononuclear cells are activated and proinflammatory cytokines are upregulated in obese individuals [33, 34]. We observed an association between serum tnf- levels and pbf and total fat mass in trunk region . Studies analyzing the association between serum tnf- and dxa scans have not been reported in csle so far, but studies on healthy women and type-2 diabetes patients showed an association between plasma levels of tnf- and visceral adipose tissue volume measured by ct - scan [3538]. Previous studies have shown that visceral fat accumulation is associated with increased risk of cv risk . In addition, with an increase in tnf-, a reduction in lipoprotein lipase activity in adipose tissue is observed . There is also evidence that tnf- has a local effect, regulating adipocyte size in the face of increasing energy consumption [40, 41]. Cytokines, such as tnf- and il-6, are primarily involved in the early stages of the inflammatory response culminating in atherosclerosis [39, 42]. Increased tnf- levels in the endothelium promote initial atheroma plaque [39, 42]. However, so far, studies were not able to conclude whether tnf- is a causative factor of atherosclerosis . Both il-6 and tnf- are expressed and secreted by human adipose tissue . In obesity, increased secretion of il-6 may contribute to metabolic dysfunction [44, 45]. In addition, one previous study has shown that il-6 correlated positively with bmi and with measures of insulin resistance in abdominal obese male subjects . As previously described in adults sle patients, we observed higher il-6 and il-10 levels in csle patients when compared to healthy controls [4649]. Il-10 downregulates inflammatory activation of monocytes and macrophages by transcriptional and posttranscriptional inhibition of the entire range of proinflammatory cytokines . Il-10 has been shown to reduce atherosclerosis and it can be found in atheromatous plaque due to local macrophages production . However, il-10 is involved in sle pathogenesis and it is increased in sle patients with cvd compared to sle patients without cvd [51, 52]. In our study, we did not observe an association between sera il-10 levels and obesity . We also did not observe an association between sera il-6 levels and obesity . In the literature, it has been described that plasma il-6 levels are associated with increased cv risk and observed in sle patients with metabolic syndrome and in patients with type 2 diabetes [44, 54]. In a large healthy family population study where children were included, il-6 levels were closely associated with traditional and nontraditional risk factors for atherosclerosis . Although csle is rare, it is important to consider that one limitation of our study is the small number of patients and controls included . Corticosteroids also cause a redistribution of fat deposition, occurring predominantly in the trunk and face [5659]. However, we did not observe an association between serum tnf-, il-6, and il-10 levels and corticosteroid dose . To the best of our knowledge, this is the first study to evaluate the association of bmi, body composition and serum tnf-, il-6, and il-10 levels in csle patients . Although these cytokines have been shown to be associated with cvd in other populations, we only observed an association between serum tnf- levels and obesity, and pbf and total fat mass in trunk region . Our findings suggest that total fat mass may contribute to increased levels of serum tnf- levels in csle.
|
Psoriasis is known to be associated with an increased risk of several comorbidities including inflammatory arthritis, metabolic syndrome, and atherosclerotic disease . The etiology of this autoimmune disorder is unknown but is believed to be an interplay between genetic predisposition and environmental factors such as smoking, high body mass index, and excessive alcohol consumption . The association between psoriasis and enteropathy has been recognized since 1971 when marks and shuster reported a small group of patients with severe psoriasis who presented with diarrhea / steatorrhea and were ultimately found to have enteropathy that was characterized by histological changes similar to celiac disease (cd). However, subsequent epidemiologic studies attempting to characterize this association have yielded inconclusive results, primarily because of small sample size . Therefore, to further investigate this possible relationship, we conducted a systematic review and meta - analysis of epidemiologic studies that compared the risk of cd in patients with psoriasis versus nonpsoriasis participants . The first two investigators independently searched published articles indexed in medline and embase database from inception to march 2016 using the search strategy that comprised the terms for psoriasis and cd as described in supplementary data 1 . The eligibility criteria included the following: (1) cohort study, cross - sectional study, or case control study reporting risk of cd among patients with psoriasis compared with participants without psoriasis; (2) relative risk, hazard ratio, incidence ratio (ir), or standardized ir with 95% confidence intervals (cis) or sufficient data to calculate those ratios were provided . The search and literature review process were overseen by the senior investigator who resolved any different decisions between the first two investigators . This scale assessed each study in three domains including the recruitment of cases and comparators, the comparability between the cohorts and the ascertainment of the outcomes of interest for a cohort study, and the ascertainment of exposure of interest for case control study . A standardized data collection form was used to extract the following information: first author's name, title of the study, year of publication, year of study, country of origin, study design, study population, method used to identify cases and comparators, method used to diagnose psoriasis and cd, number of participants, and demographic data of participants and confounders that were adjusted and adjusted effect estimates with 95% ci . Data analysis was performed using review manager 5.3 software from the cochrane collaboration (london, united kingdom). We pooled the point estimates from each study using the generic inverse - variance method of dersimonian and laird which assigned a weight for each study based on its variance . In light of the high likelihood of between - study variance, we used a random effect model rather than a fixed effect model . Cochran's q test, which is complemented with the i statistic, was used to assess statistical heterogeneity . This i statistic quantifies the proportion of total variation across studies that is due to heterogeneity rather than chance . A value of i of 0%25% represents insignificant heterogeneity,> 25% but 50% low heterogeneity,> 50% but 75% moderate heterogeneity, and> 75% high heterogeneity . The first two investigators independently searched published articles indexed in medline and embase database from inception to march 2016 using the search strategy that comprised the terms for psoriasis and cd as described in supplementary data 1 . The eligibility criteria included the following: (1) cohort study, cross - sectional study, or case control study reporting risk of cd among patients with psoriasis compared with participants without psoriasis; (2) relative risk, hazard ratio, incidence ratio (ir), or standardized ir with 95% confidence intervals (cis) or sufficient data to calculate those ratios were provided . The search and literature review process were overseen by the senior investigator who resolved any different decisions between the first two investigators . This scale assessed each study in three domains including the recruitment of cases and comparators, the comparability between the cohorts and the ascertainment of the outcomes of interest for a cohort study, and the ascertainment of exposure of interest for case control study . A standardized data collection form was used to extract the following information: first author's name, title of the study, year of publication, year of study, country of origin, study design, study population, method used to identify cases and comparators, method used to diagnose psoriasis and cd, number of participants, and demographic data of participants and confounders that were adjusted and adjusted effect estimates with 95% ci . Data analysis was performed using review manager 5.3 software from the cochrane collaboration (london, united kingdom). We pooled the point estimates from each study using the generic inverse - variance method of dersimonian and laird which assigned a weight for each study based on its variance . In light of the high likelihood of between - study variance, we used a random effect model rather than a fixed effect model . Cochran's q test, which is complemented with the i statistic, was used to assess statistical heterogeneity . This i statistic quantifies the proportion of total variation across studies that is due to heterogeneity rather than chance . A value of i of 0%25% represents insignificant heterogeneity,> 25% but 50% low heterogeneity,> 50% but 75% moderate heterogeneity, and> 75% high heterogeneity . Our search strategy yielded 572 potentially relevant articles (428 articles from embase and 144 articles from medline). Four hundred and two articles were excluded at this stage since they were not observational studies, did not report the outcome of interest, or were not conducted in patients with psoriasis, leaving 31 articles for full - length article review . Ten studies were excluded as they were descriptive studies without comparators, whereas five of them were excluded since they compared the prevalence of cd - related antibodies between those with and without psoriasis but did not compare the prevalence of clinical disease . Four retrospective cohort studies with 12,912 cases of psoriasis and 24,739 comparators met our inclusion criteria and were included in this meta - analysis . Figure 1 outlines our study identification and literature review process . The clinical characteristics and newcastle ottawa scales of the studies included in this meta - analysis are described in table 1 . It should be noted that the inter - rater agreement for the quality assessment was high with the kappa statistics of 0.66 . Search methodology and literature review process main characteristics of the studies included in this meta - analysis of the association between psoriasis and celiac disease all included studies revealed an increased risk of cd among patients with psoriasis even though did not always reach the statistical significance . The pooled analysis demonstrated a significantly higher risk of cd among patients with psoriasis compared with participants without psoriasis with the pooled odds ratio of 3.09 (95% ci, 1.924.97). Forest plot of this meta - analysis to confirm the robustness of our analysis, we performed jackknife sensitivity analysis by excluding one study at a time from the pooled analysis . The results of this sensitivity analysis ranged from 2.87 to 8.90 and remained statistically significant . Since only four studies were included in this meta - analysis, evaluation for publication bias was not performed . Since only four studies were included in this meta - analysis, evaluation for publication bias was not performed . This study is the first systematic review and meta - analysis to investigate the risk of cd among patients with psoriasis using comprehensive data from all available studies . We were able to demonstrate a statistically significant increased risk of incident atrial fibrillation among patients with psoriasis with approximately 3-fold increased risk of cd compared with participants without psoriasis . The pathophysiologic mechanisms behind this increased risk are not known, and further investigations are required . However, there are few possible explanations . First, the association between cd and several autoimmune diseases, such as type i diabetes mellitus and autoimmune thyroid disease, is well documented . It is believed that shared genes (at - risk human leukocyte antigen [hla] haplotypes) might be responsible for this association . For example, type i diabetes mellitus and cd share multiple common genetic loci such as hla - dr3, hla - dq2, and hla - dq8 . The shared genes might play a similar role in the association between psoriasis and cd . Second, the hyperproliferated keratinocytes found in patients with psoriasis are known to produce an excessive amount of interleukin (il)-1 and il-18, the essential signals for the induction of th1 response . Interestingly, mucosal inflammation in patients with cd is also caused by activation of th1 in response to dietary gluten . Third, it is also possible that, in fact, cd increases the risk of psoriasis, but diagnosis of cd is often delayed or missed as its clinical manifestation could be subtle and nonspecific . Intestinal barrier dysfunction associated with undiagnosed or untreated cd may allow increased passage of immune triggers resulting in increased risk of autoimmune diseases including psoriasis . Given the possible mechanistic links between the two diseases, gluten - free diet, the cornerstone for the management of cd, may also have a role in the management of psoriasis . In fact, benefit of gluten - free diet among patients with psoriasis has been observed in nonrandomized studies . The major strength of this study was the advantage of systemic review and meta - analysis that comprehensively combined all available data . Nevertheless, we acknowledge that the study has some limitations and the results should be interpreted with caution . Second, we could not perform an evaluation for publication bias as only four studies were included in the analysis . Therefore, we cannot exclude the possibility of publication bias in favor of positive studies . Third, the primary studies were conducted in only two countries which might limit the generalizability of our results to other populations . Our meta - analysis demonstrated an approximately 3-fold increased risk of cd among patients with psoriasis . Whether routine screening for cd is suggested in clinical practice patients with psoriasis are at approximately 3-fold increased risk of celiac disease compared with participants without psoriasis . Patients with psoriasis are at approximately 3-fold increased risk of celiac disease compared with participants without psoriasis.
|
Movement disorders are neurological conditions that affect the speed, fluency, quality, and ease of movement . There may be either an excess of movement or a paucity of voluntary and automatic movements, unrelated to weakness or spasticity . Movement is produced and coordinated by several interacting brain structures, such as the motor cortex, the cerebellum, and the basal ganglia (bg). The motor system is part of the central nervous system that is involved with voluntary and involuntary movements . The extrapyramidal system is part of the motor system that causes involuntary reflexes and movement, and modulation of movement (i.e., coordination). The bg comprises a group of interconnected deep brain nuclei, namely, the caudate and putamen, the globus pallidus internus (gp), the substantia nigra (sn), and the subthalamic nucleus (stn). These nuclei (via their connections with the thalamus and the cortex) influence the involuntary components of movement and muscle tone . Disruption of such complex circuitry within the bg causes movement disorders, such as parkinson's disease (pd), essential tremor (et), and dystonia . Intimate structural and functional connections between cerebellum and basal ganglia appear to be involved in patients with dystonia . In certain types of dystonia, cerebellar dysfunction (such as compensatory activity) clinical, biochemical, pathological, and imaging studies suggest an abnormal functioning of the cerebellum in et . Movement disorders can be classified as hyperkinesias (excess of movements), dyskinesias (unnatural movements), and abnormal involuntary movements . There is also decreased amplitude of movement (or hypokinesia), but the terms bradykinesia (slowness of movement) and akinesia (loss of movement) are used as well . For example, acute morbidities encountered in movement disorders include those related to parkinson's disease, acute drug reactions (acute dystonia, neuroleptic malignant syndrome, serotonergic syndrome, and malignant hyperthermia), acute exacerbation of chronic movement disorders (status dystonicus), hemiballism, and stiff - person syndrome . The year 2012 marks the 25th anniversary of the birth of modern dbs . It was initially created to treat tremor of the ventral intermediate nucleus (vim) of the thalamus . Since then, dbs has become a highly effective and safe surgical treatment for severe et, advanced parkinson's disease, and dystonia . Dbs is widely administered with voltage - controlled devices, in which current is variable [9, 10]. High frequency dbs leads to a kind of functional deafferentation of the stimulated structure and to the modulation of cortical activity . Up to date, tens of thousands patients have undergone implantation of dbs electrodes, mainly for the treatment of parkinson's disease, severe et, and for primary (idiopathic) dystonia . New uses of dbs include epilepsy and psychiatric disorders such as depression, obsessive compulsive disorder, and tourette's syndrome . Motor cortex stimulation is used for intractable neuropathic pain (including central poststroke pain). The role of dbs for parkinson's disease, et, and dystonia is a well - established treatment option that is currently approved for use in north america, europe, and in countries such as australia and new zealand . The aims of this narrative paper are to explore the use of dbs in the treatment of movement disorders to review indications for its use and its mechanisms of action . The implantation technique for dbs and its possible adverse effects future technological advances clarifying pathophysiology of movement disorders and the need for improved research designs are discussed as well . The paper is based on an extensive search of the literature (pubmed, embase) in relation to the topics covered without strict inclusion or exclusion criteria in the search strategy . Indications for the use of dbs include the need to improve function, reduce medication dependency, and avoid ablative neurosurgery . Dbs has arisen to the forefront as a highly effective, safe, and reversible treatment of parkinson's disease, et, and dystonia . The possible target sites for dbs include the ventral intermediate (vim) nucleus of the thalamus, the gpi, and the stn . Parkinson's disease is a chronic progressive neurodegenerative movement disorder affecting the extrapyramidal motor system . The loss of sn pars compacta dopaminergic neurones projecting to the caudate and putamen is considered its neuropathological hallmark . Class one evidence exists for the usefulness of dbs for parkinson's disease [11, 13, 14]. It is estimated that more than 10% of parkinson's disease patients could benefit from dbs treatment . Dbs should be reserved for patients with levodopa - responsive parkinson's disease who have levodopa - related complications that cannot be adequately controlled with medications . The three currently accepted primary targets used for dbs in the treatment of idiopathic advanced parkinson's disease refractory to medical therapy are the vim thalamus, the gpi, and the stn . The overall clinical outcome of stn and gpi dbs for control of dyskinesia and motor fluctuations is similar . Reduction of dopaminergic therapy after stn dbs may help in reducing visual hallucinations and impulse control abnormalities . The use of constant - current bilateral dbs of the stn for parkinson's disease results in significant improvements in motor function and daily fluctuations of response to levodopa . The evidence to date shows that dbs is generally safe from the cognitive standpoint in well - selected pd patients . However, there is a clear risk of postsurgical cognitive decline that seems greater whenever the stn dbs is used . Significant improvements occur in patients with advanced parkinson's disease (particularly those with severe motor fluctuations) when treated with gpi dbs . These include improvements in gait and posture, reduction of dyskinesias, and the reduction of both the amount and severity of on / off fluctuations . However, both primary and various types of secondary dystonia can be treated very effectively with gpi dbs . Such tremors include parkinsonian tremors, ets, cerebellar tremors, tremors of multiple sclerosis, and orthostatic tremors . Dbs of the vim thalamus remains an effective target for treatment of certain patients with tremor dominant parkinson's disease refractory to medical therapy . The frequency of stimulation is a key factor in determining clinical efficacy [21, 22]. Stimulation starts to reduce tremor at a frequency of approximately 50 hz and reaches a plateau at 200 hz . For more than five years after implantation, thalamic dbs has been shown to benefit tremor control [20, 23]. In severe parkinsonian tremor, promising results have recently been obtained from the use of dbs in the posterior subthalamic area (including the caudal zona incerta). Et is the most common movement disorder affecting up to 5.5% of individuals aged 65 years or older . The main exclusion criteria of dbs treatment for et include altered cognition and the presence of an untreated or disabling psychiatric illness . The usefulness of thalamic stimulation in the treatment of essential head and voice tremor remains unproven . Dbs has been an emerging therapy for disabling cerebellar tremors of different aetiologies (multiple sclerosis, stroke, trauma, cavernous haemangiomas, tumours, and degenerative disease). Better control in posttraumatic tremor occurred when dual deep brain stimulator leads were placed over a larger region of the ventral thalamus [8, 28]. Bilateral thalamic stimulation has demonstrated beneficial effects in case reports in treatment - resistant orthostatic tremor [29, 30]. . It might be primary (idiopathic) or secondary to a known structural lesion of the brain (e.g., cerebral palsy from perinatal hypoxia, infections, stroke, trauma, drugs, and wilson's disease) or associated with a complex regional pain syndrome . The interaction between the bg and cerebellar circuits plays a major role in its pathophysiology . It presents with sustained, uncontrolled, and often painful muscle contractions causing repetitive movements and abnormal postures . Dystonia is divided into focal (affecting a single body region), segmental (two or more adjacent areas), or generalized (involving the legs, or one leg and the trunk, plus at least one other area of the body). Focal dystonias include cervical dystonia (spasmodic torticollis), blepharospasm, oculogyric crisis, oromandibular dystonia, spasmodic dysphonia or laryngeal dystonia, and focal hand dystonia . The gpi shows abnormal firing activity in dystonia and is therefore the usual target of dbs (e.g., for primary dystonia and for cervical dystonia orspasmodic torticollis). The optimal frequency and amplitude stimulation settings needed for dbs in dystonia are higher than for gpi dbs and stn dbs in parkinson's disease patients . Positive effects of dbs on dystonia scales, quality of life, and pain reduction have been confirmed in many studies [2, 32, 33]. In primary generalised dystonia long - term sustainability of these benefits has been demonstrated . In tardive dystonia (from neuroleptics, metoclopramide, and prochlorperazine), there is significant improvement in dystonic symptoms from dbs . Whereas the maximum beneficial effect on tremor and rigidity is reached within minutes, the delay for maximal improvement in akinesia is minutes to hours, and the improvement in dystonia gradually develops over several weeks [22, 3740]. The third is that high - frequency stimulation induces long - term synaptic changes (plasticity). Recent evidence suggests that dbs has more complex mechanisms of action than the pure functional inactivation of the target region . The ultimate effect of modulating the network activity within the bg can be viewed as the takeover on hyperactive elements or structures of the cortico - bg - thalamocortical complex circuit [8, 4143]. For example, reducing the abnormally enhanced synchronisation of basal ganglia output is an essential mechanism in the therapeutic effect of dbs in parkinson's disease . Other possible mechanisms of action for high - frequency dbs include local neuronal inhibition with concomitant activation of surrounding fibres, thus resulting in increased synaptic output and activation of afferent axon terminals (e.g., the cortical inputs in the case of high - frequency stimulation of the stn or nucleus accumbens) [22, 44, 45]. This could be of benefit for the treatment of obsessive - compulsive disorders and depression [22, 46]. Dbs may modulate specific neurones that release specific neurotransmitters, thereby affecting these systems in the brain . The use of volume of tissue - activated studies, other functional imaging, microelectrode multisite recordings, local field potentials, eegs, and magnetoencephalographic studies will promote understanding of the stimulation effects on local and long - range neuronal networks . For example, patient selection criteria for dbs in parkinson's disease are as follows: (1) a diagnosis of medically refractory intractable parkinson's disease, primary generalised dystonia, or et, with symptoms that substantially interfere with the patient's quality of life and functionality, (2) intact cognition, (3) the absence of an untreated or disabling psychiatric illness, (4) realistic expectations, (5) the ability and willingness to participate in regular followup visits, and (6) the absence of comorbidities that are contraindications to dbs [18, 47]. The dbs technique uses continuous high - frequency stimulation of specific brain regions (figure 1). It involves the implantation of a microelectrode into a deep target within the brain that is connected to a stimulator; the stimulator is programmed to emit electrical impulses at varying strengths and frequencies . Impulses travel to the implanted electrodes from a pulse generator (similar to a cardiac pacemaker) that is telemetrically programmable . Medtronic dbs device (minneapolis inc .) Is currently the most widely utilised system in functional surgery across the world . The device used has three separate components including the electrode, the extension wires connecting the intracranial electrodes with impulse programming generator (ipg), and the ipg (figure 2). Although details regarding surgical techniques may vary, all combine a stereotactic technique with detailed image guidance . Stereotaxis is a minimally invasive surgical procedure that makes use of a three - dimensional coordinate system to accurately locate a target in a deep - seated area of the brain . Electrodes are implanted into the target brain area by means of this stereotactic surgical procedure with electrophysiological recordings at the cellular or pathway level . A stereotactic head frame is placed on the patient under local anaesthesia in the operating room . A computed tomography (ct) scan or, more commonly, a magnetic resonance imaging (mri) scan is obtained; this identifies the anterior commissure, posterior commissure, and the midcommissural point . Based on the location of these structures, well - established x, y, and z target coordinates are used to plan electrode placement . Planning software determines the target coordinates; an entry point is found that will allow passage of the electrode through the brain without traversing the ventricle or damaging vascular structures . Surgery is usually performed while the patient is awake, off drug therapy, and under local anaesthesia, as this enables reliable microelectrode recording (mer) to be obtained; it allows evaluation of the intraoperative stimulation and possible adverse effects caused by the current diffusion to adjacent structures . General anaesthesia is generally contraindicated during mer, as it depresses neural activity, suppresses clinical symptoms (tremors and rigidity), and interferes with the evaluation of clinical benefits . In patients unable to tolerate an awake procedure, ketamine is a safe and effective alternative to other drugs used to induce general anaesthesia, as the feasibility of microelectrode recording is preserved . A scalp incision and burr hole are placed in the skull at the predetermined entry point . Electrodes of 1.3 mm in diameter integrating four contacts of 1.5 mm length each, connected to a pulse generator, are used . Verbal feedback is received from the awake patient regarding unwanted adverse effects (such as paraesthesias or visual phenomena). Proper placement is confirmed by intraoperative fluoroscopy and postoperative mri or ct scanning . Once trial stimulation has been deemed successful, a permanent pulse generator (similar to a pacemaker) is placed in the subclavicular space . Stimulation parameters (frequency, amplitude, and pulse widths) may vary . Programming these parameters several time - consuming visits may be required before the best therapeutic effect is reached . Bilateral lead implantations can be performed either during a single surgery or in a staged procedure separated by 24 weeks . Pulse generators can be placed in a subclavicular position either on the same day or as part of a staged procedure after lead implantation . Successful outcomes are correlated with patient selection, accurate placement of the electrodes in their surgical target, and optimal programming of patients . At what stage however, an eight - year followup study in parkinson's disease showed that stn dbs can be considered safe from a cognitive standpoint but did not seem to modify the cognitive evolution along the course of the disease . On the basis of these observations, it may be appropriate to perform surgery earlier than currently indicated . Adverse effects noted include those related to the surgery, the hardware, and the stimulation per se . Surgical complications include primarily intracerebral haemorrhage (less than 2% in most centres) and infection (in about 4% of the cases) [2, 51]. Intraoperative or postoperative haemorrhage is the most dreaded complication of dbs . Haemorrhages may occur due to laceration of intracerebral vessels during microelectrode recording or lead implantation . Surgery on the gpi carries a greater haemorrhagic risk than does that on the stn . Hardware complications (device - related problems occur in 4.5% of the patients) include the following: erosion over the connector; electrode ruptures or malfunction; electrode migration; lead fractures; infections; skin erosion; battery failure; device malfunction; mri safety concerns . Erosion of the subcutaneous portions of the hardware occurs in patients with a very low body mass index . Electrode impedance should be checked and recorded at each clinical visit [15, 55]. Stimulation signals with amplitudes greater than those required to achieve symptom control can affect neighbouring structures causing adverse effects; these are reversible with amplitude adjustments . To avoid this dyskinesia, worsening of axial symptoms (freezing, balance, and gait disturbance), speech disturbance, involuntary muscle contractions, paraesthesia, and diplopia are among the common stimulation - related and transient side effects . Stn dbs can worsen speech and gait in some patients, requiring stimulation parameters to be adjusted . Other adverse effects observed after stn dbs include neuropsychiatric problems, cognitive deterioration, eyelid opening apraxia, weight gain, stimulation - induced dyskinesias, and worsening akinesia [56, 57]. The neuropsychiatric symptoms following stn dbs in parkinson's disease patients are generally transient and mild if managed appropriately . With gpi dbs, adverse effects include paresthesias, muscle contractions, visual flashes, worsening akinesia, dysarthria, weight gain, eyelid opening apraxia, confusion, and cognitive decline . A recent study reported that depression worsened with stn dbs but improved with gpi dbs . Years later, patients can develop disabling levodopa - resistant symptoms, such as gait disturbances and cognitive impairment . Stimulation - induced dyskinesia is frequently managed with a reduction in the dosage of dopaminergic medications . To control symptoms with fewer medication adverse effects, programming of dbs can be performed concurrently with changes in levodopa doses . In dbs for et, the most frequent stimulation - induced adverse effects are paresthesias, followed by dysarthria and pain; these are reversible once the stimulation is turned off . Gait or balance may worsen following dbs for medication refractory et . Adverse effects of dbs may include modulation of affect, cognition, and behaviour, or possible changes of personality . Some data suggest that the implantation per se and not the stimulation is the main cause of the decline in executive function . Dbs is generally safe from the cognitive standpoint in well - selected pd patients when looking at measures of global cognition . Nevertheless, there is a clear risk of postsurgical cognitive decline that seems greater whenever the stn dbs is used, although data with other targets is limited . Only one large randomized, double - blind trial has focused mainly on motor efficacy issues of stn dbs versus gpi dbs . Postsurgical decline in verbal fluency has been the most consistently reported cognitive adverse effect in patients undergoing subthalamic dbs [18, 59]. The demonstration of long - term cognitive effects from the surgical procedure or stimulation is difficult . It remains challenging to differentiate these from the natural progression of the disease and other confounding variables (such as drug therapy, brain vascular lesions, pd progression, and concurrent degenerative pathology). Short - term clear cut changes are most probably due to the surgical procedure itself and the electrical stimulation . The factors (such as age, pd duration, disease phenotype, and levodopa responsiveness) that predict postsurgical cognitive decline remain unsatisfactory . A wireless instantaneous neurotransmitter concentration system (wincs) has been developed to promote understanding of the neurocircuitry involved [61, 62]. The wincs system provides real - time neurotransmitter monitoring to reveal underlying neuromodulatory mechanisms of dbs action . This device is capable of monitoring the release of a variety of neurochemicals (dopamine, serotonin, histamine, and adenosine) during dbs using the electroanalytical techniques of fast - scan cyclic voltammetry at a carbon fibre microelectrode, and fixed potential amperometry at enzyme - linked biosensors . Dbs systems; these would provide feedback from brain electrical activity to direct the stimulation and neuroimaging modalities . Computational analysis or electrophysiological modelling dbs would then depend on the use of multiple electrodes with these closed - loop it might even allow the performance of effective and safe programming through remote access, such as via the telephone or the internet . By disentangling the neuronal network codes, closed - loop devices could provide stimulation on demand . On - going clinical trials with dbs are investigating its use in tremor in multiple sclerosis, in mood disorders, in pain and cluster headache, in hypertension, in obesity, in memory impairment, in aggressiveness, in drug addiction, and in other central nervous system disorders; this will enhance indications for its use in future . Advances in functional imaging are providing new offer preoperative modelling for dbs surgery, including nerve fibre tracts (diffusion tensor imaging), and imaging of volume of tissue activated by a specific electrode . Computational analysis techniques for dbs include mathematical models of the abnormally synchronized electrical activity that underlies epilepsy, movement disorders, and many mood disorders as well . New programming options such as interleaving and constant current devices are now on the market . Constant - current stimulation provides more accurate control of the spread of the electrical field than do voltage - controlled devices, as adjustments can be for heterogeneity in tissue impedance [10, 68]. The development of new electrodes with improved variability of stimulation direction should aid progress as well . Finding the right anatomical areas to stimulate to gain the best outcomes remains a challenge . A more recent experimental target is the pedunculopontine nucleus (ppn) that may be appropriate for patients with gait freezing or postural instability gait difficulty [6971]. The centremedian / parafascicular thalamic complex has been proposed as a successful target for control of tremor as well . Fibre tracts rather than nuclei might be the correct target of choice (not only in parkinson's disease, but also in thalamic stimulation for et). Optogenetic studies suggest that stn stimulation and stimulation of afferents from cortical areas might form the main mechanism of action of dbs [11, 41]. Movement disorders encompass acute and chronic diseases characterised by involuntary movements or loss of control or efficiency in voluntary movements . In movement disorders, dbs is a highly effective, safe, and reversible surgical treatment for advanced parkinson's disease, tremor, and dystonia . Its use has promoted interdisciplinary clinical team work and provided an improved understanding of the complex neurocircuitry associated with these disorders . For improvement of outcomes after dbs, a refinement of patient selection criteria is needed . Dbs is a useful therapeutic option in carefully selected patients that significantly improves motor symptoms, functional status, and quality of life . Dbs remains an expensive resource, and its future clinical use will continue to raise many regulatory and ethical issues . Further evidence, particularly in the form of prospective studies and randomised controlled trials, is required to better establish the pathophysiology of movement disorders and its role therein.
|
Cutaneous hyperpigmentation is a recognized adverse effect of chronic minocycline use occurring in up to 50% of patients, . In a recent study performed at the mayo clinic, 54% of 291 patients receiving long - term minocycline suppression for orthopedic infections developed some degree of hyperpigmentation after a mean follow - up of 4.8 years . In this cohort, factors associated with minocycline - induced cutaneous hyperpigmentation (mich) include a history of vitamin d deficiency, presence of a shoulder prosthesis, noncirrhotic liver pathology, and use of a concurrent medication (e.g., calcium channel blocker) also known to cause hyperpigmentation . Mich is not associated with adverse clinical effects, and it is mostly cosmetic in nature . We herein present a rare case of extensive skin hyperpigmentation involving both lower extremities in a patient receiving long term minocycline . In june 2016, a 76-year - old male with a past medical history significant for nephrolithiasis and diverticulitis, presented to the authors institution with extensive hyperpigmentation involving both lower extremities . He underwent a left total knee arthroplasty in 1988 at an outside institution and underwent revision surgery in 1992 . In 2001, he underwent a second revision for fractured patella that was complicated by an infection with a coagulase - negative staphylococcus . He received six weeks of treatment with parenteral vancomycin followed by oral trimethoprim - sulfamethoxazole . Operative cultures from the knee grew enterococcus sp ., prevotella sp, viridans group streptococcus, as well as candida parapsilosis . After completing antimicrobial treatment with vancomycin, ertapenem and fluconazole, he underwent reimplantation using a rotating hinged knee arthroplasty in september 2005 (fig . Since that time, the patient was maintained on oral minocycline chronic suppression . In 2010 he uses a brace as well as a cane to ambulate . At a follow - up in february 2012 when he was seen again in june 2016, there was extensive blue - gray pigmentation in both cheeks and in the lower extremities (fig . 2), as well as sub - ungual blue - gray pigmentation in both hands (fig . There are three types of pigmentation patterns that can result from taking minocycline for long periods of time . Type i is a blue - gray pigmentation occurring around areas that were previously inflamed . Type ii has the same appearance as type i and covers areas of normal skin such as the anterior shins, arms, and ankles . Type iii is a muddy brown pigmentation usually occurring on areas of the skin that are exposed to the sun . The blue - gray pigmentation is due to the deposition of iron within the dermal macrophages . The diffuse hyperpigmentation seen in the patient presented in this case report includes both types i and ii . Blue - gray pigmentation is clearly seen around the scar on the left knee from his knee replacement surgery (type i). Hyperpigmentation is also distinctly seen on the shins of both legs and around the ankles of the patient (type ii). Hyperpigmentation is predominantly seen with minocycline and less likely to occur with other tetracyclines such as doxycycline . Minocycline is five times more lipophilic than doxycycline; hence, central nervous system adverse events are more common with minocycline . Although doxycycline may have a higher incidence of gastrointestinal upset and photosensitivity, minocycline has an increased likelihood of severe and permanent cosmetic adverse events and central nervous system adverse events . In the study of orthopedic patients on long - term minocycline suppression, these side effects are an addition to gastrointestinal adverse effects that can also occur with minocycline . In the absence of data to show that minocycline is superior to doxycycline for long - term suppression of infections including orthopedic infections, the authors propose that doxycycline be looked upon favorably when chronic use is indicated.
|
Root canal isthmus, a narrow ribbon - shaped communication between two root canals is an important anatomical feature because of the fact that it may contain pulp remnants, necrotic tissues, and micro - organisms and their byproducts . An isthmus is also called a corridor, a lateral interconnection, and a transverse anastomosis . The prevalence of isthmus varies according to the tooth type, root levels, and age . An isthmus might be found in roots with c - shaped canals or in two adjacent canals such as mesial roots of mandibular molars, premolars, and so on . The mesial root of the mandibular first molar exhibits the most number of isthmuses . The majority of isthmuses have been reported in the apical 5 mm of root canals . A study in a chinese population reported that the prevalence of isthmuses decreases with age in molars due to the deposition of secondary dentin . Irregularities in root canal system, including isthmuses, are inaccessible spaces for instruments, irrigation solutions, and medicaments, and serve as reservoirs for bacteria, which finally leads to the failure of conventional root canal treatment . In addition, isthmuses overlooked during periapical surgeries might lead to the failure of surgical treatment . Ideally, with the present practice of advanced preparation and filling of isthmuses during root - end resection, the success rate of endodontic treatments is expected to increase in most cases . Therefore, a thorough knowledge of this anatomic feature in the apical third of root canals in posterior teeth has a great value in increasing the success rate of surgical and nonsurgical endodontic treatments . A large number of studies have been carried out in different parts of the world to determine the prevalence of isthmus in mandibular molars, ranging from 54 to 89% [table 1]. Considering ethnical variations and inadequate published data on this anatomical feature, the aim of the present study was to evaluate the prevalence and location of isthmus in the mesial roots of extracted mandibular molars in an iranian population . In this cross - sectional descriptive study, 60 extracted mandibular first and second molars were randomly selected from dental clinics of tehran (from the north, south, east, and west regions). The teeth were rinsed under tap water immediately after extraction and immersed in 10% neutral buffered formalin solution and prepared for two - angle radiographic examination (straight and 20 mesially). The inclusion criteria consisted of mature roots, the presence of two canals in the mesial root, absence of any calcification, internal or external root resorption, and visible cracks . The age, gender, and race of the patients were not considered . All teeth were decoronated and two #15 k - flexofiles (dentsply / maillefer, ballaigues, switzerland) were used to verify the two canals in the mesial roots of the teeth and a periapical x - ray was taken . A low - speed handpiece with a thin metallic disk (d and z, germany; length: 0.17 mm, breadth: 2.0 mm) was used to cut each root at 2, 4, and 6 mm distances from the apex perpendicular to the root long axis . Each separated root segment, which was 2 mm in thickness, was placed in 5.25% sodium hypochlorite solution for 24 hours to remove any debris or organic material remnants . Subsequently, the root samples were immersed in 17% ethylenediaminetetraacetic acid (edta; ariadent, asia chemie teb, tehran, iran) for 30 seconds, then rinsed with distilled water, and dried . Finally, the sectioned surfaces of the samples were stained with indian ink and evaluated under a stereomicroscope (nikon ufx - dx, tokyo, japan) at a magnification of 30 . Photographs were taken using a camera (nikon fx-35 xx, tokyo, japan), and recorded and evaluated by two endodontists . The absence or presence of isthmuses and their types were evaluated and recorded based on the classifications of kim and teixeira at various distances from the apex . The kim classification consists of five types [figure 1]: schematic representation of isthmus classifications described by hsu and kim type i: presence of two canals without a noticeable communication type ii: presence of two canals without a definite communication type iii: similar to type ii but with three canals instead of two canals type iv: extension of the main canal into the isthmus type v: presence of a complete communication or corridor between the two canals the teixeira classification consists of no isthmus, incomplete isthmus, and complete isthmus . A chi - squared test was used to determine the relationship between the prevalence and types of isthmuses with canal location after prevalence and confidence intervals were determined . The results are presented in [tables 2 and 3] and based on the classifications of kim and teixeria . In the 60 mandibular first and second molars evaluated in the present study, isthmus was found in an average of 83% of the mesial roots at 2, 4, and 6 mm distances from the apex . The highest prevalence of isthmus was found at a distance of 6 mm from the apex with 92% [confidence interval (ci): 89.8 - 93.6]; the lowest prevalence was found at a distance of 2 mm from the apex with 70% (ci: 64.7 - 75.3). The prevalence of isthmus was 88% (ci: 85.7 - 90.92) at a distance of 4 mm from the apex . Prevalence of isthmuses, based on the kim classification, at 2, 4, and 6 mm distances from the apex in an iranian population prevalence of isthmuses, based on the teixeira classification, at 2, 4, and 6 mm distances from the apex in an iranian population based on the kim classification [figure 2], there was no significant relationship between isthmus type and canal location . The most prevalent isthmus at 2 and 4 mm from the apex was type v but at 6 mm, it was type ii . However, in terms of the teixeira classification [figure 3], there was a significant relationship between sections at 2 and 6 mm from the apex (p = 0.039). Moreover, the incomplete type was most common in 6 mm (67%) and least in 2 mm (18.3%). Lack of isthmus was most common in 2 mm (18%) and least in 6 mm (5%). The complete type was most common in 2 mm (52%) and least in 6 mm (25%). Isthmus classifications described by hsu and kim: type i (a), type ii (b), type iii (c), type iv (d), type v (e) teixeira classification: no isthmus (a), incomplete isthmus (b), and complete isthmus (c) the management of root canal isthmus has been shown to be very essential in nonsurgical and surgical endodontic treatment . Complete cleaning, shaping, and obturation of the apical third of root canals are considered as among the most important factors in achieving an excellent prognosis of root canal therapy . An unprepared isthmus in the root canal system, especially in the mandibular and maxillary molars, might contain necrotic debris and tissue remnants, which might serve as a reservoir for bacteria, leading to endodontic failure . Therefore, initial anatomical knowledge, recognition, and proper management of an isthmus may be of great value to increase the success rate of surgical and nonsurgical endodontic treatments in posterior teeth . In the present study, isthmuses were found in 83% of the mesial roots of the mandibular first and second molars, which is consistent with the results of the studies by fan et al . In which prevalence rates of 85, 81, and 88.5% were reported, respectively [table 1]. Teixeira et al . Found an incidence of 59% two canals in the mesial root of mandibular molars . The prevalence of isthmus was greatest 3 - 5 mm from the apex . In these cases, 22% were complete and 37% partial in mandibular molars . Bidar et al . Reported an isthmus incidence of 16% in distal roots with two canals of mandibular molars in a sample of iranian population . This lower rate of isthmus could be explained by different roots (distal versus mesial). However, the authors emphasized that even this percentage would be taken into account during the cleaning and shaping of root canals . Furthermore, the highest and lowest prevalence rates of isthmuses in the present study were found at 6 mm and 2 mm distances from the root apex, respectively . Therefore, the number of isthmuses increases from 2 to 6 mm distance beyond the apex . Previous studies, similar to our study, have shown the highest prevalence of isthmuses at 4 - 6 mm distances from the apex in the mesial roots of mandibular molars . In addition, we found the highest and lowest prevalence rates of complete isthmuses at 2 and 6 mm distances, respectively, indicating a progressive decrease in the number of complete isthmuses from 2 to 6 mm beyond the apex . The prevalence of complete isthmus at 2 mm from the apex, in our study, was higher than that of the findings of gu et al . Management of complete isthmus is easier with the use of microsurgical techniques, such as the usage of a dental operating microscope and microsurgical instruments; however, preparation of incomplete isthmuses is more difficult and requires the accurate use of fine ultrasonic tips . In the present study, a higher rate of incomplete isthmus was found in the 6 mm apical root, indicating a challenging situation during nonsurgical preparation of mandibular molars . Additionally, following 3 mm root end resection during periapical surgery, retropreparation and retrofilling to a depth of 3 mm are suggested to clean and fill the 6 mm apically located segment of an isthmus ., the teeth were sectioned and evaluated under a stereomicroscope, similar to the technique used by teixeria et al . And bidar et al . The sectioning, staining, and clearing is a commonly used technique due to its greater accuracy in the detection of isthmus than other techniques . However, microcomputed tomography is a modern technique, which is used at present for the evaluation of the morphology, location, and configuration of isthmus . The technique was first used by mannocci et al . To determine the prevalence of isthmuses in the mesial roots of mandibular first molars . One of the advantages of this technique is a thorough reconstruction of the root canal system without destroying the specimens . If the isthmuses are not cleared of bacteria, there is potential for the treatment to fail, and the presence of unsuspected isthmuses may also affect the quality of the root canal filling . Therefore, complete removal of debris and micro - organisms from the apical third of the root canal is an important predicting factor for improving the long - term prognosis of endodontic treatment . A recent study found that the residual bacteria which frequently are entrapped in ramifications, isthmuses, and dentinal tubules makes it necessary to use an antibacterial irrigant and inter appointment medicament to maximize bacterial reduction before filling of the infected teeth . However, the complete eradication of bacteria could not be achieved in apical isthmus after two sessions of endodontic therapy . Despite various studies on the evaluation and management of isthmuses and recent advances in nonsurgical endodontic treatment modalities such as modern sonic and ultrasonic irrigation devices, side - vented needle irrigation (sni), and vpro endosafe (vpro), cleaning and shaping of isthmus areas showed that the application of negative pressure techniques for the removal of debris from the isthmus in the mesial root of a mandibular first molar does not lead to the removal of more debris compared to the manual dynamic irrigation technique and none of the techniques completely removes debris from an isthmus . Some in vitro studies have shown that none of the isthmuses in the root canals can be completely obturated with root - filling materials during conventional endodontic treatment . It was shown that production of dentinal debris during canal instrumentation and its penetration into the isthmuses of mesial root canals of mandibular molars prevent penetration of sealers and filling materials into the isthmuses despite continuous irrigation during and after instrumentation . Therefore, proper management of isthmuses including bacterial reduction and complete filling requires future application of newer technologies and then further studies to verify their efficacies . A recent study by de groot et al . On the cleaning efficacy of laser - activated irrigation of root canals showed that the use of this technique is more efficient in removing debris from the apical third of the root canal compared to passive ultrasonic irrigation and hand irrigation techniques . In addition, the application of er, cr: ysgg laser (er, cr: ysgg: erbium, chromium - doped: yttrium, scandium, gallium, and garnet) for the obturation of root canal system resulted in an increased rate of better obturated root canals and isthmuses . Therefore, it is postulated that the use of modern technologies such as lasers, modern irrigation devices, and surgical microscopes might result in a more thorough cleaning and obturation of isthmuses during surgical and nonsurgical endodontic treatments . Isthmuses are very common in the mesial roots of mandibular permanent molars in the iranian population, with the highest prevalence in those at 6 mm distance from the root apex . Therefore, endodontic microscopes and newer technologies should be used for cleaning and obturation of isthmuses to achieve higher success rates in endodontic treatment.
|
The aim of the present investigation was to develop an instrument to monitor any changes in maternal and neonatal health (mnh) care provider motivation resulting from the introduction of pilot interventions in rural, primary level facilities in ghana, burkina faso, and tanzania . The work was undertaken in the frame of the quality of maternal and prenatal care: bridging the know do gap (qualmat) project. The interventions that qualmat will pilot are a clinical decision support system (cdss) to reinforce provider competence, and a package of incentives to reward good performance . As the interventions are the same for all three countries it was agreed that a common instrument would be used to assess their effect on provider motivation so as to facilitate comparability . In contrast to other work in this area, this paper focuses upon the actual development of the instrument and the challenges that presented themselves . Whilst this instrument is rather specific for qualmat, the detailed methodology outlined here provides guidance for others seeking to put such tools into practice . 1) (3, 18, 20, 2931, 33) shows how individual and contextual influences interact with a provider's competence and work motivation to give rise to their work effort, ultimately resulting in their overall job performance . Its elaboration was based upon a literature review and exchange between the project collaborators . In particular, reference was made to the multi - level approach proposed by franco et al . Developed with reference to (3, 18, 20, 2931, 33). Attach a great deal of importance to individual level influences (30). In line with this, the framework outlines demographics such as age, sex, marital status, number of dependents, and level of training . It also outlines a health worker's needs, wants, expectations, goals, values, and how far they believe in their ability to succeed in certain situations (self - efficacy) (34). Efficacious individuals have been found to be more persistent in trying to accomplish goals (35). Furthermore, mention is made of traits such as self - control and conscientiousness that predispose a person to behave or respond in a certain way and which can also influence job performance (3, p. 3). The contextual influences include workplace factors (organizational level), factors resulting from the broader health system and policy environment, including conditions of employment, as well as community and cultural level influences . It has also been suggested that the nature of a job itself has implications for its motivating potential (36), which explains the further inclusion of work factors, that is, the variety of skills required, or the discretion a worker has to decide how to accomplish tasks . The preliminary qualitative research indicated that the actual nature of mnh work is of relevance in that it is an area that either involves routine monitoring, or rapid action and decision - making, if problems arise . Moreover, it is perceived to be an area of high occupational risk and to readily expose a provider's actual level of competence (37). The workplace or organizational level factors are expanded upon in the framework, as our qualitative findings indicated difficulties in this area . Particular attention is paid to management aspects, especially human resources management, given their importance for staff performance (38). These aspects include whether a health worker has clear work goals, access to professional exchange, work aids and guidelines, continuing education, and supportive supervision . The other factors are not fully elaborated on in the framework . In short, health system factors are considered to include facility staffing levels and skills mix, availability of work equipment and drugs, state of infrastructure, functionality of the referral system, and so on . Policy aspects refer to employment conditions, including salaries, overtime, leave, and pension provision . Many of these were shown to be sources of serious concern in the qualitative research with many providers only moving on to talk about other aspects of their work and motivation once they had aired their grievances on these issues . At primary level care in all three countries, mid - level cadres and auxiliaries make up a significant proportion of the workforce . Several studies have highlighted that the position of these cadres is difficult in terms of the respect they command (18), their conditions of employment, and their opportunities for professional development (39, 40). Broader conditions such as the effectiveness of legal systems may also have relevance in so far as they may deter the more extreme forms of adverse worker behavior (theft and corruption), as well as national ownership of reform processes (41). Community issues include the number of patients, their level of education (42) and neediness (43), as well as their preferences and whether they are considered to resist or accept treatment (44). Finally, cultural factors include a tendency for workers in less secure settings to focus on immediate rather than long - term goals (13), loyalty to ones kin, responsibility to one's extended family, and the socioeconomic expectations made of those in certain positions (45). The qualitative findings show that the challenges of facility management go hand in hand with some of these issues, such as difficulties associated with maintaining discipline and criticizing older workers (37). The framework ascribes a central place to work motivation, which in public health literature is defined as an individual's degree of willingness to exert and maintain an effort towards organisational goals (29, p. 1255). It shows that the extent of alignment between a health worker's personal goals and those of their workplace has an effect on an individual's willingness to exert an effort at work (1). This was influenced by the qualitative work, which revealed primary health care workers were very clear about the goal of their facilities, by the work group climate assessment tool (46), and drew upon work undertaken with employees in the private sector in south africa (47). Another important factor that affects the ongoing motivation of health workers is their experience of work results or outcomes (29) and the feedback they receive . The framework shows the different modalities through which providers should receive feedback, even though the qualitative research indicated that some of the mechanisms do not work well . The study was carried out in lindi rural and mtwara rural districts in the south of mainland tanzania, nouna and solenzo districts in north west burkina faso, and builsa and kassena - nankana districts in north - eastern ghana . These are all deprived, rural areas where community livelihoods are vulnerable, infrastructure is poorly developed, and the working conditions of health staff are difficult . Whilst there are very important differences among ghana, tanzania, and burkina faso, at primary health care level in these disadvantaged districts there are also strong commonalities . In all three countries, maternal and child health services . Moreover, all the countries face critical shortages of skilled health staff and challenges to recruit and retain staff in rural facilities (4850). It should be noted that from the outset, it was assumed, based upon knowledge of the setting, that the providers in the study context were literate in either english (ghana), french (burkina faso), or kiswahili (tanzania). The first would explore changes in mnh provider knowledge as a result of the interventions . The second would monitor the overall performance of facilities through the use of a quality composite index . It was also agreed that the instrument would be implemented at baseline, before the interventions were introduced at facility level, and then at two subsequent intervals to capture possible changes in the shorter and longer term . It should be clarified that the instrument actually only affords the opportunity to monitor changes over time, through a comparison of the findings from subsequent rounds of data collection to the baseline . Furthermore, a plan was made for further qualitative research, in the form of in - depth interviews, to be conducted after the analysis of the data from each subsequent use of the instrument to facilitate a deeper understanding of any changes shown . The process of developing the instrument was informed by a literature review, reference to the qualmat conceptual framework and the aforementioned, preliminary qualitative research . Scientific literature was retrieved from pubmed, science direct, psycinfo, and the anthropological index online . Further literature was sought by means of a request to experts in this field . Following on from this, the project collaborators brainstormed to identify constructs where changes were expected due to the pilot interventions . These included contextual influences such as competence strengthening, work organization, quality of mnh services, and the role of performance and community relations . These were differentiated into attitudes (how mnh providers think and feel) and behavior (what they do) (30). Constructs covered by the former included self - efficacy, motivation, pride, and task meaningfulness . The latter included timeliness and attendance, behavior to patients, conscientiousness, and cooperation, which are all constructs that lend themselves to a degree of verification by others . For validation, the proposed constructs were presented to a panel of experts from the three countries involved . They were requested to rank them in terms of their influence on provider motivation and the extent to which they would be likely to be affected by the interventions . This was to ensure a sub - saharan lens was applied to the instrument from the outset (51) and to maximize the possibility of the instrument focusing upon constructs that were applicable in all settings . In a subsequent step, items were elaborated for each construct . As fontaine observed that issues of functional equivalence are not restricted to theoretical constructs but can also emerge in regards to measurement aspects (52), reference was made, wherever possible, to tools that had already been used in the context of developing countries . Care was taken to formulate the items in as straightforward a manner as possible given the intended target audience . A total of 35% of the items were negatively phrased to reduce response set bias (19). Such verification has been sought from the managers of health workers (30). However, in these study settings, facility managers were still involved in the delivery of clinical care . In addition, the strong influence of the hierarchy revealed by the preliminary qualitative research led to concerns that this mechanism could influence the findings . A peer was defined as another colleague based at the same facility who was also involved in the study . At this stage, senior health staff from the three countries informed of the project were sent the instrument . They were asked to reflect upon whether they thought it would actually measure what was intended and to fill it out . As a result several items were further simplified, but overall no constructs or items were questioned so confirmation of face validity was assumed . For both parts of the instrument, a four - point likert scale was used with the options: strongly agree, disagree, and disagree strongly. A four - point scale was thought to be relatively straightforward and therefore preferable for the target group . This decision was only taken after considering whether a don't know option might be necessary . Moreover, others observed that little use was made of this option even when it was available (19). The output was a final version for pre - test which contained 64 items for self - administration and 12 to be completed by one of the respondent's co - workers (peer) so that perceptions could be compared and limited verification undertaken . The instrument was introduced with a text adapted from that used in the hackman and oldham job diagnostic survey (36). Given the varying understandings of motivation that were observed in the qualitative research, and to avoid socially desired behaviour responses (38), the actual term up until now the development was informed as far as possible by input from all the three countries . For simplicity, ghana was selected as the country for the pretest . This was because the instrument could be applied in english which was the language in which the development had taken place . The pretest was conducted with 70 primary level health workers in the bongo district of the upper east region of ghana . This number of health workers was chosen as being just sufficient for the purpose of factor analysis (53), whilst also in keeping with the number of participants in the study overall . The pre - test revealed that the use of the likert scale required detailed introduction in the field, as expected . It was clarified to these health workers that there would be no feedback on the findings as they were sought for finalization of the instrument only . The respondents were assured about confidentiality . However, at this stage, to facilitate the work of the country researchers, the name of the staff member for peer assessment was written on the peer instrument . Although the peer that filled out this instrument did so anonymously, the issue of confidentiality was questioned by some of the respondents as they filled out this part of the instrument . To address this, a numbering system was used to pair up the self and peer responses when the final version was implemented . Item difficulty, that is, a measure of the ability of items to differentiate between subjects, was then calculated and 14 items with extreme difficulty (p<0.3 or p>0.7) were excluded (54). Internal consistency was judged by cronbach's coefficients using a criterion of 0.70 (55). For the overall instrument cronbach's was 0.871 and the split half reliability (spearman brown coefficient) was 0.737, both of which were considered to be satisfactory (54). However, the internal consistency of the single constructs was less convincing as shown in table 1 . Overview of cronbach's coefficients for constructs from pre - test data bennett et al . Argued in their pioneering work in jordan and georgia that cronbach's scores of 0.60 might also be considered acceptable in such pilot situations (30). Constructs included in the tool in kenya gave cronbach's coefficients of between 0.36 and 0.64 (19), although it should be qualified that their intention was to develop a short, practical tool meaning the number of items per construct was sometimes small, which has an effect upon such scores . The scree plot that was generated to explore the overall distribution of the data indicated a three - factorial structure . Despite some overlapping, the two main factors were broadly equivalent to the theoretically assumed dimensions management and performance . The items loading on management covered issues of work tools and staffing as well as promotions and further training . The items loading on performance had more to do with feedback from managers, co - workers, and the community as well as the reputation of the facility in general . Items loading on the third factor pertained to individual health workers and covered their self - efficacy, motivation, commitment, and behavior at work . All three factors relate back to the conceptual framework . A total of 14 items loaded to the management factor, giving a cronbach's of 0.786 and explaining 15.8% of the variance . A total of 13 items loaded to the performance factor, giving a cronbach's of 0.829 and explaining 14.6% of the variance . Finally, a total of 15 items loaded to the third factor, with generally lower loadings . The cronbach's was 0.815 and they explained 9.7% of the variance . Given that the pre - test version was considered too long, eight items that did not load highly (loading 0.3) to any of the three factors were also removed to achieve a lean and focused instrument . An overview of the items and constructs that did not perform well and thus removed to finalize the instrument is provided with a discussion in the next section . The final version of the instrument was then translated into french and kiswahili using the back translation method and further pre - testing for quality control . A short set of instructions was developed to ensure that a streamlined approach was taken to the implementation in all three countries . During development, it was flagged that collecting information on issues such as provider behavior from peers could be potentially sensitive . Cognitive dissonance refers to the way people alter their perceptions to reduce the discomfort experienced by holding conflicting views, such as knowing what one should do in a given situation, yet privately acknowledging what one really does (56). It was therefore agreed that feedback sessions would be arranged to present and discuss any differences that emerged between the self and peer assessments in an organized and constructive manner . As there had been errors with the use of excel to enter the pre - test data, an epi - data entry - mask was developed for use at baseline . The mask showed the coding of the responses very clearly next to each item (1=agree strongly; 2=agree; 3=disagree; 4=disagree strongly), and only allowed for one response per item or a zero if no response had been given . 12 facilities had previously been purposely selected according to certain criteria, including being based in a rural area (> 10 km from a town) whilst fulfilling certain basic requirements of infrastructure (e.g. Electricity supply) needed for the pilot interventions . No sampling was undertaken and all the mnh providers (83 in burkina faso, 50 in ghana, and 62 in tanzania) at these facilities were approached . All those agreeing to take part signed consent forms . Willingness to take part in the study was high in all the settings and nobody refused . Whilst these numbers are quite small, they are nonetheless sufficient to identify an effect, should one exist (57). On average it took 1.5 hours to introduce, explain, and administer both parts of the instrument . Mean responses to the three main aspects (management, performance, and individual) were compared across the demographic variables for any differences of significance . Un - weighted means were used as all the aspects were afforded the same importance . The mean was chosen rather than the sum to facilitate interpretation of scores, in which 2.5 is the neutral midpoint on the 4-point response set . The professions of the respondents were re - coded into lower level and more higher trained cadres, and the number of dependents that a respondent was financially responsible for were grouped (04, 59, 10 +) for analysis . Regression analysis was used with the respondents age, total years at school, length of time in their current level / position, and at their current rural workplace . Ethical clearance was granted by the institutional review board at the navrongo health research centre (i d nhrcirb 085) for ghana; the muhimbili university of health and allied sciences ethical review committee (ref no . Mu / aec / volxiii/96) for tanzania; and the ethics committee for health research for burkina faso (no.2010.05/cle / cr). Before presenting the final instrument, it is considered worthwhile to show and discuss which aspects did not perform well during the pre - testing . Table 2 shows that the constructs that did not perform well when used at primary care level in ghana included work meaningfulness, energy level / burnout, whether a provider feels valued / exploited, attitudes to patients, behavior to patients, conscientiousness, and timeliness / attendance . In addition, single items from the constructs self - efficacy, pride / shame, motivation, satisfaction, and cooperativeness also failed to perform well . Constructs and items that did not perform well psychometrically at the outset, it should be noted that nine of the 22 items that were eliminated had been newly developed based upon our preliminary qualitative research . It is likely that these items were under - researched . For example, with regard to the construct work meaningfulness, the thrust of the items would appear to be important as all respondents agreed with wanting to serve their people and provide them with important services . It is possible that positive bias, the wish to respond in a socially desired way (58) or cognitive dissonance may all have had an influence here . Items about dependability at work and doing things without being told were all responded to positively across the board despite the qualitative research having indicated that serious problems existed in precisely these areas . With regard to the construct energy level / burnout, the intention was to take this issue of concern up but not to make it a strong area of focus . As a result future efforts would be well advised to follow (32) and refer to the subscales of maslach's burnout inventory (59), as these have also been found to demonstrate reliability when used with health professionals in africa (60). This was despite the fact that the items had previously performed adequately in other settings . This result is perhaps not surprising, and suggests too narrow and undifferentiated a focus upon financial aspects . Conversely the aspect of motivation that did not perform well was the item that provoked the respondents by asking whether the salary was the main reason for them to do their work . The preliminary qualitative research endorses this view with some of the respondents in all three countries underlining that this was absolutely not the reason that they took up a health profession, whilst others blamed the providers they considered to be driven by financial rewards for the poor quality of care . The internal consistency of the items was unacceptable and the items also failed to load to any of the three factors . This construct sought to capture interpersonal aspects that were shown to be important for the quality of care in the preliminary qualitative phase . This was therefore a sensitive area, as were the points raised in the construct behavior to patients, such as politeness and whether a companion could stay with a woman in labor . Most of the statements made by providers about their motivation to help referred to the patients in their collective form as the community. Creating distance between oneself and the individuals that may suffer as a result of one's actions is a strategy people often use to reduce cognitive dissonance (61). Overall, a further nine of the 22 items that were eliminated from the self - administered instrument were negatively phrased . Culturally, it is also plausible that respondents might instinctively have been more likely to reject abruptly phrased negative statements . This phenomenon has been observed in cultures in which disagreement is not voiced directly (62). Whilst the use of the factor analysis facilitated the achievement of a parsimonious instrument, it was precisely some of the constructs that are most intricately linked to the concept of motivation that did not perform well and were removed . Had the development not been constrained by the tight project schedule, more work could have been usefully invested to achieve their inclusion . For example, further qualitative research could have been undertaken to better understand and refine the constructs, whilst the possible effect of cognitive dissonance could have been explored through carefully moderated discussions of alternative views (56). At pre - test the responses to all items about health worker behavior included in both the self - administered and the peer instruments were the same and, in both cases, overwhelmingly positive . This was despite indications to the contrary, for example, absenteeism and inter - disciplinary staff conflicts from the preliminary qualitative research . The sanctions that were further shown by this research to result from error making and the aforementioned confidentiality concerns may explain this . The final version of the instrument is shown in table 3, with an excerpt of the formatting provided in fig . Final version of the instrument with sources statements in bold were included in the peer instrument . The mean age was 32 years, with the majority of respondents aged between 25 and 35 years . Of those that were married, 16 lived in separation from their partner due to the rural nature of the posting, with seven living in separation from their children for the same reason . Sixty - five of the respondents may be classified as lower - level cadres (27 auxiliary midwives, 22 community outreach workers, and 16 auxiliary nurses), and 18 were more highly trained (16 registered nurses and 2 midwives). Seventy had been working in their positions and at their current health facility for 3 years or less . These findings bear testimony to the high levels of staff turnover and specific challenges of recruiting female providers to rural areas that were repeatedly raised by managers in the preliminary qualitative research . The latter was further lamented as having a negative effect upon the acceptability of mnh services . Many were also still single indicating that they were in the early stages of their career . The minority belonged to more highly trained cadres and very few actually originated from the rural areas in question . Almost half of those that are married live separated from their partner due to the rural nature of their posting . Most of the variables (see the demographic section of table 3 for an overview) did not have an effect upon the mean responses (not shown). As age had an effect in all three countries, it is discussed at a later stage . Table 4 shows that the longer a respondent has been at their current level, the more positive they become about the items pertaining to management items . It is possible that with time the respondents better understand the difficulties attached to, and efforts made to accomplish, managerial tasks in this context . Effect of time in current position on mean responses to the three main aspects in burkina faso f - values have been rounded up to two decimal places in ghana, all of the respondents were female . A total of 23 were married, 13 were single, with a further 14 either widowed or divorced . Of those that were married, two lived in separation from their partner due to the rural nature of the posting, and three lived in separation from all or some of their children for the same reason . The 15 community health nurses are considered to be a lower - level cadre in the ghanaian health system, although the entry condition of high school completion is higher for this group of cadres than in the other two countries . The mean number of years the respondents had been working at their current level was eight . The mean number of years they had been working at their current health facility was three, with a range of 112 years . The profile of these health workers suggest that in ghana there has been some success in recruiting more highly qualified staff to rural areas, although the total number of staff available at the facilities was lower overall . Moreover, the area of mnh was found to be exclusively staffed by women, with midwives sometimes also managing facilities . In these areas of rural ghana, older, more experienced staff were also found and very few were separated from family members due to their work . Community health nurses are generally recruited from, and sponsored by, districts according to need . Upon qualifying they most of the variables did not have an effect on the mean responses (not shown). Factors such as age, and time spent both in the current position and at the current facility were exceptions . Table 5 shows that, as in burkina faso, the longer the respondents work at their current level, the more positive their responses to the items about management aspects become . Again it is possible that with time the respondents appreciation of the efforts made by their managers increases . Effect of time in current position on mean responses to the three main aspects in ghana f - values have been rounded up to two decimal places table 6 shows that as the time spent at the current facility increases, the responses to the items about individual dimensions of motivation become significantly less critical . It is plausible that with time the respondents become more in tune with how the community appreciates them, and see the impact of their work on the catchment's health status more clearly, which could serve to reinforce their motivation, commitment, and job satisfaction . Effect of time at current facility on mean responses to the three main aspects in ghana f - values have been rounded up to two decimal places in tanzania, 43 of the respondents were female and 19 male . Thirty - nine were married, 20 were single, and a further three widowed . Five of those that were married lived in separation from their partner due to the rural nature of the posting . Four of these five also lived in separation from all or some of their children for the same reason . Forty - five of the respondents belonged to more highly trained professional groups (19 nurse midwives, 11 other types of nurse, 12 sub - cadres of physician, three health officers) and 17 were auxiliaries (medical or nurse attendants). The mean number of years spent working at the current level was nine, and at the current health facility seven . These findings suggest that whilst lower - level cadres were not in the majority as in burkina faso (78%), they nonetheless accounted for a reasonable proportion (27%) of the workforce at the primary level facilities involved . The majority (69%) of the providers were female, but there was some male involvement . The findings further indicated that tanzania, like ghana but unlike burkina faso, has managed to post health workers from rural areas back to their home districts . This could either indicate that rural postings are open - ended and staff infrequently transferred in the study area, or reflect some success in staff retention . Most of the variables did not have an effect upon the mean responses (not shown). The number of dependents the respondents were responsible for, age and the time spent at the current facility were exceptions . Table 7 shows that the greater the number of dependents the more positive the respondents were in their mean responses to the items about individual aspects, such as the level of effort made, their motivation, job satisfaction, and commitment to remain at the facility . This could be due to the importance of the respondent's income to support these dependents, or to the way their profession or standing in the community brings other benefits to these dependents, which serve to further motivate them . Effect of the number of dependents upon mean responses to the three main aspects in tanzania mean, standard deviation, and f - values have been rounded up to two decimal places table 8 shows that the longer the respondents remain at a facility the less critical their views about the management aspects . This could be because with time the respondents gain a greater understanding of the difficulties of managing a facility in such constrained, rural circumstances . Effect of time at current facility on mean responses to the three main aspects in tanzania f - values have been rounded up to two decimal places table 9 shows that age had a significant effect on the responses in all three countries . In burkina faso and tanzania, the older the respondents were, the more positive their responses to the items pertaining to performance aspects . This could be because they enjoy greater respect and appreciation of their work experience from the community and their co - workers . In ghana, the older the respondent were, the more positive their responses to the items pertaining to individual aspects . Older respondents may be more reconciled with, and settled in, their rural placement and enjoy respect and appreciation which serve to reinforce their motivation, commitment, and job satisfaction . Others have also suggested that job satisfaction improves as the worker's age increases (63). The significant effect that age had upon different aspects across the three countries f - values have been rounded up to two decimal places finally, the positive bias found in the peer results at pre - test were not replicated, reflecting that this was probably caused by concerns about confidentiality . Table 10 shows that at first use of the final instrument in burkina faso and tanzania, the peers were more critical in their assessment of their colleagues work behavior than the colleagues were about themselves . Four respondents from tanzania returned the peer part of the instrument without having filled it in . In ghana, the effect was different and the peers were less critical than the colleagues themselves . Differences between self and peer responses to the items about provider behavior from all three countries mean, standard deviation and f - values have been rounded up to two decimal places the preliminary qualitative work can help to explain these differences; in burkina faso, the findings thereof suggested an openness between immediate colleagues, quite in contrast to the respect demonstrated for those in higher positions . The team and its importance, from an individual's responsibilities especially when it came to sanctions for poor behavior or performance at work; in tanzania, the qualitative findings showed a degree of conflict between facility staff regarding the division of labor, as well as some snobbery between higher and lesser trained staff as also observed by others (18). The fact that four respondents did not fill out the peer part could indicate some discomfort with this type of assessment . In ghana, a strong degree of competitiveness was found between the staff, which could explain why the respondents were very strict in their assessment of their own work behavior . The results demonstrate that the instrument could be used in different languages with health workers of differing levels of schooling and training . The variables that had an effect upon the mean responses provide useful pointers on where to focus the planned, accompanying qualitative work so that any changes that the instrument may show over time can be better understood . There was never an intention to combine the datasets . However, there was an interest to see how well an instrument that was effectively finalized through a process of pre - testing held in one country of sub - saharan africa could be applied in another . The fact that the instrument was found to require extensive introduction at pre - test had been expected, but was also a source of concern as the general level of health worker training at primary care level in ghana was thought to be higher than in the other two countries . However, differences in the amount of introduction the instrument required in the field were not born out during their implementation in tanzania and burkina faso, despite the data confirming the respondents lower average years of total schooling and the lesser availability of more highly qualified staff . To further explore how the instruments had transferred, basic reliability testing was carried out using the baseline findings from tanzania and burkina faso . The cronbach's for the kiswahili version of the instrument was 0.820 overall, 0.633 for the management aspects, 0.619 for the performance aspects, and 0.753 for the individual aspects . The cronbach's for the french version was 0.808 overall, 0.615 for the management aspects, 0.516 for the performance aspects, and 0.762 for the individual health worker aspects . In both cases, the concerns about the effects of translating from english into kiswahili a bantu language with a completely different grammatical composition being greater than those of translating into french were not confirmed . In both cases, despite the care taken to translate the instruments using the back - translation method and undertake further pre - testing to ensure comprehensibility before use, some of the internal consistency was lost . This is probably because of the highly context - specific nature of the concept of motivation (62), which the qualitative findings also revealed . The particularly low result from the performance aspects in burkina faso could have its roots in important differences found in this area by the preliminary qualitative research . This showed the use of performance management tools to be far lower, and the acceptability of encouragement and prize - giving as ways to motivate staff to be far higher than amongst the respondents from ghana and tanzania . The mean age was 32 years, with the majority of respondents aged between 25 and 35 years . Of those that were married, 16 lived in separation from their partner due to the rural nature of the posting, with seven living in separation from their children for the same reason . Sixty - five of the respondents may be classified as lower - level cadres (27 auxiliary midwives, 22 community outreach workers, and 16 auxiliary nurses), and 18 were more highly trained (16 registered nurses and 2 midwives). Seventy had been working in their positions and at their current health facility for 3 years or less . These findings bear testimony to the high levels of staff turnover and specific challenges of recruiting female providers to rural areas that were repeatedly raised by managers in the preliminary qualitative research . The latter was further lamented as having a negative effect upon the acceptability of mnh services . Many were also still single indicating that they were in the early stages of their career . The minority belonged to more highly trained cadres and very few actually originated from the rural areas in question . Almost half of those that are married live separated from their partner due to the rural nature of their posting . Most of the variables (see the demographic section of table 3 for an overview) did not have an effect upon the mean responses (not shown). As age had an effect in all three countries, it is discussed at a later stage . Table 4 shows that the longer a respondent has been at their current level, the more positive they become about the items pertaining to management items . It is possible that with time the respondents better understand the difficulties attached to, and efforts made to accomplish, managerial tasks in this context . Effect of time in current position on mean responses to the three main aspects in burkina faso f - values have been rounded up to two decimal places a total of 23 were married, 13 were single, with a further 14 either widowed or divorced . Of those that were married, two lived in separation from their partner due to the rural nature of the posting, and three lived in separation from all or some of their children for the same reason . The 15 community health nurses are considered to be a lower - level cadre in the ghanaian health system, although the entry condition of high school completion is higher for this group of cadres than in the other two countries . The mean number of years the respondents had been working at their current level was eight . The mean number of years they had been working at their current health facility was three, with a range of 112 years . The profile of these health workers suggest that in ghana there has been some success in recruiting more highly qualified staff to rural areas, although the total number of staff available at the facilities was lower overall . Moreover, the area of mnh was found to be exclusively staffed by women, with midwives sometimes also managing facilities . In these areas of rural ghana, older, more experienced staff were also found and very few were separated from family members due to their work . Community health nurses are generally recruited from, and sponsored by, districts according to need . Upon qualifying they most of the variables did not have an effect on the mean responses (not shown). Factors such as age, and time spent both in the current position and at the current facility were exceptions . Table 5 shows that, as in burkina faso, the longer the respondents work at their current level, the more positive their responses to the items about management aspects become . Again it is possible that with time the respondents appreciation of the efforts made by their managers increases . Effect of time in current position on mean responses to the three main aspects in ghana f - values have been rounded up to two decimal places table 6 shows that as the time spent at the current facility increases, the responses to the items about individual dimensions of motivation become significantly less critical . It is plausible that with time the respondents become more in tune with how the community appreciates them, and see the impact of their work on the catchment's health status more clearly, which could serve to reinforce their motivation, commitment, and job satisfaction . Effect of time at current facility on mean responses to the three main aspects in ghana f - values have been rounded up to two decimal places thirty - nine were married, 20 were single, and a further three widowed . Five of those that were married lived in separation from their partner due to the rural nature of the posting . Four of these five also lived in separation from all or some of their children for the same reason . Forty - five of the respondents belonged to more highly trained professional groups (19 nurse midwives, 11 other types of nurse, 12 sub - cadres of physician, three health officers) and 17 were auxiliaries (medical or nurse attendants). The mean number of years spent working at the current level was nine, and at the current health facility seven . These findings suggest that whilst lower - level cadres were not in the majority as in burkina faso (78%), they nonetheless accounted for a reasonable proportion (27%) of the workforce at the primary level facilities involved . The majority (69%) of the providers were female, but there was some male involvement . The findings further indicated that tanzania, like ghana but unlike burkina faso, has managed to post health workers from rural areas back to their home districts . This could either indicate that rural postings are open - ended and staff infrequently transferred in the study area, or reflect some success in staff retention . Most of the variables did not have an effect upon the mean responses (not shown). The number of dependents the respondents were responsible for, age and the time spent at the current facility were exceptions . Table 7 shows that the greater the number of dependents the more positive the respondents were in their mean responses to the items about individual aspects, such as the level of effort made, their motivation, job satisfaction, and commitment to remain at the facility . This could be due to the importance of the respondent's income to support these dependents, or to the way their profession or standing in the community brings other benefits to these dependents, which serve to further motivate them . Effect of the number of dependents upon mean responses to the three main aspects in tanzania mean, standard deviation, and f - values have been rounded up to two decimal places table 8 shows that the longer the respondents remain at a facility the less critical their views about the management aspects . This could be because with time the respondents gain a greater understanding of the difficulties of managing a facility in such constrained, rural circumstances . Effect of time at current facility on mean responses to the three main aspects in tanzania f - values have been rounded up to two decimal places table 9 shows that age had a significant effect on the responses in all three countries . In burkina faso and tanzania, the older the respondents were, the more positive their responses to the items pertaining to performance aspects . This could be because they enjoy greater respect and appreciation of their work experience from the community and their co - workers . In ghana, the older the respondent were, the more positive their responses to the items pertaining to individual aspects . Older respondents may be more reconciled with, and settled in, their rural placement and enjoy respect and appreciation which serve to reinforce their motivation, commitment, and job satisfaction . Others have also suggested that job satisfaction improves as the worker's age increases (63). The significant effect that age had upon different aspects across the three countries f - values have been rounded up to two decimal places finally, the positive bias found in the peer results at pre - test were not replicated, reflecting that this was probably caused by concerns about confidentiality . Table 10 shows that at first use of the final instrument in burkina faso and tanzania, the peers were more critical in their assessment of their colleagues work behavior than the colleagues were about themselves . Four respondents from tanzania returned the peer part of the instrument without having filled it in . In ghana, the effect was different and the peers were less critical than the colleagues themselves . Differences between self and peer responses to the items about provider behavior from all three countries mean, standard deviation and f - values have been rounded up to two decimal places the preliminary qualitative work can help to explain these differences; in burkina faso, the findings thereof suggested an openness between immediate colleagues, quite in contrast to the respect demonstrated for those in higher positions . The team and its importance, from an individual's responsibilities especially when it came to sanctions for poor behavior or performance at work; in tanzania, the qualitative findings showed a degree of conflict between facility staff regarding the division of labor, as well as some snobbery between higher and lesser trained staff as also observed by others (18). The fact that four respondents did not fill out the peer part a strong degree of competitiveness was found between the staff, which could explain why the respondents were very strict in their assessment of their own work behavior . The results demonstrate that the instrument could be used in different languages with health workers of differing levels of schooling and training . The variables that had an effect upon the mean responses provide useful pointers on where to focus the planned, accompanying qualitative work so that any changes that the instrument may show over time can be better understood . However, there was an interest to see how well an instrument that was effectively finalized through a process of pre - testing held in one country of sub - saharan africa could be applied in another . The fact that the instrument was found to require extensive introduction at pre - test had been expected, but was also a source of concern as the general level of health worker training at primary care level in ghana was thought to be higher than in the other two countries . However, differences in the amount of introduction the instrument required in the field were not born out during their implementation in tanzania and burkina faso, despite the data confirming the respondents lower average years of total schooling and the lesser availability of more highly qualified staff . To further explore how the instruments had transferred, basic reliability testing was carried out using the baseline findings from tanzania and burkina faso . The cronbach's for the kiswahili version of the instrument was 0.820 overall, 0.633 for the management aspects, 0.619 for the performance aspects, and 0.753 for the individual aspects . The cronbach's for the french version was 0.808 overall, 0.615 for the management aspects, 0.516 for the performance aspects, and 0.762 for the individual health worker aspects . In both cases, the concerns about the effects of translating from english into kiswahili a bantu language with a completely different grammatical composition being greater than those of translating into french were not confirmed . In both cases, despite the care taken to translate the instruments using the back - translation method and undertake further pre - testing to ensure comprehensibility before use, some of the internal consistency was lost . This is probably because of the highly context - specific nature of the concept of motivation (62), which the qualitative findings also revealed . The particularly low result from the performance aspects in burkina faso could have its roots in important differences found in this area by the preliminary qualitative research . This showed the use of performance management tools to be far lower, and the acceptability of encouragement and prize - giving as ways to motivate staff to be far higher than amongst the respondents from ghana and tanzania . There was never an intention to combine the datasets . However, there was an interest to see how well an instrument that was effectively finalized through a process of pre - testing held in one country of sub - saharan africa could be applied in another . The fact that the instrument was found to require extensive introduction at pre - test had been expected, but was also a source of concern as the general level of health worker training at primary care level in ghana was thought to be higher than in the other two countries . However, differences in the amount of introduction the instrument required in the field were not born out during their implementation in tanzania and burkina faso, despite the data confirming the respondents lower average years of total schooling and the lesser availability of more highly qualified staff . To further explore how the instruments had transferred, basic reliability testing was carried out using the baseline findings from tanzania and burkina faso . The cronbach's for the kiswahili version of the instrument was 0.820 overall, 0.633 for the management aspects, 0.619 for the performance aspects, and 0.753 for the individual aspects . The cronbach's for the french version was 0.808 overall, 0.615 for the management aspects, 0.516 for the performance aspects, and 0.762 for the individual health worker aspects . In both cases, the concerns about the effects of translating from english into kiswahili a bantu language with a completely different grammatical composition being greater than those of translating into french were not confirmed . In both cases, despite the care taken to translate the instruments using the back - translation method and undertake further pre - testing to ensure comprehensibility before use, some of the internal consistency was lost . This is probably because of the highly context - specific nature of the concept of motivation (62), which the qualitative findings also revealed . The particularly low result from the performance aspects in burkina faso could have its roots in important differences found in this area by the preliminary qualitative research . This showed the use of performance management tools to be far lower, and the acceptability of encouragement and prize - giving as ways to motivate staff to be far higher than amongst the respondents from ghana and tanzania . The results show that it is possible to undertake work of this nature at primary health care level, particularly if an effort is made to keep the formulation of the instrument as straightforward as possible and if the introduction thereof is undertaken in an appropriate and detailed manner . However, such instruments require very lengthy preparatory periods and ongoing qualitative research during development to clarify and respond to areas of difficulty . A more extensive review of the anthropological literature and greater involvement of anthropologists in any future such endeavors is highly recommended . The effort needed to adapt such an instrument for use in different countries within the region of sub - saharan africa should not be underestimated . The qualmat research project funded as part of the 7th framework programme of the european union (grant agreement 22982) is a collaboration between the centre de recherche en sant de nouna (burkina faso), ghent university (belgium), heidelberg university (germany), karolinska institute (sweden), muhimbili university of health and allied sciences (tanzania), and navrongo health research centre (ghana). The overall objective of this research is to improve the motivation and performance of health workers and ultimately the quality of pre - natal and maternal care services . The intervention packages include the development and implementation of a system of performance based incentives and a computer - assisted cdss based on who guidelines . The interventions are evaluated in a pre - post controlled study design in rural burkina faso, ghana, and tanzania between the years 2009 and 2014 . The authors have not received any funding or benefits from industry or elsewhere to conduct this study.
|
The spanish reference laboratory for meningococci routinely receives meningococci isolated from sterile sites for serogrouping, serotyping, and serosubtyping . From january 1995 to november 2000 (just before the new c conjugate vaccine was routinely introduced), the laboratory received 2,975 meningococcal strains to be characterized by serotyping and serosubtyping with monoclonal antibodies (8). The b:2b: p1.2,5 and b:2b: p1.2 antigenic combinations were found in 18 isolates (table 1). All these strains were suspected of belonging to the a4 lineage and were fully characterized by pfge and mlst as described previously (2,11); results were compared with those obtained among the c:2b: p1.2,5 epidemic strains . Two additional strains characterized as b:4:p1.2,5 were also included to determine if these antigenic combinations might be caused by similar genetics events . Nr, pulse types not related to those found in c:2b: p1.2,5 strains . Fifteen (83.3%) meningococci showed sequence types identified as representative of the a4 clonal lineage; this lineage also represents the genotype of the c:2b: p1.2,5 epidemic strain . The proportions of isolates belonging to the a4 clonal lineage were 75% and 85%, respectively, in both b:2b: p1.2 and b:2b: p1.2,5 strains . Seven of these 15 meningococci characterized as serogroup b belonging to the a4 lineage were isolated from patients who had never been immunized with the a+c polysaccharide vaccine . Three group b strains that were suspected by antigenic characterization of belonging to the a4 complex showed nonrelated sequence types (table 1). In a different study (data not shown), most of the c:2b: p1.2,5 epidemic strains grouped in two closely related pattern profiles by pfge: pt7 and pt8 . Table 1 shows the pfge pattern profiles of the b:2b: p1.2,5 strains . Some strains showed minor pattern profiles already present among c:2b: p1.2,5 isolates (pt1, pt4, and pt38, all of them closely related to pt7 and pt8). Those strains showing pfge pattern profiles that we did not find among the c:2b: p1.2,5 epidemic strain belonged to lineages different than a4 (table 1). On the other hand, the b:4:p1.2,5 strains showed the same sequence type, st33, associated with et5 . The frequency of the c:2b: p1.2,5 and b:2b: p1.2,5 meningococci of the a4 lineage is shown in table 2 . Recombinant strains expressing serogroup b or c have been previously described as resulting from a capsule - switching genetic mechanism (9,10). A similar event with w135 isolates has been recently described (12). However, the relevance of this phenomenon has not been fully described . In our surveillance analysis, the group b strains of the a4 lineage appeared before the vaccination campaigns; this finding differs from results of an analysis conducted in canada after a similar surveillance (10). Our findings show that those genetic variants are being produced in the meningococcal population at random and that a variant s appearance is not necessarily related to mass immunization campaigns . In fact, these group b meningococci belonging to the a4 lineage were also isolated in some of the regions that used the vaccine on a small scale (13). However, the increased number of these b:2b: p1.2,5 strains from the a4 lineage during the study period might indicate a positive selection caused by mass immunization campaigns during 1996 and 1997 (table 2). Seven (50%) of these strains were isolated from patients who did not receive a+c vaccine, indicating that the individual immune status should not be a critical factor for developing meningococcal disease with these serogroup b strains of the a4 lineage rather than other clonal lineages . Nasopharingeal competition might be an important factor in the spread of these group b strains, as has been suggested to explain the spread of serogroup b meningococci belonging to the et15 lineage (10). Theoretically, however, the c:2b strains of the a4 lineage and the b:2b meningococci also belonging to the a4 lineage should have a very similar genetic background with the exception of a locus in the capsular operon (9). In fact, both types of strains showed not only the same or similar sequence type by mlst but also a very similar genetic profile by pfge (data not shown). Nevertheless, those strains with a group c polysaccharide capsule maintained a major epidemic even after a mass immunization campaign (table 2) and even when these group c strains were not common in the carrier population (14). Whether a similar observation can be made for the serogroup b strains belonging to the a4 clonal lineage is not clear; the small increase in these serogroup b strains does not appear to be linked with increased epidemic potential . Thus, the capsular polysaccharide appears to be the only differing factor between these two types of meningococci . Once again, the high number of serogroup b strains in asymptomatic carrier population (14) associated with a natural immunity, might partially explain the different epidemic potential of the two genotypes . However, the nature of the group c polysaccharide alone does not explain why c:2b: p1.2,5 strains were responsible for an important epidemic wave in spain in 19961997 . Some other factors, such as the amount of polysaccharide, might explain differences in virulence (15). Two meningococci characterized as b:4:p1.2,5 were included to analyze if some other antigenic combinations might appear as result of different genetic events . This possibility was not confirmed in our study but should be more accurately analyzed in the future . In 2000, a new increase in cases of group c meningococcal disease was detected in some regions of spain (6). Because of these data, spanish health authorities made the decision to include a new group c conjugate vaccine in the routine infant immunization schedule beginning in autumn 2000 . How the two different vaccines against group c meningococci (polysaccharide and conjugate) influence the selection of serogroup b belonging to the a4 lineage strains in spain that have had a capsular - switching event would be an interesting future topic of research.
|
Most hemiplegic patients who suffer from stroke experience restrictions on mobility at home and in the community, and they especially have difficulty with independent walking1 . Turnbull et al.2 suggested that the recovery of gait ability is an important goal of physical therapy for a stroke patient, because gait is an important element of functional independence . With regard to this, mumman3 suggest that the biggest loss after stroke is gait ability, and hemiplegic patients show disorders in the selective ability of regulated and coordinated movements, which results in a slow gait velocity and compensatory movements by the lower extremity of the unaffected side . Perry4 also suggested that hemiplegic patients show a short stride length and slow gait velocity for result of damage to the joint and to the regulatory function of the muscles that are necessary for normal gait . Furthermore, gait is closely connected with the environment, since gait adapts and is modified to overcome obstacles and the varied geography that are faced during walking5 . Due to central nervous system damage, stroke patients show muscle weakness, abnormal muscle tone, and disorders of balance and posture control, which result in difficulty in the control of movement6 . For these reasons, problems occur with the quality and adaptation of the gait pattern, resulting from imbalance in the low extremity stance phase of the affected side and of the low extremity stance phase of the unaffected side, a decline in cadence and gait velocity, asymmetrical weight distribution, and a difference between step length and stride length7, 8 . In particular, gait disorder after stroke reduces the functional independence level and results in a negative prognosis, which is a reason why regaining gait ability is a critical element directly connected with patients independence and is one of the goals of rehabilitation9 . Neurotherapy methods, which include bobath therapy and proprioceptive neuromuscular facilitation, mainly focus on the control of abnormal muscle tone and of the asymmetrical movement which leads to gait disorder10 . These methods require many therapists and time, because they mainly consist of muscle strengthening movements in a static position through manual handling by a therapist . However, studies on the effects of neurophysiotherapy performed by therapist handling are inconclusive . Therefore, we hypothesized that gait function would improve with pelvic control following a hip extensor strengthening exercise (hese) program for the paretic lower extremity . We examined whether the hese program promotes functional improvement of the paretic lower extremity of stroke patients . The participants in this study were fifteen hemiplegic patients who had been diagnosed with stroke (table 1table 1.clinical characteristics of the hemiplegic stroke patientsage (yr)gender (%) height (cm)weight (kg)cause of disease (%) as (%) k - mmse (score)time post- stroke (mo)44.2 3.9 m 10 (66.7)f 5 (33.3)168.5 2.168.5 3.5 in 12 (80.0)he 3 (20.0)rt 7 (46.7)lt 8 (53.3)26.5 2.520.5 m: male; f: female; in: infarction; he: hemorrhage; as: affected side; rt and lt: right and left side; k - mmse: korean version of mini mental status examination) who were receiving inpatient or outpatient treatment at hospital p rehabilitation center . All the subjects participated in a four - week six - method hip extensor strengthening exercise (hese) program . This program was performed by a therapist manipulating the subjects for about half an hour a day in the supine position, side - lying position, and prone position on a treatment table . The hese program comprised six steps: data are presented as means se . M: male; f: female; in: infarction; he: hemorrhage; as: affected side; rt and lt: right and left side; k - mmse: korean version of mini mental status examination 1 . Hip extension and posterior tilt movement; 2 . Hip joint and pelvis movement using a therapeutic ball; 4 . Hip joint and pelvis movement hip joint extension muscle strengthening movement in the side - lying position; and 6 . Each session consisted of three sets of 15 performances of the 6-step program lasting about half an hour, with 30 seconds of relaxation time between the sets11 . Each participant was assessed by a physical therapist before and after the intervention in order to examine its effects on gait performance and stability . The 10-m walking velocity test and the berg balance scale (bbs) were used to evaluate the changes in gait performance and stability . Bbs is a widely used clinical test which was developed to evaluate both the static and kinetic balance abilities of stroke patients . It consists of 14 assessment items: sitting to standing, standing without support, sitting without support, standing to sitting, transfers, standing with eyes closed, performing the romberg test with eyes open, reaching, turning and looking over the shoulder, making 360 turn to the right and left, and standing on one leg . It has been shown that subjects with bbs scores> 41 have a low risk of fall, medium risk of fall for bbs scores of 2140, and high risk of fall for bbs scores of less than 20 . Bbs can be used to evaluate the balance ability of patients with hemiplegia caused either by senile disorder or stroke12 . A gaitrite (gait trainer 2 analysis system, usa) was used to measure the spatiotemporal variables of gait (walking speed, walking cycle, affected side stance phase, stride length) and the symmetry index (stance phase, stride length). Subjects performed three trials for both pre- and post - test measurements . When gaitrite was used in the study, it helped the participants observe in real time their feet touching the ground on a monitor . Gaitrite can compare gait velocity (meter / sec), gait cycle (cycle / sec), and the symmetry index (%) of the stance phase and the swing phase, with normal category values on a histogram13 . Statistical analyses were performed using spss version 20.0 . The shapiro - wilks test was used to verify the general and medical characteristics and the measured variables displayed a normal distribution . The chi - square was used to compare the general and medical characteristics of the participants and the paired t - test was conducted to compare the results of before and after the treatment . The formulas for the symmetry indexes of the stance phase and stride length used in the study were: symmetric index of length (%) = non - affected side low extremity length (cm)/affected side low extremity length (cm) 100%; and symmetric index of the stance phase (%) = affected side low extremity stance phase (sec)/non - affected side low extremity stance phase (sec) 100% . The protocol of this study was approved by the committee of ethics in research of the university of yongin, in accordance with the terms of resolution 5 - 1 - 20, december 2006 . Furthermore, all subjects provided their informed consent to participation in the present study . Table 1 summarizes the clinical characteristics of the subjects . Walking speed, stance phase and stride length of the affected side, and the symmetry index of the stance phase significantly improved after the hese program (p<0.05) (table 2table 2.effects of hip extensor strengthening exercise program on the hemiplegic stroke patientsvariableshemiplegic stroke patientspre - hesepost - hesewalking speed (m / sec)0.5 0.00.6 0.0walking cycle (c / sec)0.6 0.00.6 0.0as stance phase (sec/%)47.0 1.248.5 1.1as stride length (cm)38.1 3.041.8 2.8si of stance phase (%) 90.0 4.294.0 4.0si of stride length (%) 90.6 6.493.1 5.710wvt (m / sec)29.8 11.829.2 11.6bbs (score)37.1 2.537.3 2.8data are presented as means se . Hese: hip extensor strengthening exercise; as: affected side; si: symmetry index; 10wvt: 10 m walking velocity test; bbs: berg balance scale . *: significantly different from pre - hese, p<0.05). Hese: hip extensor strengthening exercise; as: affected side; si: symmetry index; 10wvt: 10 m walking velocity test; bbs: berg balance scale . *: significantly different from pre - hese, p<0.05 the distinctive gait patterns of hemiplegic patients include a slow gait cycle and velocity, differences between the affected side and unaffected side step length, a short stance phase, and a relatively long swing phase on the affected side14, 15 . Restoration of the ability to gait is a very important goal for stroke patients, and therefore, evaluating gait patterns of hemiplegic patients and analyzing the related elements is meaningful16, 17 . To contribute to the treatment of problems with gait, this study aimed to discover the effects of hip extension muscle strengthening on gait ability and stable gait . In the study, the experimental group showed significant improvements in walking speed, the affected side stance phase, stride length, and the stance phase symmetry index after the training . The hese program conducted for the hemiplegic patients contributed to improvements in walking speed, stance phase, stride length, and the stance phase symmetry index . The treatment with respect to movement after the acute phase improved hemiplegic patients gait and function, similar to the results of a previous study18 . In addition, in order to discover effective movement methods for hemiplegic patients besides general movement treatment, a muscle strengthening movement program using manipulations by a therapist was performed11 . In that study of the effects of leg muscle improvement movement and an aerobic movement program on muscle weakness and stiffness, thirteen stroke patients at least nine months after stroke onset were the subjects of a ten - week program11 . For about half an hour, the experimental group carried out resistance movements using a sand pocket, and therabands of eight different elasticities, and also received a therapist s handling for the hip flexor and extensor, knee flexor and extensor, and ankle flexor and extensor muscles . There was an increase in strength of about 42.3% in the leg muscles, and gait velocity also increased11 . Moreover, in a study of the effects of gradual resistance movement on the leg muscle, involving twenty chronic stroke patients, gradual resistance movement by centripetal and centrifugal movement was conducted for eight weeks19 . As measured by computed tomography, there was a decline in hypoderm and the amount of body fat and an increase in midthigh muscle area of the femoral region19 . There was also an increase of the femoral muscles of about 9.04.5%, and of gait velocity of about 48%19 . Considering the results of previous studies of movement programs using gradual muscle movement and therapist handling, it seems that a treatment program using hip joint muscle strengthening movements and therapist handling provides an appropriate environment for improvement of gait ability and for motivation of patients . Wade et al.20 reported that the 10-m walking velocity test for hemiplegic patients is a simple, objective measurement for evaluating functional recovery . However, sharp and brouwer21 reported that after a six - week intervention of knee joint isokinetic resistance movement involving fifteen chronic stroke patients, muscle power and gait velocity improved, whereas walking up and down stairs and tug times showed no significant differences with respect to functional performance ability . Page22 reported that the effect of movement treatment on stroke patients depends on the treatment time, the movement form, and the patient s positive participation . Hendricks et al.23 suggested that the degree of recovery from stroke weakens as time passes and that the recovery of movement regulation ability occurs no later than three months after a stroke . A limitation of their study was that the disease period of the participants ranged from 6 months to 91 months, and no improvement of movement regulation function resulted . The reason why there was no significant improvement in all test items after four weeks of movement therapy was the order of movement and other factors during the intervention . To elicit an improvement in hemiplegic patients stable gait, a much longer treatment period is required, and the stage and duration of stroke and a variety of forms of movement also need to be considered . From this it can be understood that for hip joint muscle power strengthening movements to influence hemiplegic patients stable gait, several things are required at the same time: a long enough treatment period, a variety of movements and muscle power strengthening movements of the hip joint, knee joint, and ankle joint . Despite positive changes, the ability to generalize the present study s results to every hemiplegic patient is limited . Further study of more methods for improving stable gait through hip flexor muscle power strengthening movements is required, with larger numbers of participants, a longer treatment period, and a follow - up after the treatment . Furthermore, scientific multi - dimensional investigations on the effects of neurophysiotherapy related to gait and muscle function should be conducted for stroke patients24,25,26,27,28,29,30.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.