text
stringlengths 0
868k
|
|---|
Attention deficit hyperactivity disorder (adhd) is a common disorder that affects 5.3% to 20% of the children worldwide . Us studies have shown a prevalence of 8.7% in 815 years old (froehlich et al . 2007). Specifically in india, studies in hospital or outpatient clinics, with referral bias, suggest prevalence of 5.2% to 29.5% [36]. The condition generally leads to poor academic performance and problems with behavior at home and school . Children with this disorder often have other problems such as anxiety, depression, and learning disabilities . As they reach adolescence, these children are also at greater risk of drug and alcohol abuse and other issues such as increased rate of motor vehicle accidents . Children with adhd also suffer from higher levels of temper - tantrums, tics, and problems with family and peer relationships . If the condition remains untreated, it can continue into adulthood and prevent the person from achieving their maximum potential . With proper medical attention and care, children can generally learn to cope with their disorder . Both medication and behavioral therapy may help . Drugs, which usually consist of stimulants such as methylphenidate and amphetamine - dextroamphetamine, are either expensive or not available in india . Furthermore, these medications require close medical attention, which is also a scarce and expensive resource . Indeed, while medication combined with behavioral therapy has been shown to be the most effective therapy after 1 year and 2 years in the multimodal treatment study of children with attention deficit hyperactivity disorder conducted by nimh, longer term followup suggests medications appear to have little additional benefit . Unfortunately, there is a lack of similar studies in india regarding the use of stimulant medication, or multimodal therapy . Clearly, the use of a low - cost, effective method for identifying children with adhd and providing them with some form of behavioral therapy would go a long way to improve the quality of life for a significant portion of the school age population . Some approaches, such as the use of play therapy and physical exercise, would be easy to adapt . Ideally, strategies that are culturally familiar would be more acceptable and easier to incorporate . There is strong belief but limited evidence to show that yoga and meditation help focus and attention . Pilot studies using this as family - based therapy for adhd in 8 boys have been reported to show promise . Additional theoretical basis may be the increase in dopamine release in the cns from yoga . In children with adhd, reduced dopamine levels are seen in the cns, and strategies to regulate these levels are suggested as possible therapies . To make this affordable, a peer - mediated approach utilizing normal high school volunteers was planned . Indeed, limited studies in small settings have shown peer tutoring does help children with adhd [12, 13]. Furthermore, to allow maximum adherence, immersion in the regular school day was planned . We report efficacy of a six - week multimodal peer - mediated behavioral program that includes yoga in improving performance and behavioral scores as measured by the vanderbilt . Additionally, the ability of peers to instruct and children with adhd to learn yoga was evaluated . Finally, whether this embedded program could remain functional based solely on local resources a program was designed to assess prevalence of adhd in india and perform a needs assessment in the town of najibabad 250 kilometers north of delhi . The boys and girls schools in this town of 150,000 in north up accounted for more than 40% of the town's children, from all socioeconomic backgrounds . The majority of children came from urban or semiurban areas (87.2%), and 56% were hindus while 42% muslim . All 910 children ageing from 6 to 11 were screened for adhd using the initial teacher vanderbilt assessment [6, 7]. The vanderbilt questionnaires were translated into hindi by trained teachers . While it was designed in the english language and is used prevalently in western countries, this score has been used in other non - english speaking countries . Furthermore, studies analyzing diagnosis of adhd in children in india using the vanderbilt have been performed . Found that the vanderbilt could be used to identify children with adhd, though some minor discrepancies between parents and teachers reporting information about the child were noted . The performance impairment scores on the questionnaire are based on 8 areas: reading, mathematics, written expression, relationship with peers, following directions, disrupting class, assignment completion, and organizational skills . Each category is scored from a 1 to 5 with a 4 or 5 indicating impairment, and hence abnormal scores . Those with impairment had the parent vanderbilt questionnaire completed . From this initial screen, 156 with poor school performance were identified, and the combined parent and teacher scores as well as a neurodevelopmental assessment by neurodevelopmental pediatrician identified 80 children (8.8%) diagnosed with adhd and further categorized into either combined, predominantly inattentive, or predominantly hyperactive / impulsive types . The study was approved by the school board of mdkv and registered under clinicaltrials.gov (nct01012778). These children were evaluated in a medical camp for comorbidities, and additional programs to educate families and teachers on the problems of adhd were conducted . Furthermore, all yoga postures were designed by designated yoga teachers to ensure that they have no real physical strain beyond normal physical activities . This was a multimodal program that incorporated yoga postures, meditation program, and behavioral play therapy in 1-hour sessions during the school day . Postures and simple breathing techniques that would be appropriate for children between 6 and 11 years were used . The next 30 minutes were devoted to behavioral therapy and then 5 minutes for discussion about the past sessions or any questions the children might have . The children were organized into manageable groups of 8 to 12 children and also divided by gender to keep with school custom . Teachers played no direct role in the actual therapy of the children but supervised the classroom, and logged children's behavior using a simple scale . High school volunteers were selected after being recommended by their teachers for excelling in academics and leadership qualities . A further criterion was that they could take on this extra responsibility without adversely affecting their academic performance . The volunteers were trained and assessed over 3 weeks until they became proficient in yoga, meditation, and peer mentoring during the behavioral therapy . From the fifth week, the high school student volunteers managed the program alone . In the sixth week of the program, children's yoga performance was measured using a yoga posture score (table 1). In this system in each of the 5 aspects of the yoga posture, a child could score from 0 to 2 . A score of 0 indicated that the specific aspect of the posture was not recognized and the child did not even make an attempt . A score of 1 indicated that the child attempted that aspect of the posture but performed it inadequately . Finally, a score of 2 indicated that the child recognized that aspect of the posture and performed it at an adequate level . Each child was scored independently by the 2 observers and the mean of the scores used . In order to measure the child's ability to perform breathing portion of meditation, the duration for which they could maintain the humming sound on exhalation was recorded . This was based on the principle that improvement from breathing techniques used in meditation leads to prolonged but controlled exhalation . All children were evaluated in the same week and were measured in three trials using a simple stopwatch . Our measurements in yoga and meditation were compared against a control group of 3 healthy children aged 711 who participated in the 6-week program alongside the children with adhd . In addition, the children were assessed with a follow - up teacher and parent vanderbilt . This included performance impairment score by the teachers, allowing comparison from baseline for both the total number of categories still impaired and average performance impairment score, as well as behavioral scores . Using the change in the average performance impairment score, percent improvement was calculated per child . Completed teacher and parent vanderbilt follow - up questionnaires were collected for 70 of the 76 children who joined the program . The collected data contained 26 females and 44 males, a gender ratio similar to that seen in the us . The average age for females was 8.27 sd 1.8, while the average age for males was 8.47 sd 1.3 . Furthermore, the parent and teacher vanderbilt scores were used to subcategorize 70 of the children into combined, hyperactive / impulsive, and inattentive . Of these, 47 of the children (67.1%) were combined, 8 of the children (11.4%) were predominantly hyperactive / impulsive, and finally 15 of the children (21.4%) were predominantly inattentive . Improvement of performance impairment scores was noted in a large number of children, specifically in the poor academic and social performance categories . The average performance impairment score showed a significant decrease from an average baseline score of 5.72 sd 1.78 to 1.41 sd 2.13 on followup (p <0.001 paired t - test). More importantly, 57 of the 63 (90.5%) children had some form of improvement in their performance impairment from this therapy, and more than half the students, 35 of the 63 (55.5%) students, improved to the normal range with no performance impairment reported by teachers . The performance impairment score change did not vary by gender, age, or initial adhd subtype (figure 1). Also, final teacher and parent behavioral scores demonstrated an alternative measure of improvement to the performance impairment scores . 25 of the 64 children (39.1%) had behavioral scores shift from the abnormal to normal range as rated by parents and teachers . Yoga posture scores (ypss) and meditation values were also collected for the 63 children . Children were measured on their improvement of yoga posture scores from a baseline score of 40 . All the children improved by an average of 29.5 points or an improvement of 73.9% sd 15.5 . This was similar to the control group of 3 children also taught yoga and meditation . There was weaker interobserver correlation at r 0.81 than during training of observers (r 0.97) but may partly be explained by day to day variance as measurements were not performed concurrently . The improvement in yoga posture scores from baseline did not vary by gender, adhd subtype, religion, or most importantly their performance impairment level (r = 0) (figure 2). Children could maintain the humming sound / exhaling of breath for an average time of 7.85s sd 3.16 by 6 weeks . Because this had not been performed before, we had no exact expectation for the normal range of child after being taught meditation . We did find, however, that their performance was similar to the control group of 3 children . Again, this trend did not have statistical significance (p = 0.4, anova, r = 0.1). Gender and adhd subtype had no correlation with the children's meditation scores except for a subgroup of girls who were diagnosed with the adhd combined subtype who had a higher than average meditation score (p = 0.06, chi square). Again, there was no significant correlation between the children's ability to learn meditation and their initial performance impairment score (r = 0.14) (figure 3). The results of this pilot study demonstrate that a six - week peer - mediated multimodal behavioral program that included yoga and meditation can lead to measurable benefits in children with adhd . Improvement did not really vary by age, gender, or type of diagnosed adhd . The ability to incorporate yoga and meditation as well as play therapy using school aged peers as volunteers was shown . The improvements seen from the program would need to be sustained in the long term, and further prospective studies are needed to dissect out factors that may be relevant to improvement . Furthermore, the fact that the vanderbilt questionnaire had to be translated into hindi for all the parents and the majority of the teachers may have led to some misunderstanding and affected some of the results . This questionnaire has been used by others in india but still needs to be formally validated in hindi . This potential problem may lead to an error in diagnosis in a few cases but does not affect the main outcomes of the study because the change in performance of each child was analyzed . The difference between parent and teacher would remain consistent and not affect the measured change in performance of the child . Through the course of the program, it was evident that the children could and did learn the yoga to a standard level setup by a control group of 3 children . The children learned yoga over the six - week period and improved to an average yoga posture score of 69.5 with an sd 6.25, a score of 86.9% . While this novel score warrants validation and interobserver variation in practice was higher (r = 0.81), one promising finding was that the yoga score along with the meditation score fell within a normal distribution curve . The scoring system demonstrated that a majority of the children learned yoga to a similar level . More importantly, yoga improvement did not vary by gender, age, type of adhd diagnosed, or performance impairment score at diagnosis . If confirmed, this would suggest therapy would be applicable no matter the variation of age or the severity of the child's adhd . The length of controlled exhalation in the majority of the children fell within the average score of 7.85 seconds, similar to a control group of 3 children . Again children could learn to control their breath irrespective of their performance impairment score at diagnosis indicating that their impairment due to adhd did not inhibit them from learning meditation . The ability to train peers in a few sessions is an important low - cost strategy . The results of the six - week period show promise of such an approach as an effective and low - cost way to address needs of children with adhd . Long - term followup of the peer - mediated intervention is ongoing to see if these early gains are sustained.
|
The rising number of children classified as overweight and obese has become a primary health concern in the united states (6,9,14,18,19,22). According to body mass index (bmi), over 33% of children / adolescents, ages 6 19 years, have been classified as overweight or obese (bmi 85th percentile) (6,18,19). If current trends continue the prevalence of overweight in children is expected to double by the year 2030 (22). In an attempt to monitor this growing epidemic, school districts across the country use bmi to assess a child s risk of weight - related health problems (16). The bmi method does not actually provide an estimate of percent body fat (% bf) but rather compares the child s weight and height ratio against population specific norms . Because the bmi measurement is easy to perform, inexpensive and noninvasive, it is more often used than direct measures of body fat which can be time - consuming, invasive and costly (i.e. Air - displacement plethysmography, hydrostatic weighing, skinfold method). Although convenient, bmi results must be interpreted with caution due to the inconsistent pattern of growth and development in this age group (6,22). A method of assessing% bf that school districts may find as an attractive alternative to the bmi measurement is leg - to - leg bioelectrical impedance analysis (lbia). During the lbia assessment, a low level electrical current is introduced into the body and impedance, or resistance to the current flow is measured as the participant stands on a scale - like analyzer (17). Using the calculated impedance value,% bf can be estimated using preprogrammed prediction equations that have been specifically developed for children (10,17). Lbia is simple to perform, quick (less than 30 seconds), noninvasive and portable; all characteristics that increase its appeal . It can be used in diverse settings including private clinicians offices, wellness centers, and hospitals and across a spectrum of ages, body weights, and disease states (10,17). Several studies have examined the validity of lbia in children and their findings are inconsistent (7,11,13,20,21). In normal weight children, ages 5 10.9 years, a high correlation (r= 0.94) was found between% bf by lbia and dual - energy x - ray absorptiometry (dxa); however, while lbia overestimated mean% bf by 2.5% (21). Hosking et al . (11) also reported high correlations between% bf by dxa and lbia for boys (r= 0.92) and girls (r= 0.95) but again mean% bf values were significantly different (boys:% bfdxa% bflbia = 0.9%; girls:% bfdxa (7) reported significant correlations between lbia and dxa% bf, but found large intra - subject variations in overweight / obese adolescents (13) and preadolescents (7). Conversely, sung et al . (21) reported no mean% bf differences between lbia (28.9 12.8%) and dxa (27.3 10.3%) in chinese children ages 7 16 years . A potential limitation to the utilization of lbia technology in school districts may be the need to follow a series of pretesting guidelines designed to control for fluctuations in hydration status, which could affect the accuracy of measurement (5,10). For instance, no physical exercise 12 hours prior to the lbia assessment is a recommended guideline (10). If necessary, this restriction significantly reduces the usability of these analyzers in schools where controlling a child s pre - testing behavior may be quite difficult . A few investigations have examined the effect that aerobic exercise has on lbia - measured% bf values in children . Reductions in% bf have been reported following both laboratory - controlled treadmill (1,2) and cycle ergometry (8) exercise . More recently, andreacci et al . (3) reported that mean lbia - determined% bf was reduced following a 60-min after - school exercise bout in thirty - three children . Although statistically significant, the% bf reductions following the after - school exercise bout were minimal (female = 1.6%; male = 0.4%). Given the relatively small magnitude of change, the authors suggested that adhering to the pre - test exercise guideline may be unnecessary in instances such as a school physical where a 1.02.0% measurement error may have little effect on the adiposity classification of a child (3). However, data comparisons against adiposity - based health risk percentiles were not preformed in that study . Given the potential use of lbia in the school setting, the impact that a structured in - school physical education class has on lbia% bf measurements and the childs adiposity - based health risk classification is in need of clarification . Therefore, the purposes of this investigation were to determine: 1) whether participation in a structured in - school physical education class altered the lbia - determined% bf value; and 2) whether the potential exercise - induced% bf magnitude of change altered the health risk classification of the child . Seventy - six girls (age: 121 y; height: 153.9 7.5 cm; body mass: 51.9 15.5 kg; bmi: 21.7 5.4 kg / m2) participated in this investigation . Prior to participation, parents informed written consent and subjects written assent were obtained according to the requirements established by the bloomsburg university institutional review board and the shikellamy area school district . During each physical education class, prior to beginning the exercise activity, participants were led through 35 min of structured warm - up / stretching . Following the warm - up / stretching, participants performed a variety of exercises based on the unit in physical education class for approximately 2530 min . Each unit (i.e. Daily lesson) included both fitness - based (i.e. Circuit based exercise) and skill - based game / activity (i.e. Field hockey and soccer). All units were designed towards increasing physical fitness / activity and meeting state regulated recommendations . The circuit - based exercises (e.g. Jumping rope, push - ups, sit - ups, squats, bicep curls, etc) were done preceding the skill - based game / activity . At the end of each exercise class participants were led through a cool - down period of stretching, lasting approximately 23 min . All participants had their lbia body composition assessed twice (pre- and post - exercise) while participating in the physical education class . Body composition was assessed using a lbia analyzer (tanita model #tbf-300a; tanita corporation of america inc ., lbia measures of% bf were obtained immediately before and within 5-min of completing the physical education class . Prior to the lbia assessment, height was determined using a detecto (webb city, mo) physician s scale . Gender, age, and height (cm) were entered into the lbia system . The standard mode was used for all lbia measurements, as recommended by the manufacturer . Leg - to - leg impedance of the lower extremities and body weight (kg) were measured simultaneously while the child stood on the scale . The% bf was then automatically calculated using the analyzer s pre - programmed prediction equations . In order to assess the intensity of the physical activity experienced during the physical education class, girls were randomly selected to wear a heart rate monitor (polar electro, inc ., heart rate was measured continuously throughout the physical education class and averaged, for each child, over the entire session . Statistical analyses were performed using spss 16.0 for windows (spss inc, chicago, il). Statistical significance was established a priori at p<0.05 . Paired sample t - tests (pre- vs. post - exercise) were used to examine the lbia body composition and heart rate data for the girls . Bland - altman plots (4) were used to assess individual differences in% bf and impedance from pre- to post - exercise . Children and adolescents (15) were used to determine whether the% bf change post - exercise altered the subjects adiposity - based health risk classification . As suggested by mueller and colleagues (15), the 85th percentile was considered the cutoff point to determine cardiovascular risk related to adiposity level (> 85th percentile = unhealthy body fat). Seventy - six girls (age: 121 y; height: 153.9 7.5 cm; body mass: 51.9 15.5 kg; bmi: 21.7 5.4 kg / m2) participated in this investigation . Prior to participation, parents informed written consent and subjects written assent were obtained according to the requirements established by the bloomsburg university institutional review board and the shikellamy area school district . During each physical education class, prior to beginning the exercise activity, participants were led through 35 min of structured warm - up / stretching . Following the warm - up / stretching, participants performed a variety of exercises based on the unit in physical education class for approximately 2530 min . Each unit (i.e. Daily lesson) included both fitness - based (i.e. Circuit based exercise) and skill - based game / activity (i.e. Field hockey and soccer). All units were designed towards increasing physical fitness / activity and meeting state regulated recommendations . The circuit - based exercises (e.g. Jumping rope, push - ups, sit - ups, squats, bicep curls, etc) were done preceding the skill - based game / activity . At the end of each exercise class participants were led through a cool - down period of stretching, lasting approximately 23 min . All participants had their lbia body composition assessed twice (pre- and post - exercise) while participating in the physical education class . Body composition was assessed using a lbia analyzer (tanita model #tbf-300a; tanita corporation of america inc ., arlington heights, il, usa). Lbia measures of% bf were obtained immediately before and within 5-min of completing the physical education class . Prior to the lbia assessment, height was determined using a detecto (webb city, mo) physician s scale . Gender, age, and height (cm) were entered into the lbia system . The standard mode was used for all lbia measurements, as recommended by the manufacturer . Leg - to - leg impedance of the lower extremities and body weight (kg) were measured simultaneously while the child stood on the scale . The% bf was then automatically calculated using the analyzer s pre - programmed prediction equations . In order to assess the intensity of the physical activity experienced during the physical education class, girls were randomly selected to wear a heart rate monitor (polar electro, inc ., heart rate was measured continuously throughout the physical education class and averaged, for each child, over the entire session . Statistical analyses were performed using spss 16.0 for windows (spss inc, chicago, il). Statistical significance was established a priori at p<0.05 . Paired sample t - tests (pre- vs. post - exercise) were used to examine the lbia body composition and heart rate data for the girls . Bland - altman plots (4) were used to assess individual differences in% bf and impedance from pre- to post - exercise . Children and adolescents (15) were used to determine whether the% bf change post - exercise altered the subjects adiposity - based health risk classification . As suggested by mueller and colleagues (15), the 85th percentile was considered the cutoff point to determine cardiovascular risk related to adiposity level (> 85th percentile = unhealthy body fat). The lbia body composition data are presented as a function of time in table 1 . Significant reductions (p<0.0001) were observed for% bf, impedance, body mass and fat mass in the girls when compared to pre - exercise values (table 1). Significant increases (p<0.0001) were observed for fat free mass when compared to pre - exercise values (table 1). Bland - altman plots (4) exploring for individual differences in% bf are depicted in figure 1 . The difference in% bf from pre- to post - exercise is plotted against body mass (figure 1). According to the bland - altman plot (4), body mass had no apparent influence on the magnitude of the% bf change post - exercise . Total sample difference in% bf pre- to post - exercise (mean sd) was 0.7 0.9% bf . As shown in figure 1, participating in the physical education class resulted in a% bf reduction in the majority of the girls (73.7%). However, in 19.7% the% bf value increased and 6.6% of the girls experienced no change pre- to post - exercise . More specifically, the% bf magnitude of change was 1.0% bf in 64.5% of the girls, between 1.1 and 2.0% bf in 23.7% of the girls, and by more than 2.0% bf in 11.8% of the girls (figure 1). Prior to the start of the exercise class: 12 girls were classified as underfat (<5th percentile for body fat), 43 girls were classified as (5th to 85th percentile for body fat), 7 girls were classified as overfat (85th 95th percentile for body fat) and 14 girls were classified as obese (95th percentile for body fat), following the exercise class: only 2 girls had changed classification categories: 1 from the healthy - fat to underfat category and 1 from the obese to overfat category . Despite these two changes, when using the 85th percentile as the cutoff point to determine cardiovascular risk related to adiposity level (> 85th percentile = unhealthy body fat), both girls remained in the same adiposity classification category (healthy vs. unhealthy) following exercise . The primary finding of this investigation was that although the structured in - school physical education class reduced lbia - determined% bf estimates these changes had no effect on the health risk classification of the girls . Our finding of a small, but statistically significant reduction in mean% bf (~0.6%) observed in the girls is consistent with the% bf reductions (range 1.2 1.6%) that have been previously reported in the laboratory setting (1,2,8). Recently, andreacci et al . (3) also reported that mean% bf decreased following an after - school exercise program in eighteen girls . The magnitude of the mean% bf reduction following the after - school exercise session was greater than found presently (1.6% vs. 0.6%). Previous research suggests that the exercise - induced% bf alterations may be influenced by the intensity and/or duration of the exercise bout (1,2). Possible causes for lbia - determined% bf changes include increases in blood flow to active muscle tissue, cutaneous blood flow, and skin temperature during the exercise bout (12). Given that the intensity of the after - school and in - school exercise bouts were similar, 76% and 73% of age - predicted maximal heart rate, the larger reduction in mean% bf following the after - school exercise bout may have been due to the differences in duration . In the present study, the lbia post - exercise assessments were conducted immediately following the physical education class, which lasted approximately 35 min, whereas the after - school exercise program was approximately one - hour in length . The comparison of this data suggests that exercise duration may influence the magnitude of% bf change . It appears that exercise beyond 35 min may cause a larger physiological disruption and% bf alteration; however, most physical education programs will be completed within the duration examined presently . Although mean% bf data provides information regarding the entire group, it does not necessarily give accurate estimates for all individuals within that group . As such, the bland - altman (4) method was used to better explore individual variability for our sample . Overall, performing exercise prior to the lbia assessment resulted in a reduction in% bf for the majority of girls (~74%) whereas no change (6%) or an increase (20%) was observed in the others . Regardless of whether% bf was increased or decreased the% bf alteration was less than 2.0% bf in 88% of the girls in this study . Similar percentages have been reported for girls in the after - school exercise study and in previous laboratory - designed research, 93% and 86%, respectively (13). It is apparent from these investigations that performing sub - maximal and maximal intensity exercise prior to the lbia assessment will result in% bf alterations of less than 2.0% bf for most girls . To determine whether this magnitude of change had any practical significance we compared the pre- and post - exercise% bf values to previously published body composition percentiles . Mueller and colleagues (15), developed reference percentiles for% bf by ethnicity, sex and age in u.s . As suggested in that paper, values of% bf above which cardiovascular risk variables increase are located at the 85th percentile (15). As such, this percentile was used as the cut - off point for the definition of excessive (unhealthy) body fat in this study . Despite the exercise - induced% bf alterations observed pre- to post - exercise, all 76 girls remained in the same health - risk classification category (either above or below the 85th percentile) following the physical education class . This was not a lbia validation study and the current body of evidence is limited and the findings are inconsistent (7,11,13,20,21). As such, we are not recommending that school districts replace the bmi assessment with lbia technology at this time . Additional lbia validation preferably against multi - component models (e.g. Three - component, four - component) is needed to more clearly determine the accuracy of lbia technology in this population . Only then may it be considered as an alternate or supplemental method to the current health - risk assessment program . Another limitation to the current study was that this investigation included girls ranging in age from 10 14 years . Given the complexity of growth and development that is observed during this time period, these findings cannot be generalized to children who differ by age or gender than those examined presently . In summary, our laboratory previously reported minimal changes in% bf as a result of laboratory - based exercise and a field - based after - school exercise bout in children . The present investigation was an extension of the use of lbia into an actual in - school, structured, physical education setting . The intensity of the physical exercise class was moderate corresponding to approximately 73% of the girls age predicted maximal heart rate . This study demonstrated that although exercise altered the lbia - determined% bf estimate, the magnitude of change was relatively small and had no impact on the child s subsequent adiposity - based health risk classification category (healthy vs. unhealthy body fat). As such, adhering to the pre - test exercise guideline appears unnecessary when using lbia to categorize the health - risk of an adolescent girl . This information is important for those that currently use or are considering the use of this technology in adolescents.
|
Acute gastroenteritis (age), characterized by the onset of diarrhea with or without vomiting, still represents a major cause of morbidity even in industrialized countries, being mortality confined in mostly resource - constrained nations . Although generally considered a mild and self - limiting disease, age is one of the most common causes of hospitalization and is associated with a substantial disease burden . Within the european union, surveillance studies showed that rv accounts for up to 2 thirds of admissions to hospital and emergency room visits and one third of primary care consultations for age among children under 5 years, being the greatest burden of disease consistently observed in children aged under 2 . Rvge is estimated to occur at a rate of 1 symptomatic infection in every 7 children each year, accounting for 231 deaths, more than 87,000 hospitalizations and almost 700,000 outpatient visits . The reveal study, carried out in belgium, france, germany, italy, spain, sweden, and the uk, reported that rvge in children under 5 y of age was responsible for between 53.0% and 68.9% of cases presenting to hospitals, 35.4% and 63.3% for those seen in emergency departments, and 7.7% and 41.3% of cases seeking primary care physicians . In 2006, 2 new live, oral, attenuated rv vaccines were licensed for infants less than 6 months of age rv vaccination was first recommended to us children in 2006 . Subsequently, in 2009 the world health organization strategic advisory group of experts (sage) recommended rv vaccination for all children . Worldwide a number of countries have adopted this recommendation and implemented rv vaccines in their pediatric immunisation programmes, but only in a limited number of countries in europe . Some countries, such as austria and luxembourg (2006), belgium (2007), finland (2009), united kingdom and germany (2013), norway and estonia (2014), latvia (2015) introduced universal anti - rv vaccination until april 1st 2015, while in other countries, such as, sweden, denmark, and romania the formal assessment for universal vaccination is under consideration . In italy, where rvge is an important cause of pediatric hospitalization, associated with high health care costs, as pointed out by several studies, among them, that of marocco et al . Is the only nationwide but limited only to the primary diagnosis, the national health care system (nhs) is decentralized i.e regions are expected to implement free of charge - all the vaccinations included in the national immunization plan (nip); further, they are allowed to increase the vaccination offer providing that the additional budget is funded at regional level, either centrally or in co - payment with the citizens . Rv in not included in the current national immunization plan (nip) and most of the regions introduced it in co - payment, sometimes reducing the co - payment to a small amount . Sicily is the only region were rv universal mass vaccination (umv) free of charge was implemented in 2012 . In order to provide an epidemiological picture that can be helpful in assessing the need to adopt anti - rv universal vaccination also in italy, this study was designed to estimate the proportion of rvge among children younger than 6 y of age who were diagnosed with age and admitted to hospital in italy during the years 20052012 . In the study time frame, 334,982 age hospital discharge records (hdrs) were collected in italy (average annual number: 41,873 hospitalizations), in children aged <6 years, being age the primary diagnosis (pd) in 50.30% (168,509 cases) of these . Table 1 shows the number of hospital admissions only coded as age of any etiology in pd: 63.09% of age (106,326 cases) presented the code of gastroenteritis of non - specified origin, and 33.75% of cases were viral gastroenteritis (vge), that were the leading cause of admissions for gastroenteritis of specified origin; rvge were 39,024 (23.16%), and represented 68.61% of all vge . Considering the total admissions for age (in pd), over the 8-years study period, a significant and consistent reduction of the total number of admissions for age, from 27,555 in 2005 to 14,988 in 2012, (a decrease of 45.60% - age trend - test: coefficient=-1,939; p <0.001) was observed . In parallel, a minor, but statistically significant, decrease for rvge of 29.72% (from 5,824 in 2005 to 4,093 in 2012; rvge trend - test: coefficient = 253; p = 0 .014) was found out . Table 1.number (percentage) of all hospitalizations for gastroenteritis in pd among children <6 y of age in the 20052012 period 2005200620072008200920102011201220052012unspecified etiology infectious: icd9 cm 009009.312,569 (45.61%)12,500 (47.57%)10,619 (44.96%)9,191 (42.55%)7,743 (43.47%)8,794 (43.46%)7,145 (46.92%)7,013 (46.79%)75,574 (44.85%) non - infectious: icd9 cm 558.95,244 (19.03%)5,352 (19.51%)4,684 (19.83%)4,223 (19.55%)3,428 (19.25%)3,604 (17.81%)2,289 (15.03%)1,928 (12.86%)30,752 (18.25%)specified etiology viral: icd9 cm 008.62008.8 (without rv)3,055 (11.09%)3,275 (11.94%)2,524 (10.69%)2,235 (10.35%)1,930 (10.84%)1,987 (9.82%)1,455 (9.55%)1,392 (9.29%)17,853 (10.59%) rotavirus: icd9 cm 008.615,824 (21.14%)5,439 (19.83%)5,144 (21.78%)5,324 (24.65%)4,146 (23.28%)5,301 (26.2%)3,753 (24.65%)4,093 (27.31%)39,024 (23.16%) bacterial: icd9 cm 001005, 008008.5661 (2.4%)634 (2.31%)475 (2.1%)460 (2.13%)383 (2.15%)406 (2.01%)481 (3.16%)447 (2.98%)3,947 (2.34%) parasitic: icd9 cm 006007202 (0.73%)228 (0.83%)174 (0.74%)163 (0.75%)181 (1.02%)142 (0.70%)154 (1.01%)115 (0.77%)1,359 (0.81%) total27,55527,42823,62021,59617,81120,23415,22714,988168,509age trend - test: coefficient = 1,939; p <0.001; number of rvpd hospitalizations, trend - test: -coefficient = 253; p <0.014 . Number (percentage) of all hospitalizations for gastroenteritis in pd among children <6 y of age in the 20052012 period age trend - test: coefficient = 1,939; p <0.001; number of rvpd hospitalizations, trend - test: -coefficient = 253; p <0.014 . Figure 1a shows the trend of hospitalizations for rvge in children under 6 y of age over the study period, but including secondary diagnosis (sd). Sd inclusion leads to a total of 79,344 hospitalizations associated with rv, of which 40,320 (50.81%) in sd . Figure 1. (a) number of rvge hospitalizations (code icd9 cm 008.61) in primary (pd) and secondary diagnosis (sd) among children <6 y of age in 20052012 . Number of rvpd hospitalizations trend - test: -coefficient = 253; p<0.014; number of rvsd hospitalizations trend - test: -coefficient = 163; p = 0 .184; total number of rv hospitalizations trend - test: -coefficient = 89; p = 0 .630 . Rvpd: rvge hospitalizations in primary diagnosis; rvsd: rvge hospitalizations in secondary diagnosis;% rvpd: percentage of rvge hospitalizations in primary diagnosis;% rvsd: percentage of rvge hopistalizations in secondary diagnosis . (b) hospitalization rates per 100,000 of rvge pd and sd among children <6 y of age in 2005 - 2012 . Hospitalization rates per 100,000 of rvge pd trend - test: -coefficient=-8.21; p=0.010; hospitalization rates per 100,000 of rvge sd trend - test: -coefficient=4 .40; p=0.209 . Rvhrpd: hospitalization rates for rvge gastroenteritis in primary diagnosis; rvhrsd: hospitalization rates for rvge gastroenteritis in secondary diagnosis; rvhrtotal: hospitalization rates for rvge gastroenteritis in any diagnosis (pd and sd). (a) number of rvge hospitalizations (code icd9 cm 008.61) in primary (pd) and secondary diagnosis (sd) among children <6 y of age in 20052012 . Number of rvpd hospitalizations trend - test: -coefficient = 253; p<0.014; number of rvsd hospitalizations trend - test: -coefficient = 163; p = 0 .184; total number of rv hospitalizations trend - test: -coefficient = 89; p = 0 .630 . Rvpd: rvge hospitalizations in primary diagnosis; rvsd: rvge hospitalizations in secondary diagnosis;% rvpd: percentage of rvge hospitalizations in primary diagnosis;% rvsd: percentage of rvge hopistalizations in secondary diagnosis . (b) hospitalization rates per 100,000 of rvge pd and sd among children <6 y of age in 2005 - 2012 . Hospitalization rates per 100,000 of rvge pd trend - test: -coefficient=-8.21; p=0.010; hospitalization rates per 100,000 of rvge sd trend - test: -coefficient=4 .40; p=0.209 . Rvhrpd: hospitalization rates for rvge gastroenteritis in primary diagnosis; rvhrsd: hospitalization rates for rvge gastroenteritis in secondary diagnosis; rvhrtotal: hospitalization rates for rvge gastroenteritis in any diagnosis (pd and sd). Overall, the percentage of hospital admissions for rvge in pd has gradually and significantly decreased from 57.93% in 2005 to 43.18% in 2012 . On the contrary, the incidence of rvge sd admissions has increased from 42.07% in 2005 to 56.82% in 2012 . The annual incidence rates of rv hospitalizations among children <6 y of age are shown in figure 1 b. the average hospitalization rate (hr) was 296/100,000 children: 146/100,000 children for rvge in pd and 150/100,000 children for rvge in sd . Since 2008 the hrs for rvge in sd exceeds those for rvge in pd, with the highest peak in 2010 (total rv hr: 339/100,000 children). The decrease of the hrs for rvge in pd is 8.21 per year (p = 0 .01), while considering the trend of hrs for rvge in any diagnosis (pd and sd) it is not statistically significant (p = 0 .487). Most rvge hospitalizations (80.79%) occurred in children younger than 3 y (table 2), mainly infants 2 years (1223 months) had the highest number of cases (33.67%), followed by children aged up to 3 y (2435 months), with 18.45% of annual hospitalizations, then children aged 011 months (28.67%). Table 2.temporal distribution of rotavirus infections in italy . Distribution (absolute and relative) by age groups of the hospitalizations for rotavirus gastroenteritis (code icd-9 cm 008.61) in pd in children aged <6 y over the 20052012 period age groups <1 y of age1 year2 years3 years4 years5 years 011 months1223 months2435 months3647 months4859 months6071 months n%n%n%n%n%n%total20051,59927.461,95733.601,05718.1562210.683676.302223.815,82420061,49927.561,89834.9099418.2855910.282945.411953.595,43920071,49829.121,69432.9393918.2552410.192915.661983.855,14420081,51428.441,73332.551,01118.9956210.563025.672023.795,32420091,24630.051,37533.1681219.593939.482034.901172.824,14620101,55729.371,84534.8093317.604879.192905.471893.575,30120111,11929.821,25233.3667017.853719.892075.521343.573,75320121,15628.241,38633.8678419.153859.412125.181704.154,0932005201211,18828.6713,14033.677,20018.453,90310.002,1665.551,4273.6639,024n/% = number / percentage of all hospitalizations in the given year for the specified age group . Distribution (absolute and relative) by age groups of the hospitalizations for rotavirus gastroenteritis (code icd-9 cm 008.61) in pd in children aged <6 y over the 20052012 period n/% = number / percentage of all hospitalizations in the given year for the specified age group . Rvge hospitalizations seasonal peak was during december - march every year, with maximum values of 2,850 cases in pd during 2006 and 3,139 cases in sd over 2008 y (data by italian hdd database; data not shown). In rvge sd cases, 26,675 (66.16%) main diagnoses 2): the most frequent were dehydration (49.77%) syncopations and convulsions (6.59%) and acidosis and electrolyte fluid disorders (5.35%). The main (52%) drg code for rvge sd was 298 (symptoms concerning nutrition and metabolism <18 years). Figure 2.number (n) and frequency (%) of other diseases in pd in rvge sd cases . Number (n) and frequency (%) of other diseases in pd in rvge sd cases . Total hospital charges for the admissions for rv in the overall period were approximately 112 million . They, however, decreased from 7,238,739 in 2005 to 3,158,220 in 2012, considering only pd . Hospital admission rates for rv age in children aged <6 y still remain a relevant topic in italy . The hospital discharge data (hdd) analysis confirmed that rvge still represents the greatest proportion of hospitalized vge, in agreement with previous results either in italy and in other parts of europe or usa . As in the study time frame the rv vaccine coverage (estimated less than 10%) did not reach yet significant levels to affect the overall epidemiology of the disease, the figures reported here can be considered as a pre - vaccination picture . A progressive reduction of all hospitalizations for acute diarrhea in children, in the study period, which is more evident for age of unspecified etiology and of bacterial and parasitic origin was observed . Indeed, we provided evidence that there was a switch in the position of rv age diagnosis from pd to sd . Vitale et al, using the markov model and considering a cohort of 555,791 births in 2011 in italy, in the absence of vaccination, estimated an average of 14,000 hospitalizations per year by using the rvge hospital rates collected within the reveal study; in our study, an average of 9,918 hospitalizations per year for rv in any diagnosis was found out . Whereas an underestimation of hospitalizations through the hdd by around 4050% was reported, even if calculated from a different setting, our findings are consistent with those reported . Our findings support the need of including both pd and sd, which also includes nosocomial infection forms and the incidence of which was estimated in italy by 5.3% in children under 30 months, in rv hospitalizations analysis . The most frequent pd in cases of sd rvge were: dehydration, acidosis and vomiting (54%), infections of the upper and lower respiratory tract (respectively 11% and 13%), seizures or other neurological symptoms (7%) and urinary tract infection (6%), in agreement with previous reports . Although further studies would be needed to confirm the hypothesis, a consistent part of admissions such as dehydration, gastrointestinal disorders, febrile seizures and electrolyte abnormalities reported in main diagnosis could be associated with the rv etiology; this would also partially justify the under estimation of rvge hospitalization figures . It can be assumed that variations in coding rv hospitalizations in the studied years might be related to the introduction of strategies of containment of the sanitary expense, being some icd9-cm codes leading to a more specialized management and reimbursement . Even though the study was not intended as an economic analysis of rvge hospitalizations, however, figures obtained were just a rough indicator of real healthcare costs when compared to more accurate calculations . Limitations of the study . Indeed, regional data are not detailed even if the regional differences in the payment of rvge hopitalizations may influence the coverage of rv vaccines and the age hospitalizations . In conclusion, rvge hospitalization figures in italy are still relevant and generate significant costs to the nhs . As observed in other countries, the introduction of rv umv in italy might consistently reduce morbidity and associated medical costs . This is a retrospective population - based study, conducted among all pediatric patients aged <6 y hospitalized for age in italy, between january 1st 2005 and december 31st 2012 . The data source was the italian hdd obtained from ministry of health (processing national hdd, ministry of health, general directorate for health planning, vi office). This database contains administrative and health data regarding hospital admissions, that all public and privately - owned hospitals in italy are legally required to report . For each admission, a pd is reported; this represents the clinical condition which took up the greatest amount of resources and therefore involved the greatest cost for the hospital . The clinical information is coded by the international icd9-cm system (international classification of diseases, 9th revision, clinical modification), currently used in italy . Gastroenteritis codes include the following: - unspecified etiology gastroenteritis of presumed infectious etiology (009009.3) and presumed noninfectious etiology (558.9);- gastroenteritis with specified etiology: vge (008.6169), bacterial gastroenteritis (001005 and 008008.5) and parasitic gastroenteritis (006007). - unspecified etiology gastroenteritis of presumed infectious etiology (009009.3) and presumed noninfectious etiology (558.9); - gastroenteritis with specified etiology: vge (008.6169), bacterial gastroenteritis (001005 and 008008.5) and parasitic gastroenteritis (006007). We included all admissions with at least one gastroenteritis related main or secondary discharge diagnosis . For each of these hospitalizations, we obtained the following data: age, month of admission, costs related to admissions . Each hospitalization cost, on average, has been estimated, according to the theoretical remuneration of admission reported in each hdr provided by diagnosis related group (drg) system . Even if a specific drg rates for rvge is not available, the 3 possible drg codes to which the disease can be referred to (184: esophagitis, gastroenteritis etc ., 785; 298: symptoms concerning nutrition and metabolism <18 years, 1,190; 422: diseases of viral origin and fever of unknown origin, 1,660) were considered . Data provided by the ministry of the health did not contain any patient identifiers and was therefore completely anonymous . Hence notification of the study to ethics committees was not applicable, nor was informed consent of patients required . The frequency of hospitalization with a pd of gastroenteritis was calculated as the ratio between patients with any age code in pd over the total aggregate observed in the database . As the rvges are the only vaccine - preventable, for these frequencies and hospitalization rates also in sd were analyzed, to obtain their overall epidemiological picture . Hrs were calculated for every year as the ratio between the number of hospital discharges and the resident populations aged <6 y per 100,000 . Population data for 20052012 period was obtained from italian institute of statistics (istat), which registers the national population, by age group, as of the january 1 for each year . The statistical significance of temporal trend of hrs was determined using the analysis of the slope of the regression line between hrs and years of observation . The authors are grateful to professor flavia carle, general directorate for health planning, vi office, ministry of health, for providing data useful to carry out the analysis . This research was conducted independently and publishing costs only were supported by an unrestricted grant from glaxosmithkline s.p.a.
|
Since minimally invasive surgery (mis) is performed using an endoscope and several thin instruments through small incisions made in patients, it provides patients with some advantages like shorter recovery time, less postoperative pain, earlier resumption of normal activity, and cost savings . However, it is more ergonomically challenging to performing surgeons due to its inherent complexity such as limited work volume and degree of freedom . Specifically, such complexity induces abnormal movements of arm and shoulder while holding certain body postures, for example, head and torso, for prolonged time [13]. Importantly, this complexity often exposes performing surgeons to increased ergonomic risks including muscle fatigue that can result in critical errors during surgical procedures [46]. The vulnerability to ergonomic risk is well confirmed in a literature stating that performing laparoscopic surgery is significantly more stressful for the surgeon than open surgery . In addition, it has been reported that mis carries more complications than open surgery [8, 9]. Therefore, it is important to quantitatively measure ergonomic risks on performing surgeons, particularly muscle fatigue during mis procedures . Note that timely intervention with information about muscle fatigue can ensure improved quality of mis procedures . Some existing study for fatigue analysis has focused on quantitative measures and their applications for isometric or isotonic contractions during relatively short bouts of high - force activities . Among these studies, frequency banding analysis predicted muscle fatigue when lower frequency bands increase and higher frequency bands decrease . Standard discomfort analysis was also used to detect the level of muscle fatigue on subjects, which may lack objective analysis . In addition, heart rate and tissue oxygen saturation were used as indicators of fatigue development . Importantly, power spectral density (psd) of transformed emg data through fast fourier transform approach was widely used to detect muscle fatigue [1416]. In this approach, frequency and amplitude changes are considered as a result of a reduction in conduction velocity in the muscle fibers and larger motor unit synchronization . As mis operations can be considered as prolonged light muscle activation, psd based measure, which is mainly for static activities, may not be efficiently used to predict muscle fatigue during mis operations . Specifically, when psd based measures are used for light muscle activations, conflicting results and complicated relationship between subjective and objective fatigue have been reported [17, 18]. Such conflicts result from stationary data requirement for psd based measures to be successfully used . In fact, emg data collected from light muscle activations are nonstationary due to changing distance between muscle and emg sensor, as well as changing muscle length . From the literature, it is noted that fatigue mechanism during these activities is not well understood in comparison to high - force (or intense) muscle activities . Although there are no significant reductions in muscle force level during mis operations, there are some physiological changes in muscles that can lead to muscle fatigue affecting the capacity of muscles and the performance of subjects [20, 21]. Uhrich et al . Assessed the muscle fatigue during a relatively short time during simulated laparoscopic surgery . In their study, the effects of fatigue, monitor placement, and surgical experience have been compared . After obtaining the emg activity and muscular discomfort scores before and after a fatigue session, it was found that the emg data and discomfort scores demonstrated a fatigue response in several muscle groups . They found minimal differences between the two monitor positions and less muscle activity and discomfort in the attending surgeons . In another study, slack et al . The length of the operations varied within 110 hr, but only one minute period before and after operations were analyzed using frequency analysis . In addition, the muscle fatigue increases proportional to time . On the other hand, recurrence quantification analysis (rqa) has been tested on biceps brachii and shown to be more sensitive to muscle fatigue than fft variable spectral center frequency (fc). In another study, filligoi and felici showed that determinism%, which is one of the rqa variables, is more effective than median frequency to detect emg signal changes in biceps brachii muscle . For the first time, this novel data analysis method is used in our study to quantify any possible muscle fatigue in real laparoscopic surgery operations which is known as prolonged and low - force muscle activity compared to some intense tasks which involve isometric muscle contraction throughout the whole task . The main goal of this study is to answer the following questions: can objective manifestations of muscle fatigue be detected from emg data during a laparoscopic surgery as prolonged light muscle activation?what is time - to - fatigue for the muscles experiencing fatigue during laparoscopic surgery?which muscle has the highest possibility level of fatigue in laparoscopic surgery among the tested muscle groups? Can objective manifestations of muscle fatigue be detected from emg data during a laparoscopic surgery as prolonged light muscle activation? What is time - to - fatigue for the muscles experiencing fatigue during laparoscopic surgery? Which muscle has the highest possibility level of fatigue in laparoscopic surgery among the tested muscle groups? As the first step, emg data for fatigue analysis was collected . Specifically, surface emg electrodes were attached to upper arm muscles of participants to collect muscle activations while performing various mis procedures . Next, emg data was converted into higher dimensional data using time shift and represented by recurrence plots that facilitate recurrence quantification analysis (rqa), particularly computation of determinism values . Then, moving average technique was applied for trajectories of determinism values to detect any changes as the indicator of muscle fatigue . Under an irb - approved protocol, five right - hand - dominant expert laparoscopic surgeons, who have performed more than 100 laparoscopic surgeries, performed fifteen mis procedures in a local hospital ., a total of eight surface emg (semg) electrodes were attached to the following four bilateral muscles including bicep, triceps, deltoid, and trapezius . Note that since lower arms are scrubbed from the fingertips to the elbow, electrodes were not placed on these sterilized muscle compartments . Tricep and bicep were selected due to their high activity level during arm flexion and extension . Since the shoulder and neck are the common area of muscle fatigue, trapezius and deltoid were also included in our study . All semg data were collected using an 8-channel bioradio 150 physiologic data acquisition system (great lakes neurotechnologies, incorporated, cleveland, oh). After wiping skin surfaces overlying target muscle groups with rubbing alcohol and allowing the alcohol to dry, two 1 1 mvap - ii electrodes (mvap medical supplies, incorporated, newbury park, ca) were placed over the muscle bellies of each muscle group and connected to the positive and negative input poles for each channel . An electrode was also attached to the right elbow and connected to the ground input on the bioradio 150 to complete the input circuit . The biocapture data acquisition software package (great lakes neurotechnologies, incorporated, cleveland, oh) more specifically, semg data was sampled at frequency of 256 hz from each channel . Digital signal processing filters were then applied to exclude the noise that are at low (<10 hz) and high frequency (> 127 hz) signals . Rqa is a time series analysis method and detects the deterministic structure of the dynamical systems . Let x(i) be the ith point on the orbit describing a dynamical system in d - dimensional space, for i = 1, n square, where a dot is placed at (i, j) whenever x(j) is sufficiently close to x(i). In order to obtain a recurrence plot from a time series {ui}, the following procedures are required . First, we choose an embedding dimension d and construct the d - dimensional orbit of x(i) by the method of time delays: if u and i are scalar, x(i) = (ui, ui+1,, ui+d1). Next, we choose r(i) such that the ball of radius r(i) centered at x(i) in r contains a reasonable number of other points x(j) of the orbit . Finally, we plot a dot at each point (i, j) for which x(j) is in the ball of radius r(i) centered at x(i). We call this picture a recurrence plot (rp) and an example of rps is shown in figure 2 . Note that i and j are, in fact, times; therefore, a recurrence plot describes natural time correlation information . Recurrence plots tend to be fairly symmetric with respect to the diagonal i = j because if x(i) is close to x(j), then x(j) is close to x(i). There is, however, no complete symmetry because we do not require r(i) = r(j). When n is more than 2 dimensions in a phase space, projection is performed . Starting from the time series s(t) = {s1,, sn}, the attractor of the underlying dynamics is reconstructed in a phase space by applying the time - delay vector method by takens . The reconstructed trajectory x can be expressed as a matrix where each row is a phase space vector: (1)x = x1,x2, xmt, where xi = [s1, si+t, si+(de 1)t], m = n (de 1)t, de is the embedding dimension, and t is the delay time . The recurrence plot is a tool that can be used to investigate higher dimensional dynamics through a two - dimensional binary plot of its recurrences . Any recurrence of state i with state j is pictured on a boolean matrix expressed by(2)ri, jde,=xixj, where xi, j r are the embedded vectors, i, j n, () is the heaviside step function, and is an arbitrary threshold . In the graphical representation, each nonzero entry of ri, j is marked by a black dot in the position i, j. since any state is recurrent with itself, the recurrent plot (rp) matrix fulfills ri, j = 1 which hence contains the diagonal line of identity (loi). The percentage of determinism (% det) derived from diagonal lines and related to predictability of the system is an important parameter in rqa which quantifies the ratio of the recurrence points . The following formula is typically used to calculate% det from a recurrence plot: (3)%det=l = lminnlpll=1nlpl100%,where p(l) is histogram or frequency distribution of diagonal line lengths, n is the length of a data series, and lmin is predefined minimal length of a diagonal line . In this study, the above% det for emg data was used as a muscle fatigue indicator . Cross recurrence plot (crp) toolbox available in matlab was used for rqa analysis . In order to ensure optimized results, rqa parameters including embedding dimension (de), time delay (t), and threshold () should be selected carefully . In the crp toolbox, one can set the parameters of optimal embedding dimension and time delay to the obtained values from false nearest neighbors (fnn) and average mutual information (ami) function which may lead to the optimal recurrence plots as shown in figure 3 . Using these functions, embedding dimension and time - delay parameters to facilitate optimal threshold value, it has been suggested to consider the threshold value only a few percent of the maximum phase space diameter . Therefore, the threshold value was chosen according to the 10% of the minimum value of maximum phase space diameter of the data . In this study, the whole duration of mis operations summarized in table 1 was analyzed by applying rqa for each minute of the operation with a window length of 15,360 data points . Then,% det value was derived from rqa analysis and the results were plotted against operation time . Finally, a moving average analysis with the interval (or window size) of ten was applied to the% det values to determine time - to - fatigue . Figure 4 shows% det values of all eight muscles for surgeon 1 performing case 3 for 132 minutes as an example . It was observed from figures 4(g) and 4(h) that moving average of% det of bilateral trapezius muscles increased after 4550 minutes of operation . In addition, moving average of% det of bilateral deltoid increased after 5560 minutes of operation as shown in figures 4(e) and 4(f). Between deltoid and trapezius, bilateral trapezius became more deterministic with% det close to 75% at the end of operation while bilateral deltoid was less deterministic with% det value close to 50% . In this study, the increase in the moving average of% det values is considered as the development of muscle fatigue . Thus, it is conjectured from these observations that trapezius became more fatigued than deltoid for surgeon 1 performing case 3 . However, there were no changes in moving averages of% det of bilateral bicep and triceps throughout the entire operation as shown in figure 4 . As the next step,% det was tested for all the mis operations and results are summarized in table 2 . Det results did not detect any changes in any of the muscles for surgeon 2 in case number 1 which had the least completion time of 55 minutes . Also, surgeon 4 in case number 2 as well as surgeon 5 in case number 3 did not experience any fatigue in their deltoid muscle . Specifically, no fatigue signs were detected on bilateral bicep and triceps in any of the subjects . Figure 5 shows the mean of moving average values for det% of all the operations and subjects . Table 2 also shows that fatigue signs are developed at least 45 minutes after operations begin and trapezius gets fatigue sign earlier than deltoid . The moving average of% det for bilateral trapezius deltoid increased after 4550 and 5560 minutes of operation, respectively . This might be caused due to the following nature of mis procedures: (i) during mis, surgeons should maintain their head positions at certain orientation to keep watching the monitor and this may impose significant stress on trapezius muscle, and (ii) as the surgeon operates thin and long instrument through a small incision, they often use excessive shoulder movements to overcome the limited degree of freedom and this may impose fatigue on deltoid muscle . In this study, higher% det value implies that the emg data are getting more deterministic and periodic . This deterministic and periodic pattern is the result of synchronization of motor units in fatiguing stage . In order to supply necessary force to continue certain tasks, if almost all motor units have already been involved, motor unit synchronization takes place to continue task operation and prevent the failure . The fact that more motor units are recruited and synchronized during the course of muscle fatigue has been shown in literature . For conventional occupational tasks, increase in synchronization of motor units has been successfully detected using% det values through a computer simulation model . On the other hand, shoulder disorder is considered as one of most important musculoskeletal disorders, especially in prolonged repetitive activations with high precision [3335]. An increase in interstitial potassium concentrations in trapezius muscle can be the cause of decreased conduction velocity . Also, the intra- and extracellular sodium and potassium concentration changes can be the main reason for changes in emg data which are related to muscle fatigue . Although the recovery of these metabolic changes is quick, in prolonged light muscle activation, muscles need longer recovery times in order to regain the primary force capacity [37, 38]. Because of orderly recruitment of motor units, low threshold fibers are vulnerable in prolonged muscle activation, which necessitates the importance of recovery time to avoid myalgic disorders in trapezius [39, 40]. It can be summarized from the literature review that fatigue analysis is highly difficult for prolonged light muscle activation tasks such as mis procedures . This study shows that trapezius was the first muscle to show fatigue sign in prolonged light muscle activation during mis procedures . It is interesting to note that similar results were reported in a light assembly task in industrial operations . While the existing study also suggested recovery / break time for workers at 90 minutes after the task begins, the results in this study suggest recovery / break time after 4550 minutes after mis operations begin . More likely, this difference results from intensity and precision level of two tasks: industrial and surgical . This might be because of less muscle activation and less muscle contraction in laparoscopic surgery for these two muscles . As muscles are vulnerable to fatigue during mis operations which have prolonged and intense nature, detecting the muscle fatigue and estimation of time - to - fatigue are of great importance . To meet this need, this study proposed and tested a novel measure that can be efficiently used for detection of muscle fatigue and time - to - fatigue from emg data . In the future study, correlation between objective and subjective results would be important . Here, objective results mean fatigue analysis using the proposed measure of this study and subjective results correspond to survey analysis to subjects asking whether they feel fatigue symptoms during mis procedures . Also, it would be interesting to compare performance analysis with fatigue analysis in the future, since the final goal for muscle fatigue analysis is to detect any possible effect on surgeon's performance . This will emphasize the importance of quantitative muscle fatigue analysis, although it might be challenging to apply performance analysis to real surgical operations . However, performance analysis can be easily applied to dry lab experiments such as fundamentals of laparoscopic surgery (fls) tasks, since there are validated methods to analyze the performance of subjects . Therefore, the combination of rqa, as a quantitative muscle fatigue analysis method, and standard performance analysis of fls tasks will open up new doors for future studies related to muscle fatigue and performance analysis of real mis operations which would be very beneficial for surgical community . Also, future studies should include larger number of subjects and more surgical operations in order to confirm findings of this study . In this study, recurrence quantification analysis (rqa) was applied to emg data recorded from eight muscle groups of five surgeons while doing fifteen mis operations . The results showed that this novel measure could detect the sign of muscle fatigue on bilateral deltoid and trapezius at 4555 minutes after operations began, and no sign of fatigue was found on other muscles . It was found from this study that trapezius and deltoid were the most vulnerable muscles among all eight muscle groups tested . Here, it is worthwhile to note the nature of mis procedures such that surgeons manipulate long and thin instruments for the frequent changes of their orientation and position mainly using bicep and triceps and maintain their arm posture using deltoid while gazing through monitor using trapezius muscle for prolonged time . Considering this nature, deltoid and trapezius may show clear sign of fatigue while other muscles do not show any sign of fatigue as tested in this study . Based on the results, it could be suggested that surgeons need to take break time at 4550 minutes after mis operations begin in order to minimize muscle fatigue and other possible muscle disorders . To have a better understanding about the effect of recovery time on surgeons doing such a complicated laparoscopic operation, future research might test different recovery times to find an optimum amount of time for muscle relaxation before muscles fatigue . In addition, ergonomic improvement of surgical equipment to reduce the intensity level might be efficient in reducing muscle fatigue or at least increasing time - to - fatigue.
|
The main goal of the adhesion of restoratives materials to dental hard tissues is to obtain high bond strengths and a satisfactory, long - lasting seal.13 over the last decade, a number of investigations have reported that several factors might interfere with the bonding ability of adhesive systems to enamel or dentin, including the adhesion strategy,4 conditioning time,5 solvent removal method,6,7 thickness of the adhesive layer,8 and even the environmental humidity.9,10 another factor that might affect the performance of adhesive agents is their temperature during polymerization . Manufacturers usually recommend that dental adhesive resins be stored at room temperature to prevent early evaporation of the solvent . However, they are commonly refrigerated to extend their shelf life, and dentists usually take the materials from the refrigerator and use them immediately under clinical conditions . As the temperature potentially interferes with the viscosity and the ability of the solution to penetrate into the substrate, as well with the reactivity of the monomers,11,12 it is likely that this process may affect the efficacy of bonding agents . Few studies have reported the influence of refrigeration on the performance of bonding agents,1316 and conflicting results are described in literature . Spohr et al16 detected no significant differences in bond strength between specimens at room temperature and refrigerated specimens for etch - and - rinse systems, while pazzinato et al15 reported that the environmental temperature can influence the rate of spreading of the adhesive system in clinically relevant times and may influence adhesive thickness on cavity walls as well . While these studies usually concentrate on evaluating bond strengths, there is no report in the literature regarding the effect of refrigeration on the polymerization mechanism or viscosity of dental adhesive resins . The purpose of this study was to evaluate the effect of refrigeration at 4c and post - refrigeration times (immediate, 5, 10, 15, or 20 min) on the viscosity and conversion kinetics of bonding resins . The hypothesis tested was that refrigeration would have a time - dependent influence on both viscosity and polymerization . The bonding resins of two adhesive systems were evaluated: scotchbond dual - cure (3 m espe, st . Paul, mn, usa) and clearfil se bond (kuraray, tokyo, japan). Control samples were defined by evaluating both viscosity and polymerization kinetics after keeping the materials at 25c for 24 h. the bonding agents were stored under refrigeration at 4c for 24 h. after removing the materials from the refrigerator, different post - refrigeration times were tested: immediate, 5, 10, 15, and 20 min . The temperature of the bonding resins at each post - refrigeration time was measured using a k - type thermocouple connected to a digital thermometer (tecpel co. ltd ., taipei, taiwan). The thermocouple tip (0.2 mm diameter) was placed into the bottle for 5 s and the temperature recorded . All analyses were performed under controlled temperature (251c) and humidity (605%) conditions . Viscosity measurements for the control and all post - refrigeration times of both adhesive agents were performed using a cone - plate digital viscometer (cap2000 +; brookfield, middleboro, ma, usa). A constant 5 l volume of the bonding solutions was dispensed in the equipment operating under the following settings: temperature of 25c, speed of 200 rpm, shear rate of 1 s, and run time of 15 s. three specimens were tested for each material / post - refrigeration time condition . The refrigeration and equilibration cycles were conducted after placing the adhesive resins back into the refrigerator for 24 h. data were computed in pa.s and submitted to two - way anova (material vs. post - refrigeration time) followed by tukey s test (p<.05). The real - time polymerization was evaluated by fourier transform infrared spectroscopy (prestige21; shimadzu, tokyo, japan) as previously described,17 using an attenuated total reflectance device composed of a horizontal znse crystal . A constant volume (5 l) of bonding solution was dispensed onto the crystal and photo - activated for 20 s using a quartz - tungsten - halogen light unit (optilux501; demetron kerr, orange, ca, usa) with 600 mw.cm irradiance . The polymerization reaction was monitored in real time for 1 min using happ - genzel apodization, collecting spectra in the 1680 to 1540 cm range, with a resolution of 8 cm . With this setup, one spectrum (one scan) the refrigeration and equilibration cycles were conducted after placing the adhesive resins back into the refrigerator for 24 h. the degree of conversion (dc) for each scan was calculated as previously described,17 considering the intensity of c = c stretching vibration (peak height) at 1635 cm and using, as an internal standard, symmetric ring stretching at 1608 cm from polymerized and unpolymerized samples . Dc (%) was determined by subtracting the percentage of remaining aliphatic c = c from 100% . Final dc values were submitted to two - way anova (material vs. post - refrigeration time) followed by tukey s test (p<.05). Average conversion vs. time data were plotted and hill s 4-parameter non - linear regressions were used for curve fitting . As the coefficient of determination was greater than 0.99 for all curves, the rate of polymerization (rp) was calculated using these data - fitted plots, and the maximum rate of polymerization (rp) was recorded . The temperature of the bonding resins at each post - refrigeration time was measured using a k - type thermocouple connected to a digital thermometer (tecpel co. ltd ., taipei, taiwan). The thermocouple tip (0.2 mm diameter) was placed into the bottle for 5 s and the temperature recorded . All analyses were performed under controlled temperature (251c) and humidity (605%) conditions . Viscosity measurements for the control and all post - refrigeration times of both adhesive agents were performed using a cone - plate digital viscometer (cap2000 +; brookfield, middleboro, ma, usa). A constant 5 l volume of the bonding solutions was dispensed in the equipment operating under the following settings: temperature of 25c, speed of 200 rpm, shear rate of 1 s, and run time of 15 s. three specimens were tested for each material / post - refrigeration time condition . The refrigeration and equilibration cycles were conducted after placing the adhesive resins back into the refrigerator for 24 h. data were computed in pa.s and submitted to two - way anova (material vs. post - refrigeration time) followed by tukey s test (p<.05). The real - time polymerization was evaluated by fourier transform infrared spectroscopy (prestige21; shimadzu, tokyo, japan) as previously described,17 using an attenuated total reflectance device composed of a horizontal znse crystal . A constant volume (5 l) of bonding solution was dispensed onto the crystal and photo - activated for 20 s using a quartz - tungsten - halogen light unit (optilux501; demetron kerr, orange, ca, usa) with 600 mw.cm irradiance . The polymerization reaction was monitored in real time for 1 min using happ - genzel apodization, collecting spectra in the 1680 to 1540 cm range, with a resolution of 8 cm . With this setup, one spectrum (one scan) every second was acquired . Three specimens were tested for each material / post - refrigeration time condition . The refrigeration and equilibration cycles were conducted after placing the adhesive resins back into the refrigerator for 24 h. the degree of conversion (dc) for each scan was calculated as previously described,17 considering the intensity of c = c stretching vibration (peak height) at 1635 cm and using, as an internal standard, symmetric ring stretching at 1608 cm from polymerized and unpolymerized samples . Dc (%) was determined by subtracting the percentage of remaining aliphatic c = c from 100% . Final dc values were submitted to two - way anova (material vs. post - refrigeration time) followed by tukey s test (p<.05). Average conversion vs. time data were plotted and hill s 4-parameter non - linear regressions were used for curve fitting . As the coefficient of determination was greater than 0.99 for all curves, the rate of polymerization (rp) was calculated using these data - fitted plots, and the maximum rate of polymerization (rp) was recorded . The results for temperature and viscosity as a function of the post - refrigeration time are shown in figure 1 . Clearfil presented a faster increase in temperature (increase is prominent in the first 5 min) after exposure to room temperature than scotchbond . The factors material and post - refrigeration time were both significant (p<.001), and so was their interaction (p<.001). In general, all post - refrigeration times presented significant differences in viscosity compared to each other . A continuous decrease in viscosity with increased post - refrigeration time was observed for both bonding resins . For scotchbond, the decrease was more evident up to 10 min after refrigeration, while for clearfil the decrease was more evident after 10 min . Comparing the control and 20 min samples, slight differences in viscosity were observed for both systems . At the immediate post - refrigeration time, scotchbond was significantly more viscous than clearfil (p<.001), while clearfil was significantly more viscous for the times 5 and 10 min (p<.001). Similar viscosities for these two materials were detected after 15 min at room temperature (p.45). Material (p<.001) and post - refrigeration time (p=.018) were both significant, whereas the interaction between the two factors was not significant (p=.223). For scotchbond, a significantly higher final dc value was detected for the control compared with the immediate and 5 min post - refrigeration groups (p<.001). On the other hand, similar dc was observed for the times 10, 15, and 20 min in comparison with the control sample (p.558). For clearfil, the control sample showed significantly higher final dc than all post - refrigeration groups (p.003), which were similar among them (p.858). Comparing the different materials, clearfil always showed significantly higher dc than scotchbond (p.012), regardless of the post - refrigeration time . For scotchbond, although the control group showed the highest rp value, similar rp profiles were detected for the 10, 15, and 20 min post - refrigeration times; the immediate and 5 min times showed lower rp compared with all other groups . In contrast, for clearfil, all post - refrigeration times showed lower rp values compared with the control group . Comparing the bonding resins, the fundamental principle of bonding to enamel and dentin relies on a micromechanical inter - locking in which the inorganic phase of the demineralized substrate is exchanged by the adhesive resin . The bonding resin should be able to fully penetrate into the etched substrate and polymerize in loco, and therefore it must present proper fluidity to permit its infiltration . The results of this study demonstrated that the refrigeration of the bonding resins dramatically increased their viscosity, and similar values to those of the non - refrigerated sample were detected only 20 min after removing the materials from refrigeration . Thus, the hypothesis tested for viscosity was confirmed . Despite the similarity in viscosity of the control samples of each bonding resin, scotchbond showed a higher increase in viscosity due to refrigeration than clearfil, which also showed faster increase in temperature after refrigeration . One possible explanation for this is related to the role of the components in the formulation . Both adhesives present bis - gma, a very viscous, high molecular weight monomer . However, while the diluent monomer for scotchbond is the dimethacrylate tegdma, clearfil contains the monomethacrylate hema as the main diluent, which has lower viscosity . Distinct ratios between bis - gma and diluent is one of the factors that might be responsible for the differences in viscosity . The fact that both materials presented similar viscosities at room temperature suggests that scotchbond has a higher amount of bis - gma, which could explain the increased viscosity during refrigeration compared with clearfil . Another observation was that the decrease in viscosity over the course of time was dependent on the material tested . Although clearfil showed a faster increase in temperature after exposure to room temperature, the viscosity of clearfil decreased more slowly than scotchbond . This might be a result of the greater hydrogen bonding potential of hema compared with tegdma, slowing down the viscosity recovery after refrigeration . The presence of fillers in clearfil may also explain this result, since the differences in the thermal conductivity of the glass particles compared with the resin matrix may have influenced heat transfer through the material, maintaining the viscosity of the system at higher levels for a longer period of time . As no fillers are present in scotchbond, the system increases its fluidity faster than clearfil . Regarding the polymerization process, refrigeration significantly decreased the dc measured immediately and after 5 min for both adhesives . After 10 min, scotchbond presented a similar conversion to the control sample . Therefore, the hypothesis for conversion was also confirmed, as refrigeration presented a time - dependent influence on the dc . Nonetheless, the impact of refrigeration on dc was also material - dependent; clearfil showed significantly lower dc for all refrigerated samples, even after a 20 min post - refrigeration time . This might be linked to the aforementioned longer time required for clearfil to increase fluidity, which may interfere with the mobility of the monomers in the system.12 restricted mobility may decrease the polymerization rate and the conversion of double bonds; all refrigerated groups showed lower rp than the control sample for clearfil . In corroboration, lohbauer et al,18 testing resin composites, observed lower monomer conversion for specimens at the temperature 102c compared with 232c, and also a significant linear correlation between% dc and increase in temperature . Despite the increased effect of refrigeration on clearfil, this bonding resin presented significantly higher dc than scotchbond, regardless of the post - refrigeration time . This result is most probably related to the type of diluent used in each system . The dimethacrylate tegdma potentially renders the polymer network more densely cross - linked11,19 but also reduces the limiting dc for scotchbond . For clearfil, the presence of the monomethacrylate hema reduces the amount of cross - linking reactions but increases the final conversion . It is difficult to forecast whether the differences in conversion observed here might predict a distinct clinical performance for the bonding resins . Although higher dc is usually linked with improved mechanical properties,20 the cross - link density also strongly affects the properties of the polymer,19 especially by reducing the access of water into the network, which is responsible for degrading the bonding layer over the course of time.4 the present outcomes showed a time- and material - dependent effect of refrigeration on both the viscosity and polymerization of bonding resins . Therefore, it seems adequate to indicate that adhesive systems should be removed from refrigerator and exposed to room temperature for at least 20 min before they are used . In addition, it can be suggested that the post - refrigeration period should be longer for materials containing fillers . According to lohbauer et al,18 the recommendation for resin restoratives is similar; the authors indicated that composites should be used at room or physiological temperatures . However, the effect of refrigeration is likely to be even greater for composites; thus, earlier removal from the refrigerator is advisable . The present results do not take into account other effects that might affect the performance of refrigerated materials in a clinical situation, such as differences in temperature and humidity in the oral environment . Further investigations are necessary to define the time required for proper performance of adhesive systems after refrigeration . Refrigeration at 4c presented a significant time- and material - dependent effect on the viscosity and polymerization kinetics of the two dental adhesive resins tested . Under clinical conditions, adhesive agents should be removed from refrigerator at least 20 min before they are used.
|
More recently, they have been used in autotransplantation procedures to replace non - restorable teeth . The transplantation of third molars may help to maintain alveolar bone and enable endosseous implantation without requiring bone regeneration, fulfilling functional and aesthetic demands . Information regarding morphology and number of roots may be especially beneficial for careful extraction and subsequent endodontic procedures in autotransplantation . Relatively few studies have been conducted on the root and canal morphology of mandibular third molars, and there is no available report that specifically examines the use of cone - beam computed tomography (cbct). Cbct was introduced for head and neck applications and consists of a conical radiographic source and a high - performance digital panel detector . Cbct has been used in various applications, including measurements for gingival and dentogingival units, as a preoperative tool in decision making for furcation involvement, evaluation of the facial bony wall, estimation of cancellous bone density, clinical assessment of bone grafting, assessment of root length, and resorption of the root . It has been suggested that cbct data may provide a better basis for treatment plans . The main purpose of this study was to investigate the root morphology of korean mandibular third molars, and to evaluate the prevalence of c - shaped (gutter - shaped), two - rooted, and three - rooted mandibular third molars with distolingual roots . Evaluations were performed on 60 male and 77 female patients whose mean age was 35.3 15.3 [table 1]. Descriptive statistics of study population according to the age and gender an i - cat scanner (imaging sciences international, hatfield, pa, usa) with a spatial resolution of 10 line pairs per centimeter and an isotropic 0.4-mm voxel size was used for this study . Serial axial cbct images were evaluated continuously by moving the toolbar from the floor of pulp chamber to the apex to determine the number of roots and their morphology, using commercially available software (m - view, seoul, korea). The incidences of mandibular third molars with one - root, c - shaped roots, two roots, or three roots were evaluated by age group, gender, and topology [figures 14]. To evaluate the bilateral occurrence of one - rooted, c - shaped, and three - rooted mandibular third molars, evaluations were performed only on the patients who had bilateral mandibular third molars (patient n = 77). Cone - beam computed tomography images showing mandibular third molars with one root (arrow) mandibular third molars with one root with c - shaped canal (arrow) mandibular third molars with two roots (arrow) mandibular third molars with three roots having distolingual root (arrow) statistical analyses of the occurrences, according the contributing factors, were performed using the chi - square test . Data analysis was done with commercially available software (pasw statistics 18, spss inc ., the number and percentage of mandibular third molars evaluated in the study group are listed in table 1 . One hundred and twenty - one teeth (56.5%) were detected to have two roots . Only 3.7% of mandibular third molars had c - shaped roots, and 1.9% had three roots with distolingual roots . Calculating the incidence of each type by using the total number of teeth in each age group as the denominator, the occurrence of three - rooted teeth in each affected age group (20 - 29, 30 - 39, 40 - 49) increased to a respective 1.0% (1/99), 4.2% (2/48), and 6.7% (1/15). The percentage of c - shaped roots for the age groups 20 - 29, 30 - 39, 50 - 59, 60 - 69 was a respective 4.0% (4/99), 2.1% (1/48), 5.6% (1/18), and 14.3% (2/14). The overall occurrence of the number of roots in each age group was reported to show significant difference [p <0.05, table 2], and the incidence of multi - rooted third molars tended to increase with patient age . Analysis of incidence of mandibular third molars with one - root, c - shaped root, two roots, or three roots according to age groups the classification of mandibular third molars by root number and gender is seen in table 3 . Using the total number of mandibular molars in male and female patients as the denominator, the incidences of one root (31.5% (29/92) for male versus 42.6% (52/122) for female), c - shaped root (4.3% (4/92) for male versus 3.3% (4/122) for female), two roots (63.0% (58/92) for male versus 51.6% (63/122) for female), three roots (1.1% (1/192) for male versus 2.5% (2/112 for female) were similar between males and females (p = 0.144). Classification of mandibular third molars by root number and gender classification of mandibular third molars by number of roots and topology is done in table 4 . The incidences of one root (37.3% (42/110) for right side versus 38.5% (40/104) for left side), c - shaped root (3.6% (4/110) for right side versus 3.8% (4/104) for left side), two roots (57.3% (63/110) for right side versus 55.8% (58/104) for left side), three roots (1.8% (2/110) for right side versus 1.9% (2/104) for left side) appeared to be very similar between the right and left sides (p = 0.919). Classification of permanent mandibular third molars by root number and topology (right and left side) an analysis of bilateral and unilateral distribution of mandibular third molars with c - shaped roots, two roots, or three roots having distolingual roots is listed in table 5 . To evaluate the bilateral occurrence of one - rooted, c - shaped, two - rooted, and three - rooted mandibular third molars, only patients who had bilateral mandibular third molars the incidence rate of each of these types was calculated using the total number of mandibular molars in each group (the one - rooted, c - shaped, two - rooted, and three - rooted groups) as the denominator . Bilateral occurrence was more evident for all groups except for the three - rooted group . Calculated bilateral and unilateral distributions for each group are as follows: one - rooted group (79.4% (50/63) for bilateral distribution versus 20.6% (13/63) for unilateral distribution), c - shaped group (66.7% (4/6) for bilateral distribution versus 33.3% (2/6) for unilateral distribution), two - rooted group (85.4% (70/82) for bilateral distribution versus 14.6% (12/82) for unilateral distribution), and three - rooted group (0.0% (0/3) for bilateral distribution versus 100.0% (3/3) for unilateral distribution). Analysis of bilateral and unilateral distribution of mandibular third molars with c - shaped root, two roots or three roots having distolingual root this study used cbct images to evaluate the number of roots and the morphology of 214 mandibular third molars in 137 korean individuals . The mandibular third molar, the last tooth in the molar series, is reported to be associated with greater variation in root pattern and canal systems . It is widely accepted that mandibular molars usually have two roots: one located mesially and one distally . This study showed that highest percentage of mandibular third molars (56.5%) had two roots, which is consistent with previous reports that showed respective results of 53.0% and 53.4% . The incidence of three roots found for this report was rare (1.9%), and the additional roots were found in the distolingual area . An additional root that is located distolingually is called radix entomolaris, and this is a morphological variant identified as an mongolian trait . An additional root located in the lingual area we found that the overall occurrence of the number of roots according to age groups was significantly different; specifically, the younger the group, the lower the incidence rate of multi - rooted teeth . Further study with a larger number of patients may be needed to draw conclusions about this apparent trend . Gender predilection for the presence of distolingual roots and c - shaped roots in mandibular third molars was also evaluated in this study . Previous reports have already found no significant differences in third molar development between males and females, and no significant relationship between the gender of the patient and the presence or absence of third molars has been found either . Topological predilection for the presence of either the distolingual root or c - shaped root in mandibular third molars is rarely reported in the literature . This study observed very similar occurrences between the right and left sides of the same patient's jaw . No significant side differences of mandibular third molar mineralization have been reported previously, and prior study found that left - right symmetry in the root development of the mandibular third molar was very high, with a correlation coefficient of 0.93 for males and 0.95 for females . Analysis was performed to evaluate the unilateral or bilateral occurrence of one - rooted, c - shaped, two - rooted, and three - rooted teeth in the mandibular third molars . Most patients (80.5%) exhibited similar morphology on both their right and left mandibular sides . A previous report indicated that 78.2% of the individuals studied possessed both mandibular third molars, while 11.3% had one and 10.5% had none . Extraction of mandibular third molars is a common operation in oral and maxillofacial surgery, and many reports have been published related to this issue . Various aspects such as the prevalence of caries experience, carious lesions, or restorations on the occlusal surface have been determined in asymptomatic third molars that have erupted to the occlusal plane . The prevalence of caries in third molars is considered to be high as well as associated with patients caries experiences in first and second molars . The morphology of mandibular third molars may be of interest to the operator for many procedures including surgical removal, autotransplantation for atraumatic procedures, and endodontic treatment . Tooth autotransplantation using mandibular third molars is reported be a useful surgical method to replace non - restorable teeth, with a high long - term survival rate . Recently, phase - contrast radiography was used to assess the root morphology of mandibular third molars, and it was suggested that phase - contrast radiography may be more useful than conventional radiography for this purpose . There was a high prevalence of two - rooted and one - rooted mandibular third molars from a korean population, and it was found that the incidence of multi - rooted third molars tended to increase with patient age . These data regarding the occurrence and morphology of teeth roots will provide useful information to dentists for various dental procedures.
|
Neoadjuvant chemotherapy (nac) has generally been used in treatment of locally advanced and inflammatory breast cancer, but its use is increasing for earlier stages of the disease [1 - 3]. The number of patients who are candidates for breast conserving treatment (bct) increases with the use of nac, which downsizes tumors, facilitating bct in patients who would otherwise require mastectomy . Several clinical trials have reported equivalent impacts of neoadjuvant versus adjuvant chemotherapy on survival . The locoregional recurrence (lrr) rate was also acceptably low in patients treated with nac followed by breast conserving surgery (bcs) and radiotherapy (rt). Dna microarray analysis of gene expression profiles has divided breast cancer into distinct molecular subtypes with different clinical outcomes and responses to treatment, including estrogen receptor (er)positive / luminal, basal - like, and her2-positive subtypes . However, dna microarray analysis has challenges for wide use in routine clinical care, determination of molecular subtypes based on clinically available immunohistochemical (ihc) markers such as hormone receptor (hr) and her2 status has been considered and validated as a more practical approach to identification of the corresponding subgroups based on gene expression profiling . It has been demonstrated that different molecular subtypes can predict lrr in addition to survival and distant metastasis (dm) in the adjuvant setting [10 - 12]. However, the impact of molecular subtypes on ipsilateral breast tumor recurrence (ibtr) and lrr in patients who undergo nac warrants further investigation . Therefore, the current study was conducted to evaluate whether molecular subtypes can identify patients at high risk for ibtr and lrr following nac and bct . This was a single - institution retrospective review of an institutional review board approved prospective breast cancer database . A total of 335 consecutive patients with non - metastatic breast cancer who underwent nac followed by bcs and rt from 2002 to 2009 were identified . Before initiation of nac, all patients had been clinically staged according to the sixth edition of the american joint committee on cancer (ajcc) guidelines . Clinical stages were evaluated by physical examination, ultrasonography, fluorodeoxyglucose - positron emission tomography (pet)/computed tomography (ct), and chest ct . Clinicopathological data were recorded, including age, menopause status, ct stage, cn stage, pathological tumor size, number of lymph nodes (lns) identified pathologically, histological type, histological grade, er, progesterone receptor (pr), her2, and ki-67 status . Nac consisted of anthracycline - based (doxorubicin 60 mg / m and cyclophosphamide 600 mg / m every 3 weeks for four cycles, n=150), taxane - based (docetaxel 75 mg / m and capecitabine 1,000 mg / m orally twice daily on days 1 - 14 every 3 weeks for four cycles, n=85; paclitaxel 80 mg / m followed by gemcitabine 1,200 mg / m on days 1 and 8 every 3 weeks for four cycles, n=27), or combined anthracycline - taxane based therapy (doxorubicin 60 mg / m and cyclophosphamide 600 mg / m every 3 weeks for four cycles followed by docetaxel 100 mg / m every 3 weeks for four cycles, n=73). A total of 245 patients (73.1%) were treated in one of the two prospective institutional clinical trials . Nac regimen for the remainder was chosen at physician s discretion . In the bcs procedure, residual primary tumors were excised, and clear margins to healthy tissues were determined from frozen biopsy specimens . However, five patients with persistent positive resection margins in the final pathology reports declined further surgical resection . No further revision surgery was attempted in 30 patients with close resection margins (<2 mm). Standard level i and ii axillary ln dissections were performed in all except 14 patients who underwent sentinel ln biopsy without axillary dissection . No residual tumor or only carcinoma in situ in both primary breast tumor and lns was considered pathologic complete response (pcr). Following bcs, rt was performed with tangential fields at a median dose to the breast of 50.4 gy in 28 fractions over 5.5 weeks in all patients . All patients received an electron boost to the tumor bed with a median dose of 10 gy in five fractions . Supraclavicular nodal rt was delivered in 318 patients (median dose, 45 gy in 25 fractions). Internal mammary nodal rt was administered at a median dose of 55 gy to only seven patients with pre - nac initial pet - positive internal mammary lns . Adjuvant hormone suppression therapy was offered to all patients with er - positive or pr - positive tumors . Some patients showed changes in er and pr expression before and after nac, but hormonal suppression therapy was administered to all patients whose tumors were er- or pr - positive in one or more tests . Following rt, an ihc assay was used to evaluate the expression of the er, pr, her2, and ki-67 markers in pretreatment core biopsies . Er and pr positivity were defined using the allred score when strong nuclear staining was observed in at least 3/8 tumor cells examined . Er and pr status were categorized as hr - positive when er or pr staining was positive, and as hr - negative when er and pr staining were negative . Immunostaining for her2 was considered positive in the case of strong (3 +) membranous staining in at least 10% of tumor cells, or in the case of 2 + with unequivocal amplification by fluorescence in situ hybridization . For evaluation of ki-67, areas with the highest ki-67 staining were examined; 15% was used as the cut - off value for ki-67 to dichotomize the patients . According to the ihc features on core biopsies before nac, patients were classified according to ihc - based molecular subgroups as follows: luminal a (hr+/her2/ki-67 <15%), luminal b1 (hr+/her2/ki-67 15%), luminal b2 (hr+/her2 +), her2 (hr/her2 +), and triple negative (tn) (hr/her2). In this study, the her2 group, which is known as an unfavorable feature, was divided into two subtypes based on the use of trastuzumab . The final six groups were as follows: luminal a, luminal b1, luminal b2, her2 with trastuzumab (her2[t+]), her2 without trastuzumab (her2[t]), and tn . Lrr was defined as recurrent disease in the ipsilateral breast, chest wall or axillary, supraclavicular, infraclavicular, or internal mammary lns . All ibtrs and lrrs were considered events, regardless of whether they were the first site of failure versus occurred with or after dm . Patients who did not experience ibtr or lrr were censored at the last follow - up or at the time of death . Distributions of the clinical factors among groups were compared using the kruskal - wallis test for continuous variables and the chi - square test for categorical variables . Actuarial rates of ibtr and lrr were calculated using the kaplan - meier method, and differences between groups were compared using the two - sided log - rank test . Logistic regression was used to evaluate the association between covariates of interest and the probability of ibtr or lrr . Significant differences in the distribution of histological type, histological grade, resection margin status, and response to nac were observed among subtypes . In evaluation of the response to nac, we noted a difference (p <0.01) in pcr rates with a lower percentage of patients in the luminal a (10.6%) and b1 (6.1%) subgroups compared with patients in the her2(t) (35.5%), and tn (23.0%) subgroups . The median follow - up period was 7.2 years (range, 0.7 to 11.6 years). Twenty - six ibtrs, 15 regional recurrences, 67 dms, and 56 deaths occurred during follow - up (table 2). The 5-year lrr - free survival rates in the subtypes were as follows: luminal a, 96.4%; b1, 93.9%; b2, 90.3%; her2(t+), 92.9%; her2(t), 78.3%; and tn, 79.6% (fig . Compared with the luminal a subtype, significantly higher lrr rates were observed for the luminal b2, her2(t), and tn subtypes (p=0.02, p <0.01, and p <0.01, respectively). The 5-year ibtr - free survival rates in the subtypes were as follows: luminal a, 97.2%; b1, 93.9%; b2, 92.8%; her2(t+), 92.9%; her2(t), 89.1%; and tn, 84.6% (fig . The her2(t) and tn subtypes had significantly higher rates of ibtr compared with the luminal a subtype (p=0.04 and p <0.01, respectively). Despite the same unfavorable molecular markers with her2(t), her2(t+) subtype showed no difference in ibtr and lrr rates compared with the luminal a subtype . The 5-year dm - free and disease - free survival (dfs) rates were as follows: luminal a, 90.2%; b1, 75.6%; b2, 83.0%; her2(t+), 85.7%; her2(t), 76.6%; and tn, 75.4% (fig . 1c) and luminal a, 88.4%; b1, 75.6%; b2, 81.9%; her2(t+), 85.7%; her2(t), 70.0%; and tn, 72.1% (fig . The clinicopathological variables associated with ibtr and lrr were analyzed by univariate and multivariate analyses (table 3). In univariate analysis, the factors affecting ibtr development included the tn subtype (p <0.01), poorly differentiated tumors (p=0.03), and clinical t3 - 4 stage (p <0.01). Luminal b2 subtype (p=0.03), her2(t) subtype (p <0.01), tn subtype (p <0.01), poorly differentiated tumor (p=0.01), and clinical t3 - 4 stage (p <0.01) were also associated with lower lrr - free survival rates . In the multivariate model, the her2(t) subtype, tn subtype, and clinical t3 - 4 stage affected the development of both ibtr and lrr . Compared with the luminal a subtype, the her2(t) and tn subtypes were potent factors affecting ibtr / lrr, with hazard ratios of 4.2 (p=0.04)/7.6 (p <0.01) and 6.9 (p=0.01)/8.1 (p <0.01), respectively (table 3). Notably, a pcr after nac was not associated with the development of ibtr (p=0.39) or lrr (p=0.65). Patients of the her2(t+) subtype had significantly lower hazard ratios for ibtr and lrr compared with her2(t) patients . In the analysis of ibtr and lrr according to pcr versus non - pcr after nac, patients of the tn subtype who failed to achieve pcr showed a significantly higher lrr (p=0.03) (fig . However, among patients of the non - tn subtypes, including her2(t), no significant effect of a pcr on either lrr (p=0.52) (fig . Breast cancer is now regarded as a biologically heterogeneous disease comprising different molecular subtypes, each with a different prognosis and response to treatment [10 - 12]. These subtypes, including luminal, her2, and basal - like, can be defined by gene expression profiling or approximations to this classification using ihc . Clinicians should consider these features for proper assessment of the relevant evidence and decide on an appropriate therapeutic course of action . In a series of women with clinical stage ii - iii breast cancer who underwent nac and bct, we found that molecular subtypes showed correlation with different rates of ibtr and lrr . The tn and her2(t) subtypes had worse outcomes with significantly higher ibtr and lrr rates than those of other subtypes despite excellent tumor responses to nac . Several authors have examined the impact of molecular subtype on lrr in different patient populations . Nguyen et al . Evaluated 793 patients treated with bct as a first - line intervention . After a median follow - up period of 70 months, the 5-year lrr rate was 0.8% for luminal a, 8.4% for her2, and 7.1% for basal subtypes . Also evaluated differences in lrr according to subtype in patients undergoing bct as initial treatment . These patients were classified based on receptor status as well as nuclear grade, with subgroups defined as luminal a (hr+/her2/grade 1 - 2), luminal b (hr+/her2/grade 3), luminal her2 (hr+/her2 +), her2 (hr/her2 +), and tn (hr/her2). The 5-year lrr rates were 0.8% for luminal a, 10.8% for her2, and 6.7% for tn subtypes . In contrast to our study, both of these studies were limited to patients undergoing initial surgery . After a median follow - up period of 43 months, 5-year lrr rates were 3.8%, 1.3%, and 4.2% for luminal a, her2, and basal subtypes, respectively . The molecular subtype and pcr predicted dm, dfs, and overall survival (os). Only patients who received nac were included; however, patients underwent bct or mastectomy . After a median follow - up period of 55 months, a higher rate of lrr in patients with basal (14%) versus luminal (4%) or her2 (5%) tumors was reported . By evaluating only the 49 patients who underwent bct, no lrr events were observed in the luminal or her2 groups, while 8% of the basal group developed lrr . Most recently, caudle et al . Analyzed the clinicopathological data from 595 patients who received nac and bct . After a median follow - up period of 64 months, the 5-year lrr - free survival rates were found to vary by subtype: hr+/her2, 97.0%; hr+/her2 +, 95.9%; hr/her2 +, 86.5%; and hr/her2, 89.5% (p=0.001). First, our data encompassed a homogeneous group of patients with clinical stage ii - iii breast cancer who underwent nac followed by bct at a single institution, compared with the results from patients treated with nac followed by bct or mastectomy . To the best of our knowledge, the current study is unique in its analysis of the impact of molecular subtypes on ibtr and lrr in patients who underwent nac followed by only bct, which could be associated with the concerns regarding a higher lrr rate compared with mastectomy . Most previous studies have focused on dfs, os, or lrr alone [23,26 - 28]. Inclusion of patients from previous treatment eras may yield higher rates of lrr compared with those treated more recently due to several factors . The evolution of systemic therapy has resulted in better local control and better outcomes on systemic recurrence . The use of modern radiation techniques and the evolution of breast imaging may have an impact on the rates of ibtr and lrr . Third, we included 36 patients treated with trastuzumab, of whom 14 her2(t+) patients had a better local outcome compared with her2(t) patients . Five - year ibtr- and lrr - free survival rates were 92.9% versus 89.1% and 92.9% versus 78.3% in her2(t+) versus her2(t), respectively . This result suggests that the use of trastuzumab could alter the impact of the molecular subtype on local outcome in her2 subtype patients . Last, we found that a pcr to nac had no impact on locoregional outcomes in any patients of non - tn groups . In tn patients, however, a pcr was associated with excellent ibtr and lrr control . The association between the extent of response to nac and prognosis has been examined [3,5,23,25 - 27]. The best relative dfs, as well as dm - free survival, and os was observed in those who achieved a pcr . Reported that a pcr to nac did not affect lrr or ibtr regardless of subtype, while caudle et al . Reported that patients achieving a pcr had similar lrr rates among subtypes a second limitation was the modest number of patients evaluated; categorization according to the six subtypes resulted in a small number of patients in some subtypes, including her2(t+), luminal b1, and her2(t) patients . Therefore, these findings should be confirmed in a larger prospective study in the future . In conclusion, we demonstrated that the tn and her2 subtypes predicted higher rates of ibtr and lrr after nac followed by bct . Among the non - tn subtype patients, pcr was not predictive of better ibtr or lrr . However, among the tn subtype patients, a pcr to nac was a predictor of better lrr control . Taken together, a novel locoregional treatment strategy to decrease ibtr and lrr such as mastectomy instead of bct in tn subtype patients with non - pcr to nac deserves further investigation . Improvements in systemic therapy, investigation of radiosensitizing agents, radiation dose escalation, and other new techniques may prove to be important.
|
Soft - tissue sarcomas (stss) are mesenchymal - origin neoplasms characterized by locally aggressive behavior and a propensity for metastases 1 . Intra - lesional heterogeneity, a well - documented phenomenon in stss 2 - 8, can lead to imaging characteristics on us, ct, mri, and f - fluorodeoxyglucose (fdg) pet that can be confused with those of benign fluid collections (bfs), such as hematomas, abscesses, and post - operative fluid collections 3, 9 - 33 . This overlap in imaging appearance leads to diagnostic dilemmas in two main clinical situations: at initial diagnosis of a soft - tissue mass, and in differentiation of recurrent sts from a bf on post - operative imaging . In either setting, the clinician must decide between biopsy and short - term follow - up imaging, each with its own limitations and important implications for patient care . Biopsy of all suspected lesions would not only be costly, but sampling error can lead to equivocal results . Follow - up imaging can avoid this issue by demonstrating growth, stability, or regression, but can delay the diagnosis and appropriate treatment of malignant lesions . F - fdg pet - ct offers the potential of non - invasively helping to make this distinction . However, previous studies of differentiating stss from benign lesions have met with variable success and have included few or no bfs 2, 13, 34 - 36 . In addition, the majority of these studies have used the degree of f - fdg avidity, as assessed by metrics such as standardized uptake values (suvs), while ignoring other data available in f - fdg pet examinations, such as the spatial pattern of f - fdg avidity (sp). Sp has not been as extensively investigated as suv 36 - 42, and may provide additional information about the biological behavior of soft - tissue lesions on f - fdg pet 37 . This study will test two hypotheses about the use of f - fdg pet - ct in differentiation of stss and bfs . We hypothesized that 1) f - fdg pet - ct can differentiate stss from bfs, and 2) sp can provide useful information in differentiating stss from bfs in addition to that provided by suvmax . A retrospective study was performed using a search of fdg - pet / ct reports from 1/1/2006 to 12/31/2011 using keywords " hematoma, " " seroma, " " abscess, " and " sarcoma . " Reports were reviewed for all 3,938 cases . Images were reviewed when a report was unclear or indicated the presence of an sts or bf in the extremity . A total of 100 cases (44 bfs and 56 primary, recurrent, or metastatic stss) met our inclusion criteria (table 1). We limited the study to lesions in the extremities in order to decrease the likelihood of interpretation errors caused by normal adjacent structures such as bowel . When multiple studies were available from the same patient, the study on which the finding first appeared was selected . In cases of multiple lesions, only a single representative lesion from the patient was selected in order to avoid the bias toward malignancy when a large numbers of lesions were present . The readers were directed to the specific lesion in question prior to opening the study . The reference standard for bf was biopsy, decrease in size, or stability for at least 6 months off treatment as per imaging, or development immediately following surgery (too quickly for a malignancy to typically develop). All f - fdg pet / cts were performed at our institution according to standard guidelines and uniform image acquisition and processing protocols . Patients were instructed to fast for at least 6 hours prior to imaging and had a measured blood glucose level of less than 150 mg / dl at the time of radiopharmaceutical administration . Patients received 10 to 20 mci of f - fdg, and were allowed to rest quietly in a darkened room for about 60 minutes before images were acquired on a pet / ct scanner (discovery, ge healthcare, milwaukee, wi). Ct images were acquired without oral or intravenous contrast, and used for attenuation correction of pet data . Four readers with 7 years, 6 years, 6 years, and 3 years of experience in interpretation of f - fdg pet / ct at a large cancer center that specializes in the care of sts underwent a 30-minute training session using cases not included in the subsequent imaging review . The readers were told that the lesions that they would be assessing would either be stss (primary, recurrent, or metastatic) or bfs (post - operative collection, hematoma, or abscess). The readers independently reviewed the images on dedicated workstations (advantage workstation (aw), ge healthcare, milwaukee, wi) and were allowed to review all pet and ct images in the selected study using custom and adjustable window settings, but were blinded to historical data, other studies, and the final diagnoses . The readers were asked to 1) assess the sp of a specific lesion on a 4-point scale (thin, moderate, thick, or solid) independently of the degree of f - fdg avidity on a score sheet (fig . 1), and 2) make a subjective determination based on their experience as to whether each lesion represented an sts . Standardized uptake value (suv) was calculated as where a is the tissue tracer activity in microcuries per gram, i is the injected radiotracer dose in millicuries, and m is the patient mass in kilograms . The maximum suv (suvmax) for each lesion was measured by placing a 3d volume of interest around each lesion . Kruskal - wallis tests were used to compare the 4-point ordered avidity scale by reference standard diagnosis, and wilcoxon rank - sum tests were used to compare suvmax . Agreement was classified by convention based on kappa values as slight (0.00 - 0.2), fair (0.21 - 0.40), moderate (0.41 - 0.60), substantial (0.61 - 0.80), and almost perfect (0.81 - 1.00) 43 . Logistic regression analysis was used to evaluate the diagnostic utility of using suvmax alone and combined with sp for differentiation of sts from bf . The resultant receiver operating characteristic (roc) curves are provided . The discrimination analysis for suvmax alone used frequentist inference with delong's 95% confidence interval (ci) 44 for the area under the roc curve (auc). The bootstrapping approach provided in the proc library was used to compute 95% pointwise cis for the roc shape . Youden's optimal threshold using suvmax alone is reported 45 . Because independent variable sp is assessed with uncertainty among the four readers, a joint model was used to conduct inference using all of the observed information . The combined inference used a bayesian hierarchical model to integrate over the inherent inter - reader variability for evaluating sp . For each patient, let i denote the probability that the i patient presents thick or solid sp (i = 1,, n). A conditional multiple logistic regression model was used to adjust the i patient's log - odds ratio for presence of sts as a linear combination of an intercept, a partial effect modifying suvmax, and a partial effect modifying i . Beta (1, 1) prior distributions were assumed for the is reflecting maximum entropy . Results are reported to reflect discrimination of sts in the presence of the estimated inter - reader variability for evaluating sp in the form of marginal 95% pointwise posterior credible intervals (pci) for the auc and roc shape . A retrospective study was performed using a search of fdg - pet / ct reports from 1/1/2006 to 12/31/2011 using keywords " hematoma, " " seroma, " " abscess, " and " sarcoma . " Reports were reviewed for all 3,938 cases . Images were reviewed when a report was unclear or indicated the presence of an sts or bf in the extremity . A total of 100 cases (44 bfs and 56 primary, recurrent, or metastatic stss) met our inclusion criteria (table 1). We limited the study to lesions in the extremities in order to decrease the likelihood of interpretation errors caused by normal adjacent structures such as bowel . When multiple studies were available from the same patient, the study on which the finding first appeared was selected . In cases of multiple lesions, only a single representative lesion from the patient was selected in order to avoid the bias toward malignancy when a large numbers of lesions were present . The readers were directed to the specific lesion in question prior to opening the study . The reference standard for bf was biopsy, decrease in size, or stability for at least 6 months off treatment as per imaging, or development immediately following surgery (too quickly for a malignancy to typically develop). All f - fdg pet / cts were performed at our institution according to standard guidelines and uniform image acquisition and processing protocols . Patients were instructed to fast for at least 6 hours prior to imaging and had a measured blood glucose level of less than 150 mg / dl at the time of radiopharmaceutical administration . Patients received 10 to 20 mci of f - fdg, and were allowed to rest quietly in a darkened room for about 60 minutes before images were acquired on a pet / ct scanner (discovery, ge healthcare, milwaukee, wi). Ct images were acquired without oral or intravenous contrast, and used for attenuation correction of pet data . Four readers with 7 years, 6 years, 6 years, and 3 years of experience in interpretation of f - fdg pet / ct at a large cancer center that specializes in the care of sts underwent a 30-minute training session using cases not included in the subsequent imaging review . The readers were told that the lesions that they would be assessing would either be stss (primary, recurrent, or metastatic) or bfs (post - operative collection, hematoma, or abscess). The readers independently reviewed the images on dedicated workstations (advantage workstation (aw), ge healthcare, milwaukee, wi) and were allowed to review all pet and ct images in the selected study using custom and adjustable window settings, but were blinded to historical data, other studies, and the final diagnoses . The readers were asked to 1) assess the sp of a specific lesion on a 4-point scale (thin, moderate, thick, or solid) independently of the degree of f - fdg avidity on a score sheet (fig . 1), and 2) make a subjective determination based on their experience as to whether each lesion represented an sts . Standardized uptake value (suv) was calculated as where a is the tissue tracer activity in microcuries per gram, i is the injected radiotracer dose in millicuries, and m is the patient mass in kilograms . The maximum suv (suvmax) for each lesion was measured by placing a 3d volume of interest around each lesion . Kruskal - wallis tests were used to compare the 4-point ordered avidity scale by reference standard diagnosis, and wilcoxon rank - sum tests were used to compare suvmax . Agreement was classified by convention based on kappa values as slight (0.00 - 0.2), fair (0.21 - 0.40), moderate (0.41 - 0.60), substantial (0.61 - 0.80), and almost perfect (0.81 - 1.00) 43 . Logistic regression analysis was used to evaluate the diagnostic utility of using suvmax alone and combined with sp for differentiation of sts from bf . The resultant receiver operating characteristic (roc) curves are provided . The discrimination analysis for suvmax alone used frequentist inference with delong's 95% confidence interval (ci) 44 for the area under the roc curve (auc). The bootstrapping approach provided in the proc library was used to compute 95% pointwise cis for the roc shape . Youden's optimal threshold using suvmax alone is reported 45 . Because independent variable sp is assessed with uncertainty among the four readers, a joint model was used to conduct inference using all of the observed information . The combined inference used a bayesian hierarchical model to integrate over the inherent inter - reader variability for evaluating sp . For each patient, let i denote the probability that the i patient presents thick or solid sp (i = 1,, a conditional multiple logistic regression model was used to adjust the i patient's log - odds ratio for presence of sts as a linear combination of an intercept, a partial effect modifying suvmax, and a partial effect modifying i . Beta (1, 1) prior distributions were assumed for the is reflecting maximum entropy . Results are reported to reflect discrimination of sts in the presence of the estimated inter - reader variability for evaluating sp in the form of marginal 95% pointwise posterior credible intervals (pci) for the auc and roc shape . There were 100 patients, ranging from 9 to 89 years of age (median age 54 years), with 42 females and 58 males . There were 100 lesions (table 2), of which 56 were stss and 44 were bfs . Of the 56 stss, 38 (68%) were primary, 14 (25%) were recurrences, and 4 (7%) were metastases . Of the 44 bfs, 32 (72.8%) were post - operative fluid collections, 9 (20.5%) were hematomas, and 3 (6.8%) were abscesses . Of the 9 hematomas 3 were of unknown etiology, 3 related to catheter placement, 2 were related to surgery, and 1 was related to anticoagulation . The abscesses were associated with immunocompromised status in patients receiving chemotherapy, either related to direct inoculation following minor injury or in the setting of systemic bacteremia . The diagnostic performance of f - fdg pet - ct using the subjective assessments of the 4 readers is shown in table 3 . The mean sensitivity of the readers for detection of stss was 93% (range: 91% - 98%) and the mean specificity was 77% (range: 59% - 91%). We next assessed the data available in f - fdg pet studies, including suvmax and sp . The median suvmax for all lesions was 5.5 (range: 1.1 - 33.7). The stss had a significantly higher suvmax (median 10.7, range: 2.0 - 33.7) than bfs (median 2.8, range: 1.1 - 12.3) (p<0.0001). The median suvmax of abscesses (11.6, range 4.3 -12.3) was higher than that of the other bfs (2.7, range 1.1 - 8.4) (p=0.009). The readers scored the sp of the stss and bfs on the 4-point avidity scale (fig . 61) and varied among the different sps, being highest for the thin sp (= 0.70) and lowest for the thick sp (= 0.46, table 4) the sp of stss was more likely to be assessed as thick or solid by all readers (p<0.0001). Modeling the diagnostic efficacy of a system that classified lesions with a thick or solid sp as an sts yielded an inter - reader averaged sensitivity and specificity of 69% and 98%, respectively . The presence of thick or solid sp resulted in an estimated 14.1-fold increase in the partial odds of sts with 95% pci=(3.74, 54.1). Moreover, each unit increase in suvmax was associated with a 1.35-fold increase in the partial odds of sts with 95% pci=(1.18, 1.60). 4, red curve) produced an auc=0.89 (95% ci 0.83 - 0.96). 4, red dot), yielding a sensitivity of 84% and specificity of 89% . Classification using both suvmax and sp (fig . 4, blue curve) resulted in an auc=0.96 (95% pci = 0.94 - 0.98). Comparing the two interval estimates of auc revealed that the resultant improvement in the discriminability of sts from bf using both suvmax and sp did not achieve statistical significance at the 0.05 level . 4, see open circle) were contained within the 95% interval estimates of both roc shapes . Our results showed that f - fdg pet - ct is a sensitive (mean 93%, range: 91% - 98%) modality for the differentiation of stss from bfs (table 3). The mean specificity of 77% (range: 59% - 91%) was lower than the sensitivity . However, given the importance of making a prospective diagnosis of a sarcoma, the high sensitivity affirms the value of f - fdg pet - ct in the early diagnostic workup of patients suspected of having a primary or recurrent sarcoma, especially given that the studies were interpreted in the absence of historical and clinical data . Our results are in the range of sensitivity (91% - 100%) and specificity (73% - 100%) reported in the literature on differentiating sts from benign soft - tissue lesions 5, 6, 16, 35, 36, 46, although these studies included few or no bfs . We found statistically significant differences in the suvmax of stss (10.7, range: 2.0 - 33.7) and bfs (2.8, range: 1.1 - 12.3). In addition, suvmax was significantly independently associated with sts in the presence of sp . Sp has not been as extensively investigated as suv 36 - 42, and may provide additional information about the biological behavior of soft - tissue lesions on f - fdg pet 37 . Qualitative assessments of heterogeneity, degree of peripheral nodularity, and apparent peripheral thickness of lesions have been used in the past to differentiate benign from malignant lung 38 and peripheral nerve sheath 39 tumors, and to distinguish between high - grade and low - grade stss 36 . Quantitative algorithms for objective characterization of sp have been used to estimate prognosis in patients with stss 37, 40, 41 and to assess treatment response in patients with head and neck cancers 42 . Widespread adoption of these quantitative methods has likely been hampered by practical concerns such as time constraints in busy clinical practices . We chose to focus on a qualitative assessment of sp to provide a more readily applied clinical method using an intuitive 4-point scale (fig . Agreement among the readers in scoring the sps had a mean = 0.61 (range 0.46 - 0.70). Stss were more likely to be assessed as thick or solid across all readers (p<0.0001), and we found that sp was significantly independently associated with sts in the presence of suvmax . The shape of the roc curves may suggest that the incorporation of sp (fig . 4, blue curve) improves discrimination of sts from bf compared to suvmax alone (fig . 4, red curve); however, the difference between the aucs lacked statistical significance, and the shapes of the 95% intervals overlapped . 4, open circle) were contained within the 95% interval estimates of both roc shapes, suggesting that the sensitivity / specificity tradeoffs derived from the subjective assessments of the 4 readers are similar to the tradeoffs provided by the quantitative methods . First, it was retrospective and f - fdg pet - ct is not routinely used for detecting abscesses or hematomas in our clinical practice . This likely introduced a selection bias regarding our patient population, which tended to include large numbers of simple post - operative fluid collections (72.8%) detected on routine surveillance, and relatively few hematomas (20.5%) and abscesses (6.8), which are usually characterized by mri or ultrasound at our institution . Given that inflammatory lesions such as hematomas and abscesses tend to have higher suvmax and present greater diagnostic challenges we found an " optimal " suvmax threshold of 5.15 for classification of sts using suvmax alone, arbitrarily assuming equal costs for misclassification of a lesion as an sts and a bf . In clinical practice, the implications of a false negative diagnosis of an sts would likely outweigh those of a false positive diagnosis; however, in the interest of objectivity we adopted the more conventional assumption of equal costs in our analysis, avoiding specification of subjective utility weights . In addition, this suvmax threshold should be used with caution, given the variability that exists in suv measurements across institutions 47 . An apparent limitation of our study concerns the inclusion of lesions with the solid sp . It can be argued that these cases present little or no diagnostic challenge, since they would be expected to represent stss . Given the degree of inter - observer variability for the solid sp (= 0.63, table 4), our results indicate that this sp is not necessarily straightforward . This may be secondary to the blooming effect that is evident when fdg uptake is indicated on fused images . F - fdg pet - ct is a sensitive modality for the differentiation of stss from bfs . Classification schemes based upon suvmax, alone or augmented with sp are expected to help effectively discriminate sts.
|
In this issue of critical care, protti and colleagues report the effects of metformin on human platelets both in vitro and ex vivo . In vitro experiments were performed on healthy platelets incubated with increasing doses of metformin, whereas ex vivo experiments were done on platelets from patients presenting accidental metformin - induced lactic acidosis . In both situations, platelets' lactate production and mitochondrial functions were measured . In vitro, a dose - dependent relationship between metformin con centration and lactate production was found . In both conditions, high levels of metformin decreased mitochondrial respiratory chain complex i activity, mitochondria polarization, and oxygen consumption . Metformin is a biguanide that has been used as a first - line drug for type 2 diabetes treatment since 1957 in europe and 1995 in the us . Metformin was reputed to induce lactic acidosis, partly because phenformin, another biguanide, was withdrawn from the market because of an unacceptable rate of this complication . However, numerous clinical studies reported a similar incidence of lactic acidosis in diabetic patients with or without metformin, leading some authors to deny the existence of metformin - associated lactic acidosis . However, in usual clinical practice, metformin contraindications are not often respected . Moreover, physicians do not really monitor adequately their prescription . As a result, numerous publications reported the association between metformin and lactic acidosis . When a cause of lactic acidosis such as shock state or acute renal failure is present, the responsibility of metformin could be questioned . But when healthy patients without risk factors develop metformin poisoning leading to lactic acidosis, there is no doubt about this link . However, metformin inhibits hepatic gluconeogenesis in different animal species and decreases mitochondrial respiratory chain complex i activity in different organs . The clinical research on metformin - associated lactic acidosis was limited to retrospective studies describing incidence, risk factors, and supportive treatments . A big step forward was made when the gattinoni group reported a decrease in oxygen consumption after metformin poisoning in humans, strongly suggesting that metformin was able to induce mitochondrial dysfunction in humans . The study by protti and colleagues elegantly confirms the implication of mitochondria in the pathophysiology of this disease . Of course, the importance of platelet mitochondrial dysfunction per se has to be put in perspective . However, as demonstrated previously in the pig, platelet mitochondrial dysfunction mirrors the mitochondrial dysfunction in other vital organs . Platelets are more easily accessible than vital organs like the liver or kidney . For research purposes in humans now that serious research on this rare disease has started, we can also imagine improving its care . Currently, the treatment is only supportive: increasing blood pressure with fluid infusion and catecholamines and promoting metformin elimination by renal replacement therapy . Restoring atp production during energy failure due to mitochondria dysfunction is still challenging . Another condition associated with mitochondrial dysfunction, succinate can bypass respiratory chain complex i inhibition and restore oxygen consumption . In isolated cells, succinate is reputed not to cross the plasma membrane, but methyl succinate (a cellpermeant succinate) has been used to bypass metformin blockade of respiratory chain complex i.
|
Most patients have advanced disease when they are diagnosed, and most experience relapse and metastasis after treatment . The prognosis of advanced gastric cancer is very poor; therefore, systemic multidisciplinary treatment of gastric cancer is particularly important, and chemotherapy plays a critical role in advanced gastric cancer treatment . However, the response rate of cddp treatment against advanced gastric cancer and the survival of patients remain unsatisfactory . Also, chemotherapy is often limited by dose - related toxicity, which restricts advanced gastric cancer treatment . Thus, developing more effective and less toxic therapeutic regimens for new therapeutic agents is urgently required for sensitizing gastric cancer cells to chemotherapy to improve the prognosis . Steroidal saponins have significant bioactivities, including their antitumor, hemostatic, immunotropic, and analgesic properties . Paris saponins are the most important potential agents that can be developed for new antitumor medicines [213]. Among them, paris saponin i (psi) has been extensively studied . The major advantages of psi as an anticancer agent are related to its ability to inhibit tumor growth in various cancer types [1419] associated with a low level of toxicity . Recent studies have demonstrated that psi possesses pharmacological activities concerning the cytotoxic activity against many cancers with mechanism of increasing levels of bax, cytochrome c, activating caspases, and by decreasing both bcl-2 expression and specific kinase-1/2 activity [1419]. Psi may be a potential anticancer drug by inhibiting proliferation and a good radiosensitizer of gefitinib resistant nsclc cells . However, the relationship between psi and the sensitivity of gastric cancer cells to cisplatin has not been reported . This study was conducted to explore the possibility of using psi as an agent to sensitize cancer cells to cisplatin, with an attempt to provide new methods and insights for the management of gastric cancer . Paris saponin i (ps i) (c44h70o16) was obtained from the zhejiang institute for food and drug control (batch no . The purity was greater than 99%, and it was dissolved in dimethyl sulfoxide (dmso) and stored at 20c . The drugs were diluted in rpmi-1640 to achieve the final concentration used for following experiment with the final dmso concentration less than 0.25% (v / v). The rpmi-1640 medium and fetal calf serum were obtained from hyclone co. (logan, ut). The cycle test plus dna reagent kit and fitc annexin v apoptosis detection kit were obtained from bd biosciences (nj, usa). Rabbit anti - rat b cell lymphoma 2 (bcl-2; #3498), bcl-2-associated x protein (bax; #5023), caspase-3 (#9665), and p21/waf1/cip1 (#2947) monoclonal primary antibodies at 1: 1000 dilution (cell signaling technology, danvers, ma); anti - gapdh (santa cruz biotechnology, inc ., dallas, tx). The human gastric cancer cell line sgc-7901 was obtained from the atcc company (manassas, va, usa). Cells were grown in rpmi-1640 culture medium with 10% fetal bovine serum, 100 g / ml penicillin and 100 g / ml streptomycin at 37c in a 5% co2 humidified atmosphere . The antiproliferative effects of psi, cisplatin - alone, and cisplatin plus psi were assessed using a mtt assay . Sgc-7901 cells (100 l / well, 110 cells / ml) were seeded and each group had triplicate treatments . Meanwhile, a nontreated group was established as the control (dmso concentration was 0.25% (v / v)), and then treated with different concentrations of psi (0.2, 0.4, 0.8, 1.6, 3.2, 6.4 g / ml), or cisplatin (0, 1, 2, 4, 8, 16, 32, 64 m), or a combination of cisplatin (at the concentrations shown above) plus psi (0.3 g / ml) for 48 h. dose - dependent curves were generated . The cytotoxic effects of tested agents were expressed as the 50% inhibiting concentration (ic50). Four groups were divided as the control group, psi group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Psi (0.3 g / ml) and cisplatin (0, 8,16, 32 m) were used to treat the cells for 48 h, and then cells were harvested and fixed with 70% ethanol which were stored overnight at 20c . Flow cytometry with a kaluza software, version 1.20 (beckman coulter, inc ., brea, ca, usa) was used to analyze cell cycle . Annexin v / pi method was used to analyze apoptosis with annexin v fitc apoptosis detection kit (bd biosciences). Four groups were divided as the control group, psi group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Cells were treated with psi (0.3 g / ml) and cisplatin (0, 8, 16, 32 m), then harvested at 48 h, and stained following the kit instruction . Cells were incubated with the mixture of annexin v fitc and pi in the dark . Four groups were divided as the control group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Cells were treated with psi (0.3 g / ml) and cisplatin (16 m), following treatment, cells were lysed with lysis buffer containing 50 mm tris - hcl (ph 8.0) and 150 mm 1% tritonx-100 (sigma - aldrich). Equal amounts of protein were separated by 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis, then transferred to nitrocellulose membranes (thermo fisher scientific, inc ., waltham, ma, usa). The membranes were incubated overnight at 4c with primary antibodies (rabbit anti - rat bcl-2, bax, caspase-3 and p21/waf1/cip1 monoclonal antibodies and mouse anti - rat gapdh monoclonal antibody (1: 1,000)), and then washed three times with tris - buffered saline supplemented with tween-20, prior to being incubated for 2 h at room temperature with the hrp - conjugated goat anti - rabbit igg secondary antibody (1: 10,000). The membranes were visualized using an enhanced chemiluminescence system and x - ray films (santa cruz biotechnology inc . ). Groups were compared by one - way anova test and snk - q test considering p<0.05 as a significance level . Paris saponin i (ps i) (c44h70o16) was obtained from the zhejiang institute for food and drug control (batch no . The purity was greater than 99%, and it was dissolved in dimethyl sulfoxide (dmso) and stored at 20c . The drugs were diluted in rpmi-1640 to achieve the final concentration used for following experiment with the final dmso concentration less than 0.25% (v / v). The rpmi-1640 medium and fetal calf serum were obtained from hyclone co. (logan, ut). The cycle test plus dna reagent kit and fitc annexin v apoptosis detection kit were obtained from bd biosciences (nj, usa). Rabbit anti - rat b cell lymphoma 2 (bcl-2; #3498), bcl-2-associated x protein (bax; #5023), caspase-3 (#9665), and p21/waf1/cip1 (#2947) monoclonal primary antibodies at 1: 1000 dilution (cell signaling technology, danvers, ma); anti - gapdh (santa cruz biotechnology, inc ., dallas, tx). The human gastric cancer cell line sgc-7901 was obtained from the atcc company (manassas, va, usa). Cells were grown in rpmi-1640 culture medium with 10% fetal bovine serum, 100 g / ml penicillin and 100 g / ml streptomycin at 37c in a 5% co2 humidified atmosphere . The antiproliferative effects of psi, cisplatin - alone, and cisplatin plus psi were assessed using a mtt assay . Sgc-7901 cells (100 l / well, 110 cells / ml) were seeded and each group had triplicate treatments . Meanwhile, a nontreated group was established as the control (dmso concentration was 0.25% (v / v)), and then treated with different concentrations of psi (0.2, 0.4, 0.8, 1.6, 3.2, 6.4 g / ml), or cisplatin (0, 1, 2, 4, 8, 16, 32, 64 m), or a combination of cisplatin (at the concentrations shown above) plus psi (0.3 g / ml) for 48 h. dose - dependent curves were generated . The cytotoxic effects of tested agents were expressed as the 50% inhibiting concentration (ic50). Four groups were divided as the control group, psi group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Psi (0.3 g / ml) and cisplatin (0, 8,16, 32 m) were used to treat the cells for 48 h, and then cells were harvested and fixed with 70% ethanol which were stored overnight at 20c . Flow cytometry with a kaluza software, version 1.20 (beckman coulter, inc ., annexin v / pi method was used to analyze apoptosis with annexin v fitc apoptosis detection kit (bd biosciences). Four groups were divided as the control group, psi group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Cells were treated with psi (0.3 g / ml) and cisplatin (0, 8, 16, 32 m), then harvested at 48 h, and stained following the kit instruction . Cells were incubated with the mixture of annexin v fitc and pi in the dark . Four groups were divided as the control group, cisplatin group and psi + cisplatin group . The concentration of dmso in the control group was 0.25% (v / v). Cells were treated with psi (0.3 g / ml) and cisplatin (16 m), following treatment, cells were lysed with lysis buffer containing 50 mm tris - hcl (ph 8.0) and 150 mm 1% tritonx-100 (sigma - aldrich). Equal amounts of protein were separated by 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis, then transferred to nitrocellulose membranes (thermo fisher scientific, inc ., waltham, ma, usa). The membranes were incubated overnight at 4c with primary antibodies (rabbit anti - rat bcl-2, bax, caspase-3 and p21/waf1/cip1 monoclonal antibodies and mouse anti - rat gapdh monoclonal antibody (1: 1,000)), and then washed three times with tris - buffered saline supplemented with tween-20, prior to being incubated for 2 h at room temperature with the hrp - conjugated goat anti - rabbit igg secondary antibody (1: 10,000). The membranes were visualized using an enhanced chemiluminescence system and x - ray films (santa cruz biotechnology inc . ). Groups were compared by one - way anova test and snk - q test considering p<0.05 as a significance level . Psi concentrations of 0.2 to 6.4 g / ml caused dose - dependent inhibition of the sgc-7901 cell growth at 48 h (figure 1a). The ic50 value of psi in sgc-7901 cell lines at 48 h was 1.12 g / ml, indicating that psi had a significant anticancer activity in gastric cancer cells in vitro . Then the cells were treated with different concentrations of cisplatin, either alone or in combination with psi (choose ic20, 0.3 g / ml) at 48 h. cisplatin at concentrations of 1 to 64 m caused a dose - dependent inhibition at 48 h (figure 1b). The ic50 value of cisplatin in sgc-7901 cell lines was 30.4 m at 48 h. when cisplatin was combined with psi (0.3 g / ml), the ic50 value decreased significantly to 20.3 m (figure 1b). The results indicate that psi significantly sensitizes sgc-7901 cell lines to cisplatin - induced proliferation inhibition . Cisplatin induced g2/m phase arrest in a concentration - dependent manner at 48 h. furthermore, psi promoted cisplatin - induced g2/m phase arrest in a cisplatin concentration - dependent manner (figure 2). The results show that psi promotes cisplatin - induced inhibition of sgc-7901 cell proliferation according to the g2/m phase arrest . Annexin v / pi double staining assay was used to evaluate the apoptosis induced by psi and cisplatin in sgc-7901 cells . Apoptosis was observed in cisplatin treated group with different concentrations, and furthermore, significant apoptosis was observed in psi plus cisplatin group compare to cisplatin treated group (figure 3). The results reveal that psi promotes cisplatin - induced apoptosis in sgc-7901 cells at 48 h significantly in a cisplatin concentration - dependent manner . To explore the mechanism by which psi enhances the cisplatin - induced apoptosis and cell cycle arrest in sgc-7901 cells, we examined the effects of psi and/or cisplatin on the expression of key regulators, including caspase-3, bax, bcl-2 and p21 . Caspase-3, bax and bcl-2 were the most important apoptosis regulators and p21 was the most important cell cycle checkpoint regulator . Cisplatin treatment decreased the level of bcl-2 and increased the levels of caspase-3, bax, p21, however, psi enhanced these effects (figure 4). The result suggested that the regulation of p21, caspase-3, bax and bcl-2 expressions contributed to g2/m phase arrest and apoptosis induced by psi to cisplatin in sgc-7901 cells . Psi concentrations of 0.2 to 6.4 g / ml caused dose - dependent inhibition of the sgc-7901 cell growth at 48 h (figure 1a). The ic50 value of psi in sgc-7901 cell lines at 48 h was 1.12 g / ml, indicating that psi had a significant anticancer activity in gastric cancer cells in vitro . Then the cells were treated with different concentrations of cisplatin, either alone or in combination with psi (choose ic20, 0.3 g / ml) at 48 h. cisplatin at concentrations of 1 to 64 m caused a dose - dependent inhibition at 48 h (figure 1b). The ic50 value of cisplatin in sgc-7901 cell lines was 30.4 m at 48 h. when cisplatin was combined with psi (0.3 g / ml), the ic50 value decreased significantly to 20.3 m (figure 1b). The results indicate that psi significantly sensitizes sgc-7901 cell lines to cisplatin - induced proliferation inhibition . Cisplatin induced g2/m phase arrest in a concentration - dependent manner at 48 h. furthermore, psi promoted cisplatin - induced g2/m phase arrest in a cisplatin concentration - dependent manner (figure 2). The results show that psi promotes cisplatin - induced inhibition of sgc-7901 cell proliferation according to the g2/m phase arrest . Annexin v / pi double staining assay was used to evaluate the apoptosis induced by psi and cisplatin in sgc-7901 cells . Apoptosis was observed in cisplatin treated group with different concentrations, and furthermore, significant apoptosis was observed in psi plus cisplatin group compare to cisplatin treated group (figure 3). The results reveal that psi promotes cisplatin - induced apoptosis in sgc-7901 cells at 48 h significantly in a cisplatin concentration - dependent manner . To explore the mechanism by which psi enhances the cisplatin - induced apoptosis and cell cycle arrest in sgc-7901 cells, we examined the effects of psi and/or cisplatin on the expression of key regulators, including caspase-3, bax, bcl-2 and p21 . Caspase-3, bax and bcl-2 were the most important apoptosis regulators and p21 was the most important cell cycle checkpoint regulator . Cisplatin treatment decreased the level of bcl-2 and increased the levels of caspase-3, bax, p21, however, psi enhanced these effects (figure 4). The result suggested that the regulation of p21, caspase-3, bax and bcl-2 expressions contributed to g2/m phase arrest and apoptosis induced by psi to cisplatin in sgc-7901 cells . Although new compounds have been developed to be active against transitional cell carcinoma, cisplatin remains one of the most active standard single - agents and the mainstay of typical combination regimens against gastric cancer [2226]. However, cisplatin is highly toxic, and its efficacy is limited owing to its adverse events . Thus, developing effective agents to sensitize cisplatin efficacy and overcome platinum resistance in gastric cancer makes a challenge . Paris saponin i, originally derived from rhizoma paridis, which is the root of chinese herbal, has been recently investigated as a new anticancer agent [1419]. In the present study we found that the ic50 value of cisplatin in sgc-7901 cell lines was 30.4 m at 48 h. when cisplatin was combined with psi (0.3 g / ml), the ic50 value decreased significantly to 20.3 m, revealing that psi significantly sensitized sgc-7901 cell lines to cisplatin - induced proliferation inhibition . The most important effect of chemotherapy for treating human cancers is cell proliferative inhibition according to the induction of cell apoptosis . Cisplatin is one of the most commonly used drug in treating various types of cancer . It has shown that cisplatin can bind to dna and inhibit dna synthesis, suppress cell division and induce apoptosis . It has been increasingly recognized that the apoptosis of tumor cells is a key indicator for measuring the effectiveness of chemotherapy, and the apoptosis is associated with the chemotherapy drugs in a time- and dose - dependent manner . There are two major apoptosis pathways: an extrinsic pathway, which involves signal transduction through cell surface death receptors, and an intrinsic pathway, which is triggered by radiation or chemical agents . Therefore, targeting the regulation of apoptosis represents an important pharmacological strategy for the development of chemotherapeutic agents . Caspase-3 is the most important death protease in the caspase family, which play vital roles in mediating interactions through the apoptotic process, catalyzing the specific cleavage of many key proteins in the apoptosis pathway . The bcl-2 family is composed of a series of anti - apoptotic and proapoptotic members . Bcl-2 and bax are the crucial mediators of cell apoptosis between anti - apoptosis and proapoptosis . Bcl-2/bax ratio is regarded as an indicator of apoptosis level, and a high bcl-2/bax value indicates cell resistance to apoptosis . Therefore, pharmacological manipulation of caspases and bcl-2 family is a potential therapeutic strategy . In the present study, apoptosis was increased by cisplatin treatment and was increased significantly by psi plus cisplatin treatment . Further, cisplatin treatment decreased the level of bcl-2 and increased the levels of caspase-3, bax, and psi enhanced these effects of cisplatin . Thus, psi induces apoptosis, especially together with the cisplatin treatment, leading to enhanced efficacy . The mechanism may be by the regulation of bcl-2, bax, and caspase-3 . Psi enhanced the effect of cisplatin to alter the cycle distribution with g2/m phase arrest in gastric cancer cells . Further study showed that psi significantly increased the expression of p21, finally resulting in cell cycle blocking of g2/m phase, which indicates that p21 is an important mediator in cell cycle progression . Psi with cisplatin can induce significant g2/m phase arrest through p21 regulation in gastric cancer cells . Psi significantly sensitizes sgc-7901 cell lines to cisplatin - induced proliferation inhibition in a cisplatin concentration - dependent manner in vitro . The mechanism of this chemosensitivity is related to the g2/m phase arrest and apoptosis by increased caspase-3, bax, p21 and decreased bcl-2 expression . Therefore, psi shows promise as a chemosensitizer, but this needs further investigation in vivo.
|
The disease is characterized by progressive intracranial vascular stenosis of the circle of willis, resulting in successive ischemic events . Diagnosis is established by the typical appearance on cerebral angiography i.e. ; puff of smoke and refers to the appearance of multiple compensatorily dilated striate vessels seen on angiography . Ct and mri play a major role in documenting the regions of infarction / hemorrhage . We performed this study to analyze the role of brain perfusion spect in diagnosis and management of moyamoya disease . A retrospective analysis of the records of 17 patients (10 male, 7 female) referred for brain perfusion scintigraphy between may 2005 and dec 2009 was conducted [table 1]. The aim of the study was to describe the spectrum of findings on brain spect in patients with moyamoya disease and to compare the findings with other investigations when available . Of these 17 patients, 7 were children of age group 3 to 16 years and 10 adults between 23 to 50 years . All patients underwent a baseline technetium-99 m ethyl cysteinate dimer (tc99m - ecd) brain perfusion scintigraphy as per the established procedure guidelines . One patient had a follow up scan at six months after surgical procedure (myo - dural synangiosis). Three patients underwent both a baseline and post diamox brain perfusion scintigraphy for evaluation of cerebrovascular reserve . Showing the characteristics of perfusion defects in the brain on tc99m - ecd brain perfusion study for children, an intravenous line was secured and the child was placed in a quiet, dimly lit room along with one of the parents . Child was instructed not to speak . Once the child had calmed down, tc99m - ecd in a dose of about 10 mbq per kg body weight was injected via the intravenous cannula . Five min after the tracer injection intravenous sedatives were administered under close monitoring, as per the institutional sedation protocol . They were allowed to stay in a dimly lit room and instructed not to speak . For preparation of ecd, tc99 m was obtained from a generator that had been eluted previously within 24 hrs . Tablets of diamox up to 1,200 mg crushed to form powder were given orally at least 30 minutes before the tracer injection . Applying manually drawn regions of interest the ratio of the counts in the region with perfusion defect to corresponding contralateral normal cerebral cortex was determined both in the baseline and post - diamox study . Cerebrovascular reserve was calculated as the proportion of this ratio in the post diamox study to that in the baseline study . A ratio greater than one was considered as adequate reserve . Tomographic images of the brain were acquired in 128 128 matrix, circular orbit and continuous 360 acquisition . The acquired data were processed using butterworth filter, order 0.45, cut off 10 and chang attenuation correction method was applied . Visual interpretation of the perfusion state was made using a rating scale of 0 to -3, in which; 0 was baseline perfusion, -1 mild and -2 moderate reductions in perfusion . A score of -3 was given to a region of deficit which was defined as a clear disconnection in brain ecd uptake in more than 3 continuous slices . The presenting clinical features were noted and patients records were scrutinized for reports of ncct, mri, dsa, and ct angiography (cta). Headache was the presenting symptom in 7, seizures in one, loss of vision in one . All the patients in pediatric age group presented with neurological defect as the presenting feature . While majority of the adult subjects had headache and vomiting as the presenting symptom but one patient had sub - arachnoid hemorrhage . Following the initial presentation, features of moyamoya disease were detected on dsa in 11 patients, cta in 1, mr angiography in 1 . Four patients had evidence of parenchymal infarcts on mri and evidence of haemorrhage in two . In our study, unilateral perfusion defects were seen in 10 patients, normal perfusion in 2 and bilateral defects in 5 patients . However, unilateral features of moyamoya disease were found in angiography only in three of them (pts 4, 5 and 11). In one of these patients (pt 11) there was retrograde filling of the middle cerebral artery from the posterior circulation and hence no demonstrable perfusion defects . No perfusion defects despite bilateral vascular changes were noted in one patient (pt 14). Cerebral infarcts were detected on mri unilaterally in three subjects while multiple infarcts were identified in one . Tc99m - ecd brain spect showed bilateral perfusion defects in one patient with unilateral mri infarcts while in the rest of the patients the defects were more extensive compared to mri . Follow up studies following surgical procedures (myo - dura synangiosis) was done in two patients and showed partial resolution of perfusion defects in the involved areas . Perfusion defects of the individual patients in the respective cerebral areas are depicted in the table . Moyamoya disease is characterised by steno - occlusive changes in the terminal internal carotid artery and involving the proximal portions of the anterior or the middle cerebral arteries with abnormal vascular networks seen in the vicinity of the steno - occlusive disease . Extensive fibocellular intimal thickening and deposits of thrombi and lipids with proliferation of smooth muscle cells is the pathogenic feature of the disease . Cerebral angiography is considered the gold standard investigation in moyamoya disease as the demonstration of the internal carotid stenosis with formation of collaterals is very effective . Mri and ct scans also demonstrate the squeal of the pathology in the form of infarcts and intra - cerebral, subarachnoid and intra - ventricular haemorrhages . Tissue level changes of the altered flow dynamics have not been well elucidated in moyamoya disease . In our study we have found that though vascular changes are seen bilaterally (5/14 i.e. 35.7%), in majority of the cases unilateral perfusion defects alone are noted . In their study, ogata et al, found that the rate of vascular events was lower in patients with unilateral spect perfusion defects middle cerebral artery territory, i.e. Frontal lobe and parts of the parietal lobe and basal ganglia are most frequently involved [figure 1]. The presence of artero - venous malformation along with features of moyamoya disease in one patient can possibly explain such a phenomenon (pt 13). Progression of posterior circulation defects after revascularisation has been described in a study by huang et al . Tc99m - ecd brain perfusion spect images in transaxial, sagittal and coronal views showing extensive perfusion defects in the left frontal and parietal lobes tc99m - ecd brain perfusion spect images in transaxial, sagittal and coronal views showing moderate perfusion defects in the right occipital cortex (posterior circulation) along with the parietal, temporal and the thalamus good cerebrovascular reserve was found post acetazolamide in two patients [figure 3]. Though the drawback in our study was the usage of oral acetazolamide preparation, obvious visual improvement was noted in the images suggesting adequate effect of the drug . Presence of good cerebro - vascular reserve is a known good prognostic factor indicating lesser chances of future events or interventions . Tc99m - ecd brain perfusion spect images in transaxial views showing perfusion defect in the right broca's area (a) which shows improvement (b) in the post acetazolamide study our study demonstrates that though the pathological process occurs in the arteries, tc99m - ecd brain spect reflects the result of these pathogenic changes on the cerebral tissue . The perfusion defects might involve both anterior and posterior circulations unilaterally or bilaterally and are better delineated in perfusion imaging compared to anatomical imaging modalities . Demonstration of infarcts in posterior cerebral artery territory adds prognostic value, predicting occurrence of future infarcts . Oral acetazolamide is also effective in demonstration of cerebrovascular reserve though not the ideal mode of administration . Our study is lacking adequate follow - up of the patients to show the prognostic implications of the findings of perfusion scintigraphy . We conclude that brain perfusion scintigraphy is an indispensible adjunct in evaluation of patients with moyamoya disease yielding information about the direct end results of the pathology in the vessels and also prognostic information.
|
W ostatnich latach coraz czciej wprowadza si do leczenia chirurgicznego choroby wiecowej zabieg pomostowania aortalno - wiecowego bez uycia krenia pozaustrojowego (off - pump coronary artery bypass opcab). Zabieg przeprowadzany na bijcym sercu uwaa si za mniej inwazyjny, poniewa pozwala unikn efektw ubocznych zwizanych ze stosowaniem krenia pozaustrojowego . Celem badania byo porwnanie iloci przetaczanych preparatw krwi w dwch grupach pacjentw operowanych z powodu choroby niedokrwiennej serca przy uyciu techniki pomostowania aortalno - wiecowego bez uycia krenia pozaustrojowego lub z uyciem krenia pozaustrojowego (cardiopulmonary bypass cpb). Grupa i skadaa si z 84 osb (64 mczyzn i 20 kobiet), w rednim wieku 63,74 7 lat, ktre poddano zabiegowi z uyciem techniki opcab, a grup ii tworzyo 60 osb (54 mczyzn i 14 kobiet), w rednim wieku 63,51 6 lat, ktre poddano zabiegowi z uyciem pucoserca (cpb). 2,27 0,3 (grupa opcab) i 2,63 0,6 (grupa operacji w kreniu pozaustrojowym / grupa cpb) (p <0,05). Rednia liczba jednostek koncentratu krwinek czerwonych podanych w grupie opcab wyniosa 2,31 0,18 jednostek na pacjenta, a w grupie cpb rednia liczba jednostek wieo mroonego osocza wyniosa 1,13 0,13 w grupie opcab i 1,57 0,15 w grupie cpb (p <0,05). Recent years have seen a growing interest in off - pump coronary artery bypass surgery . The majority of cardiac procedures are performed on cardiopulmonary bypass, with blood transfusions being part of the procedure . As the extracorporeal circulation causes many side effects involving blood components, the restoration of hemoglobin concentration by means of transfusion is almost always essential . Systemic inflammatory response syndrome (sirs) is usually self - limiting and may involve most organs [5, 6]. Hemostatic disturbances secondary to cpb may cause such serious complications as disseminated intravascular coagulation (dic) [7, 8]. There were 152 patients (118 men and 34 women) at the mean age of 63 14 years enrolled in the study . The opcab group included 84 patients (64 men and 20 women) at the mean age of 64 7 years and the cpb group included 68 patients (54 men and 14 women) at the mean age of 63 6 years . The mean preoperative left ventricular ejection fraction was 53 9% and 51 8%, respectively . Demographic and clinical data are presented in table i. all procedures were performed as a result of stable angina pectoris . 1.03 mmol / l in the opcab group vs. 8.78 0.70 in the cpb group . The mean hematocrit values were 0.41 0.05 in the opcab group vs. 0.42 0.03 in the cpb group, ns . There was no difference in serum platelet concentration, which was 251.42 74.01 demographical and perioperative data heparin was administered at the dose of 2 mg / kg in the opcab group and 3 mg / kg in the cpb group, and the desired act was 350 s and 480 s, respectively . Postoperatively, heparin was neutralized by protamine administered at the dose of 1 mg per 1 mg of heparin . The cpb group was subsequently subjected to the procedures of ascending aorta and right atrium cannulation . Cardiopulmonary bypass was conducted in moderate hypothermia (27 - 29c) with cold, crystalloid cardioplegia administered antegrade in accordance with the st . The octopus iii (medtronic, usa) stabilization system was used and intraluminal shunts were applied during each distal anastomosis . The obtained data were entered and analyzed using the statview 5.0 software (sas institute, inc ., continuous variables were described as mean values sd and compared using student's t - test or the mann - whitney u - test . The test or fisher's exact test was chosen to compare categorical variables . To evaluate changes over time, we used repeated measures analysis of variance (anova). The obtained data were entered and analyzed using the statview 5.0 software (sas institute, inc ., cary, nc, usa). Continuous variables were described as mean values sd and compared using student's t - test or the mann - whitney u - test . The test or fisher's exact test we used repeated measures analysis of variance (anova). Values of p <0.05 were considered significant . There were no perioperative deaths and no case of postoperative low cardiac syndrome was found in the study groups . There were 12 patients (14%) in the opcab who did not require any blood product transfusions . Two reoperations (2.4%) in the opcab group and three (4.4%) in the cpb group were performed due to excessive bleeding (p <0.05). The mean cardiopulmonary bypass time was 63 18 minutes and the mean cross clamping time was 43 11 minutes in the cpb group . The mean packed red blood cells, fresh frozen plasma and platelet units transfused in the opcab group were 2.31 0.18, 1.13 0.13 and 0.28 0.16, respectively . The mean packed red blood cells, fresh frozen plasma and platelet units transfused in the cpb group were 3.94 0.30, 1.57 0.15 and 0.23 0.16, respectively . There was a statistically significant difference in the mean packed red blood cells (2.31 0.18 vs. 3.94 0.30, p <0.05) and fresh frozen plasma (1.13 0.13 vs. 1.57 0.15, p <0.05) transfusion rate between the groups . There was a difference in the mean serum hemoglobin concentration between the groups (opcab 7.79 0.91 mmol / l vs. cpb 7.03 0.88 mmol / l six hours after surgery, p <0.05 and opcab 7.47 1.10 mmol / l vs. cpb 7.17 0.99 mmol / l one day after surgery). Figure 1 presents the differences in the serum hemoglobin concentration between the groups after surgery . The platelet count was comparable before the procedure (199 61 10/l vs. 178 41 10/l in the opcab and cpb group, respectively). The platelet count after surgery decreased progressively from 205 56 10/l, 192 53 10/l one day after surgery to 169 57 10/l on the 7 postoperative day . On the other hand, the platelet count after surgery increased progressively in the cpb group from the initial 155 41 10/l, 165 43 10/l one day after surgery to 369 72 10/l on the 7 postoperative day . Hemoglobin concentration after surgery in opcab and cpb group there was also a statistically significant difference in postoperative drainage between the two groups (opcab: 755.54 42.82 ml vs. cpb: 895.74 47.35 ml, p <0.05). The first successful use of the heart - lung machine on humans occurred in 1953, when john gibbon performed surgery on a 15-month - old girl, celia bavolek, at jefferson hospital in philadelphia . Eleven years later, in 1964, the russian surgeon kolessov performed the first successful heart bypass surgery on a beating heart . Surgical revascularization was soon demonstrated to provide excellent survival results and relief of symptoms [11, 12]. Renewed interest in beating - heart bypass grafting in the mid-1990s resulted from the option of revascularization without the potential complications of extracorporeal support . Although the theoretical advantages of opcab procedures are generally accepted, the use of this technique still remains sporadic . For example, off - pump surgery constitutes only 20 to 25% of all coronary artery bypass procedures performed in the united states . A debatable issue is that of graft patency rates, which seem to be at least equivalent to those observed in the case of conventional techniques . The advantage of off - pump coronary artery bypass can be supported by such important factors as reduced morbidity and mortality, rapid return to usual functional capacity, and economic benefits . Unfortunately, a lot of data reported in the literature concerning the outcomes of off - pump bypass grafting have been inconclusive as to the overall benefit of the technique . Although the opcab technique eliminates cardiopulmonary bypass and hypothermic cardiac arrest, the manipulation of the ascending aorta by partial clamping has for the most part not been eliminated . So far, there have been 37 randomized clinical trials published, comparing opcab versus conventional cabg . No randomized trials have shown a significant reduction in the occurrence of stroke or myocardial infarction, acute renal failure, intra - aortic balloon pump (iabp) requirement, mediastinitis or wound infection, the recurrence of angina, or the need for reintervention within 30 days of opcab, in comparison with conventional cabg . Similar results were obtained at 1 and 3 years after surgery . In the present study, there was a reduction of blood cell product transfusions in the opcab group, as compared to the cpb group (table ii). Opcab procedures make it possible not only to limit the number of transfusions but to eliminate transfusions altogether [16, 17]. The elimination of blood product transfusion can be essential in the case of patients with religious restrictions, such as jehovah witnesses . Blood products transfusions the serum hemoglobin concentration in the opcab group remains stable throughout the postoperative period, as presented in table i. at the same time, we can observe a decline in the hemoglobin concentration in conventional cabg patients until the 12 postoperative hour . The restitution of the hematocrit level was achieved by administering packed red cell transfusions thereafter . Off - pump surgery allows for reducing the rate of blood product transfusions or eliminating them altogether . Patients undergoing conventional cabg surgery were characterized by higher postoperative drainage, presumably due to more serious coagulation disturbances.
|
Myocardial infarction (mi), and subsequent reperfusion injury, is the most common and clinically significant form of acute cardiac injury and results in the ischemic death of cardiomyocytes.1,2 among the pathological mechanisms underlying myocardial ischemia / reperfusion (mi / r) injury, inflammation and inflammatory cell infiltration, together with the activation of innate and adaptive immune responses, are the hallmark of mi and reperfusion injury.3,4 ischemic cardiac injury activates the innate immune response via toll - like receptor (tlr)-mediated pathways and upregulates the chemokine and cytokine syntheses in the infarcted heart . Tlrs, which are expressed by inflammatory cells and also on endothelial cells and cardiomyocytes, can recognize endogenous danger signals released during cell death following myocardial ischemia and reperfusion.5,6 a growing body of evidence suggests that modulating tlr activation may enhance the benefits and blunt the negative effects of the inflammatory response, providing new therapeutic options for preventing mi / r injury.6 chemokines stimulate the chemotactic recruitment of inflammatory cells into the infarct . One of the well - studied cc chemokines, cc chemokine ligand 2 (ccl2), is a potent chemoattractant for monocytes, macrophages, t cells, and nk cells; cc chemokine receptor 2 (ccr2), the receptor for ccl2, is mainly expressed by monocytes and macrophages . The ccl2/ccr2 signaling pathway has been implicated in postischemic inflammatory response, and pharmacological inhibition or genetic targeting of the ccl2/ccr2 pathway might represent an attractive approach to blunt excessive inflammation and prevent detrimental ventricular remodeling.712 various cytokines promote adhesive interactions between leukocytes and endothelial cells, resulting in the transmigration of inflammatory cells into the site of injury . The recruitment of inflammatory cells is a dynamic and superbly orchestrated process comprising sequential infiltration of the injured myocardium with neutrophils, mononuclear cells, dendritic cells (dcs), and lymphocytes.3,4,13 neutrophils migrate into the infarcted myocardium during the first hours after the onset of ischemia and peak after one day.1 thereafter, monocytes and their descendant macrophages dominate the cellular infiltration and release inflammatory mediators, reactive oxygen species, and proteolytic enzymes, contributing to the initiation and resolution of inflammation, phagocytosis, proteolysis, angiogenesis, infarct healing, and ventricular remodeling.1,3,14 meanwhile, dcs and t lymphocytes are recruited into the injured myocardium, contributing to wound healing and ventricular remodeling.1517 both detrimental effects and the beneficial role of these inflammatory cells have been documented in the pathophysiology of mi and reperfusion injury, and the diverse and seemingly conflicting roles may be attributable to the subset heterogeneity and functional diversity of the inflammatory cells.3,4 mi / r triggers a complex inflammatory reaction accompanied by cytokine release and inflammatory leukocyte infiltration into the endangered myocardial region.1,3,4,18 although the inflammatory response and cytokine elaboration after mi / r are integral to the healing process and contribute to left ventricular (lv) remodeling, excessive inflammatory responses after mi / r injury are detrimental for cell survival and extracellular matrix integrity via an enhanced activation of proapoptotic signaling pathways, with subsequent poor clinical outcome.3,19,20 these findings suggest that an inflammatory reaction is essential for the healing process, and thus, no effective therapeutic strategy against inflammation has been established.4 it has been widely accepted that myocardial infarct healing and post - mi remodeling are processes in which leukocytes, cytokines, and chemokines play both a beneficial role and a detrimental role.3,4,20 recent studies have demonstrated that recruited monocytes / macrophages persist for days in the infarct zone and contribute to inflammation, phagocytosis, proteolysis, angiogenesis, and collagen deposition . Reduced macrophage infiltration resulted in decreased inflammation, diminished interstitial fibrosis, and attenuated lv remodeling and dysfunction . On the other hand, macrophage participation is integral to wound healing and tissue repair after mi.3,4,21 as shown in figure 1, these diverse and seemingly contrasting functions might be attributed to macrophage heterogeneity, which is characterized by differential activation, distinct phenotypes, and diverse functions . Hence, the challenge lies in ameliorating the detrimental inflammatory response while not affecting the tissue repair response . The innate immune system is activated after various forms of tissue injury and triggers immune responses in the host.22 the role of innate immune responses in cardiac ischemic injury and tissue repair has been shown to be more pivotal than first thought . The innate immune system contributes importantly to the progression of myocarditis and the remodeling process after mi.2325 our understanding of the pathogenesis of mi / r injury became much clearer with the discovery of tlrs . Tlrs are expressed by leukocytes and recognize pathogen - associated molecular patterns and endogenous danger signals released during cell death.22 tlrs are also expressed in cells with no direct role in host innate immune responses, such as endothelial cells and cardiomyocytes.26 on activation, tlrs exert their inflammatory response through nuclear factor kappa - light - chain - enhancer of activated b cells (nf-b) translocation to the nucleus.5,6,27 thus, tlrs hold great promise as a therapeutic target within the innate immune system, for cardiac ischemia and other conditions, without affecting host defense or proper scar formation after infarction . Modulating tlr activation may enhance the benefits, blunt the negative effects of the inflammatory response, and provide new therapeutic options after mi / r injury . This concept is supported by observations in tlr knockout mice.2831 tlr4-deficient mice sustained smaller infarctions and exhibited less inflammation after mi / r injury.28 ex vivo experiments showed that tlr2 hearts performed better than wild - type hearts after mi / r injury,29 and tlr2 mice were protected against endothelial dysfunction after mi / r injury.30 circulating tlr2 was also demonstrated to mediate mi / r injury . Administration of a tlr2 antagonist just five minutes before reperfusion reduced infarct size and improved cardiac performance and geometry . Furthermore, antagonizing tlr2 reduced inflammation and cell death after infarction.31 thus, tlr2 has been established as a new therapeutic target for the treatment of acute ischemic and reperfusion injury, even when it is initiated in the late ischemic period . In the setting of mi, deficient tlr2 or tlr4 signaling in mice prevented adverse cardiac remodeling, resulting in preserved cardiac function and geometry after mi.24,32 in addition to tlr signaling, activation of the innate immune system through interleukin-1 receptor - associated kinase 4 (irak-4) signaling was important for bone marrow - derived dc mobilization and maturation, contributing to post - mi mortality and adverse remodeling . In irak-4 knockout mice, attenuation of toll / interleukin-1 receptor signaling resulted in lower expression of cytokines and decreased inflammation through blunted innate immune response.15 as the cause of inappropriate activation of the inflammatory response after mi, an autoimmune reaction is a possible mechanism of unnecessary inflammatory reactions induced secondary to myocardial injury.33,34 it has been demonstrated that cardiac myosin acts as an endogenous ligand for tlr2 and tlr8,35 and the presence of autoimmunity to cardiac myosin and troponin is associated with an adverse clinical outcome after mi.34,36,37 additionally, lymphocytes obtained from the spleen of rats that have suffered mi can injure normal cardiomyocytes,38 and heart failure was induced by adoptive transfer of splenic lymphocytes from rats after mi.33 furthermore, mice preimmunized with murine cardiac troponin i displayed greater infarct size, increased more significant fibrosis, higher inflammation score, and more cardiac dysfunction after mi.37 these findings indicate that myocardial damage results in the release of not only endogenous ligands of tlrs but also self - antigens . Taken together, autoimmune responses against myocardial antigens may contribute to secondary myocardial injury after mi and may be a new mechanism of maladaptive lv remodeling after mi . Chemokine expression is a prominent feature of the postinfarction inflammatory response, and as an essential player in inflammatory leukocyte trafficking, chemokines are involved in i / r injury, myocardial healing, infarct angiogenesis, and scar formation after mi.39 in addition, chemokines exert important effects on nonhematopoietic cells, such as endothelial cells, smooth muscle, and fibroblasts, and may modulate fibrous tissue deposition and wound angiogenesis.40 one of the extensively studied cc chemokines, ccl2, which was originally named monocyte chemoattractant 1, is a potent chemoattractant for monocytes, t cells, and nk cells and has been implicated in a wide variety of diseases characterized by monocyte - rich leukocyte infiltrates.40 ccl2 upregulation has been observed in murine, rat, and canine models of mi / r.7,41 in the canine model of reperfused infarction, induction of ccl2 mrna occurred only in ischemic segments within the first hour of reperfusion, peaked at three hours, and was localized by immunostaining on the venular endothelium.7 ccl2 mrna levels were increased by 40-fold in the noninfarcted lv one day after left coronary artery ligation, and increased levels persisted for 28 days.7 ccl2 expression was also increased in both experimental and clinical heart failures.42,43 enhanced myocardial ccl2 expression contributed to reperfusion injury, infarct healing, and ventricular remodeling through the following two mechanisms: ccl2-induced infiltration and activation of inflammatory cells, such as monocytes / macrophages and lymphocytes,7,9,10,39 and ccl2-induced transcription factor causing cardiac cell death and ventricular dysfunction.44 ccl2 also promotes the induction of other cytokines, matrix metalloproteinase, and transforming growth factor- through an autocrine / paracrine mechanism,40,45,46 thus modulating fibrous tissue deposition and wound healing . Given the essential effects of ccl2 signaling on different cell types involved in the postischemia inflammatory response, the pharmacological inhibition or genetic targeting of ccl2/ccr2 signaling might represent an attractive approach to blunt excessive inflammation and decrease monocyte / macrophage infiltration, thereby promoting infarct healing and preventing detrimental ventricular remodeling . In agreement with this concept is the fact that ccl2-deficient mice display a decreased and delayed macrophage infiltration and myofibroblast accumulation associated with a diminished interstitial fibrosis, improvement of lv dysfunction and regional hypocontractility after mi / r.9,10 similarly, administering a ccl2 competitor reduced inflammatory monocyte recruitment, limited neointimal hyperplasia, and attenuated mi / r injury in mice.12 moreover, anti - ccl2 gene therapy improved the post - mi survival rate, which was associated with a decreased macrophage recruitment and an attenuated contractile dysfunction, interstitial fibrosis, and lv cavity dilatation.7 genetic deletion of ccr2 resulted in a decreased macrophage infiltration and a reduced tnf- and matrix metalloproteinase expressions, which might contribute to the attenuation of lv remodeling after mi.8 nahrendorf et al showed that pretreatment of mice for three days with a lipid nanoparticle that encapsulated a short interfering rna targeting ccr2 prior to the induction of mi / r injury resulted in reduced numbers of monocytes and macrophages in the heart and reduced the infarct size by 34%.14 the recruitment of inflammatory cells is a dynamic, well - organized process with sequential infiltration of the injured myocardium with neutrophils, mononuclear cells, dcs, and lymphocytes.3,4,20 a growing number of studies have demonstrated that recruited monocytes / macrophages persist for days in the infarct zone and contribute to inflammation, phagocytosis, proteolysis, angiogenesis, collagen deposition, and ventricular remodeling in the setting of myocardial reperfusion injury and postinfarction healing.710,19,20,4749 on one hand, excessive and prolonged infiltration of inflammatory macrophages into the infarct myocardium is harmful, contributing to excessive inflammatory response, tissue destruction, interstitial fibrosis, cardiac dysfunction, and adverse ventricular remodeling.710 on the other hand, a controlled recruitment of macrophages is essential to wound healing and tissue repair through phagocytosis of necrotic cells, facilitating angiogenesis and extracellular matrix reconstruction in the ischemia - injured myocardium and the infarct.48,49 these diverse and seemingly conflicting functions may be attributable to macrophage heterogeneity as characterized by differential activation, distinct phenotypes (m1: classically activated macrophages and m2: alternatively activated macrophages), and diverse functions, both pathogenic and protective.5052 the subset heterogeneity and function diversity also hold true for the monocytes . As reported by nahrendorf et al.14, infarcted hearts modulate their chemokine expression profile over time, and they sequentially and actively recruit ly-6c and ly-6c monocytes via ccr2 and cx3cr1, respectively . Ly-6c monocytes digest damaged tissue, whereas ly-6c monocytes promote healing via myofibroblast accumulation, angiogenesis, and collagen deposition.3,4,14 thus, a therapeutic strategy targeting ccr2 monocyte / macrophage migration is a promising approach for treating numerous inflammatory diseases without disrupting inflammation resolution, which is associated with noninflammatory monocytes and alternatively activated macrophages . Consistent with this concept, recent comprehensive analysis of mouse cardiac macrophage subsets in a steady state and during inflammation have revealed that proinflammatory macrophages, which comprise half of all ly-6c monocytes and mhcii cd11c ccr2 macrophages, specifically express ccr2.53 this finding might explain why short interfering rna, targeting the ccr2 axis that blocks the monocyte / macrophage lineage, was successful in preventing the ischemic cardiac injury.14 the role of monocytes / macrophages in mi / r injury and postinfarction healing is a double - edged sword, as illustrated in figure 1 . Monocyte / macrophage recruitment is integral to the infarct healing; on the other hand, an uncontrolled inflammatory cell infiltration may exacerbate reperfusion injury and compromise the reparative functions mediated by these cells . Thus, the challenge is how to ameliorate the detrimental effects of proinflammatory monocytes / macrophages, while sparing the beneficial roles of the reparative or regulatory macrophages . The existence of monocyte / macrophage subset heterogeneity and their biphasic recruitment in response to ischemic injury provide a possible solution . A recent study has demonstrated that knocking down interferon regulatory factor 5, which is a critical transcription factor favoring m1 polarization, decreased infiltration of m1 and ameliorated inflammation following mi, thereby improving infarct healing.54 additionally, nuclear receptor subfamily 4, group a, member 1, was demonstrated to be essential to ly-6c monocyte production . In the absence of nuclear receptor subfamily 4, group a, member 1, ly-6c monocytes expressed increased levels of ccr2 on their surface, avidly infiltrated the myocardium, and differentiated to proinflammatory macrophages, resulting in defective healing and compromised heart function.55 these findings suggest that therapeutics targeting distinct macrophage lineages by genetic manipulation of polarity - determining genes may serve as new treatments for cardiovascular diseases . Stem cell therapy has been considered as the promising therapeutic in treating cardiovascular diseases, and many preclinical studies and clinical trials reported beneficial effects of stem cell therapy on infarct healing, although the underlying mechanism remains poorly understood . A recent study has provided an insightful explanation that the cardioprotective effects of mesenchymal stromal cell treatment might be attributed to the cross talk between injected stem cells and macrophages.56 mesenchymal stromal cell treatment reshaped the macrophage response by favoring m2 polarization, resulting in increased numbers of m2 and changed cytokine profile of macrophages, thereby improving postinfarction healing.56 dcs and their precursors are considered sentinels of the immune system, and they circulate through the blood and nonlymphoid peripheral tissues, where they become resident cells over time.57 after pathogen invasion or tissue injury, dc precursors accumulate rapidly in the local infected or injured tissues.57 as early as 1993, it was demonstrated that dcs infiltrated the injured myocardium and participated in the activation of lymphocytes after mi.58 however, both detrimental effects and beneficial or regulatory roles of dcs in the postinfarction healing and remodeling were observed.15,16,59 it has been demonstrated that g - csf improved early postinfarction lv remodeling through decreased dcs infiltration and suppression of dc - mediated immunity.59 bone marrow - derived dcs mobilization, mediated via irak-4 signaling, contributed to postinfarction myocardium apoptosis, th1 cytokine expression, and interstitial fibrosis, leading to an increased mortality and an adverse lv remodeling.15 by contrast, in transgenic mice expressing diphtheria toxin receptor on dcs, which allowed the investigator to specifically deplete dcs by injecting diphtheria toxin, dcs were demonstrated to be a potent immunoprotective regulator during the postinfarction healing process via control of monocyte / macrophage homeostasis.16 in addition, dcs were suggested to regulate the development of autoimmune heart failure through the recognition of heart - specific peptides.60 in addition to neutrophils, monocytes / macrophages, and dcs, lymphocytes are also present in the ischemic and reperfused myocardia and the infarct . Cd4 t lymphocytes accumulate in the infarct zone early during reperfusion, and the infarct - sparing effect of adenosine a2a receptor activation is primarily due to inhibition of cd4 t cells infiltration and activation in the reperfused heart.61 hofmann et al.17 demonstrated that cd4 t cells proliferated in draining lymph nodes shortly after ischemic injury, and cd4 t - cell - deficient mice displayed higher total numbers of leukocytes and proinflammatory monocytes and increased lv dilation as determined by serial echocardiography up to day 56 after mi . Additionally, foxp3 cd4 regulatory t cells (treg) contributed to inflammation resolution and beneficially influenced infarct healing by modulating monocyte / macrophage differentiation . Mechanistically, treg cell depletion was associated with m1-like polarization, characterized by decreased expression of inflammation - resolving and healing - promoting factors . Therapeutic treg cell activation induced an m2-like differentiation within the healing myocardium, associated with myofibroblast activation and increased expression of monocyte / macrophage - derived proteins, fostering wound healing.62 apart from t lymphocytes, the interaction between mature b lymphocytes and monocytes was also involved in myocardial ischemic injury and maladaptive lv remodeling . Mature b lymphocytes selectively produce ccl7 and induce ly6c monocyte mobilization and recruitment to the heart, leading to an enhanced tissue injury and deterioration of myocardial function . Genetic or antibody - mediated depletion of mature b lymphocytes impeded ccl7 production and monocyte mobilization, attenuated myocardial injury, and improved cardiac function.63 collectively, these findings suggest that therapeutic modulation of lymphocytes constitutes a new approach to improve infarct healing post - mi . Postinfarction immunoinflammation, as characterized by inflammatory cell infiltration and the activation of innate and adaptive immune responses, is essential to cardiac injury and repair . The inflammatory cascade may provide unique opportunities for interventions aimed at reducing cardiomyocyte injury while optimizing the healing response and attenuating adverse remodeling . Timely resolution of the inflammatory infiltrate and spatial containment of the inflammatory and reparative response into the infarcted area are essential for optimal infarct healing . For instance, targeting proinflammatory leukocyte subsets, to dampen detrimental inflammation while sparing the wound healing roles of the anti - inflammatory monocytes / macrophages, may reduce cardiomyocyte injury and adverse remodeling . Despite the challenges ahead, we are hopeful that new therapies for myocardial ischemia and reperfusion will soon be integrated into clinical practice.
|
Team working in health care involves interaction among health professionals who work interdependently to provide a given type of care.13 multiprofessional team working has been classified into three major types, each of which has its own characteristics related to the amount and type of collaboration among team members.4 these include multidisciplinary, interdisciplinary, and transdisciplinary team working.47 the need for team working and collaboration in health care delivery for the purpose of improving patient outcomes has been a major area of research in the last two decades.810 team working has been shown to be desirable for achieving quality outcomes in health services through facilitation of information flow and coordination and provision of health care within the increasing diversity of disciplines in health care.11 studies have shown that team work is an important factor in prevention of adverse patient events in health care.12 in nigeria, anecdotal evidence shows that clinical services are often organized along strict professional lines and teams are formed by and within individual professions independent of one another . Consultant - led obstetrics and gynecology teams (units), for instance, are made up of doctors only and deliver services along strict professional lines . Nursing care is often organized according to wards and clinics, and complements the medical care in those wards and clinics . Collaboration among these groups occurs only to the extent that each group carries out its functions to permit patient care to proceed in a coordinated fashion . A semblance of multiprofessional teams can be found only in high dependency units such as accident and emergency departments, labor wards, intensive care units, and newborn special care units . While the literature on multiprofessional collaboration in health care has steadily increased in north america and europe, and multiprofessional collaboration has been promoted by the world health organization,1317 little is known about collaborative models of health care in africa where team working is necessary, among other benefits, to address perennial challenges such as staff shortages and interprofessional conflicts in the health sector . We found no studies that addressed team working in obstetrics and gynecology practice in south east nigeria . The aims of this study were to describe the knowledge of interdisciplinary team working among obstetricians and gynecologists in two teaching hospitals in south east nigeria and to determine their attitude toward development of an interdisciplinary collaborative approach to patient care in these institutions . South east nigeria is made up of five states and has a combined population of approximately 20 million according to the 2006 nigeria national census.18 the area is served by ten university teaching hospitals . This study took place at two of these centers in enugu and ebonyi states, namely, the university of nigeria teaching hospital enugu and the federal teaching hospital abakaliki, in ebonyi state . Both centers had a total of approximately 160 doctors working in the obstetrics and gynecology departments . The study covered the period from december 1, 2013 to january 30, 2014 . Ethical clearance for the study was obtained from the research ethics committees of the two study centers . . A convenient sample of two hospitals was selected from the ten teaching hospitals in the south east geopolitical zone of nigeria . Doctors were approached in their outpatient clinics and informed about the study and their consent sought . Those who agreed to participate in the study were given the questionnaire (see supplementary materials section) and asked to bring the completed questionnaire to their next clinic for collection . In all, 140 doctors working in the obstetrics and gynecology departments of both hospitals were given the questionnaire . A 25-item, self - administered, anonymized, semistructured questionnaire developed for the study was used for data collection . The questionnaire was pretested in a group of 20 resident doctors in a sister department (pediatrics) at the university of nigeria teaching hospital, enugu . The questionnaire was in four parts: the first part was concerned with sociodemographic data; the second explored current interprofessional relationships among health workers; the third explored the respondents awareness and knowledge of multiprofessional and interdisciplinary team working; and the fourth focused on their perceptions of and attitude toward interprofessional team working . The statistical analysis was done using statistical package for the social sciences version 17.0 software for windows (spss inc ., the main outcome measures were the proportion of respondents who had good knowledge of interdisciplinary team working and the proportion that had a good attitude toward interdisciplinary team working . The statistical analysis was done using statistical package for the social sciences version 17.0 software for windows (spss inc ., the main outcome measures were the proportion of respondents who had good knowledge of interdisciplinary team working and the proportion that had a good attitude toward interdisciplinary team working . A total of 140 questionnaires were distributed, of which 116 were returned, giving a response rate of 82.9% . Approximately 74% of respondents were of the opinion that existing arrangements that emphasized strict professional boundaries in the formation and functioning of clinical service units in the different health professions inadvertently promoted professional segregation and rivalry . Approximately 78% (91/116) believed that interprofessional conflicts / rivalry hinders delivery of medical care in the study centers; this opinion was expressed by 66% of consultants, 83% of senior registrars, 79% of registrars, and 76% of senior house officers . Approximately 55.2% (64/116) of respondents had observed interprofessional conflicts in their work places . The commonest sources of conflict were assertion of professional boundaries (48.3%, 56/116), superiority (36.2%, 42/116), accusation of incompetence (30.2%, 35/116), and accusation of irresponsibility (18.9%, 22/116). The most common interprofessional conflict / rivalry identified was between doctors and other health workers . Table 2 summarizes the responses of participants to questions on knowledge of and attitude to interprofessional team working . Approximately 74.1% (86/116) of respondents stated that they were aware of the concept of interdisciplinary team working, with 15% of these having very good knowledge, 35% having good knowledge, and 29% having poor knowledge . Approximately 37% (32/86) of respondents who were aware of team working reported received formal teaching / training on multiprofessional team working in the course of their professional development . Approximately 71% (61/86) of the respondents believed that medical care would be best delivered by interdisciplinary teams, and 74.1% (64/86) felt that interprofessional team working was feasible in nigeria . Seventy - three percent (63/86) felt that interdisciplinary team working would be necessary for the development and functioning of subspecialty units in obstetrics and gynecology at nigerian hospitals . Approximately 77.6% (67/86) of respondents who were aware of team working believed that interdisciplinary teams would be useful in obstetrics and gynecology practice in nigeria, with 89% of these (60/67) rating its prospects as very useful . A total of 140 questionnaires were distributed, of which 116 were returned, giving a response rate of 82.9% . Approximately 74% of respondents were of the opinion that existing arrangements that emphasized strict professional boundaries in the formation and functioning of clinical service units in the different health professions inadvertently promoted professional segregation and rivalry . Approximately 78% (91/116) believed that interprofessional conflicts / rivalry hinders delivery of medical care in the study centers; this opinion was expressed by 66% of consultants, 83% of senior registrars, 79% of registrars, and 76% of senior house officers . Approximately 55.2% (64/116) of respondents had observed interprofessional conflicts in their work places . The commonest sources of conflict were assertion of professional boundaries (48.3%, 56/116), superiority (36.2%, 42/116), accusation of incompetence (30.2%, 35/116), and accusation of irresponsibility (18.9%, 22/116). The most common interprofessional conflict / rivalry identified was between doctors and other health workers . Table 2 summarizes the responses of participants to questions on knowledge of and attitude to interprofessional team working . Approximately 74.1% (86/116) of respondents stated that they were aware of the concept of interdisciplinary team working, with 15% of these having very good knowledge, 35% having good knowledge, and 29% having poor knowledge . Approximately 37% (32/86) of respondents who were aware of team working reported received formal teaching / training on multiprofessional team working in the course of their professional development . Approximately 71% (61/86) of the respondents believed that medical care would be best delivered by interdisciplinary teams, and 74.1% (64/86) felt that interprofessional team working was feasible in nigeria . Seventy - three percent (63/86) felt that interdisciplinary team working would be necessary for the development and functioning of subspecialty units in obstetrics and gynecology at nigerian hospitals . Approximately 77.6% (67/86) of respondents who were aware of team working believed that interdisciplinary teams would be useful in obstetrics and gynecology practice in nigeria, with 89% of these (60/67) rating its prospects as very useful . This was an initial prevalence study to evaluate the feasibility of implementing interdisciplinary team working in nigerian hospitals . We chose to emphasize interdisciplinary team working because other types of multiprofessional team working may not suitable for our environment given our level of socioeconomic development . Multidisciplinary team working does not allow sufficient collaboration to tap the expertise of different professions, while the blurring of professional boundaries in transdisciplinary team working may require higher than existing levels of professional discipline and control in our society . We also chose to evaluate the knowledge and attitude of physicians first because doctors drive most clinical activities in our hospitals and their attitude to interdisciplinary collaboration could be key to operationalizing any policy to introduce interdisciplinary team working in government - owned health institutions in nigeria.19 our results show a high level of awareness of interprofessional team working among respondents . However, this did not translate into a high level of knowledge of the meaning of the concept of interprofessional team working . The results suggest that awareness was not based on a deep understanding of the meaning and content of interprofessional team working . This may not be surprising considering that a much smaller proportion of respondents had been exposed to formal teaching or training on interprofessional team working . Therefore, this study suggests that there might be a need for theoretical training of health workers on interdisciplinary team working in the study centers . Anecdotal evidence suggests that team working is not taught in medical or nursing schools in nigeria, unlike in europe, the uk, and the usa . While changes in the curricula of nigerian medical schools might need to include team working, short - term measures, such as workshops and update courses, could be organized for health workers to include topics on interprofessional team working . Meanwhile, a very high proportion of respondents agreed that interprofessional rivalry was an important feature of patient care in the two departments studied . This may mirror the situation of medical practice in the entire country, given a previous study showing that the recent industrial disputes in the nigeria health sector had been instigated by struggles between doctors and other health professionals for leadership of the health team.20 a high proportion of respondents in this study expressed the opinion that the current method of organizing clinical units in the different professions promoted unnecessary professional segregation and fanned rivalry . First, although they may still allow work in hospitals to proceed in a coordinated way, fractious relationships arising from them may delay the processes of care.21 secondly, they could engender an unfriendly working environment, which could impair the efficiency of individual health workers as well as that of the system itself.21 our results suggest that respondents acknowledged the need to begin to think about promoting professional collaboration in order to improve patient care in our hospitals . Our results also show that there was a significant desire for team working by doctors in the obstetrics and gynecology departments of the study centers . This finding suggests that the attitudes of doctors may not be an impediment to the establishment and implementation of collaborative interprofessional team working in this area . This finding is important, given the dominant position of doctors in public hospital services . Although this study involved only one department and a relatively small proportion of all health workers, our results suggest the need to begin to look into ways of entrenching collaborative care in our hospitals . More research will definitely be needed to determine the views of health workers across different professions; however, we do not expect the opinions of doctors in other departments in the study centers to be markedly different from those of their colleagues in the obstetrics and gynecology department . Curriculum developers should explore ways of increasing interprofessional education among the different health professions in nigeria in order to expose potential entrants into the professions to collaborative relationships early in their careers.22 the usefulness of interprofessional education in promoting and facilitating interdisciplinary team working has been extensively explored in the literature.2326 the limitations of this study include the use of a single profession and one department in each hospital, which limits the external validity of our results . Although qualitative studies should have been able to explore the opinions of respondents in greater detail, use of anonymized self - administered questionnaires enabled the respondents to express their opinions freely without bias . No formal psychometric analysis of the questionnaire was undertaken, but the ability of the questionnaire to elicit correct responses from respondents was ensured by pretesting and modification of the final version based on the results of the pretest . We conclude that there was a fair knowledge of the concept and a very positive attitude toward interprofessional team working among obstetricians and gynecologists in the study centers, suggesting that the attitude of physicians may not be an impediment to implementation of a collaborative interdisciplinary approach to clinical care in the study centers . Section 1 sociodemographic characteristics fill or tick as appropriate age (years) sex .religion (denomination).. professional rank ..institution / health facility where you work: tick as appropriate federal teaching hospital abakalikiuniversity of nigeria teaching hospitalwhich country did you have your basic medical degree? State as appropriate nigeriaukusagermanyothers: state as appropriate . Age (years) religion (denomination).. professional rank .. institution / health facility where you work: tick as appropriate federal teaching hospital abakalikiuniversity of nigeria teaching hospital federal teaching hospital abakaliki university of nigeria teaching hospital which country did you have your basic medical degree? State as appropriate nigeriaukusagermanyothers: state as appropriate . Others: state as appropriate . Section 2 current interprofessional relationship among health workers tick yes or no, or fill as appropriate do you think that current ways of organizing professional groups in patient care in your hospital promotes interprofessional conflicts? Tick yes or no yesnoare there any interprofessional conflicts that you have observed among your work colleagues and other professionals in your department? Yesnoif you ticked yes to the question above, state the type of conflicts that you have observed which of these have you experienced in the course of your work in your center? Tick as appropriate being told that some procedures are meant for other doctors or other professionalsbeing told by colleagues or other professionals that you should mind your own workworking in an arrangement where professional boundaries are emphasizedbeing reported to a higher officer for interfering with other peoples professional responsibilitieswhat do you consider the impediments to team working in obstetrics and gynecology care in nigerian hospitals? Do you think that current ways of organizing professional groups in patient care in your hospital promotes interprofessional conflicts? Tick yes or no yesno are there any interprofessional conflicts that you have observed among your work colleagues and other professionals in your department? Yesno if you ticked yes to the question above, state the type of conflicts that you have observed which of these have you experienced in the course of your work in your center? Tick as appropriate being told that some procedures are meant for other doctors or other professionalsbeing told by colleagues or other professionals that you should mind your own workworking in an arrangement where professional boundaries are emphasizedbeing reported to a higher officer for interfering with other peoples professional responsibilities being told that some procedures are meant for other doctors or other professionals being told by colleagues or other professionals that you should mind your own work working in an arrangement where professional boundaries are emphasized being reported to a higher officer for interfering with other peoples professional responsibilities what do you consider the impediments to team working in obstetrics and gynecology care in nigerian hospitals? Section 3 awareness and knowledge of interdisciplinary team working are you aware of the term interdisciplinary team working? Tick yes or no yesnohave you been exposed to any form of training on team working? Tick yes or no yesnoidentify the key components on interprofessional team working: tick five correct responses common decision - making processdecisions made by doctors as leaders of the health teamcommon goalgoals are based on individual professionsregular meetingsmeetings are held only when the leader choosescontribution of expertise in collective patient care within each professional areaprofessional expertise can be contributed in any area a member choosescommon approacheach profession chooses its own approach to patient care are you aware of the term interdisciplinary team working? Tick yes or no yesno have you been exposed to any form of training on team working? Tick yes or no yesno identify the key components on interprofessional team working: tick five correct responses common decision - making processdecisions made by doctors as leaders of the health teamcommon goalgoals are based on individual professionsregular meetingsmeetings are held only when the leader choosescontribution of expertise in collective patient care within each professional areaprofessional expertise can be contributed in any area a member choosescommon approacheach profession chooses its own approach to patient care common decision - making process decisions made by doctors as leaders of the health team goals are based on individual professions meetings are held only when the leader chooses contribution of expertise in collective patient care within each professional area professional expertise can be contributed in any area a member chooses each profession chooses its own approach to patient care section 4 attitude to interdisciplinary team working do you consider interdisciplinary team working as a useful approach to effective and sustainable high quality obstetrics and gynecology care in nigeria? Tick yes or no yesnohow would you rate the usefulness of interdisciplinary team working in the delivery of obstetrics and gynecology care? Tick only one as appropriate very usefulmoderately usefulusefulnot usefulwill you accept to work in a team where nurses and other health professionals share responsibilities for patient care with doctors? Tick as appropriate very readily acceptreadily acceptacceptbarely acceptnodo you think that interprofessional team working is necessary for the establishment and maintenance of subspecialty units in obstetrics and gynecology care in nigeria? Tick yes or no very happyhappybarely happynodo you think that it is feasible to form interprofessional teams in obstetrics and gynecology departments in nigerian hospitals? Tick yes or no yesnoare you happy to consult with and/or communicate your thoughts about patient care to nurses or other health workers in your team and have them offer their opinions to guide your decisions about patient care? Tick as appropriate very happyhappybarely happyno do you consider interdisciplinary team working as a useful approach to effective and sustainable high quality obstetrics and gynecology care in nigeria? Tick yes or no yesno how would you rate the usefulness of interdisciplinary team working in the delivery of obstetrics and gynecology care? Tick only one as appropriate very usefulmoderately usefulusefulnot useful will you accept to work in a team where nurses and other health professionals share responsibilities for patient care with doctors? Tick as appropriate very readily acceptreadily acceptacceptbarely acceptno do you think that interprofessional team working is necessary for the establishment and maintenance of subspecialty units in obstetrics and gynecology care in nigeria? Tick yes or no very happyhappybarely happyno do you think that it is feasible to form interprofessional teams in obstetrics and gynecology departments in nigerian hospitals? Tick yes or no yesno are you happy to consult with and/or communicate your thoughts about patient care to nurses or other health workers in your team and have them offer their opinions to guide your decisions about patient care? Section 1 sociodemographic characteristics fill or tick as appropriate age (years) sex .religion (denomination).. professional rank ..institution / health facility where you work: tick as appropriate federal teaching hospital abakalikiuniversity of nigeria teaching hospitalwhich country did you have your basic medical degree? State as appropriate nigeriaukusagermanyothers: state as appropriate . Age (years) religion (denomination).. professional rank .. institution / health facility where you work: tick as appropriate federal teaching hospital abakalikiuniversity of nigeria teaching hospital federal teaching hospital abakaliki university of nigeria teaching hospital which country did you have your basic medical degree? State as appropriate nigeriaukusagermanyothers: state as appropriate . Others: state as appropriate . Section 2 current interprofessional relationship among health workers tick yes or no, or fill as appropriate do you think that current ways of organizing professional groups in patient care in your hospital promotes interprofessional conflicts? Tick yes or no yesnoare there any interprofessional conflicts that you have observed among your work colleagues and other professionals in your department? Yesnoif you ticked yes to the question above, state the type of conflicts that you have observed which of these have you experienced in the course of your work in your center? Tick as appropriate being told that some procedures are meant for other doctors or other professionalsbeing told by colleagues or other professionals that you should mind your own workworking in an arrangement where professional boundaries are emphasizedbeing reported to a higher officer for interfering with other peoples professional responsibilitieswhat do you consider the impediments to team working in obstetrics and gynecology care in nigerian hospitals? Do you think that current ways of organizing professional groups in patient care in your hospital promotes interprofessional conflicts? Tick yes or no yesno are there any interprofessional conflicts that you have observed among your work colleagues and other professionals in your department? Yesno if you ticked yes to the question above, state the type of conflicts that you have observed which of these have you experienced in the course of your work in your center? Tick as appropriate being told that some procedures are meant for other doctors or other professionalsbeing told by colleagues or other professionals that you should mind your own workworking in an arrangement where professional boundaries are emphasizedbeing reported to a higher officer for interfering with other peoples professional responsibilities being told that some procedures are meant for other doctors or other professionals being told by colleagues or other professionals that you should mind your own work working in an arrangement where professional boundaries are emphasized being reported to a higher officer for interfering with other peoples professional responsibilities what do you consider the impediments to team working in obstetrics and gynecology care in nigerian hospitals? Section 3 awareness and knowledge of interdisciplinary team working are you aware of the term interdisciplinary team working? Tick yes or no yesnohave you been exposed to any form of training on team working? Tick yes or no yesnoidentify the key components on interprofessional team working: tick five correct responses common decision - making processdecisions made by doctors as leaders of the health teamcommon goalgoals are based on individual professionsregular meetingsmeetings are held only when the leader choosescontribution of expertise in collective patient care within each professional areaprofessional expertise can be contributed in any area a member choosescommon approacheach profession chooses its own approach to patient care are you aware of the term interdisciplinary team working? Tick yes or no yesno have you been exposed to any form of training on team working? Tick yes or no yesno identify the key components on interprofessional team working: tick five correct responses common decision - making processdecisions made by doctors as leaders of the health teamcommon goalgoals are based on individual professionsregular meetingsmeetings are held only when the leader choosescontribution of expertise in collective patient care within each professional areaprofessional expertise can be contributed in any area a member choosescommon approacheach profession chooses its own approach to patient care common decision - making process decisions made by doctors as leaders of the health team goals are based on individual professions meetings are held only when the leader chooses contribution of expertise in collective patient care within each professional area professional expertise can be contributed in any area a member chooses each profession chooses its own approach to patient care section 4 attitude to interdisciplinary team working do you consider interdisciplinary team working as a useful approach to effective and sustainable high quality obstetrics and gynecology care in nigeria? Tick yes or no yesnohow would you rate the usefulness of interdisciplinary team working in the delivery of obstetrics and gynecology care? Tick only one as appropriate very usefulmoderately usefulusefulnot usefulwill you accept to work in a team where nurses and other health professionals share responsibilities for patient care with doctors? Tick as appropriate very readily acceptreadily acceptacceptbarely acceptnodo you think that interprofessional team working is necessary for the establishment and maintenance of subspecialty units in obstetrics and gynecology care in nigeria? Tick yes or no very happyhappybarely happynodo you think that it is feasible to form interprofessional teams in obstetrics and gynecology departments in nigerian hospitals? Tick yes or no yesnoare you happy to consult with and/or communicate your thoughts about patient care to nurses or other health workers in your team and have them offer their opinions to guide your decisions about patient care? Tick as appropriate very happyhappybarely happyno do you consider interdisciplinary team working as a useful approach to effective and sustainable high quality obstetrics and gynecology care in nigeria? Tick yes or no yesno how would you rate the usefulness of interdisciplinary team working in the delivery of obstetrics and gynecology care? Tick only one as appropriate very usefulmoderately usefulusefulnot useful will you accept to work in a team where nurses and other health professionals share responsibilities for patient care with doctors? Tick as appropriate very readily acceptreadily acceptacceptbarely acceptno do you think that interprofessional team working is necessary for the establishment and maintenance of subspecialty units in obstetrics and gynecology care in nigeria? Tick yes or no very happyhappybarely happyno do you think that it is feasible to form interprofessional teams in obstetrics and gynecology departments in nigerian hospitals? Tick yes or no yesno are you happy to consult with and/or communicate your thoughts about patient care to nurses or other health workers in your team and have them offer their opinions to guide your decisions about patient care?
|
The frequency of chronic kidney disease (ckd) has been progressively increasing over the last two decades (1) and has become a worldwide public health problem . The prevalence of ckd is estimated to be 816% worldwide (2). Kidney transplantation is the best alternative treatment for end - stage renal disease and health - related quality of life and survival of the patients are improved compared with dialysis (3, 4). Worldwide, more than 1.4 million patients with ckd receive renal replacement therapy with incidence growing by approximately 8% annually (5). Unfortunately, despite significant improvement in graft function, kidney transplants can still fail due to acute rejection and chronic allograft nephropathy (1, 3) that can lead to three fold greater risk of death compared to patients with functioning grafts (1, 6). Due to the increasing demand for renal transplants, identifying potential risk factors implicated in graft failure is essential to improve patient survival and quality of life (1). To achieve this purpose, traditional statistical techniques such as cox proportional hazards (ph) model however, it relies on restrictive assumptions such as proportionality of hazards and linearity of effects on log hazard function (linearity assumption) (7). Besides, the performance of traditional methods like cox regression is not reliable in the presence of high rate of censoring (8). Potential prognostic factors affecting renal graft have also been investigated by several studies with cox ph model (3, 9, 10). Ideally, it would be important to improve the predictive performance of the models identifying potential prognostic factors affecting renal graft via learning theory and data mining techniques for survival time that require no assumptions . Machine learning methods such as tree - based approaches have recently been developed to handle right censored survival data and their effective performance has been confirmed in different areas (11). Random survival forests (rsf), is a non - parametric tree - based ensemble learning method that can automatically handle the difficulties of cox model and can also be used to select and rank variables (7, 11). Due to the limitations of the cox model, using rsf to identify effective risk factors for survival has been suggested (7). Although, several studies have confirmed the promising performance of rsf compared to traditional cox model (8, 1214) in different disease, there is no attempt to use rsf in renal transplantation and compare its performance with cox model . This study aimed to identify prognostic factors affecting renal graft by rsf and compare its performance with cox proportional hazard model . The present study utilized a data set corresponds to a retrospective cohort study which was conducted in hamadan, western iran, from 1994 to 2011 . The number of 475 patients underwent kidney transplantation in ekbatan or besaat hospitals and was eligible to enroll the study . To identify important risk factors, the patients who did not have any information about risk factors were eliminated from the analysis . In this regard, only 378 out of 475 patients were considered in the present study because the information about potential risk factors was not observed for the rest of the patients . The risk factors were age, sex of donors and recipients, type of donor (living - donor or deceased donor), familial relationship, hemoglobin level, blood groups of donors and recipients, duration of dialysis before transplantation (year), cold ischemic time (min), creatinine level at discharge, body mass index (bmi) of donor (kg / m2), left or right kidney, type of immunosuppressive drugs used (imuran, prednisolone, cyclosporine vs. cellcept, prednisolone, cyclosporine), duration of hospitalization (day), volume of urine excretion during the first 24 h after transplantation (ml/24 h), and occurrence of acute or hyperacute rejection . In this regard, acute rejection is related to formation of cellular immunity, which usually occurs to some degree in all grafts, except between identical twins and hyperacute rejection is initiated by preexisting humoral immunity and usually manifests within minutes after transplantation (3). The survival time was the time between kidney transplantation and episode of rejection (3). Rsf is an extension of random forest rf to right - censored survival data with the same principles underlying rf, which enjoys all its important properties (7, 15). Each tree consists of nodes (variables) in which classification or split was implemented . In survival settings, tree node splits according to maximizing survival differences between daughter nodes (new nodes). In this regard, in each tree, survival time and status of the patients were considered as response variables . Then, the ensemble estimate for the cumulative hazard function (chf) is drawn by calculating the chf for each sample in a data set, and summing this ensemble over the observed survival times yields the predicted outcome referred to as ensemble mortality (a measure of mortality for a patient that has been shown to be an effective predictor of survival) (15). Each run of rsf was performed for the kidney transplant data set based on 1000 trees under log - rank splitting rule . The importance of each model covariate was also determined by a rapidly computable internal measure of variable importance (vimp) that can be used to rank variables . The larger vimp, the more predictive the variable (the threshold value is 0.002) (11). Moreover, multiple imputation strategy based on rf was utilized for treating missing data (7). Five imputed data set were provided and then combining rules (16, 17) were applied to calculate evaluation criteria and vimp . In order to compare the performance of rsf and traditional cox ph, two criteria were used including integrated brier score (18) and c - index (19) using out - of - bag (oob) data . A perfect prediction rule would have a concordance of 1 (20). Random - forestsrc, a freely available package from the comprehensive r archive network (cran). The mean survival time for 378 patients was 7.354.62 yr, the median survival time was 6.81 yr . Out of 378 transplantations, 37 (10%) episodes of rejection occurred, and the remaining 341 patients (90%) were censored . Mean and standard deviation of variable importance (vimp) for kidney transplant data over five imputed data set . Each run based on 1000 trees under log - rank splitting the cold ischemic time, recipient s age, creatinine level at discharge and donors age are highly predictive, and duration of hospitalization is moderately predictive . However, type of donors, hemoglobin level, donor s sex, immunosuppressive drug usage, post - transplantation condition, recipient sex, familial relationship, donor and recipient blood group, side of the kidney, duration of dialysis and urine volume are unlikely to be predictive . According to cox ph model, three variables of recipient age, type of donor (living vs. deceased), and episode of post - transplantation acute and hyperacute rejection were identified as most important variables . Rsf had lower prediction error based on integrated brier score (0.081) compared to cox model (0.088). In addition, the c - index of rsf was considerably higher (0.965) than that of the cox model (0.766). The effect on survival of the most five influential covariates found in the rsf analysis was displayed with 5-yr partial survival plots in fig . 1 . The estimated partial survival for a covariate indicates estimated survival for different levels of the covariate when the effects of all other covariates are justified . It can be seen from figure that, as cold ischemic time increases up to about 35 minute, the five - year predicted survival increases as well and it tends to decline after 35 minute . Partial 5-year predicted survival for five most influential covariates on survival in kidney transplant data . Rsf identified cold ischemic time, recipient s age, creatinine level at discharge, donor s age and duration of hospitalization as the top five most important predictors of survival for graft failure patients in the present study . Several authors estimated the survival rate of kidney transplantation and detected the risk factors of graft rejection (2124). Our results showed that the cold ischemic time variable was the most important factor in the risk of graft rejection, which is consistent with the results of some other studies (25, 26). Cold ischemic time is one of the risk factors that is involved in immediate anemia in renal transplant recipients (27). Based on the results, as recipient s age increases predicted five - year survival time increases as well . This may be a result of stronger and more efficient immune system in younger recipients (3). Previous studies have reported creatinine level at discharge as a risk factor in rejection of kidney transplantation (9, 10, 32). Donor age was the fourth top risk factor, which had a negative correlation with graft rejection, i.e. Kidney rejection is more likely among those recipients who receive kidney from older donors . This result is also similar to the result of other studies (3, 25, 26, 33, 34). The fifth top most important variable was duration of hospitalization, confirmed eralier (35, 36). This study focused on the performance of rsf method in identifying potential risk factors for survival of kidney graft failure patients compared to traditional cox model . The results demonstrated that the rsf model performed significantly better than the conventional cox - proportional hazard model . Several studies also confirmed the promising performance of rsf compared to cox ph model in real data sets (8, 12, 14). Rsf had better performance compared to cox ph model based on prediction error criterion (13). Therefore, it can be applied successfully for identifying risk factors of the kidney transplantation survival . Rsf deals with the traditional cox model issues such as proportionality assumption coherently and automatically (37) and analysts do not require knowing in advance the relationship (i.e. Linear, nonlinear) of a variable over time (8). Besides, the performance of cox regression is not reliable in the presence of high rate of censoring which was the case in the present study (about 90% censor rate). While, rsf is a robust extension of random forest a highly used machine learning method that has gained much interest in a variety of fields of application and generated a vast amount of computational literature in the last decade (8, 38). However, the performance of different methods is data dependent and conducting additional studies is needed to compare rsf to cox regression to document further its performance in clinical settings (8). There were some limitations in the present study . Reliable sources of data obtained from prospective design were required for estimation of survival rate and associated prognostic factors, but the present study used a data set of a retrospective cohort study and medical records . Quality and accuracy of estimates depends primarily on the quality of recorded data, but verifying the accuracy of data was not possible in the present study . Besides, quality of the services and technology may vary over time, but we have no document to justify this issue . These issues might bias results . In addition, long - term follow - up duration results in losing some patients, which in turn may lead to biased results (3). Rsf identified a different subset of risk factors in chronic nonreversible renal graft rejection than the cox ph model . The rsf is a promising method for intuitive variable selection and is a way to eliminate the doubt in the black box approach to statistical analysis that should be further investigated in survival analysis of other diseases (8). Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
|
Slips, trips and falls (stfs) lead recurrently to injuries in occupational situations1 . These accidents are triggered by a movement disturbance (a slip or a trip) when working, especially when walking . Other movement disturbances (a wrench slipping, an arm colliding with a wall, etc .) Can occur in occupational situations; moreover, these can arise when performing different types of tasks (tightening a bolt, moving an item alone or with a colleague, etc . ). This paper considers ostfs and, more broadly, occupational accidents with movement disturbance (oamds); the latter composing a set of accidents operationally defined by leclercq et al.2, 3, which involve a heavy cost in both human and financial terms4 . The literature often advances workplace design and upkeep5, 6, access system configuration7 or, again, human factors8, 9 for explaining ostfas . Implementing actions that neutralise these factors to secure displacements, however, such actions frequently overlook not only task diversity, but also production requirements and they can therefore only offer a partial response to preventing all oamds . Research into these accidents shows that, as in all occupational accidents, many accident - causing event configurations stem from arbitration between production and safety, which cannot be overlooked if progress is to be achieved in the prevention field . Production - safety arbitrations lead to controls applied under working conditions in order to perform the task while maintaining safety . The control most frequently referred to involves walking fast to try to absorb a delay or confront an emergency . These observations provide a partial explanation for worker difficulties in systematically applying certain recommendations based on common sense (e.g. Do nt rush) that are aimed at preventing oamds . This paper describes initially the need for, and limits involved in, neutralising the environmental factors in play and subsequently the production - safety arbitrations prompted by the so - called organisational oamd factors referred to in the literature . Some of these arbitrations imply control implementation by the worker performing the task, which is then reflected in his / her displacements or, more generally, in his / her movements that increase exposure to oamd risk . Focusing on organisational factors allows us to integrate these controls into a set highlighted by a general work organisation model . Such a model indicates areas of similarity between oamd genesis and other occupational injury geneses . Movement disturbance factors may be permanent and visible (floor in poor condition, congestion, difficult access to parts of a machine, etc .) In some work situations and may expose many workers over relatively long periods . This is the case of slippery floors in food processing shops, for example . Such factors, along with haste, carelessness and awkwardness are frequently advanced when explaining oamd occurrence . Neutralising environmental factors often involves taking action on certain working conditions (installing a slip - resistant floor, reconfiguring an access system, etc . ). It is commonplace for companies that decide to raise their oamd - related safety level primarily focus of this type of action . However, in common with instructions designed to change behaviour (e.g. Instructions to workers to move carefully from place to place or to adopt a safe, unhurried displacement, avoiding short - cuts), this action cannot meet the requirements for preventing all oamds . Instructions of this type alone in fact disregard other aspects, which are sometimes more difficult to objectify and control, such as urgency of the situation, fatigue or certain task requirements . As in all occupational accidents (oas), an oamd will often be caused by a combination of factors, each of which is of different nature . A clearly visible obstacle is never sufficient to cause a trip: it may simply not be taken into account by a worker, when his / her visual attention is absorbed by his / her task during a displacement . On the other hand, an oamd can occur without involving a permanent, visible anomaly in the environment: a worker, late for his / her appointment, misses a step when running up stairs that are not subject to any design defect . Finally, many situations are temporarily more susceptible to oamd occurrence: for example, when performing his / her activity, a worker collides with an element in his / her environment, which obstructs his / her movement; he / she had intended to move this element on completion of priority work . In the situation illustrated by fig . 1.two images of occupational situations taken from the napo in safe on site / champions of the world video produced by, a first level of prevention would involve disposing of unwanted material or organising storage areas . At a given moment, presence of elements required for performing a task can also represent an accident factor for a worker or his / her colleague . In fig . 1b, this would be the cinder blocks left near a mason, but could also be a batten left lying on the ground when stripping formwork, a wheelchair when transferring a patient or a toolbox when conducting maintenance work . Two images of occupational situations taken from the napo in safe on site / champions of the world video produced by neutralising accident factors that are permanent and visible in the work environment is important, but analysing the part played by this factor in a more comprehensive accident genesis is in fact just as important . Behaviours adopted in work situations also need to be understood since they often reflect the presence of organisational factors . The literature includes in - depth analyses of occupational slips, trips and/or other movement disturbances conducted at various companies . Events leading to injury are integral to the relevant company operation and some are related to production - safety arbitrations referred to long ago in the general occupational accident field . For example, situations described in terms of recovery or momentary co - activity by faverge10 reflect arbitrations revealed during iron mine accident analysis, in particular . Monteau11 refers to known organisational risks, when analysing occupational health and safety from an organisational perspective . It should be noted that few of these accidentology studies are considered in relation to understanding and preventing oamds . Yet, the contribution of multiple organisational factors has been highlighted during analysis of such accidents . Research reported in bentley & haslam12 and in leclercq & thouy13 questions the role of work preparation in stfa occurrence . Bentley & haslam12 effectively describe the difficulties encountered in distributing mail on time during periods involving snow and ice . Leclercq & thouy13 show that a number of accidents have involved field operators climbing up into and down from trucks, when checking equipment required during the day at various building sites . This phase of their activity called for all the more care since instances of missing equipment were frequent . A specific study of oamds sustained by train drivers14 has revealed problems involving task allocation as well as recovery situations, i.e. Situations in which the normal task is interrupted by an incident, from which the worker has to recover, in other words strive to restore the usual course of work10 . These accidents occurred when inspecting a train prior to departure: in the first case, the train started to brake during the operation; in the second case, an inexperienced driver detected a brake failure he had never before encountered and did not know how to remedy and, in the third case, the driver once again climbed down from the train because he had overlooked an inspection point . In each case, the driver gave his full attention to inspection in order to prevent the train being delayed and, when walking, tripped on a sleeper or a plate creating unevenness in the ground . In the first two cases, the driver was performing a recovery operation at the time of the accident to restore the train braking system operation . All recovery situations introduce or accentuate a time constraint, so resources mobilised to make the braking system operational as quickly as possible were partially lacking in terms of controlling displacement and this effectively caused the driver to trip . Bentley et al.15 refer to a concurrent visual task when explaining the occurrence of certain oamds; these authors also emphasise that, at a given moment, resources dedicated to performing the task may be lacking in terms of controlling displacement . In many cases, existing obstructions to displacement are due to earlier or simultaneous work performed by workers other than the worker, who sustains an oamd; this reveals the part played by co - activity or a succession of activities in oamd occurrence . For example, a worker has to divert to avoid tools useful to other workers installing new equipment, but left on his / her displacement route . Displacement diversion may be considered as a form of recovery activity intended to restore a normal course of work by returning to the initial route . Co - activity, historically described by cuny16, represents task performance by persons pursuing different production objectives and required to share concurrently a common workplace . Interim situations or those involving subcontracted work, in particular, can generate co - activity or a succession of activities . Finally, bentley & haslam12 have shown that the job and finish policy implemented at the time in the united kingdom s mail distribution company, which allowed workers to go home as soon as the last mail had been distributed, could encourage workers to take risks by hurrying or taking short - cuts . These authors reported that workers explained that the accident risk raised by reading mail addresses while walking was more acceptable than the time wasted in stopping to read the addresses . Working conditions (hence movement performance conditions) play a part in oamd occurrence since they make it more or less difficult to control displacement and, more generally, movement during task performance . Organisational factors highlighted during oamd analysis reveal worker arbitration between production and safety in the work situation, in which he / she is exposed to a risk of movement disturbance . Production - safety arbitrations relate particularly to the organisational activity implemented by the company . Neutralisation of organisational factors therefore requires local and collective management of the oamd risk to ensure proximity to the company s specific characteristics and to compare existing logics and viewpoints . Bentley & haslam12 state that, depending on the workers distributing mail, managers consider performance a priority over safety and that the workers themselves prefer rapid performance to safer performance of their work; their attitudes reflect those of the management in this respect . As in the presence of any oa risk, controls are implemented to perform the task, while ensuring safety with regard to movement disturbance, in other words while ensuring movement control ., for example in the case of a collision when bolting because the spanner slipped . Oamds can also involve more atypical movements, such as picking up an object or walking, and in some cases, being cut by an element in the environment or missing a step when running up stairs . Controls implemented in work situations are therefore virtually permanent and the worker manages the available resources to perform his / her task, while controlling his / her movement . The resources required for movement control vary in time and with respect to the work situation . For example, derosier et al.17 report situations, in which metallurgists are sometimes required to move over template elements similar to beams . At these moments, the resources required to control their movements are more extensive than those required when walking on a level floor . Likewise, resources required for walking on a floor with variable slip resistance are more extensive than resources required for walking on a surface with uniformly high slip resistance . Resources needed to perform the task as a whole are also variable . At certain moments, a worker s visual attention can be taken up by a task and can thus be unavailable for movement control14, 15 . Task characteristics and requirements will therefore condition resources, which could be dedicated to movement control . 2.model of ostfa understanding based on the worker and his / her activity (adapted from the model developed by vezina (2001) for musculoskeletal disorders). Contributes to our understanding of movement disturbance by illustrating a work situation model based on the worker and his / her activity . This has been adapted from the model developed by vzina18 in relation to work - related musculoskeletal disorders (wrmsds). Wrmsds and oamds are invariably outcomes of occupational risks, which manifest themselves through worker movements . This is why oamds and wrmsds possess common characteristics with an impact on prevention . Oamd prevention has been the subject of little research to date and could therefore benefit from studies in the wrmsd prevention field, at least from a theoretical and methodological standpoint . Similarities between wrmsd and oamd and their consequences for prevention have been developed by leclercq et al4 . Model of ostfa understanding based on the worker and his / her activity (adapted from the model developed by vezina (2001) for musculoskeletal disorders). Figure 2 shows that controls are implemented in work situations to ensure safety when performing a task . Movements performed at work are subject to continuous adjustment with respect to the required task and individual, organisational and environmental constraints, as reported by chassaing19 when studying wrmsds . Some of the implemented controls can be easily observed (rushing, moving round obstructions, etc .) And the individual strategies, to which these controls contribute, can be examined in detail using personal interviews . Sometimes, they cannot be visually observed and their detection requires a very fine observation grid: one that accurately describes movements such as heel strike angle when walking, distance provided as a safety margin between the foot and a low - level obstruction during a displacement, supports used, etc . To acquire a best possible understanding of worker controls implemented to perform a task in an occupational situation, while avoiding movement disturbances, we need to combine two levels of analysis: analysis of the activity and analysis of the movement performed within the activity . Macroscopic developments such as technological advances or the advent of regulation influence the conditions under which an operator performs his movements and hence the resulting risks present in occupational situations . This model illustrates the outcome of macroscopic developments in the occupational situation through productive organisation choices . Illustrates a work organisation model developed by the niosh20 . The nature of the different factors involved in oa occurrence is displayed, along with the boundaries within which these factors are effectively harmful . Organisation of the niosh work model taken from sauter et al ., (2002). This model illustrates the outcome of macroscopic developments in the occupational situation through productive organisation choices . In general, productive organisation characteristics evolve constantly under the specific effects of technical progress (automation, introduction of new technologies, etc . ), subsequent growth in productivity21, employment market developments (active population characteristics, etc .) And reorganisations22 (outsourcing, etc . ). These macroscopic developments and choices made by productive organisations affect the work situation (level of prescription, time and spatial constraints, etc .) In ways that condition how worker movements are performed . Controls are continually implemented not only by a worker performing his / her task, while avoiding injuries, but also at the different levels illustrated in fig . 3 . Analysing and combining these controls contributes to our understanding and prevention of occupational accidents, in particular oamds . Despite scientific progress in the safety field, oamds are still commonly considered simple accidents resulting from a malfunction in a simple system; this might suggest that their prevention is also this paper aims to encourage changes in these perceptions by attempting to orient the reader s vision towards organisational factors, which often combine with other accident factors to cause movement disturbance and injury in work situations . These risks manifest themselves in the worker s movement but are none the less an unwanted consequence of productive organisational decisions . Oamd organisational factors reveal the need for local and collective management of this risk and the importance of a better understanding of movement / displacement performed under working situations, i.e. In a context integrating specific task requirements and working conditions . While organisational measures implemented by the company represent a lever for oamd prevention, two points should be noted: on the one hand, organisational activity is restricted as illustrated by fig . 3 and, on the other hand, its lever is not unique . Maximum possible neutralisation of factors close to the injury in the accident genesis and risk awareness also constitute major lines of prevention . Awareness of the oamd risk, in particular, is an essential prerequisite to any progress in preventing these accidents . Perception of the oamd risk and its more or less accepted nature are factors, which determine both consideration of this risk at every level of the company and controls implemented by workers.
|
The introduction of digital technologies in clinical pathology practice could produce great benefits in the form of improved patient care, better efficiency of health services, and novel diagnostic tools . At the same time, it is clear that these benefits can only be achieved if digital pathology solutions are carefully crafted for the clinical prerequisites . Whereas low - volume and nonurgent situations such as research, teaching, and to some extent, consultations, are currently feasible with existing digital pathology systems, if digital pathology is to reach prime time status then more work is needed to enhance the suitability of the systems for clinical routine . Clinical deployment also requires solving issues such as validation mechanisms, cost - efficient digital storage, and medico - legal demands, as well as redesigning work practices for the digital era . Efforts to advance the field are taking place around the world . In the nordic countries (sweden, denmark, norway, finland, and iceland), there is a particular concentration of development work towards clinical use of whole slide imaging (wsi). For example, all routine histology slides are today scanned in the hospitals of linkping and kalmar and extensive digital primary review is performed, and> 60 wsi scanners have been installed in sweden to date . Against this backdrop, the nordic symposium on digital pathology (ndp) was created to promote knowledge exchange regarding the state - of - the - art in digital pathology . The specific focus of ndp is advances toward the clinical adoption of wsi and other digital technologies in pathology . As these advances require a concerted effort from health care, industry, and academia, ndp is intended as a forum where professionals from all domains can meet . The first ndp event was organized in november 2013 and attracted 125 attendees, whose feedback lead to an expanded ndp event in november 2014 as will be detailed below . Judging from the history of digitization of radiology imaging, there is reason to believe that the nordics will continue to be a forerunner in clinical use of digital pathology . While perhaps not reflected by its regional name, ndp aims to be a venue of broad international interest where state - of - the - art in digital pathology is discussed and advanced . Nordic symposium on digital pathology symposium 2014 took place november 56 in linkping, sweden . A total of 144 attendees gathered, of which 47% listed health care as the primary affiliation, 33% industry, and 19% academia . The health care representatives were dominated by pathologists, but also laboratory technologists and it staff were in significant numbers . The participants represented 14 different countries from europe, north america, and australia, with the nordic attendees being in a large majority (87%). Central to the program was a series of invited talks and a collaborative workshop on clinical deployment issues . The contents of these sessions will be outlined in the sections below . In the science and innovation session, a double - blind review process was carried out by the symposium's international program committee with 15 senior researchers in the field and this resulted in three jpi papers published alongside this editorial: a comparative study of input devices for digital slide navigation (jesper molin et al . ), randomspot: a web - based tool for systematic random sampling of virtual slides (alexander wright et al . ), and histopathology in three - dimensional: from three - dimensional reconstruction to multi - stain and multi - modal analysis in addition, the ndp included an industrial exhibition consisting 13 vendors, ranging from large multinationals to recent startups, showing everything from wsi scanners through enterprise image management to desktop electron microscopy . Figure 1 shows a session snapshot and the program details are available at the npd website http://www.liu.se/ndp?l=en . A key part of the ndp program was the workshop discussing clinical adoption of digital pathology . The workshop was organized as an open floor discussion where broad participation was encouraged and also achieved . As an input to the discussion, a survey was distributed among the health care attendees in advance of the symposium . Some results from this survey will be presented next as it paints an interesting picture of the attitude toward digital pathology in nordic health care . It must be noted that the respondents of the survey represents an extremely biased selection among the pathology community . Since only ndp participants were asked, this means that respondents are likely to be among the most positive to digital pathology and also among the most experienced . There is also strong geographical dominance from the nordics and in particular sweden . Of 74 it is likely that the pathologist dominance were even higher for some questions that require deep knowledge of clinical practice . Role distribution of survey respondents the survey first asked: today, to what degree do you use digital images of histology slides in your practice? (in% of all histology cases .) The results are shown in figure 3, showing moderate levels of adoption but no use in about 50% of respondents . Another bias to note for these questions is that several people from the same institution may have responded . Since the most digitized sites kalmar and linkping had several attendees, these numbers are likely to represent higher usage than numbers on a per site basis . Current use of digital pathology among survey respondents the same question was asked for the predicted situation at the end of 2016, shown in figure 4, showing significant optimism for near - future use of digital pathology . Predicted use of digital pathology at the end of 2016 the respondents were also asked to judge the impact of digitization: what effect do you foresee that digital pathology will have compared to traditional microscope practice, with regards to the following areas? The impact grading was given in a five - point scale, major negativeminor negative status quo minor positive major positive . The assessments with regards to pathologist work are in figure 5 whereas other laboratory aspects are in figure 6 and overall impact in figure 7 . Foreseen impact of digitization with regards to pathologist's work foreseen impact of digitization with regards to laboratory aspects foreseen impact of digitization with regards to overall effects broadly, these responses indicate a very positive attitude toward digital pathology in terms of its effects on pathologist and laboratory working . However, more negative responses were received in the effect on pathologists efficiency (time per case and speed of slide navigation) as well as perceived delays in slide arrival from the laboratory until starting review . Overall effects of digitization were seen as very positive, especially for the quality of care . Finally, the respondents also were asked to state the three main barriers for adoption of digital pathology in their clinical practice . It was clear that the cost of implementation is a major issue; 79% of the responses mentioned lack of sufficient funds as a barrier . Technology limitations were listed in 71% of the responses, some referring to insufficient performance of commercial solutions and some referring to lacking it infrastructure in their organization . A conservative attitude among colleagues other responses concerned lack of organizational engagement at local, national and international levels to develop protocols, work practices, and standards . After the survey results had been presented, a guided discussion between all participants took place . Advanced digital pathology implementation efforts were reported by many contributors, either established (e.g. Skne, linkping) or in planning (e.g., gothenburg, karolinska / stockholm, oslo, copenhagen). The planned use cases covered similar areas such as retrieving archived cases, presenting at multi - disciplinary meetings, obtaining second opinions (either for individual cases or to share work between institutions). Digital pathology was seen by many contributors as a key enabler of higher quality pathology services, by increasing specialist reporting of cases or supporting and supporting colleagues across distances . Those who had implemented digital pathology on a large scale were positive about the effects it had on workflow and reported no untoward delay in slide arrival caused by the extra step of scanning (in fact, one pointed out that the cases arrived in a more continuous flow, rather than the batches of glass slides normally received). Several contributors (linkping, skne, toronto) had experience of working with moderate or large volumes of the digital work . Fatigue using dp systems was mentioned by a few, possibly a combination of older less effective slide viewing software and the known effect of computer displays on eye fatigue . Several experienced commenters pointed out that fatigue was often an issue with the microscope and that digital pathology offered ergonomic benefits which could be beneficial in the long term for the pathologist's experience . Laboratories produce a lot of glass slides, and wsis produce large amounts of storage space . It was felt that data storage was very often raised as a concern by it departments involved in discussions about digital pathology implementations . Some contributors pointed out that projections of hundreds of terabytes of image data per year, while realistic for 100% digital practice, may serve to inhibit pathologists and it departments from trying the technology, and that in fact to start going digital - only a modest storage capacity of a few terabytes is needed . It contributors pointed out that mature information lifecycle management systems for digital pathology had yet to appear (some contributors reported being charged excessive monthly costs for even small amounts of data), but it was likely that tiered storage systems would ameliorate the daunting costs associated with large amounts of live online storage, as would the constant reduction in price per terabyte of storage media . Some discussion around how long digital images should be kept for and what latency before image retrieval might be tolerated revealed that several contributors had envisaged such tiered data arrangements would be needed . Centers with mature or second - generation digital pathology systems often had it staff who understood well the complexities of wsi data, and well - integrated systems . Experienced users re - emphasized the need for digital pathology to be supported by knowledgeable and (preferably) designated it staff . Standards were mentioned by only a few contributors - the it staff, who expressed surprise at the lack of standardization of digital pathology image formats and interoperability, and those pathologists on their second generation of scanners who had experienced incompatibility between two different vendors products (e.g. In viewers or in image analysis algorithms). Some audience members had experience of the last digital revolution in medical imaging (in radiology) and saw many parallels in the it needs, questions about validation / safety and clinical acceptance of the technology . The room was understandably full of those keen to adopt digital pathology, many of whom reported colleagues with more conservative attitudes . Some of the objections were seen, however, as entirely justifiable (e.g. Concerns over speed of diagnosis and diagnostic accuracy with digital systems) and many in the room agreed that these were issues that needed to be addressed . For successful implementations, the need for champions in each department was mentioned, as well as the value in immersing trainees in a digital working pattern from an early stage . Wiser (and older) heads pointed out the benefits of actively seeking out sceptics and involving them in digitization projects . Dr . Andrew evans from the university health network, toronto described a long - standing program of digitization including telepathology and wsi in a university hospital network . He provided a very detailed description of the assiduous planning involved in digital pathology adoption and his experiences of involving the entire department in projects . Metin gurcan of ohio state university spoke about his work in image analysis and computer aided diagnosis, introducing many parallels from radiological imaging and emphasizing the importance of pathologist - computer scientist partnerships and validation in such work . Jan baak from stavanger university hospital gave an expansive talk on his long career in pathology imaging, especially speaking about his role in the prognostication of breast cancer with morphology and image analysis, emphasizing the ongoing value of good pathological assessment even in a genomic era . Dr . Sten thorstenson from linkping university hospital explained his long experience of digital pathology at kalmar and linkping, starting at a time when a terabyte really was a large amount of data . After 9 years he reports being entirely comfortable working digitally and has been reporting 100% from home for almost a year now without access to a microscope or physical slides . Derek magee from the university of leeds gave an overview of his work in image analysis research . A focus area has been digital three - dimensional pathology, and in particular tackling the inherent challenges of the slide registration, color normalization, and histology - radiology correlation . Thomas miliander from vrmland county council, sweden, presented this health - care provider's strategy for imaging it infrastructure . The approach taken is an enterprise image management backbone for all medical images, relying on standards for tight integrations with other information systems, a context into which now also wsi is entering . Johan lundin from the institute for molecular medicine finland, helsinki, provided an overview of his group's work in digital pathology . The portfolio presented spanned from web and touch - enabled wsi viewing applications to low - cost handheld microscopes utilizing smartphone camera components . In a special session, elin kindberg of sectra presented preliminary results from a national swedish effort to investigate key medico - legal issues arising when deploying digital pathology . Regarding access to swedish patient data outside of sweden the legal situation is clear that this is possible provided those appropriate security measures are taken . Legal directions regarding whether all wsi data must be stored does not, however, exist; the swedish law only mandates good and safe health care . The conclusion is that the pathology profession needs to define what the legal mandate means in this case . The swedish pathologist society is now finalizing an official guideline document describing different possible paths, all legal, and all with different advantages and drawbacks . The 2 ndp spanned across many areas of interest with regards to the emerging use of wsi and related it tools in clinical routine . Feedback from attendees indicates that this sharing of knowledge and experiences across organizations, disciplines, and sectors is an important catalyst for development of best practices and overall progress . Organizing ndp 2014 has been a very rewarding experience, and we welcome attendees from all over the globe to future gatherings of this group.
|
Gestational diabetes mellitus (gdm) is defined as glucose intolerance 1st recognized during pregnancy with a prevalence of 2% to 14% in all pregnant women . Gdm is associated with maternal, fetal, and neonatal adverse outcomes such as cesarean delivery, preeclampsia, shoulder dystocia, macrosomia, neonatal hypoglycemia, and perinatal death . Although yet to be proven, screening and treating gdm may contribute to prevent adverse outcomes . The most commonly used screening and diagnostic methods of gdm are flawed because they give relatively poor negative and positive predictive values . The 2-step diagnosis method, the 1-hour 50-g glucose challenge test (gct), and the 3-hour 100-g oral glucose tolerance test (ogtt) are currently used in the united states, and the single - step 2-hour 75-g ogtt is used in european countries . In korea, the 2-step diagnosis approach has been used predominantly as in the united states, but several hospitals have adopted new guidelines for the diagnosis of gdm . It is also necessary to change the current counseling and treatment approaches for gdm patients because perinatal outcomes tend to differ according to glucose levels . Patients with 50-g gct within 140 to 199 mg / dl had 2.5-fold increasing risk of large for gestational age (lga) and 2.9-fold increasing risk of macrosomia . Langer et al demonstrated that every 10 mg / dl increment in fasting blood glucose (fbg) resulted in 15% increase in adverse composite outcomes . The purpose of this study is to evaluate the association between perinatal outcomes and 50-g gct values as well as fbg among gdm women . A retrospective analysis of 3434 pregnant women who had 50-g gct was carried out between march 2001 and april 2013 at severance hospital, seoul, korea . Women with fetal anomalies, multiple gestations, overt diabetes mellitus (dm), and hypertension were excluded from the study . A total of 2631 pregnant women received the normal 50-g gct and 803 received the100-g ogtt because their 50-g gct value was greater than 140 mg / dl . As a result, 307 patients were diagnosed with gdm (gdm group) and 496 showed false - positive result (impaired glucose tolerance group). A false - positive result was defined as showing positive in the 1-hour 50-g gct but negative in the 3-hour 100-g ogtt . Gdm was defined as showing 2 or more abnormal duration (hours) of 100-g ogtt values: fbg of 95 mg / dl or more; 180 mg / dl or more for 1-hour; 155 mg / dl or more for 2-hours; and 140 mg / dl or more for 3-hours . A total of 171 patients had normal fbg (<95 mg / dl) and 136 patients had abnormal fbg (95 mg / dl) (fig . The 1-hour 50-g gct result was also divided into 20-unit increments, and these subgroups were used to evaluate maternal and perinatal outcomes . A total of 307 pregnant women (the same number as gdm patients) were randomly selected from the normal 1-hour 50-g gct group (n = 2631) to be the control . The risks of adverse maternal and perinatal outcomes for subgroups of the gdm group were then analyzed and compared against the control group . Maternal composite adverse outcomes included cesarean delivery and preeclampsia, while fetal composite adverse outcomes included lga, apgar score, intensive care unit admission, neonatal hypoglycemia, and hyperbilirubinemia . Preeclampsia was diagnosed according to the criteria of the acog practice bulletin: new onset of blood pressure of 140/90 mm hg or more on 2 separate readings taken 6 hours apart after 20 gestational weeks; and proteinuria of 300 mg/24 hours or more . Lga was defined as birth weight greater than the 90th percentile compared with gestational age . Neonatal hypoglycemia was defined as blood glucose level of less than 40 mg / dl, and hyperbilirubinemia was defined as bilirubin level of more than 5 mg / dl . For statistical processing, the chi - square test or fisher exact test was used for categorical variables and the 2-sample t test or the wilcoxon rank sum test was used for continuous variables . Multiple logistic regression analysis was performed to estimate the odds ratios (ors) of adverse outcomes with adjustment for confounders . Cary, nc) and statistical significance was considered for p - values <0.05 . Based on the results of the 50-g gct, the clinical characteristics and perinatal outcomes of the impaired glucose tolerance (igt) group and the gdm group (table 1) were compared . Significant differences were observed between the 2 groups in terms of their maternal age, body mass index (bmi) before pregnancy and at delivery, and family history of dm . For perinatal outcomes, the gdm group showed higher incidence of cesarean delivery, macrosomia, lga, and neonatal hypoglycemia . Comparison of characteristics of igt and gdm groups . Among gdm patients, maternal characteristics and perinatal outcomes study findings show statistical significance in bmi before pregnancy and at delivery, rate of cesarean section, prevalence of gestational hypertension, gestational insulin therapy, and hba1c at diagnosis . Incidence of macrosomic newborn (3.5% for normal glycemic vs 22.1% hyperglycemic group, p <0.001) and lga newborn (10.5% for normal glycemic vs 36.0% hyperglycemic group, p <0.001) was higher in the fasting hyperglycemic group, meeting the carpenter and coustan criteria . Moreover, the prevalence of neonatal hypoglycemia was 9.4%, and 15.4% in the normal glycemic and hyperglycemic groups, respectively (p <0.001). To compare perinatal outcomes between the 2 groups, the odds ratio was calculated after controlling for confounding factors (table 3). The odds ratio for perinatal outcomes was 6.72 (95% ci: 2.5917.49, p <0.001) with macrosomia, 3.75 (95% ci: 1.977.12, p <0.001) with lga, and 1.65 (95% ci: 0.793.43, p = 0.183) with neonatal hypoglycemia . The maternal and perinatal outcomes of pregnant women with 50-g gct result of over 140 mg / dl were further stratified into 20-unit increments (table 4). The findings showed significant differences in bmi before pregnancy and at delivery, incidence of gestational hypertension and gestational insulin therapy, hba1c at diagnosis of gdm, macrosomia, lga, and neonatal hypoglycemia . The 50-g gct results were categorized and the perinatal outcomes were compared with 50-g gct normal group after adjusting for confounders (table 5). Increased 50-g gct values in subgroups showed relevance with higher risk of perinatal outcomes . The ors of macrosomia (up to 20.31-fold), lga (up to 6.15-fold), and neonatal hypoglycemia (up to 84.00-fold) were higher in subgroups with higher 50-g gct values . Among gdm patients, the group with 50-g gct level of 140 to 159 mg / dl was found to be associated with macrosomia (or: 4.31, 95% ci: 1.4213.13, p = 0.010) and neonatal hypoglycemia (or: 17.27, 95% ci: 2.03147.12, p = 0.009) when compared against the normal group . However, lga (or: 0.84, 95% ci: 0.401.73, p = 0.628) did not show statistical significance . The subgroup in the 160 to 179 mg / dl range showed significant or for macrosomia (or: 5.95, 95% ci: 1.9218.49, p = 0.002) and neonatal hypoglycemia (or: 53.72, 95% ci: 6.78425.70, p <0.001). Lga (or: 1.48, 95% ci: 0.733.03, p = 0.279) showed the tendency to increase but there was no statistical significance . Also, the subgroups in the 180 to 199 mg / dl and the 200 mg / dl ranges showed a strong association with all adverse perinatal outcomes . Therefore, risks of adverse perinatal outcomes increased as the values of 50-g gct results increased . Maternal characteristics and perinatal outcomes according to fasting glucose values in gdm patients . Or of perinatal outcomes for fasting glucose level 95 mg / dl in gdm group . Maternal and perinatal outcomes according to 50-g glucose challenge test in gdm patients . Or of perinatal outcomes according to 50-g glucose challenge test values in gdm patients . This study investigated the maternal and perinatal outcomes according to fbg and 50-g gct values in gdm pregnant women . The risks of macrosomia, lga, and neonatal hypoglycemia increased with fasting hyperglycemia and higher 50-g gct values . Study findings also showed that the association between fasting hyperglycemia and adverse perinatal outcomes remain to be significant after adjustment for potential confounders . Previous studies have found that postprandial hyperglycemia was associated with excessive fetal growth in gdm patients requiring insulin therapy or pregestational diabetes patients . Other studies have indicated that meal - related glucose threshold measurement did not increase the risk of adverse fetal outcomes . Recently, other researches have demonstrated significant association between fasting and 1-hour 75-g ogtt glucose values with lga newborns among gdm women . It has been reported that strict glucose control in this risk group may be necessary in order to avoid lga newborns . It has been emphasized in many studies that fbg is an important factor in gdm screening as well as in predicting neonatal adverse outcomes . Gdm women with an isolated abnormal fbg were more likely to need hypoglycemic agents to obtain good glycemic control . The significance and magnitude of this association was consistent with the results of this study . In the abnormal fbg group, 47.1% (64/136) of gdm patients needed gestational insulin therapy to control the blood glucose but in the normal fbg group (p <0.001), only 12.9% (22/171) of pregnant women who were diagnosed with gdm required insulin treatment . The hapo studies have demonstrated the continuously increasing relationship between maternal blood glucose levels and adverse perinatal outcomes such as frequency of lga, neonatal hypoglycemia, cord blood serum c - peptide level above the 90th percentile, and primary cesarean section delivery . However, these studies are based on the single step 75-g ogtt, and gdm was diagnosed using the international association of diabetes and pregnancy study groups (iadpsg) criteria . In the hapo studies, the outcomes were compared after categorizing fasting, 1-hour, and 2-hour glucose values . In contrast, this study is based on the 2-step diagnosis of gdm, and the outcomes of the 50-g gct values and the fbg of 100-g ogtt were compared against each other . The outcomes found in this study give a more accurate picture of the situation in korea, where the 2-step diagnosis is predominantly used . In addition, without adjusting for confounding factors, such as prepregnancy bmi and gestational weight gain, adverse outcome risks may have been overestimated in other earlier studies . However, in this study, the relation between maternal hyperglycemia and adverse perinatal outcomes were analyzed after adjusting for bmi before pregnancy and gestational weight gain, because bmi is also related to maternal and perinatal outcomes in gdm patients . Fbg has been used as the most important indicator for the diagnosis of dm in nonpregnant adults because it reflects impaired insulin secretion and resistance . Fbg values tend to stay constant throughout the entire period of pregnancy and this is also true for nonpregnant patients . Fbg values have less individual variation compared to other glucose values; therefore, abnormal fbg level is a significant indicator in diagnosing gdm . At present, fbg is a good screening test for gdm with advantages such as simple procedure, reasonable cost, reproducibility, easy access, and wide acceptance . Recently, other studies have reported that abnormal fbg alone is capable of detecting 50% of pregnant women with gdm from a pool of women who had already been diagnosed with gdm with another screening method . If combined with the 2-hour plasma glucose level, another 25% of pregnant women with gdm can be detected . In 2016, park et al developed a more practical and efficient screening tool using fbg and prepregnancy bmi for predicting adverse outcomes of gdm . This new screening tool focused on predicting the maternal and perinatal adverse outcomes of gdm patients . The findings of this study show that bmi before pregnancy, bmi at delivery, hba1c value at diagnosis, and the application of gestational insulin therapy were much higher in the abnormal fbg group . Several studies have indicated that maternal prepregnancy bmi was associated with the risk of gdm . Sacks et al confirmed that maternal bmi had a powerful impact upon fetal birth weight . Therefore, gdm patients with both higher bmi and abnormal fbg values can have potentially worse perinatal outcomes . This study also showed that abnormal fbg values according to the carpenter and coustan criteria had significance association with higher incidence of lga, macrosomia, and neonatal hypoglycemia . In addition, adverse perinatal outcomes according to different 50-g gct values among gdm patients were evaluated in this study . The risks of macrosomia, lga, and neonatal hypoglycemia increased with increasing 50-g gct values . Several studies have examined the relationship of 50-g gct and perinatal outcomes . In 1987, leikin et al reported that the false - positive gct group (gct values of 135 mg / dl or more but normal ogtt values) had higher incidence of macrosomia compared with the normal gct group (11.9% vs 6.4%, p = 0.009). Recently, other retrospective cohort studies also showed that false - positive gct is an independent risk factor for adverse perinatal outcomes (or: 5.96, 95% ci: 1.310.3). The findings of this study suggest that the risks of the macrosomia (up to 20.31-fold), lga (up to 6.15-fold), and neonatal hypoglycemia (up to 84.00-fold) increased with higher 50-g gct values . More importantly, 50-g gct values in the range of 140 to 159 mg / dl were not associated with lga compared to the normal 50-g gct group . These results should be interpreted with caution since confidence intervals were very wide due to a limited number of cases in the 50-g gct normal group . In 2013, figueroa et al evaluated the relationship between 50-g gct values and perinatal outcomes in mild gdm patients, and showed that gct values of 140 mg / dl or more were associated with an increase of composite perinatal outcomes, lga, and macrosomia . However, there was no evaluation for the group with gct value of 200 mg / dl or more . They only included mild gdm group with fasting glucose value less than 95 mg / dl . The strength of this study is that a full spectrum of gdm patients were examined using the carpenter and coustan criteria, including the group with 50-g gct higher than 200 mg / dl . Therefore, it was possible to evaluate the continuous 50-g gct values in the lower or upper ranges . This study also included normal and abnormal fasting glucose groups and the abnormal fbg group tended to have a greater risk for adverse perinatal outcomes . A randomized clinical trial of a larger scale, using prospectively collected data from a well - characterized trial cohort, is ideal and necessary to validate the findings of this study . All gdm women were treated to achieve the recommended value of their glycemic profiles and 28.0% (86/307) of the pregnant women with gdm needed insulin therapy . Even without the influence of gdm management in addition, long - term health complications such as childhood obesity, impaired insulin sensitivity, or type 2 diabetes mellitus were not considered for in this study . In conclusion, also, composite perinatal outcomes such as macrosomia, lga, and neonatal hypoglycemia are more frequent with increasing 50-g gct values . Therefore, more attention and care should be given during prenatal counseling, as well as more active therapeutic intervention taken when necessary with closer fetal monitoring, with the objective to reduce adverse perinatal outcomes in gdm patients with abnormal fbg or high 50-g gct values.
|
Crohn s disease (cd) is a chronic inflammatory disorder of the gastrointestinal tract characterized by focal, asymmetric, transmural inflammation of uncertain etiology and of an unpredictable course . The clinical presentation of cd is characteristically manifested by repeated cycles of active and quiescent disease of definable patterns according to disease location and types (inflammatory, fibrostenotic and fistulizing).1,2 the prevalence and incidence of cd in the united states is estimated to be 50 per 100,000 and 5 per 100,000 annually, respectively.3 the treatment regimen is individualized based on disease activity, location and behavior taking into the account the balance between medications and their side effects and prevention of complications . The treatment of cd remains empirical and the disease is not curable since no clear etiology of cd disease has been yet elucidated . Munkholm et al in their population - based cohort study from scandinavia4 demonstrated that among all patients treated with 5-aminosalicylic acid (5-asa) agents and corticosteroids (cs), 13% of patients will achieve complete remission, 20% of patients will experience annual relapse and 67% will have a combination of relapse and remission within the first 8 years after initial diagnosis . Less than 5% of patients will have a continuous course of active disease . Another population - based cohort based in olmsted county, minnesota, which was conducted prior to the routine use of anti - tumor necrosis factor (anti - tnf) agents, confirmed that a representative patient with cd would be expected to spend 24% of the time in medical remission without medications, 41% of the time in post - surgical remission without medications, 27% of the time in medical treatment with 5-asa derivatives and 7% of the time having disease activity requiring treatment with corticosteroids or immunomodulators.5 although cd has been recognized as having a chronic relapsing course, it is evident that the majority of patients remain in clinical remission at any particular time . However it is recognized that the majority of patients will progress from inflammatory to complicated fistulizing or penetrating disease over time . The cumulative risk for the development of a cd - related fistula has been estimated to be 33% at 10 years and 50% after 20 years based on a population based cohort study form olmsted county, mn.6 therefore the treatment strategies for cd must target lifelong management, addressing both short - term and long - term aspects of the disease and are guided by the disease location, severity, associated complications and concurrent therapy taken by the patients . These treatment strategies consist of a sequential (step up) approaches ranging from the first line agents such as 5-asa, controlled released corticosteroids (budesonide) and antibiotics all used to treat mild to moderate active cd to the second line with oral prednisone and the third line with conservative use of immunomodulators (azathioprine (aza), 6-mercaptopurine and methotrexate) and further biological therapy (infliximab, adalimumab, czp and natalizumab). Recently, 5-asa has been critically analyzed for treatment of patients with cd and is suggested to be no more effective than placebo.7 however, recent data suggest that early initiation of combined treatment with immunomodulators and anti - tnf agents (infliximab) (top down) was more efficacious than conventional management with cs followed by aza and then infliximab8 in prior anti - tnf and anti - metabolite nave patients . Therapy with anti - tnf antibodies has become a mainstay of treatment for patients with cd who are unresponsive to conventional medical management . Currently there are three anti - tnf agents that have been approved by the u.s . Food and drug administration (fda) in the treatment of cd, namely infliximab, adalimumab and czp . Infliximab (remicade) is administered intravenously whereas adalimumab (humira) and czp (czp) (cimzia) are administered subcutaneously . Treatment with infliximab consists of an initial loading regimen with three initial infusions at the dose of 5 mg / kg at week 0, 2 and 6 followed by every 8 week maintenance schedule.9 treatment with adalimumab (administered subcutaneously) consists of initial loading dose of 160 mg (given either in four doses of 40 mg each within 1 day or in two daily doses of 40 mg each over two consecutive days) followed by 80 mg dose given two weeks later with initiation of maintenance treatment after additional 2 weeks at dose 40 mg every 2 weeks.10 treatment with czp is initiated with an initial loading dose of subcutaneous injection of 400 mg at weeks 0, 2 and 4 followed by maintenance treatment every 4 weeks.11 czp was approved in april 2008 by the us food and drug administration and is currently approved for reducing signs and symptoms of cd and for maintaining clinical response in adult patients with moderate to severe activity of the disease with inadequate response to conventional therapy.12 anti - tnf therapy (infliximab, adalimumab and czp) was found to be significantly more efficacious than placebo in inducing remission at week 4 with a total mean difference in effect between anti - tnf agents and placebo of 11% (95% ci 6%16%, p <0.001) based on the results of a meta - analysis of fourteen randomized placebo controlled trials that included a total of 3995 patients with cd.13 these biologic medications were also significantly superior over placebo in maintaining remission at weeks 20 through 30 with total mean difference in effect between active and placebo arms of 23% (95% ci 18%28%, p <0.001) among patients who responded to an open - label induction with either infliximab, adalimumab or czp followed by randomized placebo controlled maintenance treatment.13 this review discusses the efficacy of czp and adherence to anti - tnf therapy with a particular focus on czp in patients with cd . The efficacy of czp was evaluated in two dose - response phase ii (n = 384)14,15 and two phase iii (the pegylated antibody fragment evaluation in cd disease: safety and efficacy 1 (precise 1) and precise 2)16,17 (n = 1330) randomized placebo controlled trials in adult patients with moderate to severe cd (table 1). The first phase ii trial (n = 92) assessed efficacy of czp over 12 weeks period after single 30-minute intravenous infusion of either czp (cdp870) (1.25 mg / kg, 5 mg / kg, 10 mg / kg or 20 mg / kg) versus placebo.14 the primary endpoint was clinical response (decrease in crohn s disease activity index (cdai) score at least by 100 points when compared to baseline) at week 4.14 czp demonstrated similar efficacy to placebo in achieving primary endpoint (60% for 5 mg / kg, 58.8% for 10 mg / kg, 47.8% for 20 mg / kg vs. 56% for placebo).14 similarly, no difference between any dose of czp and placebo was observed with respect to secondary endpoints (clinical response, remission, cdai score decrease by 70 points, c - reactive protein (crp) levels at weeks 2, 8, 12).14 on the other hand, czp given at 10 mg / kg was significantly more efficacious than placebo in inducing remission at week 2 (47.1% vs. 16%, p = 0.041).14 the second phase ii 12-week trial (n = 292) evaluated efficacy of czp administered subcutaneously (100 mg, 200 mg or 400 mg) or placebo.15 treatment with czp was not superior over placebo as assessed at the primary study endpoint (clinical response at week 12) with the response rates among active drug arm of 36.5% (100 mg), 36.1% (200 mg) and 44.4% (400 mg) and in the placebo arm of 35.6%.15 however, czp was superior to placebo in achieving clinical response at week 2 (100 mg, 200 mg and 400 mg), 4 (200 mg and 400 mg), 8 (100 mg and 400 mg)and 10 (400 mg) with the highest rates for 400 mg dose at any analyzed.15 in addition, czp was superior to placebo in inducing clinical remission at week 4 (100 mg, 200 mg and 400 mg) and week 8 (100 mg and 400 mg) but not week 12.15 treatment with the highest dose of czp (400 mg) was superior to placebo in achieving primary (53.1% vs. 17.9%, p = 0.005) and secondary endpoints in patients with high baseline levels of crp (10 mg / l) but not in those with low baseline crp levels in post - hoc analysis.15 based on these findings it was proposed that the efficacy of czp over placebo might not have been demonstrated due to the high placebo response rate in the large cohort of patients with low baseline level of crp.15 the latter findings were taken into consideration in the phase iii 26-week precise 1 trial (table 1).16 patients in this trial (n = 660) were stratified based on low (<10 mg / l) or high (10 mg / l) baseline crp levels and then randomized to subcutaneous injections of either czp 400 mg or placebo given every 2 weeks through week 4 and then every 4 weeks through week 26.16 czp was found to be significantly more efficacious in achieving the primary endpoint (at least 100 point decrease in cdai score at week 6 and both weeks 6 and 26 in a cohort of 302 patients with high baseline crp levels) with rates of 37% vs. 26% (wk 6, p = 0.04) and 22% vs. 12% (both wk 6 and 26, p = 0.05).16 in an overall cohort treatment czp was superior to placebo in achieving clinical response at week 6 (35% vs. 27%, p = 0.02) and both weeks 6 and 26 (23% vs. 16%, p = 0.02).16 on the other hand, no significant difference was found between the active arm and placebo arm with respect to achieving remission at any time point among all patients (wk 6: 22% vs. 17%, p = 0.17; both wk 6 and 26: 14% vs. 10%, p = 0.07) or patients with high baseline crp level (wk 6: 22% vs. 17%, p = 0.29; both wk 6 and 26: 13% vs. 8%, p = 0.24).16 concomitant use of immunosuppressants or cs, previous infliximab therapy or smoking status did not influence the response rates at the aforementioned time points.16 the presence of antibodies to czp were detected in 8% of czp - treated patients with a 4% rate in czp - treated patients who also received immunosuppressive agents and with 10% rate in czp - treated patients who did not receive concomitant immunosuppressive agents.16 the subsequent precise 2 trial (table 1) observed that czp was superior to placebo in maintaining response and clinical remission in responders to induction therapy with czp.17 among patients who received an open - label induction therapy with 3 single doses of 400 mg czp given subcutaneously every 2 weeks 64% (428/668) responded (at least 100 point decrease in cdai score vs. baseline score).17 these patients were stratified according to baseline crp levels (10 vs. <10 mg / l) and randomized to receive subcutaneously either czp 400 mg or placebo administered every 4 weeks through week 24 with follow - up through week 26.17 therapy with czp was superior to placebo in maintaining response to treatment through week 26 in patients with baseline high c - reactive protein levels (primary end point) (n = 213, 62% vs. 34%, p <0.001) and in the intention to treat population (n = 425, 63% vs. 36%, p <0.001).17 czp was also significantly superior to placebo in achieving clinical remission at week 26 in the cohort with high baseline crp (42% vs. 26%, p = 0.01) and in all patients in the intention to treat population (48% vs. 29%, p <0.001).17 antibodies to czp were detected in 18% of patients receiving placebo maintenance therapy and in 8% of patients receiving continuous czp treatment (p - value not reported).17 among those who received concomitant immunosuppressive agents the rates of detectable antibodies to czp were 2% in czp maintenance arm and 8% in placebo maintenance arm.17 on the other hand, the rates of patients with detectable antibodies to czp in those not treated with immunosuppressants were 12% in czp arm and 24% in placebo arm.17 a recent detailed analysis of a cohort of 108 patients with fistulizing cd that participated in the precise 2 trial17 showed that 58 (53.7%) of them achieved clinical response to induction therapy with czp at week 6 and were subsequently randomized to receive further maintenance with either czp (n = 28) or placebo (n = 30).18 the complete fistula healing rate was achieved at week 26 in 36% of czp - treated and in 17% of placebo - treated patients (p = 0.038).18 however, using the precise 2 trial17 pre - specified definition of fistula closure (closure of 50% of fistulas at any two consecutive post - baseline visits at least 3 weeks apart) there was no difference between czp and placebo arms with respect to percentage of patients achieving fistula closure (54% vs. 43%, p = 0.069).18 an additional analysis of randomized maintenance trial data from precise 2 highlighted that czp - treated patients with shorter duration of cd (less than 1 year) had higher response rates at week 26 when compared to those czp - treated subjects with longer duration of cd (5 years) (89.5% vs. 57.3%, p <0.05).19 however, czp - treated patients with both short (<1 year) and long (5 years) duration of cd had significantly higher response (89.5% vs. 37.1%, p <0.01 and 57.3% vs. 32.7%, p <0.001, respectively) and remission (68.4% vs. 37.1%, p <0.05 and 44.3% vs. 23.5%, p <0.001, respectively) rates than placebo recipients at week 26.19 the factors that independently predicted maintenance of response to czp at week 26 identified by logistic regression were shorter (<2 years) vs. longer duration of cd (82.1% vs. 58.5% p <0.006), absence vs. presence of prior intestinal resection (67.5 vs. 51.6%, p <0.027), infliximab - nave status vs. prior exposure to infliximab (68.7% vs. 44.2%, p <0.002), and no corticosteroid use vs. corticosteroid use at baseline (65.7% vs. 57.3%, p <0.001).19 although the precise 2 trial demonstrated that the efficacy of czp is higher in patients receiving this agent as the first - line biologic when compared to infliximab - exposed individuals a post - hoc analysis of precise 2 data showed that patients with cd may benefit from treatment with czp regardless of prior use of infliximab when compared to those treated with placebo.20 czp was significantly more effective than placebo as maintenance therapy at week 26 in both infliximab - exposed (response: 44.2% vs. 25.5%, p = 0.018; remission: 32.7% vs. 13.7%, p = 0.008) and in infliximab nave patients (response: 68.7% vs. 39.6%, p <it should be noted however that the superiority of czp over placebo was more distinct in infliximab nave patients.20 these interesting observations however require future validation in a large prospective placebo controlled trials . All patients who completed 26-week precise 2 trial were offered open label extension treatment with czp given at 400 mg s.c . Dose every 4 weeks for 54 weeks (precise 3 trial).21 the precise 3 trial included 141 patients who received czp (precise continuous group) and 100 patients who received placebo (precise 3 drug interruption group) in prior precise 2 trial.21 among patients who were either in response or remission at precise 3 baseline (week 26 of precise 2) the rates of sustained response (reduction in harvey - bradshaw index score 3 from baseline for all visits) and remission (hbi score 4 for all visits) were similar between continuous and drug interruption arms at 26 weeks (sustained response: 74.4% vs. 79.7%, respectively; sustained remission: 72.8% vs. 73.5%, respectively) and 54 weeks (sustained response: 66.1% vs. 63.3%, respectively; sustained remission: 62.1% vs. 63.2%, respectively) of precise 3 trial.21 on the other hand, patients in the drug interruption arm had a greater incidence of adverse events related to czp than those receiving czp continuously (32% vs. 23.4%, p - value not reported).21 therefore it has been suggested that continuous administration of czp should be recommended due to its effectiveness and more favorable safety profile.21 all patients who relapsed (increase in cdai 70 points above baseline or higher than baseline at week 6 of precise 2 trial with an absolute cdai score 350 points) and decided to withdraw before week 26 of precise 2 trial were offered an open- label extension study (precise 4).22 patients (n = 124) enrolled in the precise 4 study were separated into either the continuous (n = 49) or drug interruption (n = 75) arm based on whether they received czp or placebo maintenance following czp induction during the precise 2 trial.22 patients who relapsed on czp maintenance therapy received a single dose of czp 400 mg s.c . Whereas those who relapsed after czp interruption received three reinduction doses of czp 400 mg s.c . 2 weeks apart with subsequent maintenance administration every 4 weeks up to week 52.22 czp was equally efficacious in continuous and drug interruption treatment arms with 63.3% and 65.3% response (reduction in harvey - bradshaw index score 3 from baseline) rates at week 4, respectively and 54.8% and 59.2% further maintaining this response at week 52, respectively.22 the remission rates (hbi score 4) at week 4 were 28.6% and 44% among those treated with czp continuously and with prior intermission, respectively with sustained respective remission rates at week 52 of 64.3% and 54.5%.22 patients with cd experiencing disease relapse on czp maintenance therapy following initial response to induction with czp may benefit from administration of an additional dose of czp . Similarly, those with recurrence of cd after czp discontinuation may achieve improvement in their symptoms after reinduction of czp.22 a phase iiib welcome trial (26-week open - label- induction, double - blind - maintenance, placebo - controlled trial evaluating the clinical benefit and tolerability of czp induction and maintenance in patients suffering from cd with prior loss of response or intolerance to infliximab) assessed the efficacy of czp in treatment of patients with active cd and prior loss of response or hypersensitivity to infliximab . 23 an open - label induction with czp administered s.c . At the dose 400 mg at weeks 0, 2 and 4 in 539 patients resulted in 62% response (decrease in cdai 100 points from baseline) and 39.3% r emission (cdai 150 points) rates at week 6.23 there were 329 patients who responded to czp induction at week 6 who entered a double - blind maintenance part of the welcome trial that compared the efficacy of czp 400 mg maintenance treatment administered either every 2 weeks (n = 161) or every 4 weeks (n = 168) from week 6 through week 26.23 both maintenance regimens displayed comparable rates of sustained response (36.6% vs. 39.9%, respectively p = 0.55) and remission (30.4% vs. 29.2%, respectively, p = 0.81) at the end of the trial (week 26).23 a recent randomized double blind placebo controlled 6-week trial (table 1) evaluated the efficacy of czp in 439 adult patients with active cd and no prior exposure to anti - tnf therapy.24 patients were randomly assigned to either a single s.c . Dose of czp 400 mg or placebo given at 0,2 and 4 weeks with subsequent assessment of clinical remission (cdai 150 points) at week 6.24 overall, there was no statistical difference in remission rates at week 6 between czp and placebo groups (32% vs. 25%, p = 0.174).24 however, among patients with baseline crp 5 mg / l treatment with czp resulted in a statistically significant difference in remission rates at week 6 when compared to placebo (p = 0.031).24 certain demographic and baseline disease characteristics such as age 40 years, male sex, crp 10 mg / l, disease located in colon or in ileum and colon, no prior surgical resection, disease duration less than baseline mean, increased clinical disease activity (cdai 300 points) were associated with a statistically significant 23 fold higher rates of clinical remission with czp versus placebo.24 recent data from a swiss, prospective, questionnaire - based phase iv study of 60 clinical practice based - patients who received induction and maintenance treatment with czp 400 mg demonstrated 70% and 67% response (decrease of hbi score 3 points vs. baseline) rates and 40% and 36% remission (hbi 4 points) rates at week 6 and week 26, respectively.25 in addition, 36% and 55% of patients had complete fistula closure at week 6 and 26, respectively.25 among treated patients 88% and 67% continued czp beyond week 6 and week 26, respectively.25 adherence has been defined as the degree to which the patient follows medication intake and other doctor s recommendations.26,27 the term adherence is currently preferred over the term compliance since it underlines the equal role of both patient and the doctor in their relationship whereas the term compliance underlines only the greater power of the doctor.26,27 according to the world health organization patient s adherence to treatment determines the success of given therapy.28 on the other hand, the adherence to treatment in patients with chronic disorders in developed countries has been estimated to be at 50%.28 levy and feld grouped patients reasons of patients non - adherence to gastroenterology medical management into either lack of adequate skills or knowledge to comply with prescribed treatment (inadequate or poor information about prescribed medications), lack of patients belief that prescribed treatment is helping them or the lack of support from the patients environment (financial or employment situation, situation at household not allowing to comply with treatment, difficulties with transportation) (table 2).27 in order to increase patients adherence physicians should understand that their recommendations for patients have to include clear explanations of rationale for treatment, why adherence to prescribed regimen is crucial to therapeutic success, review of therapeutic assignments given during past visits (homework) including discussion of any difficulties patients may have encountered, attempt to address them and praise success (table 3).27 levy and feld suggested 10 recommendations addressing the reasons for nonadherence (table 4). They underline the crucial role of the proper physician - patient contact in establishing the pattern of patient s adherence . Although levy and feld published their recommendations in 1999 when anti - tnf agents were emerging for treatment of cd their recommendations may be also applied to medications administered intravenously or subcutaneously in order to increase patient s adherence . For example, quality of the physician / patient relationship and patient s trust in physician s recommendations certainly would lead to increased adherence to any medication that is warranted . The major goal of treatment of cd is to induce and maintain disease in remission . It has been demonstrated that remission in patients with cd is associated with reduced hospitalizations and surgeries, increased employment and improved quality of life.29 this is why it is important to determine factors associated with adherence and factors associated with non - adherence to anti - tnf agents in order to improve adherence if patient does not adhere or to maintain adherence if patient adheres to prescribed regimen . Until now and at the time of writing this manuscript, there have been no published studies on the adherence to czp in patients with cd . However, there are some data available on adherence to other anti - tnf agents in cd, namely infliximab and adalimumab . There have been only two studies that evaluated the adherence of infliximab30,31 and one study that assessed adherence to adalimumab32 in patients with cd . Two studies assessed factors predictive of non - adherence for infliximab30 and adalimumab using multivariable models32 (table 5). In their first study kane et al collected data from outpatient databases that included 274 patients with cd who were scheduled to receive 1185 infusions with infliximab within 17 month period.32 the authors defined non - adherence as patient no - show without prior rescheduling of appointment by the patient.30 the observed non - adherence rate was 4% (48/1185) and a female sex and time from the initial infliximab infusion greater than 18 weeks were found to increase risk of non - adherence 2-fold.30 in an attempt to assess the impact of the adherence to infliximab on health care costs in patients with cd an analysis of the integrated health care information service national managed care benchmark database including medical histories of over than 25 million patients enrolled in managed care within the us was performed and identified 571 patients with cd who were receiving infliximab maintenance treatment over the 4 year time period (at least four consecutive infusions) within the first year after the initial infusion.31 non - adherence was defined as less than 7 infusions during the first year of treatment.31 its rate was found to be 34.3% and it was associated with nearly 3-fold increase in an all - cause hospitalizations (or = 2.7; p <0.001) and 2.5-fold increase in cd - related hospitalizations (or = 2.5, p <0.001).31 in addition, non - adherence to infliximab was also associated with increased by 73% adjusted total medical costs excluding infliximab cost (p <0.001), by 115% adjusted all - cause hospitalization cost (p <0.001) and by 29% adjusted all - cause outpatient cost excluding infliximab cost (p <0.001) when compared to adherence to infliximab.31 similarly, non - adherence to infliximab was associated with increased by 90% adjusted cd - related medical cost excluding infliximab cost, by 115% adjusted cd - related hospitalization cost and by 43% adjusted outpatient cost excluding infliximab cost when compared to adherence to infliximab (p <0.001).31 a group of french researchers performed a 21 month prospective observational multicenter study of adherence to adalimumab in patients with cd.32 non - adherence was defined as either delay or miss of at least one injection of adalimumab within 3 months prior to the study.32 among 108 patients with cd 49 (45.4%) of them were non - adherent to adalimumab injection with 16 patients (14.8%) missing at least one of injection and 33 patients (30.6%) delaying at least one injection.32 the reasons for non - adherence were forgetfulness (24.6%), infection (24.6%), travel (20%), intentional non - adherence (10.8%), pharmaceuticals supply problems (9.2%), side effects (7.7%), pregnancy (1.5%) and hospitalization due to cd (1.5%).32 overall, duration of disease greater than 93 months and adalimumab injection 80 mg every other week were negatively associated with injection delay or miss.32 the injection regimen of adalimumab at the dose of 40 mg every other week was associated with nearly 4-fold increase in injection delays whereas the presence of at least one relapse within last 12 months was a negative predictor of a delayed injection.32 duration of cd greater than 90 months was negatively associated with missed injection.32 current evidence strongly suggests that czp is an effective therapy for patients presenting with moderate to severe cd in anti - tnf nave patients as well as in patients with secondary loss of response or intolerance to infliximab . Czp has expanded the spectrum of anti - tnf agents available for the treatment of patients with cd . Patients with increased serum markers of inflammation (crp) belong to the subset of patients in whom czp is of particular benefit . Studies have demonstrated czp to be an effective for induction and maintenance therapy in patients with cd and improving health - related quality of life for these patients.33,34 future studies on large number of patients are warranted to evaluate the efficacy of czp in the setting of clinical practice . There have been no published studies that assessed adherence to czp in patients with cd . There are limited data on adherence to other anti - tnf therapies, infliximab and adalimumab . Treatment with czp is associated with improvement in quality of life and lessened work impairment in patients with cd . At this moment, health care professionals should be encouraged to follow ten adherence recommendations presented in table 4 to attempt to increase patient adherence to medications and regimens . Patients should be encouraged to adhere to treatment with czp not only due to its efficacy in maintaining clinical remission in cd but also because of improvement in quality of life and reduction of work impairment . Future studies should determine what factors are associated with non - adherence to czp and also other anti - tnf agents . This would allow us to make evidence - based steps necessary to increase patients compliance.
|
Long - term peritoneal dialysis (pd) is associated with progressive increase in the thickness of peritoneal membrane, predominantly in the submesothelial compact collagenous zone (1), and membrane hyperpermeability (2). The mechanisms involved in these structural and functional changes remain unclear, but prolonged exposure of the membrane to conventional pd solution containing high concentrations of glucose and glucose degradation products (gdp) may play an important role . Epithelial - mesenchymal transition (emt) of epithelial cells, characterized by loss of epithelial cell characteristics and gain of ecm - producing myofibroblast characteristics, is an important mechanism involved in tissue fibrosis (3 - 6). Recent data (7 - 9) suggest that human peritoneal mesothelial cells (hpmc) undergo emt during pd and that emt may play an important role in the development and progression of peritoneal fibrosis leading to failure of peritoneal membrane function . This brief review will discuss the mechanisms of emt and suggest strategies for the prevention of emt and preservation of peritoneum during long - term pd . Accumulating evidence implicates emt as a potential mechanism for the development and progression of peritoneal fibrosis during long - term pd leading to failure of peritoneal membrane function . (7) first reported that peritoneal mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype soon after pd was initiated with a decrease in the expression of cytokeratin and e - cadherin through induction of the transcriptional repressor snail . (8) demonstrated that intra - peritoneal administration of adenovirus - mediated transforming growth factor-1 (tgf-1) increases peritoneal expression of genes associated with fibrosis and emt including collagen i, -smooth muscle actin (-sma), and snail, suggesting that emt occurs in vivo after tgf-1 overexpression in the peritoneum . Nonepithelioid mesothelial cells from spent dialysate produces a greater amount of vegf ex vivo than epithelioid - like mesothelial cells (9), suggesting that emt may also have a role in peritoneal hyperpermeability . It is therefore important to clearly understand the mechanisms involved in emt during pd in order to provide a novel therapeutic strategy to prevent emt and peritoneal fibrosis . We have shown that high glucose (10) and glucose - based pd solution (11) induce generation of reactive oxygen species (ros) in cultured hpmc and that ros generated by glucose - based conventional pd solution is responsible for peritoneal neoangiogenesis, membrane hyperpermeability, and peritoneal fibrosis in rats treated with glucose - based pd solutions (12). We (13) recently reported that 1) high d - glucose, h2o2, and glucose - based pd solutions upregulate -sma and downregluate e - cadherin in hpmc, 2) antioxidants, n - acetylcystein (nac) and catalase, effectively reverse high glucose - induced -sma and e - cadherin expression in hpmc, and that 3) prolonged exposure of rat peritoneum to glucose - based pd solution upregulates -sma expression in the peritoneum, which is effectively inhibited by nac . All these data suggest that ros plays a major role in peritoneal emt induced by high glucose and glucose - based pd solutions . This is consistent with our previous observation that ros is involved in tgf-1-induced emt in renal tubular epithelial cells (14). Gdp have been suggested to play a role in inducing emt . Spent dialysate obtained at 12 months after the initiation of pd using solutions containing low gdp had a significantly fewer number of fibroblast - dominant cells compared to effluent obtained from patients using pd solutions containing high gdp (15). Given that gdp signal through ros (16), it is conceivable that ros mediate gdp - induced emt in the peritoneum . Rapamycin was shown to effectively inhibit tgf-1-induced emt in cultured hpmc, suggesting the involvement of a mammalian target of rapamycin (mtor) in emt (17). The phosphatidylinositol 3-kinase (pi3-k)/akt / mtor pathway has recently been recognized as an important pathway in diabetic renal injury . High glucose activates the akt / mtor pathway in mesangial cells (18), both akt and mtor are increased in diabetic kidneys (19), and low - dose rapamycin slows the progression of diabetic renal injury including -sma overexpression and matrix accumulation (20). In cultured hpmc, treatment with antioxidants effectively inhibited high glucose - induced ros generation (10) and emt (13). In an animal model of pd, intraperitoneal administration of nac effectively prevented -sma expression in the peritoneum (13) as well as peritoneal membrane thickening, neoangiogenesis, and hyperpermeability (12). These observations strongly suggest that ros is an important therapeutic target in peritoneal emt and structural and functional alterations in peritoneum during long - term pd . Since tgf-1 is the major inducer of emt, strategies inhibiting tgf-1 signaling is a plausible way to prevent emt during pd . Bone morphogenetic protein-7 (bmp-7), a 35 kda homodimeric protein and a member of tgf- superfamily, is an endogenous antifibrotic protein that prevents renal fibrosis in ureteral obstruction (21), diabetic nephropathy (22), and nephrotoxic serum nephritis (23). We (24) recently observed that hpmc constitutively express bmp-7, that high glucose, glucose - based pd solution, and tgf-1 downregulated bmp-7 expression in hpmc, and that overexpression of bmp-7 in hpmc prevented emt induced by tgf-1, suggesting bmp-7 as a potential therapeutic strategy for preventing emt of hpmc . This is consistent with a recent report (25) that ex vivo treatment with bmp-7 reversed in vivo and ex vivo emt of hpmc . Bmp-7 rapamycin can prevent tgf-1-induced emt in hpmc (17) presumably through inhibition of high glucose - induced activation of the mtor pathway (18). Clinical trials are needed to prove the efficacy of these experimental strategies in pd patients . Cell culture and animal studies suggest that high glucose, gdp, glucose - based pd solution, tgf-1, loss of bmp-7, and activation of the mtor pathway induce emt of hpmc and that antioxidants, bmp-7, and rapamycin may prevent emt and allow better preservation of structural and functional integrity of the peritoneal membrane during long - term pd . Further studies elucidating the mechanisms involved in emt of hpmc and clinical trials may provide new therapeutic strategies for inhibiting peritoneal fibrosis during long - term pd.
|
Use - dependent plasticity shapes neuronal networks within sensory systems during early life to optimally represent sensory stimuli . Experience - dependent organization of eye - specific inputs is a major mechanism whereby refinement of synaptic connectivity is achieved in the developing visual system [24]. Monocular deprivation during development leads to a loss of cortical connectivity of the deprived eye resulting in a shift of the ocular dominance in the visual cortex, which will become permanent if the md persists to adulthood [5, 6]. Although neuronal plasticity of the developing brain gradually decreases with age, recent findings suggest that it can be reactivated in the adult visual cortex and other regions, such as the amygdala . A variety of experimental manipulations, including enzymatic treatments [10, 11], environmental enrichment [1215], food restriction, genetic manipulations [17, 18], and other manipulations, promote this kind of plasticity [1921]. Although the mechanisms behind the adult induced plasticity are still unclear, we are beginning to understand the key factors involved . For example, the developmental maturation of neuronal inhibition, mainly through the parvalbumin containing interneurons [22, 23], is known to be involved in both the opening and the closure of the critical period . Several extracellular matrix components, such as psa - ncam or the perineuronal nets, have been shown to play a role in the maturation of the inhibitory circuitries and experimental manipulations removing these extracellular matrix components, can trigger an early closure or a reopening of the critical period, respectively . Similarly, a variety of other molecules, such as transcription factors or proteins involved in chromatin structure remodeling, are also key factors in regulating the closure and reopening of the critical period . The main pharmacological approaches to experimentally regulate critical period plasticity in the adulthood are those affecting the action of ascending projection systems, such as the serotoninergic or cholinergic systems [21, 2729]. In this line, we have investigated the plastic effects of antidepressants, such as fluoxetine, that modulate serotoninergic transmission, and we have shown that these drugs, in a long - term treatment, are able to trigger critical period plasticity in the adult brain, through an early epigenetic modification that regulates gene expression . Here, we have used fluoxetine in combination with an experience - dependent paradigm of visual deprivation, to analyze the large - scale gene expression patterns, to understand the temporal - dependent changes that allow the reopening of the critical periods in the adult brain . A total amount of 32 long - evans hooded rats were used in this study, equally distributed in 4 experimental groups (n = 8 animals per group), as explained later (figure 1(a)). Animals were group - housed under standard conditions with food and water ad libitum in plexiglas cages (40 30 20 cm) and kept in a 12: 12 light / dark cycle . Adult rats at the postnatal day 70 (p70) were systemically treated with fluoxetine (fluoxetine - hydrochloride, 0.2 mg / ml drinking water) for 23 days . Three weeks after the beginning of the fluoxetine treatment, rats were anaesthetized with avertin (1 ml/100 g) and mounted on a stereotaxic apparatus to perform the eyelid suture for monocular deprivation (md). Eyelids were inspected daily until complete cicatrisation; subjects with even minimal spontaneous reopening were excluded . Great care was taken during the first days after md to prevent inflammation or infection of the deprived eye through topical application of antibiotic and cortisone . Two days after md, the binocular region of the primary visual cortex was dissected . For all microarray experiments, total rna was purified using rna extraction kit (macherey nagel), and amino allyl crna labeling kit (ambion) was used to label crna according to manufacturer's standard protocols . Agilent whole rat genome microarray kits (4 44 k) were hybridized following provided protocols . Images from hybridized microarrays were segmented and the median intensity of each spot was estimated by the software genepix v.5.0 (axon). Data was imported into the software (http://cran.r-project.org/) and preprocessed by the bioconductor package limma . The statistical analysis used was a linear model followed by t - test for finding the differentially expressed genes . In order to increase the reliability of the statistical analysis in addition, we also increase the reliability of the analysis through validation of the results using multiple rt - pcrs . Lists of significant genes were screened by the david 6.7 annotation tools in order to find overrepresented biological themes . Purified rna was treated with dnase (fermentas) and cdna was synthesised from 1 g of rna (invitrogen). Real - time pcr was carried out to determine relative enrichment in the samples using the sybr green method according to the manufacturer instructions (sybr green i master, light cycler 480, roche diagnostics). The comparative ct method was used to determine the normalized changes of the target gene relative to a calibrator reference; in particular, values were normalized to gapdh levels . Previous studies have shown that 7 days period of monocular deprivation in fluoxetine - treated adult rats is sufficient to bring about a change in the ocular dominance . To reveal early transcriptional changes that precede and underlie the functional change, we analysed gene expression, using dna microarrays, at two days after md . Microarray analysis revealed only relatively few genes that were significantly regulated by either flx (n = 197, see supplementary table s1 in the supplementary material available online at http://dx.doi.org/10.1155/2013/605079) or md alone (n = 239, table s2), treatments that themselves do not produce any changes in the ocular dominance plasticity . However, the combination of flx and md, the treatment that promotes changes in ocular dominance, altered the expression of a significantly larger number of genes (n = 1603, table s3, figure 1(b)). Notably 1237 out of 1603 (77%) of the genes in the group receiving both md and flx were downregulated, whereas in the groups receiving either md or flx, 111 out of 239 and 88 out of 197 genes were downregulated, respectively, comprising of roughly 50% of all the regulated genes . Hence, the combination of the treatments apparently has two major effects on gene expression; first, it increases the number of regulated genes when compared to the single treatments, and second, it has a striking effect on downregulating most of the genes, indicating that silencing of genes normally expressed during basal conditions is likely involved in the triggering of plasticity of the adult brain . The representation of biological themes was screened using fisher's exact test on the lists of differentially expressed genes in each comparison . Chronic fluoxetine treatment induced a regulation of genes related to chromatin remodelling, nervous system development, and plasticity, as well as regulation of gene expression and transcription in the binocular visual cortex (table s4). Md altered the expression of a significant number of genes related to cell differentiation, cell plasticity, and neurogenesis . Several genes of the ion homeostasis and regulation of transcription were also found overexpressed (table s5). The combination of md and fluoxetine treatment downregulated the majority of the differentially expressed genes, altering the expression of genes represented in a variety of functional processes, including genes related to neuronal development, plasticity, and apoptosis . In addition, genes involved in the synaptic transmission, ion and intracellular calcium homeostasis, and vesicular secretion were found differentially expressed . Blood circulation and lipid metabolism were among the most significantly overrepresented families (table s6). To provide validation of the microarray data, we next examined single patterns of gene expression by means of real - time pcr, in the same experimental groups and using the same experimental paradigm (figure 1(a)). In particular, we focused our attention on genes whose expression may alter molecular and cellular processes involved in the closure of the critical period for visual cortex plasticity, such as the balance of inhibitory and excitatory transmission [22, 31, 32], transcription factors regulating gene expression, extracellular matrix remodeling, myelination, and chromatin structure remodeling [26, 29], as well as genes involved in processes of synaptic plasticity, neuronal differentiation, and outgrowth (see table 1). We observed that fluoxetine produced a significant increase in the expression of genes involved in inhibitory neurotransmission when comparing both animals with binocular vision and animals with monocular deprivation with their respective controls (bv - sal versus bv - flx and md - sal versus md - flx; figure 2(a)). Specifically, in animals with binocular vision, we found an increased expression of the vesicular gaba transporter (vgat; 60% increased expression; p = 0.001), while in rats with monocular deprivation together with fluoxetine treatment, we observed an increase in the expression of gabra4 (30% increased expression; p = 0.02). We did not observe many changes in the composition of nmda receptor subunits in either of the experimental groups (see figure 2(b) and table 1). The only significant change we found was a decrease in the expression of the nr2a subunit (nmda-2a; 20% decreased expression; p = 0.04) in the animals with monocular deprivation treated with fluoxetine . We detected increases in the gene expression of transcription factors in the animals with binocular vision treated with fluoxetine (figure 2(c)). In particular, nfkb1 and dlx1 increased their expression (50% and 30% increased expression, resp . However, in those animals with monocular deprivation, fluoxetine treatment produced a decrease in the expression of transcription factors, such as egr-2 (p = 0.04). The expression of reelin, transcript that encodes a glycoprotein that mediates synaptic plasticity at hippocampal level, was significantly increased in md animals treated with fluoxetine (figure 2(d); 40% increased expression; p = 0.001). The expression of additional transcripts that encode proteins involved in neuronal differentiation and outgrowth processes as well as synaptic plasticity increased in both groups . In animals with binocular vision, fluoxetine promoted an increase in the expression of clcn3 (20% increased), kcnv1 (20% increased), and kcnq3 (30% increased), which encode ion channels that mediate chloride and potassium conductance (p <0.05), and in animals with monocular deprivation fluoxetine produced also an increase in the expression of clcn3 (50% increased expression; p = 0.01). The expression of mmp2 and mmp9 was markedly changed between animals treated with fluoxetine and with binocular vision and those with monocular deprivation (figure 2(e)). Mmp2 and mmp9 encode for proteolytic enzymes that degrade extracellular matrix components [3537] and play a key role in mediating synaptic plasticity at the level of the hippocampus [38, 39]. In particular, mmp2 gene expression was decreased in animals treated with fluoxetine alone (50% decrease; p = 0.02), while animals with combined monocular deprivation and chronic fluoxetine treatment had an increased expression of both mmp2 (60% increased; p = 0.01) and mmp9 (50% increased; p = 0.01). Changes in the expression of transcripts that encode an enzyme that regulate chromatin susceptibility to transcription were detected in animals with binocular vision after chronic fluoxetine treatment . In particular, we found that hdac3 expression was enhanced (figure 2(f); 30% increased p = 0.02). On the other hand, the expression of mbp, which encodes a basic protein of myelin, a repressive factor for visual cortex plasticity, was significantly reduced by fluoxetine treatment in animals with both binocular vision (40% decreased; p = 0.01) and monocular deprivation (40% decreased; p = 0.001). This study provides a large - scale analysis of changes in patterns of gene expression associated with the reopening of the critical period of plasticity in the adult visual system induced by the combination of fluoxetine treatment and monocular deprivation . Our findings suggest a scenario where an enhanced serotoninergic transmission induced by long - term fluoxetine treatment induces a shift of the inhibitory - excitatory balance [8, 29], which in turn promotes an alteration in the expression of genes involved in different biological themes that may underlie the functional modifications in the adult visual cortex related with the reopening of the critical period plasticity . Our results reveal that the process of plasticity reactivation in adulthood involves both (i) a transient activation of neural mechanisms normally present during early stages of brain development and (ii) a removal of molecular factors that inhibit plasticity in adulthood . Gene expression patterns involved in processes of synaptic plasticity, neuronal differentiation, and outgrowth were, indeed, differentially regulated by chronic fluoxetine treatment . Reelin is an extracellular glycoprotein involved in the migration and correct development of the cerebral cortex [41, 42]. Reelin is highly expressed by cajal - retzius neurons during development, but its expression is limited to a subpopulation of interneurons during the adulthood [43, 44]. Although the function of reelin in adult neurons remains unclear, its overexpression has been shown to enhance plasticity and learning, affecting presynaptic transmission [34, 45]. Our results demonstrate an upregulation of reelin after chronic fluoxetine treatment, suggesting that the overexpression of molecules involved in the juvenile plasticity plays an important role in the reopening of the critical periods during the adulthood . The proteolytic enzyme mmp2, on the other hand, may drive mechanisms of synaptic plasticity by degrading extracellular matrix components that are inhibitory for plasticity, as observed in the adult hippocampus . Increase of mmp2 expression, indeed, was paralleled by a decrease of mbp: a basic component of myelin, which is a repressive factor for visual cortex plasticity . Our analysis of gene expression points towards a downregulation of mbp following long - term antidepressant treatment, supporting the hypothesis that the removal of factors that are inhibitory for plasticity may provide a permissive environment for structural and functional changes of neuronal circuitries in the adult nervous system . Chronic fluoxetine administration has been shown to promote structural changes in both excitatory [46, 47] and inhibitory circuits [4850]. Although there is evidence that long - term fluoxetine administration promotes a reduction of gaba - mediated inhibition in adult visual cortical circuitries [8, 29], a compensatory mechanism might explain the increase in the expression of vgat or gabra4 that we observe in our experiment . These results are also in agreement with previous studies, in which fluoxetine treatment in combination with monocular deprivation produces an increase in the elongation of the tips of interneuronal dendrites, supporting the idea that inhibitory neurotransmission plays a key role in the reopening of the critical periods [20, 22, 23]. Similarly, the change of nmda receptor subunit composition, evidenced by the decrease in nmda-2a gene expression following antidepressant treatment, is particularly interesting in this respect . The expression of the nr2a subunit has been correlated with a progressive decrease of nmda receptor currents during development [51, 52]. This raises the possibility that a decrement of the nr2a / b ratio may increase nmda receptors sensitivity thus causing the strengthening of synapses required for the potentiation of the nondeprived input . Another highly significant notion that emerges from our data is that the changes promoted by the combination of fluoxetine with monocular deprivation, regarding the expression of transcription factors and proteins of the extracellular matrix, are opposed to those promoted by fluoxetine alone . This indicates that these molecules might be underlying the structural plasticity changes driven by monocular deprivation to produce the shift in the ocular dominance and its consolidation in the visual system . Our findings support the hypothesis that the therapeutic effect of antidepressant drugs is dependent on changes in neuronal plasticity [55, 56]. Importantly, these results open up new insights into the understanding of the mechanisms underlying the reopening of the critical period in the adult brain, by providing the basis of gene expression patterns for a visual deprivation paradigm that demonstrates the ability of the nervous system to translate environmental stimuli into structural and functional changes of neural circuitries.
|
Procalcitonin (pct) is a 14-kd protein encoded by the calc-1 gene and synthesized physiologically by thyroid c - cells . Under normal conditions, serum pct levels are negligible . After shock or tissue injury (i.e. Burn, trauma, surgery) or infections and sepsis, pct mrna expression has been documented in human extra - thyroidal tissues . Thus, systemic pct concentrations are considered as a component of the inflammatory response and as an acute - phase marker . In cardiac acute patients, data on pct some studies [3, 4] reported that pct levels were increased in acs patients on admission, whereas other investigations [5, 6] documented that plasma pct concentrations were in the normal range in patients with uncomplicated acute myocardial infarction . Elevated concentrations of pct have been reported in patients with cardiogenic shock . In a more recent retrospective study, it was observed that cs patients showed high pct concentrations, especially in the presence of multiorgan failure (mof) and in absence of signs of infections (cultures and clinical findings). We recently observed that the degree of myocardial ischemia (clinically indicated by the whole spectrum of acs, from unstable angina to cardiogenic shock st - elevation following myocardial infarction) and the related inflammatory - induced response are better reflected by crp (which was positive in most acute cardiac care patients of all our subgroups) than by pct which seems more sensible to a higher extent of inflammatory activation, being positive only in all cs patients . In these patients, the clinical interpretation of absolute pct values (both in diagnostic and prognostic terms), represent a major challenge since they may be influenced by several factors, such as the degree of systemic inflammatory response, the coexistence of multiorgan dysfunction, the presence / absence of infections and finally by the time of measurements during hospital course (i.e. The dynamics of pct levels). No data are so far available on the dynamics of pct levels in patients with cardiogenic shock . The aim of this preliminary investigation was therefore to evaluate the serum evolution of pct during intensive cardiac care unit (iccu) staying in a group of patients with cardiogenic shock (cs) following st - elevation myocardial infarction (stemi) submitted to primary percutaneous intervention (pci) with no laboratory or clinical sign of infection . Ten consecutive patients with cardiogenic shock following stemi were submitted to pci and then admitted to our 12-bed iccu in florence, a tertiary center, from 1 september 2008 to 31th march 2009 . To be eligible for the present study, all patients had to be free of infection at the time of blood sampling, as evidenced by both clinical and microbiological examinations, including urinary cultures and microbiological examinations of tracheal aspirate in mechanical ventilated patients and blood cultures . A clinical diagnosis of cardiogenic shock was made if all the following criteria were present: 1 . Systolic blood pressure persistently less than 90 mmhg or vasopressors required to maintain a systolic blood pressure of more than 90 mmhg; 2 . Signs of hypoperfusion (e.g. Urine output less than 30 ml / hour or cold / diaphoretic extremities or altered mental status); 3 . Clinical evidence of elevated left ventricular filling pressure (e.g. Pulmonary congestion on physical examination or chest x - ray). Pulmonary artery catheterization was not required when all clinical criteria and echocardiographic evidence of left ventricular dysfunction without mechanical complications were present . The day after iccu admission blood samples were obtained for cardiac biomarkers (tni <0.15 ng / ml), leucocytes count (4000 - 10000/l), crp (<9 mg / dl), uric acid (<6.5 mg / dl), nt - pro brain natriuretic peptide (nt - probnp, in males 0 - 50 yrs: <88 pg / ml,> 50 yrs: <227 pg / ml; in females: 0 -50 yrs: <153 pg / ml;> 50 yrs: <334 pg / ml) and procalcitonin measurements (normal values <0.5 ng / ml). Transthoracic 2-dimensional echocardiography was performed on admission in order to evaluate left ventricular ejection fraction (lvef). Apache ii (acute physiology and chronic health evaluation ii) score was also assessed . The study design was approved by the local ethic committee and inform written consent was obtained for each patient . Statistical analysis was performed by means of spss 13.0 package (spss inc, chicago, il). Data are reported as frequencies and percentages or means s.d . And analyzed with fisher s exact test and student s t test, respectively . Since pct was determined once a day, its mean value for each day of hospital stay in either group of patients has been calculated and graphically plotted in order to obtain two linear regression lines, whose slopes have been subsequently compared by means of an f test . In all analyses, table 1 shows the clinical characteristics of cs patients following stemi included in the study after pci . Clinical characteristics of patients included in the study . Compared with survivors, dead patients exhibited higher values of apache ii score, as well as trend towards higher serum concentrations of troponin i, though it did not reach statistical significance . No significant differences were detectable in regard to age, sex, infarct location, left ventricular ejection fraction, and mean arterial pressure between the two subgroups . As depicted in table 2, higher values of glycemia, nt - probnp and crp were detectable in dead patients in respect to survivors . Basal serum concentrations of procalcitonin were higher in (dead) survivors patients, though this difference did not reach statistical significance due to high values of standard deviation . As depicted in figure 1, the pattern of pct variations during iccu course was significantly different in cs patients who survived in respect to those who died (survivors: slope = -3.760.71 standard error; dead: slope = -0.810.35 standard error, p=0.004). The main finding of the present investigation, though preliminary and performed in a small subset of patients, is that the patterns of temporal pct variations throughout iccu course were heterogeneous in patients with cs and no clinical or laboratory signs of infection . A progressive reduction in pct values was observed in cs patients who survived, whereas the lack of changes in pct concentrations was documented in cs patients who died . Conversely, basal absolute pct values were not significantly different between the two subgroups, since they exhibit a wide range of values in the overall population . Sponholz et al . Described the evolution of serum procalcitonin levels after uncomplicated cardiac surgery and observed a progressive return to normal levels within the first week . Peak pct levels were reached within 24 hours postoperatively and this increase seemed to be dependent on the surgical procedure, being more invasive procedures associated with higher pct levels, and on intraoperative events, including aortic cross - clamping time, duration of cardiopulmonary bypass and duration of surgery . In infected patients, pct levels were elevated throughout the first week postoperatively [19, 20, 21], with a more pronounced trend in bacterial and fungal infections than in viral infections of sirs . [22, 23]. The authors concluded that the dynamics of pct levels, rather than absolute values, may be more important for identifying patients with infectious complications after cardiac surgery . More recently prat et al . Confirmed a slight increase in pct values in the first postoperative day after cardiac surgery, in agreement with previous results [25, 26, 27] and with adamik et al ., who showed that the development of postoperative complications after cardiac surgery with cardiopulmonary bypass was associated with increased postoperative neopterin and pct levels . Similarly, after heart transplantation, serum pct levels display a rise in response to surgery, with a peak on day two, whereas high peak levels with delayed return to normal values should lead to a search for inflammatory processes, as they are often associated with increased morbidity and mortality . Likewise, in patients with cardiogenic shock and no sign of infections we documented a reduction of pct levels only in survivors cs patients . This time course of procalcitonin can probably be explained, both in postsurgical and in cs patients, by normal pct kinetic . In healthy subjects the injection of endotoxin is followed by a rise in pct, reaching a maximum 24 hours thereafter . The return of pct levels to normality within a few days in surgical patients (after an uncomplicated postoperative course) and in cs survivors patients can be explained by half - life of pct (18 to 24 hours), in absence of a further insult that might induce pct production . Our findings, along with those in cardiac surgery strongly support the contention that the dynamic approach may be more reliable that the static one (that is the absolute single pct value) especially in the challenging conditions characterized by a systemic inflammatory response, such as cardiac surgery and cardiogenic shock . Indeed, in a cohort of unselected critically ill patients, jensen et al . Observed that a pct increase was an independent predictor of 90-day survival and that the pct day - by - day changes was able to identify critically ill patients at a higher risk of icu mortality . On the other hand, the initial ct level did not predict mortality, even though many patients were admitted with a pct 1.0 ng / ml . This suggests that several pct measurements should be made consecutively to assess the critically ill patient s infection - related mortality risk (to monitor treatment of infection day - by - day). In our investigation we further confirmed that higher values of nt - probnp are associated with increased mortality in cs patients and that a more marked systemic inflammation (as inferred by higher values of crp) and higher severity score (as indicated by apache ii) were associated with an ominous prognosis . The main limitation of the present investigation is represented by the small number of patients . However, the population is homogeneous, comprising patients with cardiogenic shock following stemi all submitted to pci, with no clinical and laboratory sign of infections . It is interesting to note that, despite the small number of subjects, the behavior of pct was clearly detectable . According to our preliminary findings, patterns of temporal pct variations throughout iccu course were heterogeneous in patients with cs following stemi submitted to pci and no clinical or laboratory signs of infection . A progressive reduction in pct values was observed in cs patients who survived, whereas a lack of changes in pct concentrations was documented in cs patients who died . Our findings strongly support the contention that the dynamic approach may be more reliable that the static one (that is the absolute single pct value) especially in the challenging conditions characterized by a systemic inflammatory response, such as cardiogenic shock . We further confirmed that higher values of nt - probnp are associated with increased mortality in cs patients and that a more marked systemic inflammation (as inferred by higher values of crp) and higher severity score (as indicated by apache ii) were associated with an ominous prognosis.
|
Cell growth is tightly linked with the cell's perception of its nutritional environment . In particular, microorganisms, such as the yeast saccharomyces cerevisiae, that spend most of their time in the stationary phase in the wild, therefore, yeast is a good model organism for the study of nutrient detection and response . Autophagy is one of several responses to nutrient starvation (klionsky and ohsumi 1999). A large number of cytoplasmic components are nonselectively enclosed within a double - membrane structure called an autophagosome, in which they are transported into the vacuole / lysosome to be degraded by resident hydrolases . Such turnover of a large amount of cytoplasm mediated by autophagy is essential for survival under nutrient - depleted conditions . We have isolated several genes essential for autophagy (termed apg) and have been investigating the function of the gene products (tsukada and ohsumi 1993; funakoshi et al . 1997; matsuura et al . 1998). Genetic and morphological analyses revealed that the degradative process of autophagy shares mechanistic components with the cytoplasm - to - vacuole targeting (cvt) pathway (harding et al . ; baba et al . 1997), which is biosynthetic, delivering a resident hydrolase, aminopeptidase i (api), to the vacuole (klionsky and ohsumi 1999). On the other hand, autophagy and the cvt pathway are distinct in many aspects . The two pathways appear to be regulated separately; the cvt pathway is mainly observed under growing conditions, whereas autophagy is induced by starvation (baba et al . Furthermore, cvt vesicles and autophagosomes, the vesicles formed in the cvt pathway and autophagy, respectively, are clearly different in size (baba et al . 1997). Recently, the t - snare tlg2 and sec1-homologue vps45 were found to be required for the cvt pathway, but dispensable for autophagy, suggesting that these two pathways are mechanistically distinct (abeliovich et al . 1999). Tor is a phosphatidylinositol kinase - related kinase that promotes cell cycle progression in response to nutrient availability (thomas and hall 1997). Treatment with the immunosuppressant rapamycin, a specific inhibitor of tor, induced cell cycle arrest at g0 . For example, accumulation of glycogen, repression of genes that are stimulated in growing cells, and stimulation of genes that are induced during starvation, all result from inhibition of tor (hardwick et al . Our laboratory has found that rapamycin induces autophagy in yeast (noda and ohsumi 1998). However, the molecular mechanism by which tor negatively regulates autophagy remains to be determined . Here, we present evidence that apg1, a protein kinase essential for autophagy, plays a pivotal role in induction of tor - regulated autophagy . An nh2-terminally truncated (8 amino acid) form of apg1 open reading frame, subcloned into pgbd - c2 vector, was used as bait to screen a yeast genomic library, and interacting proteins were identified by dna sequencing . A dna fragment including the entire apg17 gene was cloned from yeast genomic dna using pcr . The kinase - negative apg1 mutation was obtained using the quikchange site - directed mutagenesis kit (stratagene). Antibody against apg13 protein was raised against a glutathione s transferase (gst)-apg13 fusion protein . Specifically, a 1.9-kb bglii - xbai fragment of the apg13 gene coding for 396 amino acids of apg13p was subcloned into the vector pgex-2 t . The expressed fusion protein was purified with glutathione - sepharose 4b (amersham pharmacia biotech). Expression and purification of the fusion protein was carried out according to the manufacturer's instructions . Immunoprecipitation, kinase assay, and immunodetection of nh2-terminally hemagglutinin (ha)-tagged apg1 (apg1) were performed as described previously (kamada et al . Apg1 was immunoprecipitated with anti - ha mab (16b12; babco), and an in vitro protein kinase assay was performed in the presence of [p]atp and myelin basic protein (mbp, substrate). Yeast cells exponentially grown in yepd medium were treated with zymolyase 100 t (seikagaku kogyo) to generate spheroplasts . The resultant spheroplasts were treated with or without 0.2 g / ml of rapamycin and broken by resuspending in lysis buffer (pbs, ph 7.4, 1 mm edta, 1 mm egta, 2 mm na3vo4, 50 mm kf, 15 mm na2h2p2o7, 15 mm p - nitrophenylphosphate, 20 g / ml leupeptin, 20 g / ml benzamidine, 10 g / ml pepstatin a, 40 g / ml aprotinin, 1 mm pmsf, and 0.5% tween-20). Cell lysate was cleared by 10-min centrifugation at 6,500 g and 30-min incubation with protein g apg1 in the cleared cell lysate was bound to anti - ha mab, and apg13 was detected with anti - apg13 antibody . The resultant immunoprecipitates were also analyzed by protein kinase assay and immunoblot with anti - ha . For in vivo labeling of apg13, cells (tfd13-w3) expressing apg13 were in vivo - labeled with 50 ci of s (trans, icn) for 10 min, or 50 ci of pi overnight in sd medium, and transferred to yepd or nitrogen - depleted medium sd(n) for 1 h. apg13 protein was immunoprecipitated following tca precipitation . Immunoprecipitated apg13 was treated with 5 u of alkaline phosphatase for 1 h at 30c . Progression of autophagy was estimated by the increase of alkaline phosphatase activity in the cells expressing a cytosolic proform of the phosphatase protein (pho860p; noda et al . In an effort to study the mechanism of autophagy induction, we focused on the apg1 gene, which encodes a protein kinase whose activity is essential for autophagy (matsuura et al . Nh2-terminally ha - tagged apg1 (apg1) was immunoprecipitated with anti - ha ascite and the resultant immunocomplex was analyzed using an in vitro kinase assay . Apg1 kinase activity was found to be highly elevated in cells grown under starvation conditions (fig . 1 a). After a 6-h incubation in nitrogen - depleted medium, sd(n), the amount of activated apg1 had apparently increased, and was accompanied by slower gel migration, presumably because of autophosphorylation (fig . The increase in apg1 kinase activity is not due to this apparent increase in the protein amount, because shorter treatments with rapamycin (for example, see fig . Apg1 activity was also increased by rapamycin treatment, but the effect of rapamycin was abolished in a rapamycin resistant tor1 mutant (tor1 - 1; kunz et al . These results suggest that apg1 activation is required for the induction of autophagy and that it is mediated by tor proteins . A kinase - negative apg1 mutant (k54a; this indicates not only that the enhanced apg1 kinase activity is required for autophagy, but that basal apg1 activity in growing cells (fig . Next, we performed a two - hybrid screening with apg1 as bait to identify apg1-associating proteins, which may regulate apg1 activity . The following three genes were obtained from the screen: apg13 (funakoshi et al . 1997) and two novel genes, which were subsequently found to be essential for either autophagy or the cvt pathway, or both . One gene, designated as apg17 (ylr423c), was essential for only autophagy and was not required for the cvt pathway (fig . 2 a). The other, cvt9 (harding et al . 1996; d.j . Klionsky, personal communication), was required for the cvt pathway, but not for autophagy . Among the 16 apg genes discovered so far, it is interesting to note that apg1 binds to proteins whose function is specific to either autophagy (apg17) or the cvt pathway (cvt9). Overexpression of apg1 in an apg13 mutant partially rescues the autophagy defect (funakoshi et al . Similarly, the apg17 mutant was also rescued by overexpression of apg1 (data not shown), indicating that these three genes interact functionally . In the apg13 mutant, attenuated apg1 activity was observed . In rapamycin - treated apg17 cells, apg1 activity also was found to be largely impaired (20% of the wild - type). On the other hand, deletion of cvt9, which is not needed for autophagy, resulted in rapamycin - induced activation of apg1 to 50% of wild - type . The effects of deleting apg13 and apg17 on apg1 activity are not the result of a general autophagy defect, because deletion of other apg genes, such as apg5 (mizushima et al . 1998), does not affect the activation of apg1 (data not shown). These results indicate that the activated state of apg1 is required for autophagy induction, and that apg13 and apg17 play a key role in the activation of apg1 in response to tor inhibition . The next question we addressed was how these apg1-associating proteins transmit the starvation signal from tor to apg1 . Overexpression of apg13 resulted in a smeared apg13 band on the immunoblot caused by retarded migration, indicating that it was modified in some way (fig . This modified form was observed only in growing cells, and after starvation or rapamycin treatment, the slower - migrating form disappeared . In particular, it was noted that the disappearance of the slower - migrating form occurred within five minutes after rapamycin treatment . In vivo labeling and in vitro phosphatase treatment revealed that the apg13 bandshift was due to phosphorylation (fig . These results suggest that apg13 is phosphorylated in a tor - dependent manner, which was confirmed by the observation that dephosphorylation of apg13 in response to rapamycin was not seen in tor1 - 1 cells (fig . The dephosphorylated, faster - migrating form of apg13 in starved cells was rapidly phosphorylated after readdition of yepd medium (fig . 3 d), suggesting that the phosphorylation state of apg13 is extremely sensitive to nutrient conditions . This excludes the possibility that the phosphorylated form of apg13 is degraded upon starvation and apg13 is de novo synthesized after medium addition . The faster - migrating form of apg13 (as well as the slower - migrating form) was found to be labeled with pi (fig . 3 b, lane 8), suggesting that apg13 remains partially phosphorylated under starvation conditions . To confirm that there is a physical association between apg1 and apg13 a vacuolar protease - deficient strain was used for these experiments because apg13 is quite labile in cell lysate . When apg1 and apg13 were expressed from a high - copy plasmid, only the faster - migrating form of apg13 3 e), indicating that the hyperphosphorylated form of apg13 has little affinity for apg1 . Next, we performed the experiment using a low - copy plasmid to more closely approximate physiological cellular conditions . The amount of apg13 bound to apg1 increased rapidly (as quickly as 10 min) after rapamycin treatment (fig . 3 f), which corresponds well to the time course of apg13 dephosphorylation . These results strongly indicate that tor negatively regulates apg1 kinase activity by means of (hyper)phosphorylation of apg13, which reduces the affinity of apg13 for apg1 . From these results, we hypothesized that apg13 binding to apg1 is required for the induction of autophagy, but not for the cvt pathway . The two - hybrid assay was used to determine the apg1-binding site on apg13, using various apg13 open reading frame fragments as prey . A central 89-amino acid region (432520) we also isolated a cooh - terminal truncated form of apg13, apg13(1448), whose ser449 was mutated to a stop codon using in vitro mutagenesis (kaiser et al . This mutant has a mutation within the putative apg1-binding site, and is unable to associate with apg1, as confirmed by the two - hybrid assay and coimmunoprecipitation (fig . 4 a, and data not shown). This result indicates a role for a domain of apg13 around amino acid 448 in binding apg1 . We tested several cooh - terminal truncated apg13 mutants including apg13(1448) for autophagy activity . 4 b, bottom), presumably due to the absence of the apg1-binding domain . Another cooh - terminal truncated form, apg13 (1568), which contains the entire putative apg1-binding domain, displayed partial, but significant, autophagic activity, when compared with apg13(1448). Apg13(1568) was less competent for autophagic import than full - length apg13, suggesting that additional sequences downstream of the apg1 binding site are important for maximal activity . On the other hand, apg13(1448) partially, but significantly, rescued vacuolar - targeting of precursor api (fig . 4 b, top), suggesting that this truncated protein is still functional for the cvt pathway . Apg1 activity in the apg13 mutant was partially restored in the presence of either apg13(1448) or apg13(1568), and was fully recovered in the presence of the whole apg13 construct (fig . 4 c). The kinase activity of the apg13(1568) transformant was clearly higher than that of the apg13(1448) transformant . These results confirmed the hypothesis that the apg1apg13 association and subsequent activation of apg1 are required for autophagy induction in response to starvation . It is currently thought that tor signaling in yeast is bifurcated (thomas and hall 1997). One pathway involves the small gtpase rho1, which is responsible for actin organization and is not affected by rapamycin . The other involves tap42, a rapamycin - sensitive phosphatase - associating protein that is necessary for the initiation of protein translation and amino acid permease turnover (di como and arndt 1996). Tap42 is known to be located directly downstream of tor, and is required for tor - mediated signaling, especially the rapamycin - sensitive branch (jiang and broach 1999). To investigate this issue further, we tested the ability of a tap42 mutant (tap42 - 11; di como and arndt 1996) to induce autophagy at a nonpermissive temperature . Accumulation of vacuolar autophagic bodies in tap42 cells was found to be comparable to that in wild - type cells, confirming that induction of autophagy is not controlled by tap42 (fig . 5). Furthermore, deletion of npr1, whose product is a protein kinase negatively regulated by tap42 (schmidt et al . 1998), did not affect the induction of autophagy (data not shown). Therefore, we concluded that tap42 does not transmit a signal from tor in the autophagy induction pathway . The association between apg1 and apg13 is negatively regulated by tor signaling . In nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy . This tight apg1apg13 association is required for autophagy, but not for the cvt pathway, an observation that supports a model in which the apg1apg13 complex plays an important role in switching from the cvt pathway to autophagy in response to nutrient conditions (fig . The function of apg17 is still unclear, but our preliminary results suggest that it may be involved in the apg1apg13 interaction . When both apg1 and apg13 were overexpressed, apg1apg13 binding was observed, even in cells grown in yepd (fig . 3 d), resulting in a small amount of apg1 activation, insufficient to induce autophagy (e.g., see fig protein sorting to the plasma membrane and vacuolar degradation of amino acid permeases, gap1 and tat2, are also regulated in response to nutrient conditions, and are dependent upon tor, npr1, and tap42 (but not on apg1; roberg et al . Tap42 plays a key role in the rapamycin - sensitive tor pathway, suppressing npr1 activity (schmidt et al . Our observation that tor regulation of apg1 activity and autophagy induction is rapamycin - sensitive, but tap42-independent, implies that the apg1apg13 interplay comprises a novel tor signaling pathway regulating autophagy induction . It is possible that tor directly phosphorylates apg13, but this remains to be investigated . Recently, nuclear transport of transcription factor gln3 has been shown to be under the control of tor signaling, but the involvement of tap42 in this system is still controversial (beck and hall 1999; cardenas et al . 1999). Deletion of gln3 did not affected autophagy (data not shown). In mammalian cells, two targets of mammalian tor (mtor) have been identified: 4e - bp1 and p70s6k (thomas and hall 1997). Another recent study reported a relationship between mammalian tor and autophagy (shigemitsu et al . Apg1 homologues of caenorhabditis elegans (ogura et al . 1994) and mammals (yan et al.
|
A change in the genetic code, also known as mutation, is the primary source of genetic variation which gives rise to diversity within a population . When accumulated over generations, these genetic variations may improve the adaptability; hence, the survival of organisms in different environmental conditions [1, 2]. This may in turn induce or preferentially select for further advantageous changes for better adaptation within the environment [35]. Although mutations - conferring advantageous traits have been observed in animals such as lizards and fish, it is difficult to study these effects in a laboratory setting due to space and time constraints . For example, it took 36 years for the lizards to show distinct features . On the other hand, bacteria has a number of advantages - fast generation time, ability, to fossilize, and resurrection of historical generations . Escherichia coli, a common intestinal bacterium, has been used in a long - term evolutionary experiment spanning more than 2 decades [3, 911]. A number of stress adaptation studies had demonstrated that the growth phases may impact e. coli adaptation . Nair and finkel suggested that a nonspecific dna binding protein, dps, may confer multiple stress tolerance at stationary phase, which concur with jolivet - gougeon et al . . In addition, the genome of several strains of e. coli had been sequenced, representing a reliable source of genetic knowledge . In terms of the effects of chemical treatments, bacterial resistance and tolerance to antibiotics are well established and the mechanisms have been widely studied [1417]. In contrast, mechanisms of insusceptibility to nonantibiotic agents, such as food preservatives and antiseptics which might include tolerance or resistance, are less well understood . For example, citric acid inhibits the growth of proteolytic strains of clostridium botulinum, sodium chloride can inhibit the growth of many bacteria such as listeria monocytogenes, ochrobactrum anthropi, and lactobacillus plantarum by lowering the water activity, and fatty acid such as formic, propionic, and acetic acid [24, 25] are also capable of inhibiting bacterial growth . As an intestinal bacterium, e. coli comes into contact with the food and chemicals that we consume . A study which treated pigs with ampicillin, a common antibiotic, demonstrated a significant increase in the occurrence of ampicillin - resistant e. coli from 6% to more than 90% after a course of 7 days . It has been suggested that incomplete absorption in the large intestine led to the presence of subtherapeutic doses of antibiotics in the faeces, resulting in evolutionary pressure for intestinal bacteria such as e. coli towards antibiotic resistance [27, 28]. Although the interactions between antibiotics and bacteria have been well studied [16, 26, 29, 30], the interactions between food additives and bacteria remain elusive . It had been demonstrated that benzoic acid and sodium chloride [32, 33] can affect e. coli physiology . Firstly, we aim to examine the adaptability of e. coli atcc 8739 (a sequenced strain) in a long - term culture environment in the presence of benzoic acid, sodium chloride, and monosodium glutamate (msg, a common taste enhancer in asian cooking), singly and in combination . Two concentrations of each additive were used to evaluate the effects of concentration in the adaptability of e. coli . Generation time across passages is used as an estimation of adaptation where decreased generation time across passages in an additive demonstrated that the cells are growing faster compared to an earlier passage . Thus, a decrease in generation time across passages indicates that the cells are adapting to the additive, whereas an increase in generation time suggests stress . Secondly, we aim to estimate the genomic effects of these adaptations using nei and li distance to estimate the genetic distances between the samples after polymerase chain reaction (pcr)/restriction fragments length polymorphism (rflp). We hypothesized that, e. coli atcc 8739 is able to adapt to the food additives; thereby, demonstrating decrease in generation time across passages . Generation time analysis demonstrated e. coli atcc 8739 is able to adapt to the additives over extended culture, and dna fingerprinting suggests that benzoic acid, sodium chloride, and monosodium glutamate are exerting evolutionary pressure on the bacterium . Lysophilised escherichia coli atcc 8739 strain (reference passage 4 from atcc) was revived on nutrient agar plate and incubated at 37c before inoculating into 8 different treatments supplementation in 10 ml nutrient broth . These 8 treatments consist of 4 sets of additives with 2 different concentrations each as shown in table 1 . Subculturing was performed by transferring 1% (100 l) of the previous culture on every monday, wednesday, and friday to the next passage in order for adaptation to occur at the stationary phase of growth . Optical density (od) readings were taken before the next subculture at 600 nm wavelength to estimate the number of generations within the current passage and to also determine the number of cells that are being inoculated into the new passage . Glycerol stocks for each treatment were made from 1% of the culture for every 12th passage after culturing on macconkey agar . The swap experiment was done fortnightly (6 - 7 passages interval), involving the transfer of escherichia coli cells cultured in different treatments to other treatments for the measurement of generation time . Four types of swaps were carried out, whereby the cells were inoculated into the new treatment in a 100 times dilution . The first set of swap involves the inoculation of basal medium- (l salt) treated cells into the six nonsalt treatments . An example would be inoculating cells grown in l salt into h msg treatment . For the second set, cells cultured in high and low concentrations of each treatment were swapped for all treatments . For example, cells growing in h msg were inoculated into the l msg media and vice versa . In the third set, cells of high concentration treatments (h msg, h ba, and h salt) the last set is similar to the previous set except that cells of the low concentration were swapped . Cells from low concentration treatments (l msg, l ba, and l salt) were each inoculated into l comb media . Od600 readings were recorded down at intervals, and generation times were calculated for each interval . Treatment cultures from every 12th passage interval were used for genomic dna extraction using the phenol - chloroform method of dna extraction for gram - negative bacteria . The dna pellet was air - dried and dissolved to 100 ng/l in ph 8.0 tris / hcl buffer and stored at 20c . Each reaction consisted of 50 l of mixture prepared using 200 ng of dna template in 10pmoles of dntps, 50 pmoles of primer, 1 unit of taq polymerase, and 1x standard buffer (with 1.5 mm of mgcl2) provided by the supplier (new england biolabs, inc . ). Primer 5, cgcgctggc; primer 6, gctggcggc; primer 7, caggcggcg were used separately . The pcr reaction was carried out (hybaid limited, pcr express) under the cycling condition of initial denaturation at 95c for 10 minutes; 35 cycles of amplification at 95c for 1 minute, 27c for 1 minute, 72c for 3 minutes, followed by a final extension at 72c for 10 minutes before gel electrophoresis in 2% (w / v) agarose gel with 1x gelred . The primers used were generated by a previously described method using the following rules: (1) the same primer must be suitable as forward and reverse primers, (2) each primer must be between 6 to 15 bases, (3) the predicted amplicon size must be between 300 to 3100 bases in order for resolution in 2% (w / v) agarose gel, and (4) each primer should be predicted to yield 3 or 4 amplicons . 11 l of pcr product was digested with 1 unit of restriction endonuclease (taqi, hinfi, or mspi), in a reaction mixture consisting of 1x restriction digestion buffer and 100 ng/l acetylated bsa made to a total volume of 20 l with distilled water . Hinfi and mspi reaction mixtures were incubated at 37c, while the taqi reaction mixture was incubated at 65c . All reaction mixtures were incubated for 16 hours before analysis in 2% (w / v) agarose gel with 1x gelred . Cell density was calculated from od600 readings using the correction suggested by sezonov et al . . Briefly, the cell density is directly proportional to od600 readings when od600 reading is below or equal to 0.3, at which the cell density is equivalent to 5 10 cells per milliliter . If od600 reading is above 0.3, the cell density is estimated by the equation of cell density = 52137400 in (od600 reading) + 118718650 . Generation time for all experiments was calculated from difference in cell density at intervals between 120 and 300 minutes after the inoculation of cells into fresh media, and the geometric mean was calculated . Changes in generation time across passages were tested using t - test for regression coefficient . The migration distance of the bands of pcr and rflp of different treatments within the same passage was tabulated and a nei - li dissimilarity index (di), where the maximum value of 1 is obtained when there are no common bands when comparing between the 2 treatments, while a minimum of 0 will be obtained when the 2 treatments have exactly the same bands . The correlation coefficient (cc) value between dis across passages statistically tested against the cc value of 0.95 (~1) using the z - test for two correlation coefficients where the p value of more than 0.05 would indicate that the null hypothesis (cc is equal to 0.95) is not rejected . Analysis of the generation times showed that all eight treatments over the passages displayed different rates of decreasing generation times as shown in table 2 . The steepest decline in generation time occurs in h comb treatment where approximately 2.02 minutes reduction in generation time per passage over 70 passages was observed, followed by l msg (1.87 minutes), l ba (1.39 minutes), l salt (1.24 minutes), l comb (1.22 minutes), h ba (1.15 minutes), h salt (1.12 minutes), and finally h msg (0.906 minutes). The regression intercept may be used to estimate the generation time of the cells in each treatment media for the first passage which is indicative of the level of initial stress on the cells . On this basis, the treatment exerting the highest level of stress on the cells would be h comb, followed by l msg, h ba, l ba, l comb, l salt, h salt, and h msg . The linear regression of the generation time across passages demonstrated that the gradients of the equations are not equal to zero which indicates that the generation times are not constant for the six swaps . Although there are changes in the general trend of generation time across the passages, the p values calculated for the six swaps were more than 0.05 which is not significant: l salt cells to h msg media, 0.475509; l salt to l msg media is 0.421721; l salt cells to h ba media is 0.250415, l salt cells to l ba media is 0.4660235; l salt cells to h comb media is 0.484887; l salt cells to l comb is 0.443381 . The generation times trend of the four swaps (msg, ba, salt, and combination) from low - treatment to high - treatment over 12 swaps change in a decreasing manner (table 3). With reference to the regression equations, the linear regression gradient of low treatment cells into high treatment media for combination treatment is the steepest followed by that for ba, msg, and salt treatments . At swap count between eight and nine, the generation time is almost the same for msg, salt, and combination, but the generation time for ba is still distantly higher . The generation time trends of the four swaps (msg, ba, salt, and combination), from high treatment to low treatment over 12 swaps, changed in a decreasing manner . With reference to the regression equations, the linear regression gradient of high - treatment cells into low - treatment media for msg treatment was the steepest followed by that for ba, combination, and salt treatments . The generation time of high - treatment cells into low - treatment media for msg treatment was almost the same as for salt treatment between swap count four and five, and as for combination treatment between swap count eight and nine . The generation time of swapping high - concentration treated cells into high - combination medium showed similar trends . At the 8th swap, after the 10th swap, generation time for all treatments remain, constant at 200 minutes till the 12th swap . The generation time of swapping low - concentration treated cells in to low - combination medium showed similar trends . At the 2nd swap, after the 4th swap, generation time for all treatment followed a similar trend till the 12th swap . Electrophoresis agarose gels of the pcr and rflp products for the eight treatments were used to study the differences between the genome of the e. coli cells of the treatments across the passages . Nei - li dissimilarity index (di), which had been shown to be suitable for rflp, was utilised to mathematically calculate the dissimilarity between pair - wise comparisons of the treatments . The dissimilarity index of the 28 comparisons showed a trend of convergence from pcr / rflp number 4 onwards (figure 2). This trend is further elaborated with the estimation of the maximum and minimum mean values (figure 3) which shows converging linear regression line across the 6 pcr / rflp . The similarity among the six resulting effects is that each type of effects had two originating comparisons . Therefore by plotting the two comparisons against each other and testing for significance, we can deduce whether the genomic differences in each of the two comparisons are actually a consequent effect from the resulting effects . This suggests that the pcr / rflp - inferred genetic distance between h msg and h comb, and h ba and h salt varied independently (not correlated). In this paper, we present one of the first comprehensive investigations of the effect of e. coli cells' adaptations to a variety of food additives using a long - term culture approach . Our results suggest that cells grown under different stress condition are able to adapt to the environment which can be observed by decreased generation time and genetic variations . Since e. coli cells were grown in nb with the various supplementations of treatments, it was important that any changes to the cells were a direct result of the treatments rather than from the nb . The generation time trend for e. coli cells from l salt (nb) inoculated into six different media (table 3) showed that nutrient broth did not appear to impact on adaptability as none of the regression gradients were statistically different from a gradient of zero suggesting that the general generation time trend remained almost the same; therefore, nutrient broth (l salt media) was unlikely the cause of any adaptations observed . The low - concentration treated cells were observed to be adapting to their environment as seen from the decreasing generation time . The cells are dividing at a faster rate with increasing passages suggesting lowered stress level in later passages comparing to early passages (table 3). However, as the concentration of additives is the same throughout the passages, decreased generation time suggests that the cells are adapting to the stress . Low - treatment cells inoculated into high - treatment media also showed decrease in generation time across the swaps . Growth rate has been used as a measure for adaptation to a stressed environment in previous studies where chen and shakhnovich had demonstrated increase in growth rate of 35 bacterial species upon adaptation to thermal stress . In addition, zhu and yang also demonstrated increase in growth rate; thus, decrease in generation time, when clostridium tyrobutyricum adapts to the presence of butyric acid . Our results suggest that the low - treatment cells had gradually adapted to its own individual treatment before the swap, causing it to be less stressed when swapped into high - treatment media . The generation times of cells from low single treatments to l comb were observed to increase gradually across passages (table 3). This suggests that low msg, ba, or salt treatments were not stressful enough to induce significant adaptations such that when they were placed into the l comb treatment which now contains additional stress inducers, the cells could not cope . This may suggest that the cells may be gradually optimized to grow in a specific treatment; thus, increasingly specialized to their specific environment . Similar cases had been reported in other evolutionary studies using e. coli [4244]. The effects of l comb did not increase the adaptability but instead decreases it as seen from the generation time analysis (table 2). It has been suggested that the presence of msg counteracts the effects of drop in ph caused by ba . This is achieved by increasing the resistance of e. coli cells against the lowered ph, which will otherwise kill the cells . This suggests that the effects of l msg and l ba cancel each other out, leaving only l salt which is further supported by the similarity between the adaptability of l salt (1.24 minutes per generation, table 2) and l comb (1.22 minutes per generation, table 2). E. coli cultured in h comb treatment had the greatest decline in the generation time over 70 passages . Since higher stress level may force the cells to adapt quickly in order to survive [45, 46], suggesting that the e. coli cells in h comb treatment experienced the highest level of stress among the eight treatments (table 2) in contrast to h msg which induced the lowest decrease in generation time . This may suggest that the presence of glutamate in msg may be aiding the growth of cells as glutamate can serve as an additional source of nutrient for the cells . Thus, h msg may cause the least amount of stress but instead led to better growth resulting in a lower rate of adaptation; hence, the lowest decrease in generation time . When high - concentration treated cells were swapped into low - treatment media containing the same type of stress, reduced generation time was observed . Although both high and low concentrations appear to result in some adaptations as measured by generation time, the rate of adaptation differs . The general decline in generation times of the cells from low - treatment to high - treatment media is steeper than that of the reverse . High - concentration treated cells inoculated into low - concentration treatment media appeared more stressed . This is surprising as low - concentration treated cells inoculated into high - treatment media should experience more stress than high - concentration treated cells inoculated into low - treatment media, provided that the type of stress is similar . A possible explanation for this is that the type of stress may differ, even though low and high treatment contained the same type of additives and differing only in concentration . This may be explained by the catabolism of stress - induced molecules . In takatsu, the level of cardiolipin, a salt stress marker of staphylococcus aureus, took longer to return to basal level upon reculture in basal media after stressed in 5% nacl than in 10% nacl . . It may be plausible that high - concentration treated cells may induce stress - induced molecules which may add to the level of metabolic stress at a lower concentration . The swap from individual high - concentration treatments (h msg, h ba, and h salt) to h comb showed decreased generation time . This may suggest that pretreatment of cells in a stressed environment may condition them to adapt to another stress environment which has been demonstrated by other adaptation studies using e. coli [5053]. However, the swap from individual low - concentration treatments (l msg, l ba, and l salt) to l comb showed the opposite trend with increased generation time . This further corroborates that the adaptive nature of different concentrations may be different; thus, requires further studies . Our results from pcr / rflp showed a converging trend in di indicating that the e. coli from all treatments are getting similar (figure 3) suggesting that they mutate in a similar manner . This suggests that they may evolve the same type of stress mechanism and dna repair . However, all the treatments originate from the same bacterial clone, suggesting that the initial stress adaptation may involve mutation as it has been suggested that hypermutation is a feature in initial stress adaptations . It is known that e. coli exposed to stresses would respond to counteract the effects . Tucker et al . Has shown that e. coli in nitric oxide (no) will reduce the no to nitrous oxide under anaerobic conditions which is harmless to the cell . In another study, while the cells from all treatments may have experienced different types and levels of stresses, it is likely that the cells might have adapted and activated similar stress - responsive mechanism by evolving similarly . This interpretation is supported by a number of studies suggesting the presence of global stress response in e. coli [5759]. In addition, cebrin et al . Found that adaptation to ph stress may protect staphylococcus aureus against oxidative stress by hydrogen peroxide, suggesting that adaptation to particular stress may confer tolerance to other stresses . In this paper, the similar response and mutations to the e. coli of the treatments primers 5, 6, and 7 amplified a random sample amounting to 0.37% of the whole genome which is a limitation of this study . However, several studies had demonstrated that pcr - based dna fingerprinting using a small number of primers is suitable to examine genetic diversity in e. coli, candida dubliniensis, and mackerel . Another limitation is that dna fingerprinting was performed on the entire population and not on isolated colonies . Hence, this paper can only imply on areas of the genome that were amplified, and analysis was approaching genetic similarity at a population scale . This method had been used other studies examining metagenomics in environmental bacterial samples [63, 64] and human myopia . The genes responsible for stress - handling mechanism may also not be present in the amplified regions of the genome . It is unlikely that the genetic distance of e. coli in the eight treatments reaches zero as a population, suggesting that the declining trend is likely to taper off . On the other hand, previous studies in e. coli and herminiimonas arsenicoxydans demonstrated the presence of ecological specialization . Our results showed that the generation time decreased over passages, suggesting the possibility of ecological specialization . This may indicate the presence of both global stress response and ecological specialization in e. coli . Global stress response allows for adaptation to new stress environments, but extended stress may lead to ecological specialization . Hence, it may be hypothesized in future studies that continued culture may lead to ecological specialization which may be seen as a divergence in the genetic distance . Statistical analysis of the selected comparisons indicates that the effects of all the treatments were insignificant except 10ba + salt (table 4). Statistical tests for msg and ba effect suggested that different gels provided constant results; thus, suggesting reliability in our study . Statistical tests suggest that msg and ba, and msg and salt are likely to interact with each other (table 4). This suggests that high - combination media contains 10msg + 10ba + salt and the interacting effects of msg and ba, and msg and salt . Results from swap analysis indicated that low - salt cells when swapped to high - combination media showed an increase in generation time . This suggests that the high stress in high combination media results in difficulties for the cells from l salt to grow and caused an increase in doubling time . This might be due to the additional combined stress produced by msg interacting with ba and salt . The presence of the additional interacting stress of the combination treatment can also be observed from the analysis of generation time where the stress level of h comb is much higher than the three individual high - concentration treatments . Ba kills bacteria by lowering the ph of the media, whereas msg has the effects of ph resistance on the cells . Hence, the presence of msg may aid the growth of the e. coli living in low - ph environment caused by the presence of ba . On the other hand, combined effects from msg + s could be harmful to the cells as salt may increase the high sodium content provided by msg in media . This paper had demonstrated that e. coli is able to adapt to food additives over an extended period of time by observing the decreased in generation time over a period of 70 passages . This may have implications in using sublethal doses of bacteriocidal agents such as disinfectants and preservatives . Hence, it may be hypothesized that increasing passages may demonstrate a shift towards ecological specialization.
|
Laparoscopic surgery has established itself as a durable alternative for both gynecologic and general surgical procedures . With increasing popularity and greater utility, the types and number of reported complications are increasing . We describe the case of a 70-year - old male undergoing routine laparoscopic cholecystectomy for gallstone pancreatitis who developed asystolic cardiac arrest intraoperatively . A review of the literature revealed 2 cases of asystolic cardiac arrest during laparoscopy: one was during laparoscopic cholecystectomy and one was during diagnostic laparoscopy for gynecologic evaluation . A 70-year - old male with a past medical history negative for ischemic heart disease with asymptomatic myocardial infarction was admitted to the hospital with a 24-hour history of severe, acute epigastric abdominal pain . His point of maximal impulse was nondisplaced, and he had no evidence of jugular venous distension . His abdomen was soft with no masses, hernias, or palpable evidence of organomegaly . He demonstrated mild to moderate tenderness to palpation of his epigastrium and right upper abdominal quadrant . Initial investigations included the following tests: complete blood count: white blood cell count 14.6; hemoglobin / hematocrit 15.1/44.5, platelets 399 000; basic metabolic profile: na 138, k 4.1, cl 103, co2 26, urea 14, creatinine 0.9, glucose 138; liver function tests: total bilirubin 0.8, albumin 3.1, aspartate aminotransferase (ast) 576, alanine aminotransferase (alt) 417, alkaline phosphatase 352, ldh 1639; amylase 1173; lipase 5339 . Initial electrocardiography revealed regular rhythm with first - degree av block and no evidence of acute coronary ischemia . A chest xray showed mild cardiomegaly, hyperinflated lungs, and no evidence of infiltrate or congestion . Ultrasonography of the gallbladder showed several gallstones with a common bile duct measurement to 8 mm, no wall thickness, and no evidence of pericholecystic fluid . He was not allowed to take anything by mouth and was started on empiric intravenous antibiotics for presumed persistent common bile duct obstruction . Over ensuing days, the patient's laboratory evaluations showed a continuously decreasing amylase and lipase until normality was achieved on hospital day number 4 . It was deemed that the patient would require endoscopic retrograde cholangiopancreatography (ercp) and cardiology clearance prior to undergoing laparoscopic cholecystectomy . Because the patient's acute symptomology had entirely resolved and he was tolerating a regular diet without recurrence of pain, he was discharged home with plans to undergo ercp and cardiac evaluation as an outpatient . Ercp was attempted by a well - experienced gastroenterologist; cannulation of the sphincter of oddi was unsuccessful secondary to a duodenal diverticulum, and the procedure was aborted . Cardiac assessment consisting of a stress test was performed, which was negative for unstable coronary circulation . The patient returned to the hospital 6 weeks after the initial evaluation for laparoscopic cholecystectomy . In the interim, he had been doing well, tolerating a low - fat diet, and had stopped smoking 2 weeks prior to the scheduled surgery . Preoperative medication comprised mefoxin and was discontinued approximately 30 minutes prior to the scheduled surgery . In the operating room, the patient was preoxygenated with 80% oxygen to achieve a peripheral pulse oxygen saturation of 100% . Appropriate intubation was confirmed by positive end - tidal co2 and auscultation of administered breaths in bilateral lung fields . Anesthesia was maintained with nitrous oxide and fentanyl . In the supine position, access into the peritoneal cavity was attained using the open hassan technique via an intraumbilical incision . Pneumoperitoneum was initially achieved to an intraperitoneal pressure of 15 mm hg by first administering low - flow co2 followed by high - flow co2 . The gallbladder was then grasped with a gallbladder grasper and retracted in the lateral / cephalad direction for approximately 15 seconds resulting in an asystolic episode for 30 seconds . The patient was administered atropine, with subsequent resumption of sinus cardiac rhythm . With resumption of stable vital signs, reinsufflation of the peritoneal cavity to 15 mm hg sinus rhythm was achieved within 5 seconds of releasing the gallbladder and relieving the pneumoperitoneum . A third attempt at gallbladder manipulation was made without insufflation but with direct visualization of the gallbladder . Cardiac rhythm resumed approximately 5 seconds after the gallbladder was released . Throughout all 3 episodes, adequacy of ventilation was confirmed bilaterally, oxygen saturation remained at 100%, capnometry readings of 35 to 40 mm hg were obtained, and the patient remained normothermic . No acute electrocardiographic changes were appreciated with resumption of cardiac rhythm in the operating room . The patient was extubated in the operating room, transferred to the postanesthesia recovery room, and maintained on telemetry . Postoperative cardiology and electrophysiology evaluation did not reveal a primary cardiac event as the cause of the patient's asystolic episodes . Additionally, the patient's cardiac isoenzyme profile over the 24-hour period was negative for acute myocardial injury . Given these findings coupled with the patient's respiratory stability intraoperatively, it was deemed that a severe vagal reaction in response to gallbladder retraction was the source of the patient's asystolic episodes . Therefore, the patient underwent insertion of a temporary pacemaker prior to a reattempt at a laparoscopic cholecystectomy . The pacer was set to a rate greater than the patient's resting heart rate . The second procedure was performed using a pneumoperitoneum of 15 mm hg and was accomplished without incident . The pacemaker was removed in the early postoperative period, and the patient was discharged home without further incident . The causes of cardiovascular collapse during laparoscopy include co2 pulmonary embolization, cardiac arrhythmias, vagal reactions secondary to peritoneal distention during insufflation or viscus manipulation, and diminished cardiac preload secondary to caval compression . Asystolic cardiac arrest is a potential manifestation of these hemodynamically significant events . In a review of the literature, the american association of gynecology reports an incidence of one in 2500 cases of asystolic arrest during laparoscopy . We were able to identify only one previously described case of asystole during laparoscopic cholecystectomy . The clinical manifestation generally includes a diminished end - tidal co2, tachycardia, diminished breath sounds in a specific lung field on auscultation, and a classic cardiac murmur associated with gas embolization . The general mechanism is perceived to be infiltration of insufflated co2 into venous / lymphatic channels with subsequent pulmonary migration . It is unlikely that the asystolic arrest in our case is secondary to gas embolization because our patient failed to exhibit any of the above signs . An alternative cause of hemodynamically significant cardiovascular changes during laparoscopy is hypoxia or hypercapnia resulting in cardiac arrhythmias . It is believed that the combination of the trendelenburg positioning and elevated intraabdominal compartment pressures predispose a patient to aspiration, resulting in hypoxia and possibly hypercapnia . However, it is unlikely that clinically significant elevations in co2 levels on blood - gas measurements can be detected . Elevated intraabdominal pressures can diminish venous return to the heart, preload, resulting in diminished cardiac output . With intraabdominal pressures ranging from 12 to 15 mm hg, however, with intraabdominal pressures in excess of 40 mm hg, a significant caval compression leads to a decreased preload and cardiac output . The first is an increase in central blood volume due to the forcing of blood out of the splanchnic circulation . The second is a diminished preload secondary to peripheral pooling of blood in the lower extremities in combination with the reversed trendelenburg position . The result is a temporary increase in circulating blood volume followed by a sustained decrease in central pressures . These typically occur in patients with primary pulmonary pathology, such as pulmonary / mediastinal blebs, which rupture under positive pressure . Lehman et al delineate the possibility of tension pneumothorax during insufflation secondary to a congenital diaphragmatic defect . Cases of pneumothorax / pneumomediastinum generally present with hypotension, tachycardia, diminished breath sounds in a lung field, and possibly subcutaneous emphysema . Shifren et al1 describe a case of asystolic cardiac arrest during gynecologic laparoscopy that is attributed to rapid peritoneal distension during insufflation . Under circumstances of elevated intraabdominal pressures, it is postulated that manipulation of certain pelvic structures/ organs may further elevate intraabdominal pressures . We do not believe this to be the cause in our case . Even during gallbladder handling without pneumoperitoneum, asystole occurred.1 it is our opinion that the asystolic cardiac arrest in our case was secondary to a severe vagal reaction that was triggered by manipulation of the gallbladder . This was validated by the fact that recurrent asystole was documented for approximately 5 seconds upon grasping the gallbladder without elevated intraabdominal pressures . Additionally, no reproducible hemodynamic sequelae occurred during the successful attempt at laparoscopic cholecystectomy, once the temporary pacemaker was in place . We could not identify any clinical criteria, including altered co2 levels, hypoxia, diminished breath sounds, or tachycardia to suggest any of the other proposed mechanisms of cardiovascular collapse during laparoscopy that are described above.
|
Voltage - gated sodium channels (nav) are membrane - bound proteins that initiate action potentials in nerve and muscle cells and are critical elements of proper function in these tissues . The channels open when the voltage across the cell membrane is depolarized by a few millivolts above the normally negative resting membrane potential . Channel activation allows sodium ions to enter the cell and further depolarize the membrane potential . The movement of sodium ions through the membrane comprises the rising phase of the action potential . This step, along with the activation of voltage - gated potassium channels, allows the membrane to repolarize and ends the action potential . Action potentials act as electrical messages that travel along the axons of nerve cells and the surface of muscle fibers initiating the release of neurotransmitters by neurons and coordinating contractions in muscle . Sodium channels are formed by a 260 kda -subunit that is associated with one subunit (1) in skeletal muscle cells and with two subunits (3 and 1 or 2) in the central nervous system . The subunit forms the pore and the protein contains components required for other aspects of channel function including voltage - dependent activation and fast inactivation (figure 1). Although the kinetics and voltage dependence of channel gating are modified by the subunits [3, 4], all the elements of channel function can be reconstituted when the subunit is expressed alone in heterologous expression systems, e.g. Xenopus laevis oocytes [57]. An early model of the two - dimensional folding pattern of the subunit predicted that the protein consists of four homologous domains (di - iv) composed of six -helical transmembrane segments (s1s6) and that the regions of the protein between segments s5 and s6 of all four domains reenter the membrane to form the outer pore of the channel through which sodium ions enter the cell . Further work on sodium channels has supported the general features of this model including the identification of the s4 segments as the voltage sensor . A repeated motif of positively charged amino acids separated by two hydrophobic amino acids is found in the portions of the channel assigned to the s4 transmembrane segments . When the positively charged residues in the s4 transmembrane regions are replaced with uncharged amino acids, the voltage - dependence of channel gating is altered as would be expected in the region of the channel that acts as a voltage sensor [9, 10]. Additionally, there is evidence that portions of the s4 segments move outward in response to the membrane depolarization . Residues in the s4 segments become more accessible to reaction with extracellular reagents and less accessible to reaction with intracellular reagents when the membrane is repeatedly depolarized [11, 12]. After channels open in response to membrane depolarization, they rapidly inactivate which stops the flow of sodium ions into the cell . This form of channel gating occurs when the linker between the third and fourth domains of the channel physically occludes the intracellular mouth of the channel pore [9, 1316]. Channel opening, ion selectivity and inactivation are each controlled by separate regions of the -subunit . Voltage - gated sodium channels are encoded by a multigene family [17, 18]. Different types of excitable tissue express different members of the sodium channel gene family and the tetrodotoxin (ttx) sensitivities of nerve or muscle cells are dependent on the type of channels expressed in the cell . There are ten members of the gene family in the three mammalian species where all members of the gene family have been identified . In the weakly electric fish sternopygus macrurus, six genes have been identified although there maybe as many as eight sodium channel isoforms in fish (personal communication by h. zakon;). The nine mammalian channel isoforms that have been identified and functionally expressed (nav1.1 nav1.9) have greater than 50% identical amino acid sequence within each of the four domains and the linker between domains iii and iv . The tenth sodium channel isoform nav has a more divergent sequence and may represent a distinct subfamily . This channel isoform has never been functionally expressed in heterologous cells, but evidence from nav expression patterns and nav knockout mice indicate that the channel may not function as a voltage - gated channel but rather be important for sensing and regulating extracellular salt in the hypothalamus and visceral organs [23, 24]. The genes that encode nav1.1 through nav1.9 in humans and mice are found on four chromosomes and the chromosome segments containing sodium channel genes are paralogous . A segment of chromosome 2 contains genes encoding nav1.1, nav1.2, nav1.3 and nav1.7 that have more than 90% amino acid sequence identity [18, 21]. The marine toxin ttx has long been recognized as a potent inhibitor of sodium currents in nerve and muscle . A more comprehensive review of ttx and its actions relative to other marine toxins is discussed elsewhere in this issue (al - sabi et al . ). Ttx sensitivities of nerve or muscle cells are dependent on the type of channels expressed in the cell . Products from the cluster of genes located on chromosome 2 are all blocked by nanomolar concentrations of ttx and are expressed in neurons . A second cluster of genes containing nav1.5, nav1.8 and nav1.9 is located on chromosome 3 . These isoforms have 75% amino acid sequence identity as genes in the chromosome 2 cluster but are blocked by micromolar concentrations of ttx . The genes have more limited expression patterns, with nav1.8 and nav1.9 primarily expressed in neurons of the dorsal root ganglion and nav1.5 primarily expressed in cardiac muscle cells . The two final sodium channel isoform genes, nav1.4 and nav1.6, are each located on separate chromosomes despite the fact that they have greater than 85% sequence identity with the genes clustered on chromosome 2 and are also blocked by nanomolar concentrations of ttx . One channel isoform, nav1.6, is expressed in many types of neurons but nav1.4 appears to be solely expressed in skeletal muscle fibers . Subtle differences in channel function may explain differences in the expression pattern of channel isoforms, but an understanding of the correspondence between channel function and expression is still at an early stage . Recent work has shed some light on the correspondence between channel isoform function and expression . Both nav1.2 and nav1.6 are expressed in neurons of the central nervous system but their expression patterns differ in the cell types and even the region within the same neuron in which they are found . The nodes of ranvier are the regions along the length of axons without myelin and glial cell wrapping that allow for the saltatory conduction of action potentials . The predominant isoform at the nodes of ranvier in sensory and motor neurons of the adult central and peripheral nervous system is nav1.6 . However, in developing retinal ganglion cells both nav1.2 and nav1.6 are clustered at immature nodes of ranvier, and only as myelination proceeds does nav1.6 replace nav1.2 [28, 29]. If nav1.6 is required for proper function of mature axons, this suggests that nav1.6 allows axons to transmit high frequency action potentials . Indeed, nav1.2 and nav1.6 respond differently to a rapid series of depolarizations, currents through nav1.2 decrease and currents through nav1.6 increase [30, 31]. Currents through nav1.6 increase because repeated stimulations of the channels cause a use - dependent potentiation of channel opening where channels activate faster after repeated depolarizations . Currents may decrease through nav1.2 after repeated stimulation because channels more rapidly enter a slow inactivated state and fewer channels are available to open with repeated stimulations . The slow inactivated state develops after prolonged membrane depolarization or repeated stimulation and sodium ions cannot pass through channels in this state [32, 33]. The expression of nav1.6 in mature nodes of ranvier may allow the rapid, repeated depolarization of the membrane and the transmission of high frequency action potentials along the length of the axon . Cell maturation is accompanied by another change in sodium channel isoform expression in skeletal muscle tissue . However, by postnatal day 35, mrna encoding nav1.5 is undetectable and mrna encoding nav1.4 has increased 10-fold [34, 35]. Intriguingly, after denervation nav1.5 is expressed again and nav1.4 transcript expression declines as if the muscle were reverting to an earlier developmental stage . Cardiac muscle tissue where nav1.5 is primarily expressed has a very different pattern of activity than adult skeletal muscle where nav1.4 is primarily expressed . Action potentials in the heart are repetitive and sustained with the membrane remaining depolarized for several hundred milliseconds . In contrast, during the action potential in skeletal muscle fibers membrane depolarization lasts a few milliseconds and can occur at high frequency [37, 38]. If subjected to the prolonged depolarizations that occur during the cardiac action potential nav1.4 channels enter the slow inactivated state and are no longer excitable unless the membrane is held at a negative potential for seconds . However, nav1.5 currents do not slow inactivate completely even after long depolarizations lasting seconds . These channels can function in the activity pattern found in heart muscle tissue and may also be able to function better in the altered activity pattern of immature and denervated muscle fibers that have depolarized resting membrane potentials and spontaneous action potentials . Several mutations in nav1.4 that are linked to the skeletal muscle diseases hyperkalemic periodic paralysis and paramyotonia congenital impair the ability of the channels to enter the slow inactivated state and reduce the use - dependent inhibition of sodium current after rapid stimulation [41, 42]. This defect accentuates the muscle membrane depolarization and hyperkalemia sensitivity that lead to muscle paralysis . Thus, an alteration of the sodium channel isoforms expressed in a tissue may impair the proper functioning of that tissue . Although a change in sodium channel expression pattern might allow certain tissue to resist the effects of ttx, the expression of an isoform with different kinetic and voltage - dependent properties might alter the functional properties of the tissue . Tetrodotoxin blocks sodium channel activity by binding to the outer pore of the channel that is formed by s5s6 linkers . The portion of the linkers that interacts with ttx forms the pore -helix, the selectivity filter and the outer vestibule of the pore [43, 44]. Sodium ions entering the cell pass through the outer vestibule of the pore and the narrow selectivity filter before they can enter the inner pore of the channel (figure 2). Two rings of mostly negatively charged amino acids line the outer vestibule (shown in pink in fig . 2), and the inner ring, composed of aspartate (di), glutamate (dii), lysine (diii), and alanine (div) (the deka filter shown as red, red, blue, and green space filling structures in fig . 2) forms the selectivity filter [45, 46]. Structural support for the selectivity filter is provided by interactions of the amino acids between the negatively charged rings and those in the pore helices [43, 44]. The positively charged guandinium group and hydroxyls of ttx (figure 3) interact with the side chains of the amino acids that form the negatively charged rings [45, 47, 48]. Changes in the amino acids of the s5s6 linker from the pore helix to the outer negatively charged ring effect ttx binding either by altering the electrostatic interaction between ttx and an amino acid side chain directly or by altering the shape of this narrow portion of the pore where ttx binds [4345, 4749]. The binding affinity of the channel for ttx is also altered by changes in membrane potential [50, 51]. The percentage of channels blocked by ttx increases with repeated stimulation of the channel . One model of use - dependent block interprets the increased block that accompanies repeated membrane depolarizations as indicative that the binding site for ttx becomes accessible and the probability of ttx binding increases when the channel activates in response to membrane depolarization [50, 51]. Another model of ttx use - dependent block suggests that toxin binding in the pore can be affected by a cation (na or ca) bound in the closed pore [52, 53]. When the channel opens the ion passes into the interior of the cell and allows ttx to bind to the outer pore . The determination of which model correctly describes use - dependent block will probably best be made with data from the crystal structure of the pore in the open and closed state . These data should show whether the conformation of the outer pore is different when the channel is in the closed and open state . In addition to the block of ion permeation by ttx, external application of toxin appears to affect sodium channel gating . The steady state voltage dependence of gating charge immobilization the restriction of voltage sensor movement during inactivation is hyperpolarized by ttx in crayfish giant axons . The effect of ttx on charge immobilization is reduced, but not entirely eliminated, by internal perfusion of n - bromoacetamide (nba). This result suggests that ttx alters the voltage dependence of both fast and slow inactivation, or that nba alters channel structure in such a way that the effect of ttx on inactivation is reduced . Although a number of amino acid changes have been identified that affect ttx binding to the channel through mutational analysis, naturally occurring differences in ttx sensitivity among members of the sodium channel gene family arise from differences at a single amino acid position in the outer pore (figure 1). Tetrodotoxin - sensitive members of the gene family can be distinguished by the presence of an aromatic amino acid at the domain i position above the selectivity filter and ttx - resistant members have a cysteine or a serine at the same position [5660]. In tetrodotoxic animals, ttx resistance appears to be derived from the substitution of non - aromatic amino acids at this critical position in domain i in the ttx - sensitive members of the sodium channel gene family [61, 62]. A hydrophobic portion of ttx is thought to interact with the aromatic amino acid above the selectivity filter in domain i [43, 47]. The type of amino acid at this position also affects the ability of the channel to conduct sodium ions through the membrane . The ttx - resistant channel nav1.5 that is primarily expressed in heart muscle tissue has lower permeability to sodium ions compared to the ttx - sensitive channel nav1.4 expressed in skeletal muscle tissue . The replacement of a tyrosine with a cysteine at the critical position in domain i of nav1.4 reduces single channel conductance from 53 ps to the level measured for nav1.5, 43 ps [58, 63]. The relationship between channel permeability and the functional requirements of excitable tissues is not clear but it is unlikely that the differences reflect a requirement for ttx resistance in heart muscle . The effects of ttx on the human body differ among various excitable tissues based upon the sodium channel isoforms expressed in the cells of that tissue type . The dangers of ttx intoxication include effects on tissues that primarily express ttx - sensitive sodium channel isoforms such as skeletal muscle tissue and peripheral nerves . The diaphragm is composed of skeletal muscle fibers and may become paralyzed during ttx intoxication . Heart muscle tissue that primarily expresses a ttx - resistant channel isoform can in most instances continue to function after ttx is ingested . Other effects include paralysis of the limbs that can progress to generalized flaccid paralysis, dizziness that may be accompanied by a sensation of floating perhaps as proprioceptive input is lost, and numbness of the mouth that can progress to the tongue, face and periphery . The most severe cases of ttx poisoning can include symptoms of hypotension and bradycardia perhaps as the ttx - sensitive channels found in arterial smooth muscle cells and the sinoatrial node of the heart are blocked [6769]. Ingesting newts of the genus taricha that have high concentrations of ttx in their skin is lethal to almost every one of their potential predators . One predator, the garter snake thamnophis sirtalis, has evolved resistance to ttx that allows the snake to eat newts . The effects of attacking a toxic newt can range from reduced locomotor performance to paralysis and death from respiratory failure depending on the level of resistance of the individual snake . Variation in ttx resistance among snake populations is extreme and spans three orders of magnitude . Thamnophis sirtalis is found across north america, but it is only in snake populations that are sympatric with toxic newts that extreme resistance to ttx has evolved suggesting that snakes have evolved resistance in a coevolutionary arms race with tetrotodoxic newts . Phylogeographic evidence indicates that ttx resistance has evolved independently at least twice within t. sirtalis populations in western north america [71, 72]. Studying the evolution of ttx resistance in garter snakes has provided an opportunity to determine what changes are possible in a conserved portion of the nav that still allow for proper channel function . Elevated resistance to ttx is due, at least in part, to mutations in the outer pore of a nav expressed in the skeletal muscle fibers of resistant snakes [73, 74]. An analysis of the nucleotide sequence of the channel cloned from snake skeletal muscle demonstrates that the channel has the highest homology to other vertebrate skeletal muscle sodium channel genes (nav1.4). Tetrodotoxin resistance in garter snakes has evolved through mutations in an important functional region of a ttx - sensitive sodium channel gene, tsnav1.4 and not through changes in gene expression where a ttx - resistant channel gene is expressed in skeletal muscle tissue . Mutations observed in ttx - resistant snake sodium channels are at positions in the outer pore other than those previously identified, and may therefore have effects on channel function that differ from those imparted by changes in the domain i sequence [58, 63]. Snakes from three ttx - resistant populations (warrenton, benton, and willow creek) have an aromatic amino acid in the critical position of the domain i sequence but novel mutations in the domain iv s5s6 linker of tsnav1.4 that increase the ttx concentrations required to block the channel . The domain iv outer pore sequence of tsnav1.4 from a non - resistant snake population (bear lake) matches that of rat and human nav1.4 and is blocked by low concentrations of ttx . Changes in the amino acid sequence of channels from ttx - resistant snakes are in a highly conserved portion of the s5s6 linkers that forms the outer vestibule and selectivity filter of the channel . Amino acid substitutions that alter the structure or charge in this portion of the pore can affect both ttx - binding and channel function [43, 45]. For example, ttx binding, single - channel conductance and ion selectivity are all affected by amino acid substitutions that replace the conserved domain iv aspartic acid in the outer ring of charged amino acids in the outer pore with an uncharged residue [45, 75, 76]. One of the amino acid substitutions in the willow creek channel sequence replaces the aspartic acid in the equivalent position of domain iv with an uncharged asparagine . It is reasonable to predict that this dramatic change at a critical residue may affect other aspects of channel function . Additional substitutions in the channel sequence that affect ttx binding are in regions of the channel that affect the structure of the selectivity filter and outer vestibule . The population with the most extreme resistance values (willow creek) has the most changes in the outer pore sequence of tsnav1.4 and the four amino acid substitutions increase the ttx resistance of the channel by three orders of magnitude . This population also has significantly slower action potential (ap) rise rates than the three other populations suggesting that the changes in the structure of the outer pore may have altered channel function . Two populations from another lineage with intermediate ttx resistance (benton and warrenton) have more conservative amino acid substitutions and the change in ttx resistance they impart is more modest . The ap rise rates from benton snakes are the same as those recorded from nonresistant snakes (bear lake population), however ap recordings from warrenton snakes have the surprising result that the ap rise rates are faster than those recorded from other snake populations . This result is not predicted by the single change in the pore sequence of the warrenton channel and suggests that another mechanism may also play a role in ttx resistance of this snake population . Specifically, snake from this population may express an increased number of sodium channels in skeletal muscle fibers . An increase in the sodium current of skeletal muscle fibers would increase the ap rise rate and could increase the concentration of ttx required to block activity in the skeletal muscle fibers of this population . The proper functioning of electrically excitable cells depends on maintaining a balance between ion currents that alter the membrane potential . Adaptations that allow common garter snakes to eat tetrodotoxic newts may have altered sodium channel function and this change could alter the magnitude of sodium currents in skeletal muscle cells . Changing sodium current magnitude could alter the balance of currents that influence cell excitability and action potential propagation . There is a physiological trade - off between ttx resistance and locomotor performance that manifests as more resistant snakes having slower maximum crawl speeds . Differences among populations in ap rise rates suggest that changes that alter the ttx resistance of the skeletal muscle may also affect cell physiology . The slowing of the ap rise rate in one population and its increase in another suggest that changes in channel function and possibly channel expression affect cell physiology . The evolution of ttx resistance in thamnophis sirtalis has occurred through a series of unique substitutions in a protein that is vital for nerve and muscle cell activity and in a region of the protein that is critical for its function . Further work in this system has the potential to increase our understanding of how ion channel function influences cell physiology through an opportunity to measure the benefits and costs of changes in sodium channel structure on the proper functioning of nerve and skeletal muscle tissue.
|
Post - transplant lymphoproliferative disease (ptld) is a serious, often fatal complication after solid organ transplantation . The incidence of ptld is greatest among heart (213%), lung (12%), and heart / lung (59%) transplant recipients, but occurs less frequently in liver (2%), renal (13%), and bone marrow (12%) transplant recipients . The patient s age, transplanted organ, epstein - barr virus (ebv) status of the donor and recipient before transplantation and the dosage of immunosuppressive drugs are considered risk factors . These differences in the incidence of ptld may be partly attributed to the higher doses of immunosuppressive drugs necessary following heart and lung transplantation . Other possible contributing factors may be bronchus - associated lymphoid tissue (balt) and nodal tissue harboring ebv in the donor transplant . Ebv infection, either preexisting in the recipient or acquired from the donor, is strongly implicated in the pathogenesis of ptld . Immunosuppression may permit uncontrolled proliferation of ebv - stimulated b cells by inhibition of suppressor t cells, from polyclonal to monomorphic and monoclonal proliferations . Monoclonal proliferations can subsequently accrue mutations of oncogenes or tumor suppressor genes, and lead to gain a fully malignant behavior and loss of responsiveness to immune regulation . Moreover, mutation of c - myc, n - ras and p53 genes has recently been implicated in the terminal progression of ptld . The peak incidence of ptld occurs 3 to 4 months after transplantation, but may develop as early as 6 days later . Patients with early onset ptld, within the first year, have a better prognosis than those with one developed late onset . In lung transplant recipients, ptld may develop in the allograft lung, lymph nodes or other malt sites, which frequently involves extranodal locations, including the lung . A lung involved by ptld may present as nodular or diffuse reticulonodular infiltrates, as solitary or multiple lung masses, or as hilar and mediastinal lymphadenopathy, and pulmonary nodules often have foci of necrosis . Histologically, ptld can range from polymorphic b cell hyperplasia to monomorphic b - cell proliferation that is indistinguishable from diffuse large cell or immunoblastic lymphomas . These lymphomas are generally high grade with diffuse large cell, immunoblastic, or small noncleaved cell burkitt or burkitt - like morphologies . Herein, our experience of two recently encountered cases of ptld following a lung transplantation, which demonstrated an aggressive clinical behavior, is reported, with a review of the literature . A 42-year - old man was admitted with a fever and chills for 3 days . His past medical history included dyspnea on exertion, which had developed from childhood, and was diagnosed as having a large patent ductus arteriosus with eisenmenger syndrome at the age of 20 . Six months prior to this presentation, the patient had undergone heart - lung transplantation due to progressive dyspnea, chest pain and peripheral cyanosis . His preoperative examination revealed cytomegalovirus (cmv) igm antibody negative, cmv igg antibody positive, herpes simplex virus (hsv) igm antibody negative, hsv igg antibody positive, varicella zoster virus (vzv) igm antibody negative and vzv igg antibody positive . The tests for ebv early antigen (ea)-igm was positive, ea - igg negative and epstein - barr nuclear antigen (eana) igg positive . The donor was a 25-year - old male whose preoperative examination revealed cmv igm antibody negative and cmv igg antibody positive . The test for ebv ea - igm was negative and ea - igg positive . During the immediate postoperative period, two months after the transplantation, he developed spiking fever with right lower lung field haziness and an accompanying pleural effusion, which was treated under the impression of bacterial pneumonia . One month later, he suffered a sudden fever and chill, and was admitted for further evaluation . On physical examination his chest examination revealed coarse breathing sounds in both lung fields and a grade i / iv systolic murmur in the aortic and tricuspid areas . Laboratory tests showed a white cell count of 11,090/l, hemoglobin 9.2 g / dl, platelet 315,000/l, wintrobe erythrocyte sedimentation rate (esr) 5 mm / hr (reference range; 010 mm / hr), serum protein 5.1 g / dl, albumin 2.4 g / dl, aspartate aminotransferase (ast) / alanine aminotransferase (alt) 22/21 iu / l (reference range; <37/<43 iu / l, respectively), creatinine 0.8 mg / dl, cmv igm antibody positive, cmv igg antibody positive, urine cmv - pcr negative, hsv antibody igm negative, hsv antibody igg positive, vzv antibody igm negative and vzv antibody igg positive . The tests for ebv revealed ea - igm antibody positive, ea - igg antibody negative, ebna igg antibody positive and ebv - pcr negative . A plain chest radiograph and computerized tomography revealed multiple, variably sized nodular lesions at the apical segments of both upper lungs, anterior segment of the left lung, posterobasal segment of the left lower lobe, hilar portion of the right middle lobe and superior segment of the right lower lobe . Irregular thickening of the alveolar septa and the perivascular connective tissue, due to diffuse infiltration of atypical lymphoid cells, were observed . The ebv - dna reaction was positive by in situ hybridization, but light chain restriction could not be confirmed (figure 1d). Thirty days after admission, the patient began to complain of visual disturbance, and was treated with intravitreal ganciclovir and foscarnet under the diagnosis of cmv retinitis . The chest lesion continued to progress, with multiple infectious foci, and multiorgan failure developed . A 33-year - old woman was admitted for evaluation of multiple air space nodules in the left lung field . Seven years before this presentation, she began to suffer from progressive dyspnea and dry cough . Four years before presentation, she was transferred to a general hospital and diagnosed as having severe emphysema (fvc 1.34 l (35.0%), fev1 0.61l / sec (20.0%), dlco 53% of expected value). She was a healthy hepatitis b virus (hbv) carrier and her 1-antitrypsine levels were 189, 381 and 225.3 mg / dl, by three separate tests . Two years before presentation, she underwent left lung transplantation and had been administered cyclosporine a, azathioprine and corticosteroid for immunosuppression, and lamivudine for hbv management . Preoperative serologic tests revealed cmv igm antibody negative, cmv igg antibody positive, hsv igm antibody negative, hsv igg antibody positive, vzv igm antibody negative and vzv igg antibody positive . There was no information regarding the donor . During 18 months of follow - up after the transplantation however, a routine follow up plain chest radiograph showed multiple air space nodules in the transplanted lung . On physical examination, she had a chronic ill - looking appearance and a moon face, although the lung sounds were clear in both lung fields without rales . Laboratory tests revealed a white cell count of 5,440/l, hemoglobin 11.7 g / dl, platelet 232,000/l, c - reactive protein (crp) quantitation 25.9 (reference range; 08 mg / l), wintrobe esr 58 mm / hr, serum protein 5.6 g / dl, albumin 3.2 g / dl, ast / alt 19/12 iu / l, bun 33 mg / dl and creatinine 0.9 mg / dl . The ea - igm and igg antibodies were positive, and the ebna - igg antibody was positive, which is a typical reactivity pattern for ebv reactivation, e.g. Ebv - associated lymphoproliferative diseases or epithelial carcinomas, such as nasopharyngeal carcinoma . Chest high resolution computed tomogram revealed multiple air spaced nodules at the left upper lobe and collapse of the lingular segment . These nodules had speculated margins with accompanying peripheral ground glass opacity, suggesting inflammatory changes (figure 2a2c). A comparison of inspiratory and expiratory phase images showed neither mosaic perfusion nor small airway disease . A percutaneous transthoracic needle biopsy was performed on a nodule in the left upper lobe . These nodules consisted of lymphocytes, which by immunohistochemical study revealed positive reactions to l-26 and negative reactions to uchl-1, kappa, lambda, cytokeratin and ki-1 in the tumor cells . A malignant lymphoma, of high - grade large b - cell type, was confirmed (figure 2d). She was given a chemotherapeutic regimen comprising of cytoxan 1200 mg, vincristine 2 mg and prednisone 100 mg for 5 days, and one - week later epirubicin 90 mg was administered before being discharged . Two weeks later the patient developed sudden dyspnea and died of pulmonary edema and a pneumothorax . A 42-year - old man was admitted with a fever and chills for 3 days . His past medical history included dyspnea on exertion, which had developed from childhood, and was diagnosed as having a large patent ductus arteriosus with eisenmenger syndrome at the age of 20 . Six months prior to this presentation, the patient had undergone heart - lung transplantation due to progressive dyspnea, chest pain and peripheral cyanosis . His preoperative examination revealed cytomegalovirus (cmv) igm antibody negative, cmv igg antibody positive, herpes simplex virus (hsv) igm antibody negative, hsv igg antibody positive, varicella zoster virus (vzv) igm antibody negative and vzv igg antibody positive . The tests for ebv early antigen (ea)-igm was positive, ea - igg negative and epstein - barr nuclear antigen (eana) igg positive . The donor was a 25-year - old male whose preoperative examination revealed cmv igm antibody negative and cmv igg antibody positive . The test for ebv ea - igm was negative and ea - igg positive . During the immediate postoperative period, two months after the transplantation, he developed spiking fever with right lower lung field haziness and an accompanying pleural effusion, which was treated under the impression of bacterial pneumonia . One month later, he suffered a sudden fever and chill, and was admitted for further evaluation . On physical examination his chest examination revealed coarse breathing sounds in both lung fields and a grade i / iv systolic murmur in the aortic and tricuspid areas . Laboratory tests showed a white cell count of 11,090/l, hemoglobin 9.2 g / dl, platelet 315,000/l, wintrobe erythrocyte sedimentation rate (esr) 5 mm / hr (reference range; 010 mm / hr), serum protein 5.1 g / dl, albumin 2.4 g / dl, aspartate aminotransferase (ast) / alanine aminotransferase (alt) 22/21 iu / l (reference range; <37/<43 iu / l, respectively), creatinine 0.8 mg / dl, cmv igm antibody positive, cmv igg antibody positive, urine cmv - pcr negative, hsv antibody igm negative, hsv antibody igg positive, vzv antibody igm negative and vzv antibody igg positive . The tests for ebv revealed ea - igm antibody positive, ea - igg antibody negative, ebna igg antibody positive and ebv - pcr negative . A plain chest radiograph and computerized tomography revealed multiple, variably sized nodular lesions at the apical segments of both upper lungs, anterior segment of the left lung, posterobasal segment of the left lower lobe, hilar portion of the right middle lobe and superior segment of the right lower lobe . Irregular thickening of the alveolar septa and the perivascular connective tissue, due to diffuse infiltration of atypical lymphoid cells, were observed . The ebv - dna reaction was positive by in situ hybridization, but light chain restriction could not be confirmed (figure 1d). Thirty days after admission, the patient began to complain of visual disturbance, and was treated with intravitreal ganciclovir and foscarnet under the diagnosis of cmv retinitis . The chest lesion continued to progress, with multiple infectious foci, and multiorgan failure developed . A 33-year - old woman was admitted for evaluation of multiple air space nodules in the left lung field . Seven years before this presentation, she began to suffer from progressive dyspnea and dry cough . Four years before presentation, she was transferred to a general hospital and diagnosed as having severe emphysema (fvc 1.34 l (35.0%), fev1 0.61l / sec (20.0%), dlco 53% of expected value). She was a healthy hepatitis b virus (hbv) carrier and her 1-antitrypsine levels were 189, 381 and 225.3 mg / dl, by three separate tests . Two years before presentation, she underwent left lung transplantation and had been administered cyclosporine a, azathioprine and corticosteroid for immunosuppression, and lamivudine for hbv management . Preoperative serologic tests revealed cmv igm antibody negative, cmv igg antibody positive, hsv igm antibody negative, hsv igg antibody positive, vzv igm antibody negative and vzv igg antibody positive . There was no information regarding the donor . During 18 months of follow - up after the transplantation however, a routine follow up plain chest radiograph showed multiple air space nodules in the transplanted lung . On physical examination, her body temperature, pulse and respiration rates were 36.2c, 74/min and 20/min . She had a chronic ill - looking appearance and a moon face, although the lung sounds were clear in both lung fields without rales . Laboratory tests revealed a white cell count of 5,440/l, hemoglobin 11.7 g / dl, platelet 232,000/l, c - reactive protein (crp) quantitation 25.9 (reference range; 08 mg / l), wintrobe esr 58 mm / hr, serum protein 5.6 g / dl, albumin 3.2 g / dl, ast / alt 19/12 iu / l, bun 33 mg / dl and creatinine 0.9 mg / dl . The ea - igm and igg antibodies were positive, and the ebna - igg antibody was positive, which is a typical reactivity pattern for ebv reactivation, e.g. Ebv - associated lymphoproliferative diseases or epithelial carcinomas, such as nasopharyngeal carcinoma . Chest high resolution computed tomogram revealed multiple air spaced nodules at the left upper lobe and collapse of the lingular segment . These nodules had speculated margins with accompanying peripheral ground glass opacity, suggesting inflammatory changes (figure 2a2c). A comparison of inspiratory and expiratory phase images showed neither mosaic perfusion nor small airway disease . A percutaneous transthoracic needle biopsy was performed on a nodule in the left upper lobe . These nodules consisted of lymphocytes, which by immunohistochemical study revealed positive reactions to l-26 and negative reactions to uchl-1, kappa, lambda, cytokeratin and ki-1 in the tumor cells . A malignant lymphoma, of high - grade large b - cell type, was confirmed (figure 2d). She was given a chemotherapeutic regimen comprising of cytoxan 1200 mg, vincristine 2 mg and prednisone 100 mg for 5 days, and one - week later epirubicin 90 mg was administered before being discharged . Two weeks later the patient developed sudden dyspnea and died of pulmonary edema and a pneumothorax . The incidence of ptld after lung transplantation is 2-fold higher than that seen after any other type of organ transplantation . Primary ebv infection has been implicated as the major risk factor for ptld, particularly for ebv - naive patients who seroconverted after the lung transplantation . A 20-fold increase in the risk of developing ptld was reported to occur in ebv - seronegative vs ebv - seropositive lung recipients after transplantation . In our cases, serologic ebv testing of the recipients showed that ea - igm was positive and ea - igg negative, suggesting a recent ebv infection prior to the transplantation . In the local community, ebv spreads by contact with oral secretion, but has been transmitted by blood transfusion and bone marrow transplantation in a hospital setting through the ebv receptor (cd21), which present on the surface of b cells and epithelial cells . The most likely source of ebv infection through solid organ transplantation is transmission through an organ from an ebv - positive to an ebv - seronegative recipient . The exact mechanism by which the donor virus is transmitted from the transplanted organ to the recipient is unknown, although in solid organ transplant recipients, virus - infected cells in ptld of recipient origin have been identified . Thus, the donor virus may either be transmitted in a cell - free state or released by donor cells in the recipient . A sufficient number of ebv - carrying b cells may remain in the blood within the allograft and pass into the circulation of the recipient; the virus would then enter the lytic cycle and infect the recipient b - cell population . Alternatively, heart and lung tissue may contain foci of ebv - infected cells, which may act as sites of virus replication . Ebv infection in a naive recipient, occurring in the setting of altered host immunity, leads to uncontrolled proliferation and transformation of recipient b cells infected with ebv . These possible patterns of events require identification of high - risk causes and the development of effective therapeutic modalities . A recent study found that continuous, specific anti - viral prophylaxis in high - risk ebv - seronegative recipients significantly reduced the incidence of ptld after lung transplantation in the absence of induction therapy . Lymphoid proliferations that are morphologically indistinguishable from a malignant lymphoma occur with greater frequency in organ transplant recipients than in the general population; but are unlikely to progress to malignant lymphomas in immunocompetent patients, but often regress if the immunosuppression is sufficiently reduced . Polymorphic b - cell hyperplasia is associated with a mixture of small lymphocytes, plasma cells and immmunoblasts, without significant cytologic atypia . Monomorphic ptld has sheets of large transformed monoclonal cells or immunoblasts . Despite their overt malignant appearance, neither the histological appearance nor clonality can accurately predict the response to modulation of immunosuppression . Over the past decades, numerous attempts have been made to classify these lesions using morphology, immunohistochemistry and monoclonality, but none of these tools alone or in combination was found to accurately predict the biological behavior . The first case was confirmed as polymorphic, and was treated by conservative means by adjusting the immunosuppressant and anti - viral agent used to treat the accompanying cmv infection, whereas the second case was suspected as monomorphic ptld, and treated aggressively using a chemo - therapeutic regimen, but did not respond to treatment . Because ptld treatments are most effective in the early stage, prior to the occurrence of progression of monomorphic or monoclonal proliferations, not only the early detection of ptld, but also the identification of the clonality of ptld, are of importance in planning the means of treatment.
|
Based on a recent systematic analysis, oral conditions affected about 3.9 billion people worldwide and untreated caries in permanent teeth was the most prevalent condition with a global prevalence of 35% for all ages combined (1). Accumulation of microbial plaque on dental surfaces is the first step of dental caries and periodontal diseases . The dental caries is then progressed by further destruction of teeth by acids produced by these bacteria (2). About twenty - five species of streptococci live in the oral cavity . Of these, oral streptococci such as streptococcus mutants and s. sobrinus have direct association with tooth decay (3), while others such as s. sanguis and s. salivarius are less harmful and considered as normal microbial population of the oral cavity . Staphylococcus aureus is another gram - positive cocci responsible for oral infections (4, 5). This species can be isolated from oral cavity of specific groups such as elderly and children (6, 7). Enterococcus faecalis is another gram - positive cocci commonly isolated from endodontic infections (8, 9). Yeasts including candida species are also found in oral cavity as normal flora . Under certain circumstances such as avitaminosis, using broad spectrum antibiotics and immunosuppressive agents, they might colonize and adhere to soft and hard tissue surfaces such as dentures and form a biofilm (10). Proper oral hygiene and using oral mouthwashes with antimicrobial activity are considered as the main approaches in prevention of oral infections . Within the past two decades, methicillin - resistant s. aureus (mrsa), vancomycin - resistant enterococcus (vre) species and azole - resistant candida species are among the main pathogens responsible for oral infections (11 - 13). On the other hand, most of these synthetic antimicrobial products have some adverse effects, which make them less popular . An alternative approach to overcome these issues might be using natural antimicrobial products and phytochemicals . The middle east has unique niches for medicinal plants, which have been used for treating diseases and infections for thousands of years in traditional medicine . It has been shown previously that plants and their aromatic products have potential antimicrobial activities (14). Essential oils distilled from these aromatic plants have known medicinal properties and widely used to treat a variety of diseases (table 1). As mentioned in table 1, these eos are rich in terpenoid compounds in particular monoterpenes with known antimicrobial properties (15). The previous studies demonstrated the successful usage of essential oil (eo) based mouthwashes in preventing and controlling formation of plaque and gingivitis as well as reducing bad breath and odor - causing bacteria (16). In the previous studies, the eos distilled from seven local medicinal plants of southern parts of iran were prepared and their main constituents were identified by gas chromatography / mass spectrometry (table 1). Concerning the emergence of resistance to antibiotics in the past decades, their unavoidable adverse effects and regarding the global tendency towards using natural products and phytochemicals in medicine, the present study was conducted to evaluate antimicrobial activity of the seven common eos, as listed in table 1, against the common causes of oral infections . Salvia mirzayanii was deposited at the herbarium of medical science of department of pharmacognosy, faculty of pharmacy, shiraz university of medical sciences, iran (voucher no . 663). The satureja bachtiarica was deposited at the herbarium of medicinal plants and drugs research institute (mph), shahid beheshti university, tehran, iran (voucher no.mph-1577). The other plants were deposited at the herbarium of faculty of agriculture, shiraz university, shiraz, iran with voucher numbers of suha-111 for artemisia sieberi, and suha-110 for oliveria decumbens, as well as at herbarium of shiraz university, shiraz, iran with voucher numbers of suh-24989 for ocimum sanctum, suh-24985 for carum copticum and suh-24985 for zataria multiflora . The aerial parts of the mentioned medicinal plants were harvested at proper growth stage and then air - dried . Eos were prepared by hydrodistillation using a glass clevenger - type apparatus according to the method recommended by the european pharmacopoeia (23). The extracted eo samples were dried over anhydrous sodium sulphate and stored in sealed vials at low temperature (4c). The analysis of eos was performed using a thermoquest - finnigan trace gc - ms instrument equipped with a db-5 fused silica capillary column (60 m 0.25 mm i.d ., the oven temperature was programmed to increase from 60 to 250c at a rate of 4c per minute and finally held for 10 min; transfer line temperature was 250c . Helium was used as the carrier gas at a flow rate of 1.1 ml / min with a split ratio of 1/50 . The quadrupole mass spectrometer was scanned over the 35 - 465 amu (atomic mass units) with an ionizing voltage of 70 ev and an ionization current of 150 ma . The gc / fid analysis of the oils was conducted using a thermoquest - finnigan instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d ., nitrogen was used as the carrier gas at the constant flow rate of 1.1 ml / min; the split ratio was the same as that used for gc / ms . The oven temperature was raised from 60 to 250c at a rate of 4c per min and held for 10 minutes . The injector and detector (fid) temperatures were kept at 250 and 280c, respectively . Retention indices (ri) were calculated using retention times of n - alkanes (c6-c24) that were injected after the oil at the same temperature and conditions . The compounds were identified by comparison of their ri with those reported in the literature (24) and their mass spectrum was compared with the wiley library . The antimicrobial activities of the eos against some oral pathogens including standard species of s. mutants (atcc 35668), s. sanguis (atcc 10556), s. salivarius (atcc 9222), s. sobrinus (atcc 27607), e. faecalis (atcc11700), s. aureus (atcc 25923, 29213 and atcc 700698), c. albicans (atcc 10261), c. dubliniensis (cbs 8501), c. tropicalis (atcc 750), c. krusei (atcc 6258) and c. glabrata (atcc 90030) and four clinical isolates of s. mutants were determined in this study . Minimum inhibitory concentrations (mics) were determined using broth microdilution method recommended by the clsi with some modifications (25, 26). Briefly, for determination of antifungal activities against yeasts, serial dilutions of the eos (0.015 to 16.0 l / ml) were prepared in 96-well microtiterplates using rpmi-1640 media (sigma, st . Louis, the usa). To determine the antibacterial activities, serial dilutions of the eos (0.062 to 32.0 l / ml) were prepared in muller - hinton broth media (merck, darmstadt, germany). Test fungi or bacteria strains were suspended in the media and the cell densities were adjusted to 0.5 mcfarland standards at 530 nm wavelength using a spectrophotometric method (this yields stock suspension of 1 - 5 10 cells / ml for yeast and 1 - 1.5 10 cells / ml for bacteria). 100 l of the working inoculums was added to the microtiter plates and the plates (treated wells and untreated controls) were incubated in a humid atmosphere at 30c for 24 - 48 hours (fungi) or at 37c for 24 hours (bacteria). 200 l of the uninoculated medium was included as a sterility control (blank). In addition, growth controls (medium with inoculums but without essential oil) were included . Mics were visually determined and defined as the lowest concentration of the essential oil producing no visible growth . In addition, media from wells with fungi showing no visible growth were further cultured on sabouraud dextrose agar (merck, darmstadt, germany) and from wells with bacteria showing no visible growth on muller - hinton agar (merck, darmstadt, germany) to determine the minimum microbicidalconcentration (mmc). Mmcs were determined as the lowest concentration yielding no more than four colonies, which corresponds to a mortality of 99.9% of the microbes in the initial inoculums . Salvia mirzayanii was deposited at the herbarium of medical science of department of pharmacognosy, faculty of pharmacy, shiraz university of medical sciences, iran (voucher no . 663). The satureja bachtiarica was deposited at the herbarium of medicinal plants and drugs research institute (mph), shahid beheshti university, tehran, iran (voucher no.mph-1577). The other plants were deposited at the herbarium of faculty of agriculture, shiraz university, shiraz, iran with voucher numbers of suha-111 for artemisia sieberi, and suha-110 for oliveria decumbens, as well as at herbarium of shiraz university, shiraz, iran with voucher numbers of suh-24989 for ocimum sanctum, suh-24985 for carum copticum and suh-24985 for zataria multiflora . The aerial parts of the mentioned medicinal plants were harvested at proper growth stage and then air - dried . Eos were prepared by hydrodistillation using a glass clevenger - type apparatus according to the method recommended by the european pharmacopoeia (23). The extracted eo samples were dried over anhydrous sodium sulphate and stored in sealed vials at low temperature (4c). The analysis of eos was performed using a thermoquest - finnigan trace gc - ms instrument equipped with a db-5 fused silica capillary column (60 m 0.25 mm i.d ., the oven temperature was programmed to increase from 60 to 250c at a rate of 4c per minute and finally held for 10 min; transfer line temperature was 250c . Helium was used as the carrier gas at a flow rate of 1.1 ml / min with a split ratio of 1/50 . The quadrupole mass spectrometer was scanned over the 35 - 465 amu (atomic mass units) with an ionizing voltage of 70 ev and an ionization current of 150 ma . The gc / fid analysis of the oils was conducted using a thermoquest - finnigan instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d ., nitrogen was used as the carrier gas at the constant flow rate of 1.1 ml / min; the split ratio was the same as that used for gc / ms . The oven temperature was raised from 60 to 250c at a rate of 4c per min and held for 10 minutes . The injector and detector (fid) temperatures were kept at 250 and 280c, respectively . Retention indices (ri) were calculated using retention times of n - alkanes (c6-c24) that were injected after the oil at the same temperature and conditions . The compounds were identified by comparison of their ri with those reported in the literature (24) and their mass spectrum was compared with the wiley library . The antimicrobial activities of the eos against some oral pathogens including standard species of s. mutants (atcc 35668), s. sanguis (atcc 10556), s. salivarius (atcc 9222), s. sobrinus (atcc 27607), e. faecalis (atcc11700), s. aureus (atcc 25923, 29213 and atcc 700698), c. albicans (atcc 10261), c. dubliniensis (cbs 8501), c. tropicalis (atcc 750), c. krusei (atcc 6258) and c. glabrata (atcc 90030) and four clinical isolates of s. mutants were determined in this study . Minimum inhibitory concentrations (mics) were determined using broth microdilution method recommended by the clsi with some modifications (25, 26). Briefly, for determination of antifungal activities against yeasts, serial dilutions of the eos (0.015 to 16.0 l / ml) were prepared in 96-well microtiterplates using rpmi-1640 media (sigma, st . Louis, the usa). To determine the antibacterial activities, serial dilutions of the eos (0.062 to 32.0 l / ml) were prepared in muller - hinton broth media (merck, darmstadt, germany). Test fungi or bacteria strains were suspended in the media and the cell densities were adjusted to 0.5 mcfarland standards at 530 nm wavelength using a spectrophotometric method (this yields stock suspension of 1 - 5 10 cells / ml for yeast and 1 - 1.5 10 cells / ml for bacteria). 100 l of the working inoculums was added to the microtiter plates and the plates (treated wells and untreated controls) were incubated in a humid atmosphere at 30c for 24 - 48 hours (fungi) or at 37c for 24 hours (bacteria). 200 l of the uninoculated medium was included as a sterility control (blank). In addition, growth controls (medium with inoculums but without essential oil) were included . Mics were visually determined and defined as the lowest concentration of the essential oil producing no visible growth . In addition, media from wells with fungi showing no visible growth were further cultured on sabouraud dextrose agar (merck, darmstadt, germany) and from wells with bacteria showing no visible growth on muller - hinton agar (merck, darmstadt, germany) to determine the minimum microbicidalconcentration (mmc). Mmcs were determined as the lowest concentration yielding no more than four colonies, which corresponds to a mortality of 99.9% of the microbes in the initial inoculums . The antimicrobial activities of the eos against some oral pathogens including standard species of s. mutants (atcc 35668), s. sanguis (atcc 10556), s. salivarius (atcc 9222), s. sobrinus (atcc 27607), e. faecalis (atcc11700), s. aureus (atcc 25923, 29213 and atcc 700698), c. albicans (atcc 10261), c. dubliniensis (cbs 8501), c. tropicalis (atcc 750), c. krusei (atcc 6258) and c. glabrata (atcc 90030) and four clinical isolates of s. mutants were determined in this study . Minimum inhibitory concentrations (mics) were determined using broth microdilution method recommended by the clsi with some modifications (25, 26). Briefly, for determination of antifungal activities against yeasts, serial dilutions of the eos (0.015 to 16.0 l / ml) were prepared in 96-well microtiterplates using rpmi-1640 media (sigma, st . Louis, the usa). To determine the antibacterial activities, serial dilutions of the eos (0.062 to 32.0 l / ml) were prepared in muller - hinton broth media (merck, darmstadt, germany). Test fungi or bacteria strains were suspended in the media and the cell densities were adjusted to 0.5 mcfarland standards at 530 nm wavelength using a spectrophotometric method (this yields stock suspension of 1 - 5 10 cells / ml for yeast and 1 - 1.5 10 cells / ml for bacteria). 100 l of the working inoculums was added to the microtiter plates and the plates (treated wells and untreated controls) were incubated in a humid atmosphere at 30c for 24 - 48 hours (fungi) or at 37c for 24 hours (bacteria). 200 l of the uninoculated medium was included as a sterility control (blank). In addition, growth controls (medium with inoculums but without essential oil) were included . Mics were visually determined and defined as the lowest concentration of the essential oil producing no visible growth . In addition, media from wells with fungi showing no visible growth were further cultured on sabouraud dextrose agar (merck, darmstadt, germany) and from wells with bacteria showing no visible growth on muller - hinton agar (merck, darmstadt, germany) to determine the minimum microbicidalconcentration (mmc). Mmcs were determined as the lowest concentration yielding no more than four colonies, which corresponds to a mortality of 99.9% of the microbes in the initial inoculums . The antibacterial activities of the eos against the common causes of oral infections are shown in table 2 . The eos inhibited the growth of examined bacteria at concentrations of 0.062 - 4 l / ml, except e. faecalis, which was inhibited at concentration of 0.125 - 16 l / ml . Furthermore, all of the eos exhibited the minimal microbicidal activity (mmc) for the tested bacteria at concentrations ranging from 0.25 to 16 l / ml, except eo a. sieberi, which showed bactericidal activities at the range of 1 - 32 l / ml . Of the tested bacteria, e. faecalis had the highest mics and mbcs . For the standard yeasts tested, the mics for the eos were in the range of 0.015 2 l / ml (table 2). All the tested candida spp . Were killed by the eos at about the same or twice the concentration of their corresponding mics . Of the examined eos, s. khuzestanica, z. multiflora and s. bachtiarica showed the highest antimicrobial activities, respectively, while a. sieberi exhibited the lowest antimicrobial properties . 1,satureja khuzestanica; 2,satureja bachtiarica; 3,ocimum sanctum; 4,artemisia sieberi; 5,zataria multiflora; 6,carum copticum; 7,salvia mirzayanii . Microbial flora accumulated on the mucosal and dental surfaces of the oral cavity are responsible for dental caries and biofilm formation (27). It has been reported that eos are capable of inhibiting the growth of these microorganisms and the formation of biofilms (28). These aromatic oils were used successfully in the management of recurrent aphthous stomatitis, plaque formation and gingivitis (29, 30). In this regard, lower potency of chlorhexidine in comparison to eos has been reported previously (31). Organisms predominant in plaque formation and tooth decay are of the genus streptococcus . Similar to the study of adiguzel (32), the growth of the standard and clinical isolates of the streptococci was inhibited by tested eos at concentrations of 0.062 to 1 l / ml, except eos of a. sieberi, which exhibited higher mics (0.5 - 2 l / ml). The ability of s. aureus to develop methicillin resistance is becoming a matter of great concern . Mics of the tested eos against s. aureus were in the range of 0.06 - 2 l / ml, which is concordant with most previous studies (33, 34). In addition, eos successfully inhibited the growth of e. faecalis recognized as the commonly isolated bacteria from endodontic infections (8, 9). These results are in agreement with the report of sonboli et al . Who showed significant antimicrobial activities of three salvia species eos against e. faecalis with mics of 10 l / ml (33). Are another resident of the oral cavity associated with oral candidiasis and biofilm formation (10). Similar to the previous studies (28, 32, 35), all of the eos exhibited fungicidal activities against the standard species of candida at concentrations ranged <0.015 - 0.5 l / ml, except a. seiberi and s. mirzayanii which inhibited the growth of tested yeasts at concentrations of 0.25 - 2 l / ml . Hydrophobicity is one of the main characteristics of eos, which enables their incorporation into the cell membrane (15). As shown in table 1, s. khuzestanica, s. bachtiarica, z. multiflora and c. copticum were rich in phenolic monoterpenes, including carvacrol and thymol . It has been shown that antimicrobial activity of these phenolic monoterpenes is due to hydroxyl groups at different positions around the phenolic ring through disruption of the cytoplasmic membrane and leakage of ions and atp . Although no strong antibacterial activity was reported for terpinene as the second main constituent of c. copticum (15), this activity might be attributed to the high thymol concentration of this plant . P - cymene is another major component identified in the eo of carum copticum, which is a hydrophobic molecule and causes swelling of the cytoplasmic membrane (36). However, in combination with other phenolic compounds such as thymol, it has shown a greater antimicrobial activity by incorporating cymene in the lipid bilayer of bacteria and facilitating transport of thymol across the cytoplasmic membrane (39). Eos of o. sanctum, a. seiberi, and s. mirzayanii were rich in 1,8-cineol and exhibited strong antimicrobial activity against tested microbes . It has been shown previously that 1,8-cineol has significant antimicrobial activities alone or in combination with other monoterpenesor drugs . Of the tested eos, s. mirzayanii had the highest 1,8-cineol concentration and the lowest mics against gram - positive cocci, which is in accordance to the results of above study (40). These results supported the idea of using eos in mouthwashes and denture cleansers, since they show high efficacy in inhibiting microbial strains, even in the plantitic form . Furthermore, anti - inflammatory activity (41, 42) and pleasant odor and flavor of these eos are additional advantages to their antimicrobial activities to be used as a mouth rinse and other oral hygienic products.
|
A 23-year - old female presented with an asymptomatic, erythematous, atrophic macule on the upper right side of her back that increased gradually in size within the last four years without any symptoms (figure 1a). On physical examination the surface of the lesion was smooth and no induration was examined on palpation . Dermatoscopic evaluation of the lesion using 3gen dermlite - ii pro hr and documented with dermlite - foto 3gen (llc, dana point, ca, usa) showed a homogenous pigment network on a purplish erythematous background (figure 1b). Histopathological examination of h&e (hematoxylin and eosin) stained sections revealed epidermal atrophy, increase in melanin in basal keratinocytes and heavy dermal cellular infiltrate composed of spindle - shaped cells arranged in a storiform pattern that extended into the subcutaneous tissue (figure 2). Immunhistochemical staining for cd34 was positive, while factor xiiia was negative (figure 3a, b). Dfsp is a rare, slow growing, locally invasive cutaneous neoplasm of fibrohistiocytic origin with intermediate grade malignancy with an incidence between 0.85.0 cases per 1 million persons per year . The atrophic presentation of dfsp is the rarest variant of this infrequent neoplasm, which was first described in 1985 . The non - protuberant dfsp can be considered the early clinical stage of dfsp before developing the typical protuberant feature unless it remains as a non - protuberant tumor that is called atrophic dfsp . It occurs as an atrophic, asymptomatic plaque that can be difficult to distinguish from morphea, morphea like basal cell carcinoma, scar, lipoatrophy and atrophic dermatofibroma . Although the clinical appearance of atrophic dfsp is different from common protuberant type, histopathological features are similar . Atrophic presentation of the lesions may be due to the marked cellularity of the tumor cells in the dermis and infiltration to the subcutaneous fat . Immunhistochemical staining is important to distinguish dfsp from atrophic dermatofibroma and medallion - like dermal dendrocyte hamartoma . While dfsp cells are positive for cd34 and negative for factor xiiia, atrophic dermatofibroma cells are usually negative for cd34 and both of cd34 and factor xiiia are positive in the medallion - like dermal dendrocyte hamartoma [3, 4]. Dermatoscopic studies of dfsp are very rare in the literature . In 2013, bernard et al reported the first study of dermatoscopic analysis of dfsp in 15 cases . Delicate pigment network, vessels, structureless light brown areas, shiny white streaks, pink background coloration and structureless hypopigmented or depigmented areas were defined as six main dermatoscopic features of dfsp . In 2014, dermatoscopic features such as peripheral dilated vessels forming a mesh - like pattern, milky - red areas, whitish linear structures and fine pigment network were reported in a series of four cases of dfsp . To our knowledge, only one case of atrophic dfsp was presented with dermatoscopic features in the literature . The reported dermatoscopic findings of that case were branching vessels on a yellowish background without pigment network . The authors suggested that the dermatoscopic features might be the result of dermal atrophy and close approximation the subcutis to the epidermis . In contrast, our case showed dermatoscopically regular brown lines reticular on a purplish erythematous background . Homogenous brown lines reticular seen in our case correspond to the accumulation of melanin in basal keratinocytes, while the erythematous background is the result of dilated vessels in the dermal plexus . Here, the smooth surface reflects the stratum corneum being normal . The most frequent dermatoscopic pattern associated with dermatofibromas, a well - known and benign cousin of dfsp, is the central white scar - like patch and peripheral delicate pigment network . The histopathologic correlation of white scar - like patch in dermatofibroma is pronounced fibrosis within the papillary dermis . Contrary to dermatofibromas, fibroplasia in the upper half of the dermis is uncommonly observed in dfsp which may explain the absence of white scar - like areas in our case . In conclusion, we have presented the dermatoscopic findings in an unusual case of atrophic dfsp . Atrophic dfsp should be kept in the differential diagnosis for atrophic and depressed skin lesions, particularly those seen on the trunks of women . Dermatoscopy, a noninvasive method, may not only help to differentiate atrophic dfsp from other skin diseases but may also indicate the need for histopathological examination since the disease has prognostic significance.
|
Approximately 6.5 million individuals in the united states have hf, and the cost to care for these patients is estimated to be $39 billion annually.1, 2 most of this cost is incurred through recurrent hospitalizations; a recent report estimated that primary diagnoses of hf account for over 1 million hospitalizations annually, and secondary diagnoses of hf account for another 3 million hospitalizations annually.3 readmission rates have become important surrogates for quality of hospital care for hf patients . They are receiving greater scrutiny by policy makers and payers who are increasingly relying on payforperformance measures to determine compensation . Poor handoff, or transition of care, has been an additional problem for these complex patients and has been associated with adverse events and low satisfaction with care.4 hospital readmissions for hf exacerbations are common, and many readmissions are known to be attributable to modifiable factors5 that can be addressed with highquality postdischarge care; disease management approaches are currently endorsed in contemporary hf guidelines.6, 7, 8, 9, 10, 11, 12, 13 however, despite the strength of these published studies, the first of which was published almost 2 decades ago, recent data show that 25% of hospitalized patients with hf are readmitted within 30 days of discharge and 50% are readmitted within 6 months.14, 15, 16 in addition, there are financial incentives for decreasing readmissions to the hospital . As of october 1, 2012, the centers for medicare and medicaid services can reduce payments by 1% to hospitals whose readmission rates for patients with certain conditions (eg, hf, acute myocardial infarction, and pneumonia) exceed a particular target.17 in a landmark study published in jama in 2010, hernandez et al.18 performed an analysis including more than 30 000 medicare patients cared for in 25 hospitals . The analysis showed that early physician followup (ie, within 7 days), which occurred for less than one third of patients, is independently associated with lower rates of allcause 30day readmission.18 substantial variations in the timing of followup and the fact that the health care was rarely provided by a cardiologist were noted . The majority of posthospital followups were performed by general medicine specialists, whereas only a small percentage of the followups (7%) was provided by a cardiologist . In most cases, this finding likely reflects an increasing trend in which hospitalists only manage the care of hf patients in the hospital setting, without an expectation of any longitudinal care relationship after the patient has been discharged from the hospital . The transition from 1 caregiver to another is one of many points where a breakdown in communication can occur.19 the transition process can be complex and may involve many participants, including case managers, social workers, home health agencies, pharmacy services, and outpatient clinical providers (eg, primary care and specialist providers and ancillary services). Transitional care is increasingly being recognized as a critical component of highquality care for patients hospitalized for hf . The importance of this topic prompted the american heart association (aha) to publish a scientific statement stressing the need for quality transitional care interventions for these patients to address a variety of unmet needs.20 in september 2010, the university of texas health science center in houston and memorial hermann hospital initiated a novel allied health service that was offered on a referral basis to all patients with a primary or secondary diagnosis of congestive hf (chf). This clinic delivered specialized, protocoldriven care to patients at 1 and 4 to 6 weeks after an index hospital admission . Our hypothesis was that establishing such a clinic would reduce 30day readmission rates to the hospital . We analyzed the effect of a novel, multidisciplinary clinic for the first 169 patients who were observed between september 2010 and march 2012 by performing a retrospective chart review . This project was approved by the institutional review board at memorial hermann hospital, and the requirement for individual informed consent was waived . The clinical service assessed was specifically designed to address the needs of hf patients discharged from the hospital . The postdischarge transitional care clinic was located in the memorial hermann pharmacy wellness clinic, which is a facilitybased clinic located close to the acute care hospital . Memorial hermann hospital is a large, tertiary care urban teaching hospital in houston, texas, with 650 inpatient beds for adults . The goal of the clinic was to reduce 30day allcause readmissions and address transitional care problems by providing timely, protocoldriven postdischarge evaluation and management . The multidisciplinary allied health clinic comprised a boardcertified nurse practitioner and a boardcertified doctor of pharmacy, both of whom worked in collaboration with referring providers . A boardcertified hf cardiologist acted as the medical director for this new transitional care service . The detailed clinic protocols were developed with the multidisciplinary team and were based on approved american college of cardiology / aha guidelines . Patients were eligible to be observed in the postdischarge clinic if they were recently admitted to the hospital with a diagnosis of hf . The protocol included planned followup within 1 week and between 4 and 6 weeks postdischarge . Initial visits were scheduled for 1 hour, and subsequent visits were scheduled for 40 minutes . One additional interim visit was allowed by protocol for patients deemed to be at high risk for readmission . Referral was voluntary by providers who agreed to the designated protocols . For a patient to be referred, the referring physician had to be acquainted with the policies, procedures, and protocols of this new service and had to sign a referral to the clinic . Postdischarge clinic visits included the following: (1) a physical examination; (2) medication education and reconciliation; (3) medication uptitration per protocol; (4) individualized hf disease education emphasizing symptom recognition and reporting; (5) coordination of outpatient health care resources; and (6) a comprehensive discharge plan, including medication lists and assistance in establishing followup with home health care and other providers . The physical examination was performed by a nurse practitioner specializing in hf and focused on hemodynamic status (perfusion) and volume assessment (congestion). Volume assessment included taking orthostatic blood pressure measurements in the supine, sitting, and standing positions; performing a bedside evaluation of jugular venous pressures; and looking for any evidence of edema . Furthermore, patient weights recorded in the clinic were carefully compared to those recorded at discharge and by the patients themselves at home . Based on the examination findings, the clinical nurse practitioner made alterations to the treatment plan as necessary . The examination also included a pointofcare laboratory evaluation to detect electrolyte abnormalities and any deterioration in renal or hepatic function . Patients were asked to bring all prescription and nonprescription medications to the clinic for review . Medication regimen alterations were focused on titration of hf therapy to maintain euvolemia and maximize therapeutic medication targets, as well as correcting identified errors or addressing contraindicated therapy . All patients left the clinic with an updated med action plan (a patientfriendly printed list of medications and dosing instructions) in either full or walletsize formats . Care coordination services included communications with the primary care provider, other specialist providers, and/or home health services . In coordination with the referring provider, the need for additional resources, such as physician specialists, advanced home health services, rehabilitation services, and palliative care or hospice services, was also evaluated . All statistical analyses were performed by using sas software (version 9.3; sas institute inc ., all statistical analyses were performed by using sas software (version 9.3; sas institute inc ., the main referral sources were cardiologists, including those affiliated with a university and those in private practice . The remaining 55 referred patients (33%) were cancelled referrals; these patients were excluded from the study protocol . Over the course of 18 months, 44 patients (26% of the patients referred) had at least 1 rereferral because of rehospitalization . In total, the primary reasons for a cancelled referral were use of an alternative physician for followup (27%), inability to contact the patient (22%), and extended distance to clinic (11%). In a chisquare analysis, no baseline differences were found between the referred patients who were observed in the clinic and those who had a canceled referral . Mean age of the patients observed was 59 years old (range, 1787). The majority of patients in this hf population had multiple comorbidities, including hypertension (86%), diabetes (56%), and advanced renal disease (41%; table 1). The majority of patients (75%) had left ventricular (lv) systolic dysfunction, either with or without concomitant rightsided systolic dysfunction (table 2). Overall mean ejection fraction for the patients with lv systolic dysfunction was 24% and for those without lv systolic dysfunction was 54% . Thirtysix percent of the patients had severe right ventricular (rv) dysfunction, further signifying the advanced nature of the heart disease in this population . Of the patients observed, 47 had defibrillators; 32% were implanted, and 8% were external . For this population, the predominate form of insurance was medicare (66.7%), and most of the remaining patients were evenly divided between using medicaid (14%) and private insurance (14%). Only a small subset of patients was classified as uninsured / selfpay (7.0%). Patients were not excluded from participation if they were nonenglish speakers, because translation services were available . Cognitive limitations were also not a contraindication for participation if family members could attend the clinic with the patient . We were concerned that patients who did not attend the clinic might actually be sicker than those who did attend the clinic . However, when we compared the 2 groups, the only significant differences we identified were greater numbers of patients with hypertension and dyslipidemia in the cohort that visited the clinic, as compared to the patients who did not attend the clinic (table 1). Baseline characteristics of the patients referred to the clinic copd indicates chronic obstructive pulmonary disease; cri, chronic renal insufficiency; esrd, endstage renal disease; osa, obstructive sleep apnea; scr, serum creatinine . Heart failure characteristics of the patients who visited the clinic ef indicates ejection fraction; hfpef, heart failure with preserved ejection fraction; hfref, heart failure with reduced ejection fraction; nr, normal range; rv, right ventricular; rvsp, right ventricular systolic pressure . Assessment of new york heart association (nyha) functional classification on initial presentation to the clinic further confirmed the severity of illness in this population, with 83% of patients having nyha functional class iii symptoms or greater . Symptom class varied over the course of the 2 evaluations, as shown in table 3 . New york heart association (nyha) functional classification across visits nyha classification data unavailable for 4 patients at visit 2 . Although the patients were observed in a timely fashion after hospitalization, only 62% were euvolemic upon initial postdischarge evaluation (figure 1); thus, medication adjustments were often required at the initial visit . Volume status between visits 1 and 2 appeared to be static when assessed solely on the percentages shown . However, further evaluation showed that volume shifts occurred frequently in this postdischarge population . Between visits 1 and 2 although volume data were missing for 4 patients at visit 2, we determined that only 43% of patients remained euvolemic during the evaluation period (visits 1 and 2) without diuretic adjustments, exemplifying the need for early and repeated monitoring after hospitalization . Individual medication errors were classified as omission / commission, incorrect dosages, duplication of therapy, and nonprocurement . Noncompliance was determined based on an overall evaluation of the patient at each visit and indicated that the patient knowingly did not take a medication correctly (if procurement was not the major issue). Across both visits, the most frequent medication error was incorrect dosage, which accounted for 44% of the errors . Duplication of therapy and nonprocurement occurred less frequently and comprised 8% and 11% of the errors, respectively . Importantly, the vast majority of medication errors appeared to be related to the transition from hospital to home rather than selfaware nonadherence . The average number of medication reconciliation errors per person decreased from 2.1 at visit 1 to 0.8 at visit 2 . Medication corrections for therapy unrelated to hf were frequently necessary, with an average of 0.95 medication corrections required per visit across visits 1 and 2 . True noncompliance, meaning the patient knowingly did not follow the medication regimen, occurred for only 10% of patients and was similar between visits 1 and 2 . Medication reconciliation errors (mre) at each clinic visit . An average of 1.7 hf medications were altered per person during visit 1, whereas an average of 1.4 medications were altered during visit 2 . The medication intervention required most frequently at the clinic visits was diuretic adjustments, which were made at 46% of the exams conducted during visits 1 and 2 (table 4). Ninetyone percent of these changes involved oral diuretic adjustments alone, whereas the remaining 9% involved parenteral diuretic interventions . Parenteral therapy was delivered either in the clinic or in the home (by home health or palliative care house calls). Other frequently adjusted medications included angiotensinconverting enzyme (ace) inhibitors, angiotensin ii receptor blockers, and/or hydralazine, which were adjusted in 44% of visits . Medication titrations at each clinic visit ace indicates angiotensinconverting enzyme; arb, angiotensin ii receptor blocker; hf, heart failure; iv, intravenous administration; po, oral administration . Coordination of multidisciplinary followup care included an evaluation of the postdischarge plan and determination if additional resources were needed, with a focus on providers and ancillary services . The most frequent intervention was promoting the necessary physician followup, which occurred in 44% of visits . The nurse practitioner provided specialized coordination of additional services . In 30% of visits, either initiation or expansion of home health services was necessary . Additionally, during 12% of visits, palliative care and/or hospice services were arranged for patients with severe and persistent endoflife symptoms . We did not define strict criteria for making these referrals, but tended to refer patients who were the most socially isolated and who had the highest symptom burdens . The referring provider routinely received full progress notes that included an assessment of the hemodynamic and volume status of the patient, newly identified transitional issues that required attention, medication reconciliation reports, and any additional referrals that were made . Additionally, communications were recorded in the electronic medical record (emr) to provide continuity of care with other hospitalbased providers . Furthermore, patients were provided copies of their progress notes for their physician and allied health providers who may not have had access to the emr . In our cohort, 14 patients were readmitted at least once in the 30 days after discharge, which equates to a 12.3% allcause readmission rate . Of the 14 patients who were readmitted to the hospital within 30 days, 8 (57.14%) were readmitted primarily because of chf exacerbations, 3 (21.4%) were readmitted because of gastrointestinal bleeding, 1 (7.1%) was readmitted for management of chronic obstructive pulmonary disease (copd), 1 (7.1%) was readmitted for hemoptysis, and 1 (7.1%) was readmitted because of pacemakerrelated complications . In contrast to the readmission rate for our intervention group, the 30day allcause readmission rate for hf patients at herman memorial hospital at the texas medical center was 22.1% during the same time period (https://data.medicare.gov/data/archives//hospital-compare). Therefore, the clinic intervention resulted in a 44.3% reduction in 30day readmission rates in this group of patients during the study period, as compared to the hospital average . The direct cost for each visit was calculated to be $110.00, which included 1.5 hours of health care practitioner time (50% nurse practitioner and 50% clinical pharmacist), pointofcare testing supplies, and a medical assistant and appointment scheduler . The cost estimate in this study was fairly low because the service was established within a clinic structure that already existed . Indirect costs, such as facility fees, business overhead, and liability costs, were not included in this cost basis because these costs are highly variable between institutions and regions of the country . Assessment of new york heart association (nyha) functional classification on initial presentation to the clinic further confirmed the severity of illness in this population, with 83% of patients having nyha functional class iii symptoms or greater . Symptom class varied over the course of the 2 evaluations, as shown in table 3 . New york heart association (nyha) functional classification across visits nyha classification data unavailable for 4 patients at visit 2 . Although the patients were observed in a timely fashion after hospitalization, only 62% were euvolemic upon initial postdischarge evaluation (figure 1); thus, medication adjustments were often required at the initial visit . Volume status between visits 1 and 2 appeared to be static when assessed solely on the percentages shown . However, further evaluation showed that volume shifts occurred frequently in this postdischarge population . Between visits 1 and 2, 46% of patients showed a change in volume status . Although volume data were missing for 4 patients at visit 2, we determined that only 43% of patients remained euvolemic during the evaluation period (visits 1 and 2) without diuretic adjustments, exemplifying the need for early and repeated monitoring after hospitalization . Individual medication errors were classified as omission / commission, incorrect dosages, duplication of therapy, and nonprocurement . Noncompliance was determined based on an overall evaluation of the patient at each visit and indicated that the patient knowingly did not take a medication correctly (if procurement was not the major issue). Across both visits, the most frequent medication error was incorrect dosage, which accounted for 44% of the errors . Duplication of therapy and nonprocurement occurred less frequently and comprised 8% and 11% of the errors, respectively . Importantly, the vast majority of medication errors appeared to be related to the transition from hospital to home rather than selfaware nonadherence . The average number of medication reconciliation errors per person decreased from 2.1 at visit 1 to 0.8 at visit 2 . Medication corrections for therapy unrelated to hf were frequently necessary, with an average of 0.95 medication corrections required per visit across visits 1 and 2 . True noncompliance, meaning the patient knowingly did not follow the medication regimen, occurred for only 10% of patients and was similar between visits 1 and 2 . Medication reconciliation errors (mre) at each clinic visit . An average of 1.7 hf medications were altered per person during visit 1, whereas an average of 1.4 medications were altered during visit 2 . The medication intervention required most frequently at the clinic visits was diuretic adjustments, which were made at 46% of the exams conducted during visits 1 and 2 (table 4). Ninetyone percent of these changes involved oral diuretic adjustments alone, whereas the remaining 9% involved parenteral diuretic interventions . Parenteral therapy was delivered either in the clinic or in the home (by home health or palliative care house calls). Other frequently adjusted medications included angiotensinconverting enzyme (ace) inhibitors, angiotensin ii receptor blockers, and/or hydralazine, which were adjusted in 44% of visits . Medication titrations at each clinic visit ace indicates angiotensinconverting enzyme; arb, angiotensin ii receptor blocker; hf, heart failure; iv, intravenous administration; po, oral administration . Coordination of multidisciplinary followup care included an evaluation of the postdischarge plan and determination if additional resources were needed, with a focus on providers and ancillary services . The most frequent intervention was promoting the necessary physician followup, which occurred in 44% of visits . The nurse practitioner provided specialized coordination of additional services . In 30% of visits, either initiation or expansion of home health services additionally, during 12% of visits, palliative care and/or hospice services were arranged for patients with severe and persistent endoflife symptoms . We did not define strict criteria for making these referrals, but tended to refer patients who were the most socially isolated and who had the highest symptom burdens . The referring provider routinely received full progress notes that included an assessment of the hemodynamic and volume status of the patient, newly identified transitional issues that required attention, medication reconciliation reports, and any additional referrals that were made . Additionally, communications were recorded in the electronic medical record (emr) to provide continuity of care with other hospitalbased providers . Furthermore, patients were provided copies of their progress notes for their physician and allied health providers who may not have had access to the emr . In our cohort, 14 patients were readmitted at least once in the 30 days after discharge, which equates to a 12.3% allcause readmission rate . Of the 14 patients who were readmitted to the hospital within 30 days, 8 (57.14%) were readmitted primarily because of chf exacerbations, 3 (21.4%) were readmitted because of gastrointestinal bleeding, 1 (7.1%) was readmitted for management of chronic obstructive pulmonary disease (copd), 1 (7.1%) was readmitted for hemoptysis, and 1 (7.1%) was readmitted because of pacemakerrelated complications . In contrast to the readmission rate for our intervention group, the 30day allcause readmission rate for hf patients at herman memorial hospital at the texas medical center was 22.1% during the same time period (https://data.medicare.gov/data/archives//hospital-compare). Therefore, the clinic intervention resulted in a 44.3% reduction in 30day readmission rates in this group of patients during the study period, as compared to the hospital average . The direct cost for each visit was calculated to be $110.00, which included 1.5 hours of health care practitioner time (50% nurse practitioner and 50% clinical pharmacist), pointofcare testing supplies, and a medical assistant and appointment scheduler . The cost estimate in this study was fairly low because the service was established within a clinic structure that already existed . Indirect costs, such as facility fees, business overhead, and liability costs, were not included in this cost basis because these costs are highly variable between institutions and regions of the country . It is widely recognized that highquality postdischarge care can reduce hospital admissions and improve quality of life; some studies have even shown a mortality benefit.21, 22, 23 we found that establishing a novel, protocoldriven allied health clinic that focused on the issues that hf patients encounter as they transition from hospital to home resulted in a 44.3% reduction in 30day hospital readmissions in a sick cohort of patients . An especially important aspect of transition care is patient access to postdischarge services, and access to care very early after hospital discharge (ie, within 7 days) appears to be critical for reducing readmissions . In fact, the 7 day postdischarge visit is likely to be the single most powerful tool to prevent exacerbation of illness and readmission.18, 24 transitional care, or specialized postdischarge interventions, involves 1 or more activities that facilitate the safe, smooth, and efficient transition from one care setting to the next.20 although the hospital to home (h2h) initiative has identified key strategies to address this problem, implementing these wellintended strategies takes time, resources, and coordination and has been difficult to achieve in practice.25, 26 because the majority of hospital patients are not cured after a hospital stay, but instead go on to suffer from a constellation of chronic diseases, it is essential to have effective transitional care that takes into account the broad needs of the patient and provides the support needed in a community setting . Hospital discharges are often haphazard events . A properly coordinated discharge integrates nursing, social, pharmacologic, and hand over aspects of care . However, the pressure to discharge patients in the morning can undermine the considerable effort needed to coordinate a proper discharge . It was recently reported that of the 537 hospitals enrolled in the h2h quality improvement program, less than 25% arranged home nursing visits for patients upon discharge and less than half were using the 10 key practices identified to reduce admissions.26 highquality transitional care must include systematic communication between the hospital and postdischarge healthcare providers, patientfriendly medication reconciliation, verification that the patient has the ability to access medications after discharge, consideration of comorbidities, and education directed to patients and caregivers . Education is important and should include instructions that are easy to understand and a system to monitor for worsening signs and symptoms of hf, such as changes in daily weights, worsening shortness of breath, and swelling . It is probably best if this process is started in the inpatient setting, and then teaching can be reviewed and reinforced at subsequent visits . Posthospital care may be further complicated if the patient is elderly or has cognitive issues, poor health care literacy, transportation limitations, or limited access to followup care.3 for patients leaving the hospital with a primary or secondary diagnosis of chf, arrangements for transitional care must be both routine and systematized . There is increasing evidence that equal consideration should be given to both cardiac and noncardiac contributors to readmission because hf usually exists within a spectrum of other diseases.3 often, it is the comorbidities that drive morbidity, mortality, and hospital readmission rates in hf patients.27 there is also evidence that it is beneficial to receive followup care from a familiar provider.28 our goal for this project was to establish a routine and systematized avenue for patients to access highquality, evidencedbased postdischarge care . We specifically designed the clinic in such a way that the referring physician did not need to be concerned about losing their patient and physicians could continue to be the primary point of contact for ongoing medical issues that arose . The transition care medical director, however, acted as a back up if the referring physician was unavailable and an urgent or semiurgent issue arose . We also specifically sought to include nonenglishspeaking patients; patients with esrd and frail, elderly patients in an effort to evaluate a this helped overcome the significant reluctance of some physicians to refer patients to the new clinic . In our study population of sick, symptomatic patients with multiple comorbidities, we found that by 1 week postdischarge, one third of the patients were already having issues with blood volume . The most common issue was volume overloaded (hypervolemia, 25%); however, a significant number of patients presented with diureticrelated volume contraction (hypovolemia, 13%). This can be especially hazardous for frail, elderly patients who are at increased risk for falling . Overall, 44.7% of the patients observed at visit 1 and 40.6% of patients observed at visit 2 required diuretic adjustment, making volume control an important target for early intervention as patients transition to the home setting . As patients resume consumption of a more representative diet within the domestic environment, changes in salt and fluid intake can affect their volume status . It is clearly more difficult to control a patient's diet in this setting, given that this depends on what is available in the community and easy to prepare in the home . In total, 88 diuretic adjustments were made at visits 1 and 2 (adjustments made for 42.9% of the patients observed), indicating that maintenance of euvolemia is an important target for early intervention as patients transition to the home setting . Given that additional diuretics adjustments were required at visit 2 (46 weeks after discharge), it appears that strategies are needed for longterm volume monitoring after hospital discharge of hf patients . Patients who are treated according to modern guidelines require an average of 7 medications to manage hf, independent of the need for medications to treat other comorbidities.29 improvements in prescribing practices start with thoughtful medication reconciliation practices within the hospital.30 in theory, this should be a straightforward process: at every transition of care, a systematic and comprehensive review should occur in order to maintain an accurate prescription record, and changes should be communicated to all caregivers involved . In practice, however, this has proven to be an enormously difficult undertaking . This process is complicated by: (1) the multiple practitioners involved; (2)multiple health care electronic records that cannot crosscommunicate; (3) practitioners that do not (or cannot despite attempts) communicate with other caregivers that are treating the patient; (4) substitutions that occur in local pharmacies; (5) the complexity of insurance coverage for various medications; (6) the need for previous authorization, which can dramatically delay medication access; and (7) the burden of costs associated with medications and copays for patients taking multiple medications . These issues can be overwhelming and can be further complicated by language, literacy, and financial issues . In our study, even with extraordinarily focused efforts, discrepancies persisted . After dedicated individualize attention, we still found 0.8 medication reconciliation errors per patient at visit 2, which was, albeit, less than half of the frequency at the first visit . This underscores the fact that continual and ongoing pharmacological vigilance is warranted in populations with chronic disease . The observed persistence of medication reconciliation errors across the visits underscores the need for morefrequent medication monitoring . Furthermore, this observation supports the findings of previous studies that suggest that enhanced and longitudinal involvement of a clinical pharmacist may be critical in reducing these discrepancies.31, 32 to address this need, programs could perhaps adopt a system of weekly medication reconciliation for a specified period of time after an index hf admission . Our study also showed that not all medication errors represent patient noncompliance or nonadherence, as is often asserted by frustrated clinicians . Other factors, such as medication duplication and difficulty with procurement, were morefrequent problems . There is strong evidence in support of assisting patients with this process early; primary nonadherence (ie, not filling discharge medications) by inpatients after an acute coronary event is associated with significantly increased mortality, and secondary nonadherence (ie, not following instructions or obtaining refills) has been shown to increase mortality, hospitalization rates, and costs.33, 34, 35 medication reconciliation is an important goal that clearly needs concerted attention . This process should not be viewed merely as an accreditation game, but should be considered critical for patient safety.36 care coordination was important for this cohort.37, 38 the nurse practitioner reviewed the patient's hf diagnosis in the context of the comorbidities and made an assessment of the family situation in regard to social support . Care coordination was particularly important for the most fragile and elderly patients.11, 21, 39, 40 referrals were frequently made for cardiology, internal medicine, nephrology, wound care, and psychiatry, to name a few . For highly symptomatic patients, the nurse practitioner made referrals to home health care, palliative care, and hospice services, when appropriate . These decisions were based on the patient's functional and symptomatic status and in recognition of the need for such services for patients who were nearing the end stages of life . Inclusion of patients who were identified as highly symptomatic and in the palliative care phase of hf was likely important . In a recent large study, chun et al.41 identified a large upsurge in hospital readmissions in the last 30 to 60 days of life, with approximately 50% of hf readmissions occurring in this time frame . It is possible that appropriate identification and management of this endstage hf population, through the provision of supportive and homebased palliative nursing services, may have contributed to the reduced hospitalization rates noted in our study . In 2011, the single largest contributor to 30day allcause readmissions was hf, which accounted for 134 000 hospital readmissions totaling $1.7 billion in costs . In 2009, the mean cost of a hf admission was $13 000.42 there is a human cost to the hf readmission statistics, as well as clear societal and financial costs . When a patient leaves the hospital and then requires readmission because of a decline in his or her health, there is increased suffering and stress for the patient and the family of the patient . Furthermore, the risk of death increases progressively and independently with each subsequent hf or cardiovascular event.43, 44 each time a patient bounces back to the hospital for additional care, there is a significant increase in the risk of death . Recently, a detailed analysis of readmission data from 2228 hospitals showed that penalties accrued by 1636 hospitals were strongly related to excessive hf readmission rates . The researchers concluded that initiatives to reduce admission rates should specifically target hf readmissions.45 for hospitals that are operating on increasingly tight financial margins and are now subjected to penalties for excessive readmissions, the clear imperative is penalty avoidance . However, there may be an intrinsic conflict of interest for hospitals because readmissions represent increased volume that may contribute to the hospital's income stream . For society, the genuine question is how to provide access and effectively deliver highquality care that alleviates suffering at an affordable cost . We have demonstrated that an allied health care team consisting of a nurse practitioner specializing in hf and a clinical pharmacist can effectively deliver specialized postdischarge care by using protocols developed by a hf cardiologist . We showed that this care delivery model reduced 30day allcause hospital readmission rates, even exceeding the reduction rates shown for other postdischarge management programs, which have been up to 25%.9 this study shows that an allied health postdischarge clinic can provide a valuable service to patients and physicians that will not interfere with the physicianpatient relationship . Furthermore, if such care were to be offered routinely and systematically, this model could offer a means to improve the random and haphazard discharge care that is currently the normative standard at most hospitals . The protocols developed in this study could also potentially be modified for homebased services in order to accommodate patients who are physically unable to attend the clinic . Also, we did not compare our readmission rates to a control group, but rather to the overall hf readmission rates derived from the same hospital during the same period of time; therefore, the patient groups compared may have differed . Furthermore, we were unable to collect clinical data on patients who were referred but subsequently did not attend the clinic visits; thus, we could not determine whether this group represented a different population than those in our study who did attend the clinic . Homebased interventions were not available to meet the needs of patients who did not attend the clinic because of homebound status or lack of transportation . Additionally, patients were observed on a referral basis, which could have biased the composition of the sample . The patient group that attended the clinic appeared to be motivated to the extent that they made the time to visit the clinic; therefore, data from our cohort may have underestimated medical noncompliance in the total hf population . Further study is warranted to determine whether implementation of this postdischarge care can improve quality of life or be further expanded to other populations known to be at high risk for readmission, such as those admitted for acute coronary syndrome or pneumonia . Finally, we referred select highrisk patients to outpatient home palliative care, which may have affected our results as well . This aspect needs further study in order to assess the impact on readmission rates and overall quality of life for patients living with advanced or endstage disease . In this study, a specialized postdischarge clinic staffed by a clinical pharmacist and a nurse practitioner specializing in hf used protocols developed by a hf cardiologist, including clinic visits at 1 and 4 to 6 weeks postdischarge, to reduce readmission rates for hf patients . The resulting reduction in 30day readmission rates observed for patients who received the protocoldriven transition care (44.3%) exceeded that reported for previous postdischarge management programs . Thus, by providing a systematized, protocoldriven strategy administered by highly skilled allied health professionals, we were able to address the needs of this population directly and respond to patients individually . Furthermore, by using this strategy, which focused on patient education, maintaining euvolemic status, and reducing medication nonadherence, we provided a service to physicians and their patients that did not interfere with their private physicianpatient relationships . This service, which was performed at a very low cost to the hospital, catered specifically to the postdischarge population; therefore, competition for appointments was never an issue, as it typically is in heavily scheduled primary care clinics or specialists offices . Relief valve for patients who had not selected a primary caregiver or who had issues with access to care, giving patients more time to find appropriate primary care.
|
Viruses are the most abundant and diverse biological entities in the biosphere, and their global numbers have been estimated at 1.2 10 and 2.6 10 in the ocean and soil, respectively . Thus, viruses are key elements that contribute to the life cycles of cellular organisms . However, the study of viral ecology in natural habitats has been limited due to the difficulties of viral culture . The lack of a ubiquitous marker gene, such as the 16s rrna gene shared by all bacteria and archaea, also hampered our understanding of the genetic diversity of viruses, prior to the introduction of metagenomics into the field of viral ecology [1, 4]. Recently, viral metagenomics has enabled researchers to explore the community structure and diversity of viruses in various natural ecosystems . This methodology depends on a priori knowledge of the viral types that may be present [6, 7]. The first viral metagenome of uncultured marine viral communities was published in 2002, and there have been many subsequent advances in the methodologies (e.g., methods for amplifying the initial viral genomes) and tools used for bioinformatics analysis in viral metagenomics . These technical developments have facilitated explorations of the abundance and diversity of viruses from a wide range of natural habitats in korea . In korea, viral metagenomics was applied for the first time to unique samples, including fermented foods and atmospheric samples, as well as habitats where viruses are expected to have significant roles, such as rice paddy soil, seawater, and the human gut . This review describes recent advances in viral metagenomics and provides summaries of studies that have been conducted to characterize korean viral metagenomes . In addition, the advantages and disadvantages of the most widely used viral dna amplification methods are discussed, based on empirical knowledge . Viral metagenomics is the study of viral metagenomes (known as viromes), which are obtained directly from environmental samples using viral particle purification and shotgun sequencing . Viral metagenomic studies have increased gradually since the expansion of metagenomic approaches to viral ecology; i.e., over 200 (61 reviews) investigations of the viral communities in environmental samples have been published (fig . 1) [8 - 13]. In 2002, breitbart et al . Used shotgun library sequencing and reported that the majority of the sequences in marine viral metagenomes shared no similarity with any genes in public databases, which suggested that most environmental viruses remained uncharacterized . Subsequently, many studies have surveyed the viral diversity of unexplored habitats using viral metagenomics . Cultivation in a host is usually necessary to obtain a virus from the environment that is being investigated . However, the application of metagenomics techniques based on genetic information can circumvent this obstacle . Based on the physical characteristics of virions, viral particles can be isolated from environmental samples, which are enriched using a combination of size filtration (e.g., <0.22 m) and density gradient centrifugation (e.g., 1.35 - 1.5 g / ml cesium chloride), so that the virome can be obtained from the purified viral particles . There is a lack of evolutionarily conserved genes, such as the prokaryotic 16s ribosomal rna gene, in viral genomes . Therefore, the fragmented viral metagenomic sequences obtained by whole - genome shotgun dna sequencing are used to analyze the viral ecology instead . Viral genomes are small (on average, they comprise a few to several dozen kilobases); so, valuable genome coverage can be achieved easily by dna sequencing . The advent of high - throughput sequencing techniques, such as 454 pyrosequencing and illumina sequencing, makes it easier to achieve suitable genome coverage at low cost . Indeed, over 90 of either nearly complete or complete novel viral genomes were assembled using these methods in recent studies [9, 10, 15 - 20]. However, it is inevitable that an amplification step is necessary for small viral genomes prior to dna sequencing . Linker amplified shotgun library (lasl) and multiple displacement amplification (mda) are the main methods used to amplify viromes in viral metagenomics . The application of adapter attachment is restricted to double - stranded dna sequences; so, only double - stranded dna (dsdna) viruses can be detected using the lasl method . Thus, the dominance of dsdna tailed bacteriophages was reported initially in uncultured marine viral assemblages, as well as other environmental samples, such as kimchi, aquatic water, and feces . The mda technique amplifies dna isothermally using the phi29 polymerase and random hexaprimers and has been used before in microbiology . The high amplification efficiency of this method means that it is suitable for amplification during viral metagenomics applications . Particularly, the phi29 polymerase of the mda technique selectively amplifies circular genomes (estimated at 100 times), and it has facilitated the discovery of abundant single - stranded dna and rna viruses in environmental samples [23, 24] (described in detail below). The analysis of viral metagenome data using bioinformatics is one of the most challenging aspects of viral metagenomics . One million to 1 billion reads of viral metagenomic sequences are typically generated by high - throughput sequencing platforms (with an average read length of 350 - 400 bp using 454 gs - flx titanium and 2 150 bp using illumina hiseq 2500). After removing any low - quality, redundant, and chimeric sequences, the viral sequences are compared to sequences in public databases (e.g., the genbank non - redundant nucleotide database, mg - rast, and camera) using blast or usearch . The identification of viral sequences based on significant amino acid similarity (e - value of <10) was first described by breitbart et al ., and it has since been extended to the exploration of environmental viromes, although the e - score applied to viral metagenomic studies appears to be regarded as " a loose standard " . Most of the environmental viromes detected by viral metagenomics are defined as orphan (unassigned) sequences . The majority of viral sequences shares no amino acid similarity with previously observed genes (average 40% to 50%, occasionally up to 90%, of sequences); so, they are characterized as " unknown " . Comparisons of viral sequences with the data in public databases have demonstrated that little is known about environmental viruses . Thus, the majority of the unassigned sequences in viral metagenomes is often regarded as " junk sequences " due to a lack of suitable bioinformatics tools and viral databases for their characterization [1, 28]. At present, the viral databases are biased toward animal and plant viruses, although viruses that infect prokaryotes (bacteriophages) are sparsely represented . Most of the latter are restricted to phages that infect bacteria belonging to the phyla proteobacteria, firmicutes, and actinobacteria [29, 30]. Moreover, even " known " viral sequences share low amino acid similarities (<50%) with viral protein sequences [9, 11, 13, 31]; so, the majority of environmental viruses representing novel viral species and their viral diversity is much greater than considered previously . The observation of a high percentage of orfans (open reading frames with no homologs in known genes in the databases) in viral genomes also supports the novelty of environmental viromes . Thus, researchers could discover novel viruses in orphan sequence pools that currently remain " untapped resources . " These findings indicate our current lack of knowledge about viral genetic information and emphasize the need for physiological studies of viruses to understand viral ecology based on genomic data . Using viral metagenomic approaches, viral diversity and abundance have been investigated in various natural ecosystems in korea, including rice paddy soil, fermented foods, the human gut, seawater, and the near - surface atmosphere (table 1). 2). Sipho- and podo - like tailed viruses were found in fermented foods (fig . 2a-2c), while non - tailed small viruses were detected in the near - surface atmosphere (fig . Various types of tailed, non - tailed, circular, and long linear viruses were found in the human gut (fig . In general, the virions ranged in size from 30 to 60 nm . In agreement with the results of previous viral metagenomic studies [23, 31], over half of the sequences in the korean environmental viromes were described as orphan sequences, based on comparisons with viral proteins in public databases (table 1). Most of the sequences identified were assigned to the siphoviridae, podoviridae, and myoviridae families of dsdna viruses and the circoviridae, germiniviridae, nanoviridae, and microviridae families of ssdna viruses (fig . The first viral metagenomic study in korea surveyed uncultured viral assemblages in rice paddy soil in 2008, where mda was used with phi29 dna poly merase and random hexaprimers to amplify viral dna and to construct clone libraries for metagenome sequencing . The soil was found to contain a rich pool of unknown ssdna viruses and dsdna viruses . This study also focused on the effect of mda amplification on different types of genomic dna and showed that mda preferentially amplified circular dna genomes . This was also demonstrated using an environmental sample from surface seawater, where dsdna viruses alone were retrieved in the lasl library, whereas ssdna viruses were overwhelmingly represented in the mda library . Thus, the amplification methods used in viral metagenomics can affect the ratios of viral sequences greatly and lead to inaccurate estimates of viral diversity . Next, park et al . Investigated the abundance and diversity of uncultured viral assemblages in fermented shrimp, kimchi, and sauerkraut - fermented foods that have been consumed for a long time around the world . In contrast to the soil virome, dsdna bacteriophages from the families myoviridae, podoviridae, and siphoviridae dominated the fermented foods, and they contained a low complexity of viral assemblages compared with other environmental habitats, such as seawater, human feces, marine sediment, and soil . However, it is possible that the viral diversity of the viromes detected in fermented foods may have been constrained to dsdna viruses by the lasl method . A large number of unknown microbes, such as bacteria, archaea, microbial eukarya, and viruses, constitute up to 10 bacteria per gram of feces in the human gastrointestinal tract, and it is expected that gut viruses will affect the relationships among viruses, bacteria, and gut epithelial cells . Kim et al . Investigated the abundance and diversity of dna viruses in fecal samples from five healthy koreans, particularly ssdna viruses . Using epifluorescence microscopy with sybr gold staining, the viral abundance ranged from 10 to 10 per gram of feces, which was 10-fold less than the bacterial abundance in many other environments that harbored 10 - 100-fold more viruses (e.g., aquatic environments). Moreover, the diversity of gut viral assemblages was lower than that of gut bacteria . Who found that viral - microbial interactions in the human intestine could not be described as a predator - prey relationship, and instead, it was referred to as " kill the winner, " which was driven by a lytic life cycle . Airborne viruses are now regarded as major environmental risk factors for complex disease pathogenesis [36 - 38]. However, the atmosphere remains " one of the last frontiers of biological exploration on earth " . Using viral metagenomics with an advanced airborne particle sampling system, whon et al . Conducted the first study of the diversity and community composition of airborne viruses in the near - surface atmosphere . The viral abundance in the atmosphere exhibited seasonal changes (increasing from autumn to winter before decreasing until spring) in the range of 10 to 10 viruses per m, and the temporal variations in viral abundance were inversely correlated with seasonal changes in temperature and absolute humidity . Plant - associated ssdna geminivirus - related viruses and animal - infecting circoviruses dominated the viral assemblages, with low numbers of nanoviruses and microphages in air viromes, which suggests that airborne viral assemblages are affected greatly by terrestrial plants and animal activities . Thus, the compositions of the viral assemblages detected in fermented foods and marine samples are biased toward dsdna viruses, such as sipho-, podo-, and myophages, when the lasl method is used, whereas the viral assemblages detected in rice paddy soil, human gut, marine, and near - surface atmosphere samples contain high proportions of ssdna viral sequences, due to the use of mda, as shown in fig ., the compositions of the viral assemblages characterized in korean environments tend to depend on their specific microbial features . The human gastrointestinal tract and fermented foods are exposed to massive numbers of gut bacteria and lactic acid bacteria, respectively [39 - 41]. By contrast, the atmosphere contains far less cellular metabolism and reproductive activity than other environments, such as the soil, seawater, fermented foods, and the human gut . On this basis, the lowest abundance of eukaryotic viruses was observed in the viral assemblages in the human gut and fermented foods, whereas a high abundance of eukaryotic viruses was detected in the near - surface atmosphere . High levels of prokaryote and eukaryote cells are present in rice paddy soil and seawater, and so, comparable amounts of bacteriophages and eukaryotic viruses were detected in their viromes . The development of viral metagenomics has facilitated the discovery of novel, previously undescribed viral species . An artifact of the mda method is that it selectively amplifies the circular genomes of ssdna viruses, so that a large number of ssdna viral sequences have been identified in environmental viromes . Thus, there is great interest in the distribution and host range of ssdna viruses . In particular, microphages from the family microviridae have been identified in a wide range of environments [13, 45, 46]. In contrast to the ecology of marine dsdna phages, marine ssdna phages in the family microviridae have distinct spatial and temporal distributions . Ssdna microphages were abundant in the healthy human gut and their genotypes were much more diverse than those reported previously . Moreover, prophage - like elements in the genomes of gut microbes, such as bacteroides and prevotella spp ., were characterized as a novel subgroup in the family microviridae [13, 47], while viral sequences from the human gut were clustered with prophage - like elements from bacteroides and prevotella spp . . Eukaryotic ssdna viruses that infect plants and mammals have been identified in many environmental viromes . Circoviruses that are known to infect birds and pigs have also been identified in the viromes of invertebrates and a fish [48, 49], while geminiviruses that cause plant diseases have been detected in whiteflies, which act as insect vectors of plant viruses . A recent study by whon et al . Investigated airborne dna viral assemblages in near - surface atmosphere samples and showed that a high number of viruses (log 6 to 7 viruses per m) were present in the air, which were dominated by geminivirus - related viruses ., sclerotinia sclerotiorum hypovirulence - associated dna virus 1-which indicates that the airborne viral assemblages in the near - surface atmosphere may have strong interactions with plants . These results highlight the extensive distribution of ssdna viruses in a wide range of environments, and their host ranges may be wider than previously recognized . Thus, the discovery of novel genomes of ssdna viral families in metagenomic studies could revolutionize our knowledge of the ecology and evolution of ssdna viruses . In the last decade, viral ecologists have focused on community - level analyses of viruses to understand their abundance and genetic diversity in specific environments . The ecological effects of viruses, particularly bacteriophages, are known to control host populations via the " kill the winner system, " while they drive mortality and evolutionary change in microorganisms via lateral gene transfer by infecting their host bacteria, although the basic issue of " who infects whom " is poorly understood [2, 29, 51, 52]. In the ocean, for example, viruses regulate the microbial abundance, release dissolved organic matter, and affect global biogeochemical cycles by killing up to 40% of host bacteria per day [53, 54]. In contrast, symbiotic functions of viruses, such as host survival, competition, and protection from pathogenic infections, are beginning to be understood, and evidence for a beneficial interaction in phage - host interactions was found in the mammalian gut ecosystem [29, 56]. When host survival is threatened, a variety of environmental factors can trigger prophage induction, and the liberated prophages may become completely virulent . Overall, these studies suggest that prophage induction may responsible for triggering dysbiosis and changes in the microbial population by altering host phenotypes, thereby leading to a new environmental niche . Traditionally, host culture - dependent techniques, such as plaque assays, have been widely used for the identification of phage and host bacteria interactions . However, plaque assays require isolated host bacteria; so, they are low - throughput methods . This method is also difficult to apply to environmental samples where lysogenic infections are prevalent, because the method relies on observations of visible plaque formations, which are often absent from lysogenic infections [3, 58, 59]. Recently, deng et al . Demonstrated a new technique, known as " viral tagging, " for identifying the interactions between cultivated host bacteria and their phages, which used the nucleic acid stain sybr gold to generate fluorescently labeled phages, so that the host cells fluoresced with viral tagging, thereby allowing the sorting of virus - tagged cells by flow cytometry [52, 60]. This emerging technique is undoubtedly helpful for not only exploring virus - host interactions in their natural habitats when the method is combined with other experimental tools, such as single viral genomics and phagefish, but also identifying viral receptors in macro - organisms (e.g., the mammalian gut) if the method is combined with a fluorescently labeled receptor protein during histological examinations . The emergence of viral metagenomics has facilitated advances in virology and allowed us to understand novel aspects of viral ecology . At present, viral metagenomics is a powerful and sensitive technique for detecting viruses that cannot be identified by traditional culture- and sequence - based approaches . Most importantly, viral metagenomics suggests that novel viruses interact constantly with the human population . Thus, viral metagenomics can facilitate the improved surveillance of viral pathogens in the fields of public health and food security . This technique can be used to understand viral ecology by exploring the environmental viromes that are generated by viral metagenomics.
|
Postoperative cognitive dysfunction (pocd) is the deterioration of cognitive function, especially learning and memory, which may last for days, months, or even years [13]. Pocd occurs after cardiac and noncardiac surgeries and increases first - year morbidity and mortality after surgery [46]. There is no doubt that aged individuals are more likely to develop pocd [79]. Maze's group demonstrated that learning and memory were impaired after anesthesia and surgery in 3 - 4-month - old mice . . Demonstrated that there were no signs of neuroinflammation or cognition impairment after surgery in adult mice (46-month - old). Similarly, wuri et al . Observed no learning or memory changes after partial hepatectomy in adult mice (4-month - old). According to the work of finlay and darlington, mice after two months accordingly, 36-month - old mice and 2-month - old mice are biologically equivalent to 3040-year - old human and college freshmen, respectively . While maze's group investigated the learning and memory after anesthesia and surgery in 3 - 4-month - old mice, no data in younger adult mice, that is, 2-month - old, are available . Unfortunately, this is an age at which particular diseases will arise and may need surgeries, such as appendicitis, osteosarcoma, and leukemia . In the present study, we investigated whether the spatial reference memory of 2-month - old mice will be affected after anesthesia and surgery . This study was approved by the animal care and use committee of shanghai jiao tong university, school of medicine . All animal procedures were performed in accordance with the national institutes of health (nih) animal care guidelines . Two - month - old male c57bl/6j mice were provided by the animal research center of shanghai jiaotong university, school of medicine . The animals were housed in standard cages under controlled laboratory conditions (temperature of 22 2c, 12-hour light/12-hour dark cycle) with free access to regular rodent pellets and water . All mice were allowed to adapt to their new environment for 7 days before beginning the experiments . Mice were randomly divided into three groups: nave group, anesthesia group, and surgery group . Splenectomy was performed with neuroleptic anesthesia (intraperitoneal injection of 200 g / kg fentanyl and 10 mg / kg droperidol, as reported previously [15, 16]) in the surgery group . For the splenectomy, a small incision was made in the left upper abdominal quadrant, and the spleen was mobilized, isolated, and removed . A single dose of butorphanol (0.4 mg / kg, s.c .) Was administered for postoperative analgesia at the end of surgery . Spatial reference memory was evaluated in the mwm using a computerized video tracking system (days 37 and days 6266 in figure 1, n = 15). The reference memory test was performed on four days (days 36 and days 6265 in figure 1). For the reference memory, briefly, a hidden round platform was placed 1 cm below the water surface and located in the center of the northeast quadrant in a circular pool (110 cm in diameter and 30 cm in depth). The water was maintained at 2325c, and the pool was situated in a room with visual cues . In all the trials, each mouse was released into the water facing the pool wall from one of four separate quadrants and allowed to swim until it landed on the platform . Once the mouse found the platform, the trial was terminated, and the mouse was allowed to stay on the platform for 15 s. if the mouse failed to find the platform within 60 s, it was gently guided to the platform and allowed to remain on the platform for 15 s. four trials were conducted per day, separated by a 5-minute intertrial interval, and the platform remained at the same location throughout the test . The amount of time spent finding and mounting the platform (escape latency) and the swimming speed were calculated from the recorded videos using mwm software (shanghai jiliang software technology co. ltd ., china). The probe test was performed on the day after the reference memory test (day 7 and day 66 in figure 1). In this test, the platform was absent, and the animals were allowed to swim freely for 60 s, starting from the quadrant opposite the platform . Seven days or 66 days after surgery (day 8 and day 67 in figure 1, n = 15), the avoidance learning task was performed as previously described [17, 18] in a y - maze equipped with electric grids in the floor . The grids were controlled by a computer, and a camera on the top of the y - maze recorded and provided the position of the animals to the computer . The animals had to leave the start arm within 5 seconds and escape into the correct arm to avoid foot shocks . Active avoidance errors were recorded if the animals did not leave the start arm within 5 seconds . If the mouse chose the foot shocks were administered for 7 seconds each until the animals chose the correct arm . The foot shock level was changed individually (maximum: 40 v) according to the performance of the mouse in the first trial or until the mouse suddenly lifted one or two paws from the grid at the bottom of the y - maze after the shock . One trial per minute was performed until the mouse reached the final criterion of correctly performing seven out of eight consecutive trials . In order to avoid odor confounding, the numbers of total trials, active avoidance errors, and discrimination errors were recorded . Mice in each group were sacrificed 2 h, 6 h, 24 h, and 48 h after surgery . Hippocampus dissections were performed on ice - cold frosted glass, and tissues were quickly frozen in liquid nitrogen . The mouse hippocampus was homogenized in sterile 0.1 m pbs containing a complete protease inhibitor cocktail (roche). The homogenates were centrifuged at 10,000 rpm for 15 min at 4c, and the supernatants were analyzed for il-1 and il-6 using elisa kit (r&d systems, minneapolis, mn). The protein concentrations of all samples were measured using a bca protein assay kit (pierce). For immunohistochemical analysis of microglia, all mice (n = 4) were deeply anesthetized using equithesin [1% pentobarbital/4% (v / v) chloral hydrate; 3.5 ml / kg, i.p .] And perfused intracardially with saline followed by 4% paraformaldehyde in 0.1 m phosphate buffer (pb, ph 7.4). Brains were then harvested, postfixed in the same fixative for 4 hours at 4c, and immersed in 1030% gradient sucrose in pb for 2448 hours at 4c for cryoprotection . Brain tissue was freeze - mounted in oct embedding medium, and 16 m thick coronal sections of hippocampus were cut sequentially and mounted on superfrost plus slides . Slices were permeabilized in 0.4% triton x-100, blocked with 5% bovine serum albumin in 0.1% triton x-100, and incubated overnight at 4c with mouse anti - cd11b (abcam, cambridge, uk, 1: 100). After rinsing in 0.1% triton x-100 in pbs, sections were incubated with secondary antibodies conjugated with alexa fluor 488 (1: 500; invitrogen; paisley, uk) for 1 hour in the dark . All the procedures for negative controls were processed in the same manner except omitting primary antibody . The statistical package for the social sciences (spss) v.20.0 was used for the statistical analyses . Two - way anova with repeated measures was used to analyze the water maze escape latency and average speed . One - way anova was used for the probe quadrant trial data, avoidance learning task data, and the il-1 and il-6, followed by post hoc bonferroni correction . Upregulation of these two cytokines was observed at 6 hours after surgery and decreased again by 24 hours postoperatively (figures 2(a) and 2(b)). Anesthesia per se did not affect the level of il-1 or il-6 at any time point compared with the nave controls . Cd11b immunostaining showed that very few microglia were activated in the hippocampus from mice of nave or anesthesia groups (figure 3). On the contrary, surgery profoundly induced microglia activation in the hippocampus, which was intensive at 6 and 24 hours after surgery but started to decline by 48 hours (figure 3). The results of the morris water maze performed two days and two months after surgery revealed no differences among the three groups in latency, swimming speed, or swimming time in the target quadrant during the probe test (figures 4 and 5). Similarly, no significant differences were observed in the results of the avoidance learning task in the y - maze, regardless of the number of learning trials, avoidance errors, or discrimination errors or voltage (figures 4 and 5). We demonstrated in the present study that (a) anesthesia and surgery but not anesthesia only temporally increased hippocampal il-1 and il-6, as well as microglia activation in the hippocampus in 2-month - old young adult mice and that (b) anesthesia and surgery cannot hurt the short - term and long - term reference memory of such aged mice . These findings indicate that central inflammation induced by surgery does not necessarily lead to reference memory impairment in young adult mice . Our present results are consistent with previous studies demonstrating that neuroinflammation can be induced by surgery . . Demonstrated that the concentration of il-6 in cerebrospinal fluid significantly increased 1 week after cardiac surgery . [11, 20, 21] demonstrated that serum tnf- induced by surgery disturbed the blood - brain barrier (bbb), which then stimulated macrophage migration into the hippocampus and promoted hippocampal neuroinflammation . We assume that the increases of il-1 and il-6 in hippocampus after surgery in the present study may arise through the same pathway, but more studies are needed to confirm the assumption in the young adult mice . Other proinflammatory cytokines may also be involved in the development of pocd in aged animals . Ma et al . Demonstrated that tnf-, il-1, il-4, and il-6 in the hippocampus increased after surgery and the tnf- receptor antagonist attenuated the elevation of these cytokines . Wang et al . Found that the hippocampal il-1, tnf-, and ifn- were overexpressed after surgery in aged mice . . Demonstrated that the hippocampal il-6, il-12, and il1 increased after surgery in aged rats . More studies should be done to investigate whether such proinflammatory cytokines changed after surgery in young adult animals . However, the neuroinflammation detected in the current study is insufficient to cause learning or memory impairment in such young adult mice, as we did not observe any short- or long - term changes in these aspects after surgery . We postulate that this is because the immune system in young adult mice is very strong so that the anti - inflammatory pathways, such as the vagus nerve pathway, are rapidly activated to reduce the inflammation . In many previous experiments reporting impaired learning or memory ability after surgery, at least one other contributing factor exists . For example, fidalgo et al . Observed impaired learning and memory after surgery in adult mice when they were simultaneously infected with lps (50 ng / kg, a subclinical dose). The surgery - induced learning and memory impairment demonstrated by he et al ., wan et al ., and cao et al . Together, results from current and previous findings all indicate that other factors, such as old age or subclinical infection, are required so that the neuroinflammation induced by surgery would be deleterious enough to alter spatial reference memory in mice . Morris water maze and active avoidance test were used in the present study to measure the spatial reference memory changes after anesthesia and surgery . Spatial reference memory is the ability to remember the relevance of spaces, which is a relative long - term memory compared with working memory . Working memory is a limited capacity that is responsible for the transient holding, processing, and manipulation of information, which is a relative short - term memory . More studies should be done to investigate the changes of working memory after anesthesia and surgery . Age is probably one of the key determinants of the responses to anesthesia and surgery . As most previous studies utilized 46-month - old mice [15, 20, 21, 30], the present study used for the first time two - month - old mice, which are biologically equivalent to 18-year - old human . Differences in ages among our study and previous studies are very possibly the reason for the different behavior tests results . Since the spleen is an immunoregulatory organ and splenectomy may deteriorate the immunological system and therefore lead to an exaggerated inflammatory status, we are unable to rule out the possibility that the absence of spleen also contributed to the development of neuroinflammation . Other surgical procedures are needed to further determine the role of surgical trauma in the neuroinflammation and the following learning and memory changes . Anesthesia and surgery lead to neuroinflammation . However, such neuroinflammation is insufficient to impair the spatial reference memory of young adult mice.
|
This situation seems to get worsened with use of combination of anti - diabetic drugs . The american diabetes association defines the hypoglycemia as any abnormally low plasma glucose concentration that exposes the subject to potential harm, and proposes a threshold of <70 mg% . The spectrum of symptoms depends on duration and severity of hypoglycemia and varies from autonomic activation to behavioral changes to altered cognitive function to seizures or coma . The short and long - term complications include neurologic damage, trauma, cardiovascular events and death . There can be a six fold higher incidence of death, increased costs of medical care, and loss of productivity due to hypoglycemia . Apart from patient - related factors like lifestyle and comorbid conditions of the patients, various other factors like choice, dose, timing and combination of anti - diabetic drugs together with simultaneous use of other interacting drugs can increase the risk of hypoglycemia in diabetics . Some studies have been conducted to evaluate the knowledge and awareness about hypoglycemia in diabetics . But in this study we have tried to evaluate how successful can diabetic education prove to be in improving the awareness of hypoglycemia and the practices adopted by the diabetics for its prevention . This would be helpful in formulating certain strategies that can keep a check on this common complication of diabetes treatment . The diabetic patients attending out - door facility of the hospital and who were being treated with oral hypoglycemic drugs were included in the study after obtaining their written informed consent . Some important demographic characteristics of the patients like age, gender, education level were studied . The questionnaire was given in hindi for easy comprehension of the patients and their attendants . They were then prior asked for ability to read and comprehend the questionnaire . In the case of illiterate patients and attendants, the questionnaire had 20 questions to assess the knowledge (7), attitude (7) and practices (6) (kap) of the diabetic patients toward prevention of hypoglycemia . The knowledge part of the questionnaire was to assess the knowledge of the possibility of hypoglycemic episodes in the diabetic patients and its common symptoms . The questions asked from the patients to judge his knowledge aspect are given in table 1 . Attitude part of the questionnaire was to evaluate the beliefs of the patient regarding simple preventive measures for avoiding hypoglycemia . The practice part of the questionnaire was to judge how the knowledge and attitudes of the patients are practically put into action . Each correct response was given a score of one and each wrong answer or unsure response was given a score of zero . Seven questions from stanford questionnaire were also included in the performa to check the incidence of hypoglycemic symptoms in the patients in the past 1-week . The symptoms enquired were morning headaches, nightmares, night sweats, light headedness, shakiness or weakness, intense hunger and passing out episodes . The maximum possible score for each of the observed parameter was seven except for practices parameter where the maximum score was 6 . After filling the performa, the diabetic patients and their attendants were educated by the treating doctor regarding possibility of hypoglycemia as a complication of diabetes treatment, its consequences, common hypoglycemic symptoms and some simple precautions to be taken to avoid its occurrence . Patients were also advised to adopt the practice of self - monitoring of blood glucose . The patients were followed up after a month and again given the same kap questionnaire to check for improvement in their kap toward hypoglycemia . The incidence of hypoglycemic episodes in the last 1-week was again checked with the help of stanford questionnaire . The baseline scores and the follow - up scores were compared by paired t - test to assess the effect of diabetes care education on prevention of hypoglycemic episodes and improvements in kap of diabetic patients toward hypoglycemia . Out of 137 patients who were given questionnaire, only 109 patients were included for the final analysis . Rest of the patients were lost to follow - up . Out of these 109 patients, the mean age of the patients at the time of inclusion in the study is 53.8 1.1 years . Demographic characteristics of the patients the mean baseline scores and postdiabetic education scores for each parameter like kap and hypoglycemic symptoms are summarized in table 3 . It is evident that there is a significant (p <0.001) improvement in the kap of diabetics after diabetic education . Mean baseline scores and scores after diabetic education the percentage of patients responding correctly to each individual question of each parameter is indicated in [figures 1 - 3]. Frequency distribution of diabetics according to their knowledge of hypoglycemia frequency distribution of diabetics according to their attitude toward hypoglycemia prevention frequency distribution of diabetics according to their self - reported practices frequency distribution of diabetics according to their hypoglycemic symptoms there is a big lacuna in the existing knowledge and attitude regarding hypoglycemia in diabetics . Although many patients give importance to timely intake of meals and medicines, but the attitude toward other parameters like self - monitoring of blood glucose, keeping toffees or candies for an emergency situation and avoiding excessive exercises is largely lacking . With regard to practices, the situation is even worse . Many patients who had good knowledge and beliefs about hypoglycemia did not still put it into practice . Apart from a lack of awareness, forgetfulness and busy job schedule of the patients were the most common reasons, which did not allow a large number of patients to be self - disciplined regarding timely intake of meals and medicines . Among the patients who knew about the importance of self - monitoring of blood glucose levels, many were not able to implement it due to lack of resources and education . Many patients suffered from hypoglycemic symptoms in the past 1-week, as judged by the stanford questionnaire . Out of all the symptoms, weakness, shakiness, and intense hunger were most frequently complained of . With diabetic education, there is a significant improvement both in knowledge and attitude of the patients . A significant number of patients now know about the possibility of hypoglycemia in diabetics and the dangerous nature of hypoglycemic episodes . A lot of patients have started believing in the importance of knowing about the hypoglycemic symptoms so as to prevent them . Although there is an improvement in the practices of the patient also but it was not equivalent to the improvement in knowledge and attitude of the patients . Best - followed practices were regular and timely intake of meals and medicines . A large number of patients also started paying attention to warning episodes of hypoglycemia . But, unfortunately, the practice of self - monitoring of blood glucose and keeping toffees and candies as an emergency measure was least commonly followed . Although there has been a significant decrease in the overall hypoglycemic symptom score (stanford score) after diabetic education, but the complaint of night sweats and light headedness did not decrease even after diabetic education . The decrease in overall hypoglycemic symptom score is due to less hypoglycemic episodes seen in the patients and is indicative of the good influence of diabetic education on the patients . Thus, proper diabetic education provides us with a ray of hope of improving the knowledge and attitude of the patients and decreasing the hypoglycemic episodes in diabetics . But one of the major challenges in the way of diabetic education is busy time schedule of the doctors that does not allow adequate time for their interaction with the patients . Low literacy level of the patients and their attendants leading onto incomplete interpretation of the instructions is another major problem . Many of the patients tend to forget the advices given by the health care providers, but this problem may largely be overcome by repeated health education and motivation . The hypoglycemic symptoms as judged by stanford questionnaire were not backed up with biochemical confirmation . Recall bias was another limitation of the study as the answers to the questionnaire were largely subjected to patient's memory . Only one session of diabetic education was given to the patients before their next evaluation . Proper diabetic education of diabetic patients can prove to be very valuable tool for prevention of hypoglycemia . But the important hurdles in its way are busy and hectic schedule of health care providers, low literacy level and forgetfulness of the patients and their attendants, busy jobs of some of the patients and their low socio - economic levels . In spite of these obstacles, repeated and regular education, motivation and encouragement of the patients cannot only improve the knowledge of the patients but also reduce the gap between knowledge and practices.
|
For the past 50 years disulfiram is the commonly prescribed drug for the treatment of alcohol dependence . Important side effects of disulfiram are hepatological, dermatological, neurological (polyneuritis, encephalopathy)1,2) and psychiatric in nature . Psychiatric manifestations include confusion, loss of memory, psychosis,36) mania with psychotic symptoms.7,8) disulfiram s major metabolite diethyldithiocarbamate is an inhibitor of dopamine - betahydroxylase (dbh), an enzyme that catalyzes the metabolism of dopamine (da) to norepinephrine (ne).9) by inhibiting this metabolic pathway from da to ne in the central nervous system, disulfiram results in an increase of da concentrations in mesolimbic system resulting in psychosis . Alcoholics who developed psychotic symptoms during disulfiram treatment are found to have low levels of amine and monoamine oxidase, suggesting dbh blockage.10) we present a case of 32-year - old male who developed psychosis with the use of disulfiram . A 32-year - old male without past of psychiatric and neurological illness reported to psychiatry outpatient department with complaint of daily alcohol intake of 250750 ml (40% alcohol by volume) for the last 5 years . With the informed consent of the patient, disulfiram was administered at the dosage of 250 mg twice daily for 1 month, while the patient abstained from alcohol . Then the patient presented complaint of fearfulness, suspiciousness, easy irritability, muttering to self, decreased sleep for last one month . Haematological and biochemical indices were within normal limits . On mental status examination delusion of persecution and auditory his fearfulness, suspiciousness, irritability, muttering to self and impaired sleep gradually improved over a period of 10 days . Risk factors for development of disulfiram related psychotic symptoms include past history or family history of psychosis, overly rapid increase in dosage or greater than recommended total dosage, old age, impaired liver function and concurrent dopaminergic medications or psycho - stimulant abuse.5,11) our patient has family history of schizophrenia in his father . His psychotic symptoms improved after stoppage of disulfiram and use of lorazepam tablet only without any additional requirement of anti - psychotic treatment . These factors support the association between with disulfiram use and emergence of psychotic symptoms in our patient . The usual recommended initial dosage is 500 mg per day for the first 1 or 2 weeks, followed by a maintenance dosage of 250 mg per day.12) disulfiram related psychosis usually involve either therapeutic or higher than recommended dosages.13) our patient has developed psychotic symptoms with 500 mg per day of disulfiram . We recommend that disulfiram should be used at the lowest effective dose, possibly 250 mg daily . Our case highlights the relevance of a careful history of patient s symptoms and family history that should be performed before starting treatment with disulfiram and caution should be taken while prescribing disulfiram for patients with personal and familial antecedents of psychosis . Disulfiram - related psychiatric complications are reported to be more prevalent in eastern countries,3) which suggests that genetic factors may play a role in disulfiram induced psychosis.
|
During human gestation the placenta as a temporal villous organ fulfills a wide spread panel of pregnancy maintaining functions, including exchange of gases and metabolites, regulation of water balance, and secretion of endocrine factors . The vast majority of placenta derived endocrine factors are synthesized in the syncytiotrophoblast, which as a unique epithelium - like layer without lateral cell borders covers all placental villous trees as well as parts of the inner surfaces of chorionic and basal plates . Thus, the syncytiotrophoblast lines the intervillous space and hence is exposed to maternal blood . Beside analogues of virtually all known classical hypothalamic and pituitary hormones, the human syncytiotrophoblast also synthesizes steroid hormones, monoamines, adrenal - like peptides, cytokines, and chemokines [2, 3]. Chemokines are classified into four subfamilies according to the number and spacing of the first two cysteine residues in a conserved cystein structural motif . These four subclasses are referred to as c, cc, cxc, and cx3c, where c is a cysteine and x any amino - acid residue . The cx3c subclass was discovered in the late 1990s and contains only one member, termed fractalkine, or cx3cl1 . Fractalkine is synthesized as a 373 amino - acid transmembrane molecule, comprising an extracellular n - terminal domain, a mucin - like stalk, a transmembrane -helix, and a short cytoplasmic tail [6, 7]. The extracellular domains, representing the chemokine domain and the mucin - like stalk, can be shed by metalloproteases into a soluble isoform [810]. Thus, fractalkine exists as both, a membrane - bound and a soluble form a situation considered as unique amongst the group of chemokines . While the soluble form has chemoattractive activity for monocytes, natural killer cells, and t - cells, the membrane - bound form promotes flow resistant adhesion of leukocytes to endothelial cells via its corresponding g protein - coupled, 7-transmembrane receptor cx3cr1 . Based on that, fractalkine may be considered as inflammatory chemokine expressed in activated endothelial and epithelial cells, as well as in dendritic cells, lymphocytes, osteoblasts, neurons, and microglial cells [1214]. According to tissue distribution analysis fractalkine mrna is most abundantly expressed in brain, heart, kidney, lung, and pancreas but can also be detected in human placenta . However, current knowledge on placenta derived fractalkine and its implications on pregnancy is limited and based on a small number of studies . Placental fractalkine expression was initially demonstrated in villous trophoblast and the amniotic epithelium, which was suggested as resource for substantial release of soluble fractalkine into amniotic fluid of human second and third trimester pregnancies . Studies by hannan et al . Showed fractalkine expression by semiquantitative rt - pcr in primary endometrial epithelial cells and the trophoblast cell lines jeg-3, ac1m-32, and ac1m-88 . Migration and adhesion studies by the same group suggested fractalkine to be involved in embryo implantation processes . Recently, increased placental fractalkine expression was suggested to contribute to increased microvessel density in placental tissue from pregnancies complicated by diabetes mellitus . In the light of the broad panel of factors released from human placenta thus, we aimed to analyse the spatiotemporal expression of placental fractalkine and tested the hypothesis whether it can be shed and released into the intervillous space, that is, the maternal circulation . The study was approved by the ethical committee of the medical university of graz and informed consent was obtained from the women . First trimester placentas (mean gestational week: 9.4 1.7) were obtained from women (mean maternal age: 28.1 6.2 years; mean body mass index: 24.2 5.0) undergoing pregnancy terminations for psychosocial reasons . Term placentas were obtained after delivery (mean gestational age: 39.4 0.9 weeks) from healthy women (mean maternal age: 34.8 3.7 years; mean body mass index: 23.4 4.4) with singleton pregnancies and no clinical evidence of infection . Pregnancies complicated by hypertension, preeclampsia, metabolic disease, steroid treatment, aids, alcohol abuse, and/or drug abuse were excluded . Formalin fixed and paraffin - embedded (ffpe) tissue sections (5 m) from ten first trimester and ten term placentas were mounted on superfrost plus slides (menzel / thermo fisher scientific). After standard deparaffination, tissue sections were subjected to antigen retrieval by boiling slides in epitope retrieval solution ph 9.0 (novocostra, leica) for 7 min at 120c in a decloaking chamber (biocare medical). Sections were immunostained using a staining robot (autostainer 360, thermo fisher scientific) and the ultravision large volume detection system hrp polymer kit (thermo fisher scientific) according to manufacturer's instruction . In brief, washing steps with tbs including 0.05% tween 20 (tbs / t; merck) were followed by background blocking with ultra v block for 5 min . Monoclonal anti - human cx3cl1/fractalkine antibody (clone 81513, r&d systems) was diluted 1: 1000 (0.5 g / ml working concentration) in antibody diluent (dako) and incubated on slides for 30 min at rt . After tbs / t washing steps, primary antibody enhancer was applied to slides for 10 min at rt . Following another washing, detection was achieved by incubation with the anti - mouse / rabbit ultravision hrp - labelled polymer system (15 min) and 3-amino-9-ethylcarbacole (aec, dako), according to manufacturer's instructions . For negative controls, slides were incubated with negative control mouse igg1 (dako) at the same concentration as mentioned above . Moreover, specificity of monoclonal anti - human cx3cl1/fractalkine antibody was evaluated by an antibody preadsorption approach . For this purpose monoclonal anti - human cx3cl1/fractalkine antibody (1: 1000, 0.5 g / ml working concentration) was mixed in antibody diluent with an excessive amount of recombinant human full length fractalkine (5 g / ml working concentration, rhcx3cl1/fractalkine, r&d systems) and incubated with gentle shaking 1 h at rt . A mixture containing solely monoclonal anti - human cx3cl1/fractalkine antibody was incubated in parallel and served as control . Bewo cells were purchased from the european collection of cell cultures (ecacc) and cultured in dmem / f12 (1: 1, gibco), supplemented with 10% fcs, penicillin / streptomycin, amphotericin b, and l - glutamine, at 37c in a humidified atmosphere containing 5% co2 in air . Differentiation of bewo cells was induced with forskolin, which was supplemented to the culture medium with a final concentration of 20 m (10 mm stock in dmso). For experiments testing different concentrations of the metalloprotease inhibitor batimastat (tocris bioscience), 1 10 bewo cells were seeded in 24-well culture dishes (nunc, thermo fisher scientific) and 1 ml / well of above described culture medium . For all other bewo cell experiments, cells were seeded in 12-well culture dishes (2 10 cells / well) and 2 ml / well culture medium . One day after seeding, cells were incubated with culture medium supplemented with or without forskolin (20 m) and batimastat (10 m). Cells cultured in culture medium containing equal volumes of dmso served as solvent controls . At the end of incubation cells were washed with buffered saline and lysed with ripa buffer (sigma - aldrich) including protease inhibitor cocktail (roche diagnostics, indianapolis, ia, usa). The effect of batimastat on viability of bewo cells was analyzed by a methyl tetrazolium salt (mts) based cell viability assay (celltiter 96 aqueous one solution cell proliferation assay, promega), according to manufacturer's protocol . In brief, 2.5 10 bewo cells were seeded in 100 l culture medium per well in a 96-well dish . One day after seeding, cells were incubated in culture medium supplemented with batimastat (10 m) or solvent control dmso (0.1%) for 48 h. after incubation, 20 l mts solution reagent was added to each well and plates incubated for 1 h. thereafter absorbance was recorded at 492 nm using a plate reader and absorbance values for dmso control were set to 100% . Primary trophoblasts were isolated from chorionic villi of four term placentas by enzymatic digestion and percoll density gradient centrifugation as described previously . Cells were seeded in 6-well culture dishes (3 10/well) and 2 ml / well dmem (gibco) supplemented with 10% fcs and cultured in a hypoxic workstation (biospherix) under 8% oxygen at 37c . One day after seeding culture medium was exchanged with dmem / ebm (1: 1, gibco / lonza) supplemented with 7.5% fcs and cells incubated for another 48 h under 8% oxygen at 37c . Villous tissues from human first trimester (n = 7, between gestational week 7 and 12) and term placentas (n = 3, between gestational week 38 and 40) were washed thoroughly in buffered saline and dissected into small pieces of approximately 5 mg moist mass . Placental explants were cultured in dmem / f12 (1: 1, gibco) supplemented with 10% fcs, penicillin / streptomycin, amphotericin b, and l - glutamine with or without batimastat (10 m) in a hypoxic workstation (biospherix) under 2.5% oxygen (first trimester explants) and 8% oxygen (term explants) for 5 days at 37c . Placental explants cultured in culture medium containing the same volume of dmso served as controls . After incubation, conditioned culture media were collected and placental explants homogenized in ripa buffer with protease inhibitor cocktail using a tissue homogenizer (ika ta10 basic, ultra - turrax). Viability of placental explants was evaluated after culture by immunohistochemical staining of proliferation marker ki67 (clone mib-1, 1 g / ml, dako) and hcg (clone h-298 - 12, 1: 10, bioprime / biologo) as described in immunohistochemistry section . Both batimastat treated and control explants showed proliferation of cytotrophoblasts and synthesis of hcg in the syncytiotrophoblast . Moreover, effect of batimastat treatment was analyzed and compared with dmso control by measurement of released lactate dehydrogenase (ldh) activity in culture supernatants using ldh cytotoxicity detection kit (takara bio inc . Obtained absorbance values were normalized to total protein of respective explant homogenates and dmso control set as one . Total rna from trophoblasts and placental tissues was isolated using a column based rna isolation kit (sv total rna isolation system, promega) including an on column dnase treatment step . After quality check, total rna was subjected to quantitative gene expression analysis using a one - step rt - pcr kit (qiagen) and a predesigned expression assay for fractalkine (hs_cx3cl1_qf_1 quantifast probe assay, qiagen) according to manufacturer's instructions . In brief, 100 ng total rna of each sample was mixed with kit components in a total reaction volume of 20 l . Samples were analyzed in triplicate in 96-well plates (roche diagnostics) and a bio - rad cxf96 real - time pcr system . Cycle conditions included reverse transcription for 20 min at 50c, an initial pcr activation step for 5 min at 95c, and subsequent 2-step cycling with denaturing for 15 s at 95c and annealing / extension for 30 s at 60c for a total of 40 cycles . Ct values were automatically generated by the cfx manager 2.0 software (bio - rad) and relative quantification of gene expression was calculated by standard ct method using the expression of beta-2-microglobulin (hs_b2m_qf_2 quantifast probe assay, qiagen) as reference . B2 m was validated by comparison with the expression of other reference genes, ribosomal protein l30 (hs_rpl30_qf_1 quantifast probe assay), hypoxanthine phosphoribosyltransferase 1 (hs_hprt1_qf_2 quantifast probe assay), and 18s rrna (hs_rn18s1_qf_2 quantifast probe assay) and showed no significant developmental or cell differentiation dependent changes . Placental villous tissue was thoroughly washed with pbs and homogenized in ripa buffer including protease inhibitor cocktail using a tissue homogenizer . After determination of protein concentration according to lowry et al ., 60 g total protein was applied and separated on precast 10% bis - tris gels (nupage, novex; invitrogen). 100 ng recombinant human full length fractalkine (rhcx3cl1/fractalkine, r&d systems) was applied as positive control . Electrophoresis was followed by semidry blotting of proteins on 0.2 m nitrocellulose membranes (trans - blot, bio - rad laboratories). Blotting efficiency was determined by staining membranes with ponceau s solution (sigma aldrich). Immunodetection was conducted with a chemiluminescent immunodetection kit (western breeze; invitrogen) according to manufacturer's instructions . Monoclonal anti - human cx3cl1/fractalkine antibody (clone 81513, r&d systems) was diluted in blocking solution 1: 500 (1 g / ml working concentration) and applied to the membrane overnight at 4c . For normalization membranes were incubated with monoclonal anti - beta actin antibody (1: 20.000; clone ac-15, abcam, cambridge, uk). Images were acquired with fluorchem q system (alpha innotech, cell bioscienes, santa clara, ca, usa) and band densities were analyzed with alpha view sa software 3.4.0 . Results are presented as a ratio of relative fractalkine and beta - actin band densities, with first trimester samples set to one . Fractalkine was measured in cell culture supernatants and cell lysates as well as tissue homogenates using a quantitative sandwich enzyme immunoassay (human cx3cl1/fractalkine quantikine elisa, r&d systems). Cell culture supernatants were centrifuged at 1.500 g and 4c for 5 min . Cell lysates and placental explant homogenates were centrifuged at 8.000 g and 4c for 10 min . After centrifugation 100 l of clear supernatants was subjected to immunoassays according to manufacturer's instruction . Complete culture medium incubated without cells and ripa buffer served as blank for fractalkine measurement in conditioned supernatants and cell lysates, respectively . Samples were measured in duplicate and obtained fractalkine concentrations normalized to total cell protein or total tissue protein, respectively, which was determined in lysates according to lowry method . Data were subjected to normality test (shapiro - wilk test) and equal variance test . In case of normally distributed data differences between groups were tested using two - tailed t - test . Otherwise mann - whitney rank sum test was applied . Immunohistochemical staining of human first trimester placental sections localized fractalkine at the apical microvillous plasma membrane of the syncytiotrophoblast (figure 1(a)). The fetal endothelium, villous cytotrophoblasts, and extravillous trophoblasts in cell columns did not express fractalkine (figures 1(a) and 1(b)). In first trimester decidua fractalkine was detected at the apical plasma membrane of uterine glandular epithelial cells (figure 1(c)). Neither spiral arteries nor uterine veins showed endothelial staining (figures 1(c) and 1(d)). In human term placenta fractalkine was detected at the apical plasma membrane of the syncytiotrophoblast (figure 1(e)). No staining was observed in the fetal vascular endothelium of terminal villi and stem villi (figures 1(e) and 1(f)). To get an idea of putative changes of placental fractalkine expression over gestation, placental tissues were analyzed at first trimester and term . Quantitative gene expression analysis revealed a 15.1-fold (0.9) increase in placental fractalkine mrna expression at term, when compared to first trimester (figure 2(a)). On protein level, placental fractalkine was detected by immunoblotting of first trimester and term placenta tissue homogenates and corresponded with recombinant 90 kda full length fractalkine, which served as positive control (figure 2(b)). In contrast to quantitative gene expression analysis, semiquantitative band densitometry of immunoblots showed only a 1.7-fold (0.1) increase of placental fractalkine at term, when compared to first trimester (figure 2(c)). Immunohistochemistry suggested the syncytiotrophoblast to be the main source of placental fractalkine expression . In order to substantiate this finding the trophoblast cell line bewo, a well accepted model for the villous trophoblast population, showing secretion of pregnancy - specific hormones as well as good syncytialization, that is, formation of trophoblast syncytia in vitro, was tested for its capacity to express and release the chemokine . While basal expression of fractalkine mrna was low but detectable in untreated bewo cells, incubation with forskolin, a reagent known to induce bewo cell differentiation and syncytialization, led to a time dependent increase over time with a 22.1-fold (1.6) upregulation compared to vehicle control after 48 h (figure 3(a)). Forskolin induced fractalkine expression in bewo cells was accompanied by a 9.8-fold increase in the release of soluble fractalkine, which accounted for 2.91 (0.34) ng / mg cell protein after 48 h incubation (figure 3(b)). Since trophoblast cell lines may differ in some aspects when compared to their primary counterpart, primary trophoblasts shown to spontaneously form syncytia in vitro were isolated from term placenta and tested for their capacity to release soluble fractalkine . Analysis of supernatants from primary term trophoblasts showed continuous release of soluble fractalkine, which increased by 39.5% between 24 h and 48 h of incubation (figure 3(c)). Data from trophoblast culture provided strong evidence that fractalkine is not only expressed but also released from villous trophoblast . Since data on placental fractalkine release have virtually not been described so far, it was tempting to test if the previously described mechanism of metalloprotease mediated shedding of the transmembrane form also applies for human placenta, that is, human trophoblast . For this purpose the release of soluble fractalkine was first analyzed in forskolin treated bewo cells in presence and absence of the metalloprotease inhibitor batimastat, which has previously been shown to effectively block fractalkine shedding in other cell types such as smooth muscle cells and hepatic stellate cells [24, 25]. Incubation with 5 m and 10 m batimastat decreased the release of soluble fractalkine by 67.1% and 91.6%, respectively, compared to cells treated without the inhibitor after 48 h (figure 4(a)). Analyses of cell lysates from forskolin stimulated bewo cells incubated with or without batimastat revealed that inhibition of soluble fractalkine release was accompanied by a 3.1-fold increase of cell associated fractalkine compared to control after 48 h (figure 4(b)). To ensure that observed effects were not due to changes in cell viability, batimastat treated and control cells were analyzed using a mts based viability assay . Accordingly, batimastat treatment slightly but not significantly decreased the relative number of viable bewo cells in proliferation by 4.3% compared to control after 48 h (figure 4(c)). The situation observed in bewo cells was at least in part reflected in explant culture of human first trimester and term placenta . In first trimester placental explants, batimastat decreased the release of soluble fractalkine by 17.8% after 5-day culture, which did not reach statistical significance . However, analyses of respective tissue homogenates revealed a significant 1.6-fold increase of tissue associated fractalkine in explants incubated with batimastat, when compared to controls after 5 days (figure 5(a)). In explants from human term placenta, incubation with batimastat showed a considerable decline of soluble fractalkine release by 56.3%, while at the same time the fraction of tissue associated fractalkine increased 1.5-fold when compared to controls (figure 5(b)). Comparison of controls from first trimester and term explant experiments revealed a 5.0-fold increase in tissue associated as well as released fractalkine towards term . However, the ratio of released versus tissue associated fractalkine remained constant and was 2.1 in both first trimester and term placental explants, suggesting constitutive shedding of placental fractalkine . In order to determine any cytotoxic effects of batimastat on placental explants, the release of ldh into the culture medium was analyzed after culture and showed a slight but nonsignificant increase by 8.5% and 10.4% after batimastat treatment of first trimester and term explants, respectively, when compared to controls (figure 5(c)). The concept of the dual nature of fractalkine, acting both as soluble chemoattractive factor and transmembrane adhesion molecule, can be well applied for fractalkine expressed in human placenta . Data from placental explant and trophoblast culture provide strong evidence that placental fractalkine is constitutively released from the syncytiotrophoblast into the maternal circulation via metalloprotease dependent shedding . When speculating about a putative role of shed placental fractalkine in the fetal - maternal cross - talk, important aspects of placental development should be considered . During early pregnancy perfusion of the intervillous space with maternal blood is not yet fully established, and thus shed placental fractalkine may not act locally on maternal cx3cr1 expressing cells, but rather in an endocrine way . In doing so, placenta derived fractalkine may contribute to the low grade systemic inflammatory responses described to occur in third trimester of pregnancy [2628]. This assumption is in good agreement with increasing expression and release of placental fractalkine towards term . Mild inflammatory responses were suggested to contribute to maternal metabolic changes, resulting in insulin resistance and hyperlipidaemia, which accommodate increased energy demands of the growing fetus . Contribution of placental fractalkine to the maternal pool of soluble fractalkine during gestation is hard to estimate and should include the fact that the entire surface of placental villi at term with approximately 1215 m represents only a very small area compared to approximately 40007000 m endothelium of maternal blood vessels [1, 29]. Expression analysis of other proinflammatory cytokines, such as tnf-, il-6, il-1, and il-1, showed no difference between preeclamptic and normal placental explants, suggesting a rather marginal contribution of placenta derived cytokines to systemic inflammation . Based on placental explant experiments, the ratio between shed to membrane - bound fractalkine seems to remain constant from first trimester until term but may be influenced by parameters such as gene expression, half - life of both variants, and metalloprotease dependent shedding . The phenomenon of increased membrane - bound fractalkine in cells treated with batimastat was explained as an accumulation of the membrane - bound form as a consequence of impaired shedding activity on the cell surface [24, 25]. Since shedding is mediated by a disintegrin and metalloprotease (adam)10 and adam17 [8, 9], which both can be detected in the syncytiotrophoblast, it is tempting to speculate about an aberrant activity of these metalloproteases and its consequence on the release of placental fractalkine in pathological pregnancies . Interestingly, expression of both metalloproteases has been shown to be increased in placentas from pregnancies complicated by preeclampsia [31, 32], suggesting increased shedding and release of placental fractalkine . This assumption is in line with a recent case - control study, showing elevated plasma concentrations of soluble fractalkine in women with preeclampsia . However, whether or not preeclampsia is accompanied with increased release of placental fractalkine remains open and requires further in - depth studies . Detection of fractalkine expression in uterine glandular epithelial cells is in good agreement with previous studies showing fractalkine in apical regions of the glandular epithelium of actively secreting glands of nonpregnant endometrium as well as in early decidua . When speculating about a physiological function of fractalkine release by uterine glands it should be considered that early implantation processes, with the enlarging syncytiotrophoblast invading not only uterine capillaries but also uterine glands, give rise to connections between the latter and the intervillous space . This situation can be observed from approximately day 17 after conception throughout the first trimester, suggesting delivery of glandular secretion products, including nutrients, growth factors, and immunomodulatory cytokines into the intervillous space during first and early second trimester [35, 36]. Recently, replacement of glandular epithelial cells by so - called endoglandular trophoblasts has been suggested as additional mechanism for opening and connection of the uterine glands towards the intervillous space . Thus, uterine glands together with the growing syncytiotrophoblast may contribute to a continuous release of fetal fractalkine into the intervillous space, that is, maternal plasma . At this stage of pregnancy autocrine signalling by placental fractalkine however, with ongoing pregnancy autocrine effects of placenta derived fractalkine may be neglected, as cx3cr1 can only be detected in the fetal endothelium but not the villous trophoblast compartment at term [18, 38]. While placental fractalkine may contribute as soluble factor to low grade systemic inflammatory responses in the mother, its role as membrane - bound chemokine located on the surface of placental villi is rather unclear . Adhesion of maternal leukocytes to the syncytiotrophoblast may be considered if at all as very rare event in normal pregnancy . However, mechanisms preventing cx3cr1 expressing maternal leukocytes from binding to the syncytiotrophoblast remain speculative . Specific glycans, like sialyl lewis x and lewis a on glycosylated proteins, such as hcg, have recently been suggested to play a role in prevention of maternal leukocyte adhesion to trophoblast . Nevertheless, under pathological conditions membrane - bound fractalkine could facilitate adhesion and transmigration of maternal leukocytes through the villous trophoblast layer giving rise to accumulation of maternal immune cells within inflamed villi, as has been described for infectious villitis and villitis of unknown etiology [4042]. The human placenta is a source for the chemokine fractalkine, which is expressed in the syncytiotrophoblast and released into the maternal circulation by metalloprotease dependent shedding . Increased expression and release of placental fractalkine may contribute to low grade systemic inflammatory responses observed in third trimester of normal pregnancy . Aberrant placental metalloprotease activity may not only affect the release of placenta derived fractalkine but may at the same time affect the abundance of the membrane - bound form of the chemokine.
|
Familial adenomatous polyposis (fap) is an autosomal dominant syndrome caused by a germ line mutation of the adenomatous polyposis coli (apc) gene . Surgery for fap aims to minimize colorectal cancer risk while providing good functional and socially acceptable outcomes . Curative surgical treatment is total proctocolectomy with permanent ileostomy, but permanent stoma is an undesirable situation . Total colectomy with ileorectal anastomosis (ira) and total proctocolectomy with ileal pouch - anal anastomosis (ipaa) are procedures of choice without need for permanent stoma . The risk of rectal cancer due to the remaining rectal stump in ira continues to be the most important problem . The risk of developing cancer in the rectal stump is 4 per cent at 5 years and 25 per cent at 20 years . The result of a meta - analysis showed that functional outcome and quality of life were better after ira than ipaa . On the other hand same meta - analysis show that cancer occurring in 5.5 per cent after ira compared with zero after ipaa . As the risk of cancer and socially acceptable outcomes are the major considerations in deciding the best operative strategy for patients with fap . Technically it can be more difficult by abdominal approach to transect the rectum just on the dentate line and to perform a ileal pouch - anal anastomosis . Anorectal eversion may allow the assessment of the mucosa under direct visualization and resection remaining very little rectal mucosa and eases the hand - sewn or stapler - facilitated anastomosis . We report here a patient with fap, who had total proctocolectomy resection via rectal eversion over the dentate line under direct visualization and ileoanal - j pouch anastomosis by double - stapler technique . A 40-year - old female patient with a family history of colorectal cancer who has multiple adenomatous polyps from 4 cm proximal to the dentate line to the entire colon on colonoscopy was diagnosed as fap . The operation was performed in the lithotomy position under general anesthesia . Through the midline incision first of all colon and the rectum mobilized completely and routine colectomy was performed from 10 cm proximal to ileo - caecal valve to the rectosigmoid junction by a 50 mm linear stapler (gia dst, covidien, mansfield, ma, usa). By gentle dissection ileal j - pouch constructed from the distal ileum by a 100 mm linear stapler (gia dst, covidien, mansfield, ma, usa). The relaxing incisions were made on both sides of the meso - ileum to diminish the tension on the anastomosis . After the relaxation incision the tip of reservoir easily reaches 3 cm beyond the lower margin of the symphysis pubis . By perineal approach rectal stump irrigation with an antiseptic solution was done followed by insertion of a grasping forceps through the anus (picture 1) and the rectal stump was everted through the anus by the mucosa turning inside - out (picture 2) dentate line identified and the mucosa evaluated for the polyps . The remaining 15 cm long rectal stump resected just on the dentate line by ta linear cutter (gia dst, covidien, mansfield, ma, usa). (pictures 3 and 4) then ileal j - pouch -anal anastomosis was performed by 29 mm circular stapler (sdh29a, ethicon, ca, usa). Follows at 6th months the patient had no problem related to the anal incontinence and on digital examination anal sphincter functions found normal . Surgical options for fap patients that avoid the need for a permanent stoma include total colectomy with ira and restorative proctocolectomy with ipaa . Ipaa, which was first described by parks in 1978 for ulcerative colitis that permits total removal of all disease - prone mucosa but avoids the need for a permanent ileostomy while preserving anal continence and intestinal continuity . A meta - analysis showed that functional outcome was better preserved after ira than ipaa for fap, with regard to stool frequency, need for defecation at night, incontinence and the need for pads . These findings were expected in the patient with a retained, functioning rectum however, surprisingly, ipaa was not significantly different from ira with regard to stool frequency at night, day - time incontinence and need for antidiarrheal medication . Whether stapled or handsewn ipaa offers a better functional outcome has not been determined yet . For ipaa, it has been suggested that functional outcome is better for fap than ulcerative colitis . It has also been suggested that secondary ipaa, often performed following failed ira is associated with poorer functional outcome . The most important consideration in deciding the best operative strategy for fap patients is the risk of cancer development . Aziz et al . Showed that cancer occurring in 5.5 per cent after ira due to the remaining rectal stump compared with zero after ipaa in a meta - analysis . It is reported that there is no significant difference between ipaa and ira with respect to bowel obstruction, hemorrhage, intra - abdominal sepsis, anastomotic separation and wound infection in the same meta - analysis . Controversy still exists about the technique to be used for the pouch - anal anastomosis . Mucosectomy and handsewn anastomosis are necessary to remove the rectal mucosa as completely as possible . But this technique takes longer time and has a relatively high risk of postoperative functional problems related to leakage and incontinence due to prolonged anal manipulation . Stapling ipaa was first described by heald and allen in 1987 and is widely accepted to use for creation of the ileal pouches and ipaa . However to allow transanal insertion of the stapler head, it is usually unavoidable to leave a 12 cm segment of rectal mucosa over the dentate line that carries a risk of developing adenomas and cancer . Adenomatous polyps, colonic metaplasia, and adenocarsinoma can occur in the terminal ileum of patients with fap, although the long term risk of pouch and dentate line cancer is not known . Studies comparing handsewn versus stapled ipaa have reported variable results . In a study of large number of patients of a single institution had found that stapled ipaa had better outcomes and quality of life (qol) scores than those undergoing a handsewn ipaa . Technical difficulties can still arise with the stapled ipaa technique, particularly with respect to accurate transection and closure of the anal canal at the anorectal junction by abdominal approach . Rectal eversion permits the direct visualization of the mucosa and dentate line and has been suggested as a means of facilitating accurate anal transection and closure by use of either a handsewn purse - string suture or a linear stapler . However, there has been some concern regarding the potential of anorectal eversion to impair anal continence by causing traction injury to the anal sphincter complex or its nerve supply and thus worsen the functional outcome of restorative proctocolectomy . Williamson et al . Reported in a 50 patients series one year after restorative proctocolectomy with rectal eversion, all patients were continent, although two experienced leakage of mucus requiring a pad . Forty - two patients (84 per cent) could discriminate between faeces and flatus . They noted that the eversion of the anorectum during restorative proctocolectomy impairs the motor and sensory functions of the anal sphincter but most patients achieved satisfactory anal continence, however, despite these physiological changes . Have reviewed the median 4 years follow - up clinical results of consecutive series of 41 patients operated with rectal eversion and reported that no patients had major incontinence and only 2 (6%) had minor leakage . Anorectal eversion may be achieved by the method described above, grasping forceps being introduced transanally to pull down the transected lower rectum, or by an alternative method described by scotte et al . Whereby the lower rectum is cross - stapled over a corrugated drain, introduced transanally, which can be used to facilitate eversion of the anorectum by traction from proximal end point of colon after rectal transection . We conclude that, to facilitate accurate fashioning of stapled ipaa, anorectal eversion can be put into practice during restorative proctocolectomy . Muhittin aygar: data collection, data analysis, writing; fahri yetiir: study design, data collections, data analysis, writing; ebru arer: data collections, data analysis; murat baki yldrm: data collections; mesut zdedeolu: data analysis; doukan durak: data collections; abdssamet yaln, data analysis.
|
The inclusion criteria were patients who underwent revision surgery for recurrent pain after the kidner procedure and completed at least 12-months of follow - up after the revision surgery . The exclusion criteria were patients with recurrent pain from nonunion after fusion of an accessory navicular, a history of a local steroid injection, local infection, or underlying diseases such as uncontrolled diabetic mellitus, rheumatoid arthritis, or seronegative spondyloarthropathy . Nine patients (9 feet) were included in this study because 1 patient was lost to follow - up (table 1). Six patients underwent their initial surgery at another hospital, and the remaining 3 patients had their initial surgery performed by the author (wcl) at the study institution . The mean duration between the initial surgery and the revision surgery was 2.6 years (range, 0.5 to 5 years). The mean follow - up period was 2.3 years (range, 1 to 5 years). This study was approved by the institutional review board (no . Iit-2012 - 268) and informed consent was obtained from all patients . In 1 patient, the tp tendon could not be reattached to the navicular due to retraction of the distal stump proximal to the tip of the medial malleolus, and so a transfer of the flexor digitorum longus (fdl) was performed instead . In 4 patients, the distal stump of the tp the remaining 4 patients underwent tp tendon lengthening above the ankle joint by z - plasty, and then the distal stump was attached to the navicular with minimal force (the lengthening group). Prior to the revision surgery, all patients had difficulty performing a single limb heel rise on physical examination and had hindfoot valgus deformities on radiographic evaluation . Planovalgus deformities were noted in 7 feet; the first talometatarsal angle angulated plantarward by greater than 10 as noted on a weight - bearing foot lateral radiograph . Surgeries for the planovalgus or hindfoot valgus deformity were performed simultaneously in all patients with medial displacement calcaneal osteotomy (mdco), lateral column lengthening (lcl), or both, to relieve the tension at the reattachment site of the tp tendon (table 1). Mdco was performed in 6 feet, including 2 feet with hindfoot valgus with normal longitudinal arches, and lcl was performed in 5 feet . Preoperative and postoperative clinical evaluations were performed using the american orthopedic foot and ankle society (aofas) ankle - hindfoot score1213) and a 10-point visual analog scale (vas) for pain . Radiographic and clinical results were separately tabulated for each group (table 2). However, the statistical power was too low to compare the groups . The radiographic assessments were made with weight - bearing dorsoplantar (anteroposterior [ap]) and lateral radiographs of the foot and hindfoot alignment radiographs . All radiographs were digitally obtained through the picture archiving communication system (marosis enterprise pacs, marosis enterprise pacs; infinitt, seoul, korea). On the weight - bearing foot ap radiographs, the talonavicular coverage angle, and the first talometatarsal angle were measured . On the weight - bearing foot lateral radiographs, the first talometatarsal angle and the calcaneal pitch angle were measured . On the hindfoot alignment view, the hindfoot alignment angle and the hindfoot alignment ratio were obtained.14) the hindfoot alignment angle, which is the angle between the tibial axis and the calcaneal axis, was measured and expressed as a positive number when it was in the valgus position . The hindfoot alignment ratio was obtained by dividing the width from the calcaneus medial to the tibial axis by the calcaneal width at its widest portion on the alignment view . If the tibial axis line passed through more medial side compared to the medial calcaneal cortex, the measurements were expressed as negative values . Statistical analysis was not performed owing to the insufficient sample size; in order to achieve sufficient power for statistical analysis (0.20, power 0.80), each group needed 15 patients . Lcl was performed by fusing the calcaneocuboid joint in 2 feet, and by osteotomy at the anterior calcaneus in 3 feet by using the evans procedure . For the tp tendon advancement, the degenerative segment of the tp tendon was excised and the distal end of the tendon was advanced to the navicular, with the foot positioned in approximately 20 of plantarflexion and inversion . The tendon was securely fixed with one or two 2.7-mm suture anchors (arthrex, naples, fl, usa). Additional sutures were applied between the tendon and the adjacent soft tissues . To lengthen the tp tendon, a 6-cm longitudinal incision was made on the posterior aspect of the medial border of the tibia, after excision of the degenerative segment of the tp tendon . After exposure of the tendon, z - plasty lengthening was performed via a 5-cm longitudinal incision in the middle of the tendon (fig . The tp tendon was lengthened by 2 cm and repaired with interrupted 3 - 0 nylon sutures . The distal end of the tp tendon was securely fixed using one or two 2.7-mm suture anchors . For the fdl transfer, the master knot of henry was dissected and the fdl tendon was transected distal to that point . Using 2 - 0 ethibond polyester suture (ethicon, new brunswick, nj, usa), the fdl tendon was then rerouted from the plantar to the dorsal direction of the navicular through a 5-mm bone tunnel . The fdl was then sutured back onto itself with two simple interrupted 2 - 0 ethibond polyester sutures . Postoperatively, all patients were immobilized in a short leg non - weight - bearing cast for 6 weeks . For the first 3 weeks, the ankle was placed in 10 of plantarflexion and inversion, and this was followed by 3 weeks of casting in a neutral position . Weight - bearing as tolerated was permitted once the ankle was cast in the neutral position . After 6 weeks of postoperative care, the cast was removed and a stirrup brace was applied and maintained for another 6 weeks . Lcl was performed by fusing the calcaneocuboid joint in 2 feet, and by osteotomy at the anterior calcaneus in 3 feet by using the evans procedure . For the tp tendon advancement, the degenerative segment of the tp tendon was excised and the distal end of the tendon was advanced to the navicular, with the foot positioned in approximately 20 of plantarflexion and inversion . The tendon was securely fixed with one or two 2.7-mm suture anchors (arthrex, naples, fl, usa). To lengthen the tp tendon, a 6-cm longitudinal incision was made on the posterior aspect of the medial border of the tibia, after excision of the degenerative segment of the tp tendon . After exposure of the tendon, z - plasty lengthening was performed via a 5-cm longitudinal incision in the middle of the tendon (fig . The tp tendon was lengthened by 2 cm and repaired with interrupted 3 - 0 nylon sutures . The distal end of the tp tendon was securely fixed using one or two 2.7-mm suture anchors . For the fdl transfer, the master knot of henry was dissected and the fdl tendon was transected distal to that point . Using 2 - 0 ethibond polyester suture (ethicon, new brunswick, nj, usa), the fdl tendon was then rerouted from the plantar to the dorsal direction of the navicular through a 5-mm bone tunnel . The fdl was then sutured back onto itself with two simple interrupted 2 - 0 ethibond polyester sutures . Postoperatively, all patients were immobilized in a short leg non - weight - bearing cast for 6 weeks . For the first 3 weeks, the ankle was placed in 10 of plantarflexion and inversion, and this was followed by 3 weeks of casting in a neutral position . Weight - bearing as tolerated was permitted once the ankle was cast in the neutral position . After 6 weeks of postoperative care, the cast was removed and a stirrup brace was applied and maintained for another 6 weeks . The intraoperative findings of all the patients revealed different degrees of degeneration of the tp tendon . After the revision surgery, all the patients had normal muscle strength when examined by manual resistance of the tp and all the patients were able to perform a single heel rise . In all the patients, the aofas score, vas, and radiographic parameters improved after surgery (table 2). The mean aofas score improved from 71.50 (range, 67 to 76) to 85.75 (range, 67 to 100) in all patients: from 71.25 (range, 67 to 76) to 81.50 (range, 67 to 88) in the advancement group, and from 71.75 (range, 67 to 75) to 90.00 (range, 84 to 100) in the lengthening group . The mean vas improved from 7.62 (range, 7 to 8) to 3.00 (range, 1 to 6) in all patients: from 7.75 (range, 7 to 8) to 4.25 (range, 2 to 6) in the advancement group, and from 7.50 (range, 7 to 8) to 1.75 (range, 1 to 3) in the lengthening group . Two of the 4 patients in the advancement group reported a pain vas 4 in contrast to none in the lengthening group . One patient in the advancement group complained of unsatisfactory results including pain and difficulty with rehabilitation after undergoing reattachment in the extreme inversion position . This patient underwent an additional surgery (tp tendon lengthening and fdl transfer) 4 years after the revision surgery . This study was conducted to investigate the characteristics of the feet and the outcomes of surgical treatment for recurrent pain after the kidner procedure . In the total 9 patients available for this study, reattachment of the tp tendon with lengthening (the lengthening group) showed better clinical results than the forceful reattachment of the tp tendon (the advancement group). In this series, all patients were reoperated on because of severe pain at the attachment site of the tp tendon; they could not perform a single heel rise on the affected foot at the time of the revision . The decision about which procedure to perform was not made on clear - cut criteria, and the characteristics and severity of the patients' symptoms varied . However, the authors noted that all the feet had pes planovalgus or hindfoot valgus deformity, and all patients showed degenerative changes of the tp tendon at its reattachment site . Although several articles have reported on patients with persistent symptoms after the kidner procedure, no current literature reviews the possible treatment options and outcomes in these patients.3111516) the authors believe that this is the first review of revision surgery for persistent pain after the kidner procedure . The relationship between painful accessory navicular and flatfoot is controversial, and it is not clear whether flatfoot is the cause of painful accessory navicular or vice versa.381617) vaughan and singh18) reported that pes planus may contribute to ongoing pain after excision of the accessory navicular . Seven of the 9 patients in the present study had planovalgus deformity; however, 2 patients had normal longitudinal arches with only hindfoot valgus deformity . We believe that both planovalgus and hindfoot valgus deformities can be associated with recurrent pain after the kidner procedure, because both flatfoot and hindfoot valgus can increase the tension on the tp tendon and result in degeneration of the tendon, thereby causing recurrent pain . In the study patients, the tp tendon already has been advanced during the initial surgery to close the gap after excision of the accessory navicular . During revision surgery, an additional gap was created after debridement of the degenerated segment of tp tendon discovered in all the cases of this series, and additional advancement of the tp tendon was required . In this series, the mean length of advancement or lengthening of the tendon was 2 cm, after the degenerated portion was debrided . Because the excursion of the tp tendon was only 2 cm, excessive tension was inevitable at the tp tendon reattachment site after advancing the tp tendon.19) although patients in the advancement group showed improvements after the revision surgery, they complained of pain after prolonged standing or walking . In contrast, all the patients in the lengthening group showed good results . After experiencing poor results from advancement of the tp tendon during the initial treatment, corrective surgery to reduce strain on the tp tendon should be determined according to the deformity in each individual case . In the presence of hindfoot valgus deformity without forefoot abduction or low longitudinal arch, mdco was sufficient to reduce the tension . In the cases involving planovalgus deformity, the authors independently decided to use either the mdco or lcl method of correction, or combination of both procedures . To avoid problems associated with the kidner procedure, the accessory navicular should be soundly fused to the mother bone.411) however, secure fixation of such a small bone is difficult, and assessment of the progression of the fusion is challenging owing to the small opposing surfaces between the accessory bone and the body of the navicular . Another option for closing the gap of the tp tendon is a fdl transfer.20) in cases with stage 2 adult acquired flatfoot, an intercalary defect is created, centered at approximately 35 cm proximal to the insertion after debridement of the degenerated tp tendon; an fdl transfer is a common method to reconstruct the invertor function . The tp tendon has multiple insertions besides the primary insertion at the navicular; therefore, it cannot be proximally retracted even though the tp tendon is detached from its insertion after surgery for painful accessory navicular . We believe that the major portion of the tp tendon was inserted only to the accessory navicular in this case . Kiter et al.1) have reported that disruption at the reattachment site may cause proximal migration of the tendon when the tp tendon mainly inserts at the accessory navicular . Although the clinical result of the patient treated with fdl transfer was satisfactory, other cases were not treated with an fdl transfer for the reconstruction of the gap at the insertion of the tp tendon . We believe that reattachment of the tp tendon would be better in the long - term, rather than sacrificing the fdl . However, fdl transfer is as an alternative method of treatment when reattachment of the tp tendon is not feasible . The first limitation is the small number of cases, which means that statistically significant results could not be obtained . In order to achieve sufficient statistical power (0.20, power 0.80), 15 cases would have been needed in each group . As the symptoms of most patients are typically improved after excision of the accessory navicular, revision surgery is not common . However, we think this report on a small number of patients is meaningful because severe disability may be caused by persistent pain after the kidner procedure . The second limitation is that the degree of associated preoperative and postoperative deformity was not significantly different between the groups . Interestingly, better clinical results were obtained in the lengthening group, which had a smaller talonavicular coverage angle, lower arch, and greater hindfoot valgus on the postoperative radiographs . These findings suggest that the lower degree of postoperative pain in the lengthening group cannot be explained by better correction of the flatfoot deformity . The third limitation is that the size of the accessory navicular was not assessed at the time of the initial surgery . As the tp tendon should be advanced a farther distance when a larger accessory navicular is excised, assessment of the size is an important factor . In this current study, 6 of the 9 patients had their initial surgery at another hospital and the size of the accessory navicular could not be determined . Therefore, we cannot assess whether a larger defect at the primary surgery was a contributing factor to the recurrent pain . The fourth limitation is that the tp tendon force was not measured with an objective method . Although all revision procedures and examinations were performed by the authors, the power of the tp tendon on manual examination, the single limb heel rise postoperatively, and subtle weakness after lengthening may not have been noticed by manual examination . In addition, further follow - up is needed to determine whether there are any long - term problems with the strength of the tp tendon . In this study, recurrent pain after the kidner procedure was associated with pes planovalgus or hindfoot valgus deformity . Reattachment of the tp tendon after lengthening demonstrated better outcome compared to advancement of the tendon . Additional procedures to correct the planovalgus or hindfoot valgus deformity should be considered to treat recurrent pain after surgery for symptomatic accessory navicular.
|
Ribonucleotide reductases (rnrs) perform an essential function in all organisms, catalyzing the conversion of ribonucleotides into deoxynucleotides and providing the monomeric precursors required for dna synthesis and repair (chart 1). All rnrs initiate nucleotide reduction via a transient protein - based thiyl radical that abstracts a hydrogen atom from the 3-position of the nucleotide . Rnrs have been divided into three classes (i, ii, and iii) based on the metallo - cofactors required to generate this initiating thiyl radical . This paper focuses on the e. coli class iii rnr and the identification of a new radical species involving a three - electron bond between a cysteine and a methionine residue playing a role in the reductive half - reaction . Despite the sequence differences between the three rnr classes, the first evidence for the involvement of thiyl radicals in the reductive half - reaction of all classes two of them are class i rnrs, one with a diferric - tyrosyl radical (y) cofactor (class ia) and one with a dimanganese - y cofactor (class ib). The ia enzyme is the workhorse in dna replication, while the ib rnr is expressed under iron limitation and oxidative stress . The third rnr, which is the focus of this paper, is a class iii enzyme and is expressed only under anaerobic conditions . Nucleotide reduction is catalyzed by the 80 kda nrdd, which houses the o2-sensitive glycyl radical (g) that is generated by the 17.5 kda activating enzyme nrdg via chemistry involving s - adenosylmethionine (sam) and a [4fe4s] cluster (chart 1). The g, as with the dimetallo - ys in the class ia and ib rnrs and adenosylcobalamin in the class ii rnr, is reversibly involved in generation of the thiyl radical (chart 1).chart 1the class i, ii, and iii rnrs catalyze the conversion of nucleoside di or triphosphates to deoxynucleotides . They differ in the metallo - cofactor that initiates the reduction process and in the reductant itself . Reproduced from rhodes et al . The class i, ii, and iii rnrs catalyze the conversion of nucleoside di or triphosphates to deoxynucleotides . They differ in the metallo - cofactor that initiates the reduction process and in the reductant itself . Reproduced from rhodes et al . The class i, ii, and iii rnrs catalyze the conversion of nucleoside di or triphosphates to deoxynucleotides . They differ in the metallo - cofactor that initiates the reduction process and in the reductant itself . Reproduced from rhodes et al . Recent studies on the class ia rnr and earlier studies on the class ii enzyme established that the chemistry of nucleotide reduction is fast (100 s), and in both cases it is masked in the steady state by conformational gating (kcat of 5 s). The mechanism of nucleotide reduction by the class i and ii rnrs has been investigated using many methods resulting in the model shown in figure 1a, b . The overall reaction is divided into two half reactions . In the first half - reaction (figure 1a), a 3-nucleotide radical (2) is generated by 3-hydrogen atom abstraction by the transient thiyl radical located on the top face of the sugar . Water loss is then facilitated by protonation by a bottom face cysteine, in an irreversible step, to generate intermediate 3 . These first two steps are likely facilitated by removal of the proton of the 3-oh group . In the second half - reaction (figure 1b), intermediate 3 is reduced to the 3-keto - deoxynucleotide (4) concomitant with formation of the disulfide anion radical which then, in a proton - coupled electron - transfer step, generates the 3-deoxynucleotide radical 5 . In the final step, the hydrogen atom that was initially removed from the 3-position of the nucleotide mechanistic model for nucleotide reduction by the e. coli class ia rnr and e. coli (or bacteriophage t4) class iii rnr . (a) first half - reaction common to all rnrs; (b) second half - reaction of class ia rnr; and (c) second half - reaction of class iii rnr . The mechanism of nucleotide reduction by the class iii rnrs has been less well characterized, but studies support a similar sequence of events for the first half - reaction (figure 1a). A distinction between the rnr classes is apparent in the proposed mechanism of the second half - reaction (compare figure 1b, c), as a pair of conserved, bottom face, cysteine residues are essential for nucleotide reduction by the class i and ii rnrs, while formate is the reductant in the e. coli class iii rnr . Studies on the class iii rnr in d2o demonstrated that solvent replaces the 2-oh with retention of configuration and that a small amount of exchange of deuterium into the 3-position of the product takes place . These results are similar to previous studies with the class i and ii rnrs . Studies with [h]-formate also provided insight about the reduction process . First, h was found in the solvent, consistent with the oxidation of formate to a co2 via the conserved bottom face cysteine . Second, an unusual [h]-(kcat / km) isotope effect of 2.3 was observed, requiring exchange of formate between the active site and solvent prior to cleavage of the formate c h bond and after the first irreversible step of nucleotide reduction, thought to be h2o loss . Thus, formate appears to be able to enter and leave the active site in the middle of nucleotide turnover . A comparison of the active site structures of the e. coli class ia 2 (nrda) and the bacteriophage t4 class iii 2 (nrdd, figure s1a) reveals similar 10-stranded / barrels containing a finger loop with the essential cysteine c290 (equivalent to c439 in e. coli nrda, c384 in e. coli nrdd) at its tip, that generates the substrate radical . Of the two cysteines that donate the reducing equivalents in the class i and ii rnrs (c225 and c462 in e. coli nrda), only c79 (c225 in e. coli nrda, c175 in e. coli nrdd) is conserved in the class iii enzyme . Mutagenesis studies showed that both c79 and c290 are essential for catalysis in the class iii enzyme . Additional similarities between the class i, ii, and iii rnrs have been identified using mechanism - based inhibitors, 2-chloro and fluoro 2-deoxynucleotides, that can also function as alternative substrates (figure 2). All rnrs react with these analogues to form 13, which can partition between the normal reduction reaction to generate the deoxynucleotide product (figure 1b), or reduction from the top face or the bottom face of the sugar to generate a 3-keto - deoxynucleotide (14), which dissociates from the active site and decomposes nonenzymatically to produce the nucleobase and pyrophosphate (tripolyphosphate). In the case of the class i and ii rnrs, the furanone (15) has also been identified, and its reaction with the enzyme has been shown to result in their time - dependent inactivation . Similarities in the reactivity of all three classes of rnrs toward these substrate analogues suggest a common first half - reaction (figure 1a) and provide a mechanism by which nucleobase (n) can be formed (figure 2). Mechanistic model for nucleotide reduction by the e. coli class ia rnr with a mechanism - based inhibitor or an active site mutant (zh) with cdp . Reported here are our studies of the reaction of e. coli class iii rnr that have provided insight about the reductive half - reaction of this and the class i and ii rnrs . Incubation of the class iii rnr with ctp (substrate) and atp (allosteric effector) in the absence of formate leads to the disappearance of the g, concomitant with formation of a new radical and release of cytosine (cyt), a known breakdown product of 3-keto - deoxycytidine (figure 1c, 7, and figure 2, 14). Subsequent addition of formate leads to the disappearance of the new radical, recovery of g, and formation of dctp and a small amount of cyt . Isotopic labeling of nrdd with [-h]-cysteine, [-h]-methionine and [,-h]-methionine, in combination with epr spectroscopy of the new radical, identifies this species as a thiosulfuranyl radical (figure 1c, 8), generated from the c175 thiyl radical stabilized by an interaction with the conserved m382 . The role of the thiosulfuranyl radical in the class iii rnr second half - reaction (figure 1c) and its relationship to the disulfide radical anion in the second half - reaction of the class ia rnr (figure 1b) is discussed . All chemical reagents were purchased from sigma aldrich, unless otherwise indicated . Uv vis absorption spectroscopy was performed on an agilent 8453 diode array spectrophotometer . Anaerobic procedures were carried out in a custom - designed mbraun glovebox in a cold room at 4 c or at room temperature (rt). All solutions and proteins were made anaerobic on a schlenk line by 3 cycles of evacuation (5 min) followed by flushing with ar gas (10 min) before being brought into the glovebox . The plasmids prss and pn9 containing the genes for e. coli nrdd and nrdg, respectively, were gifts from professor marc fontecave, collge de france (paris, france). The synthesis was carried out by minor modifications of the procedure of lohman et al . A reaction mixture (10 ml) containing 5-[h]-cdp (2 mm, vitrax, specific activity of 26880/nmol), pep (4 mm), tris - hcl (50 mm, ph 7.5), kcl (80 mm), mgcl2 (20 mm), and pyruvate kinase (rabbit muscle, 120 u / ml) was incubated at 37 c for 1 h. the resulting 5-[h]-ctp was purified on a deae column (60 ml, 10 2 cm) washed with water (50 ml), and eluted with a 400 400 ml linear gradient from 0 to 750 mm triethylammonium bicarbonate (teab). The triphosphate containing fractions eluting at 550 mm teab were combined, and the solvent removed in vacuo . The product 5-[h]-ctp was isolated in 87% yield and the structure confirmed by h- and p nmr . The 5-[h]-ctp used in all experiments had a specific activity of 2860 cpm / nmol . The plasmid prss contains a 1800 bp insert between the promoter and nrdd start codon . An ndei restriction site was introduced at the 5 position of the nrdd orf by site - directed mutagenesis using the primer gttcttaaaaatatggagcgcatatgacaccgc (mutation underlined). Pcr was carried out using pfuultraii polymerase (stratagene) according to the manufacturer s protocol, followed by dpni digestion of the methylated template plasmid . The resulting plasmid was digested with ndei and ecori (neb) and the nrdd fragment was ligated into pet24a (novagen), which was linearized with the same restriction enzymes, to give pet24a - nrdd . The nrdd sequence and all cloned or mutant sequences were confirmed by dna sequencing at the massachusetts institute of technology biopolymers laboratory . To facilitate insertion of nrdd into ptrchisa (invitrogen) without an n - terminal his6-tag, an ndei restriction site was introduced into the plasmid by site - directed mutagenesis using the primer cgattaaataaggaggaataacatatgtatcgattaaataagg (mutation underlined), and an internal ndei restriction site present in the plasmid was mutated using the primer ggtatttcacaccgcacatggtgcactc . The nrdd fragment was excised from pet24a - nrdd using the same restriction enzymes and ligated into ptrc to give ptrc - nrdd . The s386e mutation was introduced by site - directed mutagenesis of the plasmids pet24a - nrdd and ptrc - nrdd using the primer ccgatgggctgccgcgagttcctcggcgtgtggg (mutation underlined). Pet24a - nrdd was transformed into bl21 (de3) cells (invitrogen), grown on lb - agar plates with 50 g / ml kanamycin (kan) at 37 c . A single colony was inoculated into 5 ml of lb (50 g / ml kan in all growths), grown at 37 c until saturated (12 h), and transferred into 1.5 l of lb supplemented with 50 m zinc acetate in a 6 l erlenmeyer flask . The culture was grown at 37 c with shaking at 220 rpm . At od600 0.6, the temperature was lowered to 25 c and isopropyl -d-1-thiogalactopyranoside (iptg, promega) was added to a final concentration of 1 mm . After 14 h, the cells were pelleted by centrifugation (5000 g, 10 min, 4 c) and frozen at 80 c . Cell paste (7.1 g) was resuspended in 35 ml of buffer a (50 mm tris, 5% glycerol (bdh chemicals), 5 mm dithiothreitol (dtt, promega), ph 7.5) containing 1 mm pmsf . The cells were lysed by a single passage through a french pressure cell (14 000 psi). Dna was precipitated by dropwise addition of 0.2 vol of buffer a containing 6% (w / v) streptomycin sulfate . The mixture was stirred for an additional 10 min, and the precipitated dna was removed by centrifugation (20 000 g, 10 min, 4 c). The solution was stirred for an additional 20 min, and the precipitated protein was isolated by centrifugation (20 000 g, 10 min, 4 c). The pellet was dissolved in 20 ml of buffer a containing 0.8 m (nh4)2so4 and loaded onto a butyl - sepharose column (2 16 cm, 50 ml). The column was eluted with 2 column volumes (cv) each of buffer a containing 0.8, 0.6, 0.4, 0.2, and 0.0 m (nh4)2so4, and the fractions were analyzed by sds - polyacrylamide gel electrophoresis (sds - page, 10% gel). This analysis led to rechromatography of the protein on the butyl - sepharose column with a gentler step - gradient . The fractions eluting at 0.60.4 m (nh4)2so4 were pooled and precipitated with (nh4)2so4 (60% saturation). The pellet was redissolved in buffer a containing 0.8 m (nh4)2so4 and loaded onto the butyl - sepharose column (2 16 cm, 50 ml). The column was then eluted with 2 cv each of buffer a containing 0.8, 0.7, 0.6, 0.5, and 0.4 m (nh4)2so4 . The fractions eluting at 0.70.5 m (nh4)2so4 were pooled and precipitated with (nh4)2so4 (60% saturation). The pellet was dissolved in 100 ml of buffer a and was loaded onto a deae - sepharose column (2 16 cm, 50 ml) and washed with 100 ml of buffer a. the flow - through and wash fractions were pooled and precipitated with (nh4)2so4 (60% saturation). The pellet was dissolved in a minimal volume of buffer a (10 ml) and desalted using a sephadex g-25 column (2 50 cm, 150 ml). The protein - containing fractions were pooled and concentrated by ultrafiltration (amicon ym-30, millipore). This procedure yielded 55 mg nrdd per g of cells (280 = 77 020 mcm), judged pure by sds - page . Pn9 was transformed into bl21 (de3) cells (invitrogen), grown on lb - agar plates with 100 g / ml ampicillin (amp) at 37 c . A single colony was inoculated into 5 ml of lb (100 g / ml amp in all growths), grown at 37 c until saturated (12 h), and transferred into 6 1.5 l of lb in 6 l erlenmeyer flasks . The cultures were grown at 37 c with shaking at 220 rpm . At od600 0.7, the temperature was lowered to 28 c, and iptg was added to a final concentration of 1 mm . After 12 h, the cells were pelleted by centrifugation (4000 g, 10 min, 4 c) and frozen at 80 c . Cell paste (12.9 g) was resuspended in 50 ml of buffer b (30 mm tris, 50 mm kcl, 10 mm dtt, ph 7.5) containing 0.1 mm pmsf . The cells were lysed by a single passage through a french pressure cell (14 000 psi). Dna was precipitated by dropwise addition of 0.2 vol of buffer a containing 6% (w / v) streptomycin sulfate . The mixture was stirred for an additional 10 min, and the precipitated dna was removed by centrifugation (15 000 g, 10 min, 4 c). The solution was stirred for an additional 20 min, and the precipitated protein was isolated by centrifugation (15 000 g, 40 min, 4 c). The pellet was dissolved in 10 ml of buffer b and desalted using a sephadex g-25 column (5 50 cm, 1 l) equilibrated with buffer b. the colored fractions were combined and loaded onto a deae - sepharose column (5 10 cm, 200 ml) and washed with 300 ml of buffer b. the flow - through and wash fractions were pooled and precipitated with (nh4)2so4 (40% saturation). The pellet was dissolved in 4 ml of buffer b and loaded onto a sephadex g-75 column (3 100 cm, 700 ml) equilibrated with buffer b. fractions (15 ml) were collected and analyzed by sds - page . The fractions containing nrdg were pooled and concentrated by ultrafiltration (amicon ym-10), yielding 4 mg nrdg per g of cells (280 = 28480 mcm), pure by sds - page . The procedure was carried out in a glovebox in a 4 c cold room . Solutions of na2s and of fe(nh4)2(so4)2 in water (100 mm) were freshly prepared in the glovebox . A solution of nrdg (250 m, 1 ml) was made anaerobic on a schlenk line and brought into the glovebox . A solution of dtt (100 mm) was added to 10 mm, followed by ordered addition of a solution of na2s (5 equiv) and fe(nh4)2(so4)2 (5 equiv), and incubation for 12 h. the solution was concentrated to 200 l by ultrafiltration (amicon ym-30). Edta (5 equiv) was then added, and the solution was desalted using a sephadex g-25 column (1 9 cm, 7 ml) equilibrated with triethanolamine (tea) buffer (30 mm, ph 7.5). The final material typically contained 2 atoms of fe per peptide determined by the ferrozine assay . In order to carry out reactions in the absence of formate, substitutes were used for components of the nrdd storage buffer found to contain a formate contaminant (tris base, glycerol, and dtt, see results section). Inositol and tcep, which contain undetectable levels of formate, effectively replaced glycerol and dtt in preserving nrdd activity . Tris buffer was replaced with bicine, which also served as a coreductant for the photoreduction system . Bicine was later found to contain small amounts of formate and was thus replaced with tea for experiments where complete removal of formate is desired . To generate nrdd - g, a solution of nrdd (200 m, 1.5 ml) was concentrated to 300 l by ultrafiltration (amicon ym-30). The protein was exchanged into bicine buffer (30 mm, ph 7.5), 3% inositol, 5 mm tris(2-carboxyethyl)phosphine (tcep), using a sephadex g-25 column (1 20 cm, 15 ml). The protein - containing fractions were pooled and made anaerobic on a schlenk line and brought into a glovebox in a 4 c cold room . A 50 l mixture of nrdd (100 m), nrdg (10 m), sam (1 mm), bicine buffer (30 mm, ph 7.5) and rose bengal (50 m) was exposed to a fluorescent lamp in the glovebox for 2 h. for inspection by x - band epr spectroscopy, the solution was diluted to 250 l with bicine buffer (30 mm, ph 7.5), 3% inositol to give a final concentration of 20 m nrdd, and sealed in an epr tube with a rubber stopper . The solution was quenched in liquid n2 immediately after removal from the glovebox . The amount of g in the solution was determined by comparing the epr signal intensity to that of a cuso4 standard . A typical yield of 0.450.50 radicals per nrdd polypeptide the assay mixture in 100 l contained nrdd (0.2 m), atp (1 mm), 5-[h]-ctp (1 mm, 2860 cpm / nmol) in tris (30 mm, ph 7.5), kcl (30 mm), mgso4 (10 mm), and hco2na (10 mm) and was incubated at 25 c . Four, 20 l aliquots were removed at 1 min intervals and quenched with 2% perchloric acid (20 l). Subsequent to removal of the phosphates using calf intestine alkaline phosphatase (roche), dctp formation was analyzed by the method of steeper and steuart . The specific activity of nrdd is 1500 u / mg, consistent with literature values . The method of steeper and steuart involves chromatography on a dowex-1-borate column where the cytidine is retained as a complex with borate, while dc is eluted . To assay for cyt released from 3-keto - dctp, the dephosphrylation step was omitted . Controls showed that ctp and dctp are retained on the dowex anion - exchange column, while the cyt passes directly through the column . 5-[h]-ctp was lyophilized before the experiments, eliminating any h2o that would also pass directly through the column . The final reaction mixture at 4 c contained in a volume of 250 l: nrdd (40 m, activated as described above), ctp (1.5 mm), atp (1.5 mm), bicine (30 mm, ph 7.5), kcl (30 mm), mgso4 (10 mm), and 3% inositol . The reaction was initiated by addition of nrdd, and the sample was rapidly transferred and sealed in an epr tube with a rubber stopper, removed from the glovebox, and frozen in liquid n2 . The total reaction time was 1 min for nrdd - wild - type (wt) and 60 min for nrdd-(s386e). For reaction with formate, nrdd was reacted first with ctp and atp for 1 min at 4 c as described above, followed by addition of sodium formate to 10 mm (2.5 l, 1 m). Continuous wave (cw) x - band epr spectra were recorded at 77 k in the mit department of chemistry instrumentation facility on a bruker esp-300 x - band spectrometer equipped with a quartz finger dewar filled with liquid n2 . Experimental conditions were as follows: microwave frequency, 9.45 ghz; modulation amplitude, 0.15 mt; modulation frequency, 100 khz; time constant, 5.12 ms; and scan time, 41.9 s. a microwave power of 10 w and an average of 10 scans was used for g, while a power of 160 w and 100 scans was used for the thiosulfurnanyl radical . A solution of nrdd and nrdg was concentrated by ultrafiltration (amicon ym-30) in a glovebox in a 4 c cold room . The final mixture for g generation (5 l) contained nrdd (800 m), nrdg (80 m), sam (1.5 mm), bicine (ph 7.5, 30 mm), kcl (30 mm), mgso4 (10 mm), rose bengal (50 m), and 3% inositol . The mixture was exposed to the fluorescent lighting in the glovebox at 4 c for 2 h to generate g. the reaction with the nucleotide was initiated by adding a solution (1 l) containing ctp and atp in reaction buffer, to give a final reaction concentration of 2 mm each . Loading and freezing the small 140 ghz epr tubes (i d 0.5 mm, effective sample volume 200 nl) could not be done as swiftly as with the x - band tubes, and the total reaction time was extended to 2.5 min at 4 c . Echo - detected 140 ghz epr spectra were obtained on a spectrometer developed by smith et al . Pulsed epr spectra were acquired at a temperature of 85 k using a hahn echo pulse sequence (/2 pulse = 35 ns and = 250 ns). The h resonance frequency of a small water sample that resides just below the sample space in the magnet was used to set the magnetic field . Ptrc - nrdd or ptrc - nrdd-(s386e) was transformed into the e. coli cysteine auxotroph jw3582 - 2 (yale e. coli genetic stock center), containing the mutation cyse720::kan . A single colony was inoculated into 5 ml of lb (100 g / ml amp in all growths), grown at 37 c until saturated (12 h), harvested by centrifugation (3000 g, 10 min, 4 c), and transferred into m9 medium supplemented with l - amino acids and cofactors . The growth medium contained in 1 l: na2hpo4 (6 g), kh2po4 (3 g), nh4cl (1 g), nacl (1 g), glycerol (4 g), mgcl2.6h2o (210 mg), and cacl2.2h2o (14 mg), alanine (0.50 g), arginine (0.40 g), aspartic acid (0.40 g), asparagine (0.40 g), glutamine (0.4 g), sodium glutamate (0.74 g), glycine (0.55 g), histidine hydrochloride (0.13 g), isoleucine (0.24 g), leucine (0.23 g), lysine hydrochloride (0.43 g), methionine (0.25 g), phenylalanine (0.15 g), proline (0.10 g), serine (2.10 g), threonine (0.23 g), tryptophan (0.06 g), valine (0.23 g), thiamine (50 mg), and racemic [,-h]-cystine (120 mg, 98%, cambridge isotope laboratories). The cultures were grown at 37 c with shaking at 220 rpm . At od600 0.6, the temperature was lowered to 25 c, and iptg was added to a final concentration of 1 mm . After 14 h, the cells were pelleted by centrifugation (5000 g, 10 min, 4 c) and frozen at 80 c, yielding 2 g of cell paste per l of culture . Pet24a - nrdd or pet24a - nrdd-(s386e) was transformed into bl21 (de3) cells, grown on lb - agar plates with 50 g / ml kan . A single colony was inoculated into 5 ml of lb (50 g / ml kan in all growths), grown at 37 c until saturated (12 h), harvested by centrifugation (3000 g, 10 min, 4 c), and transferred into m9 medium containing in 1 l: na2hpo4 (6 g), kh2po4 (3 g), nh4cl (1 g), nacl (1 g), glycerol (4 g), mgcl2.6h2o (210 mg), cacl22h2o (14 mg), and thiamine (50 mg). The cultures were grown at 37 c with shaking at 220 rpm . At od600 0.3, the l - amino acids lysine (0.1 g), phenylalanine (0.1 g), threonine (0.1 g), isoleucine (0.05 g), leucine (0.05 g), and valine (0.05 g) were added . Additionally, 50 mg of [-h]-methionine (98%, cambridge isotope laboratories) or [,-h]-methionine (98%, cdn isotopes) was added per l of medium, followed by shaking for 20 min . The temperature was lowered to 25 c, and iptg was added to a final concentration of 1 mm . After 14 h, cells were pelleted by centrifugation (5000 g, 10 min, 4 c) and frozen at 80 c . Cell paste (2 g) was suspended in 20 ml of buffer a containing 1 mm pmsf . The cells were lysed by a single passage through a french pressure cell (14 000 psi). Dna was precipitated by dropwise addition of 0.2 vol of buffer a containing 6% (w / v) streptomycin sulfate . The mixture was stirred for an additional 10 min, and the precipitated dna was removed by centrifugation (20 000 g, 10 min, 4 c). The solution was stirred for an additional 20 min, and the precipitated protein was isolated by centrifugation (20 000 g, 10 min, 4 c). The pellet was dissolved in a minimal volume (0.3 ml) of buffer a and desalted using a sephadex g-25 column (1 20 cm, 15 ml) equilibrated with buffer containing bicine (30 mm, ph 7.5), tcep (5 mm), and 3% inositol . Reaction buffer containing bicine (30 mm, ph 7.5), kcl (30 mm), mgso4 (10 mm), and 3% inositol was prepared in d2o and lyophilized to remove exchangeable protons, brought into the glovebox, and redissolved in d2o (99.9%, cambridge isotope laboratories). Nrdd and nrdg were exchanged into this buffer by repeated dilution and concentration by ultrafiltration (amicon ym-30), such that <1% h2o remained . (a) to minimize levels of formate in the assay, components of the protein storage and reaction buffers found to contain a formate contaminant (tris base, glycerol, and dtt) were substituted with compounds containing undetectable levels of formate (tea, inositol, and tcep). The reaction was initiated in a glovebox in a 4 c cold room by mixing a solution of activated nrdd (20 l) with a solution containing 5-[h]-ctp, atp, and all other components of the reaction buffer (5 l). The final reaction mixture contained nrdd (100 m), 5-[h]-ctp (1.5 mm), atp (1.5 mm), tea (30 mm, ph 7.5), kcl (30 mm), and mgso4 (10 mm). After 40 s, the reaction was quenched by addition of 2% perchloric acid (20 l). (b) nrdd was incubated with 5-[h]-ctp and atp as described above, followed by addition of a mixture (1 ml) of hco2na (10 mm), mgso4 (3 mm), tea (10 mm, ph 7.5), and unlabeled ctp (1 mm). Subsequent to mixing, the sample was immediately quenched with 17 l of 60% perchloric acid . The total reaction time with formate prior to quenching with acid was <5 s. in both cases, the samples were neutralized with koh while cooling on ice, and the precipitated kclo4 was removed by centrifugation . Quantification of 5-[h]-cyt and 5-[h]-dc was carried out as described above . To a 7 ml portion of the eluate of the dowex-1-borate column, containing a mixture of 5-[h]-cyt and 5-[h]-dc, was added carrier cyt and dc (10 nmol each). The mixture was concentrated by lyophilization, redissolved in water, cooled on ice, and the precipitated borate salts removed by centrifugation . The supernatant was analyzed by hplc using an alltech econosil column (c18, 10 m, 250 4.6 mm) on a waters 515 hplc system equipped with a 2996 photodiode array detector . The compounds were eluted with kpi (20 mm, ph 6.8) at a flow rate of 1.0 ml / min . Ab initio calculations were performed using the q - chem software package, version 4.1 . Unless otherwise specified, calculations were performed in the gas phase, using spin - unrestricted kohn sham density functional theory (ks - dft) with the b3lyp approximate functional and the 6 - 31++g * * basis set . All spin - unrestricted calculations were verified to have spin contamination of <0.5% based on the calculated expectation of the spin operator s and its deviation from the ideal value of 0.75 (for a doublet system with spin quantum number s = 0.5). Visualizations were generated using the visual molecular dynamics (vmd) program using orthographic projection, with isosurface values of 0.05 for the orbitals and 0.0025 (0.05) for the spin densities, respectively . The thiosulfuranyl radical formed from the methanethiyl radical and ethylmethylsulfide was used as a minimal model system to investigate the electronic structure of the nrdd thiosulfuranyl radical . The model was constructed using the atomic coordinates of the side chains of c79 and m288 in the crystal structure of bacteriophage t4 nrdd (pdb accession i d 1hk8, figure s1a). Hydrogen atoms were added, and their positions optimized while fixing the heavy atoms in place . A plausible reaction coordinate for the formation of a thiosulfuranyl radical at each point along the reaction profile, the (methanethiyl) s1- (ethylmethylsulfide) s2 distance was fixed, and all the other coordinates were allowed to relax, to obtain the potential energy of the structure as a function of s1s2 separation . The stationary points on the potential energy surfaces were verified to be true minima by ensuring that they contain no imaginary frequencies . The resulting reaction coordinate represents the enthalpic contribution to creating a structure of a given s1s2 separation in the gas phase at 0k . Two experimental challenges had to be overcome in order to study the reaction of nrdd, ctp, and atp in the absence of the reductant formate . The first was to optimize g formation, and the second was to remove formate contaminants in the reaction mixture components so that the first half - reaction of rnr could be studied . E. coli nrdd and nrdg were expressed and purified by minimal modification of reported procedures, with the inclusion of 50 m zinc sulfate in the expression media for nrdd . The generation of g requires the activating enzyme nrdg, sam, and a reductant for the nrdg-[4fe4s] cluster . Previously studies have shown that generation of g by nrdg can be carried out catalytically with the e. coli flavodoxin (flda)/ flavodoxin reductase (fpr) system or with a stoichiometric amount of nrdg and photoreduced deazaflavin . We wanted to activate nrdd catalytically to minimize possible interference from the activating components, which are difficult to routinely remove due to the o2-sensitivity of g. we also wanted to avoid the flda / fpr system because an epr signal from the flda semiquinone might complicate analysis of the epr spectra . We initially focused on using a catalytic amount of nrdg activated with photoreduced deazaflavin . However, this method proved unsuccessful as this photoreducant resulted in the reversible quenching of g. several photoreductant / coreductant pairs were screened, including all combinations of photoreductants acriflavin, fluorescein, and rose bengal and coreductants edta, tetramethylethylenediamine, tea, bicine, and cysteine . The rose bengal / bicine pair was chosen because it did not reduce the nrdd - g. this pair was used for all epr experiments . However, bicine contains a small amount of formate (see removal of formate from reaction and protein storage buffers section), and thus it was replaced with rose bengal / tea for all experiments involving product analysis, where the complete removal of formate is desired . Nrdd purified and activated in either way had 0.5 g per peptide (figure 2i) and a specific activity of 1500 u / mg for ctp reduction, consistent with literature values . When nrdd, [h]-ctp, and allosteric effector atp were incubated in the absence of formate and analyzed for product, we were surprised to detect dctp . Since the formation of dctp requires a reductant, we suspected that formate contaminated one or more of our reagents . Several methods were used to assess its presence . Using a coupled assay with formate dehydrogenase, formate was detected in the tris base and glycerol used in the protein storage and reaction buffers . These components were thus replaced with tea and inositol . A second more sensitive assay monitored [h]-dctp formation, which suggested formate presence in dtt . We found that nrdd activity could be maintained by replacing it with 5 mm tcep in the nrdd storage buffer . Using this formate - free buffer, figure 3i shows the cw x - band epr spectrum of the g that is generated by nrdg . Incubation of activated nrdd with ctp and allosteric effector atp for 1 min at 4 c led to the loss of g and the appearance of a new radical shown in figure 3ii, accompanied by a spin loss of 5% . Subsequent addition of saturating amounts of formate (10 mm, km = 0.2 mm) led to the disappearance of the new radical and return of the g spectrum with a yield of 80% . X - band cw epr spectra (black) and simulations (red) of nrdd glycyl and thiosulfuranyl radicals . The narrow signal of the g was scaled by a factor of one - tenth for comparison with the broader signals of the new radical . The spectral artifact at 337.5 mt (ge) is due to an impurity in the cryostat . (ii v) the thiosulfuranyl radical generated by reaction of ctp and atp in the absence of formate with (ii) nrdd in h2o, (iii) [-h]-cys - nrdd in h2o, (iv) nrdd in d2o, and (v) [-h]-cys - nrdd in d2o . In addition, three peaks at 329, 331, and 332 mt and structure in the region of 333340 mt suggest hyperfine interactions with several protons . In analogy with the mechanism of the class ia rnrs, we hypothesize that in the absence of formate, nrdd catalyzes cleavage of the 3 c h bond and loss of h2o from ctp to form 3-keto - dctp, generating a thiyl radical on c175 (figure 1c, 7). Because the new radical is long - lived (t1/2 10 min at 4 c), we propose that it might be the c175 thiyl radical stabilized by a bonding interaction with the conserved m382 residue on the thiyl radical loop, in the form of a thiosulfuranyl radical (figure 1c, 8), resembling the disulfide anion radical (figure 1b, 4) of the class ia rnr . In the crystal structure of t4 nrdd, the distance between the sulfur atoms of c79 and m288 is 4.4 (figure s1a). To test this hypothesis, we pursued further epr spectroscopy of the new radical at high microwave frequency to separate g - anisotropy from hyperfine interactions, in combination with isotope labeling of nrdd at x - band frequency to identify the proton hyperfine interactions contributing to the spectrum . Figure 4 shows the echo - detected 140 ghz epr spectrum of activated nrdd reacted with ctp and atp . The spectrum is dominated by a broad signal stretching from 4.902 to 4.998 t arising from a radical with a rhombic g - tensor but also shows a narrow signal around 4.993 t. the narrow signal is readily assigned to residual g present in the sample the principal values of its g - tensor are gx = 2.040, gy = 2.013, gz = 2.0016 . These g - values are inconsistent with a thiyl radical, where the gx value is expected to be shifted further downfield but are similar to g - values previously reported for putative thiosulfuranyl radicals . 140 ghz echo - detected epr spectrum (black) and simulation (red) of the nrdd thiosulfuranyl radical in h2o . If the new radical is partially localized on c175 it will likely exhibit hyperfine interactions with its -protons . It reveals, in comparison with the unlabeled nrdd (figure 3ii), loss of a strong hyperfine interaction, providing evidence for localization of the radical on cysteine . Another, strong hyperfine interaction remains and now dominates the spectrum . In search of the origin of this other proton hyperfine interaction (figure 3iii), we obtained the x - band spectrum of the reaction of nrdd with ctp and atp carried out in d2o (figure 3iv). Again, the spectrum has clearly lost a strong hyperfine interaction, which suggests that the unpaired electron interacts with a solvent exchangeable proton . At 4 c this exchange is complete within the 1 min required for sample preparation, and longer incubation does not lead to further changes in the signal profile . Finally, carrying out the reaction of [-h]-cys - nrdd in d2o leads to a spectrum that no longer shows any resolved hyperfine interactions (figure 3v). Comparison of this spectrum with unlabeled nrdd in d2o reveals an isotropic hyperfine interaction of 30 mhz with the nonexchangeable -proton of cysteine . Comparison of this spectrum with [-h]-cys - nrdd in h2o, on the other hand, reveals a hyperfine interaction of 50 mhz associated with the exchangeable proton, possibly the second -proton of cysteine . The exchange of a -proton of cysteine is unexpected and thus requires further verification . We hypothesized that if this exchange involved deprotonation to form a thiyl radical anion (figure 5a), then introduction of a negative charge near the radical could disfavor this process . The structure of t4 nrdd suggests that c175 of e. coli nrdd is positioned close to s386, which resides on the thiyl radical loop and aligns with e441 in e. coli nrda, a residue thought to act as a general base / acid catalyst in the class ia rnr (compare figures s1a and s1b). We constructed the nrdd-(s386e) mutant and reacted it with ctp and atp in d2o . 1% that of nrdd-(wt), and the new radical also formed at a much slower rate than with nrdd-(wt), requiring a reaction time of 1 h. the x - band spectrum of nrdd-(s386e) in d2o resembles the spectrum of nrdd-(wt) in h2o (compare figure 5bi with figure 3ii), which suggests that the proton exchange is blocked and that the structure of the radical remains largely unaffected . (a) proposed mechanism for proton exchange on c175, which is prevented in nrdd-(s386e). (b) x - band cw epr spectra (black) and simulations (red) of (i) nrdd-(s386e) in d2o and (ii) [-h]-cys - nrdd-(s386e) in h2o . The spectral artifact at 337.5 mt (ge) is due to an impurity in the cryostat . The suppression of the proton exchange by nrdd-(s386e) allows the site of the exchangeable proton to be unambiguously established . A reaction of [-h]-cys - nrdd-(s386e) in h2o with ctp and atp revealed the spectrum in figure 5bii, which is very similar to that of [-h]-cys - nrdd-(wt) in d2o (figure 3v). Thus, the exchangeable proton is a -proton of c175, and the exchange occurs stereospecifically . We hypothesize that the new radical involves m382 (figure 1c 7 and 8). To test this model, [-h]-met - nrdd was prepared, and the resulting radical examined for the effects of isotopic substitution . Comparison of the spectrum of [-h]-met - nrdd (figure 6i) and unlabeled nrdd (figure 3ii) in h2o revealed sharpening of the three peaks between 329 and 332 mt . Moreover, in the region 333340 mt, a fine structure consisting of lines separated by 0.5 mt (marked with vertical lines in figure 6i) has become clear . This fine structure is also present in the spectrum of unlabeled nrdd in h2o (figure 3ii, see vertical lines) but is not fully resolved . This shows that in unlabeled nrdd, the fine structure is masked by a broadening of the peaks due to unresolved hyperfine interactions with the three -protons of methionine . X - band cw epr spectra (black) and simulations (red) of the nrdd thiosulfuranyl radical in (i) [-h]-met - nrdd in h2o; (ii) [-h]-met - nrdd-(s386e) in d2o; (iii) [,-h]-met labeled nrdd-(s386e) in h2o, and (iv) [-h]-cys,[-h]-met - nrdd in h2o . See the text and table 1 for the simulation parameters . To further investigate the fine structure, we obtained the spectrum of [-h]-met - nrdd-(s386e) in d2o (figure 6ii). D2o exchanges the envelope protons around the active site, sharpening the features associated with the thiosulfuranyl radical, while the s386e mutation prevents exchange of the c175 proton . Comparison of this spectrum (figure 6ii) with that of the corresponding nrdd-(wt) (figure 6i) reveals an almost identical radical signal with sharpened features . The fine structure could be reproduced in the simulation by including two additional hyperfine interactions of 14 mhz, which we propose to be associated with the two protons of m382 . Evidence for this hypothesis was obtained from the spectrum of [,-h]-met - nrdd-(s386e) in h2o (only the doubly labeled methionine is commercially available). The results shown in figure 6iii reveal the loss of the two 14 mhz hyperfines, consistent with our model . Thus, our studies using a combination of [-h]-met- and [,-h]-met - labeled proteins support the role of methionine in the thiosulfuranyl radical . As shown in figures 36, simulations of the epr spectra using the epr simulation package easyspin were successfully performed, providing the underlying g - values and hyperfine interactions that support our electronic and structural assignments . The simulation of the spectrum of nrdd-(wt) in h2o (figure 3ii) was built step - by - step . Then, the hyperfine interactions were estimated for each of the four different types of protons from the appropriately labeled nrdds in h2o and d2o (figure 3ii v and figure 6). Finally all hyperfine interactions were optimized in a manual, global fit of all acquired spectra . The quality of all of the 9 and 140 ghz simulations improved when we included an isotropic line - broadening of 0.4 mt peak peak and a g - strain 10% of |gi - ge|, with i = x, y, z and ge the g - value for the free electron . Furthermore, all samples were found to contain a residual 510% g. to simulate its contribution to the spectra, its g - values (gx = 2.0044, gy = 2.0035, gz = 2.0023), an isotropic hyperfine interaction with a proton of aiso = 39 mhz, and an isotropic line - broadening 1 mt peak peak was included . For simulations of the thiosulfuranyl radical on nrdd-(s386e), the parameters derived from the spectra of nrdd-(wt) were used, except that gx was adjusted to 2.042 . Additional observations concerning the simulations require comment . First, the match between our spectra and the simulations improved with the introduction of a small anisotropy to three of the four proton hyperfine interactions listed in table 1 . -electron and a -proton that lies above or below the plane of the electron spin distribution (see figure 7a and the quantum chemical calculations in the quantum chemical calculations section). Because these dipolar contributions are small, we did not attempt to quantify them by using more advanced fitting methods as they depend on three unknown euler angles for every proton, which cannot be accurately determined from our current data set . Second, on the low - field side of the 140 ghz spectrum (figure 4) the intensity is lower than predicted by the simulation . This is caused by anisotropy of the relaxation properties of the thiosulfuranyl radical, also observed for thiyl radicals . Third, although the spectrum of [-h]-cys - nrdd in h2o (figure 3iii) does not show any resolved fine structure due to the two -protons of methionine, the quality of the simulation improves when these hyperfine interactions is included . The same is true for the spectrum of [-h]-cys and [-h]-met nrdd in h2o (figure 6iv), where including the -proton hyperfine interactions in the simulation reproduces the unresolved splitting of the 334 mt peak (marked with arrows). Fourth, and in contrast with the above observation, in all samples where the exchangeable cysteine -proton is replaced by deuterium (figures 3iv, v and 5ii), inclusion of the hyperfine interactions with the methionine -protons in the simulation gives rise to features that are not observed in the experimental spectra . More advanced epr techniques such as [h]-endor spectroscopy are required to investigate the presence of any interaction of the radical with the methionine -protons in these and other samples and to more accurately measure the hyperfine interactions that we have assigned . To better understand the electronic structure and bonding in thiosulfuranyl radicals, we undertook a computational study using a minimal model system consisting of methanethiyl radical and ethylmethylsulfide . Dft calculations were performed to obtain a plausible reaction coordinate for the formation of a thiosulfuranyl radical . This analysis yielded the reaction profile shown in figure s2, as a function of the separation of the thiyl (s1) and thioether (s2) sulfur atoms . An energetically minimal structure was found at a s1s2 distance of 3.2, with a binding energy of 1.8 kcal / mol relative to dissociated methanethiyl radical and ethylmethylsulfide . The molecular orbitals involving the sulfur 3p orbitals of the nonoptimized structure derived from the x - ray structure coordinates are shown in figure s3, while those of the energetically minimal structure are shown in figure s4 . The unrestricted dft calculation yields separate spin orbitals for the and (up and down) spin electrons . While all the sulfur 3p orbitals of the nonoptimized structure are noninteracting (figure s3), the s1 and s2 3pz orbitals of the energetically minimal structure engage in a bonding interaction (figure s4). The * antibonding singly occupied molecular orbital (somo) and the bonding somo-1 are highlighted in figure 7a . Together, they account for a s1s2 three - electron -bond of order 1/2 . The frontier orbitals show significant electron amplitude on two of the hydrogen atoms on the methanethiyl fragment . Localization of a hydrogen atom within the lobe of the * orbital could account for its lability as observed in the epr experiments . The lack of bonding in the nonoptimized protein structure, where s1 and s2 are separated by 4.4 suggests that a conformational change is required to bring c175 and m382 within bonding distance . Excess spin density coincides with the * orbital, with a small component on two of the methanethiyl hydrogens . To quantify the spin excesses on an atomic level, lwdin population analysis was performed on the spin density matrix, and the resulting spin charges are shown in figure 7b . Most of the spin (83%) is localized on the methanethiyl sulfur, with a smaller population (15%) on the thioether sulfur . In addition, a small amount of excess spin is localized on two methanethiyl hydrogens (2.1% and 2.5%) and to a lesser extent on several protons adjacent to the thioether group (0.10.5%), which is consistent with the observation of hyperfine interactions with the cysteine -protons and methionine - and -protons in the nrdd radical . In nrdd, the relative magnitude of the hyperfine interactions likely depends on the angle of rotation about the cysteine and methionine c s bonds, which are dictated by the constraints of the protein scaffold . (a) frontier molecular orbitals for the model thiosulfuranyl radical formed from methanethiyl radical and ethylmethylsulfide . Diagrams for the and spin orbitals are shown separately on the left and right, respectively, together with orbital energies in kcal / mol, which represent the ionization enthalpy of the electron in that orbital . For each diagram, the leftmost and rightmost orbitals represent the fragment molecular spin orbital of the methanethiyl and methylethylsulfide fragments, respectively, which mix to produce the bonding and * antibonding orbitals . Snpz refers to the 3pz orbital on the sulfur atom of fragment n (1 = methanethiyl, 2 = ethylmethylsulfide). (b) atomic spin populations obtained from lwdin population analysis on the model thiosulfuranyl radical, showing excess spin density localized primarily on the sulfur atoms and secondarily on two of the hydrogen atoms of the methanethiyl fragment . As shown in figure 1c, we propose that formation of the thiosulfuranyl radical involves nrdd catalyzing the conversion of ctp to 3-keto - dctp (figure 1c, 7 and 8). To investigate the fate of ctp during the reaction, the thiosulfuranyl radical was generated by incubating nrdd with 5-[h]-ctp and atp in the formate - free buffer for 40 s at 4 c followed by quenching in 1% perchloric acid . Workup of the reaction using a dowex-1-borate column, as shown in figure 8, gave 1.0 0.14 equiv of 5-[h]-cyt and 0.38 0.25 equiv of dc (identified by comigration with a standard using hplc). The former is a breakdown product of 3-keto - dctp (figures 2 and 8), consistent with our proposed model, and the latter is attributed to our inability to completely remove formate from the reactions components . As noted above, addition of 10 mm formate to the thiosulfuranyl radical results in the recovery of 80% of the initial g. we propose that during this reaction, nrdd - bound 3-keto - dctp is reduced to dctp, completing the catalytic cycle . The experiment was repeated as described above, incubating nrdd, 5-[h]-ctp, and atp in formate - free buffer for 40 s at 4 c . A 1 ml solution containing 10 mm formate and 1 mm ctp was then added, followed by immediate quenching by hand with 1% perchloric acid . The unlabeled ctp was added to dilute 5-[h]-ctp 27-fold to limit the contribution of [h]-dctp to the first turnover . The work - up is as described (figure 8), and the results reveal 0.12 0.03 equiv of 5-[h]-cyt and 1.57 0.21 equiv of 5-[h]-dc (see table 2). Comparison with the products formed by acid quench without addition of formate reflects a decrease in the amount of cyt and increase in the amount of dc detected . This suggests that 0.88 0.14 equiv of enzyme - bound 3-keto - dctp is consumed and converted to dctp and that nrdd carries out only 0.3 additional turnovers between addition of formate and acid quench . To account for the 0.12 equiv of cyt remaining after reaction with formate, we suggest that during the reaction time of 40 s prior to addition of formate, some amount of the 3-keto - dctp dissociates from the enzyme and decomposes to cyt before or during the acid quench . However, it is remarkable that the results suggest that the 3-keto - dctp remains largely sequestered in the active site during this period . Products formed after quenching of the thiosulfuranyl radical generated by reaction of nrdd with 5-[h]-ctp and atp . (i) quenching with perchloric acid leads to release of 5-[h]-cyt from breakdown of 5-[h]-3-keto - dctp . (ii) addition of formate prior to quench leads to conversion of 3-keto - dctp to 5-[h]-dctp . Average of five experiments (results for the individual trials are given in figure s6). Thiyl radicals have long been proposed to be involved in a diverse range of enzymatic reactions from the pyruvate - ferredoxin oxidoreductase to pyruvate formate lyase and all classes of rnrs . More recent examples include mechanistically diverse glycyl radical enzymes involved in fermentation, in the environmentally important processes of anaerobic hydrocarbon activation, and the noncanonical glycyl radical enzyme involved in the formation of methane from methyl phosphonate . However, the spectroscopic observation of thiyl radicals and the demonstration of their kinetic competence has been challenging due to their short lifetimes and the large spin orbit coupling with the sulfur atom, which results in short relaxation times and large g - anisotropy and as a consequence broad epr lines . In the class i and ii rnrs, three cysteines are involved in nucleotide reduction (figure 1a, b): the transient thiyl radical located on the top face of the nucleotide and two cysteines located on its bottom face that are converted to a disulfide in the reduction process . Only in the case of the lactobacillus leichmannii class ii rnr has evidence for the involvement of a kinetically competent top face thiyl radical in the first half - reaction (figure 1a) been demonstrated . The evidence in support of this mechanism for the class i and iii rnrs is inferred based on structural homology of all the classes of rnrs and extensive biochemical studies . In the second half - reaction (figure 1b), the involvement of a thiyl radical in the nucleotide reduction by the bottom face cysteines has been postulated . In the e. coli class ia rnr, e441 is believed to provide the proton required for the reduction of the 3-keto - deoxynucleotide by the disulfide anion radical via proton - coupled electron transfer (figure 1b, 4 and 5). Support for this proposal has been provided by studies with the e441q mutant that causes accumulation of the disulfide anion radical on the 10 s time scale, allowing its detection by pulsed, high - field epr spectroscopy . However, a limitation from the mutant studies is that the trapped radical is not chemically competent for deoxynucleotide formation because the essential proton for the pcet step is missing . Thus, the detailed mechanism of the bottom face reduction chemistry, and specifically the involvement of thiyl radicals, has remained elusive . Unlike class i and ii rnrs, the class iii rnrs studied to date use formate as a reductant . We hoped that examination of this rnr might shed light on the second half - reaction of all rnrs . Here we have shown that omission of formate from our assays leads to accumulation of a new radical upon reaction of nrdd with ctp and atp, accompanied by formation of a bound cytidine species proposed to be 3-keto - dctp (figure 1c, 7 and 8). Furthermore, addition of formate converts the bound nucleotide into dctp with recovery of the g. our studies suggest that the new species is a thiosulfuranyl radical and demonstrate its chemical competence . These results provide further evidence for the involvement of a thiyl radical in the reductive half - reaction of rnrs in general . Assignment of the structure of the new radical is based on results from isotopic labeling studies with various nrdds accompanied by analysis of their x band epr spectra, g - values obtained by 140 ghz epr studies, structural insight from the bacteriophage t4 nrdd, and computational studies . Important insight is also provided by recent dft and correlated ab initio calculations by van gastel et al . On the electronic structure of the cysteine thiyl radical and its unusual epr parameters . Thiyl radicals exhibit broad g - anisotropy with gx - values (x axis parallel to the cs bond) that range from 2.10 to 2.49 . In the cysteine thiyl radical, the epr g - values are sensitive to the energy difference between the nearly degenerate singly occupied orbital (somo with a predominant py character in van gastel s system) and one of the lone - pair orbitals (pz). This unusual property makes gx highly sensitive to radical conformation and h - bonds and requires an expression for the g - tensor in which third - order corrections must be taken into account . The g - tensor for our new radical from the 140 ghz epr spectrum is also anisotropic (figure 4), with a gx value of 2.040 . This value is distinct from the thiyl radicals and is consistent with the range of values reported for candidate thiosulfuranyl radicals generated by pulse radiolysis and laser flash photolysis of a range of thiols (2.0272.058). S bonds in these structures are weak and have only been observed in small molecules containing electronegative alkyl substituents (cf3ssr2 or rcossr2), in glasses / solid matrices, or in intramolecular cases . Arguments in favor of the assignment of these species as thiosulfuranyl radicals are described by symons and co - workers . In nrdd, the formation of the thiosulfuranyl radical is likely favored by the juxtaposition of the c175 and m382 sulfur atoms within the active site by the protein . Our calculations on a model thiosulfuranyl radical provide an explanation for our observed gx value relative to that of a thiyl radical . They suggest that the * antibonding somo and the bonding somo-1 together account for a weak, s1s2 three - electron -bond of order 1/2 due to the interaction between the sulfur 3pz orbital of the thiyl radical and a nonbonding orbital of the thioether . This interaction is expected to perturb both the symmetry and degeneracy of the thiyl radical 3py and 3pz orbitals, shifting the gx value closer to that of the free electron . Our isotopic labeling studies with nrdd / ctp / atp provide strong evidence for localization of the radical on cysteine and methionine as hyperfine interactions associated with both cysteine -protons and the methionine - and -protons are observed . The spin densities from our dft calculations also suggest that excess spin of the three - electron bond includes small packets of spin localized on the cysteine -protons and to a lesser extent on the adjacent and protons of methionine (figures 7b and s5). One initially puzzling observation from our epr analyses was that one of the cysteine -protons on the thiosulfuranyl radical was exchangeable with the solvent . However, perusal of the literature focused on examining the fate of thiyl radials generated by a variety of different methods in small molecules (cysteine, penicillamine, glutathione) in d2o revealed reversible deuterium incorporation into both the and/or positions . In cysteamine radicals generated by pulse radiolysis in acidic solution, hydrogen - transfer reactions lead to the equilibration of h3nch2ch2s and h3nch2ch sh species with very fast forward and reverse rates of k12 10 s and k21 1.5 10 s, respectively . In the case of nrdd c175, we propose that its -ch bond might be weakened by a hyperconjugative interaction with the singly filled sulfur pz orbital, facilitating its deprotonation and allowing exchange with deuterium from the solvent, although the mechanism remains to be determined . This result is also consistent with our dft calculations showing the localization of a proton within a lobe of the s s * orbital, and the observation that of the two diasteriotopic -protons on cysteine (we do not know which one), the one with the largest hyperfine interaction is exchanged . The exchange is prevented in nrdd-(s386e), where the negative charge adjacent to the radical was designed to destabilize the conjugate anion and thus disfavor deprotonation (see figure s1). Finally, the rapid exchange of hydrogens adjacent to the thiyl radical might provide a diagnostic for thiyl radicals in general which have been, for reasons outlined above, challenging to observe . Based on earlier studies and our observations reported herein, we propose the mechanistic model for nucleotide reduction shown in figure 1c for the class iii rnr . The reaction is initiated by the generation of the ctp 3-radical (2) by the c384 thiyl radical . In the absence of basic residues in the active site, formate has been proposed to act as a base to catalyze water loss to form a ketyl radical (3). The ketyl radical gains an electron from c175 and a proton from formic acid, forming 3-keto - dctp and generating the thiosulfuranyl radical (8). For the experiments in formate - free buffer, 3-keto - dctp can still be generated without base catalysis . This observation is analogous to the e441q mutant in the class i rnr where the 3-keto - dcdp is still formed, but at a much slower rate . Exchange of formate between the active site and buffer after formation of this stable radical rationalizes the [h]-formate isotope effect of 2.3 measured on the reduction process . A similar reaction between formate and dtt radicals generated by pulse radiolysis has previously been reported . The relative reduction potentials of co2 (e = 1.90 v) and (ch3)2co (e = 2.10 v) suggest that reduction of 3-keto - dctp to the dctp 3-radical (10) may require the concerted delivery of a proton from an unknown source . Alternatively, the delivery of the proton and electron may occur via a stepwise mechanism as shown in figure s7 . Reduction of the product radical generates dctp and regenerates the c384 thiyl radical (11). In our mechanistic model, although the function of the thiosulfuranyl radical, a stabilized form of the c175 thiyl radical, is not understood, its stoichiometric formation and ability to catalyze the formation of deoxynucleotide upon formate addition suggest its mechanistic importance . We hypothesize that since formate can enter and leave the active site even after generation of radical intermediates, formation of this species might protect the c175 thiyl radical in vivo under conditions when formate levels are low and the enzyme is saturated with substrate and effector nucleotides . The unanticipated identification of a residue (m382) that plays a part in the reaction with formate provides us with a handle to search for nrdds that use alternative reductants among the many metabolically diverse organisms with sequenced genomes . An examination of the rnrdb shows that m382 is not strictly conserved (figure s8). All annotated archaeal and bacterial nrdd sequences lacking this m382 residue contain a cysteine residue in place of g383 on the thiyl radical loop adjacent to c384 (figure s9), in a position that may allow formation of a disulfide with the bottom face thiol . In addition, the bacterial proteins contain a conserved glutamate residue aligning with y542 in the active site (compare figures s1a and s9), placing it in a position to act as a general base / acid catalyst analogous to the role of e441 in e. coli nrda . These residues are shown in the homology model of the thermotoga maritima nrdd given in figure s9 . Finally, archaeal nrdds, like those found in archaeoglobus veneficus and methanosarcina barkerii, contain a thioredoxin - like protein in the nrddg operon . All these observations suggest that there exist nrdds that use disulfide chemistry instead of formate for nucleotide reduction . The recombinant production and characterization of some of these proteins are the focus of ongoing studies . Despite the many enzymatic reactions proposed to involve thiyl radicals, there have been few systems that have allowed their spectroscopic and chemical characterization . In this study we found that reaction of the e. coli class iii rnr with ctp in the absence of formate resulted in stoichiometric accumulation of a thiosulfuranyl radical, comprising a cysteine thiyl radical stabilized by a three - electron bond to a methionine residue . This new sulfur - based radical joins other sulfur - based radicals observed in the other two classes of rnrs: the class ia disulfide anion radical proposed to be involved directly in nucleotide reduction and the class ii exchange coupled thiyl radical - cob(ii)alamin involved in 3-hydrogen atom abstraction that have been experimentally detected . Our results suggest that detecting thiyl radicals and controlling their reactivity may require an orchestrated constellation of residues adjacent to the thiyl radical that protects it from alternative chemistry while allowing the reaction to proceed rapidly when the substrate (effectors) is in the appropriate conformation.
|
Intra - uterine insemination (iui) was first introduced as a technique for subfertility around 200 years ago . This is a simple, inexpensive and non - invasive infertility treatment which is the most frequently used assisted repro - ductive technology (art) worldwide (1). Proper patient selection and sperm preparation became the first step for success in iui program (2). Several factors affect the iui outcome, such as age, etiology and duration of infertility, endometrial thickness, time of ovulation, follicular number, time and number of insemination (3). Iui has been accepted for the treatment of infertile couples with a variety of indications including mild male factor infertility; unexplained infertility and cervical mucus hostility (4). The correlation between sperm quality and clinical outcomes has been distinguished in iui setting . In routine sperm preparation using swim - up or density gradients techniques, sperm are selected on the basis of progressive motility, morphological characteristics, and concentration for iui . These parameters, however, may not guarantee the selection of spermatozoa with normal dna / chromatin integrity (5). Sperm dna damage and apoptosis are useful indicators for male factor fertility and have a significant relation with infertility of men (6, 7). In testicular biopsies, increased rates of apoptosis it is not clear whether the apoptotic markers recognized in spermatozoa are the remainders of an inconclusive apoptotic process initiated before ejaculation or whether they result from apoptosis started in the post - ejaculation period (1). Apoptosis is a programmed cell death that takes place physiologically without any inflammation (9). Recent studies have indicated that protamine deficiency and sperm dna damage are associated with poor art outcomes (10, 11). Cma3 reversibly binds to g - c base pairs in the minor groove of dna . It has been reported that sperm protamine deficiency is associated with fertilization failure (12). Considering the advantage of cma3 in assessment of protamine, and its possible use in andrology units, this quick evaluation of sperm with cma3 received much attention during recent years . Evenson and his associates showed that abnormal chromatin packaging appears to be linked with nuclear dna damage (13). The objective of this cross - sectional study was to assess the relationship of sperm parameters as well as chromatin integrity and apoptosis with iui outcomes in two groups of patients with female or mild male factor infertility . According to infertility etiology, patients were divided into two groups with mild male factor (group m; n = 29) and female factor infertility (group f; n = 31). This investigation lasted from 2010 to 2011 at research and clinical center for infertility in yazd . All women underwent ovarian stimulation with daily use of 100 mg clomiphene citrate (clomifen, leiras, finland) given between days 3 and 7 of cycle, followed by 150 iu of gonadotrophins (ibsa co, switezerland) added on day 9 . Follicle growth and maturation diameter of growing follicles was recorded on days 10 to 13, and 10,000 iu of hcg (ibsa co, switzerland) was administered when at least one or two follicles were over 18 mm in diameter . The ejaculates were collected after 23 days of sexual abstinence and delivered to the andrology laboratory . After semen liquefaction, sperm were analyzed for rates of progressive and non - progressive motility according to who criteria (14). Smears were prepared from each sperm sample, dried, then fixed in carnoys solution (methanol / glycial acetic acid, 3:1) at 4c for 10 min . Each slide was treated with 150 l of cma3 (sigma, st louis, usa) (0.25 mg / ml in mcvalin buffer; 7 ml citric acid, 0.l m + 32.9 ml (na2hpo4)7h2o, 0.2 m, ph = 7.0 containing 10 mm mgcl2) for 20 min . After staining, the slides were washed in buffer and mounted with buffered glycerol (glycerol: mcvalin, 1:1). Chromycine a3-reacted (cma3) sperm with protamine deficiency were bright yellow stained, and yellowish green stained ones were related to mature sperm with complete protamination (cma3) recognized under fluorescent microscope with a 460 nm filter (zeiss co, jena, germany) (15). Sperm apoptosis was recognized using apoptosis detection kit (roche applied sci, germany). Smears were dried and fixed in 4% paraformaldehyde in pbs (gibco co, scotland, uk) at room temperature (rt) for 1 hr . The slides were then rinsed three times with pbs and incubated with 0.3% h2o2 in methanol for 1 hr to quench endogenous peroxidase activity . The samples were treated with 0.1% triton x-100 (sigma co, usa) for 5 min at 4c and incubated with 50 l tunel reaction mixture in a humidified chamber at 37c for 1 hr . The samples were washed in pbs and exposed to dab (3,3-diaminobezidine tetrahydrochloride) (roche co, germany) as the substrate solution for color development in a dark chamber at rt for 10 min . At last, samples were dehydrated in ethanol, cleared in xylene (sigma co, usa), and mounted . For each sample, at least 200 nuclei were counted . For negative control, instead of tunel reaction mixture, slides were incubated with 50 l of labeled solution with terminal transferase . Statistical analyses were done using t - test and mann whitney test for sperm apoptosis and sperm chromatin by spss (version 16). According to infertility etiology, patients were divided into two groups with mild male factor (group m; n = 29) and female factor infertility (group f; n = 31). This investigation lasted from 2010 to 2011 at research and clinical center for infertility in yazd . All women underwent ovarian stimulation with daily use of 100 mg clomiphene citrate (clomifen, leiras, finland) given between days 3 and 7 of cycle, followed by 150 iu of gonadotrophins (ibsa co, switezerland) added on day 9 . Follicle growth and maturation diameter of growing follicles was recorded on days 10 to 13, and 10,000 iu of hcg (ibsa co, switzerland) was administered when at least one or two follicles were over 18 mm in diameter . The ejaculates were collected after 23 days of sexual abstinence and delivered to the andrology laboratory . After semen liquefaction, sperm were analyzed for rates of progressive and non - progressive motility according to who criteria (14). Smears were prepared from each sperm sample, dried, then fixed in carnoys solution (methanol / glycial acetic acid, 3:1) at 4c for 10 min . Each slide was treated with 150 l of cma3 (sigma, st louis, usa) (0.25 mg / ml in mcvalin buffer; 7 ml citric acid, 0.l m + 32.9 ml (na2hpo4)7h2o, 0.2 m, ph = 7.0 containing 10 mm mgcl2) for 20 min . After staining, the slides were washed in buffer and mounted with buffered glycerol (glycerol: mcvalin, 1:1). Chromycine a3-reacted (cma3) sperm with protamine deficiency were bright yellow stained, and yellowish green stained ones were related to mature sperm with complete protamination (cma3) recognized under fluorescent microscope with a 460 nm filter (zeiss co, jena, germany) (15). Sperm apoptosis was recognized using apoptosis detection kit (roche applied sci, germany). Smears were dried and fixed in 4% paraformaldehyde in pbs (gibco co, scotland, uk) at room temperature (rt) for 1 hr . The slides were then rinsed three times with pbs and incubated with 0.3% h2o2 in methanol for 1 hr to quench endogenous peroxidase activity . The samples were treated with 0.1% triton x-100 (sigma co, usa) for 5 min at 4c and incubated with 50 l tunel reaction mixture in a humidified chamber at 37c for 1 hr . The samples were washed in pbs and exposed to dab (3,3-diaminobezidine tetrahydrochloride) (roche co, germany) as the substrate solution for color development in a dark chamber at rt for 10 min . At last, samples were dehydrated in ethanol, cleared in xylene (sigma co, usa), and mounted . For each sample, at least 200 nuclei were counted . For negative control, instead of tunel reaction mixture, slides were incubated with 50 l of labeled solution with terminal transferase . Statistical analyses were done using t - test and mann whitney test for sperm apoptosis and sperm chromatin by spss (version 16). The data showed that non - progressive motility as well as normal morphology of spermatozoa was similar between the m and f groups . However, significant differences in other sperm parameters were observed between the groups (table 1). The clinical pregnancy rate was noticeably higher in f (6/31; 19.3%) than m group (1/29; 3.4%; p = 0.06). The data also showed that 28.6% (2/7) of the cases achieved multiple pregnancies . Non - pregnant group showed a significant number of immotile sperm, when compared with pregnant patients (p <0.01). With regard to infertility duration, no relation was noticed between duration of infertility and pregnancy rates (table 2). In addition, the results did not show any significant differences in age between pregnant and non - pregnant cases . Comparisons of sperm parameters in two groups with female or male factor infertility undergoing iui data are presented as meansd, ns: not significant, values inside parentheses represent (%) comparisons of sperm characteristics in pregnant and non - pregnant patients data are presented as meansd, ns: not significant, values inside parentheses represent (%) the findings also showed that the rate of sperm with protamine deficiency increased in sperm samples from patients with mild male infertility, when compared with the other group (p <0.01; figure 1). Also, the rate of protamine deficiency significantly increased in non - pregnant when compared with pregnant patients (p <0.05; table 2). Other findings confirmed that there was no correlation between abnormal sperm morphology and increased rate of dna damage . However, our result showed that there were no significant differences in the rate of apoptosis in both groups of patients when compared between pregnant and not pregnant patients (table 2; figure 2). In addition, the result of comparison between male and female cases in correlation with sperm apoptosis was statistically similar . Chromomycin a3 (cma3) staining: cma3 + or protamine deficient spermatozoa appear as bright yellow, cma3- or spermatozoa with normal protamine appear yellowish green tunel staining: brown stained sperm shows apoptosis+, light colored sperm indicates apoptosis some authors suggested that outcomes of semen with poor sperm morphology were comparable with normal sperm morphology in iui setting (16). Recently, it was demonstrated that both sperm morphology and progressive motility had positive effects on iui outcomes (17). Others found that normal sperm morphology can be considered as a predictor of iui success (18). Also, van voortis et al . Noticed that semen with less than 10 million motile sperm was associated with lower pregnancy rates in iui cycles . It was shown that when the count of motile sperm was above 10 million, no significant increase would be achieved in iui pregnancy rates (19). In this study, both sperm count and progressive motility were demonstrated to be lower in cases with mild male factor infertility when compared with female infertility . Conversely, concentration of immotile spermatozoa was observed to be higher in male factor and non - pregnant patients when compared with the other group . Prior to sperm preparation, total motile sperm of 3050% our findings showed that the rates of normal sperm morphology were similar in both infertile groups . Therefore, sperm morphology criterion could not be a reliable predictive indication for iui outcome . However, assessment of sperm dna integrity can be used as a good practicability factor, particularly in patients with male infertility . The findings of this study indicates that in order to select the right candidates for clinical iui, it is necessary to perform cytochemcial assays to assess the sperm dna integrity of patients . These assays should be done in combination with semen analysis, especially for patients with male factor infertility . This study also showed that patients with mild male factor infertility are not suitable candidates for iui, since the rate of chromatin immaturity in their sperm was very high . Therefore, they may benefit from other art techniques, such as icsi . In one study, sperm chromatin structure and dna integrity were known to have a critical effect on the rate of fertilization (21). The sperm chromatin condensation was shown with cma3 assay; indicating protamine defects during histone - protamine replacement of sperm chromatin condensation in the testicular phase (21). In this (2003) stated that infertile men had higher rate of sperm dna fragmentation and chromatin defects . They showed that dna fragmentation index (dfi) has a direct relation with the overall pregnancy rate (22). Similarly, bungum et al . Also found that couples who failed pregnancy after iui had an increased rate of sperm dna damage (23). The aforesaid group also showed that in iui cases in which sperm dna damage exceeds 30%, the pregnancy success rates is close to zero (24). In agreement with saleh et al . Regarding chromatin defects, our work confirmed that the rate of sperm chromatin immaturity significantly increased in infertile men, while the rate of pregnancy decreased in cases with male infertility . Cma3 assay seems to be a more efficient assay than apoptosis which can be applied as a reliable marker for prognosis of pregnancy success in iui program . (2003) also believed that sperm chromatin structure assay (scsa) parameter is correlated with the level of immotile spermatozoa and the percentage of chromatin packaging in art . However, they showed that dfi parameter is independent of sperm motility (25). In 2007, one study demonstrated that 1020% of patients became pregnant following iui program, which is similar to our cases (26). Recently, lucchini and her colleagues reported 11% rate of pregnancy outcomes from their superovulated iui cases (4). Also, they stated that some relevant characteristics of pregnancy were younger age, minimal duration of infertility and male infertility factors (17). Moreover, dorjpurev showed that sperm washing / processing did not affect the pregnancy outcomes . However, it is better to wash the ejaculates in order to separate a good fraction of spermatozoa from seminal plasma, leukocyte and non - motile spermatozoa (17, 18). Also, sperm processing is suitable for preventing the transmission of infectious agents and prostaglandin to the uterus . Another finding was related to the correlation between rates of immotile sperm with lower pregnancy after iui . In art, multiple pregnancies are evaluated with incidence reports of 6.525% (28). In our study, the rates of multiple pregnancies were higher than the aforementioned study . Our findings also showed that the rates of sperm apoptosis assay were approximately similar in two groups of mild male and female patients . This may indicate that apoptosis does not play a major role in prediction of iui outcomes . This study confirmed that there was no correlation between abnormal sperm morphology and high rate of dna damage in iui program . Therefore, this technology may not be recommended for patients with mild male infertility, since high rate of dna damage was observed in their spermatozoa . Also, it might be better to plan other art programs for male factor cases.
|
The centers for disease control and prevention estimate that more than 2 million individuals in the united states develop illness resulting from antibiotic - resistant infections on an annual basis and published antibiotic resistance threats in the united states, 2013, which provides a snapshot of the complex problem of antibiotic resistance . The threats were prioritized as urgent, serious, and concerning . Of particular concern is increasing multidrug resistance coupled with cessation of antibiotic discovery programs by most major pharmaceutical companies . This situation has created a major global health crisis in which there are few or no effective agents to treat common bacterial infections or infections caused by less common pathogens, including mycobacterium spp,, filamentous fungi, and yeasts .,, furthermore, alternative second- and third - line agents that are effective are also associated with safety issues . Most current concerns about antibiotic resistance focus on infections in hospital settings requiring parenteral agents . Little is known about the activity of topical agents against multidrug - resistant organisms (mdros), some of which are likely to be compromised because they contain agents to which resistance has already been reported . These include neomycin, polymyxin b, bacitracin, and mupirocin ., bensal hp (sonar products inc ., carlstadt, nj) is a combination topical ointment with antimicrobial properties with activity against methicillin - resistant staphylococcus aureus (mrsa) and common bacterial and fungal skin pathogens .,, the current study was designed to assess the in vitro activity of bensal hp against a broad range of contemporary pathogens, including mdros such as mrsa, vancomycin - resistant enterococcus, gram - negative so - called superbugs, mycobacterium fortuitum, nocardia brasiliensis, yeasts, and filamentous fungi . Bensal hp contains salicylic acid (30 mg / g), benzoic acid (60 mg / g), qrb-7 (oak bark extract) (30 mg / g), and vehicle polyethylene glycol 400 and polyethylene glycol 3350 . The test agent was provided by smg pharmaceuticals, cary, north carolina . In vitro activity was investigated against 184 bacterial and fungal isolates from the culture collections of creighton university, omaha, nebraska; the alegent creighton hospital microbiology laboratory, omaha, nebraska; and the university of louisville hospital microbiology laboratory, louisville, kentucky . The bacterial isolates were from us and international sources and included well characterized non - mdro and mdro isolates of enterobacteriaceae (n = 40), pseudomonas aeruginosa (n = 11); acinetobacter baumannii (n = 13); s aureus (n = 23), including mrsa and methicillin - susceptible s aureus; and enterococcus faecalis (n = 11), including vancomycin - resistant enterococcus, group a streptococcus (streptococcus pyogenes [n = 12]), propionibacterium acnes (n = 1), m fortuitum (n = 10), and n brasiliensis (n = 10). The fungal isolates were candida albicans (n = 10), candida glabrata (n = 10), cryptococcus neoformans (n = 1), trichophyton rubrum (n = 12), t tonsurans (n = 10), and t mentagrophytes (n = 10). The gram - negative bacteria were previously characterized for resistance mechanisms by phenotypic, biochemical, and molecular methods . These included isolates of enterobacteriaceae, pseudomonas spp, and acinetobacter spp producing the extended spectrum -lactamases tem-52, shv-4, shv-12, oxa-45, ctx - m-1, ctx - m-9, ctx - m-12, ctx - m-14, ctx - m-15, ctx - m-17, ctx - m-18, and ctx - m-19; chromosomal and plasmid - mediated ampc -lactamases, including fox - like and cmy-2 enzymes; and carbapenemases of the imp, vim, kpc, oxa, and ndm families . The pseudomonas aeruginosa isolates included some with upregulated mexab, mexef, and mexxy efflux pumps, and downregulation of the oprd porin . The isolates included organisms described in the media as superbugs because of their resistance to most available antibacterial agents . Atcc reference isolates included in the study were escherichia coli atcc 25922, escherichia coli atcc 35218, pseudomonas aeruginosa atcc 27853, staphylococcus aureus atcc 25923, staphylococcus aureus atcc 29213, enterococcus faecalis atcc 29212, and t mentagrophytes atcc 9533 . All isolates were tested by a cylinder diffusion procedure, that was a modification of the clinical and laboratory standards institute (clsi) disk diffusion method ., in this procedure a cylinder containing bensal hp was substituted for the impregnated filter paper disks of the clsi method . Bensal hp liquefied by heating to 56c for 10 minutes and 40 l was pipetted into a sterile metal cylinder placed on a lawn culture of the test organism . The lawn culture of the test isolate was prepared according to clsi methodology and inoculated onto appropriate media (see media). The tests with gram - negative pathogens, staphylococci, streptococci, and enterococci were incubated as recommended by clsi; that is, overnight, typically 1820 hours . All other isolates were incubated for as long as necessary to be able to visualize sufficient growth to allow measurement of an inhibition zone; that is, 4872 hours . After incubation, inhibition diameters around the cylinders were measured and recorded according to the clsi method . In the absence of clsi interpretive criteria, any zone of inhibition was interpreted to indicate susceptibility and the absence of an inhibition zone indicated resistance . This interpretation was adopted to correlate with the occurrence or absence of activity at the undiluted concentration of bensal hp that is used therapeutically ., the test isolates were 73 representative bacterial isolates that were capable of overnight growth at 35c on mueller - hinton agar . Using concentrations based on the agar dilution mics, the bactericidal activity of bensal hp against pseudomonas aeruginosa atcc 27853 and mrsa sa179 the bensal hp concentrations tested were 4 the mic and 1 the mic . Drug - free and antibiotic - supplemented mueller - hinton broths were inoculated to provide an initial inoculum of 5 10 cfu / ml of each isolate . Growth rates and killing were determined by comparing viable counts at 0, 1, 2, 4, and 24 hours . Samples for the counts were plated on roswell park memorial institute (rpmi) 1640 medium (remel, lenexa, kansas). This medium inhibits bensal hp activity and is therefore suitable to inactivate drug carryover in the samples . Bactericidal activity was interpreted as 3 log10 cfu / ml decrease after 24 hours of incubation . Susceptibility tests were performed on mueller - hinton agar (bd diagnostic systems, sparks, maryland) exception for microorganisms that did not grow well on this medium . Group a streptococci were tested on mueller - hinton agar supplemented with 5% sheep s blood (bd diagnostic systems), and fungal isolates were tested on sabouraud dextrose agar (remel). Initial tests of antifungal activity with rpmi 1640 medium determined that this medium antagonized the activity of bensal hp and was unsuitable for susceptibility testing . Time - kill testing was performed in mueller - hinton broth (bd diagnostic systems) with viable counts determined on rpmi 1640 medium . Bensal hp contains salicylic acid (30 mg / g), benzoic acid (60 mg / g), qrb-7 (oak bark extract) (30 mg / g), and vehicle polyethylene glycol 400 and polyethylene glycol 3350 . In vitro activity was investigated against 184 bacterial and fungal isolates from the culture collections of creighton university, omaha, nebraska; the alegent creighton hospital microbiology laboratory, omaha, nebraska; and the university of louisville hospital microbiology laboratory, louisville, kentucky . The bacterial isolates were from us and international sources and included well characterized non - mdro and mdro isolates of enterobacteriaceae (n = 40), pseudomonas aeruginosa (n = 11); acinetobacter baumannii (n = 13); s aureus (n = 23), including mrsa and methicillin - susceptible s aureus; and enterococcus faecalis (n = 11), including vancomycin - resistant enterococcus, group a streptococcus (streptococcus pyogenes [n = 12]), propionibacterium acnes (n = 1), m fortuitum (n = 10), and n brasiliensis (n = 10). The fungal isolates were candida albicans (n = 10), candida glabrata (n = 10), cryptococcus neoformans (n = 1), trichophyton rubrum (n = 12), t tonsurans (n = 10), and t mentagrophytes (n = 10). The gram - negative bacteria were previously characterized for resistance mechanisms by phenotypic, biochemical, and molecular methods . These included isolates of enterobacteriaceae, pseudomonas spp, and acinetobacter spp producing the extended spectrum -lactamases tem-52, shv-4, shv-12, oxa-45, ctx - m-1, ctx - m-9, ctx - m-12, ctx - m-14, ctx - m-15, ctx - m-17, ctx - m-18, and ctx - m-19; chromosomal and plasmid - mediated ampc -lactamases, including fox - like and cmy-2 enzymes; and carbapenemases of the imp, vim, kpc, oxa, and ndm families . The pseudomonas aeruginosa isolates included some with upregulated mexab, mexef, and mexxy efflux pumps, and downregulation of the oprd porin . The isolates included organisms described in the media as superbugs because of their resistance to most available antibacterial agents . Atcc reference isolates included in the study were escherichia coli atcc 25922, escherichia coli atcc 35218, pseudomonas aeruginosa atcc 27853, staphylococcus aureus atcc 25923, staphylococcus aureus atcc 29213, enterococcus faecalis atcc 29212, and t mentagrophytes atcc 9533 . All isolates were tested by a cylinder diffusion procedure, that was a modification of the clinical and laboratory standards institute (clsi) disk diffusion method ., in this procedure a cylinder containing bensal hp was substituted for the impregnated filter paper disks of the clsi method . Bensal hp liquefied by heating to 56c for 10 minutes and 40 l was pipetted into a sterile metal cylinder placed on a lawn culture of the test organism . The lawn culture of the test isolate was prepared according to clsi methodology and inoculated onto appropriate media (see media). The tests with gram - negative pathogens, staphylococci, streptococci, and enterococci were incubated as recommended by clsi; that is, overnight, typically 1820 hours . All other isolates were incubated for as long as necessary to be able to visualize sufficient growth to allow measurement of an inhibition zone; that is, 4872 hours . After incubation, inhibition diameters around the cylinders were measured and recorded according to the clsi method . In the absence of clsi interpretive criteria, any zone of inhibition was interpreted to indicate susceptibility and the absence of an inhibition zone indicated resistance . This interpretation was adopted to correlate with the occurrence or absence of activity at the undiluted concentration of bensal hp that is used therapeutically ., the test isolates were 73 representative bacterial isolates that were capable of overnight growth at 35c on mueller - hinton agar . Using concentrations based on the agar dilution mics, the bactericidal activity of bensal hp against pseudomonas aeruginosa atcc 27853 and mrsa sa179 was determined by time - kill methodology . The bensal hp concentrations tested were 4 the mic and 1 the mic . Drug - free and antibiotic - supplemented mueller - hinton broths were inoculated to provide an initial inoculum of 5 10 cfu / ml of each isolate . Growth rates and killing were determined by comparing viable counts at 0, 1, 2, 4, and 24 hours . Samples for the counts were plated on roswell park memorial institute (rpmi) 1640 medium (remel, lenexa, kansas). This medium inhibits bensal hp activity and is therefore suitable to inactivate drug carryover in the samples . Bactericidal activity was interpreted as 3 log10 cfu / ml decrease after 24 hours of incubation . Susceptibility tests were performed on mueller - hinton agar (bd diagnostic systems, sparks, maryland) exception for microorganisms that did not grow well on this medium . Group a streptococci were tested on mueller - hinton agar supplemented with 5% sheep s blood (bd diagnostic systems), and fungal isolates were tested on sabouraud dextrose agar (remel). Initial tests of antifungal activity with rpmi 1640 medium determined that this medium antagonized the activity of bensal hp and was unsuitable for susceptibility testing . Time - kill testing was performed in mueller - hinton broth (bd diagnostic systems) with viable counts determined on rpmi 1640 medium . All 184 bacterial and fungal isolates were susceptible to this combination ointment in the cylinder diffusion tests . The susceptibility of both wild type and mdro isolates indicated that the mechanisms of resistance to other antimicrobial agents of the isolates did not compromise bensal hp activity . Inhibition zone diameters were generally larger for gram - positive bacteria and filamentous fungi than for gram - negative bacteria (table i). Curiously, some mdros had larger inhibition zones than their wild type counterparts (table i). Figure 1 shows 3 cylinder tests on 1 plate in which isolates of mrsa, escherichia coli, and pseudomonas aeruginosa were inhibited by this combination ointment . The 73 isolates in the mic tests included both mdros and non - mdros for each species tested . All gram - positive isolates were inhibited by an 80-fold dilution of bensal hp, which corresponded to salicylic acid / benzoic acid / qrb-7 concentrations of 0.375/0.75/0.375 mg / g, respectively; that is, identical mic50 and mic90 values of 80-fold dilution of bensal hp . The gram - negative isolates were all susceptible to a 40-fold dilution of bensal hp (0.75/1.5/0.75 mg / g), whereas mic50 and mic90 values were 80-fold and 40-fold dilutions, respectively . In time - kill tests, the combination ointment was rapidly bactericidal against pseudomonas aeruginosa atcc 27853 and mrsa sa179 at 4 mic . The initial count of 2 10 cfu / ml was reduced to 800 cfu / ml by the time the inoculum was sampled and plated for the time zero reading . That is, the bactericidal criterion of at least a 3-log reduction in viable count was achieved within approximately 5 minutes of exposure to bensal hp . The mrsa isolate was killed with a> 4 log kill attained within an hour of exposure to 4 mic . At 1 mic (ie, an 80-fold dilution of the clinical concentration) the viable counts were unchanged after 24 hours . On sampling the tests after 24 hours, there was no evidence of reduced susceptibility to bensal hp in cylinder diffusion; that is, mutational resistance did not emerge during prolonged exposure to bensal hp . Bensal hp was active against 10 isolates each of candida albicans and candida glabrata when tested on sabouraud agar but was inactive against both species on rpmi 1640 medium . This indicated that rpmi 1640 medium antagonized the activity of bensal hp and susceptibility tests on rpmi 1640 medium were discontinued . On sabouraud agar, bensal hp was also active against 12 isolates of t rubrum, 10 isolates of t tonsurans, 10 isolates of t mentagrophytes, and a single isolate of cryptococcus neoformans . Figure 2, figure 3 show the inhibition of candida albicans and t mentagrophytes, respectively, by bensal hp . Bensal hp is currently marketed and is indicated for treatment of the inflammation and irritation associated with many common forms of dermatitis, including certain eczematous conditions . It is also used for the treatment of insect bites, burns, and fungal infections . It has been shown to accelerate reepithelialization . This study confirmed and extended previous information about the in vitro antimicrobial spectrum of bensal hp . The most important finding was that all 184 bacteria, yeasts, and filamentous fungi tested were susceptible to the clinically used concentration of bensal hp, indicating that it has a very broad spectrum of activity compared with other topical agents . In addition, the finding that bensal hp was not compromised by mechanisms of antibiotic cross - resistance between it and other classes of antimicrobials is of interest . Of note, multidrug - resistant acinetobacter, extended spectrum -lactamase producing enterobacteriaceae, multiresistant pseudomonas aeruginosa, and mrsa were inhibited by bensal hp . These pathogens correspond to the categories of potential pathogen threats listed in the centers for disease control and prevention report . The results from our study suggest that bensal hp may provide an effective topical treatment in situations where mdros are problematic . The activity of bensal hp against m fortuitum also raises the possibility of activity against other mycobacterium species, some of which are highly drug - resistant . In addition, the absence of mutational resistance emerging during prolonged exposure in the time - kill tests suggested that pathogens may not easily develop resistance to bensal hp . Additional investigation is needed on the mechanism of action of bensal hp and whether the antimicrobial activity results from the individual components or whether the combination is required to demonstrate these effects . Further studies are warranted to investigate the potential prophylactic, decolonization, and therapeutic uses of bensal hp . It would also be useful to compare its activity to other topical agents such as the combinations of bacitracin / neomycin / polymyxin, and bacitracin / polymyxin, and the monocomponent agents, mupirocin, and silver sulfadiazine . A limitation of this study is that there is neither a standardized susceptibility test method nor interpretative criteria for topical ointments such as bensal hp, with the exception of mupirocin, which is water - soluble . In the absence of such methodology, the cylinder test method using the clinically applied concentration provided useful information . Bensal hp is a very - broad - spectrum topical antimicrobial agent with in vitro activity against important pathogens such as mrsa, pseudomonas aeruginosa, gram - negative superbugs, yeasts, and filamentous fungi . Based on the in vitro findings in this study, additional studies are warranted to better understand the full clinical utility of this agent . K. thomson has received a research grant and honoraria from smg and g. thomson as received honoraria from smg . The authors have indicated that they have no other conflicts of interest regarding the content of this article.
|
Endoscopic submucosal dissection (esd) has been developed to enable the endoluminal en bloc resection of superficial gastrointestinal neoplasms, thus producing an adequate specimen for a reliable histologic assessment . Several devices and tools have been proposed to make it possible to perform esd safely and in an effective manner 1 2 3 . Despite these advances, esd still is a challenging and time - consuming procedure . In order to promote the widespread availability of esd, measures to facilitate and standardize the procedure one of the main problems associated with esd is hemorrhage control 4 5, and a correct vascular approach is key to preventing bleeding and improving the submucosal dissection 6 7 . Whenever bleeding occurs, the examiner s field of vision is critically impaired, and esd becomes less efficient and more hazardous . We propose a simple and widely available measure to improve the visibility of the submucosal space when bleeding occurs during esd: polyethylene glycol (peg) irrigation . A 70-year - old man was referred to kobe university hospital, kobe, japan, for endoscopic treatment of a laterally spreading tumor (lst) in the left side of the colon . After discussion with the patient, he agreed to undergo esd and signed a consent form covering all the components of esd: preparation, the surgical procedure with related endoscopic maneuvers, and postoperative care . 1 shows a large, flat elevated, homogeneous, granular - type lst . After mucosal incision and submucosal dissection with a 1.5-mm ball - tipped flushknife (fujifilm, tokyo, japan), we observed massive bleeding from large vessels, which was stopped with a coagulation grasper . 2 shows the condition of the field after control of the bleeding and irrigation with water . Submucosal hematoma and covered blood clot still interfere with clear vision and disturb the orientation of the submucosal layer . Submucosal hematoma and covered clot were cleared by flushing with peg (niflec; ajinomoto pharmaceuticals, tokyo, japan) in a 30-ml syringe up to three times through the working channel, and the submucosal transparency was restored (fig . A clearer view of the surface of the muscular layer through the transparent submucosa enabled further submucosal dissection safely . Peg irrigation also proved to be useful by making it possible to identify the oozing vessel precisely, facilitating direct hemostasis . A complete en bloc resection (fig . 4) was obtained successfully in 80 minutes, and the specimen was fixed for histologic assessment (fig . The patient experienced an uneventful recovery and was discharged home after 4 days of in - hospital observation . No adverse event related to the use of peg as an irrigation method was noted . Histology showed a tubulovillous adenoma with high grade dysplasia, no lymph node or vascular invasion, and free horizontal and vertical margins . Large, flat - elevated, homogeneous, granular - type laterally spreading tumor in the ascending colon of a patient referred for endoscopic submucosal dissection . After control of bleeding and flushing with water, submucosal hematoma and covered blood clot still impair visibility . Note the restored transparency, allowing a better view of the submucosal layer and surface of the muscular layer . Peg is a polymer of ethylene oxide with a wide range of applications in medicine 8 . It has been used in gastroenterology mainly as a laxative for bowel preparation before colonoscopy or the management of chronic constipation . Peg also is safely used as a pharmaceutical ingredient in ointments, suppository formulations, creams, lotions, lubricants, coating materials of tablets, and solubilizers for injection 8 . This polymer has a low level of toxicity, and when absorbed, it is eliminated through hepatic or renal pathways 8 . Previously, the only application of peg related to endoscopic resection has been reported in experimental settings, as a submucosal injectant 9 . Peg irrigation is a simple and effective means to improve visibility in submucosal dissection, particularly when bleeding occurs; it facilitates esd by allowing a better recognition of the submucosal fibers . As demonstrated in this case report, peg irrigation improved the field of view substantially and made it possible to continue esd in a safer fashion . When bleeding takes place during esd, hemostatic control with coagulation forceps or the knife blade is immediately attempted, together with water irrigation as needed . However, when the control of bleeding takes a long time and the field is occupied by blood or clots, irrigation with water is not very efficient, and visibility is compromised . In such situations, proceeding with blind hemostatic maneuvers without a clear vision of the submucosal space is hazardous and may lead not only to a failure of bleeding control but also, most importantly, to accidental damage and perforation of the muscularis propria layer . It is in this situation that we recommend cleaning the submucosal space by means of irrigation with peg . We assume that the effectiveness of peg irrigation to clear blood clots is due to its property as a dispersing agent; however, the mechanism of this effect remains to be clarified . In addition, we have noted that peg irrigation is also useful when persistent bowel residual covers a colonic flat lesion . Peg irrigation makes it possible to clean the lesion surface very effectively, optimizing conditions for chromoendoscopy and magnifying the examination . In conclusion, we propose a novel use for peg during endoscopic procedures, aimed at cleaning the submucosal space of blood clots and improving visibility for submucosal dissection whenever bleeding occurs and cannot be controlled promptly . Further studies are required to reproduce our experience in a large number of patients and to confirm the reliability of this approach.
|
Drug - induced dermatological reactions are common with the antiepiletic drugs such as carbamazepine (cbz), phenytoin, lamotrigine, ethosuximide, and phenobarbital . These reactions may occur in the mild form as benign rash or may be severe and life - threatening as erythema multiforme major or toxic epidermal necrolysis (ten). Erythema multiforme major, also known as stevens - johnson syndrome, is usually caused by reactions to medications, rather than infections . Cbz was originally introduced in therapeutic armamentarium as an anticonvulsant, and is known to produce such adverse drug reaction (adr), but the reports are rare . Cbz is still used as a first - line agent along with lithium and valproic acid in the treatment of bipolar disorder . Although there are case reports of stevens johnson syndrome (sjs) occurring in schizophrenia, bipolar affective disorder, and during a manic episode when treated with cbz, we were unable to find reports of sjs in patients having epilepsy with bipolar affective disorder . Sjs is a blistering disorder, characterized by mucosal erosions at two or more sites with small blisters and purpuric macules . A 17-year - old woman was brought to psychiatry opd with complaints of episodes of decreased sleep, irritability, and occasional aggressive and violent behavior . She was already on sodium valproate 600 mg / day for generalized tonic - clonic seizures, since the last 2 years from a primary health centre of uttarakhand state . She had a history of 510 convulsions per day for 23 days and then seizure free period of 1015 days . She accepted noncompliance to the regular treatment, thrice for 1520 days duration each, during the last 2 years, and admitted that a further increase in seizure frequency during such breaks compelled her to resume the treatment subsequently . On examination, she had history of frequent mood swings of mania and depression associated with episodic behavioral changes which was undoubtedly suggestive of bipolar affective disorder . She was diagnosed as a case of bipolar affective disorder, currently in remission, with comorbid epilepsy . The patient was initiated on higher dose (800 mg) of sodium valproate which was further increased gradually to 1600 mg / day . At this stage, a further increase in dose caused significant sedation and was intolerable . At this stage, she was referred to a neurologist which she refused to comply with . Cbz 200 mg once daily was added to her regimen of valproate 1600 mg / day in consultation with the hospital physician, which was increased to twice daily after 5 days and then three times daily after 10 days of initiation . She tolerated the treatment well until 19 day when she returned with high - grade fever, redness of eyes, swelling all over body, eruptions on lips, face in butterfly pattern [figure 1, 2] and was admitted in the dermatology ward . On examination her axillary temperature was 39c, blood pressure was 90/60 mmhg, and the pulse rate was 70 per min and regular . She had multiple bullae formation all over the body in the symmetrical pattern which gradually increased to involve> 6065% of the body surface area . She had severe pain during deglutition, generalized body edema, and bleeding per vagina . Examination by a gynecologist revealed that she was in the menstruating phase and vaginal mucosa was found ulcerated . Lesions on patient's face in the butterfly pattern lesions on patient's trunk her lab investigations showed that heamogloblin was 13 g/ dl, total leukocyte count 6000/mm, platelets 1.5 lakhs / mm, creatinine 0.9 mg / dl, urea 49 mg / dl, sodium 139 meq / l, and potassium 4.8 meq / l . Examination of urine revealed albumin (+) and full field rbcs, which correlated with her menstruation phase . Biopsy was not done as her clinical presentation was compatible with diagnosis of erythema multiforme major which was confirmed with an opinion from the pharmacologist . She was treated with methylprednisolone, chlorpheniramine, and ceftriaxone parenterally, and clobetasol gentamicin combination topically, along with iv fluids and other supportive measures . After about 2 weeks of intensive indoor management, her conditions started improving and during third week she was again put on oral valproate 200 mg with an incremental increase of 200 mg per day till it reached 1600 mg / day on eighth day of initiation . The patient again started feeling drowsy, which may have had a psychological component as the patient was already anticipating the effect due to past experience . She refused any other addition to her treatment for fear of similar reaction and agreed to bear the possibility of few convulsions per month . Two months after discharge, the patient returned for review and the dose of sodium valproate was increased since the sedation was tolerable . Her dose was increased to 1800 mg and then to 2000 mg in the next month . With this dose she started having about 34 months of seizure free period and maintained on the same dose since the last 6 months . Cutaneous lesions mostly occur on the palms, soles, dorsum of the hands, and extensor surfaces . Mucosal involvement may include erythema, edema, sloughing, blistering, ulceration, and necrosis . This patient had been taking valproate for 2 years, and her investigations were not suggestive of any other etiology for causation of these adrs . Cutaneous reactions started within 3 weeks of administration of cbz, which is the usual risk period for this adr . The causality assessment by naranjo's algorithm was done which revealed a score 7 suggesting a probable adr to cbz . In one such a report, a 6-year - old boy developed sjs five weeks after cbz was added to valproic acid, which he had been taking as sole antiepileptic therapy for several weeks . Another study showed the incidence of skin rashes with the same dose of cbz in psychiatric patients (1215%) was nearly three times more than that in neurological patients (5%). However, no study showing incidence in comorbid neurological and psychiatric patients was found during our search, hence we lack any comparison with our case report . Our patient also received sodium valproate which is also known to cause hypersensitivity reactions, but the patient had been taking valproate since the last 2 years without any adrs . It was only after the administration of cbz along with a higher dose of valproic acid that this patient developed severe adrs . Immunological reactions due to hormonal changes during menstruation trigger various hypersensitivity reactions such as mucosal ulcerations, skin rashes, asthma, etc ., so it may be an important factor in drug reactions which is yet an unreported factor and should be considered in further studies . Approximately three persons per million per week may experience life - threatening dermatological syndromes with the use of cbz . The incidence of adrs may increase when cbz is given along with higher doses of valproic acid because of increased plasma concentrations of cbz . This was a rare case of life - threatening erythema multiforme major / stevens johnson's syndrome with the use of cbz when given along with higher doses of valproic acid . It was perceived that menstruation, and comorbidity of neurological and psychiatric illnesses might have had predisposing roles . There is a need of continued adr monitoring and reporting of adrs, more so with the use of cbz.
|
A 59-year - old man presented with a swelling of the left lower extremity that had begun two months earlier . For further evaluation, we performed computed tomography (ct) venography and pelvic magnetic resonance imaging (mri). The ct venography axial images showed a 2.3 cm cystic mass compressing the left common femoral vein (fig . The mri images showed a cystic mass compressing the left common femoral vein as well (fig . We suspected adventitial cystic disease (acd) of the common femoral vein, and the patient underwent an operation . Under general anesthesia in a supine position, the femoral artery and vein were dissected for about 5 cm with a longitudinal incision on the left inguinal area . Surgical exploration showed an approximately 2.0 cm sized cystic mass that originated from the adventitia of the common femoral artery and was compressing the common femoral vein . The cyst that had adhered to the femoral artery was removed first, and the part of the wall that was attached to the cyst in the femoral artery was partially resected . Angioplasty was performed to repair the femoral artery whose wall was partially resected . Because the patient had had a partial circulation problem in the vein before the surgery and thus venous obstruction was possible, a polytetrafluoroethylene (ptfe) patch was used for angioplasty instead of using an autologous vein graft . A cystic mass excision with ptfe roofing angioplasty microscopically, the presence of a mucinous cyst and vessel wall degeneration confirmed cystic adventitial disease of the common femoral artery (fig . Acd is an unusual cystic tumor of the blood vessels characterized by the accumulation of a mucinous substance in the adventitia . Acd is an uncommon disease that was first described in 1947 by atkins and key . Acd accounts for only 0.1% of cases of vascular disease, and among them, 85% of all cases of acd occur in the popliteal arteries, while fewer cases appear in the femoral arteries . The first case of common femoral artery acd was reported by jaquet and meyer - burgdorff in 1960 . It was reported that the prevalence is 5 times higher in males than in females . The age of occurrence ranges from 11 to 72 years, and the average age is 42 . Four theories have been proposed about the nature of acd: 1) the theory that it is a systemic disorder of the connective tissue; 2) the theory that it is a chronic degenerative change due to repetitive trauma; 3) the developmental theory, which maintains that a joint - related ganglion - like structure is incorporated into the vessels during embryologic development; and 4) the ganglion theory that arterial adventitial cysts originate from joint capsular synovial structures . Thus continuous trauma from using fishing tools in contact with the thighs was suspected to have contributed to the lesion . On the other hand, considering that the lesion occurred unilaterally and did not appear on the opposite thigh, repetitive trauma is not an obvious explanation for the lesion . The symptoms of acd can include unilateral claudication of the lower extremity, and in rare cases it shows ischemic neuropathy such as paresthesia, pain, and rhigosis . Other possible symptoms include arterial obstruction that results in the pulse in the femoral, the popliteal, and the dorsal pedis arteries being weak or not palpable . However, the main symptom in our case was the uncommon occurrence of swelling that appeared due to the venous obstruction . In addition, the pulse of the blood vessels of the lower extremities was fully palpable . Recently, it has been accepted that angiography using 3-dimensional ct alone is now considered sufficient for diagnosis . Ct angiography is considered to be an important test because it not only determines the site and extent of stenosis but is also useful in evaluating the entire circulation system . Aspiration of the cyst under ct or ultrasonography is a minimally invasive method, but it is difficult to perform and the cyst has a high recurrence rate . This method also has a higher recurrence rate than complete resection involving the vessel with artificial material interposition . Interposition provides better long - term patency than the other methods . In this case, in the pre - surgical assessment the lesion was misdiagnosed as originating from the femoral vein instead of from the femoral artery . In addition, recurrence will be minimized by our having performed the arterial repair and interposition as well as the cystic mass excision . Thus we report here a case of acd, a rare disease, with unusual symptoms, that was successfully treated with surgery.
|
Rasmussen's aneurysm is a less frequently noticed entity usually associated with pulmonary tuberculosis presenting with massive hemoptysis due to involvement of small peripheral pulmonary or bronchial artery by the tubercular cavity or lesion . Involvement of a large central pulmonary artery by metastatic mediastinal nodal lesions is unreported so far . Despite the large size, a 65-year - old male of primary squamous cell carcinoma left buccal mucosa treated by left composite resection, and modified radical neck dissection 8 months back . Postsurgery local radiation with 25 fractions of 2 grey (gy) each completed just 4 months before, presented with generalized weakness and pain right hip region . There was no history of fall, fever, loss of weight or bleeding from any site . Clinical examination revealed no evidence of disease at the local site and no palpable masses anywhere in the body and there was no neurological deficit . Hematological, bio chemical and metabolic parameters were within normal limits, except mild hypo chromic normocytic anemia . Initial imaging with magnetic resonance imaging of lumbo sacral spine revealed t1 hypointense and t2 hyperintense signal intensities in right sacral ala and iliac bone lesions suggestive of metastatic lesions . Patient was subjected to fluorine 18-fluoro deoxy glucose positron emission tomography / computerized tomography (f18-fdg) for restaging and further evaluation . The primary site of left buccal region showed postoperative status with no morphological or metabolic abnormality . There was a metabolically active enhancing nodular mass lesion on the dorsum of the tongue measuring 30 19 mm with a standardized uptake value maximum (suv max) of 5.77 [figure 1a], similar nodular deposit in the cervical nuchal muscle measuring 22 21 mm with an suv max of 4.82 [figure 1b]. There were multiple bilateral metabolically active necrotic, nodular, sub pleural and parenchymal pulmonary metastasis with associated mild degree pneumothorax [figure 2]. Mediastinum showed multiple metabolically active enlarged lymphadenopathy encompassing bilateral hilar, sub aortic, and para aortic lymphadenopathy which also showed conglomeration and central necrosis . Interestingly there was a large contrast filled cavitary area measuring 66.6 54.8 72.6 mm seen amidst the necrotic lymph nodal mass, devoid of any fdg avidity [figure 3]. On close scrutiny the radiographic contrast collection was traceable up to one of the adjoining first order branch of left pulmonary artery [figure 4]. There were multiple metabolically active mixed lytic sclerotic disseminated skeletal metastasis as well [figure 5]. Due to his poor physical condition and the extensive disease load . Small asymptomatic unilateral pneumothorax requiring no intervention and the large extravasated contrast being restricted within the confines of the cavitating nodal metastasis explaining the stark absence of hemoptysis, patient was managed conservatively without any active intervention shifting from a curative to palliative intent . (a) metabolically active enhancing nodular mass lesion on the dorsum of the tongue (dotted arrow). (b) metabolically active nodular deposit in the cervical nuchal muscle (thick arrow) axial positron emission tomography / computerized tomography images of chest showing multiple bilateral metabolically active sub pleural and parenchymal pulmonary metastasis (arrows) with associated left sided pneumothorax (dotted arrow) axial positron emission tomography / computed tomography images of chest showing multiple metabolically active enlarged mediastinal lymphadenopathy with conglomeration and central necrosis (arrows) and a contrast filled cavitary area amidst the necrotic lymph nodal mass devoid of any fluoro deoxy glucose avidity (dotted arrow) high resolution axial and coronal computerized tomography chest showing the radiographic contrast collection traceable up to one of the adjoining first order branch of left pulmonary artery (arrow) maximum intensity projection and coronal positron emission tomography/ computerized tomography images revealing multiple metabolically active mixed lytic sclerotic disseminated skeletal metastasis (arrows) erosive pseudo aneurysm of small caliber pulmonary arterial branch caused by an adjoining infiltrating pulmonary lesion is termed as rasmussen aneurysm . Fritz waldemar rasmussen a 19-century danish physician first described the occurrence of dilation of the pulmonary artery in a tuberculous cavity, rupture of which causes hemorrhage and hemoptysis, often massive and life threatening . Other documented causes are atherosclerosis, bronchiectasis, sarcoidosis, trauma, postcardiac catheterization and postnecrotizing pneumonias . Pathogenesis implicated is the progressive weakening of pulmonary arterial wall adventitia and media by granulation tissue, resulting in thinning of the arterial wall and formation of pseudoaneurysm . The distribution is usually peripheral and beyond the branches of main pulmonary arteries . In the present era of selective catheter angiography, the entity of rasmussen's aneurysm is a retrospective detection encountered while addressing suspected bronchial artery erosion being the cause of massive, intractable and life - threatening hemoptysis . Angiographic intervention is warranted to unearth the source of bleeding and simultaneously attempt to embolize the bleeding source from rasmussen's transformed culprit artery . Our patient had extensive metastasis to skeleton, lungs, muscles, tongue and mediastinal adenopathy with significant necrosis . One of the aggressive and necrotizing lymphnodal mass has eroded the adjoining pulmonary artery branch, in this case a major branch vessel unlike smaller vessels usually seen in tuberculosis cavities . The leaked out blood was contained within the necrotic lymph nodal mass which explains the absence of any revealed hemoptysis and a possible emergency bleeding situation despite the large sized extravasation . Conventional sites of aneurysm are peripheral and beyond the branches of main pulmonary arteries, however it was central in this case and involved a larger central pulmonary arterial branch . Reported cases of rasmussen's aneurysm are the result of infective and chronic tuberculous cavity eroding the adjoining small caliber bronchial / pulmonary artery and none by an aggressive metastatic necrotic nodal mass . The case also highlights the aggressive, extensive and erosive nature of squamous cell carcinoma metastasis . Rasmussen's aneurysm is a rare sequel of pulmonary tuberculosis presenting with massive hemoptysis usually involving a small peripheral pulmonary or bronchial artery . Involvement of a large central pulmonary artery by an aggressive necrotizing mediastinal lymph nodal mass is unreported so far . Our case is one such entity of this rarity with walled off collection of a large magnitude contained within the necrotic mass and nonhemoptytic manifestation being an additional associated rarity.
|
During the course of hiv-1 infection, multifactorial t - lymphocyte (t - cell)-mediated mechanisms contribute to the progressive loss of host immune function [15]. In infected individuals, immune dysregulation occurs early and is characterized by a decrease in cd4 + cell count, a concurrent rise in cd8 + cells, a progressive decline in the cd4+/cd8 + ratio, and defective thymocyte proliferation . During late - stage disease, loss of t - cell homeostasis also occurs [7, 8]. T cells are chronically activated throughout the course of hiv infection, as indicated by an increase in the expression of the antigens ki67, cd38, and human leukocyte antigen (hla)-dr, with cd38 recognized as the most reliable marker of immune activation [13, 5, 9]. Immune activation provides the virus with a steady pool of target cells and has been linked with increased polyclonal t - cell proliferation and turnover, as well as increases in the apoptotic marker cd95 [1013] and activation - induced cell death [12, 1416]. Concomitant with the decline of cd4 cells in the peripheral blood, the frequency of the cd4 + cd28 null subset increases with disease progression and eventual progression to aids . The presence of cd28 on t cells is critically important for the generation of t - cell responses . Interaction of this costimulatory molecule with its ligands increases the expression of antiapoptotic proteins and improves interleukin (il)-2 production . The increase in circulation of t cells with a cd4 + cd28 null phenotype is consistent with a process known as replicative senescence [11, 13, 1719]. T cells that lack cd28 surface expression are nonanergic, oligoclonally expanded, and terminally differentiated, with limited replicative capacity and increased sensitivity to apoptosis [20, 21]. These alterations in phenotype are accompanied by cytokine changes consistent with a chronic proinflammatory state . The failure to produce adequate amounts of il-2 leads to a marked functional impairment of cellular and humoral immunity . Reduced il-2 expression has been associated with a shift from th1 cytokine responses to th2 cytokine responses . The dysregulation of cytokine secretion during the course of hiv infection has been examined using a wide range of methods, including enzyme - linked immunosorbent assay, reverse transcriptase - polymerase chain reaction, t - cell cloning, and, more recently, flow cytometric intracellular cytokine detection . Of these methods, only flow cytometry allows quantitative and qualitative determination of cytokine expression patterns in individual t cells . Successful antiretroviral (arv) therapy results in improvements in circulating cd4 + t - cell levels with decreases in cd8 + counts and declines in immune activation and cd95 expression [15, 7, 9, 2226]. Limited data on replicative senescence suggest a lack of significant improvement in the short term, despite adequate hiv suppression . Some studies have suggested that protease inhibitor- (pi-) based regimens may have a greater effect on cd4 + count recovery than nonnucleoside reverse transcriptase inhibitor - based regimens [27, 28]. Some of the previous studies on immune recovery with arv therapy have been cross - sectional in design, conducted primarily in white males, and focused on absolute cd4 + count or cd4+% recovery . Furthermore, most of these studies did not comprehensively assess the functional aspects of immune recovery . Of the studies that did evaluate the influence of arv therapy on functional immune parameters, most were drug class specific [3032]. Grace (gender, race, and clinical experience) is the largest arv trial to focus on women with hiv-1 in north america and was designed to assess sex - based and race - based differences in efficacy, safety, and tolerability of the pi darunavir with low - dose ritonavir (drv / r) plus an optimized background regimen over 48 weeks in a diverse, treatment - experienced patient population . The aim of this prospective substudy was to quantitatively and qualitatively evaluate the recovery of functional immunity (t - cell function) with a drv / r - based regimen in a subset of patients from the grace study . Grace was a multicenter, open - label, single - arm, phase iiib study conducted at 65 sites across usa, puerto rico, and canada that enrolled 429 treatment - experienced patients (viral load 1000 hiv-1 rna copies / ml) aged at least 18 years with documented hiv-1 infection . Patients received drv / r 600/100 mg twice daily plus an investigator - selected background regimen that could include etravirine . Patients at participating grace study sites were eligible for the prospective immunology substudy, which aimed to enroll up to 100 subjects . All subjects were required to sign a separate, independent ethics committee / institutional review board (irb) informed consent form specific to this substudy . The irbs were quorom review inc ., seattle, wa, office of human research ethics unc irb, chapel hill, nc, and aids research consortium of atlanta, atlanta, ga . Each irb approved of this study . The study was conducted in accordance with the principles of the declaration of helsinki and followed good clinical practice guidelines . Viral suppression in this analysis was defined as achieving hiv-1 rna less than 50 copies / ml at week 48 . Immune function and phenotype were determined by flow cytometry at baseline and weeks 12 and 48 in virologically suppressed and nonsuppressed patients . Changes in immune phenotype were determined from subsets of cd4 + and cd8 + t cells, with immune activation defined as increased expression of t - cell cd38 and hla - dr surface markers, and immune replicative senescence by increased frequency of circulating cd28 null t cells . Changes in immune function were assessed by lymphocyte proliferation in response to candida and tetanus (recall antigens), phytohemagglutinin (pha) and pokeweed (mitogenic plant lectins), and cd3+/cd28 + and by intracellular cytokine expression of il-2, interferon - gamma (ifn-), and tumor necrosis factor - alpha (tnf-) in response to staphylococcal enterotoxin b. a whole blood lysing technique was used and subpopulations were assessed according to a standard protocol for 3-color and 4-color immunofluorescence flow cytometry using fluorochrome conjugated monoclonal antibodies and a fluorescence activated cell sorter . A panel of monoclonal antibodies was used to delineate total cd3 +, total cd4 + and cd8 + t cells, cd4+/cd8 + ratio, activated t cells (cd38+/hla - dr+), immune replicative senescence (cd4+/cd28 + or cd8+/cd28 +), and apoptotic cells (cd95 +). The vybrant cfda se cell tracer kit (molecular probes, inc .) Lymphocytes were labeled with carboxyfluorescein diacetate and succinimidyl ester cfda se and then incubated at 37c with 5% carbon dioxide for 7 days . The label is inherited by daughter cells after division . Labeled lymphocytes with carboxyfluorescein diacetate and succinimidyl ester were detected by flow cytometry using cd45 markers for gating strategy . The reagents used were candida, tetanus, cd3+/cd28 +, pha, and pokeweed . Flow cytometric intracellular cytokine detection of th1 cytokines including ifn-, il-2, and tnf- was assessed using the bd cytofix / cytoperm plus fixation / permeabilization (golgiplug protein transport inhibitor; bd biosciences). Peripheral blood mononuclear cells were stimulated with staphylococcal enterotoxin b (sigma) and a cef control peptide pool (cmv, ebv, influenza virus; nih reagent 9808). Then, surface and intracellular staining antibodies were added in a single staining step (anti - hu - ifn-/cd69/cd4/cd3, anti - hu - il2/cd69/cd4/cd3, anti - hu - tnf-/cd69/cd4/cd3; bd biosciences). A total of 32 patients with hiv-1 were enrolled in the substudy; 25 (78%) patients had week 48 data and 19 (59%) were virologically suppressed at week 48 . The normal comparator group consisted of 34 healthy, hiv - seronegative individuals, 17 (50%) of whom were women and 25 (74%) of whom were white . Patient demographics and baseline characteristics for total and virologically suppressed patients are shown in table 1 . The median (range) cd4 + count at baseline for the total patient population was 191 (2, 463) and the median (range) cd4 + count in virologically suppressed patients at baseline was 222 (2, 398) cells / mm (table 1). At week 48, the median (range) cd4 + count for the total population and virologically suppressed patients was 337 (98, 812) and 398 (119, 812) cells / mm, respectively . In virologically suppressed patients, the cd4+% increased significantly from baseline to week 48 (p <.03; figure 1). The median (range) cd8 + count at baseline for the total patient population was 912.5 (288, 3131) cells / mm, while the median (range) cd8 + count in virologically suppressed patients at baseline was 1037 (288, 3131) cells / mm . The cd8+% decreased significantly from baseline to week 48 (p <.01) in virologically suppressed patients (figure 1). The median (range) cd4+/cd8 + ratio at baseline was 0.22 (0.01, 0.70) in all patients and 0.22 (0.01, 0.70) in virologically suppressed patients . The cd4+/cd8 + ratio at weeks 12 and 48 is displayed in figure 1 and table 2 . The cd4+/cd8 + ratio increased significantly from baseline to week 48 (p <.01) in suppressed patients . The percentage of cd4 + and cd8 + cells at weeks 12 and 48 in suppressed patients is shown over 48 weeks in figure 1 . The percentage of cd4 + cells significantly increased (p <.01) and cd8 + cells significantly decreased (p = .03) from baseline to week 48 . Improvements in immune activation, as measured by decreases in cd38 and hla - dr expression on cd4 + and cd8 + cells over the course of the study, were observed in both the total patient population (table 2) and in virologically suppressed patients (table 2; figure 2). The percentage of apoptotic (cd95 +) cd4 + cells in suppressed patients significantly increased from baseline to week 48 (p = .0142; table 2; figure 2). The percentage of apoptotic cd8 + cells, on the other hand, significantly decreased from baseline to week 48 in suppressed patients (p = .0025; table 2; figure 2). Changes in immune replicative senescence were measured by changes in the frequency of cd4+/cd28 or cd8+/cd28 cells (table 2). There was little change in the expression of costimulatory marker cd28 + on cd4 + cells from baseline to week 48 in the total patient population or the virologically suppressed group (table 2). There was a small decrease in the expression of cd28 + on cd8 + cells in the total patient population and the virologically suppressed population from baseline to week 48 (table 2). The ability of cd4 + lymphocytes to respond to mitogens and recall antigens improved in grace patients over the course of the study . Proliferation in response to cd3+/cd28 + and pha was at, or near, normal levels by week 12 in virologically suppressed patients, and proliferation in response to pokeweed and candida was at normal levels by week 48 (figure 3). Tumor necrosis factor - alpha and il-2 significantly increased in staphylococcal enterotoxin b - stimulated cd4 + cells of virologically suppressed patients by week 48; there was no significant change in ifn- in the stimulated cd4 + cells (figure 4). Few published studies within clinical trials have prospectively assessed in vitro changes in immune function as measured by lymphocyte proliferation [34, 35], and none of these assessed intracellular cytokine production in response to arv therapy . This substudy from the grace trial evaluated t - cell function in a racially diverse, treatment - experienced population comprised of more than 30% women . As expected, based on results from previous studies [24, 27, 28], drv / r - based therapy resulted in increases in cd4 + cell counts and decreases in cd8 + counts in virologically suppressed patients, with an improved cd4+/cd8 + ratio . In addition, we found that drv / r - based arv therapy was associated with progressive functional immune recovery over 48 weeks in virologically suppressed patients, as demonstrated by improved lymphocyte response to mitogens and recall antigens . This suggests that not only do the cd4 + cell counts of hiv-1-infected patients improve during drv / r - based therapy, but their ability to respond in vitro to immune stimuli may improve as well . Results from this report are consistent with a recent study that demonstrated significant decreases in immune activation and apoptosis in cd4 + and cd8 + t cells and a decrease in immune cd8 + senescence following arv therapy . While there have been studies evaluating the influence of arv therapy on immune parameters, data typically represent class - specific rather than regimen - specific treatment approaches . For example, therapy with integrase inhibitors has been shown to result in larger cd4 + cell count increases compared with other arv classes [29, 37, 38]. The work shown here represents a regimen - specific study, with combination drv / r treatment in addition to an optimized background regimen that could differ across patients . Unfortunately, we cannot assess differences between regimens, as our study was not comparative . The reduction in t - cell activation seen here has previously been shown to correlate with the reduction in viral load, as well as an improved response to recall antigens . The observed hiv-1-induced increase in apoptotic cd95+/cd4 + cells has been suggested to be independent of arv activity; the pi saquinavir has been shown to decrease cd95 expression in cd4 + cells from healthy donors whose cells were previously briefly incubated with hiv-1 virus . Although anti - cd95-induced apoptosis declines with therapy, this change is only occasionally associated with a reduction in expression of cd95 on t lymphocytes . It is thus not surprising that in our study cd95 expression on t cells did not decline . In the grace study, no improvement in the cd4+/cd28 or cd8+/cd28 phenotype was seen, consistent with other studies that have suggested that cd28 expression is not normalized in hiv-1infected patients who have undergone up to 3 years of arv therapy [40, 41]. One possible limitation to this study is the small sample size, which may limit data interpretation . The study aimed to enroll 50 women and 50 men, but, due to a delayed start date, after initiation of the grace study, the patient pool for this substudy was limited and the enrollment goal was not reached . Nonetheless, the data obtained are similar to those of other trials . Both immune phenotype and function of cd4 + and cd8 + cells were significantly improved in treatment - experienced patients receiving drv / r - based therapy, as evidenced by positive changes in the capacity to proliferate and the expression of intracellular cytokines by cd4 + cells . The functional recovery observed in virologically suppressed patients, as assessed by proliferative response and intracellular cytokine expression, was also seen in nonsuppressed patients, although to a lesser degree . Antiretroviral therapy has been available for 25 years; however, there has been limited research on immune recovery after long - term treatment . Furthermore, the focus of immune recovery has historically been an assessment of cd4 + cell counts . In the current study, in addition to the evaluation of cd4 + cell counts, cd4 + cell activation (cd38+/hla - dr+, cd95 +), function, and senescence (cd28) were measured as well as cd8 + cell counts, activation, function, and senescence . It should be noted that, as observed in this trial, despite the improvements in immune phenotype and function seen with arv therapy, complete normalization of cd4 + and cd8 + parameters is rarely achieved in hiv-1-infected individuals [24, 42]. However, we hypothesize that there may be some clinical benefit even in patients who do not experience measurable or significant increases in cd4 + cell counts . It is feasible that, in patients with higher baseline cd4 levels, measurable increases in cd4 + cell counts may not be observed . Previous studies have shown that despite cd4 + cell count normalization, the pretreatment nadir cd4 + count and level of cd28 cd4 + coexpressing lymphocytes determine ongoing immune competence, including responses to immunization . Despite the successful hiv therapy noted in the grace substudy this possible treatment - resistant expansion and persistence of cells with a senescence phenotype may have potential for long - term cardiovascular, metabolic, and other aging - associated consequences . This grace substudy demonstrates that drv / r - based therapy improved cd4 + cell recovery and was associated with progressive functional immune recovery over the 48-week study period . Thus, initiation of arv therapy may be required not only to restore immune function, but also to diminish the effects of chronic inflammation.
|
Chronic diseases are a major health concern and major cost in australia and in the most developed and developing countries . Since 1999, the australian government, through its national health insurance scheme known as medicare, has sequentially introduced a range of incentives including subsidised computers, payments to gps via the medicare schedule for chronic disease management (cdm) including general practice management plans (gpmps, item 721), team care arrangements (tcas, item 723), reviews of gpmps and/or tcas, home medicines reviews (hmr, item 900), and items for work undertaken by general practice nurses on behalf of a gp including administration of these care plans [35]. As in november 2012, according to the medicare schedule fees (for payment to gps) reimbursement for these items was: item 721 $141.40, item 723: $112.05, item 732: $70.65, and item 900: $151.75 . Several key factors have been identified for effective chronic disease management including: the availability and accessibility of information technology (it), accessibility of patients' clinical information, patient / consumer participation in decision making, good linkages with community resources and services, longer consultations for patients with gps, gps delegating roles and responsibilities to other health professionals, and using models of care [69]. While medicare data suggests that less than 14% of patients with a chronic disease have a gpmp and/or a tca, only one in five of these plans is regularly followed up and reviewed at the recommended frequency . Effective continuing professional development is also of importance for quality improvement in clinical practice [11, 12]. The breakthrough series methodology which includes a model for improvement (plan - do - study - act) has been described as a strategy for improving quality outcomes in general practice in australia and has been used to upskilled gps in chronic disease management [14, 15]. This mixed methods study tested a broadband - based service known as cdmnet, which creates web - based gpmps using disease specific templates by extracting and auto - populating data from gps' computer records into the gpmp and sharing this with designated member of the care team [1417]. Cdmnet was developed and is managed by an australian - based external provider, precedence health care (phc). Comprising workshops and interviews, this study aimed to promote best practice in gp management of patients diagnosed with a chronic disease, in particular, using medicare item numbers 721, 723, 732, and 900 and cdmnet . While this study was conducted in australia, the impact of the introduction of information technology is of interest globally, where information technology is being introduced for chronic disease management . The breakthrough series methodology including the plan - do - study - act model [1315], comprising of four learning workshops and a followup workshop over a period of 8 months;semistructured interviews with gps who participated in the learning workshops [18, 19]. The breakthrough series methodology including the plan - do - study - act model [1315], comprising of four learning workshops and a followup workshop over a period of 8 months; semistructured interviews with gps who participated in the learning workshops [18, 19]. Regarding learning workshops, a convenience sample of gps was recruited through the monash university, department of general practice networks . The letter of invitation was circulated to 508 gps, of those, 57 gps expressed interest; 24 gps, 2 practice staff and 6 research staff, attended the first learning workshop . Regarding interviews, of the 24 gps who commenced workshop series, 15 agreed to participate . Gps were invited to participate in the interviews during learning workshop 2; a followup telephone call was made to (a) confirm agreement to participate and (b) to arrange a time to conduct the interview . Data were collected using three tools specifically developed for this study: a predisposing activity completed two weeks before each learning workshop, an evaluation completed during each learning workshop, a reinforcing activity completed two weeks after each learning workshop . A predisposing activity completed two weeks before each learning workshop, an evaluation completed during each learning workshop, a reinforcing activity completed two weeks after each learning workshop . Interviews were conducted during august - september 2011 at the participating gps' practices . Qualitative data were analysed using content analysis [18, 19]; quantitative data were analysed using spss v.19 . Ethics for the project were submitted and approved by monash university human research ethics committee (muhrec). Throughout the intervention period (from march to november 2011) and the period up until the followup workshop (november 2011), gps were asked to report the number of gpmps (721), tcas (723), reviews (732), and hmrs (900) created . During this time, the number of items created and completed initially increased, reduced, and then increased again (table 1). Gps felt this peak and plateau similarly reflected that they were managing their usual throughput after managing their backlog . Gps were also asked to report the number of item 721 that they had created for four chronic diseases: diabetes, osteoarthritis, chd / cvd, and coad / copd during the intervention period (table 2). A similar pattern emerged with the number of item 721s developed; increasing then plateauing after workshop 2 - 3 . Discussion during workshops indicated that this may have occurred because gps felt they had identified most of their patients who they had not previously considered for a gpmp, and then after the backlog had been addressed, the numbers reported at later workshops were more reflective of their usual throughput . In addition to the four chronic diseases (table 2), gps created gpmps and tcas conducted reviews and ordered hmrs for other chronic diseases including depression, asthma, chronic low back pain, chronic kidney disease, stroke, and type 1 diabetes (table 1). Regarding the use of cdmnet, gps were asked to estimate any shift from not using to using cdmnet during the intervention period (figure 1). For gpmps (item 721), while there was an initial increase then a reduction of using cdmnet, there was a small but noticeable reduction in the number of gpmps developed not using cdmnet . A similar pattern emerged for tcas (item 723) using cdmnet, but the number developed not using it was suggested that this occurred because gps were developing tcas for gpmps that they had previously developed not using cdmnet . Regarding reviews (item 732) and hmrs (item 900) that the increase and plateau using cdmnet and the reduction and increase not using cdmnet, it was felt that these patterns reflected the followup patterns for gpmps and tcas developed prior to the introduction of cdmnet . Thus, a pattern was emerging suggesting an increase in the use of cdmnet for gpmps and tcas, but not for reviews and hmrs during the intervention period; however, it was felt that the pattern for reviews and hmrs would follow the pattern for gpmps and tcas in the future . This also suggests that an increase in the number of care planning items developed by gps using cdmnet may contribute to increase gp's income . Gps also spoke about changes in their practice nurses' and practice managers' roles . Practice nurses were becoming more involved in generating gpmps using cdmnet, identifying eligible patients, spending more time completing health assessments and preparing gpmps and reviews . Eligible patients lists, assisting in coordination, entering data on the computer, and identifying patients for recalls and reviews . Throughout the intervention period, gps evaluated the learning workshops as being of benefit . Benefits and the value of the workshops reported by gps included the following: learning from other gps that they are also experiencing similar challenges, in particular, the low interest of specialists in management plans whether they are internet generated or not, resolving how to add lists of allied health providers to cdmnet, identifying the difference between lack of details generally recorded in paper - based care planning documents (gpmps and tcas) compared with the detail recorded in a cdmnet - generated plan, the ease at which cdmnet works compared to the initial perception that cdmnet is complex, the (reduced) time required to modify documents to meet individuals' needs, when using cdmnet, an awareness that cdmnet is still an evolving process that requires it infrastructure and information sharing across the health system . Learning from other gps that they are also experiencing similar challenges, in particular, the low interest of specialists in management plans whether they are internet generated or not, resolving how to add lists of allied health providers to cdmnet, identifying the difference between lack of details generally recorded in paper - based care planning documents (gpmps and tcas) compared with the detail recorded in a cdmnet - generated plan, the ease at which cdmnet works compared to the initial perception that cdmnet is complex, the (reduced) time required to modify documents to meet individuals' needs, when using cdmnet, an awareness that cdmnet is still an evolving process that requires it infrastructure and information sharing across the health system . Having computers available at the workshop for gps to practice was valued, as was the medico - legal session . Other benefits included learning from each other about how to use cdmnet, which among other things, contributed to gps being more aware of patients' eligibility for gpmps, tcas, reviews, and hmrs: practice makes perfect - by, using the information obtained from the education activity workshops and using the knowledge straight away (gp1). For some gps, implementation of cdmnet was delayed for reasons beyond the project team's control; thus, gps were at varying stages of learning the information presented, and subsequently discussion at workshops did not always reflect the stages for all gps: we were a bit late getting it loaded on because we had some software issues and other things we started doing a few things ourselves so we were getting familiar with the format and process and that sort of thing, it all made a bit of sense and at the education meetings they were trying to troubleshoot and ease the concerns and help us feel comfortable and answer questions about use and that sort of thing, so that was all fine being time poor, gps reported that their lack of time meant they did not have the opportunity or the time to create gpmps for patients: yeah, the more complex it is, when you're under pressure already running late, you think, no i cannot do this today (gp 15). Uploading allied health providers' and specialists' information onto the address book was an issue . Although phc staff provided advice and assisted gps with this process, there were significant challenges in completing this task: one of the issues is having huge numbers of names to scroll through to find the ones that we use [in the address book] the majority of gps indicated they had some patients who were concerned with privacy issues and some patients who cannot afford the cost of private ahp / specialists . Generally, the community centres that the gps in this cohort referred to did not have cdmnet installed in their it systems: i had one patient with multiple chronic conditions and i wanted to do a gpmp, but i had to do the old paper system because she is very concerned about privacy and she said she does not have internet, she is one of those persons that is very concerned (gp2) most of the allied health people are at the local community centre and i suppose it's kind of made me realise in some ways this whole system does not work very well for my patients because most of them do not use private allied health people (6) it issues . Identified information technology (it) issues variously impacted on the gps . Some expressed concern that the information developed using cdmnet was not automatically recorded back into their medical software; others queried how cdmnet would affect the practice medical software systems and others queried compatibility: cdmnet cannot be installed for all gps because cdmnet is not compatible with some medical software (gp7). Overall, gps felt that using cdmnet raised their awareness of the number of patients with a diagnosis of chronic disease, resulting in more recognition of patients' eligibility and subsequent increase in developing gpmps . Generally, gps felt they had become more proactive in developing gpmps, tcas, and reviews for patients with chronic disease(s), rather than being reactive as they previously had been . The thing is, as you get more and more familiar; if i get really good on it and i could do them five or six, it would be fantastic (gp2). All agreed that the internet is seen to be the way of the future . With this in mind, the future use of cdmnet may depend on several factors such as the efficiency of the system, cost benefits for gps and practices, and better health outcomes for patients . The use of the breakthrough series approach provided significant insight into gps' management of patients with a chronic disease, in particular, when using medicare items 721, 723, 732, and 900 and the broadband - based service, cdmnet . At each of the workshops, gps provided feedback about cdmnet which was of value to the developers to inform updating and further development of the broadband - based service . Despite an initial lack of satisfaction with cdmnet, those who completed the gp education workshops generally reported satisfaction with many aspects of cdmnet . The eight gps who withdrew during the intervention period cited a range of reasons including time commitments, incompatibility with their practice medical it systems, and challenges with cdmnet . Overall changes made by participating gps regarding their use of cdmnet varied from no change / having developed no gpmps using cdmnet to change / developing many gpmps using cdmnet . While the variation is significant, this may be due to many reasons, not the least, the timing of when cdmnet was installed for participating gps during the intervention period . Feedback from the interviews with the gps reflected the comments made during the gp education workshops: time to learn the process was required, the uploading of the address book was a challenge for many because of allied health professionals, and specialists could not be included in gpmps and/or tcas if their information was not available in the address book . Other it issues were also discussed for exploration by phc, the for example, the incompatibility of cdmnet with some medical it systems . Nonetheless, gps generally agreed that using cdmnet raised their awareness about their patients, that gp education workshops prompted them to think about chronic disease management as a process that included a team, and that the internet is seen to be the way of the future . The gps who ceased using cdmnet either during or after completing the gp education workshops were influenced by several issues including time, cost and/or staff (including gps) unwilling to use the tool . While some felt the concept was good, they did not feel it was of benefit in their practice . The strengths of this study include the fact that the education workshops were undertaken in as close to real life as possible . Gps indicated that they benefited from, among other things, collegiality, sharing of ideas, and identifying challenges . The data collection tools were developed to ensure that the gps had a record of the changes they had made throughout the intervention . Interest in the study was strong, and significantly two - thirds completed the gp education workshops . Most participating gps participated in face - to - face interviews and assisted with circulating questionnaires to patients who had gpmps developed during the intervention period . Gps indicated that they felt that cdmnet could be sustained but would be enhanced if broadened to include other templates such as disability care planning and pain management . Whilst the technology was seen as a potential challenge for some gps and patients, others felt that cdmnet could be sustained and enhanced by including a wider range of templates for diseases other than chronic disease . Not all participating gps had cdmnet installed at the same time . With a difference of several months between the first and final installation, no comparison could be made between gps' progress regarding use of cdmnet and the medicare item numbers . In addition, not all gps who commenced in the study completed all workshops; thus, the data is reduced . Generalisability may be challenged by current and future technology regarding, for example, compatibility of cdmnet with medical software and/or adding providers into the address book, what happens in the general practice (general practice routine), and/or staff in the practice who are able / willing to be involved with the technology . Similarly, transferability may depend on what happens in health professionals' practices (gps, allied health professionals, and specialists), particularly whether health professionals choose to use cdmnet or not . During the intervention period, all gps developed gpmps and most developed tcas, with output for some increasing in the earlier part of the intervention period then levelling towards the end of the intervention period . The breakthrough series methodology facilitated upskilling gps' management of patients diagnosed with a chronic disease, in particular, the use of medicare item numbers 721, 723, 732, and 900 and the application of broadband - based service cdmnet as an enabler to achieve this . Future work may include the study being replicated with a larger study sample, randomization of participants, and conducting quantitative analysis of the outcomes . The work could include collecting demographics and professional characteristics for those who choose not to participate or commence participation then withdraw.
|
Do czstych powika mcs nale: incydenty zakrzepowe (w tym zakrzepica urzdzenia), incydenty krwotoczne oraz hemoliza . Ocena zmian w czasie wybranych parametrw ukadu krzepnicia u chorych ze schykow niewydolnoci serca leczonych za pomoc mcs i terapii przeciwzakrzepowej . Przez 6 tygodni obserwowano 16 pacjentw ze schykow niewydolnoci serca (sze pobra krwi dla kadego pacjenta). Co tydzie oceniano rozszerzony panel bada ukadu krzepnicia, w tym czas czciowej tromboplastyny po aktywacji, czas protrombinowy, midzynarodowy wspczynnik znormalizowany, aktywno czynnika von willebranda (vwf), aktywno czynnika viii, stenie fibrynogenu, d - dimeru, czynno pytek pod wpywem kwasu arachidonowego (aspi test) i dwufosforanu adenozyny (adp test), aktywujcego receptora trombinowego peptydu 6 (trap test) i kolagenu (col test). Mediana czasu od momentu wszczepienia urzdzenia wspomagajcego prac lewej komory serca (lvad) wynosia 120 dni (100150 dni). Podczas badania stenia d - dimeru oraz fibrynogenu byy podwyszone we wszystkich szeciu oznaczeniach, nie stwierdzono istotnych rnic midzy kolejnymi oznaczeniami . Aktywno vwf i czynnika viii byy podwyszone w pierwszych dwch oznaczeniach, w kolejnych oznaczeniach obserwowano ich zmniejszenie . U pacjentw stosujcych mcs wykazano znaczne zmiany w parametrach hemostazy zarwno w ukadzie krzepnicia, jak i aktywnoci pytek krwi . Heart transplantation remains the first - line therapy in the management of end - stage heart failure . However, the number of transplants is estimated at less than 3,500 yearly worldwide, which is obviously inadequate to meet the demand in this rapidly growing population of heart failure patients [1, 2]. Mechanical circulatory support (mcs) is an umbrella term describing various technologies used in both short- and long - term management of patients with either end - stage chronic heart failure (hf) or acute hf . Bridge to transplant to support patients who are unable to wait any longer for a heart transplant, or, more recently, as destination therapy for older patients suffering from end - stage heart failure and who have contraindications to heart transplantation [3, 4]. Mechanical circulatory support includes a left ventricular assist device (lvad) or a bi - ventricular assist device (bi - vad). However, mcs therapy is not without risk . Recently, clinicians have identified common mcs therapy - associated complications: pump thrombosis, bleeding, and hemolysis . The incidence of lvad thrombosis is 213% of adult patients with a continuous - flow lvad (axial flow 413%, centrifugal flow 2%). Therapeutic options include surgical procedures (device exchange, catheter - based thrombectomy) and medical therapy . The latter may consist of: thrombolytic therapy with recombinant tissue plasminogen activator, intensified anticoagulation treatment with unfractionated heparin, bivalirudin, intensified antiplatelet treatment with intravenous gp iib / iiia inhibitors, or with thienopyridine - derivative p2y12 adp receptor inhibitor . However, there are no unified guidelines as to the antithrombotic therapy [7, 8]. The incidence of lvad - associated bleeding, depending on its definition, varies widely between 10% and 50%, with no difference in the overall bleeding rates between axial- and pulsatile - flow devices . Much of the bleeding risk is attributed to the antithrombotic regimen . However, there are reports that the observed increased risk of bleeding is higher than would be anticipated from antithrombotic therapy alone . Given the coexistence of thrombo - embolic and hemorrhagic complications, monitoring of hemostasis using thromboelastometry/-graphy and platelet function analysis hemostasis assays should be used to reduce the risk of bleeding and thrombo - embolic complications during mcs therapy and antithrombotic management . Therefore, we set out to determine time - dependant changes of selected hemostasis parameters in patients with end - stage heart failure treated with mcs and antithrombotic therapy . The study was approved by the local bioethics committee, and all patients gave written consent to participate in the study . Sixteen patients with end - stage heart failure on lvad were followed for 6 weeks (six blood samples for each patient). Given the various effects of continuous - flow lvad and pulsatile - flow lvad on hemostasis, we included in the current study only continuous - flow lvad recipients . The pump is driven by a rotating magnetic levitated impeller and has a capacity of up to 15,000 rpm, resulting in a theoretical maximal blood flow of 810 l / min . It is a rotational pump with a magnetic levitating rotor (similar to a propeller). The blood flow is not axial, because inflow and outflow axes are arranged in a 90 degrees angle . Moreover, this pump runs with a lower rotation speed of 1,000 to 2,500 rpm and generates up to 10 l / min flow . Every week an extended hemostasis panel was assessed, including activated partial thromboplastin time (aptt), prothrombin time (pt), international normalized ratio (inr), von willebrand factor (vwf) activity, factor viii activity, fibrinogen level, d - dimer, platelet response to arachidonic acid (aspi test) and adenosine diphosphate (adp test), thrombin receptor activating peptide-6 (trap test) and collagen (col test). Fasting venous blood samples were taken each week, and all tests were performed within one hour of blood samples collection . Whole venous blood samples were collected from each patient and placed in 2 tubes of 4 ml with 109 mmol of sodium citrate (3.2%) and in 2 tubes of 3 ml with> 15 g / ml of hirudin . Plasma was separated by centrifugation at 2000 g for 15 min at ambient temperature (2025c). The vwf activity and d - dimers were evaluated by an immuno - turbidimetric assay, using a fully automated hemostasis analyzer (bcs xp system, innovance siemens healthcare, usa). Factor viii (% activity of normal plasma) and coagulant fibrinogen (mg / dl) were determined by chronometric techniques by means of fully automated hemostasis analyzers (bcs xp system, siemens healthcare, usa). Prothrombin time (pt,% time of normal plasma), inr, and aptt (s) were also assessed by chronometric techniques . Platelet aggregation was tested in physiological calcium conditions by the multiplate analyzer (dynabyte, munich, germany), using agonists of thrombin receptor activating peptide-6 (trap-6), arachidonic acid (aspi), adenosine diphosphate (adp), and a collagen binding activity assay (col). The antithrombotic protocol involved the use of unfractionated heparin according to the aptt (6080 s) starting on postoperative day (pod) 1 . On pod 2 warfarin was started to achieve inr of 2.02.5 in continuous - flow pumps . In addition, aspirin and/or clopidogrel were used antiplatelet agents, starting from pod 2 . The type and dose of antithrombotic regimen were at the discretion of the attending physician . Friedman analysis of variance (anova) test followed by bonferroni correction and the wilcoxon matched - pairs signed - ranks test were employed to test the difference between repeated laboratory tests during 6-week follow - up . Friedman analysis of variance (anova) test followed by bonferroni correction and the wilcoxon matched - pairs signed - ranks test were employed to test the difference between repeated laboratory tests during 6-week follow - up . Baseline clinical characteristic are presented in table i. the study population comprised 16 men with a median age of 41 (interquartile range: 2449). The d - dimer and fibrinogen concentrations were elevated but remained similar throughout all six measurements . Meanwhile factor viii and vwf activities were elevated in the first two measurements and then subsequently declined . Baseline clinical characteristics coagulation assay results in studied patients time - dependant changes in platelet function we set out to determine time - dependant patterns in hemostasis parameters in patients with end - stage heart failure treated with lvad . First, d - dimer and fibrinogen concentrations were elevated but remained similar throughout all six measurements . Second, factor viii and vwf concentrations were elevated at the beginning of the study and then steadily declined . Finally, despite the fluctuation in hemostasis parameters, there were no hemorrhagic or thrombo - embolic events during the study period . Currently, long - term survival in carefully selected patients on mcs is much better than with medical therapy . However, mcs therapy is hampered by, sometimes life - threatening, complications including bleeding and device thrombosis . Left ventricular assist device thrombosis etiology is multifactorial and thus presents complex and challenging problems in the diagnosis and management of such patients . The conditions associated with lvad thrombosis are divided into three large groups: (a) pump - related, (b) patient - related, and (c) management - related . Left ventricular assist device thrombosis occurs in 213% of adult patients with a continuous - flow lvad (axial - flow: 413%, centrifugal - flow: 2%). Thrombus may be formed at various sites, i.e. Left ventricle, inflow cannula, pump housing, outflow cannula, outflow graft, or the aortic root, thus leading to serious cardiovascular events including thromboembolic stroke, peripheral thromboembolism, lvad malfunction with reduced systemic flows or life - threatening hemodynamic impairment, cardiogenic shock, and even death [6, 15]. The four clinical signs of lvad thrombosis recognized are as follows: (a) isolated power elevations, (b) isolated ldh rise, (c) evidence of hemolysis, and (d) new heart failure symptoms . The multidisciplinary and multi - institutional ishlt group proposed an algorithm for the diagnosis and management of lvad thrombosis . Left ventricular assist device patients experience significant baseline activation of endothelial and coagulation systems, further accentuated in the early postoperative period . More importantly, prolonged activation of the endothelial and coagulation systems was also reported, which may indicate activation of the extrinsic (tissue factor) pathway of thrombosis mediated by sustained endothelial dysfunction in these patients . Elevated d - dimer concentrations, as found in our study, may reflect chronic, ongoing activation of the coagulation system . Elevated concentrations of fibrinogen, factor viii, and vwf might result in a hypercoagulable state resulting in lvad thrombosis . More importantly, we have to keep in mind that factor viii is an acute - phase protein (malignancy, chronic diseases, infections). Thus, genetic or acquired conditions determining high factor levels might predispose patients to lvad thrombosis . The vwf has a pivotal role in thrombogenesis, and high plasma levels of vwf have been associated with increased risk of thrombosis . A varied response to the antiplatelet regimen, as demonstrated during the study period, one study found that asa doses at or below 81 mg / day were an independent predictor of device thrombosis . Reported that pump thrombosis was preceded by an almost surprising increase in platelet aggregation induced by aspi and adp . Thus the authors argue that an increase of platelet reactivity or non - response (or low response) to antiplatelet therapy may, in part, play a role in pump thrombosis . Indeed, elevated expression of platelet membrane receptors, namely cd62p and cd63, have been reported in patients on lvad . Left ventricular assist device thrombosis has been reported in non - responders to aspirin and clopidogrel . In addition to thrombosis, bleeding has recently been identified as one of the most common adverse events of lvad therapy and is the major cause of morbidity . Having said that, some authors report that the increased risk of bleeding is higher than would be attributed to antithrombotic therapy . The most commonly reported sources of bleeding are epistaxis, gi bleeding, bleeding of the mediastinum and thorax, and intracranial hemorrhage . The incidence of bleeding, depending on its definition, varies widely between 10% and 50%, with no difference in the overall bleeding rates between axial- and pulsatile - flow devices . The mechanisms underlying bleeding in lvad patients are complex and not yet fully understood, and include colonic dysplasia, concomitant use of anticoagulant and antiplatelet agents, and the presence of acquired bleeding diathesis (acquired von willebrand syndrome type 2a resulting from the deficiency of high - molecular - weight vwf multimers). As such, high - molecular - weight vwf multimers declined in patients with lvad [27, 28], but returned to normal in 6 patients after heart transplantation . However, in the present study we measured only vwf antigen, which is generally within the normal range or elevated and cannot be used in the confirmation or exclusion of acquired von willebrand syndrome type 2a . The sensitivity of various laboratory tests for vws2a in patients with bleeding gi dysplasia is as follows: gel electrophoresis (quantification of hmwm)> pfa-100 closure time> vwf: rco> bleeding time> vwf: ag [15, 30]. It would seem that lvad recipients achieve a new equilibrium between prothrombotic and prohemorrhagic states . More importantly, there is a fine and complex balance in the management of such patients of overcoagulation and undercoagulation . Management protocols for lvad are usually institution - dependent, and unfortunately, there is a large variability in clinician - related factors . We have to keep in mind that the one size fits all approach is impractical and ineffective . Therefore, individually tailored antithrombotic therapy protocols must exist in centers managing lvad recipients . We did not assess the dysfunction of vwf (in particular the deficit of high molecular weight multimers of vwf assessed in gel electrophoresis). Moreover, we did not use thromboelastographic (teg) monitoring, which could have provided additional information, as teg is uniquely capable of showing the combined interaction of coagulation factors, platelet content, and platelet function in the process of clot production in whole blood . Patients with end - stage heart failure on lvad therapy demonstrate significant time - dependant changes in hemostasis parameters that could be attributable to the risk of developing both thrombotic and bleeding events . However, further studies are needed to determine whether these changes could serve as biomarkers of such events . The creation of the paper was supported by a grant funded by the medical university of silesia (no.
|
Despite the advent of new microbials, meningococcal infection remains a leading cause of morbidity and mortality. [14] based on the sequence of pathophysiological events and the agent and host factors, a wide spectrum of presentations may be seen . Patients with invasive meningococcal disease can present with meningitis alone or meningitis with shock. [14] the waterhouse friderichsen syndrome is a severe complication of meningococcal infection. [13] the patient presents with meningococcal disease along with shock due to adrenal hemorrhage. [14] here we report a fatal case of waterhouse - friedrichsen syndrome in an adult male patient with meningococcal disease . A 29-year - old male patient was admitted with a history of high - grade fever with chills and vomiting of 7 days duration, along with skin rash over the abdomen and trunk for the last 2 days . After admission he developed a hemorrhagic rash . There was no significant finding noted in the family history or the past history . On examination, his general condition was unstable and cyanosis was present . He was febrile, with a pulse rate of 90/min and systolic bp of 70 mm hg . A rash was observed over the whole of the body, but it was predominantly over the abdomen and trunk [figure 1]. The cerebrospinal fluid (csf) tapped was collected under aseptic precautions and was processed according to standard bacteriological procedures . Routine microscopy of the csf showed a cell count of 9400/mm, with 86% polymorphs and 14% lymphocytes . The csf protein was raised to 309 mg% and the sugar was reduced to 20 mg% . The gram stained smear of the csf showed pus cells along with gram - negative diplococci, some of which were intracellular and some extracellular [figure 2]. The csf was cultured on chocolate agar, blood agar, and macconkey agar and the media were incubated at 37c in humid conditions in a candle jar . After overnight incubation, tiny translucent colonies were observed on chocolate agar and blood agar, which was later identified by standard laboratory procedures to be that of neisseria meningitidis . Ct scan confirmed adrenal hemorrhage, which is supposed to be a diagnostic factor for waterhouse - friderichsen syndrome . Antibiotic sensitivity tests showed that the isolate was sensitive to all the antibiotics tested, i.e., ceftriaxone, chloramphenicol, penicillin, and trimethoprim + sulfamethoxazole . The patient meanwhile was started on ceftriaxone and steroids, but he went into shock and expired on the third day after admission . Purpuric, hemorrhagic skin lesions associated with the waterhouse - friedrichsen syndrome gram stained smear showing pus cells along with gram - negative diplococci this case is being reported as waterhouse - friderichsen syndrome is comparatively rare in this antibiotic era, especially in adults . If early diagnosis and antibacterial treatment, along with steroids, is not administered then there is high associated mortality . Asia has been the focus of meningococcal meningitis . Many outbreaks of meningococcal meningitis were documented during 1966 and 1985 in delhi and adjoining areas . In early 2005, a spurt in the number of cases of meningococcemia and meningitis due to n meningitidis was reported from india . The majority of the cases, and all the deaths, occurred in young adults between 1630 years of age . Microscopically, these lesions are characterized by endothelial damage, which leads to hemorrhages, and microthrombi in small vessels . The lesions are the result of endotoxins- and cytokine - primed vasculitis that is mediated by the upregulation of adhesion molecules on endothelium and degranulation activated neutrophils . Massive adrenal hemorrhage (waterhouse - friderichsen syndrome) although disseminated intravascular coagulation is a generalized phenomenon, it may affect any organ and when it causes adrenal hemorrhages the condition is called waterhouse - friderichsen syndrome . Gram's staining of the csf is still considered an important method for rapid diagnosis, but culture from csf or skin lesion biopsy is the gold standard. [16] in some cases, blood culture may yield the organism . In the present case only csf most of the studies showed that the isolates were sensitive to penicillin, ampicillin, and ceftriaxone; in two - thirds of the cases the isolates were resistant to ciprofloxacin . Our isolate was sensitive to all the drugs tested, but the patient expired despite adequate antibiotic therapy, probably due to the adrenal hemorrhage leading to shock . Waterhouse - friderichsen syndrome, first reported in 1911 by rubert waterhouse, is characterized by fever, rash, purpura, coagulopathy, and shock . It has been suggested by many authors that this syndrome is more common than what literature reports indicate, many cases probably being missed due to lack of familiarity with the condition . The majority of the diseases caused by meningococci occur in children under 2 years of age, but it can occur at any age . Though waterhouse - friderichsen syndrome is common with n meningitidis, other organisms are also associated with this syndrome, including streptococcus pneumoniae, -hemolytic streptococcus group a, staphylococcus aureus, neisseria gonorrhoeae, escherichia coli, hemophilus influenzae, klebsiella sp, and pasturella sp . Although the condition is predominantly associated with meningococcal infection and with sepsis due to other organisms, there are also noninfectious causes of the waterhouse - friderichsen syndrome, such as anticoagulant treatment, antiphospholipid syndrome, trauma, and postoperative adrenal hemorrhages . Though n meningitidis is susceptible to the commonly used antibiotics, the mortality in waterhouse - friderichsen syndrome is approximately 20%, rising to 50% if the patient is in shock as happened in the present case . If there are any signs and symptoms suggestive of waterhouse - friderichsen syndrome then 100 mg of hydrocortisone should also be given to the patient . If possible it should be given intravenously, but if a vein is not accessible the intramuscular route will suffice . Studied have shown that even prophylactically administered steroid can be life saving . Starting steroids like dexamethasone prior to antibacterial therapy may be useful to diminish the meningococcal inflammation brought about by bacterial cell death . Thus early diagnosis and proper treatment is necessary to prevent death from this otherwise fatal condition.
|
Bladder cancer is the second most frequent cancer of the genitourinary system, the fourth most common cancer in men, and the seventh most common of all (1). Hematuria is the most prevalent symptom that occurs in 80% - 90% of cases and is usually presented without other urinary symptoms (called painless hematuria) (2). After diagnosis, the disease is treated with surgery, chemotherapy, or radiotherapy based on the patient s particular condition, but recurrence is very common (3 - 5). Many drugs have been used in recent decades to lower the recurrence rate, such as bacillus calmette - guerin (bcg), mitomycin c, doxorubicin, and thiotepa . About forty years ago, heuson indicated that there is a relationship between diabetes mellitus (dm) and cancer (6), and other investigators claimed that disorders of intracellular signaling pathways, insulin resistance, and treatment with anti - diabetic drugs can affect cancer incidence and progression (7 - 10). Metformin is a semi - synthetic agent that is derived from galegine and is administered to lower blood sugar . Today, this drug is used for the treatment of diabetes mellitus and the prevention of cardio - vascular disease and polycystic ovarian syndrome (pcos) (11, 12). Preliminary evidence shows that metformin can lower the incidence rate of some cancers (including those of the breast, colon, liver, lung, prostate, and pancreas) in type 2 diabetic patients (13 - 15). Metformin activates protein kinases and decreases rapamycin signaling (mtor) which can then lower blood sugar (16). Based on current evidence, cancer cell growth in bladder cancer requires activation of mtor (17, 18), so it seems that inhibition of this pathway could be an effective way to treat or prevent bladder cancer . This study was designed for the assessment of metformin usage in the prevention of bladder cancer recurrence after the trans - urethral resection of a bladder tumor (tur - t). From april 2013 to september 2014, all patients referred to baqiyatallah hospital with the diagnosis of a bladder tumor who underwent tur - t were included in this study . There were 65 patients and they were divided into two groups: group 1 included 32 patients who were administered metformin as part of their treatment plan, and group 2 included 33 patients who did not take the drug . Data on sex, age, history of smoking, diagnosis of dm, size and number of tumors, histology of tumor cells, and grade and stage of resected tumors were collected before surgery . Metformin was administered in doses of 1000 mg per day (2 doses 500 mg) for the 32 patients in group 1 . All patients were followed up with ultrasonography and cystoscopy every 3 months for a 1 year period . For analyzing the data, then, a chi - square test and spearman s rank correlation coefficient were used to determine qualitative parameters, and an independent t - test was used for assessing the quantitative parameters . In all tests, from april 2013 to september 2014, all patients referred to baqiyatallah hospital with the diagnosis of a bladder tumor who underwent tur - t were included in this study . There were 65 patients and they were divided into two groups: group 1 included 32 patients who were administered metformin as part of their treatment plan, and group 2 included 33 patients who did not take the drug . Data on sex, age, history of smoking, diagnosis of dm, size and number of tumors, histology of tumor cells, and grade and stage of resected tumors were collected before surgery . Metformin was administered in doses of 1000 mg per day (2 doses 500 mg) for the 32 patients in group 1 . All patients were followed up with ultrasonography and cystoscopy every 3 months for a 1 year period . Then, a chi - square test and spearman s rank correlation coefficient were used to determine qualitative parameters, and an independent t - test was used for assessing the quantitative parameters . In all tests, a p value of less than 0.05 was considered significant . Group 1 (metformin) included 32 patients with an age range between 46 and 91 years and a mean age of 63.44 11.71 years . In this group, group 2 (control) included 33 patients with an age range between 23 - 83 years and a mean age of 62.06 14.88 years . Of these patients, 8 were female (24.2%) and 25 were male (75.8%). Other demographic characteristics are shown in table 1 . According to this it it is evident that smoking, dm, previous surgery on the genitourinary tracts, tumor histology, and stage and grade were not statistically different between the 2 groups, but the tumor pedicle type (papillary or sessile) was statistically different (p value <0.05). None of patients showed any side effects of metformin use, including abdominal or stomach discomfort, cough or hoarseness, decreased appetite, diarrhea, fast or shallow breathing, fever or chills, general feeling of discomfort, lower back or side pain, muscle pain or cramping, painful or difficult urination, or drowsiness . In group 1, the tumor size was between 0.5 - 5 cm with a mean size of 1.90 1.13, and in group 2, it was 0.5 - 11 cm with a mean of 2.14 1.79 . There was no statistical differences between the 2 groups (p value = 0.535). It was revealed that 8 (25%) patients in group 1 and 10 (30.3%) in group 2 had tumor recurrences during the 1 year follow - up period, and this rate is not statistically different (p value = 0.633). The time of recurrence (as shown in figure 1) is longer in group 1 but the prevalence of the recurrence time is not different (p value = 0.5430). The results of a correlation test between recurrence and demographic characteristics are shown in table 2 . There was no correlation between sex, dm, and tumor grade with tumor recurrence, but age and tumor size had a weak positive correlation with recurrence in group 1, and a weak negative correlation with recurrence in group 2 . However, neither of these correlations were statistically significant (p value> 0.05). Group 1 (metformin) included 32 patients with an age range between 46 and 91 years and a mean age of 63.44 11.71 years . In this group, group 2 (control) included 33 patients with an age range between 23 - 83 years and a mean age of 62.06 14.88 years . Of these patients, 8 were female (24.2%) and 25 were male (75.8%). Other demographic characteristics are shown in table 1 . According to this it it is evident that smoking, dm, previous surgery on the genitourinary tracts, tumor histology, and stage and grade were not statistically different between the 2 groups, but the tumor pedicle type (papillary or sessile) was statistically different (p value <0.05). None of patients showed any side effects of metformin use, including abdominal or stomach discomfort, cough or hoarseness, decreased appetite, diarrhea, fast or shallow breathing, fever or chills, general feeling of discomfort, lower back or side pain, muscle pain or cramping, painful or difficult urination, or drowsiness . In group 1, the tumor size was between 0.5 - 5 cm with a mean size of 1.90 1.13, and in group 2, it was 0.5 - 11 cm with a mean of 2.14 1.79 . There was no statistical differences between the 2 groups (p value = 0.535). It was revealed that 8 (25%) patients in group 1 and 10 (30.3%) in group 2 had tumor recurrences during the 1 year follow - up period, and this rate is not statistically different (p value = 0.633). The time of recurrence (as shown in figure 1) is longer in group 1 but the prevalence of the recurrence time is not different (p value = 0.5430). The results of a correlation test between recurrence and demographic characteristics are shown in table 2 . There was no correlation between sex, dm, and tumor grade with tumor recurrence, but age and tumor size had a weak positive correlation with recurrence in group 1, and a weak negative correlation with recurrence in group 2 . However, neither of these correlations were statistically significant (p value> 0.05). To our knowledge, the present study is the first one to evaluate the efficacy of metformin on bladder tumor recurrence after tur - t . Our results show that metformin cannot reduce bladder tumor recurrence, but it can prolong the time to recurrence, although such intervals are not statistically significant . This result is in contrast to those of many other studies (13, 19 - 22). Currie in 2009 claimed that in diabetic patients using insulin and metformin, the incidence of colorectal and pancreatic cancer was lower than the corresponding rates among the normal population (13). In similar studies, the survival rates of diabetic patients who were treated for colorectal or pancreatic cancer were 30% higher than those of diabetic patients who received other anti - diabetic agents (19 - 21). Furthermore, wright and colleagues found in their study on caucasian men that metformin can reduce the risk of prostate cancer by up to 44% (22). This discrepancy between our results and other studies may be due to our small sample size or the relatively short time of metformin administration and follow up (13, 19 - 22). In 2010, patel studied diabetic patients who had undergone radical prostatectomy and claimed that there is no association between metformin usage and the recurrence of prostate cancer; indeed, the recurrence rate was 55% higher in diabetic patients (23). These differences in the results may be due to the various risk factors that can affect incidence, progression, and recurrence of cancers, such as age, sex, obesity, smoking, genetics, and the environment . For example, it has been shown that smoking can increase the risk of developing bladder cancers by 3.89% and 4.65% in men and women, respectively (24), but this correlation was not shown in our study . The precise effects of metformin on cancer are unclear, but some suggestions include the following: (1) it might stop the mtor signaling pathway through amp - activated protein kinase (ampk) (25 - 27); and (2) it might decrease the insulin level by way of reducing the insulin - like growth factor-1 (igf-1) (26, 28). Furthermore, it is clear that metformin can increase poly (adp - ribose) polymerase (parp)-dependent cell death and caspase - dependent apoptosis in breast cancer . Metformin has also been shown to decrease the activity and expression of her2 in cancer cells, which is dose dependent and can be seen in higher administered doses of metformin (29 - 31). It seems that metformin can prolong the recurrence interval of bladder cancer, but the recurrence rate itself is not affected . This may be due to the small sample size and the short time of both administration and follow up in our study . Therefore, more studies with a greater sample size and longer administration and follow up times are needed . It seems that metformin can prolong the recurrence interval of bladder cancer, but the recurrence rate itself is not affected . This may be due to the small sample size and the short time of both administration and follow up in our study . Therefore, more studies with a greater sample size and longer administration and follow up times are needed.
|
Electroconvulsive therapy (ect) is an established modality of treatment for severe psychiatric illnesses such as depression, drug - resistant bipolar disorder, and schizophrenia . Among the various complications associated with ect, oxygen desaturation (defined as a spo2 <90%) the incidence of oxygen desaturation in smaller studies has ranged from 2.5% to 27.5% depending on the inspired oxygen concentration, preoxygenation and ventilation during the seizure . The objective of this study was to establish the incidence of oxygen desaturation during recovery from anesthesia for modified ect and evaluate its risk factors in a large sample . The study was approved by the institutional ethics committee and a written informed consent was obtained from the next of kin of the patient . All patients aged above 15 years who were prescribed a modified ect (with short acting anesthetic and muscle relaxant) for their psychiatric illness were prospectively included in this observational study . Patients with a history of recent myocardial infarction, pregnancy, intracranial hemorrhage and patients with a baseline oxygen saturation (spo2) <92% on pulse oximetry were excluded from the study . The clinical and demographic details such as diagnosis, duration of illness, body mass index (bmi), and pharmacotherapy and laboratory investigations were collected for each patient . Electroconvulsive therapy protocol and anesthetic management: patients undergoing ect fasted for solids for 6 - 8 h and 2 h for clear fluids . A standard monitoring consisting of an electrocardiogram, noninvasive blood pressure (bp) and pulse oximetry (spo2) was established in all patients . The anesthetic regimen consisted of administration of atropine 0.6 mg, thiopentone 3 mg / kg and suxamethonium 0.5 mg / kg for rapid muscle relaxation . During apnea, oxygenation was maintained by administering 8 l / min of o2 through a face mask using manual bag - mask ventilation until spontaneous respiration returned except during stimulus application . Passive oxygenation with 8 l / min of o2 through a face mask was continued during the seizures . The ect stimulus was delivered once the muscle fasciculations disappeared using a niviqure (technonivilak, bangalore, india) ect machine . A brief - pulse stimulus was delivered using a constant current at 800 ma, with a frequency of 125 pulses / s (62.5 hz) and a pulse width of 1.5 ms; the duration of the train was altered to adjust the dose . The stimulus charge varied from 30 mc to a maximum of 540 mc and was delivered with either bifrontal or bitemporal electrode placement . The need for a repeat - stimulus was decided by the attending psychiatrist depending on the adequacy of seizure quality and duration . Once the patient regained spontaneous respiration and consciousness, he was positioned in the recovery position and an oral suction performed . Later, he was shifted to the recovery room for further monitoring and observation . In order to avoid any potential source of bias in data collection, furthermore, to exclude the influence of multiple ect sessions on oxygen saturation in the same patient, only the first session for each patient during the study period was included . The other data that was collected are pre ect (before administration of anesthesia for ect) and post - ect (immediately following termination of ect - induced seizure) heart rate, bp and oxygen saturation characteristics (spo2, time taken for spo2 to return to 95%, the lowest spo2 value). Ect details (charge delivered, electrode placement [bifrontal / bitemporal], seizure duration, repeat stimulation), and anesthetic variables (doses of thiopentone, suxamethonium and atropine and anesthetic complications) were also collected . The primary outcome measure of the study was oxygen desaturation (defined as spo2 <90%) following ect . Univariate analysis was carried out to study the association between individual risk factors versus post - ect spo2 and time for spo2 to recover to at least 95% using a pearson's correlation test for continuous variables and a chi - square test for categorical variables . The parameters were then entered into logistic and linear regression models, to identify the independent predictive factors for post ect oxygen desaturation . Univariate analysis was carried out to study the association between individual risk factors versus post - ect spo2 and time for spo2 to recover to at least 95% using a pearson's correlation test for continuous variables and a chi - square test for categorical variables . The parameters were then entered into logistic and linear regression models, to identify the independent predictive factors for post ect oxygen desaturation . Figure 1 shows the changes in the heart rate, mean arterial pressure, and saturation before and after ect [figure 1]. Close to 50% (45/93) of the patients who had desaturation, had spo2 in the range of 80 - 89% . The mean duration for return of saturation to> 95% was 12 s. the incidence of desaturation was 64% (14/22) in obese patients (bmi> 30) and 27% (79/294) in nonobese patients (relative risk = 2.4 [95% confidence interval = 1.6 - 3.4] p <0.001). Similarly incidence of desaturation was 37% (36/97) in patients with prolonged seizure duration (> 45 s) as compared to 26% (57/219) in patients with shorter seizure duration (<45 s) [figure 2]. The longest time for spo2 to return to 95% was 150 s in an obese patient with a bmi of 32 . Demographic parameters in all patients changes in the heart rate, mean arterial pressure and saturation after electroconvulsive therapy when compared to baseline significant variables associated with desaturation pearson's correlations between study variables and outcome measures (parametric analysis) in 316 patients for 1 session the association of the study variables with post - ect desaturation was also analyzed by nonparametric tests (chi - square test) using a predefined cut - off value for each variable [table 3]. In these analyses, age, bmi, dose of thiopentone and suxamethonium and seizure duration correlated with post - ect desaturation . On multivariate analysis (by bivariate logistic regression and linear regression analysis), only bmi and seizure duration were found to be significantly correlated with post - ect desaturation [tables 4 and 5]. Significant variables associated with desaturation on univariate analysis in 316 patients for 1 session (nonparametric analysis) linear regression analysis in 316 patients for post - ect spo2 logistic regression analysis in 316 patients for post - ect spo2 despite advances in the anesthetic techniques, hypoxic complications during anesthesia for ect are not uncommon . In this study, the incidence of oxygen desaturation during modified ect was significantly high (29%) though the mean duration of desaturation was short (12 22 s). Episodes of oxygen desaturation constitute a potential threat to the safety of the patient undergoing ect procedure . Occurrence of oxygen desaturation during perianesthetic period may lead to prolonged stay in the postanesthesia care unit with substantial utilization of manpower and material resources . The cumulative impact of multiple episodes of desaturation on cerebral function, especially in the elderly patients, has not been explored . Evidence from similar areas of the study suggests that repeated episodes of oxygen desaturation are associated with impairment of attention and executive function . It would be interesting to explore if cognitive changes associated with ect have an association with the degree of desaturation . Furthermore, any damage occurring during ect from these episodes of desaturation may not be apparent until late, when it is likely to be attributed to other causes . Oxygen desaturation together with ect - induced autonomic changes may increase the myocardial oxygen demand and compromise the normal cardiac function . Quantification of the incidence of hypoxia and identifying the patients at risk and the factors contributing to desaturation will help to improve the safety of patient care . The guidelines for ect published several years ago advocate preoxygenation and ventilation during apnea after suxamethonium until the administration of the ect . Lew et al . Have demonstrated a significant reduction in the incidence of desaturation by ventilating the lungs during seizure period in a small number of patients . Showed that merely increasing the inspired oxygen concentration (fio2) from 30% to 100% did not significantly decrease the incidence of desaturation . On the contrary, high fio2 prolonged the seizure duration, which was an independent risk factor for desaturation in our study . The number of positive breaths administered during suxamethonium apnea seems to be an important factor that affects oxygenation . Swindells and simpson observed that desaturation was inversely related to the number of positive pressure ventilations performed after administration of suxamethonium and prior to administration of ect stimulus . Thus, it appears that adequate positive pressure ventilation during apnea and not merely increasing the fio2 is the key to prevent desaturation . As regards optimal pco2, one study demonstrated that hyperventilation lead to prolongation of the seizure . Both the above facts taken together, an appropriate ventilatory strategy during ect seems to be one that employs modest increase in fio2 and maintenance of normocapnia . As in our study, lew et al . Had also observed a 27.5% incidence of desaturation during 40 ect sessions . A similar incidence in a larger population in our study (316 patients) reaffirms the need to recognize the magnitude of this problem and improve the strategies to minimize it . In this context, the effect of independent predictors namely, bmi and seizure duration on oxygen desaturation needs to be examined in future studies . An important approach to minimize desaturation during ect could be to promote weight reduction in patients prescribed maintenance ect sessions . Consideration may also have to be given to prescription of antipsychotic medications that tend to cause weight gain . In our study, we observed that as the seizure duration increased, especially more than 45 s, there was a significant increase in the incidence of post - ect desaturation . It is therefore, advisable to limit the seizure to the minimum duration compatible with good clinical recovery . Earlier reports indicate that the efficacy of ect is dependent on administration of 5 - 12 adequately generalized tonic - clonic seizures of at least 20 s duration . We did not monitor end - tidal carbon - dioxide (etco2) pressure during ect as it was not a standard of care in our country at this time . The royal college of psychiatrists recommends preoxygenation only if necessary, leaving open the choice of routine preoxygenation for ect, as is done in elective anesthesia practice . Future studies need to examine whether preoxygenation reduces the incidence of desaturation during ect, at least in obese patients and to recommend it as a standard of care during ect . Thirdly, we provided only passive oxygenation and not positive pressure during the seizure period as it was done in a previous study that reported a 17% incidence of desaturation . Gastric hypomotility can occur from psychiatric illnesses like depression or schizophrenia and also from antipsychotic agents prescribed to treat these conditions . Combined with ect - induced convulsions, this may predispose the patients to pulmonary aspiration . Traditional recommendation during anesthesia for patients at risk of aspiration includes rapid sequence induction without positive pressure ventilation . Endotracheal intubation could be an alternative to protect at - risk patients against this risk . We did not monitor end - tidal carbon - dioxide (etco2) pressure during ect as it was not a standard of care in our country at this time . The royal college of psychiatrists recommends preoxygenation only if necessary, leaving open the choice of routine preoxygenation for ect, as is done in elective anesthesia practice . Future studies need to examine whether preoxygenation reduces the incidence of desaturation during ect, at least in obese patients and to recommend it as a standard of care during ect . Thirdly, we provided only passive oxygenation and not positive pressure during the seizure period as it was done in a previous study that reported a 17% incidence of desaturation . Gastric hypomotility can occur from psychiatric illnesses like depression or schizophrenia and also from antipsychotic agents prescribed to treat these conditions . Combined with ect - induced convulsions, this may predispose the patients to pulmonary aspiration . Traditional recommendation during anesthesia for patients at risk of aspiration includes rapid sequence induction without positive pressure ventilation . Apart from the fear of aspiration, endotracheal intubation could be an alternative to protect at - risk patients against this risk . In this prospective observational study, the incidence of oxygen desaturation during recovery from anesthesia for ect is 29% . This knowledge is likely to help in identifying and optimizing such patients during ect sessions . Future studies should evaluate if measures like preoxygenation and intubation in selected patients at risk, will decrease the incidence of desaturation during ect without additional complications.
|
Environmental temperature fluctuations can pose dramatic challenges to cold - blooded organisms, such as insects, fish, and crustaceans, since temperature changes can cause global perturbation that affects the reaction rates of all the biological processes . When the homeostasis of life is challenged, complex responses, including physiological, neurological, and behavioral, may co - mediate the response and rebuild the balance to prolong the animals survival . Using four congeneric species of crabs as study models, stillman has suggested that the temperature acclimation capacity of these marine invertebrates is crucial for their survival in the face of global warming . By unveiling the underlying mechanism of how organisms respond to increasing habitat temperature, we can obtain a better understanding of the direct impacts that climate changes have on life . It has been a lasting effort to probe the mechanism of the thermal perturbation response in invertebrates over the past decade . In the lobster homarus americanus, a large spectrum of physiological parameters in the circulating hemolymph has been observed to be influenced negatively by high temperature, including glucose, total protein concentration, cholesterol, chloride and calcium concentration, etc . For example, the pyloric rhythm of the stomatogastric ganglion (stg) from cancer borealis was shown to be robust to temperature changes from 7 to 23 c, but the system crashed at high acute temperatures (> 23 c). A recent study in cancer borealis and cancer pagurus showed that the pyloric phases were maintained in intact animals at high temperature (26 c), while pyloric frequency increased significantly . However, the frequency range was more restricted than it was in vitro, which might be caused by sensory feedback and neuromodulatory input . Temperature changes are also correlated with cardiac performance in multiple organisms . In h. americanus, interestingly, although the q10 values are similar in vivo and in vitro, the heartbeat rates are faster in intact animals, and less heart failures are observed at higher temperatures (above 20 c) compared to the in vitro preparations . This is intriguing because it may suggest that endogenous neural and/or hormonal signals might protect the cardiac performance integrity in intact animals from temperature ramp . However, to date, there has been no direct evidence regarding the involvement of neuromodulators in the regulation of the temperature perturbation response . To address this knowledge gap, we employed a mass spectrometry - based strategy to examine the quantitative changes of neuropeptides caused by temperature elevation . The jonah crab c. borealis was selected as an experimental model, which is an ideal system for investigating neuromodulation due to its simple and well - defined neural network . The neural network of c. borealis includes two features: the stomatogastric nervous system (stns), which generates rhythmic motor patterns that control the movement of the stomach, and the central nervous system (cns), which consists of the brain, thoracic ganglion, etc . Other major neuroendocrine components are the pericardial organ (po), which surround the heart, and the paired sinus gland (sg) located in the eyestalks . Neuropeptides from neurohemal organs, such as po, are released into the hemolymph and pumped through the stomatogastric ganglion (stg) to the brain, which can influence the output of the neural networks . A large number of neuropeptides from c. borealis have already been identified in previous studies using mass spectrometry, facilitating us to further assess their functions . In this study, we measured the neuropeptide changes in three different neural organs in the nervous system of c. borealis in response to acute temperature elevation using dimethyl labeling . A number of neuropeptides were found to be decreased in two neuroendocrine organs, po and sg, indicating that these two organs were actively involved in the temperature perturbation response . In addition, the neuropeptidome changes of the brain and circulating fluid hemolymph were also examined . A temperature stress marker peptide was discovered in the hemolymph and de novo sequenced . Methanol, acetonitrile, formic acid, acetic acid, and edta disodium salt were purchased from fisher scientific (pittsburgh, pa). Borane pyridine, formaldehyde, and deuterium formaldehyde were from sigma - aldrich (st . Louis, mo). 2,5-dihydroxybenzoic acid (dhb) used as maldi matrix was obtained from mp biomedicals, inc . Acidified methanol was prepared using 90% methanol, 9% acetic acid, and 1% water . Jonah crabs cancer borealis were purchased from the fresh lobster company (gloucester, ma) and maintained without food in artificial seawater at 1213 c for at least 1 week before experiments . To increase the ambient temperature, crabs were placed in a bucket filled with artificial seawater at 1213 c, and the bucket was then placed in a water bath preheated to around 50 c . The temperature within the bucket was increased to around 23 c in 15 min . The neural tissues, including po, sg, and brain, were dissected in chilled (approximately 10 c) physiological saline (composition: 440 mm nacl; 11 mm kcl; 13 mm cacl2; 26 mm mgcl2; 10 mm hepes acid; ph 7.4). Hemolymph samples were collected by inserting a 22-gauge needle attached to a 3 ml plastic syringe through the junction of the thorax and abdomen into the pericardial chamber . All the crabs used in this study were male, and animals with similar shell color, size, and weight were paired for each comparison group . Briefly, a mixture of 0.45 ml of acidified methanol and 0.3 ml of edta solution (20 mm aqueous solution) was spiked into 0.75 ml of freshly obtained hemolymph to extract peptides and precipitate large proteins . Edta was added to prevent cation - triggered hemolymph clotting during the sample preparation process . The samples were centrifuged at 16 000 g for 10 min, after which the supernatant was collected followed by ultrafiltration through a 10 kda mwco tube by centrifugation at 15 000 g . The low mass filtrate was concentrated to dryness using a savant sc 110 speedvac concentrator (thermo electron corporation, west palm beach, fl) and was resuspended in 80 l of 0.1% fa in water . After sonication for 10 min, the sample was desalted by c18 micro spin column (argos, elgin, il) according to the product manual and eluted in 6 l of 0.1% fa in 50% acetonitrile (v / v). Tissue extractions were obtained by homogenizing the neural tissues in 200 l of cooled acidified methanol . The undissolved tissue pellets were removed by centrifugation at 16 000 rcf for 10 min . The supernatants were dried in a savant sc 110 speedvac concentrator (thermo fisher scientific, waltham, ma) and resuspended in 20 l of 0.1% formic acid, after which the samples were desalted by a c18 ziptip (millipore, bedford, ma) according to the product instruction . A 3 l aliquot of tissue extract from neural tissues was first mixed with 0.7 l of borane pyridine (c5h8bn, 120 mm in 10% methanol), after which 0.5 l of formaldehyde (fh2, 15% in h2o) for control samples or 0.5 l of deuterium formaldehyde (fd2, 15% in h2o) for temperature stress samples was added . The mixtures were then placed in a 37 c water bath for 20 min for the labeling reaction to complete . Samples from control and stressed animals were mixed with a 1:1 ratio before mass spectrometry analysis . A model 4800 maldi - tof / tof (applied biosystems, framingham, ma) equipped with a 200 hz, 355 nm nd: yag laser was used for neuropeptide quantification analysis . Acquisitions were performed in positive ion reflectron mode, and instrument parameters were set using the 4000 series explorer software (applied biosystems, framingham, ma). Mass spectra were obtained by averaging 900 laser shots covering mass range m / z 5004000, and ms / ms were acquired by 1 kv collisionally induced dissociation (cid) using air as collision gas . To elucidate the primary sequence of the derivatized stress marker peptide, sustained off - resonance irradiation collision - induced dissociation (sori - cid) was performed on a maldi - ftms (varian, lake forest, ca) equipped with a 7.0 t actively shielded superconducting magnet . The ftms instrument consisted of an external high - pressure maldi source with a 355 nm nd: yag laser (laser science, inc ., franklin, ma) to create ions that were accumulated in the external hexapole storage trap before being transferred through a quadrupole ion guide to the icr cell . All mass spectra were collected in positive ion mode, and detection was performed in broadband mode from m / z 108.00 to 2500.00 . For sori - cid, an arbitrary waveform with a 10 da isolation window was introduced to isolate the ion of interest, and ions were excited with sori burst excitation (2.648 v, 25003000 ms). A pulse of nitrogen gas was introduced through a pulse valve from 2500 to 2750 ms to induce collision activation . The neuropeptide identification was based on mass matching with previously characterized neuropeptides from c. borealis . De novo sequencing of the stress marker peptide was done manually without the assistance of any software . For relative quantification of neuropeptides, each labeled mixture sample was spotted on the maldi plate twice, and two replicate spectra were acquired for each spot, resulting in four replicate spectra for each sample . Peak lists were extracted from the crude spectra without any postacquisition processing using the data explorer software (applied biosystems, framingham, ma). The peak pairs generated from the known neuropeptides were selected for quantitative analysis . The relative abundance ratio for each neuropeptide between the temperature - stressed sample and the control sample was determined by dividing the heavy labeled peak intensity with the light labeled peak intensity . Student s t test was performed to evaluate the differences of each peptide, and a p value <0.005 was considered to be statistically significant . It is rather difficult to study the expression of each individual neuropeptide in different physiological conditions using traditional biological assays, such as western blotting, because neuropeptide families usually contain a large number of isoforms sharing similar amino acid sequences that could cause antibody cross - reactivity . To solve such a problem, a number of mass spectrometry - based methods have been developed, leading to the discovery and mapping of numerous neuropeptides in different animals . It is our ultimate goal to utilize such tools to elucidate the functions of neuropeptides in the regulation of neural circuits . Mass spectrometry - based quantitation methods have also been used to accurately measure the quantitative changes of neuropeptide levels in animals under different conditions . For example, label - free peptidomics was employed to study the neuropeptide alterations in the tree shrew hypothalamus during volatile anesthesia . Another method, dimethyl labeling, has been reported as a fast and simple reaction that can be applied for differential proteomic and peptidomic analyses . In our previous work, dimethyl labeling was used to study the involvement of neuropeptides in feeding . In this current study, we used a similar strategy to examine the quantitative changes of neuropeptides in three different neural organs from c. borealis induced by acute temperature elevation . The po is a major neurohemal organ surrounding the heart, which can release hormones into the circulating hemolymph and regulate the functions of heart and other distant organs . To determine the variability of neuropeptide expression between different animals, we initially compared two groups of control crabs . A representative maldi - tof / tof spectrum of a dimethyl - labeled mixture of two control extracts from po is shown in figure 1a, and the peak pairs of labeled neuropeptides are indicated with their amino acid sequences . However, as shown in figure 1b, the intensities of many detected neuropeptides were significantly reduced in the temperature stress sample . Maldi - tof / tof mass spectra of dimethyl - labeled mixtures of (a) two control pericardial organ extracts and (b) pericardial organ extracts from control (12 c) versus temperature - stressed (23 c) animals . The h2-labeled dimethylated peaks (control) are indicated with closed circles, and the d2-labeled dimethylated peaks (stressed) are indicated with open circles . The labeling reaction resulted in 4 da mass differences per label between each peak pair . Peaks are annotated with their corresponding neuropeptide sequences . To further verify the observation, 15 pairs of control and stressed crabs were compared, where each single crustacean contributed a set of paired po . In the quantification experiments, three families of neuropeptides were detected in the po, including rfamide - related peptide (farp), ryamide, and b - type allatostatin (ast - b) (table 1). Table 1 and figure 2 show the average abundance ratio between control and stressed animals for each individual neuropeptide . Peptides from both the rfamide and ryamide families were significantly reduced in the po after acute temperature shock (p <0.005). The ratios between the temperature stress and control samples ranged from 0.34 to 0.68, although different isoforms in the same family were observed to have varying degrees of change . Gahknylrfa (m / z 1104.61) showed the largest level of decrease upon temperature change (0.34, p <0.001), while gnrnflrfa (m / z 1022.56) was the only rfamide peptide with no significant change upon temperature elevation . Both of the two observed ryamides, fvggsrya (m / z 784.41) and sgfyanrya (m / z 976.46), were reduced in the po at high temperature . Two isoforms of ast - b were detected in the po extract in this study, although neither of them showed significant changes . It is interesting that these neuropeptide families respond differently to the thermal challenge, indicating that they may play distinct roles in response to temperature changes . Neuropeptides with significant changes are indicated with an asterisk (* p 0.005, * * p <0.001). Farp, fmrfamide - related peptide; ast - b, b - type allatostatin . Ratios / c: ratio of neuropeptide signal intensities between stressed (23 c) and control (12 c) crabs . . Ratios of peptide levels between stressed (23 c) and control (12 c) were determined using dimethyl labeling (columns, average of ratios calculated from 15 groups of comparison; bars, standard deviation; * p <0.005; * * p the peptide hormones released by the po have rapid and direct access to the heart, which suggests that heart is a primary target of the pericardial hormones . Rfamides are present in many different organisms with a large diversity of amino acid sequences . In crustaceans, in an electrophysiological study, it was observed that the application of flrfamide peptides can increase the output activity of the cardiac ganglion that drives the contractions of the heart . It was also reported that the heart beat rate in lobster h. americanus increased with environmental temperature in vivo and in vitro, while its contraction amplitude was reduced . Therefore, it is quite likely that farps play a key role in this heart functional change in response to temperature stress . Farps are also reported to alter the arterial hemolymph flow and regulate the circulatory system . These processes may be important for the animal to manage oxygen regulation under a stressful environment . On the other hand, the ryamide peptide family was first discovered in the pericardial organ of c. borealis, and its physiological effects are largely unknown . Recently, two peptides with a similar ryamide motif were identified in drosophila and believed to be involved with feeding; however, it is unclear whether they also have cardiac effects . Another major neuroendocrine organ in crustaceans is the sg, which is a paired organ located in the two eyestalks, and the quantitative changes between temperature stress and control preparations were also determined . Since the total amount of neuropeptides was lower in the sg compared to po, four sg tissues were used for each extract . Overall, five groups of samples were analyzed, from which six neuropeptides were detected (figure 3 and table 2). As shown in figure 3, four orcokinin peptides were detected to be reduced at high temperature (p <0.005), specifically nfdeidrsgfgfa (m / z 1474.7), nfdeidrsgfgfv (m / z 1502.7), nfdeidrssfgfv (m / z 1532.7), and nfdeidrssfgfn (m / z 1547.7). The ratios of these four peptides between the stress and control samples were similar, between 0.7 and 0.8 . The other two observed neuropeptides, proctolin and yramide, did not show significant changes . . Ratios of peptide levels between stressed (23 c) and control (12 c) were determined using dimethyl labeling (columns, average of ratios calculated from five groups of stress experiments for each neuropeptide; bars, standard deviation; *, student s t test, p <0.005). Neuropeptides with significant changes are indicated with asterisk (* p 0.005, * * p <0.001). Ratios / c: ratio of neuropeptide signal intensities between stressed (23 c) and control (12 c) crabs . The sg is known to be involved in various forms of environmental stresses, such as temperature changes, salinity changes, pollution, and hypoxia . It was found that crustacean hyperglycemic hormones (chhs) were released from the sg system during stress, resulting in subsequent elevation of the blood glucose level . Although we were unable to detect and quantify the presence of chhs in this work, we found that neuropeptide orcokinins were decreased in the sg under temperature elevation . Generally, orcokinins are myotropic peptides that have excitatory effects on different tissues . Have reported that orcokinins are measurable in the hemolymph with an approximate concentration of 10 m, indicating that orcokinins may be released into hemolymph and function as a hormone in addition to its role as a locally acting neurotransmitter . In this study, we demonstrated that the orcokinin levels were reduced in the sg upon temperature stress, implicating that orcokinins may be involved in the stress response via a hormonal route . To evaluate the neuropeptide expression changes in the cns, c. borealis brain extracts were also investigated . Two brains were used for each extract sample, and 10 comparison groups were conducted . Compared to the po and the sg, a larger number of neuropeptides were detected that reside from eight different families, including farp, ryamide, yramide, cancer borealis tachykinin - related peptide (cabtrp), crustacean cardioactive peptide (ccap), proctolin, sifamide, and orcokinins . As shown in table 3, no significant changes were observed for any of these neuropeptide families in the brain . Cabtrp, cancer borealis tachykinin - related peptide; ccap, crustacean cardioactive peptide . Ratios / c: ratio of neuropeptide signal intensities between stressed (23 c) and control (12 c) crabs . The results from po and sg indicate that endocrine hormonal regulation may play a very important role in response to acute temperature elevation . To the authors knowledge, this is the first direct demonstration that neuropeptides, including rfamides, ryamides, and orcokinins, are involved in the physiological regulation of the temperature stress response . In addition, the mass spectrometry - based methods show unique advantages for comprehensive study of multiple neuropeptides simultaneously, leading to valuable insights into their physiological functions . It should be noted that the neuropeptides in the brain are not observed to be significantly changed in this study . It is possible that the neuropeptide synthesis in the brain is not strongly affected by temperature, or it may also be due to the short time course of the temperature elevation experiment . A longer term temperature perturbation study will be conducted in the future to further explore the roles played by the central nervous system and its interaction with other neuroendocrine organs . It has been reported that a number of physiological variables were changed in the hemolymph in response to temperature elevation . To better understand the temperature response system in the crab, we analyzed the peptidomic complements of the hemolymph from animals undergoing an acute temperature ramp . In our previous study, we developed an optimized sample preparation method for peptide extraction from the crude hemolymph samples . This method was utilized here to extract peptides from the c. borealis hemolymph . As shown in figure 4, a peptide peak with m / z 1137.6 (smp1137) with the highest peak intensity was repeatedly observed in the temperature stress hemolymph samples (n = 5). It should be noted that this ion was also detected from the control hemolymph in some cases but at much lower peak intensities (figure 4a). Mass spectral comparison of processed hemolymph samples from (a) control (12 c) and (b) temperature - stressed (23 c) crabs acquired using maldi - tof / tof . The dominant peak (m / z 1137.6) observed at high temperature is indicated with an asterisk . To identify this peptide, cid fragmentation was performed on a maldi - tof / tof instrument to acquire peptide sequence information . As shown in figure 5a, the fragmentation was quite complete, and the majority of the b- and y - ions were observed . To obtain complementary information for amino acid sequence assignment, formaldehyde could react with all the primary amine groups in the peptide, leading to differentiation of the lysine residue (k) as compared to glutamine (q) or the combination of glycine and alanine (ga or ag). A 56 da mass shift was observed after the dimethylation derivatization, suggesting the presence of a lysine residue in the sequence . The fragmentation spectrum further confirmed the position of the lysine (k) residue in the primary sequence . To further validate the deduced sequence, a peptide standard was synthesized and analyzed using the same activation methods (figure 5b and figure 6b), which showed a fragmentation pattern similar to that of the putative smp1137 peptide from the hemolymph . Ms / ms spectra acquired by maldi - tof / tof using collision - induced dissociation for (a) putative smp1137 from the hemolymph sample and (b) synthetic peptide standard with the proposed sequence at a concentration of 1 m . The presence of b- and y - ions is indicated by horizontal lines below (b - ions) or above (y - ions) the corresponding amino acid residues in the peptide sequence . Ms / ms spectra acquired by maldi - fticr for (a) dimethyl - labeled putative smp1137 from the hemolymph sample and (b) dimethyl - labeled synthetic standard with the predicted sequence at a concentration of 1 m . The asterisk indicates the two dimethylated sites, including the n terminus and the lysine (k) residue . The presence of b- and y - ions is indicated by horizontal lines below (b - ions) or above (y - ions) the corresponding amino acid residues in the peptide sequence . To the best of the authors knowledge, this peptide does not belong to any known neuropeptide families, and it is possibly a fragment from a certain protein in the hemolymph . Notably, lorenzon et al . Reported that the protein concentration in the lobster hemolymph increased significantly with the body temperature . It has also been reported that heat shock proteins, whose primary function was to promote initial folding of other proteins at the ribosome and the refolding of unfolded proteins when they were partially denatured, were elevated in crustacean hemolymph when the animal undergoes stressful conditions . However, we performed a blast search using the sequence of smp1137 against the protein database, with no match of any relevant proteins found, suggesting that the smp1137 could be a fragment cleaved from an unknown protein that is related to temperature stress response . Future experiments will be performed to identify the origin of smp1137 and to determine whether this peptide has any physiological activities . In addition, it is also of great interest to investigate whether smp1137 is related to other types of environmental stresses, such as salinity changes, pollution, and hypoxia, or it is a unique signature for temperature change . In this study, quantitative peptidomics was employed to study the neuropeptide changes in the jonah crab cancer borealis associated with acute temperature elevation . The results showed that neuroendocrine organs, including the pericardial organ and the sinus gland, were actively involved with the temperature perturbation response . The neuropeptides released by these two organs may be involved with temperature change response via hormonal regulation . This study provided direct evidence that neuropeptides may play an important role in the regulation of biological changes in crustaceans in response to environmental perturbation.
|
Diagnostic criteria for both type 1 diabetes (t1d) and type 2 diabetes include fasting glucose values 126 mg / dl and 2-h glucose values 200 mg / dl (1). Those glucose values were selected primarily because they coincide with observed thresholds for the occurrence of diabetic retinopathy (1). Since they were essentially derived from findings in adults, they might not always be appropriate for pediatric populations . Moreover, current criteria do not take into account the evidence that the pathogenesis of t1d begins years before it is diagnosed with standard glucose criteria (24). This suggests that other criteria can be used to diagnose t1d at earlier stages of disease . Type 1 (dpt-1) and trialnet natural history study (tnnhs) participants, all autoantibody - positive relatives of t1d patients, showing that once a diabetes prevention trial risk score (dptrs) (5,6) of 9.00 is exceeded, the 2-year risk of t1d is very high (7). (the dptrs is a validated predictor of t1d that is based on the log fasting c - peptide, glucose, and c - peptide sums from 30-, 60-, 90-, and 120-min values of 2-h oral glucose tolerance tests [ogtts], log bmi, and age .) Moreover, when that threshold was exceeded, there was a substantial decline in insulin secretion . As a result of those findings, we have explored another approach for diagnosing t1d in autoantibody - positive relatives . Specifically, we have assessed whether t1d could be diagnosed in these individuals when a very high risk threshold of a metabolic index is exceeded along with a concomitant marked decline in insulin secretion . Since the analyses pertain to autoantibody - positive individuals, we are not advocating the replacement of standard diagnostic criteria with a metabolic index . Rather we use the index to show how another approach based on prediction and natural history might be helpful in the future for diagnosing t1d at an earlier stage of pathogenesis . Data from pancreatic autoantibody - positive relatives of patients with t1d who participated in dpt-1 or the tnnhs were analyzed . Those from dpt-1 were positive for islet cell autoantibodies (ica), whereas those from the tnnhs were positive for at least one of the following autoantibodies: gada, ia-2a, miaa, and ica (very few had ica alone). Dpt-1 consisted of a low - dose parenteral insulin trial and an oral insulin trial . These trials have been described (8,9); neither intervention showed an overall effect . The tnnhs is an observational rather than an intervention study; that study has also been described (10). Both studies were approved by institutional review boards at all participating sites, and written informed consent and assent as appropriate were obtained in both studies . Participants were followed in both dpt-1 and the tnnhs for the development of t1d with ogtt surveillance at 6 (3)-month intervals . Fasting samples for measurements of glucose and c - peptide were obtained, followed by the ingestion of a 1.75 g / kg oral glucose dose (maximum 75 g of carbohydrate). Samples were then obtained at 30-min intervals for measurements of glucose and c - peptide . When a fasting glucose level exceeded 126 mg / dl and/or a 2-h glucose level exceeded 200 mg / dl, an ogtt was repeated for confirmation . If either the fasting or the 2-h glucose threshold was exceeded again at confirmatory testing, t1d was diagnosed . Participants who did not exceed either threshold on the confirmatory ogtt continued to be followed at 6-month intervals . According to the protocols, the time of diagnosis was assigned to the date of the first ogtt in dpt-1, whereas the time of diagnosis was assigned to the date of the confirmatory ogtt in the tnnhs . For consistency in these analyses, we designated the date of diagnosis as the date of the first ogtt in both studies . C - peptide was measured by radioimmunoassay (rai) in dpt-1 and by the tosoh assay in the tnnhs . In a prior analysis, 564 individuals had c - peptide measurements by both the tosoh assay and the rai used in dpt-1 (r = 0.961; tosoh = 0.96 rai + 0.1). Undetectable fasting c - peptide values were assigned a value of one - half the limit of detection . We developed a metabolic index, the t1d diagnostic index60 (index60), for the purpose of this study . Index60 includes log fasting c - peptide, 60-min glucose, and 60-min c - peptide values from ogtts . It differs from the dptrs, which includes log fasting c - peptide, glucose, and c - peptide sums from 30-, 60-, 90-, and 120-min values; log bmi; and age . An index60 threshold was chosen for a diagnostic criterion rather than the dptrs, since, in contrast to the sum of the 30- to 120-min values used for the dptrs, the 60-min values are independent of the 120-min glucose, which is a diagnostic criterion . In addition, index60 does not rely upon age and bmi, nonmetabolic measures, for diagnosis . The intent of the analysis was to determine whether an index60 threshold of 2.00 could be used as an additional diagnostic criterion for t1d . Glucose and c - peptide values at 60 min were found to be strong univariate predictors of t1d (p <0.001); they were more strongly predictive than the respective 2-h glucose and c - peptide values (supplementary table 1). The log fasting c - peptide was also predictive (p = 0.03), and its inclusion in the model appreciably enhanced overall prediction . Fasting glucose values did not contribute significantly to the model . The log fasting c - peptide, 60-min glucose, and 60-min c - peptide were all highly predictive of t1d within the index60 model . The equation for the index60 model is: more information pertaining to the index60 model is included in supplementary table 2 . An index60 threshold of 2.00 corresponded (by linear regression) to a high dptrs value: 8.02 . The development of the dptrs and its conversion to a risk estimate has previously been described (5). Those with an index60 value 2.00 at baseline were excluded, as were those with fasting glucose levels 126 mg / dl or 2-h glucose levels 200 mg / dl at baseline . We did not perform analyses pertaining to the 126 mg / dl fasting glucose threshold since it is uncommon without the presence of 2-h glucose values 200 mg / dl in autoantibody - positive individuals . Hereafter, ogtts will be characterized in the following manner: index60 value 2.00 = ind60+index60 value <2.00 = ind602-h glucose value 200 mg / dl = 2hglu+2-h glucose value <200 mg / dl = 2hglucomparisons of diagnostic criteria were based on whether t1d was diagnosed during follow - up and whether the diagnostic criteria were exceeded (after baseline) prior to or at diagnosis . 2hglu+ ogtts triggered the performance of a confirmatory ogtt, whereas ind60 + ogtts were not considered in the protocols . This likely resulted in a bias in favor of 2hglu+ ogtts over ind60 + ogtts, which should be considered in the interpretation of the findings . <2.00 = ind60 2-h glucose value 200 mg / dl = 2hglu+ 2-h glucose value <200 mg / dl = 2hglu since there was no procedure for confirming ind60 + ogtts in the protocols, we designated the confirmatory ogtt for that threshold as the next ogtt performed within a 9-month interval . This interval was chosen because it corresponded to the upper limit of the standard 6 3-month window for the next visit in dpt-1 and the tnnhs . If the next ogtt occurred after the 9-month interval, it was not considered for confirmation of the prior ind60 + ogtt . The sensitivity indicates the proportion of individuals positive for a test criterion among those who were ultimately diagnosed with t1d . The specificity indicates the proportion of individuals negative for a test criterion among those who were not diagnosed with t1d . The positive predictive value indicates the proportion of individuals who were ultimately diagnosed with t1d among those positive for a test criterion . The negative predictive value indicates the proportion of individuals who were not diagnosed with t1d among those negative for a test criterion . Data from pancreatic autoantibody - positive relatives of patients with t1d who participated in dpt-1 or the tnnhs were analyzed . Those from dpt-1 were positive for islet cell autoantibodies (ica), whereas those from the tnnhs were positive for at least one of the following autoantibodies: gada, ia-2a, miaa, and ica (very few had ica alone). Dpt-1 consisted of a low - dose parenteral insulin trial and an oral insulin trial . These trials have been described (8,9); neither intervention showed an overall effect . The tnnhs is an observational rather than an intervention study; that study has also been described (10). Both studies were approved by institutional review boards at all participating sites, and written informed consent and assent as appropriate were obtained in both studies . Participants were followed in both dpt-1 and the tnnhs for the development of t1d with ogtt surveillance at 6 (3)-month intervals . Fasting samples for measurements of glucose and c - peptide were obtained, followed by the ingestion of a 1.75 g / kg oral glucose dose (maximum 75 g of carbohydrate). Samples were then obtained at 30-min intervals for measurements of glucose and c - peptide . When a fasting glucose level exceeded 126 mg / dl and/or a 2-h glucose level exceeded 200 mg / dl, an ogtt was repeated for confirmation . If either the fasting or the 2-h glucose threshold was exceeded again at confirmatory testing, t1d was diagnosed . Participants who did not exceed either threshold on the confirmatory ogtt continued to be followed at 6-month intervals . According to the protocols, the time of diagnosis was assigned to the date of the first ogtt in dpt-1, whereas the time of diagnosis was assigned to the date of the confirmatory ogtt in the tnnhs . For consistency in these analyses, we designated the date of diagnosis as the date of the first ogtt in both studies . C - peptide was measured by radioimmunoassay (rai) in dpt-1 and by the tosoh assay in the tnnhs . In a prior analysis, 564 individuals had c - peptide measurements by both the tosoh assay and the rai used in dpt-1 (r = 0.961; tosoh = 0.96 rai + 0.1). Undetectable fasting c - peptide values were assigned a value of one - half the limit of detection . We developed a metabolic index, the t1d diagnostic index60 (index60), for the purpose of this study . Index60 includes log fasting c - peptide, 60-min glucose, and 60-min c - peptide values from ogtts . It differs from the dptrs, which includes log fasting c - peptide, glucose, and c - peptide sums from 30-, 60-, 90-, and 120-min values; log bmi; and age . An index60 threshold was chosen for a diagnostic criterion rather than the dptrs, since, in contrast to the sum of the 30- to 120-min values used for the dptrs, the 60-min values are independent of the 120-min glucose, which is a diagnostic criterion . In addition, index60 does not rely upon age and bmi, nonmetabolic measures, for diagnosis . The intent of the analysis was to determine whether an index60 threshold of 2.00 could be used as an additional diagnostic criterion for t1d . Glucose and c - peptide values at 60 min were found to be strong univariate predictors of t1d (p <0.001); they were more strongly predictive than the respective 2-h glucose and c - peptide values (supplementary table 1). The log fasting c - peptide was also predictive (p = 0.03), and its inclusion in the model appreciably enhanced overall prediction . The log fasting c - peptide, 60-min glucose, and 60-min c - peptide were all highly predictive of t1d within the index60 model . The equation for the index60 model is: more information pertaining to the index60 model is included in supplementary table 2 . An index60 threshold of 2.00 corresponded (by linear regression) to a high dptrs value: 8.02 . The development of the dptrs and its conversion to a risk estimate has previously been described (5). Those with an index60 value 2.00 at baseline were excluded, as were those with fasting glucose levels 126 mg / dl or 2-h glucose levels 200 mg / dl at baseline . We did not perform analyses pertaining to the 126 mg / dl fasting glucose threshold since it is uncommon without the presence of 2-h glucose values 200 mg / dl in autoantibody - positive individuals . Hereafter, ogtts will be characterized in the following manner: index60 value 2.00 = ind60+index60 value <2.00 = ind602-h glucose value 200 mg / dl = 2hglu+2-h glucose value <200 mg / dl = 2hglucomparisons of diagnostic criteria were based on whether t1d was diagnosed during follow - up and whether the diagnostic criteria were exceeded (after baseline) prior to or at diagnosis . 2hglu+ ogtts triggered the performance of a confirmatory ogtt, whereas ind60 + ogtts were not considered in the protocols . This likely resulted in a bias in favor of 2hglu+ ogtts over ind60 + ogtts, which should be considered in the interpretation of the findings . Index60 value 2.00 = ind60 + index60 value <2.00 = ind60 2-h glucose value 200 mg / dl = 2hglu+ 2-h glucose value <200 mg / dl = 2hglu since there was no procedure for confirming ind60 + ogtts in the protocols, we designated the confirmatory ogtt for that threshold as the next ogtt performed within a 9-month interval . This interval was chosen because it corresponded to the upper limit of the standard 6 3-month window for the next visit in dpt-1 and the tnnhs . If the next ogtt occurred after the 9-month interval, it was not considered for confirmation of the prior ind60 + ogtt . The sensitivity indicates the proportion of individuals positive for a test criterion among those who were ultimately diagnosed with t1d . The specificity indicates the proportion of individuals negative for a test criterion among those who were not diagnosed with t1d . The positive predictive value indicates the proportion of individuals who were ultimately diagnosed with t1d among those positive for a test criterion . The negative predictive value indicates the proportion of individuals who were not diagnosed with t1d among those negative for a test criterion . There were 633 dpt-1 participants (mean sd age, 14.1 9.8 years; 56% male) and 1,717 tnnhs participants (mean sd age, 18.0 13.1 years; 46% male) with ind60 and nondiabetic - range ogtts at baseline who had follow - up . Of the 633 in dpt-1, 203 (32%) were diagnosed with t1d, whereas of the 1,717 in the tnnhs, 221 (13%) were diagnosed with t1d . In dpt-1, 127/633 (20%) had at least one ind60+only ogtt, whereas in the tnnhs 83/1,717 (5%) had at least one ind60+only ogtt . Individuals with glucose levels in the nondiabetic range and with index60 values <2.00 at baseline were assessed for the accuracy of prediction of t1d by index60 and the 2-h glucose . 1), an indicator of accuracy, was significantly higher for index60 than for the 2-h glucose in both dpt-1 (0.75 vs. 0.66; p <0.001; n = 633) and the tnnhs (0.78 vs. 0.66; p <0.001; n = 1,717). To assess the accuracy of ind60 + as a diagnostic criterion for t1d, we compared the first ogtts that were ind60+only (i.e., ind60 + and 2hglu) with the first ogtts that were 2hglu+only (i.e., ind60 and 2hglu+). Sensitivities, specificities, and predictive values are shown for ind60+only and 2hglu+only ogtts in table 1 . The sensitivities were higher for ind60+only ogtts than for 2hglu+only ogtts in both dpt-1 and the tnnhs . Although the specificity was somewhat higher for 2hglu+only ogtts in dpt-1, there was no difference in the tnnhs . The positive and negative predictive values all tended to be higher for ind60+only ogtts than for 2hglu+only ogtts in both studies . Comparison of performance of ind60 + with 2hglu+ as diagnostic criteria for t1d there were 21 dpt-1 participants not diagnosed whose last ogtt was ind60+only . The mean sd dptrs value at that visit was 8.70 0.67 (n = 20 due to one missing value), which corresponds to a calculated 3-year risk of 0.97 in dpt-1 . Of those in the tnnhs the mean sd dptrs value for those individuals was also very high: 8.77 0.89 . The change in c - peptide levels from the first ind60+only ogtt to diagnosis was examined among 56 individuals who had ogtts at diagnosis in dpt-1 (fig . 1). There was a marked decline in the postchallenge c - peptide measures (p = 0.001 or p <the median percentage of change for the c - peptide values at the postchallenge ogtt time points ranged from 22 to 34% . The number analyzed was much smaller in the tnnhs (n = 17), but all of the differences were significant (p = 0.02 for 30 min and p 0.01 for the other postchallenge time points). The median percentage of decline ranged from 14 to 27% over an interval of 1.38 1.25 years . Shown are mean c - peptide levels from the first ind60+only ogtt exceeded during follow - up to diagnosis in dpt-1 . There was a marked decline in c - peptide levels at each of the postchallenge time points . We compared metabolic patterns of ind60+only ogtts (n = 115) with 2hglu+only (n = 34) ogtts . (individuals with the alternate pattern on a subsequent ogtt were excluded from the analysis .) The c - peptide values (fig . 2a) were lower (p <0.01) at each time point during the ind60+only ogtts than the values during the 2hglu+only ogtts . While postchallenge glucose values (fig . 2b) were higher at 30 and 60 min during the ind60+only ogtts, glucose values were higher at 90 and 120 min during the 2hglu+only ogtts . Panel a shows mean c - peptide levels for time points of ind60+only ogtts and 2hglu+only ogtts in dpt-1 . Panel b shows mean glucose values for time points of ind60+only ogtts and 2hglu+only ogtts in dpt-1 . The glucose values tended to be higher at the earlier time points in the ind60+only ogtts and higher at the later ogtt time points in the 2hglu+only ogtts . A plot of the c - peptide values against the glucose values (supplementary fig . 2) underscores the marked difference in the patterns between ind60+only ogtts and 2hglu+only ogtts . Those with ind60+only ogtts were younger than those with 2hglu+only ogtts, both in dpt-1 (12.9 7.2 vs. 18.1 10.2 years; p <0.001) and the tnnhs (14.7 11.2 vs. 23.9 14.6 years; p <0.001). Two scenarios were examined in which ind60 + ogtts could be useful for diagnosing t1d . We first assessed its utility in individuals with an ind60+only ogtt who were again ind60 + (with either 2hglu+ or 2hglu) at the next ogtt (<9 month interval). There were 54 such individuals in dpt-1, of whom, 50 (93%) were diagnosed with t1d . The maximum follow - up from the second ogtt of those not diagnosed was 1.0 year . In the tnnhs, 18/21 (86%) of those individuals the maximum follow - up from the second ogtt of those not diagnosed was 0.6 years . The second scenario involved individuals with ogtts that were both ind60 + and 2hglu+ who then had an ogtt for standard confirmation (<3-month interval) that was ind60+only . Thus they were negative for the 2-h glucose on the standard confirmatory ogtt, but ind60 + on both ogtts . In dpt-1, among those individuals, 28/30 (93%) were subsequently diagnosed . The two individuals not diagnosed had no follow - up . Among the individuals in the tnnhs who had an ogtt that was ind60 + and 2hglu+ and then had an ind60+only confirmatory ogtt, 7/9 (78%) thus all of those followed in both studies were ultimately diagnosed when the confirmatory ogtt was ind60+only . Summary of findings from scenarios for the use of ind60 + ogtts as an additional diagnostic criterion to 2hglu+ ogtts in dpt-1 the maximum follow - up of the four not diagnosed was 1.0 year . There was no follow - up of the two not diagnosed after the second ind60 + ogtt . Since ind60 + ogtts were not used for diagnosis in the dpt-1 and tnnhs protocols, those with an ind60 + ogtt and a subsequent confirmatory ind60 + ogtt continued to be followed . Still, a total of 67 would have been diagnosed earlier in dpt-1 if ind60 + ogtts had been used in addition to standard diagnostic criteria . Individuals with glucose levels in the nondiabetic range and with index60 values <2.00 at baseline were assessed for the accuracy of prediction of t1d by index60 and the 2-h glucose . 1), an indicator of accuracy, was significantly higher for index60 than for the 2-h glucose in both dpt-1 (0.75 vs. 0.66; p <0.001; n = 633) and the tnnhs (0.78 vs. 0.66; p <0.001; n = 1,717). To assess the accuracy of ind60 + as a diagnostic criterion for t1d, we compared the first ogtts that were ind60+only (i.e., ind60 + and 2hglu) with the first ogtts that were 2hglu+only (i.e., ind60 and 2hglu+). Sensitivities, specificities, and predictive values are shown for ind60+only and 2hglu+only ogtts in table 1 . The sensitivities were higher for ind60+only ogtts than for 2hglu+only ogtts in both dpt-1 and the tnnhs . Although the specificity was somewhat higher for 2hglu+only ogtts in dpt-1, there was no difference in the tnnhs . The positive and negative predictive values all tended to be higher for ind60+only ogtts than for 2hglu+only ogtts in both studies . The mean sd dptrs value at that visit was 8.70 0.67 (n = 20 due to one missing value), which corresponds to a calculated 3-year risk of 0.97 in dpt-1 . Of those in the tnnhs the mean sd dptrs value for those individuals was also very high: 8.77 0.89 . The change in c - peptide levels from the first ind60+only ogtt to diagnosis was examined among 56 individuals who had ogtts at diagnosis in dpt-1 (fig . 1). There was a marked decline in the postchallenge c - peptide measures (p = 0.001 or p <the median percentage of change for the c - peptide values at the postchallenge ogtt time points ranged from 22 to 34% . The number analyzed was much smaller in the tnnhs (n = 17), but all of the differences were significant (p = 0.02 for 30 min and p 0.01 for the other postchallenge time points). The median percentage of decline ranged from 14 to 27% over an interval of 1.38 1.25 years . Shown are mean c - peptide levels from the first ind60+only ogtt exceeded during follow - up to diagnosis in dpt-1 . There was a marked decline in c - peptide levels at each of the postchallenge time points . We compared metabolic patterns of ind60+only ogtts (n = 115) with 2hglu+only (n = 34) ogtts . (individuals with the alternate pattern on a subsequent ogtt were excluded from the analysis .) The c - peptide values (fig . 2a) were lower (p <0.01) at each time point during the ind60+only ogtts than the values during the 2hglu+only ogtts . While postchallenge glucose values (fig . 2b) were higher at 30 and 60 min during the ind60+only ogtts, glucose values were higher at 90 and 120 min during the 2hglu+only ogtts . Panel a shows mean c - peptide levels for time points of ind60+only ogtts and 2hglu+only ogtts in dpt-1 . Panel b shows mean glucose values for time points of ind60+only ogtts and 2hglu+only ogtts in dpt-1 . The glucose values tended to be higher at the earlier time points in the ind60+only ogtts and higher at the later ogtt time points in the 2hglu+only ogtts . A plot of the c - peptide values against the glucose values (supplementary fig . 2) underscores the marked difference in the patterns between ind60+only ogtts and 2hglu+only ogtts . Those with ind60+only ogtts were younger than those with 2hglu+only ogtts, both in dpt-1 (12.9 7.2 vs. 18.1 10.2 years; p <0.001) and the tnnhs (14.7 11.2 vs. 23.9 14.6 years; p <0.001). Two scenarios were examined in which ind60 + ogtts could be useful for diagnosing t1d . We first assessed its utility in individuals with an ind60+only ogtt who were again ind60 + (with either 2hglu+ or 2hglu) at the next ogtt (<9 month interval). There were 54 such individuals in dpt-1, of whom, 50 (93%) were diagnosed with t1d . The maximum follow - up from the second ogtt of those not diagnosed was 1.0 year . In the tnnhs, 18/21 (86%) of those individuals the maximum follow - up from the second ogtt of those not diagnosed was 0.6 years . The second scenario involved individuals with ogtts that were both ind60 + and 2hglu+ who then had an ogtt for standard confirmation (<3-month interval) that was ind60+only . Thus they were negative for the 2-h glucose on the standard confirmatory ogtt, but ind60 + on both ogtts . In dpt-1, among those individuals, 28/30 (93%) the two individuals not diagnosed had no follow - up . Among the individuals in the tnnhs who had an ogtt that was ind60 + and 2hglu+ and then had an ind60+only confirmatory ogtt, 7/9 (78%) thus all of those followed in both studies were ultimately diagnosed when the confirmatory ogtt was ind60+only . Summary of findings from scenarios for the use of ind60 + ogtts as an additional diagnostic criterion to 2hglu+ ogtts in dpt-1 the maximum follow - up of the four not diagnosed was 1.0 year . There was no follow - up of the two not diagnosed after the second ind60 + ogtt . Since ind60 + ogtts were not used for diagnosis in the dpt-1 and tnnhs protocols, those with an ind60 + ogtt and a subsequent confirmatory ind60 + ogtt continued to be followed . Still, a total of 67 would have been diagnosed earlier in dpt-1 if ind60 + ogtts had been used in addition to standard diagnostic criteria . In contrast to the clinical diagnosis of t1d, the diagnosis in prevention trials is often made through ogtt surveillance in asymptomatic individuals . We have thus explored whether an additional criterion, index60 values> 2.00, might result in an earlier diagnosis in the autoantibody - positive individuals who typically participate in prevention trials . Although limited to those individuals, the findings suggest the possibility of developing diagnostic criteria based on prediction and natural history that could result in an earlier diagnosis in the general population . Ogtt surveillance could become more common as the identification of at - risk populations improves, especially if acceptable therapies to slow the t1d disease process are identified and become available . The findings suggest that the 2.00 index60 value represents a point of transition from prediction to a virtual indication of t1d in autoantibody - positive relatives of t1d patients . The roc curves showed that at baseline, index60 was a much more accurate predictor of t1d than the 2-h glucose . Moreover, when the first ind60+only ogtts during follow - up were exceeded, there was a concomitant substantial rate of decline in c - peptide levels . That decline is consistent with the c - peptide losses that occur in the perionset period of t1d (1113). The use of the ind60 + criterion represents a novel approach for diagnosing t1d because it is based on both prediction and natural history . Since 2hglu+ was used as a diagnostic criterion in the dpt-1 and tnnhs protocols, there was potentially a bias in favor of 2hglu+ over ind60 + . Whereas 2hglu+only ogtts triggered the performance of confirmatory ogtts for diagnosis, ind60+only ogtts did not . It is thus possible that ind60 + could have performed even better as a diagnostic criterion relative to 2hglu+ . The higher predictive values for ind60+only ogtts than for 2hglu+only ogtts indicate that the choice of an index60 value of 2.00 as a threshold is reasonably conservative . The scenarios showed potential utilities for ind60 + ogtts as an additional criterion for the diagnosis of t1d (table 2). Very small percentages of those with confirmed ind60 + ogtts were not subsequently diagnosed (i.e., false positives). It is possible that the few false positives were individuals who ultimately would have developed t1d with longer follow - up . This is suggested by the very high dptrs values of those not diagnosed who had ind60+only ogtts at the last visit . Since ind60 + would be used as an additional criterion to the standard criteria, there would be no false negatives . The use of ind60 + as an additional diagnostic criterion would help to shorten the duration of follow - up for a number of participants in prevention trials, with reductions in both inconvenience and cost . If the two scenarios presented above had been implemented, the addition of ind60 + ogtts as a criterion would have resulted in an earlier diagnosis of t1d in over one - fourth of those diagnosed in dpt-1 . The ind60 + diagnostic criterion could be especially useful in children since individuals with ind60+only ogtts were much younger than those with 2hglu+only ogtts in dpt-1 and the tnnhs . It seems particularly worthwhile to assess the use of ind60 + as an additional diagnostic criterion in both prevention trials and epidemiologic studies of children who are at risk for t1d . Confirmed ind60 + ogtts might also help to identify more individuals with silent diabetes (i.e., asymptomatic individuals diagnosed by metabolic testing); they have more insulin secretion capacity than those diagnosed after symptoms develop . The marked differences in the patterns between ind60+only ogtts and 2hglu+only ogtts, evident in fig . . The higher c - peptide levels in the 2hglu+only ogtts do not necessarily indicate better -cell function, since they could be related to increased insulin resistance due to differences in age and pubertal status (14,15). As indicated above however, since the autoantibody entry criteria differed between dpt-1 and the tnnhs, the similar findings suggest that ind60 + ogtts can be used across autoantibody - positive populations . Another limitation for using index60 clinically is the need for standardization of c - peptide assays . The national diabetes data group criteria from 1979 included a glucose value 200 mg / dl between the fasting and 2-h values for diagnosis (16). A 60-min glucose value of 180 mg / dl is currently one of the criteria for gestational diabetes (1). The findings strongly suggest that prediction and natural history can provide a basis for diagnosing t1d . They showed that a confirmed index60 value of 2.00 has potential utility as an additional diagnostic criterion for t1d . It could also serve as a criterion for silent diabetes, and as an indicator of an impending rapid loss of insulin secretion . Whether index60 or another measure is used, it appears that an approach based on prediction and natural history can aid in diagnosing individuals at an earlier stage of disease . This approach will become increasingly important as preventive treatments for t1d are assessed and ultimately implemented.
|
Transgenic ostreococcus tauri lines4 were cultured in keller media - supplemented artificial sea water (km) under 12:12 h blue (ocean blue, lee lighting filter 724) light: dark cycles (17.5 e / m). For imaging, cultures were transferred to 96-well microplates (lumitrac, greiner bio - one) at a density of ~1510 cells / ml and entrained for 7 - 10 days . No density effects on clock output were observed under relevant density ranges, and cell division in microplates was found to be close to zero . One day prior to recording, 150 l km was replaced with 150 l km containing 333 m luciferin (km+). Drugs were made up in dmso or km+, diluted in km+ and added to replicates of 8 or 16 wells immediately prior to recording . For incubations in constant darkness, km+ was supplemented with 200 mm sorbitol and 0.4% glycerol in order to increase cell viability . Bioluminescent recordings were performed on a topcount (packard) under constant darkness or constant red+blue led light (5 - 12 e / m). For wash - off of reversible inhibitors, cell aggregates formed in the bottom of the wells were quickly and gently washed twice with km+, using multi - channel pipettes, and returned to recording conditions . Analysis of period was performed with fft - nlls (brass 330) using time windows 3 days; mfourfit (brass 3) was used to assess phase and confirmed manually . Statistical analysis was performed using graphpad prism . For de novo rna synthesis analysis by [p]utp uptake, 1 ml cell aliquots were either incubated in darkness or light / dark cycles for 4 days . 0.2 mbq of [p]utp was added, and after incubation cells were collected and washed twice with km . Sequence alignments were performed using ebi jalview, blast searches were performed using ncbi blastp under the default blossum62 settings . Circadian rhythms in a eukaryote can be sustained solely by non - transcriptional mechanisms, which are conserved across taxa.
|
A 27-year - old man visited our hospital because of a sudden - onset generalized convulsion . He had been overworking and had slept less than 5 hours a day for the previous month . A week prior to the hospital visit, the patient had developed a fever and generalized myalgia but had not taken any medicine . High fever, anorexia, and generalized malaise appeared . On the day of the hospital visit, he could not be awakened, and he showed no responses to any stimulus . Finally, he developed a generalized tonic - clonic seizure that lasted for about three min and that was accompanied by cyanosis, upward eyeball deviation, and tongue biting . On physical examination at the emergency department, the patient s body temperature rose up to 38.7c . He was confused and could not follow the examiner s verbal commands appropriately, and he often attempted to run out of the bed while yelling incomprehensible words and abuses . Neck stiffness was found on neurologic examination . Positive or negative myoclonic jerk was not observed . The cerebrospinal fluid (csf) was clear, and its pressure was measured at 16.0 cmh2o, with 20 leukocytes/l (95% lymphocytes), protein levels of 70.5 mg / dl, and normal glucose levels (63.0 mg / dl). Aspartate aminotransferase (ast), alanine aminotransferase (alt), and -glutamyl transpeptidase levels were increased to 441, 1294, and 460 total bilirubin and direct bilirubin levels were normal (0.6 mg / dl and 0.2 mg / dl, respectively). Seizure did not relapse after 30 min of continuous infusion of 15 mg / kg of phenytoin mixed with normal saline . He regained consciousness on the second admission day and became fully conscious the following day . Intravenous acyclovir was given for two days because of the clinical suspicion of herpes encephalitis, which was discontinued after observing the clinical improvement and the detection of the igm antibody of hav . The patient s score on the korean version of the mini - mental status examination (k - mmse) score was 30 on the fifth admission day . Serum and csf igm antibodies of herpes simplex type 1, 2, and varicella zoster were negative . Polymerase chain reaction (pcr) of the csf for hav and enterovirus were also negative . Ast and alt levels decreased to 125 and 432 iu / l on the seventh admission day . Hav, which causes an acute inflammatory hepatitis, is a picornavirus, which is transmitted by the fecal - to - oral route . The clinical spectrum varies from mild flu - like illness to fatality caused by acute fulminant hepatitis . In the anicteric form, diagnosis may be delayed due to the atypical presentation of the disease . In general, the disease is preceded by flu - like prodromes, and the progression of the hepatitis symptoms and liver enzyme elevations is relatively rapid . In a week or so, liver enzymes stop elevating and gradually decrease to normal levels . Diagnosis can be made by the detection of the serum igm antibody of hav [46]. Common pathomechanisms are attributed to a disturbed detoxification process by the damaged liver and metabolic disturbances, such as fluid electrolyte imbalances . Our patient had a seizure in an early stage of the disease, and he showed no specific laboratory abnormalities other than liver enzyme elevations . He showed neck stiffness and a clouding of consciousness that was accompanied by csf abnormalities that were compatible with encephalitis . These findings support the diagnosis of encephalitis rather than that of toxic - metabolic disturbances due to the hepatitis . After reviewing five cases, including the above report, altered consciousness and seizures are commonly manifested . Positive hav pcr results were reported in one case, of which csf cells and protein were normal . The clinical courses were all benign; all patients improved within a few days to a few weeks with supportive treatment [2,3,810]. Hav - associated encephalitis is a very rare disorder, which has not been reported in korea . No specific radiological or eeg findings are observed . In particular, in the anicteric form of the disease, the diagnosis may be difficult without a clinical suspicion . When progressive liver enzyme elevations are observed in patients with encephalitis
|
Hypertension is a major global concern and public health problem affecting more than one billion individuals worldwide and is one of the key preventable risk factors for cardiovascular events . It has a massive distributing impact on the population s health, resulting in unnecessary morbidity and mortality.1 in nearly 75% of adults with cardiovascular disease, hypertension is a common morbidity.2 despite the availability of a wide range of antihypertensive drugs, hypertension and its complications are still an important cause of adult morbidity and mortality.3,4 factors reported to be contributing to the failure to control blood pressure (bp) include poor adherence to therapeutic regimen, ignorance, and poverty.3,5 recent reports have, however, focused on the role of health care provider and poor adherence to antihypertensive drugs.6 one of the most pressing problems facing public health providers and administrators in many countries is the irrational use of drugs,7 and, therefore, the concept of rational drug use during the past few years has been the theme of various national and international gatherings . Various studies conducted in developing as well as developed countries during the past few years regarding the safe and effective use of drugs show that irrational drug use is a global phenomenon, and only few prescriptions show rational use of drugs.8 the irrational use of drugs is a major problem of present - day medical practice, and its consequences include ineffective treatment, unnecessary prescription of drugs, development of resistance, adverse effects, and economic burden on patients and society . The five important criteria for rational drug use are accurate diagnosis, proper prescribing, correct dispensing, suitable packing, and patient adherence . Pharmacists should ensure that the effective form of the drug reaches the right patient in the prescribed dosage and should also give clear instructions on the use of the drug.9,10 the study of the prescribing pattern is an important part of a medical audit that seeks to monitor the pattern of drug use and necessary modification to the pattern to achieve rational and cost - effective medication use.11 the need to improve the global control of high bp necessitated the stipulation of various hypertension classification and treatment guidelines . In recent times, these guidelines include those of the world health organization / international society of hypertension (who / ish) and the sixth and seventh report of the joint national committee on the prevention, detection, evaluation, and treatment of hypertension.12 the aim of this study was, therefore, to assess the prescribing, dispensing, and patient use pattern of antihypertensive drugs in the outpatient department of hiwot fana specialized university hospital (hfsuh). The prescribing pattern was investigated to ascertain whether it was in accordance with ethiopian standard treatment guidelines . Hypertension is a major global concern and public health problem affecting more than one billion individuals worldwide and is one of the key preventable risk factors for cardiovascular events . It has a massive distributing impact on the population s health, resulting in unnecessary morbidity and mortality.1 in nearly 75% of adults with cardiovascular disease, hypertension is a common morbidity.2 despite the availability of a wide range of antihypertensive drugs, hypertension and its complications are still an important cause of adult morbidity and mortality.3,4 factors reported to be contributing to the failure to control blood pressure (bp) include poor adherence to therapeutic regimen, ignorance, and poverty.3,5 recent reports have, however, focused on the role of health care provider and poor adherence to antihypertensive drugs.6 one of the most pressing problems facing public health providers and administrators in many countries is the irrational use of drugs,7 and, therefore, the concept of rational drug use during the past few years has been the theme of various national and international gatherings . Various studies conducted in developing as well as developed countries during the past few years regarding the safe and effective use of drugs show that irrational drug use is a global phenomenon, and only few prescriptions show rational use of drugs.8 the irrational use of drugs is a major problem of present - day medical practice, and its consequences include ineffective treatment, unnecessary prescription of drugs, development of resistance, adverse effects, and economic burden on patients and society . The five important criteria for rational drug use are accurate diagnosis, proper prescribing, correct dispensing, suitable packing, and patient adherence . Pharmacists should ensure that the effective form of the drug reaches the right patient in the prescribed dosage and should also give clear instructions on the use of the drug.9,10 the study of the prescribing pattern is an important part of a medical audit that seeks to monitor the pattern of drug use and necessary modification to the pattern to achieve rational and cost - effective medication use.11 the need to improve the global control of high bp necessitated the stipulation of various hypertension classification and treatment guidelines . In recent times, these guidelines include those of the world health organization / international society of hypertension (who / ish) and the sixth and seventh report of the joint national committee on the prevention, detection, evaluation, and treatment of hypertension.12 the aim of this study was, therefore, to assess the prescribing, dispensing, and patient use pattern of antihypertensive drugs in the outpatient department of hiwot fana specialized university hospital (hfsuh). The prescribing pattern was investigated to ascertain whether it was in accordance with ethiopian standard treatment guidelines . Prospective and retrospective studies were conducted in the hospital after obtaining approval from the institutional ethical committee . Data were collected by evaluating or reviewing the records of 400 patients with hypertension attending hfsuh and by directly observing the dispensing pattern to determine the time of dispensing between the patients and the pharmacists as well as to evaluate the pattern of patient use . Two hundred patients randomly selected were interviewed by using preprepared data collection tools for those who were taking their medication from the pharmacy during april 1may 31, 2013 . The amount of time that the pharmacist spent with the patient while dispensing the prescribed drug was measured by directly observing the dispensing process . All patients who had hypertension and were actively attending the hfsuh outpatient department were included in the study; however, patients attending the inpatient department, who were under the age of 18, with psychiatric illnesses, who were chronically ill - looking, and manifested hypertensive emergencies, or were nonconsenting were excluded from the study . Drugs were grouped in major classes of antihypertensive monotherapy diuretics, beta - blockers (bb), angiotensin converting enzyme (ace) inhibitors and angiotensin ii receptor antagonists (aiiras), calcium channel blockers (ccbs), or others . Monotherapy was defined as a prescription for one agent, or two within the same drug class (to cover the widely used fixed - combination formulations). Combination therapy was defined as a prescription for more than one agent from two classes, including two agents in one formulation . Hypertension was defined as systolic blood pressure 140 mmhg and diastolic blood pressure 90, or being on drug therapy . Stage 1 blood pressure was defined as bp in the range 140159/9099, and stage 2 blood pressure as bp in the range 160/100 . The prescribing pattern was compared with the ethiopian standard treatment guidelines, which suggest that any one of the following classes of drugs could be used as first - step agents against hypertension based on nonemergency and emergency conditions: diuretics, beta - blockers, calcium antagonists, and converting enzyme inhibitors, and the drugs prescribed were also checked to ascertain whether they were on the list of essential medicines for ethiopia or not . Among the 400 patients studied, 63.5% and 36.5% were females and males, respectively . The majority of the patients (69%) had stage 1 hypertension, and 31% had stage 2 hypertension (as shown in table 1). Out of the total number of patients, 132 had comorbid conditions, and 85 were on monotherapy, namely, diabetes mellitus (64.3%), followed by congestive heart failure (chf) (15.1%), and ischemic heart disease (ishd) (2.3%). The highest number of prescriptions were ordered by health officers (212; 53%), followed by prescriptions ordered by nurses (110; 27.5%), medical doctors (40; 10%), and medical and ho interns (38; 9.5%), as indicated in figure 1 . Of the 400 patients studied, 260 (65.5%) were on monotherapy, while 140 (34.5%) were on combination therapy . Sex - wise, 163 females received monotherapy, and 49 males were on combination therapy . The pattern of prescription of antihypertensive drugs is shown in table 2 . The most frequently prescribed class of antihypertensive drugs was diuretics, of which hydrochlorothiazide (hct) was the most frequently prescribed drug, both in single (55%), followed by enalapril (22.3%), methyl dopa (11.2%), atenolol (6.9%), and nifedipine (4.6%), and in combination with other antihypertensive drugs . A two - drug combination appeared to be the most frequent dose combination, of which the hct twenty - seven and half percent and 72.5% of the two - drug combination regimen were prescribed in stage 1 hypertension and stage 2 hypertension, respectively . A total of 1,280 drugs were prescribed, and the average number of drugs prescribed per encounter was 3.20.93 . Out of 544 antihypertensive drugs prescribed, 527 (97%) were prescribed in accordance with ethiopian standard treatment guidelines, and 473 (87%) were prescribed by their generic name . Out of 200 patients who were interviewed after dispensing, only 13 (6.5%), 52 (26%), 58 (36%), 11 (5.5%), and 26 (13%) knew the names of the drug, dose of the drug, frequency of dosing, side effects of the drugs they were taking, and caution to take during the treatment regimen, respectively . The results of the present study indicate that the proportion of females with hypertension (63.5%) was high . Other studies have also revealed that there was a high incidence of hypertension among females.4,13 more than half of the patients were over 51 years old, showing that higher age was directly related to a higher incidence of hypertension . Among the various possibilities, this could be attributable to the lack of awareness of hypertension and the lack of control of hypertension in old age . A study conducted by shivashankaramurthy et al14 in india revealed that 80% had hypertension (hpn) with edema, unlike our study, which indicated that most of the patients had hpn with diabetes mellitus as the prevalent comorbid illnesses . This study showed that most outpatients with hypertension in the hospital received monotherapy, although international guidelines2 indicated that monotherapy achieves the bp target only in a limited number of hypertensive patients . Earlier studies2,11,15 suggested that an ideal combination therapy must include antihypertensive drugs possessing complementary modes of action that produce synergistic antihypertensive effects without any adverse effects, at low doses . A study conducted by beg et al15 revealed that the proportion of patients on combination therapy was higher than that of those monotherapy . The choice of diuretics as the first - line antihypertensive drug in our setting was consistent with other studies done by etuk et al16 and in compliance with the current ethiopian standard treatment guidelines.17,18 another study conducted by khurshid et al19 in india also reported that diuretics were the most frequently prescribed antihypertensive drugs, a finding similar to our own . The jnc 7 report recommends that in the absence of any specific indications, a diuretic or -blocker should be selected as the initial therapy for hypertension.20 a thiazide diuretic should be prescribed in the absence of an indication for any other specific drug(s) or when target bp has not been attained.21 however, khaja et al22 reported that bb (65.5%) were the most frequently prescribed and that diuretics (27.4%) ranked second with respect to overall utilization pattern . Diuretic and bb monotherapy accounted for almost 55% of first - line treatment in the study done by walley et al23 in the uk . From the combination therapy, our study showed diuretics + ace inhibitor (57%) and diuretics + ccb (26.1%) were the most frequently prescribed classes of antihypertensive drugs; however, the study done by shivashankaramurthy et al14 showed ccb + bb (43.9%) was frequently prescribed, followed by aiiras and diuretics (22.94%). Beg et al15 reported that most commonly prescribed antihypertensive agents were aiiras and ace inhibitors . In the study by odili et al24, almost half of the subjects (49%) were on a two - drug combination regimen, and 14% were on monotherapy; ccb were the most frequently prescribed classes of drugs (31%), followed by diuretics (30%). It is reported that a bb diuretic combination is diabetogenic and should be avoided, especially in obese individuals and those with a family history of diabetes mellitus,21 but there was a practice of prescribing such a combination therapy for patients with diabetes mellitus in our setting . It was observed in our study that there was a low frequency of prescription administration of bb and ccb as monotherapy . Furthermore, none of the patients was on aiiras either in monotherapy or in combination therapy . The results of our study also showed that there was high prevalence of stage 1 hypertension (69%). It was found that the number of drugs prescribed increased with severity of disease and with different comorbid conditions . The study also showed that the average number of drugs prescribed per encounter was 3.20.923 . Around half of the patients (53%) had received their medications upon the orders of health officers, and the least were ordered by medical and health officer interns . Out of 544 antihypertensive drugs prescribed, 527 (97%) were prescribed in accordance with ethiopian standard treatment guidelines, and 473 (87%) were prescribed by their generic name . The use of generic names could decrease the financial burden on the patient, and this could show there was a rational prescribing pattern in the setting . Another study done by beg et al15 revealed that the average number of drugs per prescription was 2.83 . The average time spent between patient and pharmacist during dispensing was 1.23 minutes in our study . According to our study, greater than 75% of the patients left the counter without knowing the names of the drugs, side effects, and precautions associated with their medications . This may be because the pharmacists did not take the time to tell the patients about the drug while dispensing . It may also be because most of the patients came from rural areas and were illiterate, so that could have made it difficult for them to read and understand the drugs they were treated with . Diuretics and ace inhibitors were the most frequently prescribed drugs in both monotherapy and combination therapy . The highest number of prescriptions were ordered by health officers, and the fewest were by medical and ho interns.
|
The use of earthworms for soil ecotoxicological risk assessment has advanced significantly over the past few decades . As many environmental contaminants possess neurotoxic properties, there exists a growing interest in using earthworms as neurotoxicity test organisms for environmental risk assessment and as potential surrogates for evaluating impacts of neurotoxic compounds on humans (davoli et al . Neurotoxicity can be defined as any adverse effect on the central or peripheral nervous system caused by chemical, biological or physical agents (costa et al . Neurotoxicity can be manifested as severe clinical signs and structural disorders (e.g., brain lesions, neurobehavioral changes, lethality). More often, organisms are chronically exposed to low - levels of neurotoxic substances . Over time, such exposures can result in subtle, sub - clinical effects that include, for example alterations in neurochemical function and nerve conduction . The ability to diagnose these early neurological effects not only warns of imminent neurotoxic damage but also provides important information as to cellular mechanisms of action (manzo et al . Cl-20 (2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane) is a relatively new energetic compound sharing some degree of structural similarity with hexahydro-1,3,5-trinitro-1,3,5-triazine (rdx), a widely used explosive with known neurotoxic properties in both humans and animals (davies et al . 2005) and posing potential environmental risks to soil invertebrates as soil is the main sink . Recently, we have demonstrated that earthworms (eisenia fetida) exposed to cl-20 or rdx exhibited typical neurophysiological symptoms (e.g., rigidity, coiling and ataxia) and that sublethal concentrations of either compound caused reversible neurotoxicity (gong et al . 2007). These results raised further questions regarding specific sites of action and molecular targets within the worm s central and peripheral nervous systems . A preliminary neurochemical investigation indicated that 8-day exposure to rdx (1.07 or 5.35 g / cm filter paper) significantly affected whole - body, muscarinic acetylcholine receptor (machr) levels in e. fetida, and these responses were accompanied by a significant decrease in the relative conduction velocity of both medial (mgf) and lateral (lgf) giant nerve fibers (gong et al . However, no significant effects of rdx were observed on other neurochemical parameters, including monoamine oxidase, acetylcholine, and cholinesterase in these same worms (gong et al . 2006). Given the above results and the structural similarity characterized by the ch no2 bonds present in both rdx and cl-20, we hypothesize that cl-20 affects the machr . Although the machr has crucial functions within the central nervous system, emerging evidence suggests that the machr also plays an important role in neuromuscular junctions of the peripheral nervous system (santafe et al ., we used a noninvasive electrophysiological technique to evaluate neurotoxicity in cl-20-treated worms, and then measured how such exposures altered levels of whole - body machr in the same animals . Our ultimate long - term goal is to elucidate the mechanisms underlying the reversible neurotoxicity of sublethal cl-20 concentrations in earthworms (gong et al . Earthworms (e. fetida) were maintained in a continuous culture from stocks obtained from carolina biological supply company (burlington, nc, usa). Worms were kept at 22 to 25c in moistened sphagnum peat with calcium carbonate added to adjust the ph to 6.5 to 7.5 and moisture content adjusted to 50% and were fed ad libitum on a diet of magic worm food (carolina biological supply). Adult earthworms (0.3~0.6 g with clitellum) were purged overnight on moistened filter paper prior to testing . Exposures were performed in 95-ml capped glass vials via contact with moistened filter paper (gong et al . One milliliter of cl-20 solution in methanol was spread on the filter paper (115 cm) and methanol was allowed to evaporate before moistening the filter paper with 2 ml of de - ionized water . The concentration of cl-20 in stock solutions (g cl-20/ml of methanol) was confirmed by hplc analysis (gong et al . The -cl-20 (99.3%) was synthesized by atk thiokol propulsion (china lake, ut, usa). Gas chromatographic - grade methanol was purchased from burdick and jackson (muskegon, mi, usa). Four sets of experiments were carried out with duration of 1, 3, 6, and 13 days, respectively . Throughout all the experiments, each worm was housed individually in a vial . Only worms in the fourth experiment were removed and allowed to recover on clean filter paper for 7 days after a 6-day exposure . Noninvasive electrophysiological measurements were repeatedly performed on day 0 (after purging but before exposure), 1, 3, 6, 7, 10 and 13 before the worms were sacrificed on day 1, 3, 6 and 13, respectively in the four experiments . Levels of muscarinic acetylcholine receptor (machr) were determined only at the termination of each experiment when the worms were sacrificed by snap - freezing in liquid nitrogen . Four concentrations of cl-20 were tested in each experiment, except for the second experiment where only three cl-20 concentrations were tested . Ten worms were used per treatment . The exposure concentration (0.02 to 0.87 g cl-20/cm depending on the exposure length) was carefully selected to avoid lethality based on results from our previous studies (gong et al . 2007). Conduction velocities of worm mgf and lgf were measured as previously described (gong et al . Absolute velocity (m / s) was calculated by dividing conduction distance between electrode pairs (10 mm) by conduction time . Relative conduction velocity, i.e., the absolute conduction velocity measured after exposure or recovery relative to that measured before exposure, was used as assessment endpoint because absolute conduction velocity varied from one worm to another, even in the same treatment groups . The level of whole - body machr was analyzed in homogenized worms as described in basu et al . All worm samples were homogenized for 30 s in cold na / k buffer (50 mm nah2po4, 5 mm kcl, 120 mm nacl, ph 7.4). Cellular membranes were isolated by centrifuging the homogenate at 32,500g for 15 min at 4c . The resulting pellet was washed twice under the same conditions, and the final pellet was resuspended in na / k buffer . Binding to the mach receptor was performed in a 96-well 1.0 m gf / b glass filter system (millipore, boston, ma, usa) (stamler et al . 2005). Approximately 20 g of membrane preparation in na / k buffer was incubated with 1 nm [3h]-quinuclidinyl benzilate ([3h]-qnb; nen / all binding assays were carried out under gentle agitation for 60 min, and reactions were terminated by vacuum filtration . The filters were rinsed three times with buffer and then allowed to soak for 96 h in 25 l of optiphase supermix cocktail (perkin elmer). Radioactivity retained by the filter was quantified by liquid scintillation counting in a microplate detector (wallac microbeta, perkin elmer). Specific binding to the receptors was defined as the difference in radioligand bound in the presence and absence of 100 m atropine sulfate . The electrophysiological data were analyzed using a paired student s t test by comparing the absolute mgf / lgf conduction velocity measured at different time points with that measured before exposure (day 0) in the same worms within the same treatment group . One - way analysis of variance (anova) was used to determine the effects of cl-20 on machr levels . When a significant difference was found, a post - hoc test was performed with tukey s hsd (honestly significant difference). The probability (p) of type-1 or false positive error was derived from anova, whereas the power (b) of the statistical test was estimated from b = 1 with being the type-2 or false negative error probability and being set at 0.05 . All the statistical analysis was performed using sigmastat (v 3.1, point richmond, ca, usa). Earthworms (e. fetida) were maintained in a continuous culture from stocks obtained from carolina biological supply company (burlington, nc, usa). Worms were kept at 22 to 25c in moistened sphagnum peat with calcium carbonate added to adjust the ph to 6.5 to 7.5 and moisture content adjusted to 50% and were fed ad libitum on a diet of magic worm food (carolina biological supply). Adult earthworms (0.3~0.6 g with clitellum) were purged overnight on moistened filter paper prior to testing . Exposures were performed in 95-ml capped glass vials via contact with moistened filter paper (gong et al . One milliliter of cl-20 solution in methanol was spread on the filter paper (115 cm) and methanol was allowed to evaporate before moistening the filter paper with 2 ml of de - ionized water . The concentration of cl-20 in stock solutions (g cl-20/ml of methanol) was confirmed by hplc analysis (gong et al . The -cl-20 (99.3%) was synthesized by atk thiokol propulsion (china lake, ut, usa). Gas chromatographic - grade methanol was purchased from burdick and jackson (muskegon, mi, usa). Four sets of experiments were carried out with duration of 1, 3, 6, and 13 days, respectively . Throughout all the experiments, each worm was housed individually in a vial . Only worms in the fourth experiment were removed and allowed to recover on clean filter paper for 7 days after a 6-day exposure . Noninvasive electrophysiological measurements were repeatedly performed on day 0 (after purging but before exposure), 1, 3, 6, 7, 10 and 13 before the worms were sacrificed on day 1, 3, 6 and 13, respectively in the four experiments . Levels of muscarinic acetylcholine receptor (machr) were determined only at the termination of each experiment when the worms were sacrificed by snap - freezing in liquid nitrogen . Four concentrations of cl-20 were tested in each experiment, except for the second experiment where only three cl-20 concentrations were tested . Ten worms were used per treatment . The exposure concentration (0.02 to 0.87 g cl-20/cm depending on the exposure length) was carefully selected to avoid lethality based on results from our previous studies (gong et al . Conduction velocities of worm mgf and lgf were measured as previously described (gong et al . 2007) immediately before exposure and at each interval of exposure and recovery . Absolute velocity (m / s) was calculated by dividing conduction distance between electrode pairs (10 mm) by conduction time . Relative conduction velocity, i.e., the absolute conduction velocity measured after exposure or recovery relative to that measured before exposure, was used as assessment endpoint because absolute conduction velocity varied from one worm to another, even in the same treatment groups . The level of whole - body machr was analyzed in homogenized worms as described in basu et al . All worm samples were homogenized for 30 s in cold na / k buffer (50 mm nah2po4, 5 mm kcl, 120 mm nacl, ph 7.4). Cellular membranes were isolated by centrifuging the homogenate at 32,500g for 15 min at 4c . The resulting pellet was washed twice under the same conditions, and the final pellet was resuspended in na / k buffer . Binding to the mach receptor was performed in a 96-well 1.0 m gf / b glass filter system (millipore, boston, ma, usa) (stamler et al . 2005). Approximately 20 g of membrane preparation in na / k buffer was incubated with 1 nm [3h]-quinuclidinyl benzilate ([3h]-qnb; nen / perkin elmer, waltham, ma, usa). All binding assays were carried out under gentle agitation for 60 min, and reactions were terminated by vacuum filtration . The filters were rinsed three times with buffer and then allowed to soak for 96 h in 25 l of optiphase supermix cocktail (perkin elmer). Radioactivity retained by the filter was quantified by liquid scintillation counting in a microplate detector (wallac microbeta, perkin elmer). Specific binding to the receptors was defined as the difference in radioligand bound in the presence and absence of 100 m atropine sulfate . The electrophysiological data were analyzed using a paired student s t test by comparing the absolute mgf / lgf conduction velocity measured at different time points with that measured before exposure (day 0) in the same worms within the same treatment group . One - way analysis of variance (anova) was used to determine the effects of cl-20 on machr levels . When a significant difference was found, a post - hoc test was performed with tukey s hsd (honestly significant difference). The probability (p) of type-1 or false positive error was derived from anova, whereas the power (b) of the statistical test was estimated from b = 1 with being the type-2 or false negative error probability and being set at 0.05 . All the statistical analysis was performed using sigmastat (v 3.1, point richmond, ca, usa). Cl-20 exposure reduced both conduction velocity and whole - body machr levels in a concentration- and duration - dependent manner (fig . 1). Although conduction velocity was recorded repeatedly, only results from the final measurement were shown to facilitate comparison with machr data obtained from single - time determinations (see fig . 1). Effect on machr levels was most prominent at day 6 of exposure (see fig . After a 7-day recovery, both conduction velocity and machr were significantly restored (see fig . However, it should be noted that relative conduction velocity is a more sensitive endpoint than machr, and this can be partly attributed to different statistical methods used . One - way anova used for machr has less statistical power than the paired t test for conduction velocity because anova does not require pairing of collected data . 1reversible effects of sublethal cl-20 concentrations on muscarinic acetylcholine receptor (machr) and conduction velocity of medial (mgf) and lateral (lgf) giant fiber . Data are presented as mean (bar) and standard error (error bar) with n = 10 . Statistical significance is indicated by an asterisk * at = 0.05 . Endpoints were determined in worms exposed with or without recovery for 1 (a and b), 3 (c and d), 6 (e and f), and 13 days (g and h) in four separate experiments . Mgf and lgf were measured repeated but only the last measurement results (a, c, e, and g) are shown in parallel with machr results (b, d, f, and h). See materials and methods for details on statistical data analysis reversible effects of sublethal cl-20 concentrations on muscarinic acetylcholine receptor (machr) and conduction velocity of medial (mgf) and lateral (lgf) giant fiber . Data are presented as mean (bar) and standard error (error bar) with n = 10 . Statistical significance is indicated by an asterisk * at = 0.05 . Endpoints were determined in worms exposed with or without recovery for 1 (a and b), 3 (c and d), 6 (e and f), and 13 days (g and h) in four separate experiments . Mgf and lgf were measured repeated but only the last measurement results (a, c, e, and g) are shown in parallel with machr results (b, d, f, and h). Materials and methods for details on statistical data analysis there was a sharp decrease in the whole - body levels of machr reflected by the [3h]-qnb binding activity in control worms from day 1 (mean standard deviation = 101.9 27.0 fmol / mg) to day 3 (19.2 3.2 fmol / mg; see fig . 1(b, d)). It should be noted that there were no technical or experimental changes in the study over this time period, and this decrease may be due to the cessation of foraging activity and gut digestive movement as food supply was cut off on day 0 (you et al . Although statistically significant (= 0.05) decreases in machr were measured in worms exposed to cl-20 for 1 day (see fig . 1(d)), the power associated with these changes (particularly in 3-day - exposed worms) was weak as the calculated b values were below the acceptable threshold of 0.8 . This may be partly attributed to neurological plasticity and inter - worm differences in their adaptive neurological response following relatively short - term exposure to a toxicant like cl-20 (bargmann 2006). While [3h]-qnb can label and enumerate the global population of machrs, it is well established that machrs consist of several different isoforms in both vertebrates and invertebrates as a result of alternative splicing, can exist at pre - synaptic and post - synaptic sites, and are found in both the central and peripheral nervous systems (trimmer 1995; wess 1996; santafe et al . 2003; rand 2007). Furthermore, a putative acetylcholine receptor with a mixed pharmacological property (i.e., binds to both nicotinic and muscarinic drugs) has been identified in invertebrates (eldefrawi and eldefrawi 1983; trimmer 1995). It should be stressed that the machr data we present here represents the total amount of the machr and mixed nicotinic future studies should differentiate the machr responses among the different receptor isoforms in both the central and peripheral nervous systems . The strongest statistical results were obtained in worms following 6-day exposure when compared to animals exposed for 1 or 3 days (see fig . 1(b, d, f)), indicating that longer - term exposure to cl-20 may have exceeded the adaptive capability of these worms . However, after a 7-day recovery period following a 6-day exposure period (see fig . 1(h)), no statistically significant differences in machr levels were observed, suggesting that to a certain degree, the earthworms were capable of restoring cholinergic function . Recovery of these neurochemical responses were supported by the neurophysiological work that also showed a recovery response (see fig . 1 (a, c, e, g)) (gong et al . 2007), neurobiochemical and electrophysiological measurements) from our work strongly suggest that cl-20 has neurotoxic properties . However, this does not exclude the possibility that cl-20 may have other neurological targets . Many pesticides acting on neurotransmitter receptors (e.g., organophosphorus and carbamate insecticides) also inhibit cholinesterase (eldefrawi and eldefrawi 1983; edwards and fisher 1991), sometimes in a reversible manner (aamodt et al . 2007). In addition, other neurotransmission systems such as gaba, glutamate, and monoamine (barna et al . 2003) and ion channels in the nerve membrane (ray and fry 2006) should be examined to further define the precise mechanisms underlying cl-20 neurotoxicity.
|
The program evaluation is generally classified into three types: planning, summative, and formative evaluation . Even though distinctions between the different types of evaluation are sometimes blurred, differentiating their intent helps us in clarifying our understanding of evaluation process (1). Planning evaluation takes place before a program begins to give those involved in program development a precise understanding of the program, and it is sometimes referred to as " pre - formative evaluation " (2). Summative evaluation is the typical and most common type of evaluation, which is conducted at the end of a program to provide decision - makers with judgements about the program's overall merit or worth . However, although necessary, it often comes too late to be much help (3). On the other hand, formative evaluation occurs during the process of a program to provide those who are responsible ongoing information about whether things are going as planned and whether expected progress is being made . If not, this same information can be used to guide necessary improvements, before it is too late (4). Even though there is a great extent of literature on formative evaluation, most of them mainly focus on its conceptual framework, methodology and use . Surprisingly, the subsequent effect of using the findings of formative evaluation has not received systematic attention, and few researches demonstrate this by comparing data from the initial program with the final program to show whether there was an improvement in program implementation and impacts (5). This study aimed to evaluate the subsequent effect of the formative program evaluation based on a case study of a clinical training program in lao people's democratic republic (pdr). The main health care delivery system of lao pdr is a government - controlled, public system which has a strong vertical structure with three levels: central, provincial, and district level (6). Even though all health care professionals in the country are required by law to continuously improve their knowledge and skills, the continuing professional development (cpd) training system in lao pdr has not yet been functioning well (7). In 2012, under the support of korea international cooperation agency (koica), faculties from seoul national university (snu) college of medicine in korea and university of health sciences (uhs) in lao pdr launched the " continuing professional development training project to strengthen the capacity of provincial and district hospitals in lao pdr " (8). At the beginning of the project, uhs faculties conducted a needs assessment survey in luang prabang province, which was the pilot area for this project . Based on the needs assessment results, korean and lao faculties worked together to develop a cpd training program and a handbook including 80 clinical topics on 5 major clinical specialties: internal medicine, surgery, obstetrics and gynecology, pediatrics, and emergency medicine . And then, uhs faculties provided a 1-week' training of trainers' program for 30 medical faculties of the luang prabang provincial hospital . Also, the training management committee composed of provincial hospital executives and department chairs was established to monitor and manage the training effectively . Finally, the trained provincial hospital faculties provided a 10-week training program in the provincial hospital for the district hospital health professionals in luang prabang province . The training was conducted 4 times consecutively over 2 yr, and 12 medical professionals, 1 from each district hospital, were invited to each training program . Among the total 48 medical professionals, 35 of them were medical assistants, and the other 13 were medical doctors . The training was composed of 5 major clinical sections, and the trainees rotated each clinical section every 2 weeks . Lecture about clinical topics, observation of trainers' performance, and trainee's own medical practice with trainers' feedback were the main training methods . Formative program evaluation was conducted during the whole process to continuously improve the training program (fig . 1). Kirkpatrick model was applied for the program evaluation covering level 1 (reaction) and level 3 (transfer) (9). Questionnaire survey and focus group interviews with the trainees were used to evaluate the reaction of the trainees . The questionnaire was designed by the co - work of faculties from snu and uhs based on the literature review (1011). It was composed of 14 items, regarding the goals and objectives, relevance, organization, trainers' knowledge, trainers' communication, trainers' preparedness, training methods, discussion and interaction, practical session, handbook, facilities, schedule, applicability, and helpfulness of the training program . The trainees were asked to rate the items with a 5-point likert scale (1, strongly disagree; 2, disagree; 3, neutral; 4, agree; 5, strongly agree) (table 1). The survey was conducted every two weeks at the end of each clinical section of the training program . Focus group interview with the trainees was facilitated by the uhs faculties at the end of each 10-week training program . The transfer of the trainees was evaluated through the review of medical records written by the trainees . Total 354 medical records written by 44 trainees before and 3 months after the training program were collected . Global rating with a 5-point anchored scale (1, novice; 2, advanced beginner; 3, intermediate; 4, proficient; 5, expert) was used for the evaluation . A total of 25 trainers received a half - day workshop before assessing the medical records, and they practiced with some pilot medical records and received feedback during the workshop . The medical records were coded by the coordinator, and they were randomly distributed to the trainers without any personal and time information . The difference of average scores between the medical records written before the training and those written after the training was calculated to evaluate the transfer of the trainees . The evaluation data was collected under the responsibility of the training management committee and analyzed by the study team . The results were shared with the committee and the trainers after the end of each batch of the training program . The committee and the trainers reached a consensus on how to improve the training program through the group discussion based on the evaluation results . After the final end of the training program, the average scores of the survey results and the achievement of global rating scores of medical records among the four batches were analyzed statistically with the anova using spss . The institutional review board of seoul national university college of medicine and seoul national university hospital exempted review of this study since it was an analysis of de - identified data (irb no . The institutional review board of seoul national university college of medicine and seoul national university hospital exempted review of this study since it was an analysis of de - identified data (irb no . According to the results of the survey, the trainees were quite satisfied with the training program (table 2). However, especially in the early period of the training program, the trainees were not so satisfied in such areas as the organization and schedule of the training program, and discussion, interaction, and practical sessions during the training program . From the second batch, there was continuous increase of the satisfaction of the trainees in all the items of the questionnaire, and most of the significant improvement happened between the first and the second batch (supplementary fig . The focus group interviews provided similar but more in - depth view of the trainees' reactions (table 3). However, especially at the first batch of the training, some trainees suggested that there should be more practice and interaction in the training program and the trainers should pay more attention and provide more explanation to the trainees . From the second batch of the training, comments about the program and the trainers became more positive, and there was less criticism about the issues that were previously mentioned . In the second batch, some trainees suggested that the training should be more applicable to the situation of district hospitals, which also seemed to be improved from the third batch of the training program . The average global rating scores of the medical records which were written after the training program were higher than those written before the training, except the second batch (table 4). And the achievement of the average global rating scores between the medical records before the training and those after the training increased from the first batch to the last batch, especially between the second and the third batch (supplementary fig . The purpose of this study was to evaluate the effect of the formative program evaluation, which was applied to continuously improve the training program . According to the evaluation results, there was continuous improvement of the reaction and the transfer of the trainees from the first batch to the last batch of the training program . We might have a close look at the ways how the formative program evaluation contributed to the continuous improvement of the training program . At the first batch of the training program, the trainees were not so satisfied in some areas like organization and schedule of the training program, and discussion, interaction, and practical sessions in the training program . Some trainees thought the training activities were not enough for them, and there should be more practical sessions like bed side teaching or real practice rather than lectures . Trainees also suggested that the trainer should pay more attention to them and there should be more discussion and interaction between the trainer and the trainees . The review of the medical records written by the first batch trainees showed a minimal achievement of global rating scores . These results of the formative program evaluation were shared with the committee and the trainers at the end of the first batch of the training program . The committee and the trainers reached a consensus on how to improve the training program through the group discussion based on the evaluation results . They decided to increase the training activities, especially practical sessions like bed side teaching and real practice under supervision . And even during the lecture time, they agreed to foster more interaction and discussion between the trainers and the trainees . The training management committee also emphasized to the trainers that the trainees are not young students, but experienced medical professionals . At the second batch of the training program, the average scores of all the items in the survey were much increased, and there was no item which was rated below 4.0 . Also the trainee's comments, especially about the trainers, in the focus group interview became more positive than before . However, the review of the medical records written by the second batch trainees did not show any achievement of global rating scores . After a group discussion based on the results of the survey and focus interview, the training management committee and the trainers reached on a consensus that there still should be more practical sessions for the trainees, which later could be applicable to the medical practice in the district hospitals . At the third batch of the training program, the trainees were more satisfied with the practical sessions and more trainees appreciated the applicability of the training program . And the achievement of global rating scores of the medical records was much increased comparing to the first and the second batch . The program evaluation results of the fourth batch showed a minimal improvement of the reaction and transfer of the trainees . There were several key factors which should be noted in this study on the formative program evaluation . First of all, two levels, level 1 (reaction) and level 3 (transfer), of the kirkpatrick model were selected for the program evaluation for the reason that the reaction of the trainees should be closely related to the implementation of the training program and the transfer of the trainees could be a reliable parameter of the outcome or impact of the training program (12). Second, the survey for the evaluation of the trainees' reaction was conducted every two weeks during the training program to improve the reliability of the ratings . It was to minimize the dominating effect of the trainee's emotional experiences of both the peak and the end of the training program (13). Third, focus group interviews were added to seek more deeply the problems of the training program which were discovered by the survey results . By this, the quantitative evaluation using a likert scale and qualitative evaluation using focus group interviews, both of which have their relative merits (14), were integrated into the formative program evaluation process . Finally, to evaluate the transfer of the trainees, medical records which were written 3 months after the training program were collected, analyzed, and compared with those written before the training . It was based on the evidence from the previous studies that most meaningful changes would take place over a longer period of time than just right after the training (1516). We were not able to assign a control group and conduct a case - control study due to the small size of the trainees group . And the formative program evaluation did not cover the level 2 (learning) and level 4 (result) of the kirkpatrick model because of the feasibility and the time limit of the evaluation process . Further study is needed for more delicate study design and concrete results . However, even though it was a pilot clinical training program in lao pdr, the plan for the formative program evaluation was designed from the beginning of the project, and was shared with the all the participants . The whole evaluation process was conducted by the lao health professionals under the guidance and support of the study team . In conclusion, the results showed that the formative program evaluation contributed to the continuous improvement of the training program.
|
All rabbits were treated in accordance with the association for research in vision and ophthalmology statement on the use of animals in ophthalmic and vision research, and the experimental protocol was approved by the animal care committee of the massachusetts eye and ear infirmary . All experiments were carried out on the od eyes under a surgical microscope and general anesthesia . Six dutch - belted female rabbits (covance, dedham, ma, usa) weighing between 2 and 2.5 kg were used . Rabbits were anesthetized by intramuscular injection of ketamine hydrochloride inj, usp (35 mg / kg; ketaved, vedco, st . Joseph, mo, usa) and xylazine (5 mg / kg; anased, lloyd, shenandoah, ia . Topical anesthetic (0.5% proparacaine hydrochloride, bausch & lomb, tampa, fl, usa) was applied to the operative eyes . Alkali burn was performed in the anesthetized rabbits using an 8-mm diameter cotton sponge soaked in 2 n naoh and applied to the center of a cornea for 10 seconds, followed by immediate eye irrigation with saline solution for 20 minutes . Buprenorphine (0.03 mg / kg; buprenex injectable, reckitt benckiser healthcare ltd, united kingdom) was administered subcutaneously prior to the burn procedure for long - term pain management . After the surgery, yohimbine (0.1 mg / kg; yobine, lloyd) was administered in a marginal ear vein to reverse the effect of xylazine, and a transdermal fentanyl patch (12 g / hour; lts lohmann therapy system, corp ., nj, usa) was placed on the right ear to alleviate pain for 3 postoperative days . Lyophilized infliximab powder was dissolved in 10% (wt / v) pva and then infused into a porous pdms carrier using vacuum for 2 hours . Infliximab - loaded pdms was then air - dried and stored at room temperature in a sterile vial . Each dds implant was precut to approximately 4 mm in length and 1 mm in diameter, yielding a weight of 13 mg and containing approximately 85 g of infliximab . Drug - loaded dds implants (n = 3) and sham dds implants as controls (dds without drug loaded, n = 3) were implanted in six rabbits immediately after the corneal alkali burn . Subconjunctival implantation of the dds was performed in the inferior bulbar conjunctiva to avoid unexpected dislocation of the polymer . Briefly, a narrow lateral subconjunctival pocket with a length of 4 mm was made cautiously with fine spring surgical scissors . Both ends of the dds implant were then sutured to the scleral wall using an 8 - 0 vicryl suture . Erythromycin ophthalmic ointment (0.5%, bausch & lomb) was given topically to the operative eyes twice a day for 1 week after surgery . Clinical evaluation was performed on all rabbits before the chemical burn and dds implantation surgery and postoperative days 0, 1, 2, 5, and every 7 days for 3 months thereafter . For these evaluations, the rabbits were anesthetized by intramuscular injection of ketamine hydrochloride (20 mg / kg) and xylazine (5 mg / kg) and topical anesthetic 0.5% proparacaine hydrochloride was applied to the operative eyes . All treated and control eyes were photographed using a digital slr camera (nikon, tokyo, japan) attached to a surgical microscope (s21; carl zeiss, jena, germany) at standard magnifications . Photographs were analyzed using imagej 1.50e software (http://imagej.nih.gov/ij/; provided in the public domain by the national institutes of health [nih], bethesda, md, usa). Corneal epithelial defects were stained with fluorescein and imaged using a portable slit - lamp (keeler 3010-p-2001, pa) equipped with cobalt blue filter and a mounted digital camera at 10 magnification . Ocular lubricant (genteal, alcon, fort worth, tx, usa) was applied as needed during these procedures . Reversal of anesthesia was obtained through yohimbine (0.1 mg / kg) iv administration in a marginal ear vein . Quantification of corneal neovascularization (cnv) area and epithelial defect area was performed using imagej software (nih). The areas of corneal vasculature and fluorescein stain were outlined with the polygon selection tool and calculated using the imagej software (nih). Each area measurement (pixel) was normalized by the relative whole cornea area (pixel) in the same image to eliminate the small variation in camera magnification, yielding the cnv or epithelial defect area / whole cornea ratio (%). Subjective assessments of cnv, central corneal, and peripheral corneal opacity were performed by three independent scientists (mr, fl, vk) using photographs in a single masked fashion to minimize observation bias . To differentiate corneal opacification due to immediate alkali reactions (e.g., saponification) seen in the central cornea, from secondary inflammatory cell - mediated remodeling manifested in the peripheral cornea, central and peripheral corneal opacity was scored in 0.5 increments on a scale of 0 to 4, where 0 = completely clear; 1 = slightly hazy, iris / pupil easily visible; 2 = slightly opaque, iris / pupil still detectable; 3 = opaque, iris / pupil hardly detectable; and 4 = completely opaque with no view of the iris / pupil . Corneal neovascularization was scored based on the intensity of the vessels in the cornea (int.v), where 0 = no visible vessel, 1 = faint thin vessels, 2 = mild thickened vessels, 3 = moderate thickened vessels, and 4 = thick vessels . The length of vessel (lth.v) invading into the cornea was scored using the following grade system: 0 = no corneal vessel, 1 = from limbus to far periphery, 2 = from limbus to mid periphery, and 3 = from limbus to central cornea . The clock hours (chs; 30 degrees = 1 ch) involved in the cnv region were also estimated . An overall cnv score was derived from the above three assessments (overall cnv score = int.v + lth.v + chs/3). Because the range in chs was 0 to 12 hours, the number was divided by 3 to provide normalization to the scale 0 to 4, in order to match the scale of int.v and lth.v . Agreement between the three raters was statistically assessed using the intraclass correlation coefficient (icc) test . At the end of the follow - up, rabbits were euthanized using fatal plus intravenously (sodium pentobarbital; 100 mg / kg, vortech, dearborn, mi, usa). Both eyes and the lower lid with the conjunctival tissue holding the dds implant were harvested and fixed in 4% paraformaldehyde (pfa) overnight at 4c . The tissues were then embedded in optical coherence tomography (oct) and flash - frozen . Tissue section slides of whole globes and dds - harboring eyelids were prepared with a cryostat (cm1950, leica biosystems, buffalo grove, il, usa) at 10 m thickness and transferred to positively charged glass slides (superfrost glass slides, thermo fisher, il, usa). For immunohistochemistry, tissue sections were permeabilized with 0.2% triton - x100 for 5 minutes and incubated with 1% bovine serum albumin (bsa) for 1 hour at room temperature . Primary antibodies were diluted in 1% bsa and incubated with the tissue samples overnight at 4c . Infiltration of immune cells in tissues was evaluated with mouse anti - cd45 monoclonal antibody (1:100, sc-70690, santa cruz, dallas, tx, usa). Tumor necrosis factor- expression was immunolocalized by a mouse anti - tnf- monoclonal antibody conjugated with fitc (1:100, nbp1 - 51502, novus, littleton, co, usa). Retinal nerve fiber layer (rnfl) and cells at the ganglion cell layer (gcl) were analyzed using anti-3 tubulin monoclonal antibody (1:100, ma1118, thermo scientific, rockford, il, usa). Residual infliximab antibody in the dds and surrounding tissues was detected with alexa fluor 546 conjugated goat anti - human igg secondary antibody (1:300, a-21089, thermo scientific). Mounting media with 4,6-diamidino-2-phenylindole (dapi) (ultracruz, santa cruz) was used together with glass cover slips for imaging using the zeiss axio imager m2 (carl zeiss) fluorescence microscope with 20 dry and 63 oil immersion objective lenses . The total number of cells expressing tnf- or cd45 in a whole cornea section was counted using the analyze particles tool in nih imagej software . Optic nerve cross sections were examined for glaucomatous damage by using a modified paraphenylenediamine (ppd) staining protocol to stain the myelin sheath of all axons, and the axoplasma of damaged axons, as previously described . A portion of the nerve between the orbit and chiasm was surgically dissected, and fixed with half strength karnovsky's fixative (2% formaldehyde + 2.5% glutaraldehyde, in 0.1 m sodium cacodylate buffer, ph 7.4 [electron microscopy sciences, hatfield, pa, usa]) for a minimum of 24 hours at 40c . After fixation, samples were rinsed with 0.1 m sodium cacodylate buffer, postfixed with 2% osmium tetroxide in 0.1 m sodium cacodylate buffer, then dehydrated with graded ethyl alcohol solutions, transitioned with propylene oxide and resin infiltrated in tepon-812 epoxy resin (tousimis, rockville, md, usa) utilizing an automated ems lynx 2 em tissue processor (electron microscopy sciences). Processed tissues were oriented in tepon-812 epoxy resin and polymerized in silicone molds using an oven set for 60c for 48 hours . Semithin cross - sections were cut at 1-m with a histo diamond knife (diatome, hatfield, pa, usa) on a leica uc-7 ultramicrotome (leica microsystems, buffalo grove, il, usa) and collected on slides, then dried on a slide warmer . The slides were stained with filtered 2% aqueous ppd (mp biomedicals llc, solon, oh, usa) solution for 1 hour at room temperature, rinsed in tap and deionized water solutions, air - dried, then mounting media and a glass coverslip was applied over the sections for light microscopic analysis . Cross - sections of different anatomic levels were taken and imaged with 100 objective in a light microscope . The fields were spaced in a regular fashion across the entire nerve section, taking care to avoid field overlap . A rectangular box was then drawn near the center of each image to eliminate the shaded or out - of - focus areas . The cropped pictures were systematically analyzed to quantify axon numbers per unit area, axon area, and circularity with the retinal nerve fiber layer and number of cells in the retinal gcl of rabbits were analyzed in histologic sections using 3-tubulin monoclonal antibody (1:100, ma1118, thermo scientific) and dapi . 3-tubulin+ dapi+ cells in gcl were manually counted and normalized to the total measured retinal length . A minimum of three different nonconsecutive tissue sections per eye was analyzed and three rabbits per sample . To assess gcl cell loss in the burned eyes, the contralateral nonburned eye of each rabbit was used as internal control (reference of normal cell count). Data were presented in percentages of the remaining cells, with 100% representing the number of cells in the contralateral nonburned eye (3-tubulin+ cell density in burned eye/3-tubulin cell density in contralateral eye*100). Depending on the normality, student's t - test or mann - whitney u test was performed to compare the means between the anti - tnf- dds group and the sham dds group . One - way and 2-way anova were performed in datasets containing multiple variables, followed with holm - sidak pairwise multiple comparison correction test . Intraclass correlation coefficient scores between 0.8 and 0.9 assumed good agreement and between 0.9 and 0.99 excellent agreement . Mixed anova was performed in datasets containing dependent variables (e.g., cnv, opacity scores, and corneal defect area) with fixed variables being time and treatment . Analyses were performed using the statistical package of social sciences (spss, ibm, ny, usa). Linear and second order polynomial functions were generated in graphpad prism version 6.0 (graphpad, la jolla, ca, usa) to fit data points . All rabbits were treated in accordance with the association for research in vision and ophthalmology statement on the use of animals in ophthalmic and vision research, and the experimental protocol was approved by the animal care committee of the massachusetts eye and ear infirmary . All experiments were carried out on the od eyes under a surgical microscope and general anesthesia . Six dutch - belted female rabbits (covance, dedham, ma, usa) weighing between 2 and 2.5 kg were used . Rabbits were anesthetized by intramuscular injection of ketamine hydrochloride inj, usp (35 mg / kg; ketaved, vedco, st . Joseph, mo, usa) and xylazine (5 mg / kg; anased, lloyd, shenandoah, ia . Topical anesthetic (0.5% proparacaine hydrochloride, bausch & lomb, tampa, fl, usa) was applied to the operative eyes . Alkali burn was performed in the anesthetized rabbits using an 8-mm diameter cotton sponge soaked in 2 n naoh and applied to the center of a cornea for 10 seconds, followed by immediate eye irrigation with saline solution for 20 minutes . Buprenorphine (0.03 mg / kg; buprenex injectable, reckitt benckiser healthcare ltd, united kingdom) was administered subcutaneously prior to the burn procedure for long - term pain management . After the surgery, yohimbine (0.1 mg / kg; yobine, lloyd) was administered in a marginal ear vein to reverse the effect of xylazine, and a transdermal fentanyl patch (12 g / hour; lts lohmann therapy system, corp ., nj, usa) was placed on the right ear to alleviate pain for 3 postoperative days . Lyophilized infliximab powder was dissolved in 10% (wt / v) pva and then infused into a porous pdms carrier using vacuum for 2 hours . Infliximab - loaded pdms was then air - dried and stored at room temperature in a sterile vial . Each dds implant was precut to approximately 4 mm in length and 1 mm in diameter, yielding a weight of 13 mg and containing approximately 85 g of infliximab . Drug - loaded dds implants (n = 3) and sham dds implants as controls (dds without drug loaded, n = 3) were implanted in six rabbits immediately after the corneal alkali burn . Subconjunctival implantation of the dds was performed in the inferior bulbar conjunctiva to avoid unexpected dislocation of the polymer . Briefly, a narrow lateral subconjunctival pocket with a length of 4 mm was made cautiously with fine spring surgical scissors . The precut dds strip implant was then inserted into the subconjunctival pocket . Both ends of the dds implant erythromycin ophthalmic ointment (0.5%, bausch & lomb) was given topically to the operative eyes twice a day for 1 week after surgery . Clinical evaluation was performed on all rabbits before the chemical burn and dds implantation surgery and postoperative days 0, 1, 2, 5, and every 7 days for 3 months thereafter . For these evaluations, the rabbits were anesthetized by intramuscular injection of ketamine hydrochloride (20 mg / kg) and xylazine (5 mg / kg) and topical anesthetic 0.5% proparacaine hydrochloride was applied to the operative eyes . All treated and control eyes were photographed using a digital slr camera (nikon, tokyo, japan) attached to a surgical microscope (s21; carl zeiss, jena, germany) at standard magnifications . Photographs were analyzed using imagej 1.50e software (http://imagej.nih.gov/ij/; provided in the public domain by the national institutes of health [nih], bethesda, md, usa). Corneal epithelial defects were stained with fluorescein and imaged using a portable slit - lamp (keeler 3010-p-2001, pa) equipped with cobalt blue filter and a mounted digital camera at 10 magnification . Ocular lubricant (genteal, alcon, fort worth, tx, usa) was applied as needed during these procedures . Reversal of anesthesia was obtained through yohimbine (0.1 mg / kg) iv administration in a marginal ear vein . Quantification of corneal neovascularization (cnv) area and epithelial defect area was performed using imagej software (nih). The areas of corneal vasculature and fluorescein stain were outlined with the polygon selection tool and calculated using the imagej software (nih). Each area measurement (pixel) was normalized by the relative whole cornea area (pixel) in the same image to eliminate the small variation in camera magnification, yielding the cnv or epithelial defect area / whole cornea ratio (%). Subjective assessments of cnv, central corneal, and peripheral corneal opacity were performed by three independent scientists (mr, fl, vk) using photographs in a single masked fashion to minimize observation bias . To differentiate corneal opacification due to immediate alkali reactions (e.g., saponification) seen in the central cornea, from secondary inflammatory cell - mediated remodeling manifested in the peripheral cornea, central and peripheral corneal opacity was scored in 0.5 increments on a scale of 0 to 4, where 0 = completely clear; 1 = slightly hazy, iris / pupil easily visible; 2 = slightly opaque, iris / pupil still detectable; 3 = opaque, iris / pupil hardly detectable; and 4 = completely opaque with no view of the iris / pupil . Corneal neovascularization was scored based on the intensity of the vessels in the cornea (int.v), where 0 = no visible vessel, 1 = faint thin vessels, 2 = mild thickened vessels, 3 = moderate thickened vessels, and 4 = thick vessels . The length of vessel (lth.v) invading into the cornea was scored using the following grade system: 0 = no corneal vessel, 1 = from limbus to far periphery, 2 = from limbus to mid periphery, and 3 = from limbus to central cornea . The clock hours (chs; 30 degrees = 1 ch) involved in the cnv region were also estimated . An overall cnv score was derived from the above three assessments (overall cnv score = int.v + lth.v + chs/3). Because the range in chs was 0 to 12 hours, the number was divided by 3 to provide normalization to the scale 0 to 4, in order to match the scale of int.v and lth.v . Agreement between the three raters was statistically assessed using the intraclass correlation coefficient (icc) test . At the end of the follow - up, rabbits were euthanized using fatal plus intravenously (sodium pentobarbital; 100 mg / kg, vortech, dearborn, mi, usa). Both eyes and the lower lid with the conjunctival tissue holding the dds implant were harvested and fixed in 4% paraformaldehyde (pfa) overnight at 4c . The tissues were then embedded in optical coherence tomography (oct) and flash - frozen . Tissue section slides of whole globes and dds - harboring eyelids were prepared with a cryostat (cm1950, leica biosystems, buffalo grove, il, usa) at 10 m thickness and transferred to positively charged glass slides (superfrost glass slides, thermo fisher, il, usa)., tissue sections were permeabilized with 0.2% triton - x100 for 5 minutes and incubated with 1% bovine serum albumin (bsa) for 1 hour at room temperature . Primary antibodies were diluted in 1% bsa and incubated with the tissue samples overnight at 4c . Infiltration of immune cells in tissues was evaluated with mouse anti - cd45 monoclonal antibody (1:100, sc-70690, santa cruz, dallas, tx, usa). Tumor necrosis factor- expression was immunolocalized by a mouse anti - tnf- monoclonal antibody conjugated with fitc (1:100, nbp1 - 51502, novus, littleton, co, usa). Retinal nerve fiber layer (rnfl) and cells at the ganglion cell layer (gcl) were analyzed using anti-3 tubulin monoclonal antibody (1:100, ma1118, thermo scientific, rockford, il, usa). Residual infliximab antibody in the dds and surrounding tissues was detected with alexa fluor 546 conjugated goat anti - human igg secondary antibody (1:300, a-21089, thermo scientific). Mounting media with 4,6-diamidino-2-phenylindole (dapi) (ultracruz, santa cruz) was used together with glass cover slips for imaging using the zeiss axio imager m2 (carl zeiss) fluorescence microscope with 20 dry and 63 oil immersion objective lenses . The total number of cells expressing tnf- or cd45 in a whole cornea section was counted using the analyze particles tool in nih imagej software . Optic nerve cross sections were examined for glaucomatous damage by using a modified paraphenylenediamine (ppd) staining protocol to stain the myelin sheath of all axons, and the axoplasma of damaged axons, as previously described . A portion of the nerve between the orbit and chiasm was surgically dissected, and fixed with half strength karnovsky's fixative (2% formaldehyde + 2.5% glutaraldehyde, in 0.1 m sodium cacodylate buffer, ph 7.4 [electron microscopy sciences, hatfield, pa, usa]) for a minimum of 24 hours at 40c . After fixation, samples were rinsed with 0.1 m sodium cacodylate buffer, postfixed with 2% osmium tetroxide in 0.1 m sodium cacodylate buffer, then dehydrated with graded ethyl alcohol solutions, transitioned with propylene oxide and resin infiltrated in tepon-812 epoxy resin (tousimis, rockville, md, usa) utilizing an automated ems lynx 2 em tissue processor (electron microscopy sciences). Processed tissues were oriented in tepon-812 epoxy resin and polymerized in silicone molds using an oven set for 60c for 48 hours . Semithin cross - sections were cut at 1-m with a histo diamond knife (diatome, hatfield, pa, usa) on a leica uc-7 ultramicrotome (leica microsystems, buffalo grove, il, usa) and collected on slides, then dried on a slide warmer . The slides were stained with filtered 2% aqueous ppd (mp biomedicals llc, solon, oh, usa) solution for 1 hour at room temperature, rinsed in tap and deionized water solutions, air - dried, then mounting media and a glass coverslip was applied over the sections for light microscopic analysis . Cross - sections of different anatomic levels were taken and imaged with 100 objective in a light microscope . The fields were spaced in a regular fashion across the entire nerve section, taking care to avoid field overlap . A rectangular box was then drawn near the center of each image to eliminate the shaded or out - of - focus areas . The cropped pictures were systematically analyzed to quantify axon numbers per unit area, axon area, and circularity with the retinal nerve fiber layer and number of cells in the retinal gcl of rabbits were analyzed in histologic sections using 3-tubulin monoclonal antibody (1:100, ma1118, thermo scientific) and dapi . 3-tubulin+ dapi+ cells in gcl were manually counted and normalized to the total measured retinal length . A minimum of three different nonconsecutive tissue sections per eye was analyzed and three rabbits per sample . To assess gcl cell loss in the burned eyes, the contralateral nonburned eye of each rabbit was used as internal control (reference of normal cell count). Data were presented in percentages of the remaining cells, with 100% representing the number of cells in the contralateral nonburned eye (3-tubulin+ cell density in burned eye/3-tubulin cell density in contralateral eye*100). Depending on the normality, student's t - test or mann - whitney u test was performed to compare the means between the anti - tnf- dds group and the sham dds group . One - way and 2-way anova were performed in datasets containing multiple variables, followed with holm - sidak pairwise multiple comparison correction test . Intraclass correlation coefficient scores between 0.8 and 0.9 assumed good agreement and between 0.9 and 0.99 excellent agreement . Mixed anova was performed in datasets containing dependent variables (e.g., cnv, opacity scores, and corneal defect area) with fixed variables being time and treatment . Analyses were performed using the statistical package of social sciences (spss, ibm, ny, usa). Linear and second order polynomial functions were generated in graphpad prism version 6.0 (graphpad, la jolla, ca, usa) to fit data points . 1c) infliximab was seen following dds placement in the subepithelial tissues of the conjunctival fornix . 1b) in the lumen engulfing remnants of the implant with occasional giant cells (figs . 1b, 1d). While one rabbit exhibited occasional aggregates of mucus near the dds implantation site, the subconjunctival dds implantation appeared to be safe at the ocular surface with no overt sign of toxicity . The small incision in the conjunctival tissue created for inserting the dds strip healed within 7 days (fig . A photograph of the dds demonstrated its shape and porous texture of the dds (fig . (a) an implant containing infliximab has elicited an inflammatory response in the lumen . (b) most of the inflammation is granulomatous and composed of mononucleated epithelioid cells and occasional giant cells (inset). (c) an implant without drug manifests a milder granulomatous response in the lumen with no inflammation in the surrounding connective tissues . (d) epithelioid cells and giant cells line the luminal inner wall occupied by a drug - free implant (sham dds). (a d) masson trichrome staining, a: 50, b: 200 (inset 400), c: 50, d: 200 (inset 400). (e f) immunofluorescence staining against human igg of the subconjunctival tissue harboring the dds . (e) note the intense signal of human igg in the infliximab - loaded dds 3 months after rabbit subconjunctival implantation . (g) light photograph of the anti - tnf- dds at 15 days after implantation subconjunctivally in the lower lid of a burned rabbit . The antibody is loaded into the 3d porous network using pva carrier at desired concentrations . Antitumor necrosis factor- dds showed positive immunoreactivity with a secondary antibody against human igg 3 months after implantation (fig . Infliximab antibodies were not completely depleted from the dds by the end of 3 months . Eyes implanted with anti - tnf- dds also showed immunoreactivity to anti - human igg secondary antibody (supplementary fig . Positive human igg signal was found around and within small vessels in the cornea, conjunctiva, iris, and choroid 3 months after implantation of the dds . Conversely, eyes implanted with sham dds had no infliximab signal in any of the aforementioned tissue . The conjunctival tissue harboring the anti - tnf- dds also showed marked levels of human igg in a diffusion gradient pattern (supplementary fig . Infliximab presence in ocular tissue 3 months after dds implantation suggests slow and continuous diffusion of antibody from the dds . Although all rabbits developed cnv after alkali burn (figs . 2a f), the anti - tnf- dds group exhibited lower mean percentage of cnv area and overall cnv score compared to the sham dds group . The relative cnv area in the anti - tnf- dds group 92 days after burn was 13 5%, whereas in the sham dds group was 31 14% . However, no statistically significant difference was present between the two groups (p = 0.228) likely due to the considerable variability in the sham dds group (fig . 2 g). Photographs of the rabbit eyes treated with anti - tnf- dds (a c) and with sham dds (d f) 3 months after corneal alkali burn . (g, h) although not statistically significant, anti - tnf- dds treated rabbits had smaller areas of cnv compared to sham dds treated (p = 0.228; mixed anova). Similar progression patterns were found from the single - masked assessment of cnv (p = 0.131; mixed anova). (i, j) independent, single - masked assessment of central and peripheral corneal opacity showed that anti - tnf- dds treated rabbits had similar central corneal opacity as the sham dds group, but accelerated peripheral corneal clearance compared to sham dds treated, which exhibited persistent corneal opacity (p <0.05; mixed anova). Opacity score ranges from 0 to 4 (0 = clear, 4 = opaque). The corneal neovascularization score in the anti - tnf- dds group at 92 days was 6.4 2.6, whereas in the sham dds group was 8.4 0.7 but no statistically significant difference (fig . The scores from all masked raters were in agreements (icccentral corneal opacity: 0.886, p <0.0001 [0.8350.923, confidence interval (ci): 95%], iccperipheral corneal opacity: 0.889, p <0.0001 [0.8380.925, ci: 95%]). One rabbit in the sham dds group (fig . 2e) developed severe central corneal necrosis that significantly and artificially reduced the mean central cnv area in this group . All rabbits treated with anti - tnf- dds exhibited continuous decrease in the central and peripheral corneal opacity, during the 3-months evaluation period, as compared to the sham dds group (figs . Both groups had similar central corneal opacity within the studied time period (p = 0.235; mixed anova; fig . 2i), but the anti - tnf- dds group had significantly lowered peripheral corneal opacity than the sham dds group (p <0.05; mixed anova; fig . 2j). The scores from the three masked raters were in agreement (icccnv: 0.892, p <0.0001, ci: 95%: 0.7620.943). Rabbits treated with anti - tnf- dds had significantly reduced area of epithelial defect as compared to sham dds treated within the studied time frame (fig . 3 g, p = 0.04, mixed anova), except for a short period of time (3642 days) where both groups had similar defect area . Rabbits treated with the anti - tnf- dds exhibited faster re - epithelialization of the cornea and complete corneal epithelial wound closure 64 8 days after the burn . Conversely, all sham dds treated eyes exhibited incomplete epithelial wound closure by the end of the study . In fact, at 92 days, the corneal epithelial defect area in the sham dds group accounted for 6.3 4.7% of the total cornea (n = 3) versus no defect area in the anti - tnf- dds group (n = 3, p <0.05, figs . The slope of the best - fitted line for anti - tnf- dds group was 0.2023, r = 0.47 and the slope of sham dds group was 0.0349, r = 0.0190 . Effect of anti - tnf- dds in corneal epithelial defect closure and inflammation after alkali burn . Representative slit - lamp biomicroscopic images of the injured corneal with fluorescein staining 8 days (a, d), 49 days (b, e), and 92 days (c, f) after corneal alkali burn . (a f) 10 (g) anti - tnf- dds treatment significantly promoted corneal re - epithelization as compared to sham dds treatment (p <0.05; mixed anova). All corneas treated with anti - tnf- dds achieved complete corneal re - epithelialization within 71 days . Conversely, none of the sham dds treated eyes achieved complete re - epithelialization and wound closure during the 92 days of follow - up . Immunolocalization using anti - cd45 antibody in tissue sections showed that anti - tnf- dds treated rabbits (h) exhibited significantly reduced cd45 expression in the cornea as compared to sham dds treated eyes (i) at 3 months . Immunolocalization using anti - tnf- antibody in tissue sections showed that anti - tnf- dds treatment (j) significantly suppressed tnf- expression in the corneal as compared to sham dds treated eyes (k), h (m) numbers of tnf- expressing cells / cornea section in the burned eyes . Immunohistochemistry of rabbit cornea sections showed that anti - tnf- dds suppressed cd45 cell infiltration and tnf- expression in the burned corneas as compared to the sham dds group . Antitumor necrosis factor- dds treated rabbits had significantly less cd45 cells in the cornea (fig . 3h) at 3 months as compared to the sham dds group that had abundant cd45 leukocytes in the central and midperipheral corneal stroma (fig . Cd45 cell quantification showed a reduced population of leukocytes (mean = 4322 cells / cornea) in the anti - tnf- treated group as compared to the sham dds treated group (mean = 17,049 cells / cornea, p <0.05; fig . 3l). Further, a significant number of cd45 cells were observed in the limbal epithelium, iris, angle area, and corneal endothelium of the sham dds corneas while the eyes treated anti - tnf- dds presented few cd45 cells in these tissues . Consistent with the results of cd45 leukocyte infiltration in the cornea, anti - tnf- dds treated eyes exhibited remarkably less tnf- expression (fig . 3j) as compared to the sham dds treated eyes (figs . 3k, 3 m, p <0.05). Tumor necrosis factor- expression was predominant in ulcerated corneal area (e.g., the central anterior corneal stroma; fig . Preservation of the corneal endothelial mosaic and anterior segment structure was seen in all of the eyes treated with anti - tnf- dds (fig . These eyes demonstrated epithelial ulceration with bullae formation, subjacent collagen denaturation, chronic anterior stromal keratitis, and endothelial cell attenuation (fig . 4d) were other anterior segment findings observed in the sham dds treated eyes but not in the anti - tnf- dds treated eyes . Ocular phthisis and disorganization of intraocular structures was developed in one eye treated with sham dds . No evidence of inflammation was detected in the posterior segment (retina, vitreous, and choroid) of eyes from both groups . (a) treated cornea displays intact, noninflamed layers including preserved endothelium (arrows). (b) nontreated (sham) cornea with disruption and absence of the central epithelium, separation of surrounding epithelium by bullae and loss of endothelial cells . (c) a retrocorneal fibrous membrane (arrow) is adjacent to descemet's membrane (crossed arrow) in this untreated cornea . (d) peripheral anterior synechiae (arrows) in an untreated eye merges with the retrocorneal fibrous membrane (crossed arrow), a d, 100 . (e h) retinal and optic nerve degeneration 3 months after ocular alkali burn . (e) representative 20 immunohistofluorescence retinal images (3-tubulin = red and dapi = blue) of burned eyes treated either with sham or anti - tnf- dds . Sham treated eyes exhibited significantly higher loss of cells in the gcl as compared to anti - tnf- dds treated eyes . Antitumor necrosis factor- dds treated eyes exhibited increased 3-tubulin expression in the gcl as compared to sham dds treated . (g) representative microscopy images of p - phenylenediamine stained optic nerve sections of burned rabbit eyes . Consistent with the immunohistofluorescence results, sham dds treated eyes exhibited significantly increased optic nerve axon degeneration and reduced optic nerve axon density as compared to anti - tnf- dds treated eyes . Antitumor necrosis factor- treatment retain the normal fascicle packing and regular myelin wraps of the optic nerve axons . Gcl cells of sham dds treated eyes had significantly lower density compared to anti - tnf- dds treated eyes, n = 3, p <0.05 . (h) sham dds treated eyes exhibited significantly increased loss of optic nerve axons as compared to anti - tnf- dds treated eyes, n = 3, p <0.05 . Retinal neurodegeneration was inhibited using the anti - tnf- dds treatment, but not by the sham dds . Antitumor necrosis factor- treated eyes exhibited a 4.3% mean reduction of retinal gcl cell count as compared to the corresponding contralateral nonburned eye . Conversely, sham dds treated eyes exhibited a significant 38.1% mean reduction in gcl cell count (p <0.05, student's t - test; figs . Likewise, burned eyes treated with anti - tnf- dds showed no reduction in optic nerve axon density as compared to the optic nerves from the corresponding contralateral nonburned eye . However, sham dds treated eyes exhibited a significant 24.5% loss in optic nerve axons, as compared to the contralateral nonburned eye . Burned eyes treated with anti - tnf- dds had significantly higher optic nerve density as compared to burned sham dds treated eyes (p <0.05, unpaired student's t - test; figs . 4 g, 4h). 1c) infliximab was seen following dds placement in the subepithelial tissues of the conjunctival fornix . 1b) in the lumen engulfing remnants of the implant with occasional giant cells (figs . 1b, 1d). While one rabbit exhibited occasional aggregates of mucus near the dds implantation site, the subconjunctival dds implantation appeared to be safe at the ocular surface with no overt sign of toxicity . The small incision in the conjunctival tissue created for inserting the dds strip healed within 7 days (fig . A photograph of the dds demonstrated its shape and porous texture of the dds (fig . (a) an implant containing infliximab has elicited an inflammatory response in the lumen . (b) most of the inflammation is granulomatous and composed of mononucleated epithelioid cells and occasional giant cells (inset). (c) an implant without drug manifests a milder granulomatous response in the lumen with no inflammation in the surrounding connective tissues . (d) epithelioid cells and giant cells line the luminal inner wall occupied by a drug - free implant (sham dds). (a d) masson trichrome staining, a: 50, b: 200 (inset 400), c: 50, d: 200 (inset 400). (e f) immunofluorescence staining against human igg of the subconjunctival tissue harboring the dds . (e) note the intense signal of human igg in the infliximab - loaded dds 3 months after rabbit subconjunctival implantation . (g) light photograph of the anti - tnf- dds at 15 days after implantation subconjunctivally in the lower lid of a burned rabbit . The antibody is loaded into the 3d porous network using pva carrier at desired concentrations . Antitumor necrosis factor- dds showed positive immunoreactivity with a secondary antibody against human igg 3 months after implantation (fig . Infliximab antibodies were not completely depleted from the dds by the end of 3 months . Eyes implanted with anti - tnf- dds also showed immunoreactivity to anti - human igg secondary antibody (supplementary fig . Positive human igg signal was found around and within small vessels in the cornea, conjunctiva, iris, and choroid 3 months after implantation of the dds . Conversely, eyes implanted with sham dds had no infliximab signal in any of the aforementioned tissue . The conjunctival tissue harboring the anti - tnf- dds also showed marked levels of human igg in a diffusion gradient pattern (supplementary fig . Infliximab presence in ocular tissue 3 months after dds implantation suggests slow and continuous diffusion of antibody from the dds . F), the anti - tnf- dds group exhibited lower mean percentage of cnv area and overall cnv score compared to the sham dds group . The relative cnv area in the anti - tnf- dds group 92 days after burn was 13 5%, whereas in the sham dds group was 31 14% . However, no statistically significant difference was present between the two groups (p = 0.228) likely due to the considerable variability in the sham dds group (fig . 2 g). Photographs of the rabbit eyes treated with anti - tnf- dds (a c) and with sham dds (d f) 3 months after corneal alkali burn . (g, h) although not statistically significant, anti - tnf- dds treated rabbits had smaller areas of cnv compared to sham dds treated (p = 0.228; mixed anova). Similar progression patterns were found from the single - masked assessment of cnv (p = 0.131; mixed anova). (i, j) independent, single - masked assessment of central and peripheral corneal opacity showed that anti - tnf- dds treated rabbits had similar central corneal opacity as the sham dds group, but accelerated peripheral corneal clearance compared to sham dds treated, which exhibited persistent corneal opacity (p <0.05; mixed anova). Opacity score ranges from 0 to 4 (0 = clear, 4 = opaque). The corneal neovascularization score in the anti - tnf- dds group at 92 days was 6.4 2.6, whereas in the sham dds group was 8.4 0.7 but no statistically significant difference (fig . The scores from all masked raters were in agreements (icccentral corneal opacity: 0.886, p <0.0001 [0.8350.923, confidence interval (ci): 95%], iccperipheral corneal opacity: 0.889, p <0.0001 [0.8380.925, ci: 95%]). One rabbit in the sham dds group (fig . 2e) developed severe central corneal necrosis that significantly and artificially reduced the mean central cnv area in this group . All rabbits treated with anti - tnf- dds exhibited continuous decrease in the central and peripheral corneal opacity, during the 3-months evaluation period, as compared to the sham dds group (figs . Both groups had similar central corneal opacity within the studied time period (p = 0.235; mixed anova; fig . 2i), but the anti - tnf- dds group had significantly lowered peripheral corneal opacity than the sham dds group (p <0.05; mixed anova; fig . 2j). The scores from the three masked raters were in agreement (icccnv: 0.892, p <0.0001, ci: 95%: 0.7620.943). Rabbits treated with anti - tnf- dds had significantly reduced area of epithelial defect as compared to sham dds treated within the studied time frame (fig . 3 g, p = 0.04, mixed anova), except for a short period of time (3642 days) where both groups had similar defect area . Rabbits treated with the anti - tnf- dds exhibited faster re - epithelialization of the cornea and complete corneal epithelial wound closure 64 8 days after the burn . Conversely, all sham dds treated eyes exhibited incomplete epithelial wound closure by the end of the study . In fact, at 92 days, the corneal epithelial defect area in the sham dds group accounted for 6.3 4.7% of the total cornea (n = 3) versus no defect area in the anti - tnf- dds group (n = 3, p <0.05, figs . The slope of the best - fitted line for anti - tnf- dds group was 0.2023, r = 0.47 and the slope of sham dds group was 0.0349, r = 0.0190 . Effect of anti - tnf- dds in corneal epithelial defect closure and inflammation after alkali burn . Representative slit - lamp biomicroscopic images of the injured corneal with fluorescein staining 8 days (a, d), 49 days (b, e), and 92 days (c, f) after corneal alkali burn . (a f) 10 (g) anti - tnf- dds treatment significantly promoted corneal re - epithelization as compared to sham dds treatment (p <0.05; mixed anova). All corneas treated with anti - tnf- dds achieved complete corneal re - epithelialization within 71 days . Conversely, none of the sham dds treated eyes achieved complete re - epithelialization and wound closure during the 92 days of follow - up . Immunolocalization using anti - cd45 antibody in tissue sections showed that anti - tnf- dds treated rabbits (h) exhibited significantly reduced cd45 expression in the cornea as compared to sham dds treated eyes (i) at 3 months . Immunolocalization using anti - tnf- antibody in tissue sections showed that anti - tnf- dds treatment (j) significantly suppressed tnf- expression in the corneal as compared to sham dds treated eyes (k), h k 20 with tiling . (m) numbers of tnf- expressing cells / cornea section in the burned eyes . Immunohistochemistry of rabbit cornea sections showed that anti - tnf- dds suppressed cd45 cell infiltration and tnf- expression in the burned corneas as compared to the sham dds group . Antitumor necrosis factor- dds treated rabbits had significantly less cd45 cells in the cornea (fig . 3h) at 3 months as compared to the sham dds group that had abundant cd45 leukocytes in the central and midperipheral corneal stroma (fig . Cd45 cell quantification showed a reduced population of leukocytes (mean = 4322 cells / cornea) in the anti - tnf- treated group as compared to the sham dds treated group (mean = 17,049 cells / cornea, p <0.05; fig . 3l). Further, a significant number of cd45 cells were observed in the limbal epithelium, iris, angle area, and corneal endothelium of the sham dds corneas while the eyes treated anti - tnf- dds presented few cd45 cells in these tissues . Consistent with the results of cd45 leukocyte infiltration in the cornea, anti - tnf- dds treated eyes exhibited remarkably less tnf- expression (fig . 3j) as compared to the sham dds treated eyes (figs . 3k, 3 m, p <0.05). Tumor necrosis factor- expression was predominant in ulcerated corneal area (e.g., the central anterior corneal stroma; fig preservation of the corneal endothelial mosaic and anterior segment structure was seen in all of the eyes treated with anti - tnf- dds (fig . These eyes demonstrated epithelial ulceration with bullae formation, subjacent collagen denaturation, chronic anterior stromal keratitis, and endothelial cell attenuation (fig . 4d) were other anterior segment findings observed in the sham dds treated eyes but not in the anti - tnf- dds treated eyes . Ocular phthisis and disorganization of intraocular structures was developed in one eye treated with sham dds . No evidence of inflammation was detected in the posterior segment (retina, vitreous, and choroid) of eyes from both groups . (a) treated cornea displays intact, noninflamed layers including preserved endothelium (arrows). (b) nontreated (sham) cornea with disruption and absence of the central epithelium, separation of surrounding epithelium by bullae and loss of endothelial cells . (c) a retrocorneal fibrous membrane (arrow) is adjacent to descemet's membrane (crossed arrow) in this untreated cornea . (d) peripheral anterior synechiae (arrows) in an untreated eye merges with the retrocorneal fibrous membrane (crossed arrow), a d, 100 . (e h) retinal and optic nerve degeneration 3 months after ocular alkali burn . (e) representative 20 immunohistofluorescence retinal images (3-tubulin = red and dapi = blue) of burned eyes treated either with sham or anti - tnf- dds . Sham treated eyes exhibited significantly higher loss of cells in the gcl as compared to anti - tnf- dds treated eyes . Antitumor necrosis factor- dds treated eyes exhibited increased 3-tubulin expression in the gcl as compared to sham dds treated . (g) representative microscopy images of p - phenylenediamine stained optic nerve sections of burned rabbit eyes . Consistent with the immunohistofluorescence results, sham dds treated eyes exhibited significantly increased optic nerve axon degeneration and reduced optic nerve axon density as compared to anti - tnf- dds treated eyes . Antitumor necrosis factor- treatment retain the normal fascicle packing and regular myelin wraps of the optic nerve axons . Gcl cells of sham dds treated eyes had significantly lower density compared to anti - tnf- dds treated eyes, n = 3, p <0.05 . (h) sham dds treated eyes exhibited significantly increased loss of optic nerve axons as compared to anti - tnf- dds treated eyes, n = 3, p <0.05 . Retinal neurodegeneration was inhibited using the anti - tnf- dds treatment, but not by the sham dds . Antitumor necrosis factor- treated eyes exhibited a 4.3% mean reduction of retinal gcl cell count as compared to the corresponding contralateral nonburned eye . Conversely, sham dds treated eyes exhibited a significant 38.1% mean reduction in gcl cell count (p <0.05, student's t - test; figs . Likewise, burned eyes treated with anti - tnf- dds showed no reduction in optic nerve axon density as compared to the optic nerves from the corresponding contralateral nonburned eye . However, sham dds treated eyes exhibited a significant 24.5% loss in optic nerve axons, as compared to the contralateral nonburned eye . Burned eyes treated with anti - tnf- dds had significantly higher optic nerve density as compared to burned sham dds treated eyes (p <0.05, unpaired student's t - test; figs . 4 g, 4h). Our results confirm that tnf- is a major mediator of inflammation in the cornea and, perhaps even more importantly, in the retina following ocular alkali burn . The upregulation of tnf- expression in burned corneas was positively correlated with large corneal infiltration of leukocytes, delayed corneal wound healing, endothelial cell loss, ulceration, corneal opacity, and neovascularization, as well as with retinal ganglion cell loss and optic nerve degeneration . Conversely, prompt treatment with anti - tnf- antibody (infliximab) significantly suppressed complications of the burned eye . The infliximab - loaded dds delivered the drug with considerable therapeutic effect, not only to the cornea but also to the retina . It can be questioned whether the retinal and optic nerve alterations have been mediated by intraocular pressure elevation due to anterior peripheral synechiae . Peripheral corneal inflammation, which was markedly increased in the sham dds treated eyes, may have contributed to angle closure and subsequent intraocular pressure elevation . Alternatively, and perhaps more likely, severe anterior segment inflammation in the early stages after the burn may have had a direct inflammatory effect on the posterior structures . Of importance here is that etanercept (another antibody of tnf-) has been shown to prevent retinal ganglion cell loss in a rat model of hypertensive glaucoma . This study also demonstrated that the dds implant is clinically well tolerated in the subconjunctival space of the lower eyelid fornix of the rabbits . Still, by histology, there was some granulomatous inflammation detected in the spaces occupied by all the implants the most conspicuous example was noted in an eye with anti - tnf- loaded dds . There was, however, no significant lymphocytic or granulomatous response in the enveloping pseudocapsule or in the connective tissues beyond the implant, indicating the limited focal response to the dds . The hosts' conjunctival area healed with no visible defect on the surface 7 days after implantation . A possible concern of subconjunctival implantation of the anti - tnf- dds could be device extrusion, as we observed in one rabbit . The drug delivery system is composed of a porous hydrophobic and nondegradable pdms polymer, which has been studied extensively for biocompatibility in vivo and in vitro in microfluidic devices, and tissue engineering . The inflammatory responses observed in dds implantation can be attributed of natural body reaction to foreign material, which is an indispensable processed during implant integration and healing processes . The reactions presented in our study have also been described in the literature where pdms was evaluated in different mouse, rat, rabbit models as the reference material to other test materials . A study by petillo et al . Demonstrated similar percentage of ia macrophages in the exudate of pdms and empty control implants . In short, it is generally accepted that pdms induces mild host tissue response, but it is safe for long - term implantation . Burned eyes treated with anti - tnf- dds exhibited only minimal retina ganglion cell loss compared to those receiving the sham dds, which exhibited a significant 40% reduction . Likewise, anti - tnf- dds treated eyes showed no reduction in optic nerve axon density, whereas sham dds treated eyes exhibited a significant 30% reduction . These findings may be clinically important . If a tnf- inhibitor can be administered to the retina in sufficient doses by any safe and efficient route soon after an alkali burn ideally in the emergency room immediately following the lavage it is likely that some damage to the eye can be prevented . Since corneal transparency can now be restored with a keratoprosthesis in even severe alkali burns, it can be argued that protection of the retina and the optic nerve should be given primary attention . Since damage to these structures is irreversible, dosage and route of administration of infliximab should be chosen with priority to retinal neuroprotection . Thus the efficacy, safety, and practicality of the various modes of delivery to the eye must be compared: systemic infusion, subcutaneous injection, local drops, gels or dds, subconjunctival or subtenon injection or dds, or intravitreal injection . Previous studies with infliximab drops in mouse and rabbit models focused on the early biological responses following injury, where the studied time frame was within 10 days . The infliximab was shown to penetrate into the anterior stroma of the injured corneas only in the absence of the epithelium . However, efficacy is expected to be reduced following re - epithelialization or conjunctivalization of the cornea in the later healing stage . It has not been demonstrated whether infliximab in drop form can protect the retina . Subconjunctival administration of infliximab, on the other hand, appears to bypass the barrier of the epithelium quite effectively and it has already been shown that a single subconjunctival injection of infliximab results in drug infiltration into the cornea and other anterior chamber tissues but, again, any effect on the retina was not described . It remains to be determined whether subconjunctival implantation of an infliximab - loaded dds is therapeutically superior to a single subconjunctival injection . Except for the strong initial burst release of infliximab, the dds has been shown to have a nearly zero - order release kinetics over 1 month in vitro . In this study, eyes with anti - tnf- dds showed presence of infliximab antibody around and within small vessels in the cornea, conjunctiva, iris, and choroid 3 months after implantation of the dds (supplementary fig . This suggests that the anti - tnf- antibody is continuously released by the dds for at least 3 months and the antibody finds its way to various ocular tissues . The therapeutic effect of sustained anti - tnf- delivery was also observed in one rabbit with early dds extrusion (42 days) due to loose conjunctival sutures . This rabbit exhibited increased infiltration of leukocytes in the cornea and increased loss of rgcs as compared to the rabbits that retained the anti - tnf- dds for 3 months (supplementary fig . Even though this finding is based on only one rabbit, it may suggest that the effect of prolonged release of anti - tnf- antibody to the eye may be therapeutically important and warrants further investigation . Although more complex in insertion and removal, the bioavailability and sustainability of infliximab delivery to both the anterior and posterior segments of the eye are possibly enhanced compared to a single subconjunctival injection . The effect achieved in our rabbit model with a very small dose of infliximab (85 g in the current dds) compared to that of standard systemic route (210 mg / kg) is striking . This means that the systemic effect of the subconjunctival dds - delivered dose should be trivial in a human compared to that of the standard intravenous dose . It can be speculated that the dds can be modified to fit into the lower lid fornix (cul - de - sac) to give therapeutic effect at least to the cornea . This modality does not require implantation, the dose is adjustable, and most importantly reversible by removing the dds . These results confirm that tnf- is a major mediator of inflammation in the eye following ocular surface burn with alkali and that tnf- inhibition may protect the eye from extensive damage to the cornea, retina, and optic nerve, and may even improve the prognosis of a subsequent corneal transplant . The finding that a low dose of local infliximab delivered via the subconjunctival space can result in substantial retinal neuroprotection should have applications beyond alkali burns . For example, in keratoprosthesis surgery where systemic delivery of infliximab has been shown to be protective, or in surgical procedures of the eye that induce ocular inflammation, infliximab prophylaxis may be beneficial . The ability of the dds to deliver various biologic agents to the retina, such as anti - vegf or combination anti - tnf-/anti - vegf agents is an intriguing concept that requires future attention.
|
Identification and eligibility of studies: as the aim was to ascertain the prevalence of pulmonary tb among the tribal population in india, we selected and reviewed all tribal - focused, community studies, targeting a demographic population above or equal to 15 yr of age . Only those studies in which individuals were examined for tb through initial screening for standard tb symptoms (cough for> 2 wk, fever for> 2 wk, chest pain, and haemoptysis), and subsequently had their diagnosis confirmed by sputum smear and/or culture tests, were selected . Though x - ray screening was also used when tb was suspected, this was not a required procedure given the potential inaccessibility of x - ray equipment in remote areas inhabited by tribal communities . Search criteria: for the purpose of this meta - analysis, we attempted to include all population based, cross - sectional and cohort studies, both published and unpublished . Literature searches were conducted in pubmed using the following combination of keywords: pulmonary tuberculosis, tribals, india, prevalence, and survey . The references cited in the articles retrieved were also reviewed, and those found relevant were selected . Additionally, research institutes working on tribal health were approached for tb prevalence reports . Eligibility of studies: the studies obtained through the search were included only if the following criteria were met: (i) should be community - based tb prevalence studies; (ii) have targeted members of tribal communities aged 15 yr and above; (iii) have done initial screening for standard tb symptoms (cough for> 2 wk, fever for> 2 wk, chest pain, and haemoptysis); (iv) have both smear (for acid - fast bacilli, afb) and culture tests done on the sputum samples collected . A positive case for tb is defined as being positive either by smear and or culture; and (v) reported an outcome measure the tb prevalence based on smear and/or culture results . Once qualifying studies for the meta - analysis were identified, tb positives reported in each study were adjusted to account for all eligible individuals in the sample who did not participate in tb screenings and/or sputum testing (i.e. Non - coverage). Based on these adjusted figures, tb prevalence rates (per 100,000 population) were estimated for each of the studies . The quality of the reporting of the included studies was assessed using the 22 items recommended by the strengthening the reporting of observational studies in epidemiology (strobe) statement20 is shown in table i. items fulfilling the strobe statement were considered positive . Data analysis: as the studies were observational in nature, a random effects model was applied21, to account for the possibility of heterogeneity among the studies, which was tested in terms of cochran's q statistic which is distributed as a chi - square statistic with k (number of studies) minus 1 degrees of freedom and p<0.1 is considered significant . Assessment of quality of studies according to strobe criteria further, the i which describes the percentage of variation across studies, along with its 95% uncertainty intervals (ui) was used to quantify heterogeneity . Funnel plots, begg's test and egger tests were used to assess the publication bias . A sensitivity analysis by study selection and data collection: two authors (as and cm), independently carried out the literature search, identified studies, and assessed their eligibility . Two additional studies were identified through a manual search of the retrieved articles listed references . However, all recommended studies were published and, therefore, already covered by our search . Of the 22 studies, only 12 studies involved tb prevalence surveys of individuals aged 15 yr and above in tribal communities . Of the 10 studies that were not included, four were annual risk of infection studies involving children aged 1 - 9 yr222324, two were reviews816, two surveyed general tribal health2526, one study only examined the microbiological aspect of tb27, and one was a tb risk factor analysis28 . Five912132930 of the 12 studies were discarded by both, as these did not adhere to the inclusion criteria . Characteristics of the studies included in the meta - analysis reasons for exclusion: in a study conducted in the kashmir valley12, culture tests alone were performed (no smear tests were conducted). Furthermore, the study focused on culture negative individuals with abnormal x - ray findings . The number of culture positive cases was not provided . In a large scale prevalence study in the car nicobar islands13, only smear tests were performed for detection of tb cases . Similarly, in a study carried out in the thiruvannamalai district, tamil nadu9, only smear examinations were done . In a study in central india29, the targeted population comprised individuals who were symptomatic and voluntarily visited a hospital and those who were identified in prior tb surveys . As this was not a community - based study, it was excluded . In a study in madhya pradesh30, no sampling design was followed . The individuals were neither screened for tb symptoms nor x - rayed to assess their sputum eligibility . Sputum samples were randomly collected from individuals in selected communities . As the study did not screen for tb in the targeted community, it was excluded . Included studies: characteristics of the selected studies such as targeted population, type of sampling design adopted, community sample size, gender specific and overall tb prevalence per 100,000 population are shown in table ii . Studies in madhya pradesh: there were five tb prevalence studies carried out in this region . A tb prevalence survey was conducted in the madhya pradesh region, targeting baigas, one of the primitive tribes that reside in the baiga chak area of dindori district17 . Due to logistical constraints, five villages were randomly selected to achieve a sample size of 2100 and a complete census was carried out in these villages . All individuals aged 15 years and above were screened for chest symptoms indicative of pulmonary tuberculosis . Of the total population included in the study, 1410 were eligible for screening, of whom 1374 were screened . Of those screened, 115 (8.4%) were chest symptomatic . Only two of 115 tested positive based on smear and/or culture testing, translating to a tb prevalence of 146 per 100,000 population . The study suggested that tb was not a major health problem among the baigas, but continuous monitoring and implementation of tb control measures were necessary to keep the disease in check . A tb prevalence survey was conducted among the bharia tribes residing in all 12 villages of the patalkot valley of the chindwara district14 . A complete census of the population in these villages was carried out and individuals aged 15 years and above were screened for chest symptoms . Of the 2586 individuals in these villages, 1443 were eligible for screenings, of whom 1390 were screened . Of the screened individuals, 92 (6.6%) were found to be chest symptomatic . Two sputum samples were collected from every symptomatic person, resulting in a coverage of 100 per cent . Of these 92, six were found to be positive for afb, translating to a tb prevalence of 432 per 100,000 population . The study revealed that the tb disease burden among bharias did not vary from the tb burden among non - tribals estimated in other studies . 3 . In 1996, a tb prevalence survey was conducted in 37 villages located in the karhal block of the morena district targeting the saharia tribe (a primitive tribal group)18 . These villages were randomly selected based on the probability proportional to size method (pps). Both tribals (saharias) and non - tribals residing in the selected villages were included . Of the 11097 individuals (aged 15 years and above) included in the study, 6365 were tribals and 4732 were non - tribals . All eligible individuals were screened for chest symptoms suggestive of tb . Among the tribal group, 445 individuals were chest symptomatic . Two sputum samples (spot and overnight testing) from 436 individuals ninety six individuals tested positive for tb (by smear and/or culture tests), translating to a tb prevalence of 1500 per 100,000 for tribals . Children between three months and nine years underwent tuberculin skin tests, revealing an overall infection rate of 16.9 per cent ., a community based tb prevalence survey was conducted in the karhal block of the sheopur district among the saharia tribes15 . All tribal villages with a predominant tribal population (> 80%) were considered for the study . Villages from this pool were randomly selected till the required sample size of 11,000 was achieved . A complete census was carried out in selected villages and all individuals aged 15 years and above were screened for chest symptoms . Two sputum samples were collected from those who were symptomatic or had a previous history of tb treatment . Of these, 1269 (11.4%) were found to be chest symptomatic, with males recording a significantly higher rate than females (15.2 and 8.0%, respectively). Sputum samples were obtained from 1268 individuals, resulting in a coverage of 99.9 per cent . Of these, 166 (13.1%) were found to be tb positive by smear and/or culture tests, translating to a tb prevalence of 1518 per 100,000 population . Males had a tb prevalence of 2156 per 100,000, which was significantly higher than that of females (933 per 100,000). There was a positive relationship between age and tb prevalence, with an increase in prevalence from 546 per 100,000 in individuals aged 15 - 24 yr to 3086 per 100,000 for individuals over 55 . This study also reported that there was no improvement in the tb situation for saharias 15 years after the initial survey was completed, despite the involvement of the national tb control programme (ntp) in the region . The study also suggested that the high tb prevalence found among the saharia tribe in this study needed further investigation, considering that a similar study among the same tribe reported a significantly lower prevalence (387 per 100,000), similar to that of the non - tribal population in the country.10 5 . In 2009, a multi - stage stratified cluster sampling design was adopted . In the first stage, 25 per cent of districts ii, 25 per cent of the blocks in these districts were randomly selected . In stage iii, the required number of villages (65) was randomly selected using the pps method . A survey of individuals aged 15 yr and above was carried out in the selected villages and details regarding tb chest symptoms and previous history of tb were elicited . Two sputum samples were collected from persons with chest symptoms or a previous history of tb treatment . Of the 23411 individuals, of these, 1770 (7.9%) were chest symptomatic, with males recording a significantly higher rate than females (9.1 and 6.9%, respectively). Sputum samples were collected from 1703 individuals . Of these, 83 tested positive for tb, as confirmed by smear and/or culture tests, translating to a tb prevalence of 387 per 100,000 population . The findings revealed that the tb prevalence among males (554 per 100,000 population) was more than double than that observed for females (233 per 100,000 population). Additionally, the study reported a significant, positive relationship between tb prevalence and age, with an increase in prevalence from 174 per 100,000 population for individuals aged 15 - 24 yr to 990 per 100,000 population in individuals over 55 . Study in maharashtra: in 1998, a study was conducted on the prevalence of sputum - positive tb among ashti and karanja tahsils in the wardha district19 . A total of 46 tribes were included in the survey, with three predominant tribes (gond, gond gawari, and raj gonds) constituting 87 per cent of the total tribal population . Of the 14,808 tribals aged 15 yr and above, 2.1 per cent (2.7% of males and 1.5% of females) presented with chest symptoms . These figures were less than those observed for non - tribals (2.1% for males, 1.3% for females, and 1.7% combined). Two sputum samples were collected from each symptomatic individual and a tb prevalence of 184 per 100,000 (confirmed by smear and/or culture test) was calculated after subtracting the figures related to 5 - 14 yr of age . Females were found to have a significantly lower prevalence (110 per 100,000) than males (257 per 100,000). It was also observed that while predominant gond tribes had tb prevalence similar to that of the non - tribal population in india (ranging from 100 to 196 per 100,000 population), primitive tribes, namely mana and pawara, had significantly higher prevalence (ranging from 612 to 730 per 100,000 population). Additionally, all tb cases in mana tribes were found among females, while all cases in pawara tribes were found among males . Study in tamil nadu: in 1989, a tb prevalence study was implemented targeting a malayali tribal community in the north arcot district of tamil nadu in the jawadhu hills11 . A stratified simple random sample selected from 24 panchayats formed the study population . All villages in the selected panchayats were enumerated . A total of 16017 individuals aged 15 years and above were screened for chest symptoms and also x - rayed . Of these, 3347 (20.9%) had chest symptoms or abnormal radiological findings (24.6% for males and 17.0% females). Two sputum samples were collected from 3301 individuals resulting in a coverage of 99 per cent . One hundred and twenty six tested positive for tb (using smear and/or culture tests), translating to a tb prevalence of 840 per 100,000 population . Eighty eight per cent were sensitive to all three drugs: isoniazid, rifampicin, and streptomycin . Twelve percent were resistant to isoniazid and 1.6 per cent were resistant to both isoniazid and rifampicin . The study also documented the influence of screening methods on prevalence estimates, as both symptom screenings and x - rays were carried out . There was a significantly higher tb prevalence observed for males (1220 per 100,000) than for females (440 per 100,000). A positive relationship between tb prevalence and age was also found, with an increase in prevalence from 260 per 100,000 individuals aged 15 - 24 to 1500 per 100,000 for individuals above 55 . Overall estimate - the pooled estimate, based on the random effects model, was 703 per 100,000 population with a 95% ci of 386 - 1011 . The heterogeneity measure of cochran's q of 11.0 was significant, resulting in a p value of 0.08 and an i of 48 per cent (with a 95% ui of 0 - 78%). A power analysis of the effect size by the random effects model showed this study had 51 per cent power . A forest plot with the pooled estimated (marked as a diamond with a vertical dotted line) with a 95% ci, as obtained from the random effects model, is displayed in fig . 1 . Also depicted are the tb prevalence estimates from the individual studies (marked as circles) along with their 95% cis . Our calculations indicated that 48 per cent of the variation observed in the pooled estimate was due to heterogeneity among the studies, suggesting that there were inconsistencies across the studies included in this analysis . Subgroup analyses to determine possible causes of heterogeneity and publication bias could not be performed, given the limited number of studies . Forest plot of meta - analysis of the tb prevalence among tribals based on seven studies . Gender - wise estimates - of the seven studies, four provided gender - wise tb prevalence rates . Estimated tb prevalence based on the random effects model indicated that females had a lower prevalence (398 per 100,000 with a 95% ci of 167628) than males (999 per 100,000 with a 95% ci of 444 -1553). However, the heterogeneity statistic, i, was 53 and 54 per cent for females and males, respectively, further suggesting inconsistencies across the studies . Publication bias - an attempt was made to assess the publication bias, however, the funnel plot method and other tests were underpowered due to small number of studies . Sensitivity analysis - a sensitivity analysis was performed, which indicated that when a particular study was removed, the resulting pooled estimate still fell within the 95% ci of the original pooled estimate . Though this suggested the stability of our results, heterogeneity among studies persisted . 2, where the vertical dotted line is the actual pooled estimate we calculated using the random effects model along with its 95% ci . Also displayed in parentheses is the heterogeneity measure, i obtained after the removal of a study . Sensitivity analysis showing the changes in pooled estimate along with the hetetogeneity measure when that study is removed . Percentage given in parentheses are i values . Overall estimate - the pooled estimate, based on the random effects model, was 703 per 100,000 population with a 95% ci of 386 - 1011 . The heterogeneity measure of cochran's q of 11.0 was significant, resulting in a p value of 0.08 and an i of 48 per cent (with a 95% ui of 0 - 78%). A power analysis of the effect size by the random effects model showed this study had 51 per cent power . A forest plot with the pooled estimated (marked as a diamond with a vertical dotted line) with a 95% ci, as obtained from the random effects model, is displayed in fig . 1 . Also depicted are the tb prevalence estimates from the individual studies (marked as circles) along with their 95% cis . Our calculations indicated that 48 per cent of the variation observed in the pooled estimate was due to heterogeneity among the studies, suggesting that there were inconsistencies across the studies included in this analysis . Subgroup analyses to determine possible causes of heterogeneity and publication bias could not be performed, given the limited number of studies . Forest plot of meta - analysis of the tb prevalence among tribals based on seven studies . Gender - wise estimates - of the seven studies, four provided gender - wise tb prevalence rates . Estimated tb prevalence based on the random effects model indicated that females had a lower prevalence (398 per 100,000 with a 95% ci of 167628) than males (999 per 100,000 with a 95% ci of 444 -1553). However, the heterogeneity statistic, i, was 53 and 54 per cent for females and males, respectively, further suggesting inconsistencies across the studies . Publication bias - an attempt was made to assess the publication bias, however, the funnel plot method and other tests were underpowered due to small number of studies . Sensitivity analysis - a sensitivity analysis was performed, which indicated that when a particular study was removed, the resulting pooled estimate still fell within the 95% ci of the original pooled estimate . Though this suggested the stability of our results, heterogeneity among studies persisted . 2, where the vertical dotted line is the actual pooled estimate we calculated using the random effects model along with its 95% ci . Also displayed in parentheses is the heterogeneity measure, i obtained after the removal of a study . Sensitivity analysis showing the changes in pooled estimate along with the hetetogeneity measure when that study is removed . Overall estimate - the pooled estimate, based on the random effects model, was 703 per 100,000 population with a 95% ci of 386 - 1011 . The heterogeneity measure of cochran's q of 11.0 was significant, resulting in a p value of 0.08 and an i of 48 per cent (with a 95% ui of 0 - 78%). A power analysis of the effect size by the random effects model showed this study had 51 per cent power . A forest plot with the pooled estimated (marked as a diamond with a vertical dotted line) with a 95% ci, as obtained from the random effects model, is displayed in fig . 1 . Also depicted are the tb prevalence estimates from the individual studies (marked as circles) along with their 95% cis . Our calculations indicated that 48 per cent of the variation observed in the pooled estimate was due to heterogeneity among the studies, suggesting that there were inconsistencies across the studies included in this analysis . Subgroup analyses to determine possible causes of heterogeneity and publication bias could not be performed, given the limited number of studies . Forest plot of meta - analysis of the tb prevalence among tribals based on seven studies . Gender - wise estimates - of the seven studies, four provided gender - wise tb prevalence rates . Estimated tb prevalence based on the random effects model indicated that females had a lower prevalence (398 per 100,000 with a 95% ci of 167628) than males (999 per 100,000 with a 95% ci of 444 -1553). However, the heterogeneity statistic, i, was 53 and 54 per cent for females and males, respectively, further suggesting inconsistencies across the studies . Publication bias - an attempt was made to assess the publication bias, however, the funnel plot method and other tests were underpowered due to small number of studies . Sensitivity analysis - a sensitivity analysis was performed, which indicated that when a particular study was removed, the resulting pooled estimate still fell within the 95% ci of the original pooled estimate . Though this suggested the stability of our results, heterogeneity among studies persisted . 2, where the vertical dotted line is the actual pooled estimate we calculated using the random effects model along with its 95% ci . Also displayed in parentheses is the heterogeneity measure, i obtained after the removal of a study . Sensitivity analysis showing the changes in pooled estimate along with the hetetogeneity measure when that study is removed . This meta - analysis pointed to a pooled pulmonary tb prevalence estimate of 703 per 100,000 for the tribal population which was significantly higher than that estimated for india (256 per 100,000)31 . This estimate greatly differs from the rntcp annual report estimation of only 80 smear positive cases per 100,000 tribal population (rntcp report, 2011, unpublished). The studies reviewed here adopted active case finding, entailing large - scale screening and testing of individuals in tribal communities as compared to passive case finding adopted in rntcp . Taking into consideration the limited number of studies among the tribal population, this estimate was higher than the culture positive tb prevalence estimates among the non - tribal populations in a rural district of bangalore32 (nelamangala: 152 per 100,000 population) and tamil nadu33 (thiruvallur: 388 per 100,000 population). This pooled estimate however, needs to be treated with caution, considering the level of heterogeneity across the studies . While i statistic indicated moderate heterogeneity, q statistic demonstrated a significant heterogeneity among studies, indicating that there were differences among the studies, rather than due to chance . The possible reason for a power of 51 per cent for this analysis could be the small number of studies . Heterogeneity could be due to variations in study characteristics including (i) the time period when the studies took place (between 1991 and 2010) (ii) areas covered (particularly for the saharia tribe) (iii) methodological approach (two studies did a complete enumeration of the study population, while the other studies reported multi - stage cluster or stratified random sampling procedures for the surveys), and (iv) the composition of the studied population (only one study19 reported the tribal composition of the targeted community). The variance could also be attributed to the influence of various screening methods adopted to assess the tb prevalence rates . In the study conducted in tamil nadu11, it was found that the tb prevalence was underestimated when symptom screenings or x - rays alone were performed . When both methods were used, there was a 25 per cent increase in detection of pulmonary tb . Also, in this study a drug susceptibility testing was performed, revealing that approximately 12 per cent of tb cases were isoniazid resistant and 1.6 per cent were both isoniazid and rifampicin resistant . These findings suggest the need for a standardized method of tb and resistant tb screening to ensure timely interventions . This review has also provided insight into some of the socio - demographic patterns of tb among the tribal populations studied . Two studies indicated that tb prevalence among males was higher than that observed among females1015 . These studies have also reported that the prevalence of chest symptomatic was higher for males than for females, with one study reporting prevalence of chest symptomatic among males being twice of what was observed in females (554 per and 233 per 100,000 respectively)10 . Higher tb prevalence rates in men than in women have been reported among the general population also . This has been attributed to alcohol use / drugs, smoking, work environment and differences in exposure, risk of infection, and progression from infection to disease343536373839 . It has also been observed that tb incidence in males and females differ significantly from the age of 25 yr and that men are more likely than women to develop the disease from this age40 . These findings could also be applicable to understanding the higher prevalence rates of tb among the tribal male population . Some of the studies in this analysis reported an age dependent trend, with older individuals being more at risk101115 . This may be because older people are more likely to be under diagnosed and be infected with the disease from a latent infection acquired years or decades ago . Other possible issues may be attributed to delays in seeking care49 low socio - economic status, poor nutrition and metabolism and co - infection or previous disease . The observed high prevalence of pulmonary tb among the older age groups in tribal population needs to be further understood . The studies included in this analysis were limited in number and target only a few (around seven) of the numerous tribal groups (over 600) found throughout the country1 . Further, five of the seven studies included were based on the tribal population from the state of madhya pradesh alone . Therefore, the pooled estimate does not accurately reflect the pulmonary tb prevalence in the tribal population as a whole and needs to be treated with caution . Due to this limited number it was not possible to perform an assessment of the publication bias (an important measure for any systematic review or meta - analysis) as the relevant tests were underpowered due to small number of studies, or a subgroup analysis, necessary to identify the specific reasons for heterogeneity among the studies . In conclusion, our findings indicate a large variation in pulmonary tb prevalence estimates among different studies and limited coverage of the tribal population, highlighting the imperative need to comprehensively and accurately assess the tb burden among the tribal population in india . The findings also suggest the need for a standardized method of tb and resistant tb screening to ensure timely interventions . Methodological strategies need to be considered to reach the unreached and obtain a true estimation of the disease burden . Further, it is critical to understand the health - seeking behaviours of tribal people, especially of chest symptomatic, to increase their access to healthcare services . The potential role of the tribal community in tb control activities, including the identification and referral of symptomatic for care, also needs to be explored.
|
Peptidyl prolyl cistrans isomerases regulate many biological processes by interacting with molecular switches whose conformations are modulated via cistrans isomerization of the prolyl peptide () bond. (1) many molecular switches are involved in cell signaling pathways, and deregulation of these pathways could trigger cellular transformation, oncogenesis, and other diseases. (2) there are three structurally unrelated classes of ppiases that are known to date: the cyclophilins that bind cyclosporine, the fk506 binding proteins (fkbp), and the parvulins, of which pin1 is a member . Undoubtedly, cistrans isomerization of the peptide bond is one of the slowest conformational transitions found in proteins . The detailed atomistic understanding of the mechanism of ppiases is still lacking, and the bits and pieces that are known do not always form a coherent story . The local changes of the isomeric state of the prolyl peptide bond act as a switching mechanism in altering the overall conformation of proteins . Protein signaling processes utilize the additional conformational variability that arises due to the resulting cis and trans isomers of peptide bonds . Several molecular switches that are regulated by cistrans isomerization have been discovered over the years. (2) the role of cistrans isomerization of the prolyl peptide bond in interleukin tyrosine kinase (itk) sh2 domain that is regulated by cyclophilin, and ligand - gated 5ht3 ion channel,(5) are two recognizable examples . The binding site of the sh2 domain of itk discriminates between two different ligands, depending on the isomeric state of a distal prolyl peptide bond . Similarly, the conformation of five prolyl peptide bonds, one in each subunit, was shown to determine the state of the ligand - gated 5ht3 ion channel . When the prolyl peptide bonds adopt the trans conformation, the channel is closed; when they are in the cis isomeric state, the channel is open, allowing ions to flow through . Importantly, the hiv virus has also been shown to use the human cyclophilin during its final stages of viral replication, which has rekindled interest in this enzyme especially for drug design purposes . Human cyclophilin catalyzes cistrans isomerization of a prolyl peptide bond of the hiv capsid in order to trigger a conformational change necessary for viral packaging . Cistrans isomerization of prolyl peptide bonds is characterized by a very high activation energy barrier of around 1622 kcal / mol, and the rate is in the order of tens to hundreds of seconds . Therefore, cistrans isomerization is involved in slow conformational changes, including the rate - limiting step in protein folding . Nature has provided the ppiase enzymes to circumvent this very slow kinetics by catalyzing the cistrans isomerization and decreasing the time scale from seconds to the more biologically relevant millisecond time scale . The mechanism of the ppiases is still not well understood and is controversial, and has been the subject of many experimental and computational studies . For example, it was earlier thought that the remarkable speedup is achieved by a nucleophilic attack to the carbonyl carbon atom of the preceding residue that would result in the loss of the pseudo - double - bond character of the peptide bond . This possible loss in pseudo - double - bond character could then result in a lower activation energy barrier and therefore lead to a faster rate of isomerization . However, this mechanism was shown to be implausible due to the retention of catalytic activity of cyclophilin after mutagenesis studies that were carried out on all the residues that have the ability to act as the nucleophile. (16) therefore, ppiases are one of the rare enzymes in biology that carry out their function in the absence of any actual bond formation and cleavage . How do the ppiases then achieve this remarkable speedup of more than 5 orders of magnitude? Several hypotheses have been proposed over the years that include the effect of substrate desolvation and the idea of preferential transition - state binding in the active site. (1) it was shown that the effect of removing the substrate from aqueous solution to the hydrophobic pocket of the ppiases, as shown in figure 1, could result in a speedup of cistrans isomerization . This effect is partly due to the weakening of the pseudo - double - bond character of cn in nonaqueous environment, resulting in a small reduction of the transition barrier height by about 1.3 kcal / mol. (17) similarly, a speedup of up to about 20-fold of the rate of cistrans isomerization was later observed in micelles that also resulted in a small decrease in the barrier height by about 1.8 kcal / mol, assuming that the speedup is purely due to barrier reduction. (18) likewise, we have previously observed a speedup in the rate of cistrans isomerization using molecular dynamics simulations in the absence of explicit water molecules around the prolyl peptide bond due to a reduction in the effective roughness on the energy landscape that results in a change in the kinetic prefactor. (19) the kinetic prefactor depends on the diffusion coefficient on the landscape, which in turn depends on the effective roughness of the landscape . Also, the speedup can simply be a consequence of the change in the frictional drag experienced by the substrate in moving from an aqueous environment to the dry hydrophobic cavity of the binding site of the ppiases . However, these prefactor effects and slight reduction in barrier height due to the lack of aqueous medium could not account for the more than 5 orders of magnitude increase in the observed rate of cistrans isomerization due to ppiases . Also, it has previously been shown that an increase in the rate of cistrans isomerization of the angle can be achieved by constraining the peptide bond in a loop conformation, but the extent of the role of this phenomenon in the catalysis of cistrans isomerization of the peptide bond by ppiases is not known . Cyclophilin catalyzes cistrans isomerization of a -gly - pro- motif on the exposed loop structure of the hiv capsid (left). The binding site of cyclophilin (right) has a very hydrophobic pocket with the nonpolar residues shown as white, an arginine residue at the entrance of the pocket shown as blue surface, a histidine shown as cyan surface, and two asparagines shown as green . The side - chain ring of the proline residue fits very nicely into the hydrophobic pocket of the binding site . In order to fully understand the catalytic mechanism at the atomistic detail, one has to be able to observe the cistrans isomerization of the peptide bond . In this regard, all - atom molecular dynamics simulation has proven invaluable as a complementary technique to existing experimental results in fully understanding protein function. (22) however, normal molecular dynamics simulation has not been able to provide a complete picture of the catalytic mechanism of the ppiases because of the time scale limitation, and therefore the cistrans isomerization cannot be simulated directly . The time scale of cistrans isomerization and even the time scale of the catalyzed process are beyond the submicrosecond time scale of normal molecular dynamics (md). Therefore, earlier computational studies of this system have used umbrella sampling and restrained molecular dynamics in order to traverse the isomerization path . A limitation of these types of techniques is the reliance on a priori decisions about the transition path that could potentially bias the outcome . Previously, we developed an accelerated md method(26) that was used to simulate for the first time the cistrans isomerization of the prolyl peptide bond,(27) and we were able to calculate the free energy barrier and rate constants in both implicit and explicit solvent . This method speeds up the transition over energetic barriers with little or no prior knowledge of the energy landscape . In this work, we have used the accelerated md method to fully study the catalytic mechanism of the cyclophilin a enzyme by simulating the cistrans isomerization of the free substrate taken from the hiv capsid and that of the enzymesubstrate complex, both in explicit solvent . Therefore, we have used classical molecular mechanics to study the catalytic mechanism of this enzyme . We observed cistrans isomerization of the -gly - pro- bond of the free substrate ace - his - ala - gly - pro - ile - ala - nme from the accelerated molecular dynamics simulations in explicit water as shown in figure 2a . The substrate is derived from the loop region of the hiv capsid (figure 1) that is regulated by cyclophilin a. in addition to the crystal structures of cyclophilin complexed with the whole hiv capsid, cyclophilin has also been cocrystallized with the short piece taken from the full - length capsid . The free energy profile along the bond was estimated as shown in figure 2c, after reweighting the distribution of the peptide angle of -gly - pro- . The free energy barriers are similar regardless of the direction of rotation, with a barrier height of about 16.5 1.2 kcal / mol going from the trans to cis isomer and about 12.8 1.5 kcal / mol going from the cis to trans isomer . The similarity of the free energy profile in both directions can be attributed to the lack of the side chain in the preceding glycine residue, thus allowing for almost equal probability of undergoing clockwise and anticlockwise rotations . This result contrasts with our previous study of the -ser - pro- motif that has an asymmetric free energy profile, which could be attributed to the side chain of serine hindering the trans - to - cis clockwise rotation. (27) cistrans isomerization of the bond of the -gly - pro- motif of the free substrate (a) and enzymesubstrate bound complex (b) and the corresponding free energy profile after reweighting of the distribution (c) for the free substrate (black) and enzymesubstrate complex (red). After simulating the cyclophilinsubstrate complex with accelerated md simulations in explicit water, we also observed cistrans isomerization of the bond of -gly - pro- in the catalytic pocket of the enzyme that allowed us to monitor and study the catalytic mechanism of cyclophilin (figure 2b). An immediate observation of the time series of the angle is the directionality of the cistrans isomerization . The transition from trans to cis, and vice versa, is mainly unidirectional, and the directionality of the transitions is also obvious from the estimated free energy profile along the bond, also shown in figure 2c . The barrier height of the transition from the trans to cis isomer is lower for the anticlockwise direction, and that for the cis to trans transition is lower along the clockwise direction . Also, the trajectory of cistrans isomerization of the enzyme - bound substrate is noticeably different from that of the free substrate as can be seen in figure 2, a and b. an ensemble of conformations around 90 of the angle of -gly - pro- is stabilized as compare to the free substrate . Therefore, after reweighting the distributions, two other main observations from the free energy profile are the stabilization of the cis isomer against the trans isomer as compared to the free substrate and the lowering of the barrier height as we go from the trans isomer to the cis isomer (anticlockwise). The cis and trans isomers of the substrate in the binding site now have almost equal probability of occurrence, with the transition state at a higher free energy . The barrier height from trans to cis even though the barrier height of the transition state is lowered in the enzymesubstrate complex as compared to that of the free substrate, the barrier reduction is not enough to make the transition - state complex more stable than the complex with the cis or trans isomer . Consequently, crystal structures of the enzymesubstrate complexes are expected to be found either in the cis or trans conformation, as is the case . The barrier height from the trans to cis isomer in the enzymesubstrate complex is now about 10.2 kcal / mol . The reduction in the barrier height is therefore estimated to be around 6.3 kcal / mol . As a result, the magnitude of the reduction of the barrier height coupled with a possible order of magnitude speedup due to the kinetic prefactor effect is enough to increase the rate of the isomerization by more than a factor of 10 . Since the time scale of the cistrans isomerization of the free substrate occurs in 11000 s, this speedup is enough to put the catalyzed process in the biologically relevant millisecond time scale . We can see from figure 2 that the transition state in the complex has lower free energy than that in the free substrate, relative to the trans isomer . The lower barrier height of the transition state is therefore partly responsible for the speedup of the rate of cistrans isomerization . Also, the free energy of the cis isomer is similar to that of the trans isomer, thermodynamically increasing the population of the cis isomer relative to that in the free substrate . We analyzed the ensemble of structures of the transition state, and we observed that the transition state is formed when the carbonyl oxygen of gly forms a hydrogen bond with a backbone nh group of asn 102, as shown in figure 3 . This favorable hydrogen - bonding interaction between the carbonyl oxygen and the backbone hydrogen of asn 102 is formed when the n - terminal of the peptide bond rotates clockwise (looking from the n - terminal to the c - terminal along the bond). The c - terminal of the peptide bond, which comprises the proline ring, never rotates for this particular substrate and stays snuggled in the hydrophobic pocket, as is depicted in figures 1 and 3 . The rotation of the n - terminal of the peptide bond during catalysis has also been suggested from crystal structure analyses,(32) contradicting previously reported c - terminal rotation of the peptide bond. (33) however, the rotating end could be dependent on the sequence of the substrate or the family of ppiase . The enzyme - bound substrate is stabilized by three main interactions: the nonpolar interaction proline makes with the hydrophobic pocket, the hydrogen - bonding interaction between the guanidinium moiety of the conserved arginine (top) and the carbonyl oxygen of proline, and the hydrogen bond between the carbonyl oxygen of glycine and the backbone hydrogen (below) of asparagine . Therefore, in order to further probe the extent of transition - state stabilization, we have constructed a thermodynamic cycle as shown in figure 4 . The thermodynamic cycle links the free energies of binding between the trans, transition state, and cis isomers of the substrate and cyclophilin to the free energies of cistrans isomerization . It is clear from this analysis that the transition state binds more strongly to cyclophilin followed by the cis isomer, with the enzyme having the least affinity for the trans isomer . This result agrees with previous nmr experiments(34) which showed that the cis isomer binds 4 times stronger than the trans isomer to cyclophilin, which correlates with the fact that many of the cyclophilinsubstrate structures adopt the cis form . Our suggestion that the transition state interacts more favorably with cyclophilin does not contradict the fact that all of the structures of the cyclophilinsubstrate complexes are either in the cis or trans conformation . Despite the fact that the transition state interacts more favorably with the enzyme, the total free energy of the enzymetransition - state complex is higher than that of the ground state cis and trans isomers as can be seen in figure 2c, due mainly to the high penalty of activation . T, ts, and c represent the trans, transition state, and cis conformations, respectively . Furthermore, stabilization of the transition state is due not only to the favorable interaction made by the carbonyl oxygen of the gly with the backbone hydrogen of asn and by the favorable nonpolar interaction of the proline residue with the hydrophibic pocket but also to a favorable interaction of the carbonyl oxygen of pro with the guanidinium moiety of the highly conserved arg 55, also shown in figure 3 . Arginine 55 is shown to interact quite differently with the trans, transition state, and cis isomers, and therefore partly responsible for the differences in binding affinity . In this regard, a catalytic antibody, abzyme, optimized to recognize and bind a transition - state mimic, accelerates the rate of cis / trans isomerization of the peptide bond, but to a much lesser extent than cyclophilin. (35) why would the optimized abzyme have a much smaller increase in the rate of cistrans isomerization of the peptide bond than cyclophilin? The answer, we believe, lies in the nature of the peptide bond mimic, an -ketoamide, that looks like a distorted peptide bond . The chemistry of the hapten (the distorted peptide bond mimic) on the n - terminal side of the proline residue is rather different from that of typical substrates . The peptide bond connecting the preceding residue and the proline is replaced by a dicarbonyl moiety in the hapten . This moiety allows the angle of the amide bond to be around 90, similar to that of the transition state of the peptide bond . Therefore, this small change from the real substrate could compromise the activity of the abzyme on the real substrate, since the specificity of action of the abzyme was optimized for a substrate with a slightly different chemistry . The effect of arg 55 is visually evident from the crystal structure of the cyclophilinsubstrate complexes in which the guanidinium moiety forms hydrogen bonds with the carbonyl oxygen of proline, similar to the interaction shown in figure 3 . Arg 55 is highly conserved, and its replacement has been shown to decrease the catalytic activity of cyclophilin. (36) the catalytic efficiency (kcat / km) of the wild - type cyclophilin was estimated to be 16 m s, and that of the arg55ala mutant was estimated to be 0.016 m s, about 0.1% of the catalytic efficiency of the wild - type . Therefore, these results suggest that arg 55 might be important for recognition, since some catalytic activity is retained for the arg55ala mutant . The binding affinity of cyclophilin for its substrates is very low, about 2040 m,(34) and therefore, this single arginine residue could potentially be critical for both recognition and stability . It was previously shown that arg 55 was stable during one nanosecond of md simulation, and elimination of its overall charge destabilized the transition state and the cis isomer complexes. (24) we therefore decided to explore the role of arg 55 in the catalytic process over a much longer time scale and the effect this residue might have on the stability of the transition - state complex . We carried out three normal md simulations, 50 ns each, on the enzymesubstrate complex with the substrate -gly - pro- bond in the trans, transition state, and cis state, bound separately to the enzyme . The angle of only the transition state was held at 90 by applying a 1000 kcal / mol / rad angle restraint on only that degree of freedom . The distance between the carbon of the guanidinium moiety of the arginine residue to the carbonyl oxygen of the substrate proline residue was monitored for the three simulations as summarized in figure 5 (black lines). It can be seen in figure 5 that this hydrogen - bond contact is not stable in the complex with the trans isomer . Also, the hydrogen - bond formation is reproducibly correlated with the stability of the complex . At around 35 ns in this simulation of the enzymesubstrate complex of the trans isomer, the arginine residue disengages the carbonyl oxygen of the proline residue one more time, and this event is followed by the diffusion of the substrate out of the binding site (figure 5; blue lines). The blue line is the distance between the c- of the proline residue of the substrate and the c- of the phenylalanine residue in the hydrophobic pocket . Hydrogen - bonding interactions between the binding site of cyclophilin and the substrate in the trans, transition state, and cis conformations . The black line represents the distance between the carbon atom of the guanidinium moiety of the conserved arg 55 residue in the binding site of cyclophilin and the carbonyl oxygen of the proline of the substrate . The gray line depicts the distance between the backbone nh group of asn 102 in the binding site of cyclophilin and the carbonyl oxygen of gly of the substrate . The blue line monitors the substrate in the binding site of cyclophilin and represents the distance between the c- atom of proline of the substrate and the c- atom of phenylalanine, one of the residues in the hydrophobic pocket of the binding site . Similarly, but to a lesser extent, the distance between the enzymesubstrate complex with the substrate in the cis isomer is not stable and also correlated with the stability of the complex . The substrate of the cis isomer diffuses out of the binding site immediately as the arginine residue disengages with carbonyl oxygen of the proline residue . However, the hydrogen - bond contact that is formed between the arginine residue and the carbonyl oxygen of proline of the cis isomer is more stable than that of the trans isomer (figure 5). In contrast to the enzymesubstrate complexes of the trans and cis isomers, the hydrogen bond between the guanidinium moiety of the arginine residue and the carbonyl oxygen of proline of the transition - state complex is very stable and stays in the binding site during the course of the 50 ns simulation, as also shown in figure 5 . Arginine 55 therefore acts as an anchor for the substrate in the binding site by preferentially stabilizing the transition state over the trans and the cis isomers . Consequently, mutation of arg 55 to ala would result in reduction of the catalytic efficiency, as was previously shown. (36) the transition state also makes an additional favorable contact (figure 3) due to the long - lasting hydrogen - bond interaction between the carbonyl oxygen of the gly residue and the backbone hydrogen of asn 102, as also shown in figure 5 (gray line). The gly of the trans isomer in the complex never forms a hydrogen bond with the backbone nh group of asn 102 as also shown in figure 5 . The carbonyl oxygen of gly of the cis isomer in the complex does form a hydrogen bond with the backbone nh group of asn 102 (figure 5) as in the transition - state complex, but to a much lesser extent . Therefore, the stabilizing role of arg 55 and the asn 102 qualitatively agrees with the predicted trend in binding energies; that is, the transition state binds stronger than the cis isomer, which in turn binds stronger than the trans isomer . Cistrans isomerization of peptide bonds of proteins is a very important switching mechanism in biology that is involved in many cell signaling pathways . Even with the help of peptidyl prolyl isomerases, such as cyclophilin, the resulting time scale is beyond that of normal molecular dynamics . It is clear from previous experiments that there are no bond formation and cleavage events occurring during catalysis; therefore, we have used classical molecular mechanics coupled with the accelerated molecular dynamics methodology to shed some light on this very important catalytic mechanism . Using the accelerated molecular dynamics method that allows us to overcome the submicrosecond time scale limitation of normal molecular dynamics simulations, we have studied the catalytic mechanism of cyclophilin in full - atomistic detail in explicit water . Aside from a possible small electronic contribution that has not been captured by the classical mechanics empirical force field, we are able to fully describe the catalytic mechanism of cyclophilin and provide quantitative estimates of the free energies associated with the process . The catalysis is shown to occur mainly through the stabilization of the transition state in the binding site due to a combination of favorable hydrophobic and very long - lasting hydrogen bonding interactions . Cyclophilin decreases the barrier height of the trans to cis transition by 6.3 kcal / mol, which when coupled with other factors, such as a possible change in the kinetic prefactor, could speed up the isomerization process by as much as 10 . A possible effect that the classical force field could not be able to fully capture is some of the small reduction in the barrier height of 1.3 kcal / mol(17) due to a small electronic effect of desolvation of the substrate . If we added this small correction to the calculated barrier height, the overall barrier reduction would be around 7.6 kcal / mol, which would further increase the estimated rate of isomerization . Also, since the guanidinium moiety of the conserved arginine residue stabilizes the transition state through interactions with the carbonyl oxygen of proline, this also puts it somewhat close to the nitrogen of the proline . The closeness of the guanidinium moiety to the proline nitrogen could weaken the delocalization of the electron cloud along the pseudo - double peptide bond . However, as we can see, majority of the speedup has been captured using classical accelerated molecular dynamics.
|
Wild - type bacillus subtilis cells (strain 168) were grown in terrific broth (sigma). A monoclonal colony was transferred from an agar plate to 25 ml of medium and left to grow overnight at 35c on a shaker . The culture was diluted 200-fold into fresh medium and harvested after approximately 5 hours when more than 90% of the bacteria were swimming, as visually verified on a microscope . 10 ml of the suspension was then concentrated by centrifugation at 1500 g for 10 minutes, resulting in a pellet with volume fraction approximately 20% which was used without further dilution . The microchambers were made of polydimethyl siloxane (pdms) bound to a glass coverslip by oxygen plasma etching . These comprised a square, triangular or linear lattice of ~ 18 m - deep circular cavities with 60 m between centres, each of diameter ~ 50 m, connected by 425 m - wide gaps for linear and square lattices (fig . 1a, e; supplementary fig . 6) and 1025 m - wide gaps for triangular lattices (fig . 3a approximately 5 l of the concentrated suspension was manually injected into the chamber using a syringe . We imaged the suspension on an inverted microscope (zeiss, axio observer z1) under bright field illumination, through a 40 oil - immersion objective . Movies 10 s long were recorded at 60 f.p.s . On a high - speed camera (photron fastcam sa3) at 4 and 8 minutes after injection . Though the pdms lattices were typically ~ 15 cavities across, to avoid boundary effects and to attain the pixel density necessary for piv we imaged a central subregion spanning 6 6 cavities for square lattices, 7 6 cavities for triangular lattices, and 7 cavities for linear lattices (multiple of which were captured on a single slide). Fluorescence in supplementary video 3 was achieved by labelling the membranes of a cell subpopulation with fluorophore fm4 - 64 following the protocol of lushi et al.16 the suspension was injected into an identical triangular lattice as in the primary experiments and imaged at 5.6 f.p.s . On a spinning - disc confocal microscope through a 63 oil - immersion objective . For each frame of each movie, the bacterial suspension flow field u(x, y, t) was measured by standard particle image velocimetry (piv) without time averaging, using a customized version of mpiv (http://www.oceanwave.jp/softwares/mpiv/). Piv subwindows were 16 16 pixels with 50% overlap, yielding ~ 150 vectors per cavity per frame . Cavity regions were identified in each movie by manually placing the centre and radius of the bottom left cavity, measuring vectors to its immediate neighbours, and repeatedly translating to generate the full grid . Pillar edges were then calculated from the cavity grid and the gap width (measured as the minimum distance between adjacent pillars). The spin vi(t) of each cavity i at time t is defined as the normalized planar angular momentum vi(t)=z^. [(x, y)iri(x, y)u(x, y, t)]u(x, y)i|ri(x, y)|, where ri(x, y) is the vector from the cavity centre to (x, y), and sums run over all piv grid points (x, y)i inside cavity i. for each movie, we normalize velocities by the root - mean - square (rms) suspension velocity u=u(x, y, t)21/2, where the average is over all grid points (x, y) and all times t, to account for the effects of variable oxygenation on motility9; we found an ensemble average e[u]=12.1ms1 with s.d . This definition has vi(t)> 0 for counter - clockwise spin and vi(t) <0 for clockwise spin . A vortex of radially - independent speed, i.e. U(x, y, t)=u^ where ^ is the azimuthal unit vector, has vi(t) = 1; conversely, randomly oriented flow has vi(t) spin correlation of a movie is then defined as =i~jvi(t)vj(t)i~j|vi(t)vj(t)|, where i~j denotes a sum over pairs {i, j} of adjacent cavities and denotes an average over all frames . If all vortices share the same sign, then = 1 (ferromagnetism); if each vortex is of opposite sign to its neighbours, then = 1 (antiferromagnetism); if the vortices are uniformly random, then = 0 . Similarly, the circulation pj (t) about pillar j at time t is defined as the normalized average tangential velocity pj(t)=(x, y)ju(x, y, t)t^j(x, y)u(x, y)i1, where t^j(x, y) is the unit vector tangential to the pillar, and sums run over piv grid points (x, y)j closer than 5 m to the pillar j. results presented are typically averaged in bins of fixed gap width . All plots with error bars use 3 m large bins, calculated every 1.5 m (50% overlap), and bins with fewer than 5 movies were excluded . C; supplementary figs . 4 & 7) are 8, 8, 13, 14, 21, 27, 27, 22, 18, 22, 20, 11, 7, 13, 7; bin counts for triangular lattices (fig . 3d) are 5, 14, 16, 13, 16, 15, 5, 5, 10, 7; and bin counts for linear lattices (supplementary fig . 6) are 5, 7, 8, 8, 9, 9, 6, 5, 6, 7, 6, 8, 9, 5, 6, 5, 6 . Wild - type bacillus subtilis cells (strain 168) were grown in terrific broth (sigma). A monoclonal colony was transferred from an agar plate to 25 ml of medium and left to grow overnight at 35c on a shaker . The culture was diluted 200-fold into fresh medium and harvested after approximately 5 hours when more than 90% of the bacteria were swimming, as visually verified on a microscope . 10 ml of the suspension was then concentrated by centrifugation at 1500 g for 10 minutes, resulting in a pellet with volume fraction approximately 20% which was used without further dilution . The microchambers were made of polydimethyl siloxane (pdms) bound to a glass coverslip by oxygen plasma etching . These comprised a square, triangular or linear lattice of ~ 18 m - deep circular cavities with 60 m between centres, each of diameter ~ 50 m, connected by 425 m - wide gaps for linear and square lattices (fig . 1a, e; supplementary fig . 6) and 1025 m - wide gaps for triangular lattices (fig . 3a approximately 5 l of the concentrated suspension was manually injected into the chamber using a syringe . We imaged the suspension on an inverted microscope (zeiss, axio observer z1) under bright field illumination, through a 40 oil - immersion objective . Movies 10 s long were recorded at 60 f.p.s . On a high - speed camera (photron fastcam sa3) at 4 and 8 minutes after injection . Though the pdms lattices were typically ~ 15 cavities across, to avoid boundary effects and to attain the pixel density necessary for piv we imaged a central subregion spanning 6 6 cavities for square lattices, 7 6 cavities for triangular lattices, and 7 cavities for linear lattices (multiple of which were captured on a single slide). Fluorescence in supplementary video 3 was achieved by labelling the membranes of a cell subpopulation with fluorophore fm4 - 64 following the protocol of lushi et al.16 the suspension was injected into an identical triangular lattice as in the primary experiments and imaged at 5.6 f.p.s . On a spinning - disc confocal microscope through a 63 oil - immersion objective . For each frame of each movie, the bacterial suspension flow field u(x, y, t) was measured by standard particle image velocimetry (piv) without time averaging, using a customized version of mpiv (http://www.oceanwave.jp/softwares/mpiv/). Piv subwindows were 16 16 pixels with 50% overlap, yielding ~ 150 vectors per cavity per frame . Cavity regions were identified in each movie by manually placing the centre and radius of the bottom left cavity, measuring vectors to its immediate neighbours, and repeatedly translating to generate the full grid . Pillar edges were then calculated from the cavity grid and the gap width (measured as the minimum distance between adjacent pillars). The spin vi(t) of each cavity i at time t is defined as the normalized planar angular momentum vi(t)=z^. [(x, y)iri(x, y)u(x, y, t)]u(x, y)i|ri(x, y)|, where ri(x, y) is the vector from the cavity centre to (x, y), and sums run over all piv grid points (x, y)i inside cavity i. for each movie, we normalize velocities by the root - mean - square (rms) suspension velocity u=u(x, y, t)21/2, where the average is over all grid points (x, y) and all times t, to account for the effects of variable oxygenation on motility9; we found an ensemble average e[u]=12.1ms1 with s.d . This definition has vi(t)> 0 for counter - clockwise spin and vi(t) <0 for clockwise spin . A vortex of radially - independent speed, i.e. U(x, y, t)=u^ where ^ is the azimuthal unit vector, has vi(t) = 1; conversely, randomly oriented flow has vi(t) = 0 . Spin correlation of a movie is then defined as =i~jvi(t)vj(t)i~j|vi(t)vj(t)|, where i~j denotes a sum over pairs {i, j} of adjacent cavities and denotes an average over all frames . If all vortices share the same sign, then = 1 (ferromagnetism); if each vortex is of opposite sign to its neighbours, then = 1 (antiferromagnetism); if the vortices are uniformly random, then = 0 . Similarly, the circulation pj (t) about pillar j at time t is defined as the normalized average tangential velocity pj(t)=(x, y)ju(x, y, t)t^j(x, y)u(x, y)i1, where t^j(x, y) is the unit vector tangential to the pillar, and sums run over piv grid points (x, y)j closer than 5 m to the pillar j. results presented are typically averaged in bins of fixed gap width . All plots with error bars use 3 m large bins, calculated every 1.5 m (50% overlap), and bins with fewer than 5 movies were excluded . . 4 & 7) are 8, 8, 13, 14, 21, 27, 27, 22, 18, 22, 20, 11, 7, 13, 7; bin counts for triangular lattices (fig . 3d) are 5, 14, 16, 13, 16, 15, 5, 5, 10, 7; and bin counts for linear lattices (supplementary fig . 6) are 5, 7, 8, 8, 9, 9, 6, 5, 6, 7, 6, 8, 9, 5, 6, 5, 6.
|
Preeclampsia / eclampsia (pe) syndrome, defined as new onset and persistent hypertension after 20 weeks of gestation in association with significant proteinuria, is a major cause of maternal - fetal morbidity and mortality worldwide . The pathophysiology of pe remains incompletely understood, and anticipation and appropriate management of this disorder are frequently insufficient . The prevalent pathogenic theory of pe includes the manifestation of two characteristic and sequential processes considered to be of paramount importance . The first corresponds to an insufficient placentation, which drives an increase in the resistance of the uteroplacental circulation, and the second involves the maternal reaction through the activation of an inappropriate inflammatory response with a (proposed) globally impaired endothelial function (ef). Structural and functional alterations in large arteries have also been reported accompanying pe syndrome [4, 5]. Impaired ef and arterial damage could occur for a certain time before significant proteinuria and clinical manifestations of pe become apparent [3, 6]. Thus, the possibility of identifying early subclinical endothelial dysfunction, as well as structural and/or functional arterial alterations during pregnancy, could be of value in recognizing and classifying the different hypertensive disorders of pregnancy . Hopefully, this will have a positive impact on the understanding of this syndrome, as well as on the appropriate and early management of these patients . Celermajer et al . 's technique, commonly known as flow - mediated dilation (fmd), utilizes the vascular (or vaso-) reactivity test (vrt) and has become the most popular method to assess ef . The vrt consists of positioning a pneumatic cuff around the upper arm and provoking an arterial occlusion for five minutes (transient ischemia, ti). This maneuver elicits an increase in blood flow in the brachial artery once the cuff is deflated (i.e., reactive hyperemia, rh), which subsequently stimulates endothelium to release nitric oxide (no). Finally, locally produced no results in a dilation of the brachial artery (assessed by b - mode ultrasound) and a reduction of arterial stiffness (changes in pulse wave velocity (pwv) assessed by mechanotransducers). The magnitude of the arterial dilation is used as an indicator of ef, and healthy pregnant women show an enhanced vascular response evaluated by this method compared with healthy nonpregnant women [9, 10]. Whereas fmd provides information about the recruitability of ef (i.e., its responsiveness to a specific stimulus), it does not provide information concerning basal / tonic ef (i.e., release of endothelial autacoids before fmd measures are initiated). In this context, gori et al . Described a novel index for assessing the response of the artery to low flow, which utilizes data obtained from the cuff occlusion period of an fmd test . Synonymous to fmd, the vasoconstriction observed under conditions of reduced flow has been named low - flow - mediated vasoconstriction (l - fmc). Inclusion of l - fmc data to traditional measurement of fmd could provide additional and/or complementary information, which, they propose, may improve the detection of patients with cardiovascular disease and profile the vascular response to exercise among healthy volunteers . Whether the integration of l - fmc into traditional fmd studies will provide additional / complementary information among patients with hypertensive disorders in pregnancy is unknown . In addition, changes in arterial stiffness assessed by means of carotid - to - radial pulse wave velocity (pwvcr) due to the same test (vrt) have been proposed as an alternative tool for the evaluation of ef [8, 14]. Pwv, in particular carotid - to - femoral pwv, is recognized as the gold standard parameter for the evaluation of regional aortic stiffness having a wide biomedical application . A reduction in pwvcr values (i.e., upper limb region) in response to vrt has been evidenced in healthy young adults, whereas a blunted reduction has been reported in pathophysiological circumstances such as hypertension and congestive heart failure . However, the impaired ef (which could follow hypertensive disorders of pregnancy) can be assessed by using pwvcr changes and if it provides additional or complementary information to those of brachial diameter assessment has not been studied yet . In this context, the aims of this work were as follows: firstly, to determine noninvasive central and peripheral arterial parameters in a group of healthy and hypertensive pregnant women, through the use of validated techniques and parameters; secondly, to determine and analyze basal and recruitable ef through the measurement of fmd, l - fmc, and pwvcr changes . The normotensive subjects (healthy pregnant women, hp; n = 10) were recruited from the routine antenatal clinic . Women with preeclampsia (pe; n = 8) and with gestational hypertension (gh; n = 8) were recruited from the antenatal hospital ward, where they were admitted due to mild hypertension (140/90 to 149/109 mmhg). The definitions used followed the classification of the gestational hypertensive disorders, as recommended by the report of the national collaborating centre for women's and children's health, hypertension in pregnancy, of the national institute for health and clinical excellence . Under this classification, pe was defined as bp greater than 140/90 mmhg on two consecutive occasions more than 4 h apart, in combination with significant proteinuria (> 300 mg total protein in a 24 h urine collection) developing after 20 weeks of gestation in previously normotensive women . All pe included in the study were mild in terms of the severity of the syndrome . Participants were asked to abstain from physical activity and vitamin supplementation for at least 4 hours prior to the examination . Baseline demographic data were obtained by an obstetrician during a clinical interview and laboratory samples were extracted prior to the examination . The study protocol was approved by the ethics research committee of the school of medicine (republic university, uruguay) and all participants gave written informed consent . After recompilation of clinical and laboratory data, subjects were instructed to lie in a left lateral position (to avoid vena cava compression by the uterus) in a temperature - controlled (2123c) room, for at least 15 minutes, in order to establish stable hemodynamic conditions . Heart rate (hr) and right brachial (peripheral) systolic and diastolic blood pressure (psbp and pdbp, resp .) Were measured using an oscillometric device (omron hem-433int oscillometric system; omron healthcare inc ., mean blood pressure (mbp) was derived from the standard equation usually employed at the peripheral level: mbp = pdbp + 1/3(psbp pdbp). The carotid - to - femoral pulse wave velocity (pwvcf) was measured to analyze aortic regional stiffness . To this end, carotid and femoral artery waveforms were consecutively obtained with a high - fidelity applanation tonometer from the carotid and femoral regions simultaneously with continuous ecg monitoring (sphygmocor 7.01, atcor medical, sydney, australia) (figure 1). Then, carotid - femoral propagation time (t3) was determined by subtracting the time delay between the peak of r wave of the ecg recording to femoral foot of the pressure waveform (t2) of the corresponding cardiac cycle and the time delay between the peaks of r wave to carotid foot of the pressure waveform (t1). The algorithm utilized to detect the so - called foot of the wave was the intersecting tangents . Straight distance between the recording sites (carotid - to - femoral distance (c - f x)) was then carefully measured using tape on the body surface to reduce the influence of altered body contour in pregnancy . Finally, pwvcf was automatically calculated as the quotient between c - f x and t3 (figure 1). The reported value of pwvcf for a subject was always the average of at least eight consecutive beats . Pulse wave analysis (pwa) was used to assess central hemodynamics as well as systemic arterial stiffness and wave reflections . For this purpose, mean radial artery waveform was obtained (through the acquisition of many cycles) with the applanation tonometer from the wrist, and a corresponding mean ascending aortic pressure waveform was generated with a validated generalized transfer function using the same mentioned customized software (sphygmocor 7.01, atcor medical, sydney, australia). The radial pulse waveform was then calibrated using the diastolic and mean arterial pressure obtained at the brachial artery . Central systolic, diastolic, and pulse blood pressure (csbp, cdbp, and cpp, resp . ), heart rate (hr) corrected central augmentation index (ap / cpp 100[%] heart rate adjusted to a hr of 75 bpm; aix@75), and amplification ratio (ppp / cpp) were determined with the integrated software . Ultrasound assessment of carotid arteries was based on the techniques and recommendations described in international consensus . High - resolution b - mode ultrasound images of both (right and left) common carotid arteries (ccas) were obtained using a 10 mhz linear - array transducer connected to a portable ultrasound system (sonosite, micromaxx, sonosite inc ., 21919 30th drive se, bothell, wa 98021, usa). Measurements (still images and video clips / cine loops) were digitally stored for off - line analysis (figure 1). Near and far walls were analyzed and images were obtained from anterior, lateral, and posterior angles . At first, a carotid plaque screening was performed, for which the definition used was a focal structure that encroaches into the arterial lumen of at least 0.5 mm or 50% of the surrounding intima - media thickness or demonstrated a thickness of greater than or equal to 1.5 mm . Then, longitudinal views of the ccas were acquired and a video (cine - loop) of at least 10 seconds was recorded and stored . The cimt and beat - to - beat diameter waveforms were obtained and analyzed off - line using a step - by - step border detection algorithm (based on changes in acoustic impedance (z)), applied to each digitized image (hemodyn-4 m software, buenos aires, argentina). A region of 1.0 cm proximal to the carotid bulb was identified, and the far wall cimt was determined as the distance between the lumen - intima and the media - adventitia interfaces (figure 1). The software performs multiple automated or semiautomated measurements along the centimeter and averages them, increasing the accuracy of the measures . The instantaneous diameter (from the leading edge of the near wall intima - media interface to the intima - media interface of the far wall) waveform then, complementary biomechanical parameters such as peterson's elastic modulus (ep) and beta stiffness - index () were calculated relating these measures with central blood pressure as follows:(1)ep = csbpcdbpsddd / dd,=lncsbp / cdbpsddd / dd, where csbp, cdbp, sd, and dd are central systolic and diastolic blood pressure and carotid systolic and diastolic diameter, respectively (figure 1). Ep measures the ability of the arteries to change their dimensions in response to the pulse pressure caused by cardiac pulsatile ejection (pressure change required for (theoretic) 100% increase in diameter), whereas is considered to be relatively independent of blood pressure levels . Once baseline noninvasive arterial evaluation was carried out, we utilized the theoretical basis, general protocol, and methodological aspects of the vrt recommended by the guidelines for the ultrasound assessment of endothelial - dependent flow - mediated vasodilation of the brachial artery [7, 18]. For this purpose, participants were submitted to five minutes of ischemia by occluding left radial and cubital arteries using a pneumatic cuff placed around the left forearm (just below the elbow to at least 50 mmhg above psbp) and several parameters of vascular reactivity were measured before, during, and after ischemia (figure 1). Accepted methodology for the evaluation of ef (recruitability) and simultaneously for pwvcr measurement (see later), left brachial artery was visualized longitudinally above the antecubital crease using same high - resolution b - mode ultrasound device mentioned earlier (sonosite; micromaxx; usa) (figure 1). Similarly, video sequences were recorded at rest, during forearm occlusion and after cuff deflation . Subsequently and similarly to the processing of carotid images, recordings were analyzed off - line using same automated step - by - step algorithm applied to each digitalized image that allows the brachial diameter waveform obtainment and fmd and l - fmc calculation . Brachial local stiffness (ep and) was also determined by relating brachial arterial pressure and brachial diameters, as was explained earlier for carotid measurements . Fmd was quantified as the percentage of change in brachial dd, considering the basal levels and those measured one minute after cuff deflation:(2)fmd%=ddafter cuff deflationddbaselineddbaseline100 . In addition, doppler signals were performed to acquire blood flow velocity in baseline conditions and at specific moments during the reactive hyperemia period . Doppler signals were used to obtain the brachial shear rate (and its percentage of change), relating mean blood flow velocity (vm (cm / s)) to brachial mean diameter (dm) according to the following equations:(3)sr = vmdm, sr%=sr after cuff deflationsr baselinesr baseline100 . Sr is an estimate of shear stress without accounting for blood viscosity and was obtained for the characterization of the endothelial stimulus . Noninvasive, carotid, and radial pressure waveforms were simultaneously obtained using strain gauge mechanotransducers (motorola mpx 2050, motorola inc ., corporate 1303 e. algonquin road, schaumburg, illinois 60196, usa) by placing them on the skin over the carotid and radial sites (left hemibody). Pwvcr was determined taking into account the given distance between these arterial sites (c - r x) and the time delay (t) between the carotid and radial waveforms onset (figure 1). The algorithm used for the detection of the foot waves was described and explained in previous work . Although a four - minute recording after cuff release was obtained, one minute after ischemia was the specific moment where the analysis was especially taken, according to previous reports [8, 16] (figure 2). Pwvcr levels corresponding to baseline and to postischemia period were determined by averaging eight consecutive beats . After that, percent of change of pwvcr (with respect to basal levels) was quantified as follows:(4)pwvcr%=pwvcrafter cuff deflationpwvcrbaselinepwvcrbaseline100.all structural and function arterial evaluations were done by the same trained operator . The statistical analyses were performed using the statistical package for social sciences (version 22.0). Normality of the distribution of the data was examined using the shapiro - wilk test and q - q plot . All data are presented as mean value (mv) standard deviation (sd). Two - way analysis of variance (anova) was employed for the evaluation of differences in variables within and between hypertensive and control pregnant women . Differences in percentage of change of variables determined before and after the vrt (arterial diameter, pwv, and shear rate) were evaluated using two - tailed paired student's t - test . Recordings were successfully obtained from all women and all studies were included in the analysis . The mean duration of the studies was 1 hour approximately and they were all well tolerated (without symptoms and/or complications). The mean gestational age at examination of all the pregnant women was 35 3 weeks . Significant proteinuria in the daily urine collection could divide the group of hypertensive pregnant women in those with preeclampsia (with significant proteinuria> 300 mg/24 hours, pe) and those with gestational hypertension (without or with only traces of proteinuria, gh). Maternal age, gestational age, and number of previous gestations were similar between study groups . Body weight and body mass index (bmi) were significantly higher in pe compared with hp and gh (p <0.05). Uric acid levels were within normal values in hp and gh, while in pe they were abnormally increased . Baseline peripheral sbp, dbp, and map levels were significantly higher in pe and gh in comparison with hp (p <0.001). No peripheral bp differences were found among groups with hypertension (gh versus pe). In addition, pe showed higher values of csbp compared with gh (p = 0.004), without differences in cpp and cdbp . When compared with hp women, levels of csbp and cdbp in women with pe and gh were higher . Aix@75 and the amplification ratio, two composite measures of systemic arterial stiffness and wave reflection amplitude, were analyzed and are presented in table 2 . Aix@75 was significantly higher in pe with respect to gh and hp (24.3 5.7% versus 11.8 7.6 and 12.2 12.4%, resp . No significant differences were found in this parameter between gh and hp . On the other hand, amplification ratio (cpp / ppp) was only statistically different between pe and gh, with pe having the lowest values . When analyzing muscular peripheral arteries (i.e., brachial artery) by local (ep and) and regional arterial stiffness parameters (pwvcr), no differences were found among groups . However, cca and aorta (i.e., elastic arteries) showed meaningful differences in stiffness . For example, right cca ep was significantly increased (duplicating approximately its values) in pe with respect to hp and gh (p <0.001 and p = 0.004, resp . ). Similar tendencies were noticed in from the right cca but not reaching statistical differences, indicating that changes in carotid artery stiffness in pe and gh are pressure - dependent . On the left side, differences were observed in ep comparing pe and hp, and similar tendencies were maintained for . Finally, hypertensive pregnant women showed higher values of pwvcf (regional aortic stiffness) compared with hp women . However, no differences were found between the groups with hypertension, although women with pe had a tendency to show higher values (p = 0.14). None of the groups (hp, gh, or pe) presented atherosclerotic plaques . Right, but not left, cimt was significantly elevated in pe with respect to hp women (p = 0.010). Taking into account the vrt (vascular reactivity test), all groups evoked endothelial stimulus (reactive hyperemia) evaluated by changes in shear rate before and after cuff deflation (p <0.001). In addition, peak sr and sr% were the same among groups (p = 0.86 and p = 0.39, resp .) (table 3). No significant changes were found in heart rate or blood pressure intra- and intergroup before and after cuff deflation, ensuring stable hemodynamic conditions during the maneuver (data not shown). Regarding the fmd, all of them showed a dilatation of the brachial artery with respect to the basal state but without statistical significance in women with pe . As was expected, hp women showed quantitatively the highest fmd response (9.4 3.0%; p <0.001), while women with gh and pe reached the lowest values (3.6 3.3%; p = 0.021; 2.2 2.9%; p = 0.081, resp . ). Fmd mean values of gh and pe compared to hp were significantly different (p <0.001). As was mentioned above one minute after the cuff deflation, pwvcr decreased only in hp (7.0 1.6 to 5.9 0.8 m / s, p <0.01). Gh showed a blunted hyperemic pwvcr response (7.1 0.9 to 7.0 0.8 m / s; p = 0.627), while pe showed a tendency to increase arterial stiffness (6.0 1.1 to 6.4 1.3 m / s; p = 0.06). Pwvcr percentage changes [pwvcr (%)] differed comparing hp women with women with gh (13.9% versus 0.9%; p <0.01) and with pe (13.9% versus + 7.0%; p <0.01). L - fmc of the brachial artery was different according to the pregnancy status (p <0.001). Maximal vasoconstriction (negative values) was observed in hp women (7.8 3.7%, p <0.001) followed by women with gh (4.5 2.1%, p <0.001), while women with pe did not reach significant arterial constriction during the cuff inflation (0.7 3.5; p = 0.576) (table 3). Demographic, anthropometric, and laboratory variables shown in table 1 did not significantly correlate with any of the arterial parameters . In addition, there was no significant correlation between parameters of ef (i.e., fmd, l - fmc, and pwvcr%) and aix@75 or amplification ratio (data not shown). However, a low but statistically significant correlation was found between baseline pwvcf and l - fmc (r = 0.45, p = 0.04), without reaching statistical significance with other ef parameters . A significant correlation between fmd, l - fmc, and pwvcr% was seen among these parameters in the whole study population (figure 3). The present study is, to our knowledge, the first one to determine and assess simultaneously, in a group of healthy and hypertensive pregnant women, the vascular reactivity or ef by using three different but complementary methods in conjunction with the determination of central and peripheral arterial structural and functional parameters . The main results of this work were as follows: (1) central aortic blood pressure and wave reflections as well as elastic (aortic and carotid) arteries stiffness are increased in pe, with respect to peripheral blood pressure - matched gh and hp, and (2) pe showed both resting (l - fmc) and recruitable (fmd and pwvcr%) endothelial dysfunction . Among the methods that allow measurement of vascular reactivity or ef in the clinical setting, fmd has rapidly gained popularity because of its simplicity, reproducibility, and noninvasiveness [7, 18]. However, as was mentioned earlier, one important limitation of fmd is that it only provides information about the recruitability of ef (i.e., its responsiveness to a specific stimulus) and not about concerning resting ef (i.e., release of endothelial autacoids before fmd measures are initiated). We here analyze in hypertensive pregnant women both types of functional aspects of ef: endothelial recruitability through fmd and pwvcr changes and resting endothelial tone through l - fmc . The magnitude of fmd observed in hp in response to vrt was similar to that described in previous reports [9, 10]. As it was expected, hypertensive pregnant women showed a reduction in fmd with respect to hp, in coherence with greater degrees of endothelial dysfunction [22, 23]. It is noteworthy that only pe did not reach statistical significance in the dilation of the brachial artery, obtaining a more complete blunted response . Although the fmd of pe was numerically lower than those from gh, this difference did not reach statistical significance . This could be attributed or not attributed to the magnitude of the standards deviation of the mean due to the low sample size . Therefore, the vascular profile from pregnant women with gh who might develop pe could be quite similar to those women with pe . However, there is a lack of information that compares fmd between groups with pe and gh and only few studies directly analyze this issue . According to quinton et al ., the fmd at one minute of the cuff deflation was not different between the gh and pe in women who were not receiving any medication, while there were statistical differences between these groups when women were receiving medical treatment . Nevertheless, in a prospective study conducted by filho et al ., they did not find differences in fmd of the brachial artery in patients with two different forms of hypertensive disorders of pregnancy . When analyzing changes in arterial stiffness due to vrt, hp showed the major reduction in pwvcr values . On the other hand, women with hypertension showed not only a blunted response in pwvcr changes but also, in pe, a tendency to increase arterial stiffness one minute after the cuff deflation was evidenced . Indeed, by means of this method, changes of pwvcr in pe tended to be higher in comparison to gh, indicating probably greater degree of impairment of ef . It is noteworthy that all participants showed the same increase in blood flow velocity with respect to basal conditions after cuff deflation (endothelial stimulus), and variables such as baseline levels of pwvcr, basal brachial diameter, blood pressure, and gestational age were similar among the groups . Taking into account resting endothelial tone, our results show that, during cuff inflation, brachial artery responses varied between the studied groups . L - fmc of the brachial artery was significant only in hp and gh, without any constriction in pe, suggesting that pe develop also basal endothelial dysfunction . Although l - fmc was firstly described and assessed at the radial artery, spiro et al . Evidenced later that this phenomenon also occurs in healthy subjects at the brachial artery and it can be measured reliably . Studies agree that radial artery vasoconstriction occurs during cuff inflation in nonpregnant women [12, 28, 29], whereas recent studies examining the brachial diameter during occlusion demonstrate conflicting results [27, 28, 3032]. Differences in cardiovascular profile, methodological issues, and interobserver variability could explain the widely variable results . L - fmc of the brachial artery in a regimen of low but not zero blood flow (as it occurs in the radial artery) in a level that is upstream of the occlusion site . Therefore, the magnitude of reduced blood flow in the brachial artery and its relationship with the basal levels (endothelial negative stimulus for vasoconstriction) should surely yield different brachial responses . As it was previously reported, we found that women with pe showed marked structural and functional alterations in peripheral and central hemodynamics [4, 3335]. Pe had a strong tendency to present higher values in practically all studied parameters related to central hemodynamics . For instance, central sbp, aix@75, cca ep, and pwvcf were significantly higher in pe with respect to hp . We also found differences in central hemodynamics between women with hypertension, but this was not the rule as it was for pe versus hp . Only csbp, aix@75, and right cca ep were markedly augmented in comparison to gh . These findings were not due to differences in peripheral blood pressure, which was elevated to a similar degree in both types of hypertensive states . These pieces of information analyzed together indicate that women with hypertensive disorders in pregnancy (mainly pe) have increased central bp overload, central arterial stiffness, and amount of wave reflections, probably related to a vasoconstriction state due to endothelial dysfunction . Altered central hemodynamics in pe may signify an inadequately increased left ventricle afterload and myocardial oxygen demand in the mother circulation, as well as hemodynamic disturbances transmitted to the fetal circulation . Blunted fmd, l - fmc, and pwvcr changes evidenced in pe are in consonance with the plasma uric acid levels that were found elevated only in this group . In previous reports, hyperuricemia was associated with an increase of plasma xanthine oxidase activity and/or a reduction in antioxidant systems related to increased formation of reactive oxygen species and endothelial dysfunction . Could reflect an associated overweight / obesity state, differences in na and body fluid retention by the hemodynamic overload due to the hypertensive condition, or a combination of both . Our results indicate that brachial artery responses to inflation and deflation of the cuff related to endothelial dynamics could share some vascular mechanism . However, there are confusing results around the fmd and l - fmc correlation, with variable results depending on the analyzed artery (brachial versus radial) and type of physiological or pathophysiological circumstance [1113, 27]. Although both l - fmc and fmd are an expression of the vascular reactivity in response to changes in blood flow, their relationship is neither conceptually simple nor mathematically linear . On the other hand, when analyzing the relationship between fmd and pwvcr the analysis can also be a little more complex . According to moens and korteweg equation, pwv is determined by arterial diameter and also by the elastic modulus . If post - vrt changes in pwvcr in pe and gh would have followed only the changes in brachial diameter (fmd), the obtained changes in pwvcr would have shown an equal behavior to the geometrical change (change in diameter). However, in accordance with the obtained values in the groups with hypertension, a dissociation among these variables was evidenced, with an increase of arterial diameter (which would reduce the levels of pwvcr) without significant changes in pwvcr levels (or even a trend to increase in pe) after the cuff deflation period . This discordance between parameters behavior in response to the vrt indicates an increase in the elastic modulus in parallel with changes in the arterial diameter . Thus, at least in pe, we evidenced a reciprocal and simultaneous change in the vascular wall intrinsic properties and the brachial diameter . An impaired response to changes in blood flow in a concrete vascular ledge (e.g., brachial artery), without simultaneous adequate change both in brachial diameter and in arterial stiffness, could have important hemodynamic consequences . At first, a reduction in the vasodilator reserve related to endothelial dysfunction as it was seen in other pathophysiological circumstances could implicate an incapacity of the arterial system to determine an appropriate vascular adjustment against hemodynamic changes in the long (fetal growth) and even in the short term (exercise, change of position, etc . ). Second, an impaired capability of response to hemodynamic changes due to endothelial dysfunction could yield other functional cardiovascular alterations that was seen in pe, like increased left ventricle afterload and diastolic dysfunction . This point is in consonance with altered values of central parameters found in pe mentioned above . The important additional information brought by introduction changes in pwvcr and l - fmc, together with the information of central and peripheral hemodynamics, is that these variables provide information concerning a different aspect of vascular reactivity and ef, therefore complementing (and not overlapping with) the information provided by fmd . This vascular approach may provide a more comprehensive assessment of vascular state and endothelial function in hypertensive disease of pregnancy . However, our findings were statistically significant and, by definition, this indicates that the study was adequately statistically powered . Our technical approaches including the use of both multiple automated and semiautomated edge - detection / point software in ultrasound image and pressure wave assessment are largely operator - independent and also empower our findings . Given the means of the different variables and sds observed in previous works and in the present sample, twenty - five subjects (n = 25) of the total sample size (the sum of the sizes of comparison groups) would be required to detect a statistically significant effect of the pregnancy status with at least 80% of power . There is no isolated technique which satisfies completely this purpose with enough accuracy . At the present time, different combinations of clinical risk factors, biochemical markers, and doppler ultrasound of the uterine arteries are recommended . The detection rate of pe using only one clinical model of screening that includes risk factors (e.g., nulliparity, maternal age, family history of pe, etc .) Is 45.3%, while only with doppler ultrasound of uterine arteries at the second trimester it is 63.1% and with a combined approach it reaches 67.5%, with a 25% of false positive rate . The clinical importance of improving detection of pe can also be stressed when confidential enquiries are analyzed, showing that in a substantial proportion of cases of fetal death due to preeclampsia a different management might have altered the outcome . Moreover, the evidence demonstrates that administration of antiplatelet agents (primarily low dose of aspirin in different trials) to well - selected women leads to a significant reduction in the risk of developing preeclampsia and its serious consequences . For these reasons, an accurate prediction of preeclampsia or early diagnosis may, therefore, allow more efficient allocation of resources for monitoring and improving maternal and perinatal outcomes [1, 2]. On the other hand, the extensive and growing information that links endothelial dysfunction / arterial damage with pathophysiology of pe motivates researchers and clinicians to evaluate arterial parameters (including endothelial function) in this clinical setting . Additionally, there is a need to count with a more comprehensive assessing ef in a patient in concrete . In that sense, the inclusion of validated arterial parameters and a more complete ef evaluation in the contemporary assessment of preeclampsia into multiparametric models could improve prediction of pe . In this small study, which addresses the feasibility of measuring these parameters simultaneously, simply, and noninvasively, we found encouraging results that we believe warrant further investigation in order to contribute to the early recognition of preeclampsia . This is the first study that measures and analyzes, in the same pregnant women, central and peripheral hemodynamics and ef by using different parameters that offer additional and complementary information . Resting and recruitable ef from pregnant women can be assessed by using pwvcr changes and l - fmc, respectively . Central aortic pressure and wave reflections as well as stiffness of elastic arteries are improperly increased in pe . Future studies will have to determine if incorporation of these pieces of information together, assessing basal state and functional reserve or capability of response of the vascular system into multiparametric models that include clinical, obstetric, and laboratory variables and doppler ultrasound of uterine arteries, will be able to improve contemporary prediction of preeclampsia (from healthy pregnancy and from gestational hypertension). Hopefully, this could change the clinical management and prognosis of the pregnant women with pe.
|
However studies have failed to establish a cause and effect relationship between barium retention in the appendix and subsequent development of the appendicitis . It is still not advisable to perform appendectomy in such circumstances without the evidence of an acute episode . We present one such patient who had features suggestive of right ureteric colic and presented with retained barium in the appendix . A 28 years old male attended our outdoor with an 8 days old x - ray film showing tubular radio - opacity in the right iliac fossa region . He had two episodes of severe pain right lower abdomen in past 2 months for which he underwent barium meal follow through . Although the report came out to be normal but again he had an episode of pain . This time x - ray abdomen was not completely normal and the patient came to our opd for advice . Daysevents0barium meal follow through study4x - ray abdomen for repeat episode of pain abdomen12presented to our opd with x - ray filmroutine blood investigations, repeat x - ray abdomen (fig . 2) done60x - ray abdomen - normal5 monthslost in follow up routine blood investigation were sent and found to be normal . Repeat x - ray abdomen confirmed that the findings were not an artifact (fig . 1). Ultrasound abdomen was advised to rule out abnormalities in right urinary system or some obvious bowel pathology . A contrast enhanced ct scan of the abdomen was then performed to rule out any bowel pathology especially in the appendix or near ileocaecal region . It concluded that the bowel was normal but there was a tiny right renal calculi . An x - ray of abdomen performed 7 days later, showed persistence of the radiographic opacity (fig . We concluded that this is a case of retained barium in appendix with recurrent right ureteric colic because of passage of renal calculi . Symptoms got relieved on conservative therapy and subsequent usg showed no calculi in renal system . The radio - opacity was not noticeable on x - ray abdomen, 2 months after barium study . Prophylactic appendectomy was not done in our case, and the patient did not developed signs of acute appendicitis till 5 months when he was lost in follow up . Daysevents0barium meal follow through study4x - ray abdomen for repeat episode of pain abdomen12presented to our opd with x - ray filmroutine blood investigations, repeat x - ray abdomen (fig . Repeat x - ray abdomen confirmed that the findings were not an artifact (fig . Ultrasound abdomen was advised to rule out abnormalities in right urinary system or some obvious bowel pathology . A contrast enhanced ct scan of the abdomen was then performed to rule out any bowel pathology especially in the appendix or near ileocaecal region . It concluded that the bowel was normal but there was a tiny right renal calculi . An x - ray of abdomen performed 7 days later, showed persistence of the radiographic opacity (fig . Based on above findings and investigation we concluded that this is a case of retained barium in appendix with recurrent right ureteric colic because of passage of renal calculi . Symptoms got relieved on conservative therapy and subsequent usg showed no calculi in renal system . The radio - opacity was not noticeable on x - ray abdomen, 2 months after barium study . Prophylactic appendectomy was not done in our case, and the patient did not developed signs of acute appendicitis till 5 months when he was lost in follow up . The appendix is visualized in 8090% of barium swallow or enema studies, and this is accepted as a reliable sign of a non - diseased appendix but post - examination only 10% of the patients retain barium in the appendix beyond 72 h. its prolonged retention in the appendix has been viewed as altered physiology or pathological . Although barium sulphate is inert and not harmful to the mucosa, cases have been reported where appendicitis developed long after barium studies and were tagged as barium induced appendicitis . Baroliths have been conclusively retrieved from appendectomy specimen, even after 3 months following barium study in patients with acute appendicitis . Despite these case reports studies have failed to prove the cause and effect relationship between barium study and acute appendicitis . Important in this regard is the work of maglinte et al . Who studied thirty - one patients with retained barium in the appendix for longer than 72 h and followed them for over 1 year . Based on above we conclude that the decision to perform appendectomy should be based on the diagnosis of acute appendicitis and that the prolonged retention of barium in the appendix is not an indication for surgery . In our case since no signs or symptoms were suggestive of acute appendicitis, the active search for other causes were made . Finding of small renal calculi in right kidney suggested that the etiology could be ureteric colic . If a person presents with retained barium in the appendix, no appendectomy should be performed in absence of findings suggestive of acute appendicitis . If atypical presentation is found, then they should be appropriately further investigated . Some unusual things like right ureteric colic (as in our case), written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Dr mithilesh kumar sinha: data collections, data analysis and writing, dr rajan kumar sinha: writing.
|
The analysis is based on food consumption data collected in nine european countries: denmark, finland, germany, ireland, italy, poland, spain, the netherlands, and united kingdom . The data were collected by an international life science institute (ilsi) europe expert group (9). The selected micronutrients are vitamin a, retinol, vitamin d, vitamin e, niacin, vitamin b6, folate, calcium, magnesium, iron, zinc, phosphorus, iodine, selenium, and copper . Data reflect intakes from natural sources plus mandatory fortification (practiced in denmark, ireland, and poland) other fortification and supplements are not included . The survey methods comprise seven - day records or diaries with estimated or weighed amounts of foods (denmark, ireland, italy, and uk) and 24 (poland) or 48-hour recall (finland, the netherlands, and spain). Germany used a modified diet history and the dutch and spanish recalls were supplied with semiquantitative food frequency questionnaires . The data from spain and the netherlands have been adjusted to correct for short registration period (9). National dietary surveys with information on year, methodology, survey size, and age range intake of nutrients was calculated using national food composition databases . The intake data provide data from four groups: children 410 years, children 1117 years, adult women, and adult men . The analytical process included steps 2 and 3 of the following four steps for each of the selected vitamins and minerals and for each selected gender and age group: calculation of mean intakes from each of the dietary surveys (an estimate of mean european intake).calculation of the ratio between the 95th percentile and mean intake in each survey.calculation of the average of the ratios.calculation of the common estimate for high intake as the product between steps 1 and 3 (an estimate of european 95th percentile intake). Calculation of mean intakes from each of the dietary surveys (an estimate of mean european intake). Calculation of the common estimate for high intake as the product between steps 1 and 3 (an estimate of european 95th percentile intake). Average ratios for each country and the overall average arranged in ascending order are shown in table 2 . The results show that for each nutrient the ratio has approximately the same value from one survey to another, implying that the ratio between high and average intake of micronutrients follows a regular pattern across countries and survey methods . The polish ratios are systematically higher than those of the other countries due to the short registration period, which causes a wider intake distribution . The spanish and to some extent also the dutch ratios are lower than the others probably because of adjustment of primary data . In the present analysis average of ratios (p95:mean intakes) from national dietary surveys in nine european countries intake is not reported . Note: the overall average is based on ratios from all gender and age groups, i.e. Normally four ratios from each country . Overall, the ratios can be divided into three categories: one category with overall ratios of the 95th percentile and mean intake between 1.48 and 1.58; this range in ratios is close to the energy ratio (1.45) and includes the nutrients: magnesium, phosphorus, zinc, iron, vitamin b6, niacin, and folate.another category has overall ratios in the range between 1.67 and 1.79 and includes the nutrients: calcium, selenium, vitamin e, iodine, and copper.a third category has overall ratios in the range of 2.072.32 and comprises the nutrients: vitamin a, vitamin d, and retinol.in table 3, ratios of energy and micronutrients for young and older children, and adult females and males are presented . Ratios for the group of young children tend to be slightly lower than the ratios for adults . The intake distributions of children aged 1117 years are wider and thus the ratios higher because of a wider range in energy requirements in this group . An exception from this tendency is the ratios of vitamin a, vitamin d, and retinol, which are lower than other group values . One category with overall ratios of the 95th percentile and mean intake between 1.48 and 1.58; this range in ratios is close to the energy ratio (1.45) and includes the nutrients: magnesium, phosphorus, zinc, iron, vitamin b6, niacin, and folate . Another category has overall ratios in the range between 1.67 and 1.79 and includes the nutrients: calcium, selenium, vitamin e, iodine, and copper . A third category has overall ratios in the range of 2.072.32 and comprises the nutrients: vitamin a, vitamin d, and retinol . Average of ratios (p95:mean intakes) from all counties divided into age and gender groups note: figures in parentheses are the number of countries contributing to the average . The results of the present study show that the ratio between high and mean intake for each micronutrient is fairly stable from one survey to another . The similarity occurs despite differences in dietary habits across countries and despite several differences of methodological nature (type of dietary survey, food composition data base, sampling procedure, etc . ). This similarity probably reflects the biological nature of eating and eating a variety of foods . We divided the ratios into three rough categories in an attempt to explain the findings . Since most nutrients are widely distributed in rather low concentrations in many foods, their ratios are close to the ratio between the 95th percentile and mean energy intake (category 1). In category 2, intakes still follow energy intake but the intake distribution may be influenced by a few foods, which are important nutrient sources and has a skewed intake distribution, e.g. Milk, which is the major source of calcium . The third category includes highly skewed intake distributions due to only a few significant food sources of the micronutrient in question . This effect may explain why the ratios for vitamin a, retinol, and vitamin d are lower among the children aged 1117 years than the three other groups, probably reflecting that most teenagers dislike fish, liver, and carrots foods very rich in these nutrients . The only identifiable factors clearly affecting the ratios are the length of registration period and modification of primary data . Because of the pragmatic purpose of this study and because excluding, i.e. Polish data does not change the overall ratios much, we decided to accept all survey results . The reason for this was the assumption that most underreporters are individuals found in the lower end of the intake distribution (i.e. Below mean intake) and that the pattern of underreporting is the same in all populations . If the intakes of underreporters were increased to true levels, the intake distribution would be narrowed probably without any significant increase in levels of high intakes . This means that the mean values will increase and the ratio p95/mean will be reduced . The final product between the overall higher mean and lower ratio will be approximately unchanged . We are fully aware of the limitations of the applied procedure where we used aggregated micronutrient data . With access to the individual data from each country but even if the calculations are not mathematically (statistically) correct they will still create an estimate of high intake, which is sufficiently valid for the purpose of the present study . The uncertainty is hardly any larger than that of results from any of the single surveys . One could argue that simply calculating the average of 95th percentiles would be a more simple and direct way to a common estimate of high intake . This is true and the results would probably be close to the results calculated via the ratios . Another argument against the present approach is the use of mean instead of median values . But using the ratio between 95th percentile and median did not change the final results (results not shown) and since it is important to find figures that will satisfy all member states in the eu, we suggest the use of mean values instead of median values . Using the present method makes it possible to include mean intake estimates from dietary surveys that are not able to describe the intake distribution . This will allow us to use data from all or at least most european countries and thus increase the acceptability of the results across all eu member states . Flynn et al . (4) used a different approach in their model for calculating safe additions to foods . They expressed in each survey the high intakes (9097.5th percentiles) as multiples of recommended intakes and used the mean of these multiples as a representative value . However, this method does not allow use of results from surveys giving only mean intakes . Unfortunately the ilsi study does not provide data for all nutrients but we assume that the remaining vitamins and minerals will fit into a similar pattern . It still has to be shown based on dietary intake data whether this assumption is true, before the proposed model for calculating common european estimates for high intakes of all vitamins and mineral can be implemented in administrative practice . The average ratio of the 95th percentile and the mean intakes of energy and micronutrients from foods show a remarkable similarity across countries and age groups . For each nutrient it is possible based on dietary surveys from different countries to calculate a representative european average . The average ratio of the 95th percentile and the mean intakes is a simple and suitable measure for calculation of an estimate of high intake from an estimated average intake by the four steps described in the methods section . It is possible to include mean intake estimates from dietary surveys, which are not able to describe the intake distribution . The authors declare that they have no conflict of interest and have received no funding for the present paper.
|
Keratoconus is a progressive noninflammatory thinning disorder of the cornea leading to a decrease in visual acuity as a result of myopia and irregular astigmatism [1, 2]. Corneal collagen cross - linking (cxl) can effectively halt the progression of the disease, but visual acuity following cxl remains poor . In patients intolerant to rigid gas permeable contact lenses after corneal cxl, additional interventions are often necessary to improve their vision [1, 2]. Many visual rehabilitation options are available to manage keratoconus including intracorneal ring segment implantation (icrs), phakic intraocular lenses (piol), and photorefractive keratectomy (prk) and all can be combined with cxl [36]. In patients with poor best - corrected visual acuity icrs implantation the prk is used to correct mild refraction error [3, 4], while the piol's are used to correct moderate to severe ametropia in patient with good best - corrected visual acuity [5, 6]. Our study group recently published the 6-month data on the safety and efficacy of cxl followed by insertion of a phakic toric implantable collamer lens (icl) (visian toric v4 icl; staar surgical, monrovia, ca) in the posterior chamber for correction of myopia and astigmatism in patients with keratoconus . In this paper, we report the long - term safety and efficacy of sequential cxl, then icl implantation, separated by 6 months, in a larger cohort of patients with moderate to severe keratoconus with moderate to severe myopia and astigmatism, and good best - corrected visual acuity . This was a retrospective study of patients with keratoconus who underwent sequential cxl - icl procedure between december 2010 and march 2012 at the beirut eye specialist hospital (besh), beirut, lebanon . This study was approved by the institutional review board at besh and complied with the declaration of helsinki . All patients signed an informed consent prior to treatment and all surgical procedures were performed by one surgeon (e.j). Jarade's protocol were included if they had a preoperative best - correct visual acuity better than 20/40, were hard contact lens intolerant (defined as a comfortable wearing time of less than 8 hours per day), had an endothelial count> 2,200 cells / mm (noncon robo, konan medical), had history of progressive keratoconus in one or both eyes (defined as an increase in maximum keratometry of 1.00 diopter (d) or more in 1 year and/or the need for new contact lens fitting more than once in the previous 2 years), and did not have any corneal surgery (including prk and icrs) before or after the cxl and icl implantation . Patients were considered eligible for icl implantation after cxl only if the keratoconus was considered stable (defined as subjective refractions [5, 9, 10] within 0.50 d of spherical equivalent at 4 and 6 months postoperatively and was most of the time equivalent to the refraction prior to cxl). The exclusion criteria for enrollment in this study (those who could not undergo the cxl and phakic iol procedures consecutively) were central corneal thickness of less than 450 m (measured by optical pachymetry (pentacam; oculus optikgerate gmbh, wetzlar, germany)), mean k reading> 56.00, endothelial cell count of less than 2,000 cells / mm measured on the central part of the cornea by specular microscopy, anterior chamber depth of <2.8 mm from endothelium to anterior capsule measured by pentacam (oculus optikgerate gmbh, wetzlar, germany), corneal opacification or scars, history of keratitis (any form), peripheral marginal degeneration, previous corneal and/or intraocular surgeries, and autoimmune and/or connective tissue disease . The central corneal thickness limit of 450 m would account for around 400 m of remaining stromal thickness after removal of the epithelium, which is considered as the safety thickness for the residual stroma to avoid endothelial cell damage during the cxl procedure . The criteria for diagnosing keratoconus were based on a combination of computed slit - scanning videokeratography of the anterior and posterior corneal surfaces, keratometric readings, and corneal pachymetry [1316]. Keratoconus was classified, according to the amsler - krumeich criteria, into four stages based on corneal power, thickness, transparency, and astigmatism . Contact lens use was discontinued for at least 3 weeks for rigid lenses and 1 week for soft lenses prior to any ophthalmic examination, investigation, and treatment . It included uncorrected distance visual acuity (udva), corrected distance visual acuity (cdva), manifest and cycloplegic refractions, anterior and posterior segments evaluation with dilated fundus examination, and keratometric evaluation . Since the autorefractometer results of refraction are not always accurate in keratoconus and after both cxl procedures, all refractions were based on refined refraction using trial lenses, and the axis of astigmatism was chosen according to the best visual acuity obtained while rotating the astigmatism trial axis . Follow - up examinations were scheduled at baseline and at 1, 3, 6, and 12 months and every 6 months thereafter . The eye to be treated was anesthetized by applying proparacaine hydrochloride 0.5% drops on three occasions at 5-minute intervals . After positioning the patient under the operating microscope, an eyelid speculum was inserted and the central 9 mm corneal epithelium was removed with a blunt spatula . A mixed riboflavin 0.1%20% dextran solution was instilled every 5 minutes until the riboflavin penetrated the cornea (i.e., approximately 30 minutes). The ultraviolet lamp (uv - x illumination system, version 1000; iroc ag, zurich, switzerland) was then focused on the apex of the cornea at a distance of 5 cm for a total of 30 minutes, providing a radiant energy of 3.0 0.3 mw / cm . The required irradiance of 3.0 mw / cm was calibrated prior to each treatment using an ultraviolet a meter (lasermate - q; laser 2000, wessling, germany). During ultraviolet a administration, the cross - linking procedure adopted in our study is in accordance with the standard dresden protocol, which has been shown to result in absorption limited to the anterior two - thirds (200400 m) of the stroma as demonstrated by stress - strain measurements, thermomechanical measurements, and swelling studies . Thinnest and central corneal thickness were continuously monitored (sonogage pachymeter; sonogage, inc ., cleveland, oh) to ensure that neither of the two parameters dropped below 400 m . After treatment, the eye surface was washed with balanced salt solution and two drops of gatifloxacin 0.3% were instilled, followed by placement of a bandage soft contact lens . Postoperatively, patients received acetaminophen 500 mg twice daily for 3 days, one drop of gatifloxacin 0.3% six times daily for 7 days with one drop of tobramycin - dexamethasone 0.1% four times daily for 10 days, and one drop of loteprednol 0.5% five times daily, slowly tapered over 5 weeks . The bandage soft contact lens was removed on postoperative day 4 and the eye examined by slit - lamp microscopy to confirm complete corneal epithelialization . Complete assessment was performed 1 and 6 months postoperatively and included udva, cdva, refraction, and anterior / posterior topography . No further progression of keratoconus was noted in any eyes throughout the 6 months of follow - up period . The appropriate icl size was determined based on the horizontal white - to - white distance measured manually with a caliper, and the anterior chamber depth was measured with the pentacam . A minor clinical adjustment of anterior chamber depth was performed by subtracting no more than 0.2 mm whenever corneal anterior bulging was advanced . Regarding the inaccuracy of the autorefractometer in predicting the k - reading in many keratoconus cases and to obtain accurate icl choice using the online icl calculator software, adjustment of extreme values of k readings obtained by autorefractometer was performed by attenuating the k - reading values to reflect the magnitude of astigmatism obtained by manifest refraction and the chosen axis of astigmatism was always the axis obtained by manifest refraction . The pupil was dilated with cyclopentolate and phenylephrine drops, instilled 30 minutes prior to surgery, and the horizontal axis was marked by the surgeon with the patient upright to control for cyclotorsion . A 3.2 mm clear corneal tunnel incision was performed in the horizontal temporal meridian (regardless of the astigmatism axis). The icl was inserted in the posterior chamber through the incision using the injector cartridge supplied by the manufacturer . After the icl was gently positioned in the sulcus with the axis properly aligned, the remaining viscoelastic material was completely washed out of the anterior chamber with balanced salt solution and a miotic agent was instilled . Tobramycin - dexamethasone 0.1% eye drops were used four times a day for 10 days and then slowly tapered over 3 weeks . Descriptive statistics were reported as mean and standard deviation for continuous variables . Repeated - measures analysis with the bonferroni test for post hoc analysis and the wilcoxon signed rank test were computed . The study included 30 eyes of 19 patients, among those 13 males and 6 females . Mean age was 30.44 8.14 years (range: 20 to 45 years). Mean follow - up was 16 5.75 months; all patients (100%) had complete follow - up from baseline up to 12 months after icl implantation; only 10 (33%) eyes of 10 patients had 24 months of follow - up . The visian toric icl was implanted in all eyes; 11 patients underwent bilateral implantation while the remaining 8 patients had unilateral icl implantation . Preoperative mean spherical power was 8.37 3.89 d (range: 20.5 to 4 d) and mean cylindrical power 2.95 1.40 d (range: 1 to 5.25 d). According to the amsler - krumeich classification, 6 eyes had stage i, 14 eyes had stage ii, and 10 eyes had stage iii keratoconus at baseline . Among the eyes that completed the 24 months of follow - up after icl implantation, 6/10 had stage i, 2/10 had stage ii, and 3/10 had stage iii keratoconus at baseline . The preoperative values were compared to values starting 6 months after cxl, because visual acuity and corneal keratometry vary significantly in the first few months after cxl . According to table 1, both udva and cdva values at 6 months after cxl did not differ from baseline (p = 1.000 and 0.231, resp . ). At 6 months after icl implantation, there was significant improvement in mean udva from 1.57 logmar to 0.17 logmar (p <0.001) and mild improvement in cdva from 0.17 logmar to 0.11 logmar (p <0.001). Both cdva and udva remained stable thereafter up to 24 months (tables 1 and 2). No eye lost 2 or more lines in cdva in the study (figure 1). At 12 months, 43% (13 of 30) of eyes gained 1 line in cdva, and in the smaller subset of eyes with 24 months follow - up 60% of eyes gained 1 line in cdva . Overall, 60% (18 of 30) and 50% (5 of 10) of eyes had udva of 20/30 or better 12 months and 24 months after icl implantation, respectively . At 6 months after cxl, the small changes in se and the spherical component of refraction were not significant from baseline (p = 0.611 and 1.000, resp . ), unlike the mean change of 0.21 d in cylindrical component (p = 0.012) (table 1). However, the changes in se, sphere power and cylindrical power at 6 months after icl implantation were all clinically and statistically significant from baseline and their values remained relatively stable up to 12 months (table 1). However, in the smaller subset of 10 eyes with 24 months of follow - up (table 2), small hyperopic shifts of 0.25 d in se (p = 0.012) and 0.20 d in spherical power (p = 0.005) were noted after 6 months after icl visit . Overall, 63.3% and 40% of eyes were within 1.0 d se at 12 and 24 months after icl implantation, respectively (figure 2). All keratometric values showed a gradual decrease after cxl, up to the 24 months of follow - up . According to table 1, the decrease in mean k (flat) from baseline became statistically significant 6 months after icl implantation, while the decreases in mean k (steep) and mean k (max) from baseline were statistically significant starting 6 months after cxl . Overall, the safety index = [mean postoperative cdva (logmar)/mean preoperative cdva (logmar)] at 12 months and 24 months after icl implantation was 0.73 0.29 and 0.72 0.25, respectively . The efficacy index = [mean postoperative udva (logmar)/mean preoperative cdva (logmar)] at 12 months and 24 months after icl implantation was 1.03 0.26 and 1.04 0.26, respectively (figure 3). All epithelial defects healed within 4 days after cxl . In this study, none of the patients had infectious keratitis, lens rotation, vaulting problem, cataract formation, pigment dispersion, or pupillary block . Also, none had development of clinically significant haze at any of the follow - up periods . There was, however, a transient increase of intraocular pressure that was observed in most patients during the first week after icl implantation that was controlled with topical drops . Providing optimal refractive and vision results to patients with progressive keratoconus remains challenging to the refractive surgeon . While corneal collagen cross - linking (cxl) can halt progressive disease, patients with high refractive error and poor vision at baseline would remain so, after cxl, even without keratoconus progression [10, 18, 19]. Therefore, cxl is used to set the stage for other interventions to be performed . Management after cxl is tailored according to the patient's best - corrected visual acuity and refractive status . In patients with good - best corrected visual acuity and high residual refractive error after cxl, piol implantation provides adequate correction of ametropia . Several types of toric piol were reported to be effective and safe in eyes with keratoconus, but only a handful of studies have evaluated their use following a cxl procedure [6, 9, 10, 18, 2024]. The visian toric icl has demonstrated good efficacy and safety profiles for the correction of high ametropia in patients without keratoconus [2532]. In our previous study, toric icl implantation 6 months after cxl was proven to be an effective and safe method of improving visual acuity and refraction in selected eyes with moderate to severe keratoconus . In this paper, we assess the long - term (up to 24 months) safety and efficacy of that same procedure in 30 eyes with mild - to - moderate progressive keratoconus . Stability of keratoconus following cxl in preparation for icl implantation has been previously defined using stability of refraction data [5, 9, 10]. As such, icl implantation was performed 6 months after cxl, since most patients had a stable visual acuity and manifest refraction by 4 months . This flattening was not significant enough to alter the mean se manifest refraction at the time of icl implantation, or the outcome of the icl procedure at 12 months . In the small subset of 10 eyes with 24 months of follow - up, the small hyperopic shift in se might have resulted from the continuous flattening in k readings; however, the change did not affect vision . The continuous flattening in k readings and its effect on se is most likely due to the effect of cxl . It is unlikely that the 3.2 mm clear corneal incision at the time of icl implantation (surgically induced astigmatism) would have contributed to the change in se; the incisions were placed at the temporal site according to the surgeon's preference, regardless of the axis of manifest astigmatism . Another possible yet unlikely culprit of the change in se is the rotation of the toric visian icl with loss in the refractive corrective effect . Although possible, the effect of a rotation on refraction and visual acuity would have been uncovered earlier, and all our patients were happy with the end - result . After stabilization of keratoconus with cxl and icl implantation, 60% (18 of 30) and 50% (5 of 10) of eyes had udva of 20/30 or better at 12 months and 24 months, respectively . Results of our study compare favorably to other reports in terms of gain in udva and cdva [9, 10, 21], as reflected by the safety and efficacy indices . In our study, the slight myopic se refraction at post - icl implantation was related to 2 factors . First, there is no way to customize the icl to exactly fit the patient's refraction, and in most cases we had to use what was available (undershoot the target refraction of plano). Second, one patient had a high refractive power that exceeds the capacity of the icl (which is limited to 18.0 d of manifest refraction at the eyeglasses plane). Only 2 other studies have evaluated the safety and efficacy of visian toric icl following cxl [6, 10]. Both kymionis et al . And shafik shaheen et al . In a case report published encouraging results of this procedure; at 3 months, udva improved from counting fingers to 20/40 and cdva improved from 20/100 to 20/30 . Shafik shaheen et al ., in a case series of 16 eyes with early - stage (undefined) keratoconus, showed a favorable outcome in terms of visual acuity and se at 3 years of follow - up; mean cdva improved from 20/35 to 20/22, mean udva improving to 20/23 and mean se improving from 8.5 d to 0.25 d. in our previous study on mild to severe keratoconus, the 6-month results revealed that mean cdva improved from 0.15 logmar to 0.12 logmar, mean udva decreased from 1.67 logmar to 0.15 logmar, and mean se decreased to 0.89 d with no complication . Izquierdo jr et al . Employed the iris - fixated artiflex phakic iol (ophtec, usa) in 11 eyes with progressive keratoconus . Results were favorable in terms of visual acuity, sphere, and cylinder at 12 months . Employed the toric artiflex / artisan phakic iol in 17 keratoconic eyes; at 24 months, 14 eyes were within 0.50 d of the attempted se correction and 13 eyes were within 1.00 d of the attempted cylinder correction . Icl implantation after cxl depends on the stability of keratoconus (both refraction and keratometry) since progression would lead to refractive changes and drop of visual acuity . A continuous flattening in k readings after cxl occurred in our study with no significant effect on se, udva, nor cdva at 1 year; in the smaller subset of 10 eyes a statistically but nonclinically significant change in se was observed following cxl at the 2-year follow - up, but both udva and cdva were not affected . Although we do believe that a longer time interval would possibly show a greater change in keratometry, we are still uncertain whether an equivalent amount of change in refractive error would accompany this flattening, possibly related to the altered biomechanics of cross - linked corneas . As demonstrated in our results, the change in keratometry did not significantly alter the se and more importantly did not alter the udva and cdva . The small hyperopic shift observed in our study deserves further investigation with long - term studies to assess its long - term impact on vision, but it does not warrant delaying icl implantation . The continuous flattening effect of cxl with the accompanying risk for a hyperopic shift can last more than 2 years [35, 36]; therefore, targeting mild undercorrection rather than delaying the icl implantation for 12 months would improve predictability and may be a solution . Moreover, implanting an icl at 6 months as opposed to 12 months offers the patient the benefit of earlier functional visual recovery . In conclusion, the results of toric icl implantation 6 months after cxl at 1 year and at 2 years compare to the outcomes at 6 months in a previous study; it is an effective and safe method of improving visual acuity and refraction in keratoconus eyes with high myopia and astigmatism and good best corrected visual acuity.
|
Ternary boron carbonitride (b c n) nanotubes have recently attracted much attention because of their excellent mechanical properties, electrical properties, and anti - oxidant capacities . In addition, theoretical studies have revealed that the band gaps of b c n nanotubes can be tailored over a wide range by simply varying the chemical composition rather than by geometrical structure [3 - 7], which is superior to their carbon and boron nitride (bn) counterparts . This gives b c n nanotubes potential for use in electronics, electrical conductors, high temperature lubricants, and novel composites . Compared with the very extensive study about carbon and bn nanotubes, however, very little work was reported about b n nanotubes in 1994, several methods have been devoted to the synthesis of b c n nanotubes, such as arc - discharge, laser ablation, chemical vapor deposition (cvd), template route, and pyrolysis techniques . Particularly, single - walled b n nanotubes have been recently synthesized by wang et al . Via a bias - assisted hot - filament method . However, most of them usually used risky reagents such as diborane (b2h2)/ammonia (nh3), or produced nanotubes with low purity and high - cost and encountered the phase separation problem of bn and c. thus, it is of great significance to explore novel and simple routes to prepare b the current work reports a relatively safe and effective approach for growing high - purity b c n nanotubes directly on commercial stainless steel foil, by using simple raw materials of boron, zinc oxide (zno), and ethanol absolute . The reaction of boron and zno at high temperature produces boron oxide vapor that is the source of b, while ethanol absolute and nitrogen provide the source of c and n, respectively . It is interesting that the stainless steel foil is not only the support substrate but also the catalyst for the growth of the nanotubes . The obtained nanotubes have an average diameter of about 90 nm and the b, c, and n elements are found to be homogeneously distributed in the nanotubes . The growth mechanism of the nanotubes is also investigated in this study . To the best of our knowledge, it is the first time to report the synthesis of ternary b the growth of nanotubes was carried out in a conventional tube furnace . An alumina boat loaded with about 1.0 g mixture of hexagonal zno and amorphous b powder (with a zno: b molar ratio of 1.5:1) commercial stainless steel-304 foil with a thickness of 0.05 mm was inserted into the quartz tube as the substrate . Prior to heating, the chamber was flushed with high - purity n2flow to eliminate the residual air . Then the furnace was heated to 1150 c under a mixture gas flow of n2(60 ml min) and h2(40 ml min). Ethanol absolute (ar grade) was introduced into the chamber when the furnace temperature reached at 1150 c, which was carried by another n2flow with a rate of 20 ml min . Finally, the furnace was cooled naturally to ambient temperature under the protection of n2flow . After taken from the furnace, the stainless steel substrate was found to be covered with white gray deposit in the temperature range of 10001100 c . The product was characterized by field - emission scanning electron microscopy (fe - sem, hitachi s5500), high - resolution transmission microscopy (hrtem, jem-2010f), x - ray energy dispersive spectrometer (eds), and electron energy loss spectroscopy (eels), respectively . Figure 1shows the sem images of the product grown on the surface of stainless steel substrate . 1a) indicates a high production of one - dimensional (1d) nanostructures was synthesized . 1a is a high - magnification cross - sectional image of some 1d nanostructures, illustrating the hollow structure of the product . Figure 1b clearly reveals that the nanotubes are shaped in bamboo consisting of a number of compartments . The surfaces of the nanotubes are very clean and no impurities can be observed, which indicates the high purity of the nanotubes . The diameters of the nanotubes are approximately 60120 nm, with an average value of about 90 nm . Furthermore, it can also be found that nanoparticles are attached at the ends of nanotubes, which could be regarded as a typical symbol of vapor liquid solid (vls) growth model . Figure 1c and d are the secondary electron and back scattering electron (bse) images of the same area of the product . It can be seen that the attached particles (bright particles) are distinguished clearly in the bse image, which further confirms the vls growth mechanism of the nanotubes . Alow - magnification sem image of the product, showing the large quantity of the 1d product grown on the stainless steel substrate . The inset is the high - magnification cross - sectional image of some nanotubes, illustrating the hollow structure.bhigh-magnification image ofa, indicating the bamboo - like structure and high purity of the nanotubes.canddthe secondary electron and back scattering electronic (bse) sem images of the same area of the product the tem images of the product are shown in fig . The bamboo structure of the nanotubes with clean surface and uniform diameter along the nanotube length can be clearly seen (fig . 2a is the edx result, which shows the dominating peaks of b, c, and n with a low level of o, cu, and si . The existence of cu peak should be caused by the copper tem grid, while the si peak might come from the stainless steel substrate . Furthermore, quantitative analysis gives the b: c: n atomic ratio of about 0.45:0.31:0.24 . N nanotubes . In figure 2b, a particle attached at the end of the nanotube the edx spectrum indicates that the particle is mainly composed of fe with a small amount of ni, cr, cu, and c (inset in fig ., the cu and c peaks should come from the carbon film - coated copper grid . While the existence of fe, ni, and cr in the particle should originate from the stainless steel substrate . Hence, we believe that the stainless steel substrate play a catalyst role during the vls growth of the nanotubes . Atem image of a nanotube . The inset is the edx spectrum of the nanotube.btem image shows a catalyst particle attached at the end of a nanotube . The inset is the edx spectrum of the particle figure 3a shows the hrtem image of the edge part of the nanotube wall . It can be seen that the lattice fringes are well - defined, which suggests that the nanotube wall has a high degree of crystalline perfection . The interlayer spacing is approximately 0.348 nm, corresponding to the (002) plane of hexagonal system of b c n crystal (jcpds no . 35 - 1292). The spots in the fast fourier - transformed ed (fft ed) pattern can be indexed as the (002) basal planes of the b figure 3b is the hrtem image of the joint, showing the tight connection between nanotube wall and compartment . The compartment is also well - crystallized with the identical lattice spacing of about 0.343 nm, which also corresponds to the (002) plane of b c n crystal . The fft ed pattern (inset in fig . 3b) is also indexed as the (002) planes of b c n crystal . Figure 3c shows a representative eels spectrum taken from a segment of the nanotube wall, which demonstrates that the distinct absorption peaks of b, c, and n characteristic k - edges at 188, 201, and 401 ev, respectively . The k - edge signals show a discernible * peak, as well as an * band, indicating that the b, c, and n atoms are in the sp - hybridized state . The eels spectrum of the compartment shown in fig . 3d also indicates the distinct absorption features of k - edges of b, c, and n atoms . Furthermore, the elemental maps reveal that b, c, and n elements are homogeneously distributed in the nanotube (fig . Therefore, it can be concluded that the product is composed of ternary compound b ahrtem image of nanotube wall and the corresponding fft ed pattern (inset).bhrtem image of a joint between the wall and compartment and the corresponding fft ed pattern (inset).canddeels spectra taken from the nanotube wall and the compartment, respectively, revealing the dominating composition of b, c, and n elements in the wall and compartment elemental maps of a nanotube, implying the uniform distribution of the b, c, and n species in the nanotube as described above, a simple approach to synthesize b c n nanotubes was proposed by involving an additional role of catalyst of the stainless steel substrate . And based on the above results, vls model is believed to be responsible for the growth of the current nanotubes . Similar to the literatures reported about bn nanotubes and nanowires [17 - 19], fig . Firstly, the reaction of b and zno generates zn and boron oxide (b2o2) vapor at high temperature (1150 c). Meanwhile, the surface of the stainless steel may partially melt at this temperature assisted by the erosion of n2 and h2 . And thus liquid alloy droplets with main composition of fe cr ni are formed on the surface, as are verified by the edx result . Then the liquid droplets adsorb the growth species from the surrounding vapors of b2o2, c2h5oh, n2, and h2 (fig . 5a). The involving species of b and c could lead to the further decrease of the melting temperature of stainless steel and promotes the formation of liquid droplets . The reactions among these vapors produce b / c / n atoms, which diffuse through fe cr ni alloy droplets . When the concentrations of species are greater than the saturation threshold, b n crystals begin to precipitate and initially form the cap on the liquid droplets, as is shown in fig ., the cap will be lift from the droplet due to the stress under the curvature and then the hollow tip forms . At the same time, due to the diffusion of b / c / n atoms through the surface and bulk, the b when the nanotube wall grows, the b / c / n atoms also precipitate inside the nanotube and result in the formation of compartment layer . The compartment layers connect with the wall and grow together for a period, and finally depart from the droplet due to the stress accumulated under the curved compartment layers (fig . Moreover, the flowing character of b2o2, c2h5oh, n2, and h2 vapors could lower their partial pressures in the chamber, which is also favorable for the formation of 1d nanotubes . It should be noted that the produced zn vapor is transported by the carrier gas to a much lower temperature zone (below the melting point of zn), where it deposits on the substrate in the form of zn products . In addition, it is found that the hydrogen in the mixture gas is essential for the growth of b c n nanotubes . If only pure n2 flow is introduced, no b n nanotubes can be obtained, adding weight to the proposed mechanism and suggesting that hydrogen plays an important role during the growth of the b n nanotubes directly onto commercial stainless steel foil is demonstrated by using raw materials of boron powder, zinc oxide powder, and ethanol absolute . The nanotubes are pure with bamboo - like morphology and an average diameter of about 90 nm . During the formation process, the stainless steel foil plays a catalyst role additionally besides the substrate role for the b the authors acknowledge financial support from the national natural science foundation of china (nsfc, grant no . 208106), tsinghua university state key laboratory of new ceramics & fine processing and guangxi university (grant no.
|
The strength of the knee extensor and flexor muscles has been extensively studied and is a relevant clinical indicator of health status and functional capacity in coronary artery disease8, neuromuscular diseases9, the elderly10, renal disease11, and fibromyalgia12 . In sports medicine, knee extensor and flexor muscle strength is often monitored with the aim of preventing or treating orthopedic as well as muscular injuries13,14,15,16,17,18,19 . Therefore, practitioners need to have reliable tools for easy and reproducible assessment of muscle strength . The isokinetic concept of exercise20 is currently considered the best method for the assessment of knee extensor and flexor strength because of its well - established validity and reproducibility21,22,23,24,25 . However, the acquisition and maintenance costs, the time required to perform an isokinetic assessment, as well as the absence of portability of isokinetic dynamometers can limit their use . Conversely, hand - held dynamometers (hhd) are characterized by specific features such as low cost, portable design, and rapid data acquisition . An hhd provides reliable and reproducible results when used for the evaluation of muscle groups that produce little or moderate amounts of force . However, the results obtained for strong muscles, such as the knee extensors, are less convincing26,27,28 . A systematic review comparing muscle strength assessment by hhd and isokinetic testing29 showed a positive correlation between these methods . However, the heterogeneity of the protocols and devices evaluated made the interpretation of the results difficult . Therefore, the aim of this study was to: 1) assess the validity of hhd vs. isokinetic dynamometry in the evaluation of knee extensor and flexor muscle strength, 2) establish the reproducibility of hhd measurements of knee extensor and flexor muscle strength, and 3) compare the flexor / extensor ratios obtained with the 2 methods . The study was carried out at the muscle evaluation unit at the clemenceau rehabilitation university institute (strasbourg, france) and involved 30 healthy volunteers (table 1table 1.characteristics of the population (n=30)mean sdrangeage (years)32.8 11.52059height (cm)176.9 10.3160197weight (kg)74.5 15.852109gendermales (n=20)females (n=10)lateralityright (n=27)left (n=3)test sequence iso then hhd (n=16)hhd then iso (n=14)iso: isokinetic dynamometer; hhd: hand - held dynamometer). Iso: isokinetic dynamometer; hhd: hand - held dynamometer subjects were recruited by means of advertisement in the university network from january 2015 to november 2015 . Inclusion criteria were as follows: age older than 18 years, and without cardiovascular disorders, osteoarticular diseases of the knees, or previous knee osteoligamentous or thigh muscle injuries . All participants were fully informed about the risks and procedures associated with the experiment and provided written informed consent to participate in the study . Each participant completed a 10-min warm - up on a cycle ergometer (power: 1 w / kg body weight; pedaling rate: 7080 rpm). The testing method sequence (hhd vs. isokinetic testing) was established according to a randomization table prepared by the biostatistics department of the strasbourg university hospitals using r software version 3.2.2 (r core team (2015). The randomization of the subjects was generated by a draw using a bernoulli distribution with a parameter of 0.5 to maintain a mean balance in the test order . A recovery period of 20 min was implemented between testing methods . For both methods, muscle strength was first measured in the dominant leg, and after a 10-min rest, in the non - dominant leg . To avoid inter - examiner variations, all measurements were carried out by a single investigator, specialized in physical medicine and rehabilitation (male, 31 years old, 180 cm, and 90 kg). The strength of the extensor and flexor muscles of both knees was assessed using an isokinetic dynamometer (con - trex mj; cmv ag, dbendorf, switzerland). Each participant was positioned on an adjustable chair with the back set at 90 of posterior inclination . The knee range of motion was set at 90 (from 100 to 10 of flexion; 0 corresponding to the complete extension of the knee) after having aligned the leg segment to anatomical zero . Finally, a measurement of gravity for the leg segment to be tested was carried out over the entire range of motion . The protocol of isokinetic evaluation included 6 series of contractions on the dominant and non - dominant sides including concentric, isometric, and eccentric evaluations of the knee extensor and flexor muscles (table 2table 2.protocol for muscle strength measurement with the isokinetic dynamometerseriesspeedmusclesmoderepetitionsrom / positionwarm - up180/secext / flexconcentric1090warm - up120/secext / flexconcentric1090series 160/secext / flexconcentric390series 2180/secext / flexconcentric690series 30/secextisometric190 of flexionseries 40/secflexisometric190 of flexionseries 560/secexteccentric390series 660/secflexeccentric390ext: knee extensors; flex: knee flexors; rom: range of motion). A recovery period of 60 s was observed between each maximal series . Before each, participants received standardized oral information on the experimental procedure and were verbally encouraged in a standardized manner by the operator during the test . Following 10 min of rest after the evaluation of the dominant leg, muscle testing was performed in exactly the same way for the non - dominant side . Ext: knee extensors; flex: knee flexors; rom: range of motion the strength of the extensor and flexor muscles of both knees was assessed with hand - held dynamometry (microfet2, hogan health industries, inc . This dynamometer is a portable digital instrument than can be held in the palm of the hand giving muscle strength measurements in kilogram - force (kgf). As with manual muscle testing, this dynamometer is placed between the leg segment to be evaluated and the examiner s hand . Participants were asked to sit with their legs dangling over the end of a standard, adjustable examination table, with hips and knees flexed to 90, in order to have a distance of 12 cm between the popliteal fossae and the table end . The height of the examination table was adjusted to have a distance of about 10 cm between the participant s feet and the floor . Participants had to hold the side - edges of the table with their hands and carry out a maximal isometric voluntary contraction for 5 s. the examiner positioned a knee on the floor, with the arm fully extended in front of the lower limb to be tested . To evaluate the knee extensor muscles, the dynamometer was placed on the anterior part of the lower leg, above the talotibial joint line (fig . 1.position of an individual subject for the evaluation of knee - extensor (panel a) and knee - flexor (panel b) muscles using the hand - held dynamometer). The examiner placed one of his feet against the wall to better resist muscle contraction . To evaluate the knee flexor muscles, the dynamometer was placed on the posterior part of the leg, 12 cm above the lateral malleolus (fig . In both cases, the examiner produced a resistance force in the horizontal direction to counter the force developed by the participant and maintain an isometric contraction of the knee extensor and flexor muscles . The evaluation started with the extensor muscles of the dominant leg, followed by the flexors of the dominant side . After a recovery period of 10 min, the knee extensor and flexor muscles of the non - dominant leg were assessed using the same experimental design . For each muscle group, participants carried out 3 isometric maximal voluntary contractions of 5 s. a 60-s recovery period was observed between each muscle contraction . The position of the leg to be tested was verified initially with the help of a standard goniometer . Before the evaluation, participants received standardized oral information on the test procedure and were encouraged orally during the test . Position of an individual subject for the evaluation of knee - extensor (panel a) and knee - flexor (panel b) muscles using the hand - held dynamometer for each isokinetic series, the measurement criterion was the peak torque (pt) obtained during each series, expressed in newton - meters (nm). The maximal force developed during each contraction, expressed in kilogram - force (kgf), was recorded . For each muscle group, the maximal force was averaged over the 3 isometric contractions and used as the measurement criterion . Thus, the 2 obtained variables were the peak torque (nm) and the maximal force (kgf). By assuming a correlation of 0.6 between the 2 measurements and a total magnitude of the confidence interval of 0.45 around the estimate, a sample size of 28 subjects was needed . The reproducibility of the hhd measurement was established using the coefficient of variation over 3 consecutive measures . According to stokes, reproducibility was considered acceptable when the coefficient of variation was 15% or below30 . The statistical analysis was performed independently by the biostatistics department of the strasbourg university hospitals . All analyses were carried out using r version 3.2.2, with all the required packages, in the most updated version available at the time of the data analysis . The gaussian character of the variables was assessed with the shapiro - wilk test . When 2 variables followed a normal distribution, the pearson correlation coefficient was used; if not, the spearman correlation coefficient was employed . Concerning the correlations, the test sequence and the laterality effects were evaluated by ensuring that the confidence intervals (ci) at 95% for each variable were overlapping in the 2 modalities . The results obtained with the 2 evaluation modes on the whole population are summarized in table 3table 3.results of the muscle strength measurementsmean sd ecart - typerangemedianisokinetic (nm)concentric 60/secext d179.1 52.2*$#100.3275.8180.7ext nd165.4 52.0 * 90.5260.3155.3flex d91.9 28.5$51.1164.793.8flex nd85.1 25.551.0143.878.1concentric 180/secext d132.3 39.4*$75.4207.8136.8ext nd130.4 39.6 * 71.5204.2134.1flex d72.2 22.9$32.1115.372.8flex nd71.8 24.1$32.0141.669.2isometric 0/secext d177.2 57.3 * 89.5291.8181.2ext nd167.4 56.6 * 88.0281.0162.2flex d84.0 25.248.0153.784.7flex nd79.3 25.945.0144.273.1eccentric 60/secext d201.9 61.9 * 110.9357.5191.5ext nd195.5 69.8 * 111.8357.0169.9flex d123.1 44.169.5252.3111.6flex nd116.7 36.865.9210.3103.8hhd (kgf)ext d52.9 16.7 * 22.787.457.6ext nd51.1 17.2 * 22.284 . 351.8flex d26.7 6.017.440.927.2flex nd26.9 5.318.238.927.1ext: knee extensors; flex: knee flexors; d: dominant side; nd: non - dominant side; sd: standard deviation . $p<0.05 vs. eccentric 60/s in similar muscles . #p<0.05 concentric 60/s vs. concentric 180/s in similar muscles . The strengths measured for the knee extensor muscles were greater than the corresponding values for the knee flexor muscles, whatever the mode and velocity of the muscle actions (p<0.05). Ext: knee extensors; flex: knee flexors; d: dominant side; nd: non - dominant side; sd: standard deviation . #p<0.05 concentric 60/s vs. concentric 180/s in similar muscles the knee flexor / extensor strength ratios did not change according to the evaluation mode, with no difference between the dominant and non - dominant sides (table 4table 4.flexor/extensor ratios in isokinetic and hand - held dynamometrydominant sidenon dominant sideconcentric 60/sec52 7.0%53 9.7%concentric 180/sec55 7.0%55 8.4%isometric 0/sec49 8.7%49 11.0%eccentric 60/sec61 8.1%61 10.9%hhd53 12.9%57 hhd: hand - held dynamometer the knee extensor muscle strength was significantly greater than for the knee flexor muscles, both on the dominant and non - dominant side (p<0.05). There was no difference between the dominant and non - dominant side in a given muscle group (table 3). The ratios of knee flexor / extensor muscle strength were similar in dominant and non - dominant sides and were not significantly different compared to isokinetic ratios (table 4). The coefficient of variation of the 3 isometric muscle strength measurements using the microfet 2 hhd ranged from 3.2 to 4.2% according to the muscle group evaluated . Mean difference (absolute and relative values) as well as limits of agreement were similar between muscle groups (table 5table 5.reproducibility of muscle strength evaluation with microfet 2 hand - held dynamometercoefficient of variationmean differencelimits of agreement(%)(kgf)(%)(kgf)(%)dominant knee extensors3.20.1 3.70.1 7.07.37.613.814.0non - dominant knee extensors3.30.0 3.70.4 7.47.57.515.114.4dominant knee flexors4.20.4 2.51.4 8.94.65.416.419.2non - dominant knee flexors3.70.3 2.10.9 7.73.94.614.416.3). The correlation coefficient between the isokinetic and hhd muscle strength values ranged from r=0.87 (0.750.94) to r=0.72 (0.480.86) (p<0.01), indicating that the correlation between testing methods was generally good (table 6table 6.correlation coefficients and 95% confidence intervals for knee muscle strength assessments obtained by hand - held (hhd) and isokinetic dynamometers (con - trex)con - trexeccentricisometricconcentricconcentric60/sec0/sec60/sec180/sechhdextensors dr=0.87r=0.85r=0.87r=0.85(0.750.94)(0.70 0.92)(0.730.93)(0.710.93)extensors ndr=0.84*r=0.87r=0.86r=0.87(0.690.92)(0.740.94)(0.720.93)(0.740.94)flexors dr=0.80*r=0.75r=0.81r=0.85(0.620.90)(0.530.87)(0.630.91)(0.700.93)flexors ndr=0.75*r=0.72*r=0.83*r=0.82(0.530.87)(0.480.86)(0.670.92)(0.660.91)*spearman correlation coefficient; d: dominant side; nd: non - dominant side . * spearman correlation coefficient; d: dominant side; nd: non - dominant side . All coefficients of correlation are significant (p<0.01). The flexor / extensor ratios were significantly correlated between the hhd and isokinetic dynamometer in concentric 180/sec and isometric 0/sec modes on the dominant and non - dominant sides (p<0.05). The flexor / extensor ratio measured in concentric 60/sec mode was correlated to the hhd only for the non - dominant side . No correlation was observed for the flexor / extensor ratios between hhd and isokinetic eccentric 60/sec mode (table 7table 7.coefficients of correlation for knee flexor / extensor muscle strength ratios obtained with hand - held or isokinetic dynamometrydominantnon dominantconcentric 60/sec0.230.46 * concentric 180/sec0.39 * 0.45 * isometric 0/sec0.37 * 0.46 * eccentric 60/sec0.040.13*p<0.05). The results of the present study show: 1) good reproducibility of the hhd for knee extensor / flexor muscle strength assessment, 2) clinically acceptable agreement between the values obtained with the hhd versus the isokinetic dynamometer, and 3) the need for caution when interpreting the flexor / extensor ratios using hhd compared to isokinetic dynamometry . The muscle strength values using isokinetic dynamometry recorded in this study are in good agreement with those found in the literature31, particularly in the study by maffiuleti et al . In 200723 . For a similar population of healthy individuals (age: 30 5 vs. 33 11 years old; height: 175 8 vs. 17710 cm; weight: 70 13 vs. 74 16 kg), the strength measurements using the con - trex isokinetic module were very close, with a peak torque for the knee extensors on the dominant side of 178 46 vs. 179 52 nm (concentric at 60/s); 132 38 vs. 132 39 nm (concentric 180/s), and 202 68 vs. 202 62 nm (eccentric 60/s) when compared with our values . Similarly, the muscle strength values recorded with the hhd are in agreement, albeit with greater absolute data, with literature data32, 33 and with the recent study by douma et al ., who established reference values for knee extensor and flexor muscle strength in the active dutch population by using the microfet 2 hhd34 . The magnitude of difference between our values and previously published data using hhd is likely related to the characteristics of the participants, who were younger and fitter in our study compared to previous studies . Greater limits of agreement were previously observed for reproducibility of muscle strength using hhd in strong muscle groups (i.e., knee extensors) compared to weaker muscle groups (i.e., knee or elbow flexors)34 . Consequently, hhd was not considered as suitable methodology for muscle strength assessment in knee extensors35 . Conversely, our results are at odds with this view as we report that the reproducibility of muscle strength assessment is not altered by the level of muscle strength developed by the subjects . Indeed, the variation coefficients were lower for the 3 measures of knee extensors compared to knee flexors, despite higher levels of absolute strength in the former . Similarly, we did not observe greater limits of agreement (loa) in the knee extensors compared to the knee flexors . Of note, absolute values of loa in the present study are somewhat lower than those previously published34 . We suggest that if hhd devices are manipulated by experienced operators, hhd can be used for the evaluation of muscle strength, even in strong muscles such as the knee extensors . It should also be kept in mind that the strength of the operator might be key in stabilizing the hhd device during the measurement procedure, and therefore the operator s own strength is likely to be of great importance for the accuracy of the measurements36 . When compared with previous results reporting the coefficient of variation (cv) of isokinetic measurements using a contrex device (1.93.4% for knee extensors and 2.73.6% for knee flexors), the cvs reported in the present study are very similar for hhd (3.23.3% for knee extensors and 3.74.2% for knee flexors). This result suggests that the reproducibility of the strength measurements using hhd is in close agreement with that observed with isokinetic testing23 . In a previous literature review comparing hhd with isokinetic dynamometry, stark et al . Showed that correlation coefficients ranged between 0.43 and 0.99 for the knee extensor and flexor muscles29 . However, the heterogeneity of the protocols as well as the different models of dynamometers make the results difficult to interpret . The present study is the first to analyze the correlation between these specific dynamometers (contrex isokinetic vs microfet 2), and we report a good correlations between the 2 methods (r=0.720.87). Of note, the present data were gathered using a simple protocol, easily reproducible without any additional equipment, in order to be established in routine clinical practice and to take the greatest advantage of the practical aspects of hhd . When looking at subjects engaged in regular sports practice, only one study previously explored the correlation between hhd and isokinetic measurements37 . The study reported lower correlation coefficients (r=0.334 0.110.617 0.7) compared to our results, but it should be emphasized that the number of subjects, the type of dynamometers, and the protocol employed were different . Lastly, the present study is also the first to provide a correlation analysis between hhd and isokinetic testing for the evaluation of knee flexor / extensor muscle ratios, an index used routinely in the field of sports medicine . Our results show correlation coefficients ranging from 0.37 to 0.46 (all p<0.05). Although statistically significant, these results indicate a moderate level of correlation between the 2 methodologies, and even no correlation at all when comparing flexor / extensor ratios obtained using hhd with that from isokinetic testing in eccentric mode . Therefore, flexor / extensor muscle strength ratios measured using hhd should be interpreted with caution until further investigation is performed in this area . A limitation of our study is the fact that our population consisted of healthy, relatively young volunteers without osteoarticular or neuromuscular pathologies . Compared muscle strength measurements by using hand - held and isokinetic dynamometers in a population of individuals with various unilateral orthopedic pathologies of the knee5 . They found a significant correlation between both methods (r ranging from 0.57 to 0.80). However, the evaluation by hhd did not highlight a statistically significant difference between sides, whereas the isokinetic evaluation found a force deficit on the injured side . The pain that the patient may experience during the evaluation could be a confusing factor and must be taken into account when interpreting the strength results in the presence of pathologies . Another limit of this work is that hhd and isokinetic devices do not provide strength assessment with similar units of measurement . This makes direct comparison of absolute strength values difficult and limits the present comparison to correlation analysis . To obtain strength values expressed in the same units between the 2 devices (newtons or kgf) would have required an evaluation of the lever arm, which is likely to have introduced more variability in the data . Each evaluation method has its specific advantages and limitations . For a practitioner looking for rapid and regular muscle strength testing knee extensor and flexor muscle strength recorded with an hhd is reproducible and significantly correlated with the isokinetic values, indicating that this method may in some cases be a useful replacement for isokinetic strength measurement, even for the assessment of strong muscles . However, for strength ratio assessment, and when judged against the isokinetic standard, hhd is not a valid option.
|
Genome - wide biases in nucleotide content have been extensively studied in a wide variety of organisms . During the past decade, there has been accumulating evidence that these variations at the dna level can result in parallel changes in the frequencies of amino acids in the encoded proteins . For example, the gc content of bacterial genomes has been shown to influence the amino acid composition of the proteome . In addition to the variations in gc content, however, bacterial genomes can also show significant compositional asymmetry between the two dna strands . This strand asymmetry is usually measured as gc or at skew (see methods) and it can be due to such factors as different substitutional patterns between the leading and lagging strands during replication . By comparing the amino acid compositions of proteins encoded on the leading strand with those encoded on the lagging strand, it has been shown that these nucleotide skews can also affect the amino acid composition of bacterial proteins . Among eukaryotes, the correlations between nucleotide content and amino acid compositions have been studied primarily in animal mitochondrial genomes . It has been shown that the variations in gc content affect the amino acid composition of the encoded proteins but the effects of variations in nucleotide skew between genomes have not been studied . The recent availability of a very large number of completely sequenced mitochondrial genomes allows us to fill this gap . Mammalian mitochondria, including those of humans, are characterized by negative gc skews and positive at skews, i.e. The major coding strand of mammalian mitochondria is relatively rich in the nucleotides c and a, and correspondingly poor in g and t. for instance, as noted by perna and kocher (1995), although the human mitochondrial genome contains more than 40% gc pairs, the frequency of g on the coding strand is only 5% . The strength of the skew varies between species, and some species of invertebrate show opposite skews to those found in mammals, i.e. The coding strand is rich in g and poor in c. in recent years, there has been an explosion of data on mitochondrial whole genome sequences . Since our goal was to measure the effect of strand asymmetry on amino acid composition, we chose a group of species, the platyhelminthes (flatworms), in which the gc and at skews are opposite to those seen in mammals . Among the flatworms, the coding sequences are rich in g and t and correspondingly poor in c and a, i.e. A complete contrast to the patterns seen in mammals for example, the main mitochondrial coding strand in schistosoma mansoni (a flatworm) contains only 6.7% c, but it contains 25% g. despite the contrasting gc and at skew patterns, however, both mammals and flatworms contain essentially the same set of homologous mitochondrial genes and they span similar ranges of gc content . Thus a comparison between these two groups provides us with an opportunity to assess the potential effects of dna strand bias on the amino acid composition of a well - characterized set of orthologous proteins . We downloaded all of the publicly available complete mitochondrial (mt) genome (mtdna) sequences from both mammals and platyhelminthes from the ncbi refseq organelle genome database (http://www.ncbi.nlm.nih.gov/genomes/organelles/mztax_short.html) (released in july, 2006). There were a total of 170 mt genomes from mammals and 13 mt genomes from platyhelminthes (supplementary table s1). + -strand (the major coding strand used by ncbi for annotation) for each species . The gc and at asymmetry is measured in terms of gc- and at - skews according to the following formulae given in perna and kocher: gc - skew = (gc)/(g + c); at - skew = (a t)/(a + t), where c, g, a, and t are the occurrences of the four nucleotides . We predicted the amino acid compositions based on the mitochondrial genetic code (table 1) by partitioning the mitochondrial codons into ca - rich codons, gt - rich codons, and other codons . The frequency of synonymous codon usage was measured by the nucleotide content of g + t or c + a at the third codon positions of fourfold degenerate codon families: ggn (glycine), gtn (valine), cgn (arginine), acn (threonine), gcn (alanine), and ccn (proline) (supplementary fig . S1). Partition of the vertebrate mitochondrial genetic code into gt - rich, ca - rich and other codons gt - rich codons (italic) include gt, tg, gg, tt codons at the first two codon positions . Ca - rich codons (bold) include ca, ac, cc, aa codons at the first two codon positions . Different codon assignments in mammals and platyhelminthes are underlined . In platyhelminthes, aga and agg code for ser, ata for ile, and aaa for asn . The numbers following each codon are codon usage per thousand codons in the 11 conserved proteins of mammals (the first number) and platyhelminthes (the second number). The statistical significance of the average differences in amino acid composition between the two groups of species was scored using a student's t - test . We first confirmed the published reports (see introduction) of contrasting gc and at skews in the mitochondria of mammals and flatworms . As can be seen from fig . 1, there is a negative gc skew, and a positive at skew, in the major coding strand among the mammalian species, whereas the opposite is true among the flatworms . Despite the variations between species within both groups, there is a large average difference between them and this difference between the groups is statistically highly significant (p <0.0001). As previously noted by perna and kocher and le et al ., the major coding sequence of mammalian mtdna is relatively rich in c and a, whereas g and t are much more common in the flatworm coding sequences . Contrasting patterns of dna strand asymmetry in the mitochondrial coding sequences of mammals and platyhelminthes . (a) the gc skew, (g c)/(g + c), is negative for all mammalian species (shown in blue), and positive for all platyhelminthe species (shown in red). (b) the at skew, (a t)/(a + t), is positive for mammals (shown in blue) and negative for platyhelminthes (shown in red). Despite their differences in strand asymmetry, the major coding strands of the two groups encode essentially the same set of 11 conserved mitochondrial proteins including cytochrome b, three subunits of cytochrome c oxidase (subunit 1, 2, and 3), six subunits of nadh dehydrogenase (subunit 1, 2, 3, 4, 4l, and 5), and atp synthase f0 subunit 6 (atp6). The exception is that nadh dehydrogenase subunit 6 (nd6) is encoded on the major coding strand in flatworms, but is encoded on the opposite strand in mammals . Given the contrasting patterns of mitochondrial dna strand asymmetry between these two groups of animals, we wished to investigate if there was a corresponding difference between the two groups in the frequencies of encoded amino acids . Specifically, because of their negative gc skews and positive at skews (which reduce the frequencies of g and t nucleotides on the coding strand), we expected the mammalian coding strands to encode proteins that are relatively low in the proportions of cysteine (c), valine (v), phenylalanine (f), glycine (g), and tryptophan (w), all of which are encoded by gt - rich codons (table 1). The combined proportions of these five amino acids among the mammals are approximately half the value observed in the flatworm orthologs . Since these gc and at skews result in a corresponding enrichment of c and a nucleotides on the mammalian coding strand, we expected the mammalian proteins to show a corresponding relative increase in the proportions of glutamine (g), threonine (t), proline (p), histidine (h), asparagine (n), and lysine (k), all of which are encoded by ca - rich codons . Again, this prediction is borne out (fig . 2b) and again the average difference between the two groups of species is approximately twofold . Not only are the average differences in the predicted direction, but they are statistically highly significant (p <0.0001) and they are consistent over all species within each group (see details in supplementary table s1). In addition to the consistency over species, there is also a consistency over all amino acids within the two codon groups . These differences are surprisingly large, given that we are dealing with a set of conserved orthologous proteins . Although taken as a group, the amino acid frequencies show approximately a twofold difference between the two groups (fig . 2), at the level of individual amino acids, some of these differences are threefold or greater (fig . 3). Again, the individual amino acid differences shown in fig . 3 are highly statistically significant (p <0.0001). Thus, we can conclude that strand asymmetries at the level of dna have had a major influence on the composition of these mitochondrial protein sequences . (a) the proportions of cysteine (c), valine (v), phenylalanine (f), glycine (g), and tryptophan (w) are relatively low in mammalian proteins (shown in blue) and relatively high in flatworms (shown in red). (b) the proportions glutamine (q), threonine (t), proline (p), histidine (h), asparagine (n), and lysine (k) are, in contrast, relatively high in mammals (shown in blue) and relatively low in flatworms (shown in red). The proportions of individual amino acids that were most affected by dna strand asymmetry in mammals and platyhelminthes . (a) the proportions of cysteine and valine are low in mammalian proteins (shown in blue) and high in flatworm proteins (shown in red). (b) the proportions of glutamine and threonine are high in mammals (shown in blue) and low in flatworms (shown in red). These results show that differences in the patterns of strand asymmetry between the coding and template strands of a mitochondrial gene can produce very significant changes in the amino acid composition of the encoded proteins . The magnitude of these changes is comparable to those noted previously by foster et al . For the effects of differences in mitochondrial nucleotide composition, it should be noted, however, that the strand asymmetries described in this study do not affect the same subsets of the amino acids as those affected by changes gc content . As an illustrative example, we can compare a single pair of mitochondrial genomes, one mammal and one flatworm, those of the red deer (cervus elaphus) and the liver fluke (fasciola hepatica). In both species, the overall nucleotide content of the mitochondrial coding sequences is virtually identical at 38% gc and proportions of gc - rich (garp) and at - rich (fymink) amino acids (see foster et al . For details) are also very similar between these two species . In other words, their similarity in nucleotide composition is reflected in a similarity in the proportions of gc - rich and at - rich amino acids . But when we compare the same two species for the levels of ca - rich (qtphnk) and gt - rich (cvfgw) amino acids, we see large differences reflecting the differences in strand asymmetry between the mammals and the flatworms . For example, the liver fluke proteins contain more than twice as many valine residues and more than five times as many cysteine residues as do their orthologs in the red deer . On the other hand, the liver flukes have approximately a third as many glutamines and threonines as are found in the red deer . These differences are also statistically highly significant (p <0.001) and they are entirely consistent with what we see for the average differences between mammals and flatworms (fig . 3 and supplementary table s1). A possible alternative explanation for these results is that the amino acid differences are the cause, rather than the consequence, of the strand asymmetries . First, there is an even larger strand asymmetry at the synonymous codon sites (supplementary fig . S1) suggesting that the nucleotide skew is counterbalanced, to some extent, by functional constraint at the protein level . In other words, protein function does have an effect, but as a constraint rather than a cause . Another way to illustrate this point is to calculate the gc skew at each codon position separately . The results (supplementary table s2) show that the greatest differences in gc skew occur at the third codon position and the least skew occurs at the second position . This is consistent with the fact that many changes at the third codon position alter the codon usage but do not affect the protein sequence . Secondly, in mammalian mitochondria, one gene (nd6) is encoded on the opposite strand from the other 12 genes and, in accordance with our prediction, the amino acid composition of this mammalian protein displays a pattern that is similar to that of the flatworm proteins rather than the other 12 mammalian proteins (supplementary fig . Both of these observations indicate that the primary effect is at the level nucleotide asymmetry between the two strands of the mitochondrial genome and that this dna bias causes a secondary effect at the level of protein composition . We performed a number of further tests to explore the interplay between functional constraint at the protein level and nucleotide skew at the dna level . Since we limited our comparison to orthologous mitochondrial genes, we have eliminated the effect of different types of proteins in the two groups of species . Moreover, since mitochondrial function is highly conserved in metazoan animals, we expect that the orthologous proteins are performing essentially the same functions in the two species groups . There is still, however, the remote possibility that there are differences in physiological conditions between the mitochondria of mammals and those of flatworms and that these differences could contribute to the differences in protein composition which we observe between the two groups . To control for this possibility, we examined the sequences of three mitochondrial ribosomal protein genes: l11, l15, and l20 (supplementary table s2). Although these proteins function in the mitochondria, they are encoded by genes in the nuclear genome . The results show that the gene sequences do not show the characteristic mitochondrial gene skews and there is no significant difference between mammals and platyhelminthes, either at the dna level or at the protein level . This indicates that the key factor underlying the species differences is not the functional environment of the proteins but rather the location of the genes encoding those proteins . Since our results point to a mutational force at the dna level that is counteracted by functional constraint at the protein level, we asked what would happen if we confined our analysis to a region of the protein where there was reason to believe that the functional constraint would be especially strong . The transmembrane domain portions of mitochondrial proteins provide an opportunity to do such an analysis . Specifically, we looked at the patterns of gc skew and amino acid composition in the transmembrane domain regions of the coxi gene . The results (supplementary table s2) show that the increased functional constraint on amino acid composition does indeed lead to a decreased difference in gc skew between the two species groups . For example, the difference in gc skew between mammals and flatworms for the complete dataset is 0.84, whereas it is reduced to 0.57 for the transmembrane domains, but the same pattern remains both at the dna and protein levels . For instance, even within the transmembrane domains, the mammalian sequences have less cysteine and valine, and more glutamine and threonine than do their flatworm orthologs, reflecting the same patterns as shown in figure 3 . In other words, increased functional constraint decreases the effect of nucleotide skew, but it does not completely eliminate it . Overall, our results show that the dna strand asymmetry of animal mitochondrial genomes affects the amino acid composition of encoded proteins . A similar effect has been noted previously in bacterial genomes but it has not been reported in animal or plant genomes . Since we infer that the dna strand bias is the cause rather than the consequence of the protein differences, this raises the question of what causes the dna strand bias in the first place . In bacterial genomes, there is good evidence that it is related to dna replication, based primarily on the fact that the direction of the bias switches at the origin of replication . Recent work indicates that although dna strand biases are widespread in prokaryotes, eukaryotes, and viruses, the magnitude and the direction of the bias is variable, suggesting that the underlying causes are multifactorial . In animal mitochondrial genomes, the strand bias appears to be caused by varying durations of time that the heavy strand spends in the mutagenic single - strand state during replication . In addition to the replication - associated effects, there is evidence that transcription can also generate dna strand asymmetry in eukaryotes due to transcription - coupled mutations . A recent study has shown that strand bias in mitochondrial sequences can lead to artefactual results in phylogenetic reconstructions . This misleading result can be minimized by a recoding scheme that excludes transitions at rapidly evolving neutral sites . Our results, however, show that mitochondrial strand biases can also have significant effects at non - neutral sites that change the amino acid sequence . This means that some degree of bias remains even after the correction has been implemented . As stated by jones et al . (2007) in the case of mitochondrial genes, strand - bias should be of particular concern and the previous use of mitochondrial genomes in resolving deep phylogenies requires critical re - evaluation. It remains to be seen if dna strand asymmetry can also affect the composition of proteins encoded by eukaryotic nuclear genes, as has been shown for biases in the gc content of nuclear genes . It is already known that dna strand asymmetries exist in nuclear genes but their effects on the composition of nuclear - encoded proteins have not been studied . This work was supported by a grant to dah from the natural science and engineering research council of canada.
|
Lung cancer is the most deadly cancer disease with an estimated 27% of all cancer deaths, . A large part of patients with lung cancer undergoes radiotherapy . Tracking tumor motion poses a significant challenge for precise dose delivery in lung cancer radiotherapy, due to respiratory motion of up to 3.5 cm for primary lung tumors . If the patient s breathing motion is not correctly predicted, tumor miss might occur, or sensitive normal tissue might be undesirably exposed resulting in unwanted treatment toxicity . Advanced technologies of radiotherapy, intensity modulated radiotherapy and image guided radiotherapy, may offer the potential of precise radiation dose delivery for moving objects . However, they still need an additional function to predict the precise position of the tumor against subtle variations in real - time, . Radiation dose is typically delivered in 3 to 5 fractions over 5 to 12 days for early stage lung cancer using stereotactic radiotherapy or 30 to 33 fractions over 6 to 7 weeks for more advanced disease with each fraction lasting between 10 and 45 minutes . The patient s breathing motions during these fractions are broadly divided into two categories: 1) intra - fractional and 2) inter - fractional variations . Intra - fraction motion indicates changes where the patient is undergoing the radiation therapy, which turns up on a time scale of seconds to minutes,, . Each individual shows different breathing patterns . On the other hand, inter - fractional variation is typically shown in a time scale of minutes to hours or a day - to - day level,, . Inter - fractional motion is distinguishable from intra - fractional movement because the inter - fractional variation covers even baseline shifts and weight gain or loss, . However, most studies of breathing prediction so far have focused on respiratory motions within the single treatment session, i.e., intra - fractional variation . Recently, several studies have pointed out the difference between intra - fractional and inter - fractional movements and have discussed the importance of inter - fractional variation in radiation treatment or related imaging techniques . Table 1 summarizes the comparison between intra- and inter - fractional movements.table 1comparison between intra- and inter - fractional variations.variation typeintra - fractioninter - fractiontime of occurrenceduring a single fraction, between different fractions,,, time scaleseconds to minutes hours or day - to - day level,, motion coverageinternal organ motion, breathing, swallowing, position changes of patients, patient weight gain / loss, internal organ motion, breathing, swallowing, prediction methods for intra - fractional variation have been addressed in many studies,,,,, as illustrated in table 2 . However, inter - fractional variation has not been actively studied as much as intra - fractional motion yet despite its necessity in radiotherapy,,, . Intra- and inter - fractional variation of breathing motion can raise many challenges for respiratory prediction thirdly, the novel method should be able to handle any unpredictable breathing variation.table 2previous prediction methods for intra- and inter - fractional variations.methoddescriptiondrawbackvariationmargin-based compensated locational changes of the tumor in a primitive way, adding extra margins high possibility of over / under - dose since the margin is determined by motion range of the tumor without knowing its variationintra-/inter - fractionlinear predictive model (lp), estimated the future state based on functions comprised of linear combination of input data, proper coefficients, and constants inferior prediction accuracy for breathing signals with a long latency poor performance improvement by its exclusive usage assumption that the nonlinear respiratory movement is linearintra-/inter - fractionadaptive filter (af),,,, combined modified lps and additional filters that adjust coefficients of lps no guarantee of its superb performance in most cases because it highly depends on adaptation intervalsintra - fractionkalman filter (kf),,, efficient recurrent filter which has been utilized in various forms: kalman constant velocity, kalman constant acceleration, an interacting multiple model, and hybrid implementation based on the extended kf (hekf) only adaptable to linear or nearly linear estimation high computation complexity of kf - based models combined with other prediction toolsintra - fractionartificial neural network (nn)-based,,,,,,,,,, showed outstanding accuracy for irregular patterns and abrupt changes, extended approaches: back propagation nn, feed - forward nn, recursive nn, wavelet nn, customized prediction with multiple patient interactions using nn (cnn), and hekf long calculation time for prediction parameters and resultsintra - fractioncubic model estimated respiratory variance by using a third - order polynomial equation same drawback of low accuracy as lp because the cubic model is also one of the mathematic approaches like lpinter - fractionstochastic fluence map optimization (fmo) model extended deterministic fmo model, which assumes that a patient is static solved observed problems by employing convex penalty functions and numerous scenarios to characterize inter - fractional uncertainties unpredictable method for other disregarded scenariosinter - fraction in this paper, we propose a new prediction approach for intra- and inter - fraction variations, called intra- and inter - fractional variation prediction using fuzzy deep learning (iifdl). The proposed iifdl clusters the respiratory movements based on breathing similarities and estimates patients breathing motion using the proposed fuzzy deep learning (fdl). To reduce the computation time, first, this is the first analytical study for modeling multiple patients breathing data based on both intra- and inter - fractional variations . Secondly, the proposed method has a clinical impact for enhanced adjustment of margin size because it achieves high prediction accuracy for respiratory motion, even for inter - fractional variation . Thirdly, this study shows the clinical possibility of real - time prediction by largely shortening computing time . Furthermore, the training process can be shortened, by training breathing signals with similar patterns together in the proposed iifdl . The proposed fdl is a combination of fuzzy logic and a nn with more than two hidden layers, i.e. Deep learning network . Due to the nn architecture of fdl, it has a self - learning feature, setting network parameters by training itself according to input and desired output values . Fdl also has a fuzzy logic feature of reasoning capability for uncertainty . In fdl, a few fuzzy parameters, i.e. Prediction parameters of fdl, determine weight values between nodes in the network, and weight values are considered as the prediction parameters in other methods . Consequently, the number of prediction parameters is much less than that of other mutated nn methods and parametric nonlinear models . This reduces the computation time substantially and makes suitable for to real - time and nonlinear estimation . 1 exemplifies a simple architecture of fdl, including layer 1 through layer 4 in the hidden layers . The functions of four hidden layers can be summarized as follows: layer 1 provides membership functions which are determined by a membership function (mf) parameter set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m=$\end{document} {\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,2}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,3}$\end{document}}, layer 2 applies a t - norm operation, layer 3 computes linear regression functions by normalized weights and a linear regression (lr) parameter set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r=$\end{document} {\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,2}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,3}$\end{document}}, and layer 4 finally yields an output of fdl \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f$\end{document} by summing outcomes according to all fuzzy if - then rules . Figure 1.fdl architecture including layer 1 through layer 4 in the hidden layers: layer 1 provides membership functions, layer 2 applies a t - norm operation, layer 3 computes linear regression functions, and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . Fdl architecture including layer 1 through layer 4 in the hidden layers: layer 1 provides membership functions, layer 2 applies a t - norm operation, layer 3 computes linear regression functions, and layer 4 finally yields an output of fdl according to all fuzzy if - then rules . For the training algorithm of fdl, we use the hybrid learning algorithm which is a combination of a gradient descent back - propagation algorithm and a least squares estimate algorithm . The mf parameter and the lr parameter are identified by this training algorithm . In fig . 1, the number of fuzzy if - then rules is equivalent to that of nodes in layer 2 and 3, which are given as follows: rule1:if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{1}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{1}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{1} = r_{\mathrm {1,1}}i_{1} + r_{\mathrm {1,2}}i_{2}+r_{\mathrm {1,3}}$\end{document},rule2:if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{2}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{2}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{2} = r_{\mathrm {2,1}}i_{1} + r_{\mathrm {2,2}}i_{2}+r_{\mathrm {2,3}}$\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} are inputs of fdl, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{i}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{i}$\end{document} are fuzzy sets, which are linguistic labels . If \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{1}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{1}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{1} = r_{\mathrm {1,1}}i_{1} + r_{\mathrm {1,2}}i_{2}+r_{\mathrm {1,3}}$\end{document}, if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{2}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{2}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{2} = r_{\mathrm {2,1}}i_{1} + r_{\mathrm {2,2}}i_{2}+r_{\mathrm {2,3}}$\end{document} the output \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $o_{\mathrm {1},i}$\end{document} in layer 1 is described as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{1,i} \!=\!\begin{cases} {\mu _ {a_{i}} \left ({{i_{1}}} \right) = 1 / {\left [{{1+\left | {{{\left ({{i - m_{i,3}}} \right)} / {m_{i,1}}}} \right |^{2m_{i,2}}}} \right]},} \\ \quad \qquad \qquad \qquad \qquad \qquad {1\le i\le 2} \\ {\mu _ {b_{i-2}} \left ({{i_{2}}} \right) = 1 / {\left [{{1+\left | {{{\left ({{i - m_{i,3}}} \right)} / {m_{i,1}}}} \right |^{2m_{i,2}}}} \right]},} \\ \quad \qquad \qquad \qquad \qquad \qquad {3\le i\le 4} \\ \end{cases}\quad \end{equation*}\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mu _ {ai}(i_{1})$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mu _ {bi\mathrm {-2}}(i_{2})$\end{document} are mfs of inputs for each fuzzy set of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{i}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{i}$\end{document}. Also, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,2}$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,3}$\end{document} are the mf parameters chosen by the training algorithm . The functions of layer 2 multiply all the values coming from layer 1, as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{2,i} = {w}_{i} = \mu _ {a_{i}} \left ({{i_{1}}} \right) \cdot \mu _ {b_{i}} \left ({{i_{2}}} \right) \!,\quad 1\le i\le 2 \end{equation*}\end{document} where multiplication acts as the t - norm operator in the fuzzy system, and the output indicates the firing strength for the rule . In layer 3, the linear regression function is applied to a ratio of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}th rule s firing strength to the summation of all rules firing strengths, and its result can be calculated by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{3,i} = \frac {w_{i}}{\sum \limits _ {j} {w_{j}}}\left ({{r_{i,1} i_{1} + r_{i,2} i_{2} + r_{i,3}}} \right) \!,\quad 1\le i\le 2 \end{equation*}\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,2}$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,3}$\end{document} are the lr parameters, derived from the training algorithm . The output of layer 4 is aggregate of (3) as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{4,1} = f=\sum \limits _ {i} {\frac {w_{i}}{\sum \limits _ {j} {w_{j}}}f_{i}} = \frac {\sum \limits _ {i} {w_{i} f_{i}}}{\sum \limits _ {i} {w_{i}}}. \end{equation*}\end{document} the output of fdl is computed by its weights and regression functions as (4). The proposed iifdl is designed to reduce the computational complexity of prediction for multipatients breathing motion, which occurs during the single treatment session and between treatment sessions . To achieve this, the proposed iifdl clusters multiple patients based on their breathing feature similarities and trains their respiratory signals for each group ., a summary of its whole process is given as follows: 1)patient clustering: patients breathing feature metrics are computed from the respiratory signals, and then patients are clustered according to their breathing feature similarities.2)prediction using fdl: for each patient group, the training procedure of the hybrid learning algorithm is conducted, and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . Patient clustering: patients breathing feature metrics are computed from the respiratory signals, and then patients are clustered according to their breathing feature similarities . Prediction using fdl: for each patient group, the training procedure of the hybrid learning algorithm is conducted, and then breathing signals with intra - fractional variation or inter - fractional variation are predicted using fdl . We describe the specific clustering procedure in subsection \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a$\end{document} first, and we explain fdl for intra- and inter - fractional variation prediction in subsection \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b$\end{document}. From patients respiratory signals, we extract breathing features as clustering criteria: autocorrelation maximum (amv), acceleration variance (acc), velocity variance (vel), breathing frequency (brf), maximum fourier transform power (ftp), principal component analysis coefficient (pca), standard deviation of time series data (std), and maximum likelihood estimates (mle). Table 3 summarizes features extracted from the signals and their formula . In table 3, amv is an indicator of the breathing stability, and acc, vel, and std are directly relevant to respiratory signals,, . In addition, we use the typical vector - oriented features pca and mleas well as other breathing characteristics such as brf and ftp,, . There are two improvements in the proposed patient clustering: the removal of unnecessary breathing feature metrics, and the use of clustering criteria with vector forms.table 3features extracted from the signals.pformulaused form in iifdlused form in amv\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\max \left ({{\frac {1}{2t}\int _ {-t}^{t} {x\left ({t} \right) x\left ({{t-\tau}} \right) d\tau}}} \right) $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $t$\end{document}: period of observations)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{amv} $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{amv} \vert $\end{document} (scalar)acc\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $var\left ({{\delta x \mathord {\left / {{\vphantom {\delta x {\delta t^{2}}}}} \right .} {\delta t^{2}}}} \right) $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x$\end{document}: observed respiratory data)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{acc} $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{acc} \vert $\end{document} (scalar)vel\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $var\left ({{\delta x \mathord {\left / {{\vphantom {\delta x {\delta t}}}} \right .} {\delta t}}} \right) $\end{document}\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{vel}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{vel} \vert $\end{document} (scalar)brf\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\frac {1}{n\left ({i} \right)} \sum \limits _ {i} {\left ({{\frac {1}{bc_{i}}}} \right)} $\end{document} (n(\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}): number of breathing cycles, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $bc_i:~i$\end{document}th breathing cycle range)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{brf}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 1 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{brf}$\end{document}ftp\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\max \left ({{\sum \limits _ {n=1}^{n} {x\left ({n} \right) e^{-\frac {j2\pi} {n}\left ({{k-1}} \right) \left ({{n-1}} \right)}}}} \right) $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n$\end{document}: number of breathing signal samples, 1 k n)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{ftp}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{ftp} \vert $\end{document} (scalar)pcaprincomp\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\left ({{{\mathbf{z}}}} \right) $\end{document} (princomp(\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\cdot) $\end{document}: pca function, z: data matrix (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n\times m$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m=3 $\end{document}))\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{pca}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $3\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{pca} \vert $\end{document} (scalar)std\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\sqrt {\frac {1}{n}\sum \limits _ {i=1}^{n} {\left ({{x_{i} -{x}'}} \right) ^{2}}} $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x_{i}$\end{document}: ith breathing signal sample, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x$\end{document}: average of breathing signal samples)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{std}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{std} \vert $\end{document} (scalar)mle\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\arg \max \limits _ {\theta \in \theta} \hat {l}\left ({{\theta \left | {{x_{1},..., x_{n}}} \right .}} \right), \hat {l}\left ({{\theta \left | {x} \right .}} \right) = \frac {1}{n}\sum \limits _ {i=1}^{n} {\ln f\left ({{x_{i} \left | {\theta} \right .}} \right)} $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f(\cdot \vert \theta) $\end{document}: normal distribution)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{mle}$\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\times 3 $\end{document} vector)\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{mle} \vert $\end{document} (scalar) firstly, previous studies in,,,,, and chose two additional feature metrics, i.e. Autocorrelation delay time (adt) and multiple linear regression coefficients (mlr), in addition to those eight in table 3 for respiratory pattern analysis . However, adt depends on the length of breathing signal samples, rather than the individual respiration characteristics . The use of mlr assumes that breathing signals are linear, fixed values, and homoscedasticity . Secondly, the existing study clustered patients based on the magnitude values of their respiratory feature vectors . However, the proposed method uses breathing feature vectors for patient clustering, not their magnitude values . For example, the proposed iifdl analyzes the similarities among patients pca by comparing each component of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $3\times 3 $\end{document} vector \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{pca}$\end{document}, but the previous method in calculates the similarities based on the scalar value of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vert p_{pca}\vert $\end{document}. Accordingly, the previous method clusters patients as the same group when the breathing signals have the approximate magnitude of the breathing feature vector, even though they do not show the similar breathing features . Thus, the proposed iifdl compares each component of breathing feature vectors, so that it can provide better clustering of breathing signals than existing methods . As shown in fig . 2, respiratory signals are randomly selected from multiple patients and used for the breathing feature extraction . Let us define \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\textbf{p}=$\end{document}{\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{amv}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{acc}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{vel}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{brf}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{ftp}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{pca}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{std}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $p_{mle}$\end{document}} as a feature selection metrics set, x as an arbitrary feature combination vector based on p, and y as an optimal feature combination vector . The total number of possible xs in the given data is 247 (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\sigma _ {i\,\mathrm {8}}\text{c}_{i}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} xs, y is selected using a criterion function \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j(\cdot) $\end{document}, which is determined by within - class scatter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{w}$\end{document} and between - class scatter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{b}$\end{document} values . The within - class scatter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{w}$\end{document} is defined as follows: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} s_{w} \!=\! {\begin{array}{*{20}c} {\sum \limits _ {i=1}^{c} {\sum \limits _ {\textrm {x}\in c_{i}} \! {\left ({{\textrm {x}-m_{i}}} \right) \left ({{\textrm {x}-m_{i}}} \right) ^{t}}},} & \quad {m_{i} \!=\!\dfrac {1}{n_{i}}\sum \limits _ {\textrm {x}\in c_{i}} \textrm {x}} \\ \end{array}}\qquad \end{equation*}\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c$\end{document} is the number of classes less than the total number of patients \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{i}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i}$\end{document} indicate the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}th class and its mean, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $n_{i}$\end{document} is the number of patients of class \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i$\end{document}. The between - class scatter \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{b}$\end{document} is defined as:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} s_{b} = \! {\begin{array}{*{20}c} {\sum \limits _ {i=1}^{c} {n_{i} \left ({{m_{i} -m}} \right) \left ({{m_{i} -m}} \right) ^{t}},} & \quad {m=\dfrac {1}{n}\sum \limits _ {\textrm {x}} \textrm {x}} \\ \end{array}}\qquad \end{equation*}\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m$\end{document} is the mean of all feature combination vectors . With \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{w}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $s_{b}$\end{document}, the criterion function \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j(\cdot) $\end{document} is given as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} j\left ({{\textrm {x},\;c}} \right) = \frac {s_{b}}{s_{w}} \end{equation*}\end{document} this implies that the larger \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j(\cdot) $\end{document} allows, with low in - class and high inter - class dispersion, the more obvious distinction between classes . After criterion function values are calculated for all xs and all possible numbers of clusters \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c$\end{document}, y can be decided with the following condition:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} \upsilon = \left \ {{{\textrm {x}\left | {{\max \;j\left ({{\textrm {x},\;c}} \right) \;and\;c <n}} \right .}} \right \} \end{equation*}\end{document} after choosing y by (8), the final number of clusters \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} is set, and patients are clustered as \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} classes depending on selected principal features of y. after multiple patients are clustered, we can train patients data for each group . For intra - fractional variation, fdl trains parameters based on input data in a single session and fdl predicts breathing motion by training the fdl network for multiple datasets of previous sessions . Here, datasets of inter - fractional variation already include the patient s intra - fractional variation, as described in section i. training datasets consist of the initial data and the target data . We train the datasets with the hybrid learning algorithm . During the training procedure, two prediction parameter sets of fdl, i.e., mf parameter set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m$\end{document} and lr parameter set r, are obtained and applied to the proposed fdl . For estimating intra- and inter - fractional variation from the cyberknife data, fdl has a similar structure to fig . 1, the input datasets consist of three - dimensional (3d) coordinates for each channel . Thus, we designed the proposed prediction method to have three fdls for each \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $y$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $z$\end{document} coordinate, so that we can obtain all 3d coordinates of the estimated breathing signal . The total number of nodes in layer 2 and 3 is 27, based on the number of fuzzy if - then rules, which are given as follows: rule1:if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{1}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{1} $\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{3}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{1}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{1} = r_{\mathrm {1,1}}i_{1} + r_{\mathrm {1,2}}i_{2} + r_{\mathrm {1,3}}i_{3}+r_{\mathrm {1,4}}$\end{document},rule27:if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{3}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{3} $\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{3}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{3}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{27} = r_{\mathrm {27,1}}i_{1} + r_{\mathrm {27,2}}i_{2} + r_{\mathrm {27,3}}i_{3}+r_{\mathrm {27,4}}$\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{3}$\end{document} correspond to inputs from three channels of cyberknife machine, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{i}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{i}$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{i}$\end{document} are fuzzy sets . If \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{1}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{1} $\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{3}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{1}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{1} = r_{\mathrm {1,1}}i_{1} + r_{\mathrm {1,2}}i_{2} + r_{\mathrm {1,3}}i_{3}+r_{\mathrm {1,4}}$\end{document}, if \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{1}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a_{3}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{2}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b_{3} $\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $i_{3}$\end{document} is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{3}$\end{document}, then \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $f_{27} = r_{\mathrm {27,1}}i_{1} + r_{\mathrm {27,2}}i_{2} + r_{\mathrm {27,3}}i_{3}+r_{\mathrm {27,4}}$\end{document} the output \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $o_{\mathrm {1},i}$\end{document} in layer 1 is computed as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{1,i} = \begin{cases} {\mu _ {a_{i}} \left ({{i_{1}}} \right) = 1 / {\left [{{1+\left | {{{\left ({{i - m_{i,3}}} \right)} / {m_{i,1}}}} \right |^{2m_{i,2}}}} \right]},} \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad {1\le i\le 3} \\ {\mu _ {b_{i-3}} \left ({{i_{2}}} \right) = 1 / {\left [{{1+\left | {{{\left ({{i - m_{i,3}}} \right)} / {m_{i,1}}}} \right |^{2m_{i,2}}}} \right]},} \\ {\mu _ {c_{i-6}} \left ({{i_{3}}} \right) = 1 / {\left [{{1+\left | {{{\left ({{i - m_{i,3}}} \right)} / {m_{i,1}}}} \right |^{2m_{i,2}}}} \right]},} \\ \qquad \qquad \qquad \qquad \qquad \qquad \qquad {7\le i\le 9} \\ \end{cases}\quad \end{equation*}\end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mu _ {ai}(\cdot) $\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mu _ {bi\mathrm {-3}}(\cdot) $\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mu _ {ci\mathrm {-6}}(\cdot) $\end{document} are three kinds of the membership functions, which are calculated using the mf parameter set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m=$\end{document}{\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,2}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $m_{i,3}$\end{document}}. In layer 2 and 3, outputs \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $o_{\mathrm {2},i}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $o_{\mathrm {3},i}$\end{document} are defined as the following (10) and (11), respectively:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{align} o_{2,i}=&{w}_{i} = \mu _ {a_{k}} \left ({{i_{1}}} \right) \mu _ {b_{l}} \left ({{i_{2}}} \right) \mu _ {c_{m}} \left ({{i_{3}}} \right), ~~ 1\le i\le 27 \\ o_{3,i}=&\frac {w_{i}}{\sum \limits _ {j} {w_{j}}}\left ({{r_{i,1} i_{1} \!+\!r_{i,2} i_{2} \!+\!r_{i,3} i_{3} + r_{i,4}}} \right), ~~ 1\le i\le 27\qquad \notag \\ {} \end{align} \end{document} where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,1}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,2}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,3}$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r_{i,4}$\end{document} are the lr parameter set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $r$\end{document}. The output of layer 4 is as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \begin{equation *} o_{4,1} = f=\sum \limits _ {i} {\frac {w_{i}}{\sum \limits _ {j} {w_{j}}}f_{i}} = \frac {\sum \limits _ {i} {w_{i} f_{i}}}{\sum \limits _ {i} {w_{i}}} \end{equation*}\end{document} the equation (12) produces a single coordinate of the predicted respiratory signal, i.e., \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $y$\end{document}, or \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $z$\end{document} estimation . As mentioned above, the proposed iifdl uses three fdls for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $x$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $y$\end{document}, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $z$\end{document} coordinates, so that we can derive estimated 3d coordinates of breathing signals from those fdls . We describe the experimental data for intra- and inter - fraction motion, in subsection \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $a$\end{document}. The experimental result of patient clustering based on breathing features are presented in subsection \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $b$\end{document}, and we evaluate the prediction performance of the proposed iifdl in subsection \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c$\end{document}. Breathing data of 130 patients were collected in georgetown university medical center using the cyberknife synchrony (accuray inc . The collected data contained no personally identifiable information, and the research study was approved by the georgetown university irb . During data acquisition, three sensors were attached around a target position on the patient s body . Individual patient s database contains datasets recorded through three channels by led sensors and cameras . Each database contains a record time, 3d coordinates, and rotation data of three channels . The intra - fractional variation dataset had 130 databases, and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . Each database contains a record time, 3d coordinates, and rotation data of three channels . The intra - fractional variation dataset had 130 databases, and the inter - fractional variation dataset consisted of 32 databases with at least 1-hour time difference in - between . Sampling frequencies for patients variation data were 5.20, 8.67, and 26hz, corresponding to the measurement intervals, 192.30, 115.38, and 38.46ms . Each database contains calibrated datasets of a record time, 3d coordinates, and rotational data of three channels . During the training procedure, we randomly extracted 1000 samples for each patient . The obtained samples regarding the measurement intervals were about 0.63min for 38.46ms, 1.92min for 115.38ms, and 3.2min for 192.30ms . Table 4 shows experimental data of intra- and inter - fractional variation . In the intra - fractional variation dataset, all of 130 databases were used, and training and test data were randomly selected within 1-hour time range . In the inter - fractional variation dataset, however, we selected 32 databases . Training and test data were selected with at least 1-hour time difference in - between them for the inter - fractional variation dataset . This time scale is not on the day - to - day level as the standard definition of the inter - fractional variation, but it meets the inter - fractional time scale condition of . Actual inter - fractional motion data might be larger than data we chose because changes occurred in fractions on different days such as weight gain or loss were not contained in experimental data.table 4experimental data.data typeintra - fractional variationinter - fractional variationpatient #13032measurement intervals (ms)38.46, 115.38, and 192.30inputsestimated tumor locationoutputsnext tumor position in the current fractiontraining dataprevious tumor location data in the current fractiontumor location data in the previous fractionstest datacurrent tumor location data in the current fractioncurrent tumor location data in the current fraction we present the patient clustering results with the calculated criterion function values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document}. Fig . 4(a) shows criterion function values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} regarding the number of clusters, where we represented the proposed iifdl as a red line with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vartriangle $\end{document} maker, and the alternate cnn as a blue dotted line with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\blacktriangledown $\end{document} marker . 4(b) and 4(c) show criterion function values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of iifdl and cnn with regard to the possible breathing feature combination . Figure 4.criterion function values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of the proposed iifdl and cnn: (a) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of iifdl and cnn according to the number of clusters, (b) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of iifdl according to the breathing feature combination, and (c) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of cnn according to the breathing feature combination . In iifdl, the number of cluster \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} was 11 and the optimal breathing feature combination y was chosen as brf and mle by (8). In cnn, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} was 12 and its y was a combination of acc, vel, and pca . Criterion function values \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of the proposed iifdl and cnn: (a) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of iifdl and cnn according to the number of clusters, (b) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of iifdl according to the breathing feature combination, and (c) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of cnn according to the breathing feature combination . In iifdl, the number of cluster \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} was 11 and the optimal breathing feature combination y was chosen as brf and mle by (8). In cnn, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} was 12 and its y was a combination of acc, vel, and pca . The proposed iifdl selected the number of cluster \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} as 11 with the maximum \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document} of 5.825 as shown in fig . The optimal breathing feature combination y was chosen with brfand mle by (8) as shown in fig . The alternate cnn selected the number of cluster \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $c_{final}$\end{document} as 12, and its y was chosen with acc, vel, and pca as shown in fig . The reason of their different clustering results is that iifdl uses respiratory feature vectors, whereas cnn uses the magnitude values of respiratory feature vectors . Considered all possible 247 combinations from 8 features (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\sigma _ {i}~_{8}\text{c}_{i}$\end{document}, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1 <i \le 8 $\end{document}), the combination chosen by cnn had a local maximum value of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document}, as shown in fig . Thus, the combination of acc, vel, and pca cannot be ythat has the maximum \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $j$\end{document}. Therefore, cyberknife patient databases were grouped into 11 classes using the proposed iifdl, and the clustering results for intra- and inter - fractional variation data are presented in table 5.table 5patient database clustering.class number1234567891011total #of data - basesintra - fractional variation183522726192118130inter - fractional variation1110156n / a2n / a1532 in table 5, 130 databases of the intra - fractional variation and 32 databases of the inter - fractional variation were grouped into 11 and 9 classes, respectively . Each class showed the similar breathing features regardless of the variation type . In the intra - fractional variation, some classes (e.g. Class 1, 4, 7, 9, and 10) have only one or two patients . They are most likely considered as the irregular respiratory signals, due to their less feature similarities with other patients breathing signals . Class 2 and 8 for the inter - fractional variation also have highly few patients, but we do not consider these classes as the irregular breathing signals . It is difficult to judge the scarcity of class 2 and 8 based on the few number of intra - fractional variation databases, also these two classes were already considered as regular breathing groups for the intra - fractional variation . In this subsection, we compare the prediction performance of the proposed iifdl with existing methods . Especially, previous methods for the inter - fractional movement are mathematical models depending on predefined scenarios of patients variation, without the self - learning feature . The prediction performance of these methods is susceptible to how many potential scenarios were considered . In other words, there is a practical limitation to get decent performance results in the experiment with those mathematical models . Accordingly, we chose the existing methods for intra - fractional prediction, cnn and hekf, as the comparison targets, and we applied the selected methods to the case of the inter - fractional variation . The predictors used in cnn and hekf are nn and a combination of nn and kf, respectively, as mentioned in section i. thus, these methods have the self - learning feature . Furthermore, cnn is the prediction approach designed for multiple patients motion like the proposed iifdl . We evaluate the prediction performance of iifdl using by the following three criteria: root - mean - square error (rmse), overshoot, and prediction time . 5 shows prediction results of two databases by iifdl, cnn, and hekf, with 115.38ms interval as a median of [38.46, 192.30ms]. 5 (a) and 5 (b) present the prediction results of the intra - and inter - fractional variation datasets . Here, a horizontal axis is the time index extracted from cyberknife data . A black line is a measurement, a red line with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\vartriangle $\end{document} marker illustrates predicted values by the proposed iifdl, a blue dotted line with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\blacktriangledown $\end{document} marker is the estimated results of cnn, and an orange dotted line with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\blacktriangleright $\end{document} marker represents the estimation results of hekf . Also, two green dotted lines are upper and lower boundaries of target data, respectively . Figure 5.prediction results for (a) intra- and (b) inter - fractional variation by iifdl, cnn, and hekf: (a) db47 and (b) db121 with 115.38ms interval . The estimated values of the proposed iifdl were closer to the target values, i.e. Measurements, than those of cnn and hekf . Prediction results for (a) intra- and (b) inter - fractional variation by iifdl, cnn, and hekf: (a) db47 and (b) db121 with 115.38ms interval . The estimated values of the proposed iifdl were closer to the target values, i.e. Measurements, than those of cnn and hekf . 5, the estimated points of the proposed method iifdl were closer to the target values than those of cnn and hekf . In fig . 5, many points of cnn were distributed near or out of the boundaries, and most of the points of hekf were out of the range between upper and lower boundaries . However, the predicted values of iifdl were within the boundaries in most cases . The rmse comparison of the intra - fractional variation of each patients class showed that the proposed iifdl, cnn, and hekf had the similar rmse values overall, and iifdl outperformed cnn and hekf particularly in class 4 considered as irregular breathing signals . For the inter - fractional variation of each patients class, the experimental result also validated that the proposed iifdl is less vulnerable to the breathing irregularity . In table 6, we summarized the average rmse and standard deviation values of iifdl, cnn, and hekf for each different measurement interval . Based on those results, we also derived improvement rate of iifdl, determined by the following formula: (rmse average of cnn / hekf - rmse average of iifdl)/rmse average of cnn / hekf \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\ast ~100 $\end{document}%.table 6rmse comparison.variationintra-fractional variationinter - fractional variationmeasurement interval (ms)38.46115.38192.30average38.46115.38192.30averageiifdl (mm)0.190.210.290.410.510.750.330.460.120.280.280.730.732.060.381.02imp . Rate) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} (average of cnn / hekf - average of iifdl) / average of cnn / hekf * 100% . . Rate) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} (average of cnn / hekf - average of iifdl) / average of cnn / hekf * 100% . For given the measurement intervals of the intra - fractional variation in table 6, the rmse results presented that all the average rmse and standard deviation values of iifdl were lower than those of cnn and hekf, except the interval of 192.30ms . Although iifdl was worse than hekf in comparison on the average rmse result for the time interval of 192.30ms, the average rmse of iifdl was 0.03 mm larger than that of hekf, which is a relatively small difference . With decreased time interval from 192.30 to 38.46ms, the proposed iifdl had the more improvement rate from 11.81 to 90.54% for cnn and 6.86 to 54.36% for hekf . In the total results, the proposed method had the standard deviation of 0.46 mm, whereas cnn and hekf had fluctuating rmse values with the standard deviation of 6.16 mm and 0.92 mm . In comparison to the existing methods, the proposed iifdl improved 38.27% and 21.69% of the average rmse values, for each cnn and hekf, in the experiment of the intra - fractional variation . As show in table 6, the experimental results for the inter - fractional variation represent that all rmse values of iifdl were lower than those of cnn and hekf . The proposed iifdl improved rmse more when the time interval was smaller, which is the same as the experimental results of the intra - factional variation . The proposed iifdl with the overall standard deviation of 1.02 mm showed higher error stability than cnn and hekf with the overall standard deviation of 3.86 mm and 3.53 mm . Moreover, iifdl enhanced 59.02% and 60.44% of rmse in comparison to cnn and hekf as shown in table 6 . Therefore, we can expect that the proposed method contributes to the radiotherapy by providing higher prediction accuracy and error stability . The prediction overshoot rate is also one of the criteria that enable to assess prediction accuracy of rmse, and it can be defined as a ratio of the estimated points are out of the boundary ranges to the total ones, here the range was determined by the 95% prediction interval of target data . 6 presents the overshoot results by iifdl, cnn, and hekf for the intra - fractional variation . The measurement interval was 115.38ms, which is a middle interval of [38.46, 192.30ms]. A horizontal axis is the patient database number, and a red, blue, and orange bar indicate the overshoot value of iifdl, cnn, and hekf, respectively . The measurement interval is 115.38ms, which is a middle interval [38.46, 192.30ms]. The proposed iifdl had less variation of the error values only up to 9.1%, but cnn and hekf showed occasionally huge overshoot results almost 100% . The measurement interval is 115.38ms, which is a middle interval [38.46, 192.30ms]. The proposed iifdl had less variation of the error values only up to 9.1%, but cnn and hekf showed occasionally huge overshoot results almost 100% . 6, the proposed iifdl had less variation of the error values only up to 9.1%, but cnn and hekf showed occasionally huge overshoot results almost 100% . In the same vein with the experiment of rmse, the proposed method improved overshoot performance with higher stability in databases we utilized . In fig . 7, we show the overshoot results of iifdl, cnn, and hekf for the inter - fractional variation to demonstrate the stability of the proposed iifdl . The measurement interval is 115.38ms, which is a middle interval [38.46, 192.30ms]. However, cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . The measurement interval is 115.38ms, which is a middle interval [38.46, 192.30ms]. However, cnn and hekf had large overshoot results up to 100% and wider variance of the overshoot rates than the proposed iifdl . There was no overshoot value in class 10 . As the experimental results of intra - fractional variation, cnn and hekf had wider variance of the overshoot rates than the proposed iifdl . 7, the existing methods, cnn and hekf had large overshoot results up to 100% . However, the maximum overshoot value of the proposed iifdl was 8.4% . In table 7, we summarized average overshoot rates and their standard deviation values of iifdl, cnn, and hekf for each measurement interval.table 7overshoot comparison.variationintra-fractional variation (%) inter - fractional variation (%) measurement interval (ms)38.46115.38192.30average38.46115.38192.30averageiifdl4.652.443.902.123.692.294.082.284.202.533.722.333.552.273.822.38imp . Rate over cnn 57.9763.7479.0066.9085.6783.6171.8180.37imp . Rate) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} (average of cnn / hekf - average of iifdl) / average of cnn / hekf * 100% . Improvement rate (imp . Rate) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} (average of cnn / hekf - average of iifdl) / average of cnn / hekf * 100% . As shown in table 7, all average overshoot rates of the proposed iifdl are considerably lower than those of cnn and hekf, in both experimental results for the intra- and inter - fractional variation . Furthermore, standard deviation values of the overshoot rate had remarkable differences in between iifdl and two other methods . For the intra - fractional variation, the total standard deviation values of iifdl, cnn, and hekf were 2.28%, 26.78%, and 28.26%, respectively . Overall results for the intra - fractional variation showed that the proposed method improves the overshoot percentage by 66.90% for cnn and 74.96% for hekf . For the inter - fractional variation, also, iifdl markedly reduced not only the average overshoot percentage but also the standard deviation . The overall improvement rates of iifdl was 80.37% for cnn and 86.17% for hekf in the experiment for the inter - fractional variation . To evaluate and compare effects on the computational complexity by the proposed iifdl, we measured average cpu time of each prediction method using a pc with intel core i7 3.07 ghz and 16.0 gb ram . Table 8 compares the computing time of iifdl, cnn, and hekf for each measurement interval used in the experiment, where time difference represents the difference of the computing time between the previous methods and iifdl.table 8computing time comparison.variationintra-fractional variation (ms)inter - fractional variation (ms)measurement interval (ms)38.46115.38192.30average38.46115.38192.30averageiifdl1.324.911.615.061.705.071.545.011.324.911.615.061.705.071.545.01time diff . From cnn 252.60250.99254.74252.78253.16249.94251.32251.47time diff from hekf 251.76251.47252.82252.02250.72253.36249.85251.31atime difference (time diff .) \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} computing time average of cnn / hekf - computing time average of iifdl . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $= $\end{document} computing time average of cnn / hekf - computing time average of iifdl . In the experimental results for the intra - fractional variation of table 8, iifdl had the average computing time of 1.54ms and the standard deviation of 5.01ms, for all databases and intervals . The average computing time and the standard deviation were 254.32ms and 11.68ms for cnn and 253.56ms and 10.74ms for hekf . Thus, the total average of the time difference reduced by iifdl was 252.78ms for cnn and 252.02ms for hekf . For the inter - fractional variation, the average computing time of the proposed iifdl was 1.54ms and its standard deviation was 5.01ms throughput all databases and measurement intervals . The average computing time and its standards deviation were 253.01ms and 9.17ms for cnn, and 252.85ms and 6.17ms for hekf . In the experiment for the inter - fractional variation, the total average of the time difference reduced by iifdl was 251.47ms for cnn and 251.31ms for hekf . As we mentioned in section ii, the proposed fdl, requires less prediction parameters than cnn and hekf . Accordingly, the proposed iifdl could reduce the computing time immensely as shown in the experimental results in table 8 . Moreover, iifdl and cnn train the multiple breathing signals simultaneously based on the respiratory feature similarities . For instance, there were 35 intra - fractional variation databases of patients in class 2, and hekf needed to train the respiratory signals 35 times more than iifdl and cnn, to acquire the prediction results . Thus, the proposed iifdl is expected to improve the prediction speed maintaining the prediction accuracy during the treatment session in the clinical perspective . Table 9 compares the two kinds of variation regarding rmse, overshoot, and computing time.table 9experimental result comparison of intra- and inter - fractional variations.variationintra-fractional variationinter - fractional variationrmseiifdl average (mm)0.330.38cnn average (mm)0.970.98hekf average (mm)0.421.01improvement rate (cnn (%) /hekf (%)) 38.27/21.6959.02/60.44overshootiifdl average (%) 4.083.82cnn average (%) 13.1421.54hekf average (%) 16.6229.89improvement rate (cnn (%) /hekf (%)) 66.90/74.9680.37/86.17computing time (ms)iifdl average1.541.54cnn average254.32253.01hekf average253.56252.85time difference (cnn / hekf)252.78/252.02251.47/251.31 for rmse and overshoot of the previous methods cnn and hekf, results of the inter - fraction variation were worse than those of the intra - fractional variation as shown in table 9 . This is because the respiration variability for the inter - fraction is larger than that for the intra - fraction . On the other hand, iifdl showed similar rmse and overshoot results for both intra- and inter - fractional variation . Due to the reasoning capability of iifdl for uncertainty, the proposed iifdl achieved the similar level of the prediction results with the intra - fractional variation in the experiment for the inter - fractional variation . The proposed iifdl reduced it less than 2ms, which were over 250ms in the previous methods, cnn and hekf . Additionally, this implies that iifdl can be used in real - time applications as the proposed method can estimate the next respiratory signal before it comes . Specifically, the next breathing signal will come with the interval of 38.46ms to 192.30ms, and iifdl can calculate the estimated value within 2ms on average that is before termination of the time interval . We provide more comparison with other previous methods,,,,, in table 10, to verify the accuracy performance of iifdl . The previous methods in table 10 were referred to in section i. as shown in table 10, the proposed iifdl had the lowest error results among 9 methods . However, comparability is limited as experiments were not conducted in the identical environment . Table 10error comparison with previous methods.methodiifdlcnn hekf af, siso af / miso af kf, nn, lp cubic intra - fractional variation (mm)0.330.920.58<2.01.58 / 1.71<2.5<2.51.2n / ainter - fractional variation (mm)0.380.981.01n / an / an / an / a4.64.7 in a curative setting, high radiation doses need to be delivered with high precision, and safety margines need to be added to the target to ensure sufficient dose coverage . However, safety margins and resulting side effects of radiotherapy compromise the ability to deliver tumoricidal treatment doses . As a result, local tumor reccurences occur in 30% of conventionally fractionated treatments and less than 10% of stereotactic applications . Respiratory tumor motion range and consistency vary with patient, within one fraction and between repeated fractions with change in tumor motion range> 3 mm in 20% of fractions . In addition to addressing intra - fractional variation, this paper also investigated prediction for inter - fractional variation that might be larger than intra - fractional variation and therefore more challenging to address . Compared to currently applied population - averaged margins between 3 and 10 mm in motion - inclusive treatment, margins can be significantly reduced according to the residual prediction error for the individual patient using motion - tracking and iifdl . The proposed iifdl can contribute to treatment planning to improve delivery accuracy, by adjusting the treatment field position according to the predicted intra- and inter - fractional variation . Based on the experimental results above, we have validated that the proposed iifdl can estimate the next breathing signal before the next incoming signal arrives . Therefore, iifdl is expected to achieve real time prediction in a stream computing environment if the prediction system tolerates measurement delay of respiratory signal . Future studies may seek to identify correlations between tumor location in the lung, as well as patient - related parameters and comorbidities and predicted intra- and inter - fractional variation to even further improve prediction accuracy . In addition, further study can be conducted on prediction with other machine learning methods to improve prediction accuracy of tumor motion, which have not been introduced yet for estimating intra- and inter - fractional variation, such as support vector machines, . Based on this algorithm, we also proposed the specific estimation method for intra- and inter - fractional variation of multiple patients, called iifdl . Our approach has three main contributions to prediction of patients motion during a single treatment session and between different fractional sessions . First, the proposed method is the first study on the modeling of both intra- and inter - fractional variation for multiple patients respiratory data, collected from the cyberknife facility . Second, the proposed iifdl might enhance tumor tracking techniques due to its high prediction accuracy . Third, the proposed fdl, the predictor used in iifdl, has a much shorter computation time than other methods, so that the proposed iifdl shows the optimistic perspective on real - time prediction . The experimental results validated that the rmse value of the proposed iifdl was improved by 38.27% of cnn and 21.69% of hekf for the intra - fractional variation . For the inter - fractional variation, iifdr improved the average rmse values by 59.02% for cnn and 60.44% for hekf . The iifdl also improved the prediction overshoot by 66.90% for cnn and 74.96% for hekf for the intra - fractional variation . In a case of the inter - fractional variation, for the average computing time, the previous methods spent over 250ms for computation, but the proposed iifdl consumed less than 2ms . The outcomes of rmse and prediction overshoot demonstrate that the proposed method has more of a superb prediction performance than existing approaches . Particularly, computation time results showed that iifdl can be considered as a suitable tool for real - time estimation.
|
Calcific aortic valve stenosis has become the most common acquired valve disorder with the highest prevalence in the 8th or 9th decade of life . Comorbidities such as diabetes mellitus, stroke, coronary heart disease, peripheral artery disease, pulmonary disease, and renal impairment appear to markedly increase the risk of conventional valve replacement in the elderly and may limit the benefit of surgery in these patients . Nevertheless, the outcome of untreated aortic stenosis is dismal once congestive heart failure, angina pectoris, or syncope occur . Therefore alternative, less invasive treatment options are needed . Since the first - in - man transcatheter aortic valve implantation (tavi) by cribier et al . In 2002, more than 50000 procedures were performed worldwide and this intervention has become an accepted assumingly less invasive treatment alternative for high risk surgical patients . However, due the comorbidities in these patients, even tavi is associated with a number of complications that may lead to impaired outcome . Their closer evaluation and the definition of risk factors as well as measures to reduce their occurrence are essential and require further research . Acute kidney injury (aki) is a well - known complication of angiography with the use of iodinated contrast media that accounts for a significantly prolonged hospital stay and worse in - hospital outcome . Furthermore aki has been shown to be an independent predictor of mortality [58]. The most important risk factor for aki in patients undergoing standard heart catheterization is preexisting chronic kidney disease [9, 10]. Other risk factors include volume depletion, hemodynamic instability, and the use of nephrotoxic drugs . Tavi requires the administration of contrast media and preexisting kidney disease is frequent in the currently treated patient population . However, the incidence of aki, predictors of this complication, and its impact on outcome in patients undergoing tavi have so far been poorly defined . Therefore, we sought to assess the incidence of aki, search for its predictors, and analyze its impact on 30-day as well as midterm outcome in a sizeable group of consecutive patients undergoing tavi . A total of 150 consecutive patients with symptomatic aortic stenosis who underwent tavi in our institution because they were either not suitable for conventional surgical valve replacement or were considered at high operative risk by a multidisciplinary team including cardiologists and cardiac surgeons were included in this study . Ten out of 150 patients had been enrolled in a chronic dialysis program and were therefore excluded from analysis concerning aki . Before intervention, all patients received left and right heart catheterization . According to the institution policy, written informed consent blood samples for hematology and serum chemistry were drawn one day prior to intervention and daily up to 72 hours after treatment . Patients with a previously impaired kidney function (estimated glomerular filtration rate, egfr <60 ml / min/1,73 m) received an intravenous prehydration protocol consisting of saline 0.9% with 1200 mg of n - acetyl - cysteine both 12 hours before and after the procedure . The vascular access site was evaluated by color - coded doppler sonography and ct - angiography . Valve replacement was performed under general anaesthesia, except in one case which was done under local anaesthesia . All procedures were performed in the catheter laboratory using fluoroscopic guidance and nonionic isoosmolar contrast media iopromide (ultravist 370 (tm), schering ag, berlin, germany) and transoesophageal echocardiography . The patients received either a 23 or 26 mm edwards - sapien valve prothesis . Renal function at baseline and after 48 hours was determined from serum creatinine determined by the method of jaff . Since creatinine is known to be an insufficient marker of renal function but estimated glomerular filtration rate (egfr) is considered most suitable we used the modification of diet in renal disease (mdrd) formula for calculation: (1)egfr (ml / min/1,73 m2) = 186(creatinine, mg / dl)1,154(age, years)0,203 (0,742 in women). Acute kidney injury is divided into three stages by the acute kidney injury network: stage 1 is defined as a rise in serum creatinine 26.5 mol / l compared to baseline values or an increase in serum creatinine of more than or equal to 50% or a reduction in urine output as documented oliguria of less than 0.5 ml / kg per hour . In this study aki was defined as a 26.5 mol / l rise in serum creatinine 48 hours after procedure compared to baseline data drawn 24 hours before intervention . Logistic euroscore was calculated by the web - based system (http://www.euroscore.org/) in advance and results taken for clinical decision making . Sts score was evaluated retrospectively for further analysis including the predicted risk of renal failure (http://209.220.160.181/stswebriskcalc261/de.aspx). Renal failure by sts score is defined as an increase of serum creatinine> 176.8 mol / l, a 50% or greater increase in serum creatinine over baseline preoperative value, or new requirement for dialysis . Differences in basic clinical characteristics between groups were tested by chi - square test for categorical and the anova f - test for continuous variables . Uni- and multivariate predictors of aki were assessed by logistic regression analysis and odds - ratios (or) are reported . Univariate predictors of mortality during followup were analyzed by cox regression and calculation of hazard rate ratios (hr) with 95% confidence intervals (95% ci). Multivariate analysis of mortality was performed by cox regression analyses with potential covariates (adjusted hr). As covariates for adjustment, those parameters were chosen which were found to have a p value lower than 0.05 in univariate analyses of death . The mean age in the patient group was 81 7 years . In total, 96 patients received valve replacement via transfemoral (tf) and 54 patients via transapical (ta) approach . Patients with transapical approach were more frequently male and had significantly more underlying comorbidities such as hypertension, pad, chd, previous cabg, previous stroke, and impaired kidney function based on baseline serum creatinine measurement (see table 1). Ten patients (7%) had already been enrolled in a chronic dialysis program before intervention (5% of tf versus and 9% of ta patients, p = 0.006) and were therefore excluded from analysis concerning aki . The average amount of contrast media used in all patients was 147 58 ml . Patients with transfemoral approach received with 160 57 ml of contrast media a significantly greater amount than patients with transapical access who received 125 53 ml (p <0.0001). The rate of aki after pre - tavi diagnostic right and left heart catheterization in our patient population was 9.2% (n = 13). Only 4 patients (2.8%) developed aki after both diagnostic coronary angiography and tavi procedure (median 15 days between diagnostic catheterization and valve procedure). After exclusion of the ten patients who had already been enrolled in a chronic dialysis program before tavi, 140 patients were left for the analysis concerning the occurrence of acute kidney injury . Two patients without aki needed short - term dialysis (one patient was hemofiltrated due to low cardiac output and consecutive renal impairment, another patient acquired septic shock with renal failure). There was no significant difference regarding weight, height, baseline creatinine, and hemoglobin values in pts . Who developed aki after intervention compared to those who did not (see table 2). Patients with aki were significantly younger (79 9 yrs versus 82 6 yrs, p = 0.008) and had more frequently comorbidities such as hypertension and previous cabg whereas differences in peripheral arterial disease, cerebrovascular disease, chd, and hypercholesterolemia did not reach statistical significance . This difference did not also reach statistical significance which could have been due to the sample size . The amount of contrast media used during the procedure was also very similar between groups (147 71 ml versus 148 56 ml, p = 0.93). With aki than in those without aki (20 12 days versus 15 10 days, p = 0.03). Both, 30-day - mortality (29% versus 7%, p <0.0001) and cumulative mortality after a median followup of 309 days were significantly higher in aki patients (43% versus 18%, p <0.0001). Aki was associated with significantly worse survival (hrr 2.7, ci 1.345.41, p = 0.006, figure 1(a)). Mortality in aki pts . Was even higher (hrr 3.8, ci 1.3710.37, p = 0.01, figure 1(b)) after adjusting for risk factors (age, diabetes, pad, hypertension, previous myocardial infarction and cabg, left ventricular dysfunction, amount of contrast dye, baseline creatinine, and hemoglobin). Predictors of aki occurrence in univariate and multivariate regression analysis are shown in tables 3 and 4 . Of all included variables (age, diabetes, hypertension, pad, previous cabg, myocardial infarction, left ventricular function, baseline creatinine, and hemoglobin and amount of contrast dye) only age was found to be significantly associated with aki in univariate analysis and was detected as an independent predictor of aki in multivariate analysis (or 0.93, ci 0.870.99, p = 0.03). Including vascular access site in the model, transapical approach was also a significant predictor of aki (or 1.8, ci 1.8518.4, p = 0.003). Neither euroscore (27 19% versus 23 13, p = 0.18) nor sts score (6.0 3.5% versus 6.0 3.4%, p = 0.97) predicted the marked difference in mortality rates between aki and non - aki pts (figure 2). When applying the sts score renal failure definition to our patient population, 19 pts . However, the predicted rate of renal failure by sts score was only 7.3% (p = 0.023) for all pts . The predicted risk for renal failure based on the sts score did not significantly differ between the ta and tf treatment groups (6.8 3.5% versus 8.3 5.1%, p = 0.054). The observed rate of aki was however significantly higher in the ta group (31% versus 11%, p = 0.001) and exceeded thereby markedly the predicted rate of renal failure 1.6-fold in the tf and 3.7-fold in the ta pts . Acute kidney injury after the use of iodinated contrast media in angiography is known to account for a number of adverse effects such as prolonged hospital stay and to be an independent risk factor of mortality [710]. Several investigators have shown that aki is a relatively frequent complication after tavi and that it is associated with an increased mortality [1417]. However it remains unclear which of the underlying comorbidities contribute most to the adverse outcome following aki . Moreover, reliable predictors of aki in this patient population still need to be defined . In particular, the value of risk scores developed for patients who undergo open heart surgery remains so far unknown . In the present study, . Found very similar rates with 19% for aki and 2% for temporary dialysis . While bagur et al . Reported a lower rate of aki (11%) and need of dialysis after tavi (1.4%), aregger et al . And kong et al . Found markedly higher rates of 28% and 7.4%, and 28.8% and 6%, respectively . One explanation for this wide variation of aki rates could be that the average amount of contrast media used in these studies differed markedly, too . While it was 148 ml in the present study, bagur et al . With the lowest rate of aki reported <100 ml . In contrast, aregger et al . With the higher rate of aki used 242 ml on average . The amount of contrast media used during angiography is indeed considered one major risk factor for the development of aki . Nevertheless, in the present study no significant difference in contrast media use could be found between aki und non - aki patients . The observation that aki was not related to the amount of contrast used has also been reported by other groups [15, 16] suggesting that other factors may be more important for the development of renal impairment in the population currently undergoing tavi . Prehydration in addition to intravenous n - acetyl - cysteine application prior to contrast media exposure is a well - known measure to reduce aki rates in patients with renal impairment . In our study patients with an egfr <60 ml / min/1,73 m were treated with 1000 ml of saline 0.9% and 1200 mg of n - acetyl - cysteine which may have prevented more patients from experiencing aki than without these protective measures . Nevertheless, this prevention strategy in general and even more in this specific patient population is not effective enough to thoroughly avoid occurrence of aki . Therefore hydration therapy may have contributed to the nonsignificant association between baseline creatinine and acute kidney injury risk . Comparing aki rates and patients after diagnostic and tavi catheterization no correlation between aki after diagnostic and valve procedure could be seen implying the lack of a patient - inherent predisposition for aki occurrence after exposure to contrast media . This finding complies with the results of van linden et al . Who stated that early contrast media exposure (17 days) by cardiac catheter or ct - scan did not increase the risk of aki or rrt . In this context it should be kept in mind that after cardiac surgery without any use of contrast media, the rate of aki can also reach up to 30% with 1% requiring dialysis treatment [21, 22]. Bagur et al . Reported a 25% incidence of aki after surgical aortic valve replacement in patients with preprocedural chronic kidney disease compared to 12% in patients undergoing tavi . The markedly adverse effect of the occurrence of aki on the outcome of tavi underlines the importance of identifying predictors of this complication as well as appropriate measures for its prevention . In the present study, 30-day mortality and midterm mortality were as high as 29% and 43% in patients with aki compared to only 7% and 18% in those who did not develop this complication . The difference in survival was even more pronounced when adjusting for differences in baseline characteristics . Similar findings have been reported by other investigators [1417, 23]. Despite these rather consistent findings with regard to incidence of aki after tavi and its adverse impact on outcome, the data with regard to risk prediction and options for prevention of aki remain controversial . It appears obvious that preprocedural chronic kidney disease should be a major risk factor for the development of postprocedural aki . . Indeed showed impaired renal function with moderately elevated serum creatinine values before intervention and aki occurrence unrelated to the amount of contrast media to be the strongest predictors of 1-year mortality among tavi patients . Although baseline creatinine in the present study was slightly higher in the aki group (126.4 59.2 this may be due to small sample size and thus lack of statistical power . As a matter of fact, preinterventional serum creatinine was found to be a significant predictor of aki only in the study by elhmidi et al . Whereas several other studies could not confirm this observation [14, 15, 17, 19]. Paradoxically, younger age turned out to be the only independent preprocedural risk factor for the development of aki in the present study . This observation must be seen with caution . To qualify for tavi instead of conventional surgery, younger patients must assumingly have been markedly sicker than older patients . Hypertension was also found to be a predictor of aki in other studies [14, 19]. Without consistency, peripheral artery disease [15, 16], previous myocardial infarction, chronic obstructive pulmonary disease, systemic inflammatory response [16, 17], residual aortic regurgitation, and periprocedural red blood cell transfusion [14, 15, 19] have been reported to predict aki after tavi . In accordance with kong et al ., transapical tavi was found to be associated with a higher risk of aki in the present study . Although this could be partially due to the worse baseline characteristics of these patients, transapical access remained a significant predictor after consideration of such differences . Whether the more invasive nature of this approach, higher bleeding rates and requirement for blood cell transfusion account for this difference remains to be shown . In addition, similar to previous reports, the observed 30-day mortality was markedly lower than predicted by the logistic euroscore (11% versus 24%) whereas the sts score was indeed lower (6%). This is in agreement with the observation of piazza et al . Who found lower estimates of operative mortality by the sts score stating that this scoring system has suboptimal discriminatory power and calibration for tavi patients . Sts score as a surgical risk algorithm obviously omits several risk factors in the tavi population leading to different patient selection and thus mortality rates . The present study also demonstrates that sts score for prediction of renal failure has little value for prediction of renal failure after tavi . This underlines once more the importance of developing appropriate scores for the risk of death as well as of the risk of renal failure and other complications in patient populations currently treated with tavi . In addition to preexisting factors, hemodynamic instability with consecutive extreme hypotension caused by rapid pacing, balloon valvuloplasty, and prosthesis deployment during tavi may account for a significantly higher risk of aki in patients undergoing tavi compared to simple angiography or pci . This must be considered when developing measures to reduce the occurrence of aki after tavi . Although the data were collected prospectively in consecutive patients undergoing tavi, the analysis with regard to incidence and predictors of aki was performed retrospectively . Potentially relevant factors such as red blood cell transfusion, after procedure thrombocytopenia and hemoglobin drop, procedure time, hemodynamic complication or the use of angiotensin converting enzyme inhibitors, and/or angiotensin receptor blockers could not be evaluated . Although the study comprised a sizeable number of tavi patients, it reflects a single - center experience only and a much larger population is required to perform extensive multivariate analyses in order to better identify risk factors for the development of aki with relevant impact on the decision making in clinical practice . Its occurrence does not appear to be primarily related to the amount of contrast dye used . The occurrence of aki markedly increases hospital stay as well as 30-day and midterm mortality even after consideration of the baseline risk profile . Thus, improvements in predicting the risk of aki after tavi as well as effective measures to reduce the rate of this complication would be essential.
|
Study population - in total, 49 patients with chronic viral hepatitis, consisting of 28 hbv - infected patients and 21 hcv - infected patients, and 33 healthy, non - infected controls were included in the study . The patients were recruited from the clinic of infectious diseases of julio muller hospital (federal university of mato grosso, cuiab, state of mato grosso, central - west brazil). Chronic hbv infection was confirmed by persistent hbv surface antigenemia lasting more than six months . Chronic hcv infection was confirmed by the presence of hcv rna in blood tests . Cirrhosis was diagnosed by liver biopsy or based on clinical observations, laboratory tests or ultrasonographic evidence . Non - infected subjects were recruited from a group of healthy blood donors at the public blood bank of mato grosso state . Information about alcohol consumption, tobacco use, ethnicity and age was obtained from medical records and from an interviewer - administered questionnaire, which also included questions about exposure to mutagens and any history of cancer in the individual . Cytokinesis - block mns (cbmn) assay - the cbmn assay was performed as described by fenech and morley (1985), with minor modifications . In total, 5 l of venous blood was collected in heparin - vacutainer tubes (becton & dickinson, franklin lakes, nj, usa) and lymphocyte cultures (2 per subject) were established using 0.3 ml of whole blood added to rpmi-1640 medium (sigma - aldrich, st . Louis, mo, usa) supplemented with 20% foetal calf serum (cultilab, campinas, sp, brazil), 0.001% penicillin (vetec, duque de caxias, rj, brazil), 0.0005% streptomycin (sigma - aldrich) and 2% phytohemagglutinin (cultilab). After the cultures were incubated for 44 h at 37c in a bod incubator (eletrolab, so paulo, sp, brazil), cytochalasin b (sigma - aldrich) was added to the cultures (6 g / ml). The cells were harvested by centrifugation at 72 h after the culture was initiated . The lymphocytes were treated with a hypotonic solution (1% sodium citrate w / v) and fixed in a solution of methanol: acetic acid (3:1 v / v); in both cases, the solutions were ice cold and freshly prepared . The cell suspension was dropped onto a pre - cooled microscope slide and air dried before being stained for 5 - 7 min with 5% giemsa in sorensen phosphate buffer (0.06 m na 2 hpo 4 and 0.06 m kh 2 po 4, ph 6.8). Microscopic analysis was performed with a light microscope (nikon, melville, ny, usa) at 400x magnification . For each individual, 2,000 binucleated cells were analysed for the presence of mn, npbs and nbuds in accordance with previously established criteria (fenech et al . We calculated the frequency of each biomarker (number in 1,000,) using the following formula: of x = (number of x/2,000) x 1,000, where x is mn, npbs or nbuds (montero et al . Mutagen sensitivity evaluation - to determine mutagen sensitivity, the well - established mutagen dxr was used to treat lymphocytes from patients and non - infected subjects at 44 h after the culture was initiated . The cells were treated with 0.15 g / ml dxr (bergamo, taboo da serra, sp, brazil) diluted in sterile distilled water for 28 h, which brought the total culture time to 72 h. the experimental conditions for the dxr treatment were previously established in preliminary experiments . The conditions for cell harvesting and slide preparation were described in the previous section . Sensitivity to dxr was expressed as induced dna damage: [(mean mn after dxr)-(basal mean mn)]. Statistical analysis - an age comparison between groups was performed using one - way anova and the bonferroni post - hoc test . When the data exhibited unequal variance, the median numbers of mn, npbs and nbuds were compared between the groups using the non - parametric kruskal - wallis test followed by dunn s post - hoc test . Similarly, the median numbers of mn obtained in the mutagen sensitivity test were compared between the groups using the mann - whitney u test . The mean measurements of the induced dna damage were compared using the student s t test . The g - test or the test was used to compare ethnicity, sex, alcohol intake and tobacco intake between the groups . A linear regression model was constructed using the stata 8.2 software programme (statacorp, college station, tx, usa) to verify the independence of the frequencies of mn, npbs and nbuds from the virus type, sex, age, alcohol intake, tobacco intake and the use of antiviral drugs . The statistical analyses were performed using the statistical software programme bioestat 5.0 (ayres et al . Ethics - this study was approved by the ethical research board of julio muller hospital (protocol 439/cep - hujm/07) and informed consent to voluntarily participate was given by all of the subjects . Of the 49 patients included in the study, 28 were chronically infected with hbv (21 males and 7 females) and had a mean age of 36.1 years (ranging from 21 - 56 years), while 21 were chronically infected with hcv (13 males and 8 females) and had a mean age of 44.1 years (ranging from 27 - 55 years). The non - infected control group consisted of 23 males and 10 females with a mean age of 37.4 years (ranging from 20 - 52 years). No differences were observed between the non - infected group and the hbv or hcv - infected patients with regard to their sex (p = 0.97) and smoking habits (p = 0.16). The mean age was similar between the infected patients and the non - infected control subjects; however, the mean age of the hcv - infected patients was significantly higher than that of either the chronically hbv - infected group or the controls (p <0.05). Alcohol consumption among the study subjects ranged from 0 - 8 g / day and was more frequently reported by the non - infected control subjects (45.45%) than by the hbv - infected patients (17.86%) or the hcv - infected patients (14.28%) (p = 0.003). Cirrhosis was present in eight hbv - infected patients (28.6%) and three hcv - infected patients (14.29%) (p = 0.31) (table i). Seven patients (6 hbv - infected and 2 hcv - infected patients) were undergoing antiviral therapy at the time of the study (1 lamivudine and tenofovir, 2 ribavirin and -interferon and 3 tenofovir). Table idemographic and clinical characteristics of patients chronically infected with hepatitis b virus (hbv) or hepatitis c virus (hcv) and of control subjectsdemographic and clinical parameterscontrols (n = 33) n (%) total patients (n = 49) n (%) hbv (n = 28) n (%) hcv (n = 21) n (%) males23 (69.7)36 (69.4)21 (75)13 (61.9)females10 (30.3)15 (30.6)7 (25)8 (38.1)age (years) range37.4 10.4 (20 - 52)37.4 10.3 (20 - 55)36.1 10.36 (27 - 55)37.41 7.7 (20 - 52)smoking habit1 (3.03)8 (16.3)4 (14.3)4 (19.04)alcohol consumption15 (45.4) 8 (16.3)5 (17.9)3 (14.3)cirrhosis-11 (22.4)8 (28.6)3 (14.3) a: anova and bonferroni post - hoc test, p <0.05; b: g test, p = 0.004 . A: anova and bonferroni post - hoc test, p <0.05; b: g test, p = 0.004 . The numbers of mn, npbs and nbuds observed in the patient group were 7.01 3.23, 2.76 2.08 and 4.57 2.98, respectively . The frequencies of mn and npbs, but not nbuds, were significantly increased (p <0.0001) compared with the frequencies in the controls (4.41 2.15 and 1.15 0.97 for mn and npbs, respectively, in the controls). Considering the hbv - infected patients and the hcv - infected patients separately, the numbers of mn in the hbv - infected patients (7.18 3.57) and hcv - infected patients (6.78 2.80) were significantly higher than in the non - infected group (4.41 2.15) (p <0.0001). The numbers of npbs and nbuds in the hbv - infected patients (3.27 2.40 and 4.71 2.79, respectively) and in patients infected with hcv (2.09 1.33 and 4.38 3.28, respectively) were increased relative to those of the control group (1.15 0.97 and 2.98 1.31, respectively). However, only the difference between the hbv - infected group and the control group was statistically significant (p = 0.03) (table ii). The results were independent of age, sex, alcohol consumption, tobacco intake and the presence of cirrhosis for mn (r = 0.22, p = 0.02), npbs (r = 0.23, p <0.001) and nbuds (r = 0.15, p = 0.03). The antiviral therapy did not significantly influence any of the analysed parameters . The frequency of mn was significantly influenced by sex only for males aged <40 years in the control group, who showed a significantly lower frequency of mn (3.46 1.12) than did females (5.63 1.60) of the same age (p = 0.01). The frequency of mn and npbs was significantly higher in males, among all patients and within the hbv - infected group in comparison with the controls (p <0.01) (table iii). The frequency of npbs was significantly higher in females aged> 40 years in comparison with the controls (p <0.01). The frequency of mn, npbs and nbuds was not significantly higher in male patients with cirrhosis in comparison with male patients without cirrhosis (table iv). Table iifrequency of micronucleus (mn), nucleoplasmatic bridges (npb) and nuclear buds (nbuds) in hepatitis b virus (hbv) or hepatitis c virus (hcv)-infected patients and controlsgroupsmn (mean sd)npb (mean sd)nbuds (mean sd) controls (n = 33)4.41 2.151.15 0.972.98 1.31total patients (n = 49)7.01 3.23 2.76 2.08 4.57 2.98hbv (n = 28)7.18 3.57 3.27 2.40 4.71 2.79 hcv (n = 21)6.78 2.80 2.09 1.334.38 3.28 a, b: statistically significant in comparison to the controls (a: p <0.0001; b: p = 0.03; kruskal - wallis test with dunn s post - hoc test); sd: standard deviation .. a, b: statistically significant in comparison to the controls (a: p <0.0001; b: p = 0.03; kruskal - wallis test with dunn s post - hoc test); sd: standard deviation .. table iiithe effect of age and sex on frequency of micronucleus (mn), nucleoplasmatic bridges (npb) and nuclear buds (nbuds) n hepatitis b virus (hbv) or hepatitis c virus (hcv)-infected patients and controlsgroupsmn (mean sd)npb (mean sd)nbuds (mean sd) controls (n = 33) males <40 years (n = 14)3.46 1.12 1.32 1.312.86 2.67 males 40 years (n = 9)4.06 1.590.83 0.52.67 1.17 females <40 years (n = 4)5.63 1.601.50 0.824.13 0.85 females 40 years (n = 6)6.33 3.541.0 0.633.0 1.26total patients (n = 49) males <40 years (n = 14)6.79 4.49 3.5 2.97 4.03 2.45 males 40 years (n = 20)7.25 2.92 3.08 1.45 5.10 3.72 females <40 years (n = 6)6.92 2.853.0 2.344.0 2.61 females 40 years (n = 9)6.89 2.103.50 1.44 4.61 2.25hbv (n = 28) males <40 years (n = 12)6.71 4.82 3.27 3.14 4.42 2.45 males 40 years (n = 9)7.33 2.03 3.27 1.51 5.89 3.46 females <40 years (n = 4)7.0 3.633.25 2.963.25 2.90 females 40 years (n = 3) 8.83 1.533.12 0.484.33 0.76hcv (n = 21) males <40 years (n = 2)7.25 2.475.0 01.75 0.35 males 40 years (n = 11)7.18 3.59 2.67 1.37 4.45 3.97 females <40 years (n = 2)6.75 1.062.50 0.715.50 1.41 females 40 years (n = 6)5.92 1.663.80 1.92 4.75 2.79 a: statistically significant in comparison to females of the same age - class (p = 0.01, mann - whitney u test); b: statistically significant in relationship to controls of the same age class (p <0.01, anova, post - test student t or kruskal - wallis, post test student - newman - keuls); c: groups with n <4 were not included in statistical analysis; sd: standard deviation . A: statistically significant in comparison to females of the same age - class (p = 0.01, mann - whitney u test); b: statistically significant in relationship to controls of the same age class (p <0.01, anova, post - test student t or kruskal - wallis, post test student - newman - keuls); c: groups with n <4 were not included in statistical analysis; sd: standard deviation . The effect of cirrhosis on frequency of micronucleus (mn), nucleoplasmatic bridges (npb) and nuclear buds (nbuds) in males hepatitis b virus (hbv) or hepatitis c virus (hcv)-infected patientsgroupscirrhosis (n)mn (mean sd)npb (mean sd)nbuds (mean sd) total patientsno (23)6.82 4.102.98 2.533.67 1.75yes (11)7.54 2.272.68 1.585.00 2.59hbvno (15)6.56 4.363.26 2.914.13 1.72yes (8)8.25 2.233.06 1.685.25 2.39hcvno (9)7.31 3.802.43 1.632.81 1.53yes (3)7.00 2.901.66 cells from 15 chronically infected patients (9 hbv - infected and 6 hcv - infected patients) and 14 non - infected individuals were tested for dxr sensitivity . The numbers of mn were not significantly different between the hcv - infected and the hbv - infected patients; therefore, the patients were grouped together for comparison with the non - infected individuals to improve the statistical analysis . The patients exhibited significantly higher numbers of mn in both untreated (6.76 3.03, p = 0.03) and treated (15.03 4.94, p = 0.001) cells compared with the cells of non - infected individuals (4.25 1.45 and 9.39 3.39 in untreated and treated cells, respectively). Dxr treatment significantly increased the number of mn in both the control group (p = 0.0002) and the patient group (p <0.0001). The mean measurements of the induced dna damage were higher in the patient group (8.30 5.40) than in the non - infected control group (5.18 3.45). However, this difference was not found to be statistically significant, which was possibly due to a type 2 error (p = 0.06). Chronic hepatotropic virus (hbv and hcv) infections are characterised by potentially mutagenic cellular events, such as an increase in oxidative stress and viral integration into the dna of the host cell (farinati et al ., we demonstrated that the lymphocytes of hbv - infected patients and hcv - infected patients exhibited an increased frequency of mn compared with lymphocytes from healthy, non - infected individuals . However, these authors reported a higher frequency of chromosome breaks, leading to the formation of acentric chromosome / chromatid fragments that ultimately contributed to the formation of mn . Furthermore, the mn may have resulted from an inability of whole chromosomes to travel to the spindle poles during mitosis (fenech et al . . A higher frequency of chromosome gaps, aneuploidy and polyploidy in the peripheral blood mononuclear cells (pbmcs) of hcv - infected patients was reported previously (machida et al . The present results suggest that chronic infection with hbv or hcv accounts for chromosomal instability in lymphocytes and this phenomenon is characterised by the formation of acentric fragments and/or aneuploidy . Npbs may occur when dicentric chromosomes originating from chromosome breaks or telomere - to - telomere end fusions are pulled to opposite poles of the cell during mitosis . Nbuds are primarily considered to be formed from amplified dna that is being eliminated from chromosomes (fenech et al . Although gene amplifications (myc and erbb2) were demonstrated in hcc tissue samples that were infected with hbv or hcv (al - qahtani et al . 2010), no reports have described this genetic alteration in pbmcs from individuals with viral hepatitis . Dicentric y chromosomes have also been reported in the pbmcs of hcv - infected patients (machida et al . 2010). Together with our results, these data suggest that the chromosomal instability in lymphocytes that results from hbv infection (and likely also from chronic hcv infection) is characterised by the presence of dicentric chromosomes and gene amplification . In this study, females and subjects aged 40 years exhibited more mn than did males and subjects <40 years, respectively, among both controls and hbv - infected patients . Although these differences were not statistically significant, the results are in accordance with the well - known influence of sex and age on mn frequencies, as reported before (fenech 1998, bonassi et al . Reports on the effects of sex and age on npbs and nbuds are conflicting in the literature (donmez - altuntas & bitgen 2012, nefic & handzic et al ., we found statistically significantly higher frequencies of mn in males than in females; however, females did not present cirrhosis in our sample . It is known that dna damage levels in the leukocytes of hbv - infected patients and hcv - infected patients significantly correlate with the presence of liver lesions (farinati et al . In fact, in the current study, the frequencies of mn (in hbv - infected patients) and nbuds (in hbv - infected patients and hcv - infected patients) were increased in cirrhotic males, but this difference was not significant . Whether the extension of liver lesions in male patients is correlated with the frequency of mn found in lymphocytes is not completely clear in the sample investigated here . Even considering that the statistical analysis may have been influenced by the small size of our sample, these results should be considered with caution, especially because chromosome damage detected by the mn assay is an important biomarker for cancer prediction (bonassi et al . Hbv and hcv may contribute to increased chromosomal aberrations in infected cells by direct and indirect pathways . Regarding the indirect pathway, it has been shown that the presence of reactive oxygen species (ros) resulting from cytokine activity during chronic inflammation has a potent mutagenic effect (yan et al . A relationship between infection with hbv or hcv and increased production of ros, chromosomal aberrations and other dna damage has been reported previously (hagen et al . 1994, machida et al . 2010). Furthermore, leukocytes from patients who are chronically infected with hbv or hcv exhibit higher levels of 8-ohdg, which is the most frequent ros - induced base lesion (farinati et al . The integration of hbv into the human genome affects the expression of genes located near the site of insertion and also causes more widespread alterations of chromosomal stability (saigo et al . 2012). Because viral genome integration into the host dna also frequently occurs in the pbmcs of chronically hbv - infected patients (murakami et al . 2004), this process may contribute to genomic instability in these cells . Recently, it was demonstrated that in chronic hcv infection, the presence of double strand breaks occurs concomitantly with shortened telomeres in t lymphocytes . This phenomenon is associated with the level of fibrosis and may influence the response to treatment (hoare et al . 2013). The frequency of mutations is directly influenced by the efficiency of the dna repair mechanisms because failure to remove a lesion can facilitate mutational fixation . Extensive evidence has demonstrated that proteins produced by hbv and hcv interact with the proteins of the dna repair machinery and inhibit their functions in host cells (chen et al . Therefore, it is possible that the cells of infected patients exhibit less efficient dna repair mechanisms due to the effects of the viral proteins, which may contribute to the elevated frequency of dna damage detected in this study . Au et al . (2010) reported that when the cells of exposed populations (in this case, hcv - infected patients or hbv - infected patients) are challenged with a dna - damaging agent in vitro, the in vivo exposure - induced repair deficiency is dramatically amplified . Additionally, the deficiency will be detectable in a challenge assay as an increase in the number of chromosomal aberrations, mn or unrepaired dna strand breaks . It has been shown that b lymphocytes infected with hcv in vitro exhibit increased sensitivity to bleomycin due to the action of the ns3 protein and the core viral protein (machida et al . Furthermore, it was demonstrated that lymphocytes from hbv or hcv - infected hcc patients exhibit an increased sensitivity to bleomycin and benzo(a)pyrene - diol - epoxide, which is associated with an increased risk of cancer development (wu et al . The results obtained in the present study showed that the lymphocytes of hbv - infected patients and hcv - infected patients are not more sensitive to dxr than the lymphocytes of non - infected subjects . However, a challenge assay with other substances, such as bleomycin, needs to be performed to allow more definite conclusions about mutagen sensitivity in these patients . In summary, the present study demonstrated that the lymphocytes of patients who are chronically infected with hbv or hcv exhibit greater chromosomal instability, characterised by the presence of mn, npbs and nbuds . Although we did not observe a statistically significant result, a possible influence of cirrhosis on these parameters should be considered for further investigation.
|
Busy clinicians sometimes think twice before reading studies of animal models . Yes, it sounds interesting, but is it really going to change my practice? There is so much else i should be reading...this writer does not mean to cast aspersions on such an attitude - and, in fact, share sit, at least to some extent . The report in the previous issue of critical care by bangash and colleagues is one such study . Dopexamine is a dopamine analog that stimulates -adrenergic and dopamine 1 and 2 receptors, conferring some vasodilatory effects . Dopexamine has classically been considered a vasoactive agent with inotropic effects, perhaps with more prominent effects in some regional vascular beds . As such, dopexamine has been tested in clinical trials to optimize hemodynamics, either in patients with shock or as part of a perioperative regimen . Myocardial dysfunction occurs in a subset of patients with septic shock, so a strategy of increasing cardiac output and thus oxygen delivery in this setting made some sense . Implementation of this strategy using dobutamine, with or without norepinephrine, to improve cardiac output topredetermined supranormal levels in all patients did not improve outcomes [3 - 5], and use of inotropic therapy for this purpose is not recommended in current guidelines . Subsequent reports of potentially deleterious proinflammatory effects of catecholamines provided mechanistic support for their lack of efficacy when used indiscriminately . Use of dopexamine targeted to increase oxygen delivery to> 600 ml / minute / m, however, was shown in a randomized trial reported in 1993 to decrease mortality in the perioperative period . Whether this resulted from differential hemodynamic effects of dopexamine compared with other agents, perhaps selective vasodilation of regional circulations, or whether use of inotropes for perioperative optimization is different from their use in other settings some reports using perioperative dopexamine found reduced morbidity or mortality, confirming the initial study, but others found no difference from conventional treatment [10 - 12]. A patient - level meta - analysis suggested that some of the differences might be explained by the dose of dopexamine employed . Other studies indicated that dopexamine - in part due to 2-adrenergic effects, but also through other pathways - might have immunomodulatory effects, especially in the spleen . The current study investigated both hemodynamic and inflammatory effects of a low dose of dobutamine in a rodent model of endotoxemia . Dopexamine reduced the systemic inflammatory response to endotoxin, including cytokine release, endothelial adhesion molecules, and oxidative stress, without substantially changing systemic hemodynamics, either blood pressure or stroke volume . Regional flow, assessed by laser doppler in the mesenteric circulation, was also not changed by dopexamine - yet lactate levels and organ function were improved . While immunomodulatory effects of dopexamine were demonstrated in this study, these results contrast with those of a recent clinical investigation, also carried out by this same group, in which dopexamine improved global oxygen delivery, microvascular flow and tissue oxygenation but did not change the inflammatory response to surgery . Perhaps the difference could result in part from microcirculatory heterogeneity, something not assessed by the laser doppler methodology used in this study . Previous studies have shown that regional heterogeneity may be a good predictor of outcome in shock states, and such heterogeneity might contribute to both perfusion abnormalities and production of lactate in sepsis and other inflammatory states . Thus, while this study convincingly demonstrates immunomodulatory effects of dopexamine in this model, it seems possible that microcirculatory hemodynamic effects are also playing a role . This animal study addresses some of the mystery of why effects of dopexamine may differ from those of other catecholamines, but that mystery is not yet fully solved . Hemodynamics rule, and those who understand them rock, but this study reminds us that catecholamines have inflammatory effects that must be taken into account when considering their use . Animal studies are usually pursued as part of a reductionist approach aimed at controlling as many variables as possible in order to isolate mechanistic effects, but their interpretation and extrapolation to the clinical setting reminds us that in critical care, clinicians think of effects on different systems all together . Carefully conducted studies such as this one counteract the nihilistic tendency to think that mechanisms are too complicated and thus only hard clinical endpoints in patients are of any value, and encourage the sort of integrative approach that makes progress possible.
|
Development of the central nervous system (cns) is a complex process, which requires integration of many cellular processes including neural stem cell proliferation, migration, and neuronal differentiation . The major neuronal migration occurs in humans between the 12th and the 24th weeks of gestation and results in the formation of the cortical plate . However, the cortex continues to develop, and late migrations from the germinal matrix into the cerebral cortex continue until five months postnatally . Classification of neuronal migration disorders is based on morphological criteria and includes schizenccphaly, porencephaly, lissencephaly, argyria, macrogyria, pachygyria, microgyria, and micropolygyria . Pathogenesis of these malformations is multifactorial and includes genetic factors and environmental agents . In recent years few epidemiological studies have addressed the impact of prenatal exposures, although several maternal factors such as use of ethanol or drugs, viral infections, maternal diabetes, and untreated phenylketonuria can potentially influence the neuronal migration . The aim of this population - based study was to describe perinatal characteristics in infants diagnosed with neuronal migration disorders aiming at identifying potential risk factors . The infants included in the study were identified as those hospitalized with a diagnosis related to a neuronal migration abnormality and confirmed by a computer tomography (ct) or magnetic resonance imaging (mri). All swedish residents are assigned a unique 12-digit national registration number, which is used for official population - based registers . This number makes it possible to identify individuals and collect certain information within registers and also to link information between different registers . The inpatient register is held by the national board of health and welfare, and it records information concerning hospitalizations, including date of admission and discharge and primary and secondary diagnoses together with the national registration number . From 1987 and the swedish medical birth register was established in 1973 and includes data on more than 99% of all births in sweden . A standardized set of medical records is used by all antenatal care clinics and delivery units and at the examination of the newborn infant . Selected information from the records is computerized and forwarded to the register, which is held by the national board of health and welfare . For all births, medical information on maternal demographic data, the reproductive history, maternal smoking habits, the registration starts at the first visit to the antenatal clinic and is completed when the mother and newborn infant are discharged from the hospital . The records, which include copies of referrals for radiologic examinations, were used to identify the children who had been examined with ct or mri and to validate the diagnosis of a neuronal migration disorder . Information concerning factors that might influence neuronal migration disorders was obtained through the swedish medical birth register . For the mothers we obtained information about age, body mass index at first antenatal visit (bmi, calculated as maternal weight in kilograms at first visit to the antenatal clinic / maternal height times height), chronic diseases prior to index pregnancy, reproductive history (parity, years of infertility), and smoking in early pregnancy . Bmi was classified according to who definition as underweight <18.5 kg / m, normal weight 18.5 kg / m and <25 kg / m, overweight 25 kg / m and <30 kg / m, and obesity 30 kg / m . Smoking was classified as no smoking, smoking 19 cigarettes / day, and> 10 cigarettes per day . We also obtained information on maternal diseases during pregnancy and mode of delivery (noninstrumental and instrumental vaginal delivery and emergency and elective cesarean section). As chronic diseases we included kidney failure, celiac disease, epilepsy, ulcerative colitis, diabetes mellitus, asthma, and systemic lupus erythematosus . The information was retrieved by the international classification of diseases as icd-9 or icd-10 codes, and all icd-9 codes were manually transformed into icd-10 codes . For the infants we obtained information on sex, gestational age at birth, birth weight and birth length, and the apgar scores at one and five minutes . Small for gestational age (sga) was defined as birth weight more than 2 standard deviations (sds) below the mean birth weight for gestational age and sex according to a swedish birth weight curve . Appropriate for gestational age (aga) was defined as a birth weight between 2 sd and + 2 sd and large for gestational age (lga) as a birth weight more than 2 sd above the mean . All infants born alive from 1980 through 1999 and diagnosed with a neuronal migration disorder according to mri or ct scan sometime during this period were eligible for inclusion in the study . A total of 820 infants had been hospitalized with a diagnosis such as congenital myopathies and malformations of the cns that could be related to a neuronal migration disorder (icd 9: 359.1 - 359.24, 742.1 - 24, 759.23, and icd 10: q 040.0 - 89.9, g 71.2). We requested information on performed ct or mri scans by a letter sent to all paediatric and radiological clinics in the country, and about half of the 47 clinics responded to our request . In 120 of the patients, the diagnosis of neuronal migration was confirmed by the local radiologist in 17 subjects, 9 boys and 8 girls, all of whom were included in the study . As the study was purely descriptive, no formal testing was possible . For certain characteristics (maternal age, bmi, gestational age at birth, and birth weight), the mother's median age was 29 years, and most women were born in sweden (table 1). One of the mothers was underweight with a bmi below 19 at the start of pregnancy, and none was obese . The mean bmi of the mothers at first antenatal visit was 21.3 (range 17.628.5). One woman suffered from chronic multifocal osteomyelitis and necrosis and another was involved in a motorbike accident . Maternal care for (suspected) damage to the fetus by radiation was reported in one case . Nine male infants and eight female infants were born after mean 39.3 gestational weeks and with a mean birth weight of 3327 grams . All children were born as singletons and were aga, and all had a full apgar score . Most infants were classified to have an undefined migrational disorder, a disturbed migration of the immature brain or a migrational disorder of unknown type . Congenital malformations of the spleen or the heart, potter's syndrome, and facial asymmetry were reported, including malformation of the eye and lens, microphthalmus, and cleft palate . Two infants had skin problems at birth, and one infant suffered from obstruction of the intestine by gallstones or meconium (table 2). All infants were born at term and of ordinary birth weight to healthy mothers with normal or subnormal bmi and after normal pregnancies . Most of the infants had a concomitant malformation, and two infants were diagnosed with congenital rubella infections . The use of modern techniques of brain imaging, especially mri, has dramatically improved the ability to detect these neurological disorders while the child is still alive . Over 25 syndromes related to disturbances of neuronal migration . The incidence of disturbances of the neuronal migration is not known, but is increasing in the pediatric population probably due to the use of mri techniques for brain imaging . Epidemiological studies and experimental data have demonstrated the importance of nutritional factors in fetal brain development and the deleterious effects of nutritional deficits [911]. Bmi was recorded for 12 of the women in the study, and more than half of them had subnormal or near subnormal bmi at start of pregnancy . Since 1992 maternal bmi has been recorded in sweden at the first antenatal visit, and an increase from 23 to 24 in mean bmi was noted between 1992 and 2002 . One can speculate whether the generally lower bmi among these 12 mothers of infants with neuronal migration disorder, as compared to the general pregnant population might have influenced the fetal brain development . However, it was not possible to calculate the adjusted association between maternal bmi and risk of neuronal migrations disorder in this small descriptive study . The impact of maternal bmi at start of pregnancy and/or weight gain during pregnancy on the fetal brain development and neuronal migration needs to be evaluated in a larger study . It is well known that maternal diseases during pregnancy, such as diabetes and nontreated phenylketonuria, and conditions where the placental blood flow is reduced, such as preeclampsia, could interfere with the fetal brain development [1, 9, 13, 14]. Even a less severe maternal hypothyroidism during the first half of gestation might affect the fetal neurodevelopment and neuronal migration . Few studies have addressed the impact on maternal health on specific migration disorders . In our study however, conditions related to an abnormal pregnancy and conditions which all can cause suboptimal growth conditions for the fetus were reported in four women . Neuronal migration disorders have been described in humans and/or in animal models following in utero exposures to infections . Some viruses, such as herpes simples, cytomegalovirus (cmv), or hiv, are potentially capable to persist in a latent form within the central nervous system . Several studies have described the teratogenic effect of cmv infection and the relation to neuronal migration disorders [1618]. Adverse impacts of maternal infections due to rubella, group b streptococcus, cytomegalovirus, toxoplasmosis, and chorioamnionitis in the fetal brain are known . However, two children were reported with rubella syndrome at birth, which is more than expected . The percentage of susceptible pregnant women with rubella was gradually reduced from 12% in 1975 to just below 2% in 1994 . Rubella syndrome is very uncommon, and between 1975 and 1985, only a mean of two cases per year were recorded in sweden . Since 1985, no child with the rubella syndrome has been registered . It can be speculated that rubella had an impact on the neuronal migration in two cases in this study . It is well known that maternal smoking increases the risk of intrauterine growth restriction and affects the fetal brain by inducing intrauterine hypoxia or by acting directly on the developing brain [2123]. Smoking habits among women have changed over time in sweden . During the 1960s as many as 25% of the women smoked, this was reduced to 14% in 2004 . In this study 23% of the women smoked, which was more than in the general pregnant population during this time period . The detection of cases was difficult mainly because of our strict criteria for eligibility, which included a ct or mri scan confirming the diagnosis . In 120 of all hospitalized children, a ct or mri scan of the brain was preformed, and only 17 of them were confirmed with a neuronal migration disorder . Despite several reminders, only 50% of all hospitals in sweden responded to our request to send in ct and mri scans . None of the hospitals actively rejected participation in the study . The cause of this dropout is not known but was evenly distributed between level i, ii, and iii hospitals over the country . It can be speculated that journals from the study period were not easily found, and the time for searching these journals was regarded as too expensive for the hospitals . The study refers to a time of great medical advances, and the use of ct and mri scan is more widely used today . The cases were identified through the national patient register, and the responding hospitals were evenly spread over the country . Considering the increasing use of ct and mri scans, a study performed in more recent years might detect more children with neuronal migration disorder . This descriptive study indicates that there might be an impact of low or subnormal maternal bmi before and during pregnancy, maternal infection, such as rubella, and maternal smoking on fetal brain development, including neuronal migration . The roles of maternal bmi and congenital infections should be tested in future analytical studies.
|
More than 25 years after the identification of the causative agent of aids, hiv / aids is still a major challenge to society . The latest who / unaids report (2010) states that the number of people living with hiv has risen to 33.3 million, with more than 2.6 million new cases annually and almost 5000 aids - related deaths per day . With the introduction of the first hiv-1 protease inhibitor (pi) (saquinavir) in 1995 and the development of highly active antiviral therapy (haart) the clinical outcome of hiv / aids changed from a lethal to a manageable, but chronic, disease in the developed world . The early pis suffered from poor pharmacokinetic profiles and caused severe side effects such as hepatic toxicity and lipodystrophy . For these reasons and with a frequent daily dosing regimen, they were not the first - hand choice in haart . The most common combinations in early haart were instead two nucleoside reverse transcriptase inhibitors (nrtis) together with a non - nucleoside reverse transcriptase inhibitor (nnrti). The development of nnrti- and/or nrti - resistant hiv strains and the introduction of new pis, with a once - daily dose regime and improved effect profiles, have made the combination of a pi together with two nrtis a more frequent choice for first line treatment in haart . Although saquinavir has, to date, been followed by eight other pis (ritonavir, indinavir, fosamprenavir, nelfinavir, lopinavir, atazanavir, tipranavir, and darunavir), improving pharmacokinetic properties and reducing adverse effects are still issues that need to be addressed . Further, the rapid replication and the high mutation rate of the hiv-1 virus, together with the mutation pressure induced by today s pharmacotherapies, will lead to an increase in the problems associated with resistant virus strains . Thus, we cannot expect the good results currently seen with haart to continue if new drugs are not developed and introduced onto the market . We have been engaged in the development of novel hiv-1 pis since 1997 . In our most recent program we developed novel classes of potent hiv-1 pis incorporating a shielded tertiary alcohol as part of the transition state mimic . Inspired by the structure of the potent inhibitor atazanavir (atz) (figure 1), we used a similar hydrazide moiety in the prime side of our new tert - hydroxy - containing pis . By altering the length of the central backbone, using a one-, two-, or three - carbon spacer (figure 1, series a, b, and c, respectively), we focused on optimizing the interaction with the catalytically active aspartic acid residues of the enzyme . Class b, with the two - carbon spacer, yielded the best results, with values of ki and ec50 as low as 1 and 3 nm, respectively . In all three series (a c), inhibitors with high membrane permeability were identified, as well as inhibitors with good metabolic stability, providing pharmacokinetic properties well in the range of hiv pis already on the market, e.g., atz . C cocrystallized with the enzyme revealed binding modes that were not completely successful in establishing strong symmetric hydrogen bonds (<3.0) with both the catalytic residues asp25 and or asp125, originating from each monomer of the hiv-1 protease . Therefore, we decided to further elaborate the central transition - state mimic by relocating the hydroxyl group one position away from the backbone . This strategy was implemented by making use of a -hydroxy -lactam moiety equipped with a secondary alcohol . It was hypothesized that the -hydroxy -lactam would provide a better hydrogen bond arrangement for the catalytic asp residues and at the same time reduce the flexibility, providing a more rigid inhibitor . Spacers are indicated in red: a, one - carbon spacer (ki = 5.5 nm);b, two - carbon spacer (ki = 2.3 nm);c, three - carbon spacer (ki = 2.8 nm);d, novel lactam - based inhibitors with two - carbon spacer (ki = 0.8 nm) and altered stereocenters indicated by asterisks; e, three - carbon spacer (ki = 4.2 nm). Atz is included for comparison (ki = 2.7 nm). Modeling studies supported the hypothesis that a hydroxyl group in the 4-position of the -lactam might provide a new conformationally constrained transition - state - mimicking scaffold for the development of novel hiv-1 pis . Since both the (3r,4s) and the (3r,4r) stereoisomers provided good docking poses, we decided to synthesize and evaluate all four stereoisomers of the -lactam (figure 1, d). In addition, two different lengths of the central tether (two or three carbons) were investigated (figure 1, d and e). The prime - side hydrazide moiety, inspired by atz, has been successfully used in inhibitors in series a c and was therefore retained in the new series of lactam - based inhibitors . Here we present the synthetic protocols and the inhibitory potency on enzyme level, as well as the activity in a cell - based assay, of the new inhibitors (d and e). Also included are stability and permeability studies of selected compounds, together with x - ray analyses of three of the inhibitors cocrystallized with the hiv-1 protease . Starting from (s)-4-hydroxydihydrofuran-2(3h)-one (1a) or (r)-4-hydroxydihydrofuran-2(3h)-one (1b), four hiv-1 pr inhibitors with a two - carbon spacer and with varied stereochemistry in the lactam ring were synthesized (scheme 1). Encouraged by previously reported alkylations,1a and 1b were chosen as starting substrates for the two - step alkylation process . Upon treatment with dmpu, lda, and the first alkylating agent (allyl bromide or benzyl bromide) at 50 c followed by a second portion of lda and the addition of the second alkylating agent (benzyl bromide or allyl bromide) at 40 c, the dialkylated -hydroxy -lactams 2a d were synthesized in isolated yields of 249% (scheme 1, paths a and b). Path a: (a) dmpu, lda, allyl bromide, dry thf, added at 50 c, stirred at 50 c for 1 h; (b) lda, benzyl bromide added at 40 c, stirred at 30 c for 1 h, giving 2a and 2c in 49% and 33% isolated yield, respectively . Path b: (c) dmpu, lda, benzyl bromide, dry thf, added at 50 c, stirred at 40 c for 1 h; (d) lda, allyl bromide, added at 40 c, stirred at 30 c for 1 h, giving 2b and 2d in 2% and 5% isolated yield, respectively . In the first alkylation, the allyl group in 2a and 2c (or the benzyl group in 2b and 2d) was introduced trans to the controlling 4-hydroxyl group as expected, showing facial selectivity, as previously reported by meyers et al . And others . In the second alkylation, the benzyl group (or the allyl group in 2b and 2d) was introduced trans to the 4-hydroxyl functionality . Consequently, the second alkylation changed the stereochemistry of the first inserted group, forcing it to end up cis to the 4-hydroxyl group . To be able to collect enough material of 2b and 2d, with their low - yielding synthetic pathway, a method was developed to alter the stereochemistry at the hydroxyl group in 2a and 2c . Martin reagent to the corresponding ketones was followed by reduction using nabh4, affording 2d and 2b following paths a and b, respectively (scheme 2), with ratios 2d/2a of 5.7:1 and 2b/2c of 5.9:1 . Martin, dcm, rt, 1 h; (b) nabh4, 1% methanol in thf, rt 2 h, 2d + 2a (5.9:1) 92%, 2b + 2c (5.7:1) 85% . Lactamization of the lactones 2a d with tbs - protected indanolamine (3) was performed by adopting the methodology developed by orrling et al . Lactams 4a d were isolated in good yields using the ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ([bmim]bf4) under microwave irradiation at 180 c for 35 min, followed by protection of the alcohol moiety with tbsotf under basic conditions . Although the mixture was heated to 180 c, these lactamization conditions are relatively mild compared to those previously reported . The use of highly polar [bmim]bf4 allowed lactamization to proceed smoothly without the need of brnstedt acid . Reagents and conditions: (i) [bmim]bf4, 180 c, 35 min; (ii) triethylamine, tbsotf, dcm, 025 c, overnight, giving isolated yields of 4a 64%, 4b 53%, 4c 72%, and 4d 50% . To synthesize the prime - side moiety 5a, hydrazone 7 was prepared in almost quantitative yield starting from the boc - protected hydrazine 6, as previously reported in the literature (scheme 4). Benzylation of 7 using koh and 4-bromobenzyl bromide in anhydrous toluene afforded 8 in good yield . Catalytic quantities of the phase - transfer catalyst tetrabutylammonium hydrogen sulfate (tbahs) were used to improve solubility and increase the rate of the reaction . After the initial workup of the alkylation reaction only compound 8 was generated, but after flash chromatography purification, compound 9 was also formed (owing to hydrolysis of the hydrazone). However, purification in this step was necessary to remove excess quantities of 4-bromobenzyl bromide, which was foreseen to cause problems in the later steps . The mixture of 8 and 9 was deprotected with 4 m hcl in thf to yield the pure hydrochloride salt of 10 . Owing to the photosensitivity of the free nitrogen in the p - bromobenzylhydrazine 10, the coupling of 10 with 11, synthesized as previously reported, was performed in a reaction vessel wrapped in aluminum foil . Moreover, 10, 11, and hobt were added under a nitrogen atmosphere at 0 c, and the mixture was stirred for 30 min . Subsequently, 4-methylmorpholine (nmm) and n-(3-dimethylaminopropyl)-n-ethylcarbodiimide hydrochloride (edc) were added and the reaction mixture was gradually heated to 25 c and stirred under a nitrogen atmosphere for 15 h, giving 5a in good isolated yield (77%, 61% overall isolated yield starting from 38 mmol of 6). Reaction conditions: (a) acetone, mgso4, acoh (cat . ), reflux, 1 h, 98%; (b) (i) koh, anhydrous toluene, tbahs, 50 c, 20 min; (ii) 3, 100 c, 2 h, 81%; (c) hcl, thf, reflux, 3 h, quantitative yield; (d) edci, hobt, nmm, dcm, 025 c, 15 h, 77% (61% isolated yield over four steps . ). Steps a and c required no purification . Next the allylic double bonds in lactams 4a d were oxidatively cleaved to give the corresponding aldehydes v viii using osmium tetraoxide and sodium periodate in thf / water (3:1) at room temperature (scheme 5). Note that the nomenclature for the absolute configuration for the lactam carbon in position 3 changes when comparing the lactams 4a d, the intermediates v viii, and 12 and 13 because of changes in the assigned priority according to the sequence rule . Reagents and conditions: (a) 4a d, oso4, naio4, thf / h2o, rt, overnight; (b) 5a, acetic acid, na(oac)3bh, dry thf, rt, overnight, provided 12a in 35% and 12d in 54% isolated yield from 4a and 4d, respectively; (c) tbaf, thf, rt, overnight, provided 13a in 38%, 13b in 60%, 13c in 46%, 13d in 34% isolated yield from 4a d, respectively . Reductive amination between the crude aldehydes and the prime side (5a) was performed in dry thf using acetic acid, followed by treatment with na(oac)3bh, to afford the crude tbs - protected products . The tbs protecting groups were removed using tbaf, and the inhibitors 13a d, carrying a two - carbon tether, were isolated in good yields (scheme 5). The tbs - protected inhibitors 12a and 12d (but not 12b and 12c) were isolated, purified, and fully characterized before the final deprotection . To evaluate the effect of different p1 side chains, a small series of p1 p - phenyl- and p - pyridyl - substituted inhibitors was produced . The known problem of rapid protodeboronation of 2-pyridylboronic acid prevented us from conducting functionalization of 12a and 12d directly via suzuki thus, to introduce the 2-pyridyl as a para - substituent in p1, the 2-pyridine - substituted hydrazide 5b (scheme 6) was synthesized starting from the 4-(2-pyridinyl)benzaldehyde, as previously described . The alcohols 14a and 14d were isolated as side products in reductive amination reactions to produce 12a and 12d, respectively . Martin reagent was used to oxidize 14a and 14d to the corresponding aldehyde intermediates (scheme 5, v and viii, respectively), followed by reductive amination with 5b using acetic acid and na(oac)3bh in dry thf and subsequent tbaf - mediated deprotection to give useful yields of the inhibitors 13e and 13f (scheme 6). Martin reagent, dry dcm, rt, 1 h; (b) acetic acid, na(oac)3bh, dry thf, rt, overnight; (c) tbaf, thf, rt, overnight, provided isolated yields of 63% 13e and 38% 13h from 14a and 14d, respectively . The tbs - protected inhibitors 12a and 12d were decorated using the corresponding phenyl- or pyridylboronic acids in suzuki miyaura cross - coupling in which herrmann s palladacycle (0.1 equiv) was used as a palladium precatalyst together with k2co3 (3.3 equiv) and [hp(t - bu)3]bf4 (0.2 equiv) in dme / water . The reaction mixtures were heated to 140 c for 20 min under focused microwave irradiation in sealed reaction vessels . Cross - coupling was followed by deprotection of the hydroxyl groups using tbaf in thf at room temperature, giving inhibitors 13g j in good isolated yields (scheme 7 and table 2). Reagents and conditions: (a) (i) 12a or 12d, herrmann s palladacycle, k2co3, 3- or 4-pyridylboronic acid, [hp(t - bu)3]bf4, dme, water, microwave 140 c, 20 min; (ii) tbaf, thf, rt, overnight, providing isolated yields of 63% 13 g, 59% 13h, 74% 13i, and 66% 13j . To be able to incorporate the new lactam scaffold into inhibitors with the three - carbon spacer, corresponding to the previously published c series (figure 1), the allylic compound 4a was refluxed in thf at 80 c with 9-bbn for 6 h. after addition of naoh, h2o2, and ethanol at room temperature and another 2 h stirring, the primary alcohol 16 was isolated in good yield (scheme 8). The alcohol 16 was oxidized to the corresponding aldehyde (17) using 50% so3py in dmso together with triethylamine in dcm at 025 c . The aldehyde was thereafter used in a reductive amination reaction with 5a using na(oac)3bh as reducing agent at 35 c to give 18 in moderate isolated yield (scheme 8). The nomenclature for the absolute configuration of the lactam carbon in position 4 changes when comparing the 13a j and 19a e series because of changes in the assigned priority according to the sequence rule in iupac s guidelines . Reagents and conditions: (a) (i) 9-bbn, dry thf, 80 c, 6 h; (ii) 2 m naoh, 30% h2o2 in h2o, ethanol, rt, 2 h, 78%; (b) et3n, 50% so3py in dmso, dry dcm, 020 c, 3 h; (c) 5a, acetic acid, na(oac)3bh, dry thf, 35 c, 3 h, 35%; (d) tbaf, thf, rt, overnight, 19a 61%; (e) (i) herrmann s palladacycle, k2co3, arylboronic acid, [hp(t - bu)3]bf4, 105 c, 1.5 h; (ii) tbaf, thf, rt, overnight, 19b 45%, 19c 35%, and 19d 30%; (f) (i) 2-(tributylstannyl)pyridine, pd(pph3)2cl2, cuo, dmf, 105 c, 2 h; (ii) tbaf, thf, rt, overnight, 19e 16% . Deprotection of 18 using tbaf in thf gave inhibitor 19a in a good yield . Inhibitor 18 was also used as starting material in suzuki miyaura cross - coupling with phenyl- and pyridylboronic acids together with herrmann s palladacycle, k2co3, and [hp(tbu3)]bf4, heated by microwave irradiation to 105 c for 1.5 h. deprotection of the tbs groups using tbaf in thf gave 19b d in 3540% isolated yields . By use of 2-(tributylstannyl)pyridine, compound 18 was subjected to stille type coupling in dmf under microwave irradiation (105 c, 2 h) using cuo and with pd(pph3)2cl2 as precatalyst . The stille coupling was followed by tbaf - mediated deprotection giving inhibitor 19e in moderate isolated yield . Since the preliminary docking studies suggested that two of the stereoisomers in the lactam moiety ((3r,4s) and (3r,4r)), in the two - carbon - tethered inhibitors would fit well in the enzyme, all four stereoisomers were synthesized and evaluated regarding binding and in a cell - based assay, giving the results summarized in table 1 . Comparisons with previous series of tertiary - alcohol - based hiv-1 pis (a c) could easily be conducted by using the indanolamide in the p2 position and the p - bromophenyl as the p1 side chain . In accordance with the initial docking studies, inhibitors 13a (3r,4s) and 13d (3r,4r) exhibited good activity in the enzyme assay (ki of 2.1 and 6.4 nm, respectively) as well as in the cell - based evaluation (ec50 of 0.64 and 0.35 m, respectively). The stereoisomers 13b (3s,4s) and 13c (3s,4r) did not show any activity and, as expected, neither did the tbs - protected inhibitors 12a and 12d . The metabolic stability and permeability of the two active inhibitors were investigated . Because of its low solubility, inhibitor 13a was not tested in the permeability assay . Compound 13b exhibited slight cell toxic properties, with a cc50 of 15 m . The lactam scaffold inhibitors 13a and 13d ((3r,4s) and (3r,4r), respectively) yielded the most potent inhibitors and were therefore selected for further optimization . When the p1 position is optimized by replacing the p - bromo substituent of the p1 phenyl group in 13a and 13d with heteroaromatic moieties, the inhibitors showed improved protease inhibitor potency and, most importantly, increased antiviral activity (table 2, 13e isolated yields in the final reductive amination (12a, 12d) or reductive amination atz papp(caco-2) = 5.3 10 cm / s . For preparation of inhibitors, see schemes 6 and 7 . Isolated yields of 13e f from 14a or 14d (scheme 6) or in the coupling deprotection step of 13g j (scheme 7). Atz clint = 90 l min mg [140 l min mg]. Atz papp(caco-2) = 5.3 10 cm / s . The best inhibitors, having (3r,4s) configuration and 3- or 4-pyridylbenzyl as the p1 moiety (13 g and 13i), exhibited 10 times higher potency than 13a in the cell - based antiviral activity assay, the best ec50 values being 40 nm (table 2). The 2-pyridyl - substituted inhibitor (13e) showed lower activity than the 3- and 4-pyridyl - substituted analogues (13 g and 13j, respectively). The improved ec50 upon decorations with 2-, 3-, and 4-pyridyls has previously been demonstrated showing the same trend . The (3r,4r) compounds showed less improvements, but all inhibitors decorated with pyridine functionalized in p1 were observed to have higher potency than the precursor bromo compound 13d . The position of the nitrogen in the heteroaromatic p1 group showed the same general trend as in the (3r,4s) inhibitors, with the meta- and para - positions providing the best potency (table 2). Heteroaromatic functionalization of p1 provided inhibitors with increased stability compared to 13a and 13d . Compound 13h gave the best result (clint of 120 l min mg). Both 13 g and 13h were observed to possess moderate permeability in the caco-2 studies, with papp of 3.8 10 and 5.1 10 cm / s, respectively . When the backbone spacer was elongated from two to three carbons, as in 19a e, inhibitors with lower potency than the 13 series were obtained (table 3). This is in accordance with results previously reported for the linear series of tertiary alcohol inhibitors, e.g., comparing the b(26) and c(27) series (figure 1). However, with the p - phenyl or p-4-pyridyl groups in the p1 position, submicromolar values of ec50 were observed in the antiviral cell based assay (19b and 19d). As mentioned above, permeability (caco-2) and stability (clint) studies were performed on some of the inhibitors prepared (13a, 13d, 13 g, 13h, 19a, 19c, and 19e). Compound 19a showed high permeability (> 20 10 cm / s), while all other inhibitors investigated showed moderate permeability ((320) 10 cm / s). The value of clint varied from 120 to> 300 l min mg (tables 13). These results are in the same range as those previously reported for atz (papp = 5.3 10 cm / s, clint = 90 l min mg [140 l min mg]). There was no major difference between the 13 and the 19 series with respect to clint and papp, and the rigidification of the backbone seemed to be well tolerated compared to the linear inhibitors . The metabolic stability was improved when the bromo group in 13a and 19a was substituted by the heteroaromatic pyridyls, although the permeability was unfortunately reduced at the same time . For conditions, isolated yields of 19a for the deprotection step, and isolated yields of 19b e for the coupling deprotection step . Atz clint = 90 l min mg [140 l min mg]. A drug - resistant strain of the hiv-1 protease (leu63pro, val82thr, ile84val) was cocrystallized with the active pis 13i, 19b, and 19d for x - ray crystallographic studies of the complexes . Data were obtained for all complexes, and the structures were refined to high resolution (for refinement statistics, see supporting information). The resulting electron density maps allowed unambiguous modeling of the inhibitors within the binding site . Previously published structures of hiv-1 pis 20,21, and atz are included for comparison (figure 3). Comparison of the overall x - ray conformations and binding patterns of compounds 13i (top left, pdb code 2uxz), 19b (bottom left, pdb code 4a6c), and 19d (bottom right, pdb code 4a6b) in the active site of hiv-1 protease . Compound 13i forms five direct hydrogen bonds to the protease and five more via water molecules . The corresponding binding interactions for 19b and 19d are four direct bonds and six more through water bridges . In all three complexes, two of the interactions via water are due to the structural water coordinating ile50 and ile150 in the protein flaps . A complicating factor for the comparisons of the inhibitor complexes was the fact that compounds 20 and atz were rotated 180 compared to compounds 13i, 19b, 19d, and 21 . The overall binding configurations for 13i, 19b, and 19d to the protease are, as expected, in good accordance with those of previously published linear inhibitors 20,21, as well as with atz, despite the novel -hydroxy -lactam moiety . Previously published pis for comparison: atz (pdb code 3el9), 20 (pdb code 2uxz), and 21 (pdb code 2xye). On the basis of the modeling studies, it was postulated that the -hydroxyl group of the lactam moieties forms hydrogen bonds with the catalytic aspartic acids (asp25 and asp125). In the two - carbon linker compound 13i this -hydroxy group forms hydrogen bond interactions to the two catalytic aspartic acids with 2.7 and 3.0 . The -hydroxy group in the three - carbon inhibitors 19b and 19d only form hydrogen bonds to asp25, with 2.7 and 2.6, respectively (figure 2). This loss of a hydrogen bond for the 19 series compounds is due to the different spatial conformation of the lactam ring, apparently as a result of the longer central backbone (figure 4). As the only difference between the structures of 13i and 19d is the length of the backbone tether, this is a likely explanation of the lower antiviral potency of compound 19d compared with 13i . The position of the -hydroxy group of the lactame ring, involved in hydrogen binding to both asp25 and asp125 in 13i (gold), is different in 19d (purple) and 19b (not shown) exhibiting the three - carbon linker . This leads to a loss of a hydrogen bond to one of the catalytic aspartates . The position of the -hydroxy group involved in hydrogen binding in 19d is 2.1 from the position observed in 13i . None of the cocrystallized pis in these novel series formed a symmetrical binding pattern with the catalytic aspartic acids (asp25 and asp125) such as that seen in atz . Together with the hydrazide carbonyl oxygen, the carbonyl oxygen in the lactam ring in both 13i and 19d creates hydrogen bonds to the structural water bridging the inhibitors and the ile50 and ile150 in the flap region with hydrogen bond lengths of 2.73.3 (figure 2). The position of the p2p3 indanolamide in 13i, 19b, and 19d is not markedly affected by the introduction of the -hydroxy -lactam, absent in 20 . While in 20 the indanolhydroxyl group was close enough to form a hydrogen bond to arg108 and for the arg108 to make an edge - on cation interaction with the p1 phenyl group, the distance to the indanol group in 13i seems to prevent this bond from forming (figure 5). In accordance with the previously observed results for 21, the p1 outer phenyl group in both 13i and 19d interacts through a hydrophobic interaction with pro81 (3.33.8) and an edge face interaction to phe153 (3.73.8). The differences in length of the central motif as well as in the length of the extension of 13i, 19d, 20, 21, and atz in the p1 site are nicely accommodated through corresponding shifts in the positions of phe153 and pro81 (figure 5). These interactions are likely to improve the binding constant and is the most likely explanation of the better binding of compound 13i than 13d, differing only in the length of the extension in the p1 site . In a previously examined complex with compound 20, the interaction with phe153 was not possible, as the corresponding moiety only reached far enough for a van der waal interaction with pro81 . Neither is the interaction with phe153 observed in the complex with atz . Since the binding modes of 19b and 19d are very similar (figure 2), only 19d was included in the analysis, as the structure of the complex could be interpreted at higher resolution . Comparison of the positioning of the cocrystallized inhibitors in the s2s3 pocket and interaction with pro81 and phe153 in the s1 pocket . The effect on the s2s3 site is visualized at residues asp29, asp30, arg108, and pro181 . (a) superimposition of 13i (gold) and 19d (purple). As a result of an additional ch2 group in 19d, the lactam group present in the new series of compounds as in 19d mimics the conformation of 20, also exhibiting the three - carbon linker, very well . With the lactam ring present, the position of the indanol ring, and therefore also asp30/130, is more similar to the situation in 13i comprising the two - carbon linker . (c) superimposition of 13i and atz (black). Despite the differences of functional elements between 13i and atz in the s2s3 site, the common ribbon of the compounds overlap well . In the p1 site 13i and 19d compound 19d induced side chain and main chain atom displacements in phe153 and pro81 up to 2.5 and 1.7, respectively, compared to atz complex positions . None of the new compounds induced a shift in the position of arg108, as was seen in compound 20 . The introduction of the -hydroxy -lactams as new scaffolds was intended to provide more rigid pis and to relocate the hydroxyl group from the backbone to enable more symmetric binding to the catalytically active asp25 and asp125 of the hiv-1 protease . The outcome of the dialkylation reactions performed to obtain 2a d was in accordance with the results described by amat et al . In 2007, although they observed a larger substrate - dependent variability . When introducing the benzyl moiety in the first alkylation, as in the cases of 2b and 2d, the yields were lower (2% and 5%, respectively) than when the allyl group was introduced before the benzyl moiety (as in 2a and 2c, with yields of 49% and 33%, respectively). The same trend has been reported by johnson et al . With 4-substitued lactams but was not observed in the 5-substitued examples presented by meyers et al ., in which the order of addition did not affect the yields . Probable reasons for the lower yields observed by johnson et al . Were steric and/or electrostatic interactions between the 4-hydroxy group and the bulkier 3-benzyl moiety present after the first alkylation, compared to the smaller allyl group . These findings followed the reasoning presented by huang et al ., who proposed stereoelectronic factors to be the major explanation in this class of stereoselective two - step alkylation reactions . In the present work, the diastereoselectivity controlled by the stereochemistry of the 4-hydroxy group was strong enough to allow highly enantiomerically enriched isomers to be obtained in all cases . There was an urgent need for a robust method for the synthesis of the prime side hydrazide moiety (5a). The procedures used previously were cumbersome and low yielding because of the use of toxic and environmentally hazardous hydrazine hydrate and/or tedious purification protocols . Previously used synthetic procedures were not satisfactory, since the quantities of prime side were not sufficient to support our lead optimization program throughout . The synthetic route to the prime side hydrazide moiety 5a presented here provided an efficient way of producing sufficient amounts and constitutes an improvement in yield as well as a reduction in work compared to previous methods . With this convenient method, there was no need to use hazardous hydrazine hydrate, and the purification protocol resulted in a good yield . The biological results obtained from the novel lactam - containing inhibitors are summarized in tables 13 . Evaluation of the four stereoisomers (13a d) gave two active and two nonactive pis (table 1). The (3r,4r) and (3r,4s) stereoisomers in the lactam ring showed the best results, with 13a and 13d being the most potent compounds (ki <10 nm and ec50 <1 m). The most important structure activity feature appears to be the direction of the benzyl in the p1 position . With r - stereochemistry at the -carbon (13a and 13d), the direction of the -hydroxy substituent (position 4) appears to be of less importance for inhibition with 13a and 13d being almost equipotent . With s - stereochemistry at the -carbon, 13b and 13c showed almost no inhibiting effect on the enzyme or in the cell - based antiviral activity assay (table 1) and, as expected, the tbs - protected inhibitors 12a and 12d did not show any inhibitory potency . When the p1 side chain was decorated with heteroaromatic moieties (table 2), at best a 10-fold improvement in inhibitory potency was observed (13 g and 13i, ec50 = 0.04 m). Compared to the 2-pyridyl inhibitor 13e (ec50 = 0.190 m), the 3- and 4-pyridyl - substituted inhibitors (13 g and 13i, respectively) with (3r,4s) stereochemistry afforded 5 times higher potency, with ec50 of 40 nm . Despite the fact that atz contains a 2-pyridinyl in position p1, our previous series with one- or three - carbon spacers showed better potency for the 3- and 4-pyridinyl - substituted inhibitors . With the linear two - carbon spacer the 2-, 3-, and 4-pyridinyls gave equipotent inhibitors . This result was also obtained with the lactam - containing inhibitors with the three - carbon extended pis in the 19 series . Comparing p - bromide functionalized inhibitors 13a and 19a, a 5-fold loss of potency within measured ki and ec50 values were observed . However, the same trend is present in both series (13 and 19, table 3) as seen with the shorter inhibitors . The pyridyls (19c e) showed slightly better inhibition compared to the p - bromo compound 19a . The p - phenyl substituted 19b was among the most potent inhibitors, concurring with recent reports . We have successfully introduced -hydroxy -lactams providing a rigid backbone moiety and replaced the previously used tert - hydroxy group with a sec - hydroxy group . In addition, the length of the central spacer was varied (two or three carbons). Functionalization of the two most potent stereoisomers (3r,4s) (13a) and (3r,4r) (13d) with heteroaromatic moieties in the p - benzyl p1 position improved the potency, rendering ki values down to 0.7 nm and ec50 values down to 0.04 m . Three inhibitors were cocrystallized with the hiv-1 protease enzyme providing information about the binding of the hydroxy lactams to the enzyme . The change in binding pattern between the inhibitors with two- and three - carbon spacers was in good agreement with the observed variation in enzyme binding activity.
|
Haploid saccharomyces cerevisiae yeast cells use a prototypic, g - protein coupled - receptor / map kinase cascade signaling system, the pheromone response system 1, to sense and transmit information about the concentration of mating pheromone secreted by cells of the opposite mating type (fig . 1). The more information about pheromone concentration the system can transmit, the better a cell can distinguish between different pheromone concentrations, an essential ability for proper partner choice and mating . For example, a yeast cell ringed by potential mating partners strongly prefers to mate with partners producing the most pheromone 2 . First, a cell grows up the pheromone concentration gradient 3, a process that likely depends on measurement of precise differences in pheromone concentration at different points on the cell surface . Second, after contacting its partner and forming a prezygote, a cell preferentially completes fusion and forms a diploid with a partner that produces high amounts of pheromone 4 . These experiments indicate it is important for cells to distinguish among different pheromone concentrations at multiple steps during the mating process . Prior work suggested that optimal transmission of information about pheromone concentration depends on both distinguishable receptor occupancies and distinguishable downstream system responses . Differences in receptor occupancy are clearly important for mating partner choice and discrimination; for example, in the presence of exogenous pheromone at a concentration that saturates the receptor, cells lose the ability to discriminate high pheromone - secreting partners from low pheromone - secreting partners 2 . However, distinguishable receptor occupancies are not sufficient for partner discrimination, since hypersensitive cells, in the presence of exogenous pheromone at a concentration that does not saturate the receptor but does saturate downstream responses, also lose the ability to discriminate between partners secreting different levels of pheromone 2 . In complementary studies of orientation of mating projections in spatial gradients of pheromone, segall 3 showed that hypersensitive cells did not orient their mating projections as precisely as wild - type cells and suggested that this might result from saturation of downstream responses at most points in the gradient . However, after reducing the gradient pheromone concentrations 100 fold to concentrations at which downstream responses are not predicted to be saturated, hypersensitive cells oriented their mating projections less precisely than wild - type cells orient in gradients of higher pheromone concentrations 3 . These observations suggest that hypersensitive cells are inherently less able to respond distinguishably to different pheromone concentrations (i.e., transmit less information about pheromone concentration), even when they are responding to pheromone concentrations that saturate neither receptor nor downstream responses . One characteristic of wild - type cells that we 5 and others 6 have previously found is that, despite the large number of intermediate signaling events in the system, the dose - response curve of receptor occupancy closely aligns with dose - responses curves of downstream system responses . (here called dora) between receptor occupancy and the amount of pheromone - activated ste12 (pathway subsystem output p, which is reporter gene expression corrected for inherent cell - to - cell differences in the ability to express proteins 5) (fig . Interestingly, dose - response alignment is commonly observed in many mammalian cell signaling systems, including the insulin 7, acetylcholine 8, thyroid stimulating hormone 9, angiotensin ii 10, and epidermal growth factor 11,12 response systems . Researchers in the past have often regarded alignment of curves for ligand binding by a candidate receptor and downstream response as evidence that the putative receptor was in fact the molecule that bound ligand and caused the cellular responses1315 . However, to our knowledge, researchers have investigated neither the implications of dose - response alignment for yeast pheromone response nor its general consequences for the function of cell signaling systems . First, dora describes a linear relationship between receptor occupancy and downstream response; consequently, the entire range of receptor occupancies evenly corresponds to the entire range of possible responses (fig . By contrast, even a modest dose - response misalignment, such as a 20-fold shift in the ec50 of downstream response (fig . 2c), compresses the downstream responses corresponding to a wide range of receptor occupancies into a narrow range (fig . Previous analysis of noise propagation in a synthetic gene circuit revealed analogous amplification of upstream noise in a system with misaligned dose - responses16 . This reasoning suggested to us that cell signaling systems with misaligned dose - responses inherently transmit information with lower fidelity, even if downstream responses are not saturated, an idea consistent segall s observations that hypersensitive cells oriented mating projections less precisely in gradients than wild - type cells even at concentrations that did not saturate downstream responses 3 . We hypothesized that dose - response alignment might indicate a system that can transmit large amounts of information, and therefore we sought to better understand the underlying molecular mechanisms required for dora and the linear relationship between upstream and downstream response that it defines . Proportional negative feedback in electrical circuits, where a constant fraction of the output is subtracted from the input, can bring about a linear input - output voltage relationship17 . Biologists have also shown that negative feedback can make input - output relationships more linear in biological systems; for example, bhalla et al . Showed that, in a mapk / pkc - mediated signaling system, increasing the amount of a mapk - activated phosphatase that inactivates the mapk made the average output response more linearly related to (i.e., proportional to) the input18 . Research in both biology and engineering 17,1922 has also suggested or shown that negative feedback can increase the signal - to - noise ratio in system output and decrease the sensitivity of output to variation in properties of system components (see supplementary information 8 for further discussion). These observations suggested to us that negative feedback might mediate dose - response alignment and improve information transmission in the yeast pheromone response system . Prior work showed that the pheromone response system quickly establishes dose - response alignment; the accumulation of reporter gene expression in cells increased linearly from 15 minutes to three hours after stimulation (see fig . 2 in 5), and at all times the normalized dose - response of downstream output aligned with the receptor - ligand binding curve . These facts suggested that the molecular mechanisms that bring about and stabilize dora occurs in the first 15 minutes of pheromone stimulation . However, no quantitative measurements of system activities in this time frame existed to indicate the action of negative feedback to align dose - responses . We therefore developed tools to measure the early dynamics of molecular events that the system uses to operate before, during, and after establishment of dora . We developed reporters and methods to measure real - time signal transmission in single cells, at the membrane, and in the nucleus, and supplemented these data with biochemical measurements . We then measured system outputs (i.e., system activities at different stages in the signaling pathway, see fig . 1) after stimulating cells with 100 nm pheromone, a concentration that produces maximal downstream transcription reporter response (fig . Two membrane - proximal system outputs, g - protein activation and ste5 recruitment to the membrane, peaked and declined rapidly . To follow g - protein activation in single cells over time, we measured loss of fluorescence resonance energy transfer (fret) between cyan fluorescent protein (cfp)-tagged gpa1 and yellow fluorescent protein (yfp)-tagged ste18 by image cytometry 23 (supplementary information 2) in a derivative of a strain developed by yi and coworkers6 . Loss of g - protein fret rapidly peaked in the first minute and declined (fig . S2), consistent with lower time resolution, single time point population measurements in an earlier study 6 . We then measured, also in single cells and at sub - minute intervals, a subsequent membrane - proximal signaling event, the recruitment of ste5 to the membrane . To do this, we measured the redistribution of yfp - ste5 from the nucleus and cytosol to the membrane (supplementary information 2). Membrane recruitment of ste5 was rapid (fig 3b). Within 5 seconds of stimulation with high pheromone, individual cells showed an increase in yellow fluorescence at the cell membrane, and a corresponding depletion of fluorescence from the cell interior; no change in fluorescence was observed in unstimulated cells or cells with unlabeled ste5 (fig . Average membrane recruitment reached near - maximal values within seconds and peaked by 20 seconds, before declining toward a plateau in later minutes, similar to the dynamics of g - protein loss of fret . We then assessed intermediate system output further downstream by measuring the dynamics of mapk activation . Using quantitative immunoblotting, we measured phosphorylation of fus3 residues thr180 and tyr182, which is required for fus3 activity and pheromone response 24 . The amount of phosphorylated fus3 relative to total fus3 increased rapidly, reaching a maximum in 2.5 min before dropping to a plateau level in approximately 57 min (fig . 3c and fig . We then measured nuclear mapk activity dynamics in single cells over time . To do this, we developed a fret reporter to measure pheromone - induced changes in the association between the transcription factor ste12 and one of its inhibitors dig1 25 . We deleted native ste12 and dig1 genes and chromosomally integrated versions of these proteins fused to cfp and yfp, respectively (see supplementary information 5). We then measured changes in fret between cfp and yfp 26 in the nucleus by image cytometry 23 (see fig . S7b), but did require both ste5 (fig s7c) and map kinase activity (fig s7d), consistent with the interpretation that loss of fret directly reported pheromone - induced, map kinase - mediated derepression of ste12 . 3d), and the overall signal dynamics were very similar to those of fus3 phosphorylation (compare fig . This fast signal transfer from fus3 activation to ste12 derepression is consistent with the idea that fus3 moves quickly in and out of the nucleus, as shown in studies of changes in fus3 localization by fluorescence recovery after photobleaching (frap)27 . We confirmed that the timing of ste12 de - repression measured by loss of ste12-dig1 fret was consistent with the dynamics of pheromone - induced mrna transcription . Using ribonuclease protection assays mrna levels peaked at 5 minutes following pheromone stimulation before declining (fig . 3e and fig . The maximum rate of increase in mrna occurred between 3 and 5 minutes, consistent with the time of maximum loss of ste12-dig1 fret . All measurements of signal - relaying events showed a consistent pattern of rapid peak - and - decline toward a plateau after pheromone stimulation (fig . 3f), which suggested the action of one or more fast - acting negative feedbacks that might modulate the dose - dependence of the signal to achieve dora . A number of previous works suggested that the mapks fus3 and kss1 might mediate rapid negative feedback . Our previous study of regulated cell - to - cell variation in system output revealed a fus3-dependent reduction in variation, suggesting an autoregulatory negative feedback mediated by fus3 5 . Gartner et al . Showed that levels of phosphorylated fus3 were higher in cells bearing a kinase - dead mutant version of fus324 . Showed that ste5 t287a mutant cells, in which the ste5 carries a lesion in a site of threonine phoshorylated by fus3 on peptides in vitro exhibited increased reporter expression 28, albeit with no change in the ec50 of the dose - response . Finally, phosphoproteomic studies of pheromone response system proteins29 have uncovered numerous sites of phosphorylation on pheromone response system proteins, whose levels change upon pheromone stimulation, many of which lie in consensus map kinase target sequences (r. maxwell and o. resnekov, personal communication). We therefore hypothesized that the signal decline at different measurement points depends on non - translational, fast - acting negative feedbacks mediated by fus3 or kss1 . To test if fus3 or kss1 were sources of negative feedback on system activity, we compared the baseline system response, at system points up to and including fus3 phosphorylation, with system response after selective inhibition of either fus3 or kss1 kinase activity . To do this, we first modified reporter strains by replacing either fus3 or kss1 with the corresponding purine analog - sensitive allele 30 . We did this by changing the gatekeeper residue in each kinase s atp binding pocket (q93 in fus3, n94 in kss1) to an alanine . The mutant fus3-as2 and kss1-as2 kinases were active, as measured by fluorescent protein reporter gene output (fig . S9a), and10 m 1-nm - pp1, a cell - permeable adenosine analogue, inhibited the activity of mutant kinases without inhibiting wild - type kinases (fig . We then quantified fus3 phosphorylation by quantitative immunoblotting after stimulation with pheromone, either with or without simultaneous inhibition with 1-nm - pp1 (fig . Fus3 phosphorylation levels did not peak and decline to a plateau when we inhibited fus3-as2, but, rather, remained high, near peak levels . By contrast, when we inhibited kss1-as2, fus3 phosphorylation levels were unaffected (fig . These results indicated that fus3 kinase activity mediated one or more negative feedbacks in this system . We then studied where in the system the fus3-dependent feedback acted to diminish signal amplitude . Yi et al . Showed that the decrease in g - protein fret within 30 seconds of stimulation depended on sst2 6 . This finding suggested that the fus3-dependent negative feedback might upregulate the gtpase - activating protein (gap) function of sst2, which would increase g protein reassociation and decrease downstream signal . We tested if fus3-as2 inhibition affected the observed decline in both g - protein dissociation and ste5 recruitment . 4c), but surprisingly had no effect on the decline in g - protein dissociation in a g - protein fret reporter strain carrying fus3-as2 (fig . 4d and fig . These results indicated that fus3-mediated negative feedback acted downstream of mechanisms regulating g - protein association . To confirm that fus3 acted downstream of g - protein activation, we measured ste5 recruitment after deleting sst2 . We expected deletion of sst2 to have no effect on fus3-mediated signal decline, since sst2 is required for efficient g - protein inactivation and, as we showed above, fus3-mediated negative feedback does not reduce g - protein dissociation levels . Unexpectedly, when we deleted of sst2, we completely disrupted fus3-mediated signal decline; unlike sst2 + cells, inhibition of fus3 did not cause an increase in ste5 recruitment (fig . Furthermore, the ste5 recruitment (with or without fus3-mediated feedback) peaked and declined, similar to the baseline response of sst2 + cells (compare squares and circles in fig . This finding showed that signal peak - and - decline is the default behavior in the absence of sst2 . Since a sustained non - declining signal is only evident in sst2 + cells in the presence of fus3-as2 inhibitor, these results also indicate that sst2 promotes ste5 membrane recruitment, a hitherto unknown function of the rgs protein family, and that fus3 negatively regulates this novel signal - promoting function (fig . We then investigated which portions of the sst2 protein might be involved in promoting ste5 membrane recruitment . During analysis of sst2 point mutants, we found that ste5 recruitment in a fus3-as2 strain that carried sst2-t134a instead of wild - type sst2 peaked - and - declined in the presence and absence of fus3 inhibitor (fig . The pheromone - induced growth - inhibition of sst2-t134a cells reported by halo assays was close to wild - type (fig . S11a), and the average number of sst2-t134a protein molecules per cell was similar to sst2 abundance in the parent strain, (fig . S11b), suggesting that the t134a mutation disrupted a significant fraction of the fus3-dependent, signal - promoting function of sst2 without disrupting the bulk of its signal - reducing gap activity . T134 lies within the n - terminal dep domains of sst2, which are required for localization of sst2 to the membrane by binding the cytosolic tail of ste2 31 . These results indicate that the dep domains in sst2 might aid ste5 membrane recruitment, perhaps by providing additional membrane - proximal interaction surfaces, and suggest that mechanisms that regulate localization of sst2 to the membrane, such as disruption of sst2-ste2 interactions by yck1/2-mediated phosphorylation after longer periods of pheromone stimulation 31, might consequently regulate ste5 membrane recruitment . Finally, we tested if dose - response alignment between receptor - pheromone binding and downstream activities required fus3 activity . In principle, fus3-mediated negative feedback might scale system activity by a dose - independent factor, and therefore cause no shift in the normalized dose - response curve . For example, the ste5 t287a mutation increases the magnitude of system output relative to wild - type cells without changing the pheromone concentration yielding half - maximal response (see fig . 5 in 28). We measured dose - responses of fus3 phosphorylation in a fus3-as2 strain with and without inhibitor 15 minutes after pheromone stimulation, the time when the amount of fus3 phosphorylation had declined to a steady - state level (fig . 3c). Inhibiting fus3 kinase activity shifted the dose - response of fus3 activation, lowering the pheromone concentration needed for half maximal response by 20-fold (fig . Moreover, inhibiting fus3 kinase activity doubled the dynamic range of the output (fig . These results showed that fus3-mediated negative feedback was required for dose - response alignment in the yeast pheromone response system . We found that mapk fus3 mediates rapid negative feedback that aligns the dose - responses of upstream and downstream system activities in the pheromone response system . We propose that dose - response alignment improves information transmission through this and other signaling systems . Furthermore, we found that fus3 negatively regulates a novel signal - promoting function of the rgs protein sst2 . Our results demonstrate that rgs proteins, present in many eukaryotic signaling systems (the human rgs family, for example, contains more than 35 members 32), can function in signal transduction systems by increasing signal in addition to accelerating g - protein inactivation, possibly (as in the case of pheromone response) by facilitating recruitment of mapk scaffolds to sites of activity . The idea that dose - response alignment increases the amount of transmitted information has practical implications for drug discovery and design . For example, consider a drug that increased sensitivity of cells to a naturally occurring antagonist of cell proliferation, analogous to the downstream dose - response shift we observed upon fus3 inhibition in the pheromone response system (fig ., the dose - response misalignment could reduce the amount of transmitted information about the signal . The decrease in transmitted information could increase cell - to - cell variation in response, causing a larger number of cells fall below a threshold in antagonist response and continue proliferation . It is possible some existing drugs that allosterically modify gpcr signaling systems downstream of ligand binding (see 33, fig . 3) and those that target mid - system signaling molecules such as pkc 34 and akt 35 may decrease dose - response alignment and increase response variation, whereas drugs that specifically affect the affinity of receptor - ligand binding (see 33, fig . We propose here that the fidelity with which a cell responds to different input concentrations of a ligand depends on a systems - level quantitative behavior, dose - response alignment, found in many other cell signaling systems . For biological systems, a deeper understanding of key quantitative behaviors will likely depend on articulating appropriate analytical frameworks and metrics . Information theory36 defines a framework for quantifying the relationship between system input and output (see supplementary information 9 for further discussion), and has enabled researchers to quantify, for example, the amount of information that an axon of a single sensory neuron can transmit 37 and the amount of information about morphogen gradient that a transcription factor can transmit to a downstream effector 38,39 . Much as concepts from classical electromagnetism provide rigorous means to describe and understand the determinants of behaviors of electrical circuits, we expect that concepts from information theory will enable more rigorous and quantitative understanding of how genes (and the proteins they encode) of more complicated signaling systems interact to sense and transmit information into the cell . We constructed yeast strains and plasmids by standard methods 40,41 essentially as described (5 and supplementary information 1). By doctrine, we expressed all reporter constructs from native promoters integrated into the chromosome, and verified that the level of expressed protein was similar to the native level . With the exception of strains used for g - protein fret experiments, we constructed all strains were from otherwise- isogenic bar1- w303a reference parent strain, acl 379 5, by the steps described . We stimulated exponentially - growing cells with the indicated concentration of pheromone and/or other reagents (such as the inhibitor 1-nm - pp1) in one of two ways . For image cytometry, we affixed the cells to the bottom of wells in a glass - bottom 96-well plate, as described in 5 and in supplementary information 2.1 . Using custom fluidic hardware, we evacuated medium from the well, injected fresh medium containing the indicated concentration of pheromone and/or inhibitor, and proceeded to record images over time . For mapk phosphorylation, fus1 mrna, and flow cytometry experiments, we stimulated cells by using a micropipette to mix a small volume of pheromone and/or inhibitor into the cell suspension to the final concentration (as indicated, typically 100 nm pheromone and 10 m 1-nm - pp1). We performed image acquisition essentially as described in 5,23, with modifications as detailed in supplementary information . For image cytometry, we extracted values for parameters of interest from images using cell - id 1.0 23 . We analyzed image and flow cytometric data using physics analysis workstation (paw; see 42) and custom scripts, depending on the type of image, described in the text and in supplementary information . Supplementary information contains further details on plasmids, strains, construction methods, materials, and experimental methods.
|
It is known that breast density is a risk factor of breast cancer . A woman who has more than 75% breast density is 46 times more likely to have breast cancer than a woman who has a breast density of less than 25%1 . Guidelines for breast cancer screening have been suggested, and women over 50 years old are generally recommended to undergo mammography . One study even says women in their 40s can also increase their lifespan through mammography, recommending they too should undergo mammography2, 3 . Not only does higher breast density mean a higher chance of having breast cancer, but breast density can also cause false negatives and increase re - examination rates by lowering mammography s sensitivity4, 5 . Breast density is affected by race, age, bmi, and the level of female sex hormones . In particular, body mass index (bmi) is a risk factor for breast cancer in women who are in menopause . It has also been shown in several pilot studies that abdominal obesity and weight increase, even after correcting for bmi, have some connection with the increased rate of breast cancer after menopause6, 7 . As the amount of body fat grows due to obesity, so does the amount of fatty tissue generally, and eventually the density in mammography decreases . As mentioned above, some factors related to breast density have been reported, but they are only basic characteristics . The study subjects were 230 patients who underwent mammography and biochemical marker tests between march 1 and october 1, 2014, at soonchunhyang university hospital . All the subjects signed a written informed consent form approved by the institutional review board of soonchunhyang university hospital . Subjects who may have had abnormal bone density levels, such as diabetic patients, fasting glucose 126 mg / dl, 7.0 mmol / l, or those who had taken hormone treatment for over a year were excluded, and we chose only post - menopausal women . Six diabetic patients, 14 before menopause, and 10 hormone treatment patients were excluded, leaving 200 subjects whose average age was 48.6410.92 yrs . To perform mammography, we used a lorad elite trex mammo (trex - lorad, usa) at 26 kvp and 80 mas . The american college of radiology, breast imaging reporting and data system (acr bi - rads, usa) categorizes breast parenchymal pattern density from mammography into four grades: grade 1, almost entire fat; grade 2, fibroglandular densities; grade 3, heterogeneously dense; and grade 4, extremely dense (fig . A) represents almost entirely fat, b) represents fibroglandular densities, c) represents heterogeneously dense, and d) represents extremely dense). Height and weight were measured with an automatic height and weight scale, and body mass index (bmi) was computed using the formula weight (kg)/height squared (m). Mammography . A) represents almost entirely fat, b) represents fibroglandular densities, c) represents heterogeneously dense, and d) represents extremely dense subjects fasted for at least 12 h before blood and urine collections for biochemical marker tests . Fifty items were assayed: erythrocyte sedimentation rate (esr), white blood cell (wbc), red blood cell (rbc), hemoglobin, hematocrit, mean corpuscular volume (mcv), mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), platelet count, red cell distribution width (rdw), platelet distribution width (pdw), mean platelet volume (mpv), neutrophil (%), lymphocyte (%), monocytes (%), eosinophil (%), basophil (%), neutrophil, lymphocyte, monocytes, eosinophil, basophil, hba1c, protein, albumin, glucose, total bilirubin, direct bilirubin, aspartate aminotransferase (ast), alanine aminotransferase (alt), alkaline phosphatase (alp), urea nitrogen, creatinine, uric acid, calcium, phosphrus, gamma - glutamyl transferase (gt), lactate dyhydrogenase (ldh), amylase, triglyceride, total cholesterol, high - density lipoprotein (hdl - cholesterol), low - density lipoprotein (ldl - cholesterol), iron (fe), total iron binding capacity (tibc), c - reactive protein (crp), rheumatoid factor (ra factor), hiv combo, hbsag, antihbs, -fetoprotein (afp), carbohydrate antigen 19 - 9 (ca 19 - 9), cancer antigen 125 (ca-125), free thyroxine (free t4), thyroid - stimulating hormone (tsh), anti - hepatitis - c (anti hcv). Simple correlation analysis was performed to investigate correlations among breast density, general characteristic, and biochemical markers . Then, multiple regression analysis was performed to evaluate the factors that showed a significant correlation . Spss software (ver.18.0, chicago, usa) with a significance of 0.05 was used . The simple correlation analysis of breast density, general characteristics, and biochemical markers before and after menopause is shown in table 1table 1.simple correlation analysis of breast density, general characteristics, and biochemical markersvariablebreastdensityvariablebreastdensityvariablebreastdensityvariablebreastdensityage0.55neutrophil% 0.05ast (got)0.22tibc0.00height0.28lymphocyte% 0.07alt (gpt)0.27crp0.13weight0.30monocytes% 0.06alp0.28ra factor0.03bmi0.48eosinophil% 0.04urea nitrogen0.07hiv combo0.04esr0.07basophil% 0.03creatinine0.10hbsag0.09wbc0.12neutrophil0.06uric acid0.16antihbs0.06rbc0.01lymphocyte0.04calcium0.09afp0.03hemoglobin0.14monocytes0.05phosphorus0.06ca 19 - 90.02hematocrit0.15eosinophil0.02gt0.18ca 1250.04mcv0.13basophil0.08ldh0.05free t40.11mch0.19hba1c0.10amylase0.03tsh0.05mchc0.05protein0.02triglyceride0.30antihcv0.12platelet count0.04albumin0.04cholesterol, total0.16rdw0.15glucose0.15hdl - cholesterol0.23pdw0.10bilirubin, total0.07ldl - cholesterol0.29mpv0.07bilirubin, direct0.09iron0.00bmi: body mass index, esr: erythrocyte sedimentation rate, wbc: white blood cell, rbc: red blood cell, mcv: mean corpuscular volume, mch: mean corpuscular hemoglobin, mchc: mean corpuscular hemoglobin concentration, rdw: red cell distribution width, pdw: platelet distribution width, mpv: mean platelet volume, ast: aspartate aminotransferase, alt: alanine aminotransferase, alp: alkaline phosphatase, gt: gamma - glutamyl transferase, ldh: lactate dyhydrogenase, hdl - cholesterol: high - density lipoprotein, ldl - cholesterol: low - density lipoprotein, tibc: total iron binding capacity, crp: c - reactive protein, ra factor: rheumatoid factor, afp: -fetoprotein, ca19 - 9: carbohydrate antigen 19 - 9, ca-125: cancer antigen 125, free t4: free thyroxine, tsh: thyroid - stimulating hormone, anti hcv: anti - hepatitis - c . Items exhibiting significant correlations with breast density were: age, 0.55; height, 0.26; weight, 0.30; bmi, 0.48; hematocrit, 0.15; mch, 0.19; rdw, 0.15; glucose, 0.15; ast(got), 0.22; alt(gpt), 0.27; alp, 0.28; uric acid, 0.16; gt(ggt), 0.18; triglyceride, 0.30; total cholesterol, 0.16; hdl - cholesterol, 0.23; and ldl - cholesterol, 0.29 (p <0.05). The results of multiple regression analysis using breast density - related variables are shown in table 2table 2.multiple regression analysis of each variable related to breast densityvariablebseage0.040.00height0.040.01weight0.030.01bmi0.130.02hematocrit0.010.00mch0.060.02rdw0.080.04ast0.010.00alt0.020.00alp0.000.00uric acid0.030.01gt0.010.00triglyceride0.000.00cholesterol, total0.000.00hdl - cholesterol0.020.00ldl - cholesterol0.010.00bmi: body mass index, mch: mean corpuscular hemoglobin, rdw: red cell distribution width, ast: aspartate aminotransferase, alt: alanine aminotransferase, alp: alkaline phosphatase, gt: gamma - glutamyl transferase, hdl - cholesterol: high - density lipoprotein, ldl - cholesterol: low - density lipoprotein . Significant factors were: age, 0.040.00, height, 0.040.01; weight, 0.030.01; bmi, 0.130.02; t - score, 0.130.05; hematocrit, 0.010.00; mch, 0.060.02; rdw, 0.080.04; ast(got), 0.010.00; alt(gpt), 0.020.00; alp, 0.000.00; uric acid, 0.030.01; gt(gtp), 0.010.00; triglyceride, 0.000.00; total cholesterol, 0.000.00; hdl - cholesterol, 0.020.00; and ldl - cholesterol, 0.010.00 (p <0.05). Bmi: body mass index, esr: erythrocyte sedimentation rate, wbc: white blood cell, rbc: red blood cell, mcv: mean corpuscular volume, mch: mean corpuscular hemoglobin, mchc: mean corpuscular hemoglobin concentration, rdw: red cell distribution width, pdw: platelet distribution width, mpv: mean platelet volume, ast: aspartate aminotransferase, alt: alanine aminotransferase, alp: alkaline phosphatase, gt: gamma - glutamyl transferase, ldh: lactate dyhydrogenase, hdl - cholesterol: high - density lipoprotein, ldl - cholesterol: low - density lipoprotein, tibc: total iron binding capacity, crp: c - reactive protein, ra factor: rheumatoid factor, afp: -fetoprotein, ca19 - 9: carbohydrate antigen 19 - 9, ca-125: cancer antigen 125, free t4: free thyroxine, tsh: thyroid - stimulating hormone, anti hcv: anti - hepatitis - c bmi: body mass index, mch: mean corpuscular hemoglobin, rdw: red cell distribution width, ast: aspartate aminotransferase, alt: alanine aminotransferase, alp: alkaline phosphatase, gt: gamma - glutamyl transferase, hdl - cholesterol: high - density lipoprotein, ldl - cholesterol: low - density lipoprotein of the many risk factors that cause breast cancer, the best known is long - term exposure to female sex hormones8,9,10,11,12 . It has been reported that as estrogen levels increase, so does the risk of breast cancer13 . Additionally, breast density has a high correlation with breast cancer; as breast density increases, women are more likely to have breast cancer8 . Factors that affect breast density include race, age, bmi, and levels of female sex hormones6, 7 . In this study, the factors related to breast density were age, height, weight, bmi, hematocrit, mch, rdw, ast, alt, alp, uric acid, gt, triglyceride, total cholesterol, hdl - cholesterol, and ldl - cholesterol . Breast tissue degenerates due to the decline in estrogen and progesterone, and breast density starts to decrease due to an increase in fatty tissue14 . Bone density level, breast density, and breast cancer are related . In this study, studies of western women reported bmi as one of the major factors that affecting breast density15, 16 . According to those studies, when bmi was low, even after correcting for age, it indicated high density breasts . The proportion of dense breast was 60% in low - weight women under age 40, similar to the results of our present study . A limitation of this study was that, because there were a small number of subjects, it was difficult to identify correlations between breast density and biochemical markers objectively . Thus, an effort is needed to make more precise risk evaluations of breast density by conducting a large - scale prospective study of korean women.
|
According to the world oral health report, dental caries remains a major public health problem in most countries, affecting 6090% of school going children and a vast majority of adults, and this may be due to the changing lifestyles, dietary habits, increased sugar consumption and inadequate exposure to fluorides . The primary teeth are more susceptible to caries development than permanent teeth because of lower mineral and higher organic content of enamel . Compared to adults, the demineralization potential at low oral ph is greater while the remineralization potential at normal ph is lower in children . Hence, the progression of caries will be faster, and reversal will be slower in children, as they depend upon the balance between demineralization and remineralization . Fluorides have the ability to remineralize early carious lesions, and can be used as active anticariogenic agents, which are available in the form of dentifrices, mouth rinses, varnishes, gels, and foams . Fluoride dentifrices are the most widely used products that deliver topical fluoride to the oral environment . Most fluoride dentifrices contain fluoride predominantly in the form of sodium fluoride (naf) or sodium monofluorophosphate (mfp) and other formulations are with amine fluoride or stannous fluoride . The content of fluoride varies between 500 and 1500 ppm and are categorized into low - fluoride (<600 ppm f), standard (1000 ppm f) or high - fluoride (1500 ppm f) dentifrices . The daily use of a fluoridated dentifrice will provide sufficient fluoride to maintain appropriate levels in saliva and plaque to actively influence remineralization, but the major drawback of fluoride dentifrices is the risk of dental fluorosis in children . Fluoride toothpastes contribute approximately 57% of the total daily amount of fluoride ingested by 4- to 7-year - old children, which occurs because of less control over swallowing especially in preschool children . Preventive measures to reduce the ingestion of fluorides from toothpastes are necessary, such as reducing the amount of toothpaste used, supervised brushing in preschool children and developing low - fluoride toothpastes . The american academy of pediatric dentistry recommends low - fluoride dentifrices for children aged 26 years twice daily . The amount to be used should be of a small pea or of smear size . Many studies were conducted to test the de / remineralizing efficacy of fluoridated and nonfluoridated dentifrices on the enamel of permanent teeth, with only a few studies conducted on the de / remineralization efficacy of low - fluoridated dentifrices on carious lesions in primary teeth . Hence, there is an increasing need to know the effect of fluoride dentifrices on the carious lesions of the enamel in primary teeth . Therefore, the present study was undertaken to evaluate and compare the de / remineralization potential of different child formula dentifrices on artificial carious lesions in primary teeth using a 7 days ph - cycling model . Cheerio gel: a fluoride dentifrice manufactured by group pharmaceuticals limited, malur and marketed by dr . Reddy's laboratories ltd, solan, himachal pradesh, india (contents: 0.35% sodium mfp usp in a flavored gel base)colgate pokmon toothpaste: a fluoride dentifrice manufactured by colgate palmolive, usa (contents: 0.11% naf, sorbitol, silica abrasive)children natural toothpaste: a nonfluoridated dentifrice manufactured by pigeon company, korea (contents: calcium phosphate, glycerine, maltilol, carrageenan, flavor), which served as a negative control . Cheerio gel: a fluoride dentifrice manufactured by group pharmaceuticals limited, malur and marketed by dr . Reddy's laboratories ltd, solan, himachal pradesh, india (contents: 0.35% sodium mfp usp in a flavored gel base) colgate pokmon toothpaste: a fluoride dentifrice manufactured by colgate palmolive, usa (contents: 0.11% naf, sorbitol, silica abrasive) children natural toothpaste: a nonfluoridated dentifrice manufactured by pigeon company, korea (contents: calcium phosphate, glycerine, maltilol, carrageenan, flavor), which served as a negative control . It contained 2.2 mm cacl2, 2.2 mm kh2po4, and 0.05 m acetic acid . The remineralizing solution contained 1.5 mm cacl2, 0.9 mm nah2 po4, 0.15 m kcl and ph of 7 . The dentifrice supernatants were prepared by thoroughly mixing a 3:1 ratio (by weight) of deionized water and dentifrice, which was then centrifuged at 4000 rpm for 20 min . Twenty - one sound primary teeth indicated for extraction due to preshedding mobility were collected, and soft tissue debris was cleaned and then stored in 0.2% thymol solution . The teeth were inspected for cracks, hypoplasia and white spot lesions and then coated with an acid resistant nail varnish, leaving a narrow window, approximately 1 mm wide on the sound, intact surface of the buccal or lingual enamel . Then, they were immersed in demineralizing solution for 96 h to produce artificial carious lesions of 150200 m deep . The teeth were embedded in self - cure acrylic resin blocks . A hard tissue microtome (leica 1600 saw microtome, germany) was used to section the teeth longitudinally through the lesions to produce enamel specimens of approximately 100150 m thick . The damaged specimens were discarded, and the rest of the specimens were randomly assigned for each of the three groups (groups a, b and c). Polarizing light microscopy was utilized to record the depth of the lesions . The sections were painted under a stereomicroscope with acid resistant nail varnish leaving the lesion surface exposed for exposure to experimental solutions . The specimens were suspended with dental floss in a beaker containing deionized water and sealed with paraffin wax to achieve 100% humidity until usage . All of the specimens in a particular group were placed in the ph - cycling system on an orbital shaker (kemi company, kadavil electromechanical industries, ernakulam, kerala) for a period of 7 days . Each cycle involved 3 h of demineralization twice daily, with 2 h of remineralization between periods of demineralization . Dentifrice supernatant was treated for 60 s before the first demineralization and both before and after the second demineralization . The demineralizing, remineralizing solutions and dentifrice supernatants were freshly prepared for each cycle and stored in separate containers designed for each group throughout the experimental period . Before a topical treatment with supernatant solutions, the teeth were removed from the de-/remineralizing solutions and thoroughly washed with deionized water . The de-/remineralizing solutions and supernatant solutions were changed daily to prevent depletion or saturation of the solutions and accumulation of enamel dissolution products . The sections were then studied under polarized light microscopy to evaluate the lesion depth before and after 7 days . For clear demarcation between sound and carious enamel, the specimens were imbibed in water and then recorded using polarizing light microscope both before and after ph - cycling, to evaluate qualitatively the lesion depth in each enamel section [figures 13]. The depths of the lesions were measured with a computerized calculation method using a software program (progres, germany). Polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group a polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group b polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group c cheerio gel: a fluoride dentifrice manufactured by group pharmaceuticals limited, malur and marketed by dr . Reddy's laboratories ltd, solan, himachal pradesh, india (contents: 0.35% sodium mfp usp in a flavored gel base)colgate pokmon toothpaste: a fluoride dentifrice manufactured by colgate palmolive, usa (contents: 0.11% naf, sorbitol, silica abrasive)children natural toothpaste: a nonfluoridated dentifrice manufactured by pigeon company, korea (contents: calcium phosphate, glycerine, maltilol, carrageenan, flavor), which served as a negative control . Cheerio gel: a fluoride dentifrice manufactured by group pharmaceuticals limited, malur and marketed by dr . Reddy's laboratories ltd, solan, himachal pradesh, india (contents: 0.35% sodium mfp usp in a flavored gel base) colgate pokmon toothpaste: a fluoride dentifrice manufactured by colgate palmolive, usa (contents: 0.11% naf, sorbitol, silica abrasive) children natural toothpaste: a nonfluoridated dentifrice manufactured by pigeon company, korea (contents: calcium phosphate, glycerine, maltilol, carrageenan, flavor), which served as a negative control . It contained 2.2 mm cacl2, 2.2 mm kh2po4, and 0.05 m acetic acid . The remineralizing solution contained 1.5 mm cacl2, 0.9 mm nah2 po4, 0.15 m kcl and ph of 7 . The dentifrice supernatants were prepared by thoroughly mixing a 3:1 ratio (by weight) of deionized water and dentifrice, which was then centrifuged at 4000 rpm for 20 min . Twenty - one sound primary teeth indicated for extraction due to preshedding mobility were collected, and soft tissue debris was cleaned and then stored in 0.2% thymol solution . The teeth were inspected for cracks, hypoplasia and white spot lesions and then coated with an acid resistant nail varnish, leaving a narrow window, approximately 1 mm wide on the sound, intact surface of the buccal or lingual enamel . Then, they were immersed in demineralizing solution for 96 h to produce artificial carious lesions of 150200 m deep . The teeth were embedded in self - cure acrylic resin blocks . A hard tissue microtome (leica 1600 saw microtome, germany) was used to section the teeth longitudinally through the lesions to produce enamel specimens of approximately 100150 m thick . The damaged specimens were discarded, and the rest of the specimens were randomly assigned for each of the three groups (groups a, b and c). Polarizing light microscopy was utilized to record the depth of the lesions . The sections were painted under a stereomicroscope with acid resistant nail varnish leaving the lesion surface exposed for exposure to experimental solutions . The specimens were suspended with dental floss in a beaker containing deionized water and sealed with paraffin wax to achieve 100% humidity until usage . All of the specimens in a particular group were placed in the ph - cycling system on an orbital shaker (kemi company, kadavil electromechanical industries, ernakulam, kerala) for a period of 7 days . Each cycle involved 3 h of demineralization twice daily, with 2 h of remineralization between periods of demineralization . Dentifrice supernatant was treated for 60 s before the first demineralization and both before and after the second demineralization . The demineralizing, remineralizing solutions and dentifrice supernatants were freshly prepared for each cycle and stored in separate containers designed for each group throughout the experimental period . Before a topical treatment with supernatant solutions, the teeth were removed from the de-/remineralizing solutions and thoroughly washed with deionized water . The de-/remineralizing solutions and supernatant solutions were changed daily to prevent depletion or saturation of the solutions and accumulation of enamel dissolution products . The sections were then studied under polarized light microscopy to evaluate the lesion depth before and after 7 days . For clear demarcation between sound and carious enamel, the specimens were imbibed in water and then recorded using polarizing light microscope both before and after ph - cycling, to evaluate qualitatively the lesion depth in each enamel section [figures 13]. The depths of the lesions were measured with a computerized calculation method using a software program (progres, germany). Polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group a polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group b polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group c for clear demarcation between sound and carious enamel, the specimens were imbibed in water and then recorded using polarizing light microscope both before and after ph - cycling, to evaluate qualitatively the lesion depth in each enamel section [figures 13]. The depths of the lesions were measured with a computerized calculation method using a software program (progres, germany). Polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group a polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group b polarized light micrographs of enamel lesions before (a) and after (b) ph cycling for group c seven sections of group a were treated with cheeriogel * and the mean score, and standard deviation (sd) was 180 26 before ph - cycling and 175 22 after ph - cycling (p = 0.01). Similarly in seven sections of group b treated with colgate pokeman *, the mean score and sd was 191 2l before ph - cycling and 173 16 after ph - cycling (p = 0.03). In seven sections of group c treated with children's natural, the mean score and sd was 183 30 before ph - cycling and 201 18 after ph - cycling (p = 0.04) [table 1]. In all the groups, there exists a statistical significance (p <0.05). Comparison of the depth of the lesion before and after ph cycling in group a (cheerio gel), group b (colgate paokeman) and group c (children's natural) inter group comparison revealed that, the mean and sd in groups a and b after ph cycling had decreased than the mean and sd before ph cycling . Only mean and sd for group c had increased after ph cycling . The means and sd's of the pretreatment lesion depths between groups a, b and c were not significantly different from each other (p = 0.745) as shown in table 2 . This shows that, even though, the specimens were sectioned from different primary teeth, the variations among the teeth did not show a major effect on the progress of demineralization . Comparison of the depth of the lesion among the pretreatment groups a, b and c using anova on comparison, the posttreatment lesion depths of groups a, b and c showed mean and sd as 175 22, 173 16 and 201 18 respectively, which was found to be statistically significant (p = 0.012) as shown in table 3 . Comparison of the depth of the lesion among the posttreatment groups a, b and c using anova on overall comparison, the lesion depths in groups a and b decreased by 3% and 10% respectively, while group c demonstrated an increase in lesion depth by 9% [table 1]. Comparisons using anova and paired t - test showed that groups a and b were significantly different from group c, but there was no statistical significance between groups a and b. on using duncan's multiple range test, it was observed that group a differ from group c (p <0.05) but not with group b (p> 0.05), whereas group b differs significantly from group c (p <0.05). The caries process is a continuum resulting from an imbalance between many cycles of demineralization and remineralization rather than a unidirectional demineralization process . Fluoride has been shown to have a greater inhibitory effect on caries progression than on caries initiation . The levels needed to significantly reduce caries or, at a mechanistic level to shift the balance from caries initiation and progression to caries reversal are apparently in the sub ppm range . Hence, the present study was undertaken to evaluate and compare the remineralization effects of different child formula dentifrices on artificial carious lesions in primary teeth using a 7 days ph - cycling model . Artificial early caries - like lesions of the enamel showed all the principal histological features of natural caries and had been successfully used to study the remineralization of enamel in vitro . These artificial lesions of the enamel were more homogenously reproducible than natural lesions and thus provide a reliable experimental model, hence; carious lesions were artificially produced in the present study . Extracted or naturally exfoliated primary teeth (molars, canines, and incisors) though there are variations in the morphology of individual teeth, it was hypothesized that these variations among the teeth do not play a significant role in caries formation, and in the present study too, the depths in the pretreatment test groups were not statistically different . This implies that, even though, the specimens were sectioned from different teeth, the variations among the teeth did not show a major effect on the progress of demineralization . Single - section model, as used in this study had the advantage that a single section was fully evaluated prior to the experimental period and then again after the exposure period . The de / remineralizing solutions and supernatant solutions were changed daily to prevent depletion or saturation of the solutions and accumulation of enamel dissolution products . The concept of in vitro ph cycling was first proposed by ten cate and duijsters in 1982, in experiments where they exposed artificial carious lesions in enamel to a combination of remineralizing and demineralizing solutions . Two types of ph - cycling models are used, the 7-day ph - cycling and the 10-day ph - cycling . A 10-day ph - cycling model can be used on the enamel of permanent teeth whereas a 7-day ph - cycling or 10-day cycling with added 0.25 ppm fluoride can be used for primary teeth . In the present study, ph - cycling was done for 7 days without the addition of fluoride, because the addition of fluoride could have interfered with the hypothesis being tested . Naf and sodium mfp contain fluoride in chemically distinct forms, and they will differ in their mode of action with respect to caries reduction . The reason for greater retention of oral fluoride from naf than from mfp could be due to: (1) fluoride ions diffuse faster from naf than mfp, by a factor of 1000 in dental enamel; (2) there is no mfp analogue of calcium fluoride, which is important in oral fluoride retention; (3) fluoride ions from mfp bind to a lesser extent to tooth mineral and plaque bacteria than naf . An extensive series of in vitro and clinical trials have tested the anticaries efficacy of dentifrices containing naf or mfp . Many in vitro studies suggest that dentifrices containing naf perform better than dentifrices containing mfp whereas a study concluded no statistically significant difference between the two . The efficacy of fluoride toothpastes in clinical trials is potentially influenced by several factors, namely: fluoride concentration, frequency of use, amount used and rinsing behavior whereas in the in vitro studies, the sole factor that plays key role is the fluoride concentration used . This might be the reason for less effectiveness of mfp in the in vitro studies than in vivo studies . This again might be due to the absence of a key mechanistic step in the in vitro studies in determining the clinical efficiency of mfp, namely the hydrolysis of mfp to fluoride ions . These are in accordance with the present study where, both the mfp and naf dentifrices showed decrease in the lesion depths and the difference between the two was not statistically significant . But the naf had showed a greater decrease in lesion depth confirming its superior anticaries efficacy over mfp . Based on the results obtained from the present study, we could conclude that the child formula dentifrices containing naf and sodium monofluorophosphate have the ability to remineralize the initial carious lesions in the primary teeth as both reduced the depth of the artificial carious lesions . But, it is also important to emphasize other preventive methods in the prevention and/or reversal of caries as the child formula dentifrices could not completely remineralize the carious lesions.
|
Each year, approximately 1.68 million women were diagnosed with breast cancer worldwide, and over 500,000 women died of the disease (about 1400 deaths per day). Breast cancer might be controlled but usually not cured when diagnosed in the metastatic setting . However, the revolution in the molecular biology gives rise to an improved understanding of this disease and more options for the treatment . Although the incidence of the disease is continuously high, the mortality rate is reducing . The 5-year survival rate of breast cancer was around 89% according to the statistics in 2014 . Many new systematic therapies for advanced breast cancer have been available over the decades, especially for human epidermal growth factor receptor 2 (her2)-positive breast cancer . C - erbb-2) are important pathways related to cell growth, proliferation, differentiation, and death, and the overexpression or amplification of her2 often indicates higher rates of recurrence and mortality in breast cancer . A total of 15% to 20% of all the breast cancers are estimated to overexpress her2 receptor, and thus, these patient populations can benefit from her2-targeted therapy . Pertuzumab is a humanized, recombinant, immunoglobulin g monoclonal antibody that targets her2 . Unlike trastuzumab, pertuzumab shows its novelty which can either homodimerize with another her2 receptor or heterodimerize with a different receptor of the her family to activate certain downstream signaling pathways through phosphorylation of the tyrosine kinases . It acts on the extracellular portion of her2 receptor like trastuzumab, but the binding region is different, leading to different effects on cancers . In previous clinical trials, pertuzumab showed its efficacy in her2-overexpressed breast cancer and other cancers, such as ovarian and prostate cancer . The food and drug administration (fda) has approved pertuzumab in combination with trastuzumab and docetaxel for the treatment of patients with her2-positive metastatic breast cancer who have not received prior anti - her2 therapies or chemotherapy for metastatic diseases . The european medicines agency also recommended this combination for the treatment of adult patients with her2-positive metastatic or locally recurrent unresectable breast cancer . Previous clinical trials have reported that this monoclonal antibody is effective in the therapies for cancer patients, but the adverse effects caused by pertuzumab or pertuzumab - based therapies should also be considered, such as gastrointestinal, skin, and hematopoietic toxicities . The adverse effects might differ in each clinical trial, and some might not be caused by pertuzumab . Thus, we conducted this meta - analysis to evaluate the safety and efficacy profile of this drug . Pubmed (articles from january 1966 to january 2015) was searched using the keyword pertuzumab . In addition, we reviewed embase (articles from january 2000 to january 2015) for pertuzumab to make sure no additional studies were missed . After screening the titles and/or abstracts, duplicates were removed, and for those articles with similar data and study designs, only the most complete and recent clinical trial was included in our analysis . Two authors independently selected studies and discrepancies were resolved by discussion with a third author . As this was a meta - analysis, no ethical approval was required . In all phase i clinical trials, pertuzumab was used in the range of 0.5 to 20 mg / kg to evaluate the dose - limiting toxicity and maximum tolerated dose . In phase ii and iii clinical trials, pertuzumab was studied in 2 different dosing schedules: 840 mg as a loading dose followed by 420 mg every 3 weeks and 1050 mg every 3 weeks . Trials that met the following criteria were selected for the final analysis: prospective phase i, ii, and iii clinical trials in cancer patients; participants were treated with pertuzumab; data were available regarding the survival outcomes and incidences of all - grade or grade 3 adverse effects . Studies using pertuzumab as a single agent or in combination with other drugs were both included in our analysis . Data of clinical end points extracted from the trials were low - grade (12), high - grade (35), and all - grade (15) adverse effects according to the national cancer institute common toxicity criteria version 2 or common terminology criteria for adverse effects version 3 . Other extracted data included the first author's name, year of publication, the study design, population information, dosing schedules of pertuzumab, type of cancers, and concurrent antineoplastic medications used with pertuzumab . We performed the statistical analyses using the comprehensive meta - analysis program (biostat, englewood, nj) version 2 . For each study, the proportion of patients with each adverse effect (both all - grade and grade 3) in the pertuzumab arm was calculated, and the 95% confidence interval (ci) was derived . For all the randomized controlled studies comparing pertuzumab with placebo, we calculated the odds ratio (or) of each adverse effect mentioned in at least 2 studies to determine the role pertuzumab plays in each adverse effect . We also extracted median progression - free survival (pfs) from single - agent pertuzumab trials and hazard ratios (hrs) with 95% ci from control - arm studies to evaluate the efficacy of pertuzumab . I and p values were evaluated to test heterogeneity, and when i> 50% and p <.1, a random - effects model was used in the analysis . To evaluate the risk of bias and quality of the studies, quadas-2 was used as a systematic review assessment method, which consisted of 4 key domains: patient selection, index test, reference standard, and flow and timing . Copenhagen: the nordic cochrane centre, the cochrane collaboration, 2014, copenhagen, sweden). Pubmed (articles from january 1966 to january 2015) was searched using the keyword pertuzumab . In addition, we reviewed embase (articles from january 2000 to january 2015) for pertuzumab to make sure no additional studies were missed . After screening the titles and/or abstracts, duplicates were removed, and for those articles with similar data and study designs, only the most complete and recent clinical trial was included in our analysis . Two authors independently selected studies and discrepancies were resolved by discussion with a third author . As this was a meta - analysis, no ethical approval was required . In all phase i clinical trials, pertuzumab was used in the range of 0.5 to 20 mg / kg to evaluate the dose - limiting toxicity and maximum tolerated dose . In phase ii and iii clinical trials, pertuzumab was studied in 2 different dosing schedules: 840 mg as a loading dose followed by 420 mg every 3 weeks and 1050 mg every 3 weeks . Trials that met the following criteria were selected for the final analysis: prospective phase i, ii, and iii clinical trials in cancer patients; participants were treated with pertuzumab; data were available regarding the survival outcomes and incidences of all - grade or grade 3 adverse effects . Studies using pertuzumab as a single agent or in combination with other drugs were both included in our analysis . Data of clinical end points extracted from the trials were low - grade (12), high - grade (35), and all - grade (15) adverse effects according to the national cancer institute common toxicity criteria version 2 or common terminology criteria for adverse effects version 3 . Other extracted data included the first author's name, year of publication, the study design, population information, dosing schedules of pertuzumab, type of cancers, and concurrent antineoplastic medications used with pertuzumab . We performed the statistical analyses using the comprehensive meta - analysis program (biostat, englewood, nj) version 2 . For each study, the proportion of patients with each adverse effect (both all - grade and grade 3) in the pertuzumab arm was calculated, and the 95% confidence interval (ci) was derived . For all the randomized controlled studies comparing pertuzumab with placebo, we calculated the odds ratio (or) of each adverse effect mentioned in at least 2 studies to determine the role pertuzumab plays in each adverse effect . We also extracted median progression - free survival (pfs) from single - agent pertuzumab trials and hazard ratios (hrs) with 95% ci from control - arm studies to evaluate the efficacy of pertuzumab . I and p values were evaluated to test heterogeneity, and when i> 50% and p <.1, a random - effects model was used in the analysis . To evaluate the risk of bias and quality of the studies, quadas-2 was used as a systematic review assessment method, which consisted of 4 key domains: patient selection, index test, reference standard, and flow and timing . Copenhagen: the nordic cochrane centre, the cochrane collaboration, 2014, copenhagen, sweden). Six studies were excluded because they did not provide enough data for specific adverse effects . Search results and study selection for all the clinical trials included in our study . Characteristics of the 14 eligible studies included in our final analysis are presented in table 1 . These studies included 2 phase i trials, 11 phase ii trials, and 1 phase iii trial . Five phase ii trials used pertuzumab as a single agent, 3 phase ii trials used pertuzumab in combination with at least 1 agent, and the remaining 3 phase ii trials were randomized controlled trials (rcts). Seven trials (n = 392) evaluated pertuzumab as monotherapy . Three trials (n = 353) used pertuzumab plus other agents . Four trials (n = 1504; pertuzumab: 853; control: 651) compared the effects of pertuzumab arm with the control arm . The 14 studies included breast cancer (6 articles), prostate cancer (2 articles), ovarian cancer (3 articles), nonsmall cell lung cancer (nsclc) (1 article), and other kinds of solid tumors (2 articles). We found that diarrhea, nausea, and rash were the most common all - grade adverse effects . The rates ranged from 20.9% to 86.5% for diarrhea, 6.1% to 75.4% for nausea, and 5.7% to 37.1% for rash . The pooled rates for diarrhea, nausea, and rash were 56.9% (95% ci 49.6%63.9%), 34.0% (95% ci 27.7%40.8%), and 25.6% (95% ci 20.8%31.0%), respectively (fig . Forest plot of the incidence of all - grade (a) diarrhea, (b) nausea, and (c) rash in pertuzumab - based therapies . Subgroup analysis based on types of tumors including breast cancer, ovarian cancer, prostate cancer, and nsclc was performed . For the 3 main adverse effects discussed above, we found that adverse rates were higher in breast cancer and ovarian cancer than in prostate cancer and nsclc . The adverse rates in ovarian cancer tended to be the highest . In patients with breast cancer, regardless of the stages and surface markers, the rates of adverse effect were similar, and this was also the case in ovarian and prostate cancer . Among all types of cancers, hormone refractory prostate cancer was prone to have the lowest rate of the 3 adverse effects (table 3). The highest and lowest rates of 3 meaningful adverse effects and the pooled event rates in different kinds of tumor . We selected rcts to determine the or of each adverse effect mentioned in more than 2 studies . Among all the adverse effects, diarrhea (or 2.310, 95% ci 1.8182.936), rash (or 1.848, 95% ci 1.0943.122), and febrile neutropenia (or 1.672, 95% ci 1.1302.474) were of statistical significance, which meant pertuzumab played a prominent role in the incidence of diarrhea (fig . Adverse effects, the rate of febrile neutropenia in the experimental group was significantly higher than that in the control group (or 1.585, 95% ci 1.0452.403) (fig . Forest plot of the odds ratio of main adverse effects in pertuzumab - based therapies from all the randomized controlled trials using (a) random model and (b) fixed model . Forest plot of the odds ratio of the grade 3 adverse effects in pertuzumab - based therapies . The data of median pfs which is the time from the date of first dose of study medication to documented progressive disease or death at any time for pertuzumab in different kinds of tumors are shown in table 5 . In single - arm trials with pertuzumab alone, median pfs for ovarian cancer was 1.65 (95% ci 1.52.725) and for small - cell lung cancer was 1.525 (95% ci 1.3252.825). Median pfs did not differ between different doses administered in patients with prostate cancer (420 mg: 1.433, 95% ci 0.7672.7 vs 1050 mg: 1.433, 95% ci 0.8332.1). Similar results were also seen in breast cancer (420 mg: 1.467, 95% ci 1.2672.733 vs 1050 mg: 1.433, 95% ci 1.32.833). In control - arm trials using combination therapies, gemicitaine + pertuzumab and trastuzumab + docetaxel + pertuzumab showed a prolonged pfs, whereas chemotherapy + pertuzumab indicated that the addition of pertuzumab to carboplatin - based chemotherapy did not substantially prolong pfs in unselected patients with platinum - sensitive ovarian cancer . Pertuzumab might stabilize diseases and prolong the survival of cancer patients; however, large - scale studies are needed to confirm the results we have obtained so far . The risk of bias and quality assessments of the included studies are outlined in fig . 5a and (a) risk of bias graph: review authors judgments about each risk of bias item presented as percentages across all included studies and (b) risk of bias summary: review authors judgments about each risk of bias item for each included study . Six studies were excluded because they did not provide enough data for specific adverse effects . Search results and study selection for all the clinical trials included in our study . Characteristics of the 14 eligible studies included in our final analysis are presented in table 1 . These studies included 2 phase i trials, 11 phase ii trials, and 1 phase iii trial . Five phase ii trials used pertuzumab as a single agent, 3 phase ii trials used pertuzumab in combination with at least 1 agent, and the remaining 3 phase ii trials were randomized controlled trials (rcts). Seven trials (n = 392) evaluated pertuzumab as monotherapy . Three trials (n = 353) used pertuzumab plus other agents . Four trials (n = 1504; pertuzumab: 853; control: 651) compared the effects of pertuzumab arm with the control arm . The 14 studies included breast cancer (6 articles), prostate cancer (2 articles), ovarian cancer (3 articles), nonsmall cell lung cancer (nsclc) (1 article), and other kinds of solid tumors (2 articles) we found that diarrhea, nausea, and rash were the most common all - grade adverse effects . The rates ranged from 20.9% to 86.5% for diarrhea, 6.1% to 75.4% for nausea, and 5.7% to 37.1% for rash . The pooled rates for diarrhea, nausea, and rash were 56.9% (95% ci 49.6%63.9%), 34.0% (95% ci 27.7%40.8%), and 25.6% (95% ci 20.8%31.0%), respectively (fig . Forest plot of the incidence of all - grade (a) diarrhea, (b) nausea, and (c) rash in pertuzumab - based therapies . Subgroup analysis based on types of tumors including breast cancer, ovarian cancer, prostate cancer, and nsclc was performed . For the 3 main adverse effects discussed above, we found that adverse rates were higher in breast cancer and ovarian cancer than in prostate cancer and nsclc . The adverse rates in ovarian cancer tended to be the highest . In patients with breast cancer, regardless of the stages and surface markers, the rates of adverse effect were similar, and this was also the case in ovarian and prostate cancer . Among all types of cancers, hormone refractory prostate cancer was prone to have the lowest rate of the 3 adverse effects (table 3). The highest and lowest rates of 3 meaningful adverse effects and the pooled event rates in different kinds of tumor . We selected rcts to determine the or of each adverse effect mentioned in more than 2 studies . Among all the adverse effects, diarrhea (or 2.310, 95% ci 1.8182.936), rash (or 1.848, 95% ci 1.0943.122), and febrile neutropenia (or 1.672, 95% ci 1.1302.474) were of statistical significance, which meant pertuzumab played a prominent role in the incidence of diarrhea (fig . Adverse effects, the rate of febrile neutropenia in the experimental group was significantly higher than that in the control group (or 1.585, 95% ci 1.0452.403) (fig . Forest plot of the odds ratio of main adverse effects in pertuzumab - based therapies from all the randomized controlled trials using (a) random model and (b) fixed model . Forest plot of the odds ratio of the grade 3 adverse effects in pertuzumab - based therapies . The data of median pfs which is the time from the date of first dose of study medication to documented progressive disease or death at any time for pertuzumab in different kinds of tumors are shown in table 5 . In single - arm trials with pertuzumab alone, median pfs for ovarian cancer was 1.65 (95% ci 1.52.725) and for small - cell lung cancer was 1.525 (95% ci 1.3252.825). Median pfs did not differ between different doses administered in patients with prostate cancer (420 mg: 1.433, 95% ci 0.7672.7 vs 1050 mg: 1.433, 95% ci 0.8332.1). Similar results were also seen in breast cancer (420 mg: 1.467, 95% ci 1.2672.733 vs 1050 mg: 1.433, 95% ci 1.32.833). In control - arm trials using combination therapies, gemicitaine + pertuzumab and trastuzumab + docetaxel + pertuzumab showed a prolonged pfs, whereas chemotherapy + pertuzumab indicated that the addition of pertuzumab to carboplatin - based chemotherapy did not substantially prolong pfs in unselected patients with platinum - sensitive ovarian cancer . Pertuzumab might stabilize diseases and prolong the survival of cancer patients; however, large - scale studies are needed to confirm the results we have obtained so far the risk of bias and quality assessments of the included studies are outlined in fig . 5a and b. overall, the quality of the studies was satisfactory . (a) risk of bias graph: review authors judgments about each risk of bias item presented as percentages across all included studies and (b) risk of bias summary: review authors judgments about each risk of bias item for each included study . The safety profile of pertuzumab showed that the most significant adverse effect was diarrhea, indicating the high rate of gastrointestinal toxicities due to the use of pertuzumab in clinical settings . Other adverse effects did not have such a strong relationship with pertuzumab compared with diarrhea . Single - arm and control - arm trials showed a prolonged pfs of pertuzumab, which meant that this drug might possess the capability to stabilize diseases and prolong the survival of cancer patients . Previous studies have shown that the proper functions of gastrointestinal tracts relied on the expression of her2 receptors in many vital structures, such as epithelial cells and enteric nervous system neurons . Pertuzumab might act on receptors of these normal cells and interfere with their functions, leading to gastrointestinal toxicities . No specific guidelines were available for dealing with gastrointestinal toxicities caused by her2 antibody, but similar situations caused by other chemotherapies could give us some hints . Intravenous amifostine was recommended for the management of gastrointestinal toxicities caused by chemotherapies inhibiting epidermal growth factor receptor (egfr) in nsclc . As egfr pathway is related to anti - her2 therapy and diarrhea is actually a manifestation of mucositis, this mucosa protector amifostine might be effective in treating the diarrhea caused by pertuzumab as well . Furthermore, probiotics containing lactobacillus species were advised when the malignancy existed in the pelvic cavity, either in chemotherapy or radiation therapy . Therefore, we could use lactobacillus probiotics to treat patients with diarrhea caused by ovarian cancer if pertuzumab is approved for future ovarian cancer therapy . Nausea, rash and severe neutropenia also occurred in patients with pertuzumab - based therapies . Drucker et al advised that regular moisturization and the twice - daily application of sun - block spf 15 or higher would be helpful . The finding showed that pertuzumab could affect egfr pathway as in the mechanism of diarrhea . Some studies showed that novel anticancer drugs could inhibit the egfr - ras - raf - mek and pi3 kinase - akt - m - tor pathways to cause skin rash . Since egfrs are highly expressed on keratinocytes, the inhibition of these pathways might be associated with keratinocyte stress and therefore rash occurs . However, future studies are needed to explore a clearer mechanism of her2 inhibitors . Moreover, we tried to find out what were the related factors of these adverse effects . As is shown in table 3, tumors in females like breast cancer and ovarian cancer have noticeable higher rates in all 3 adverse effects when compared with prostate cancer and nsclc, but no significant difference was found in different subtypes of tumors . In addition, prostate cancer seemed to have less adverse effects, which might indicate that the adverse effects were related to the sex hormone or genders, but the reason was unclear . No difference between the rates in 2 different dosages of pertuzumab was found . In june 2012, the fda initially approved pertuzumab for use in combination with trastuzumab and docetaxel for the treatment of patients with her2-positive metastatic breast cancer who have not received prior anti - her2 therapy or chemotherapy . The approval was based on a randomized, double - blind, placebo - controlled phase iii cleopatra (clinical evaluation of pertuzumab and trastuzumab). The trial set 2 arms, 1 for trastuzumab, docetaxel plus pertuzumab, and the other for trastuzumab, docetaxel plus placebo . A total of 808 patients were randomly allocated (1:1) to receive either of the 2 arms . Results showed statistically significant improvement in pfs in the pertuzumab arm (hr 0.62, 95% ci 0.510.75, p <.001). In april 2013, the fda received a supplemental biologics license application for the use of pertuzumab in the neoadjuvant setting which was the first application for the neoadjuvant treatment of breast cancer . The approval was based in part on a rct conducted in 417 locally advanced, inflammatory, or early her2-positive breast cancer patients that were allocated to receive neoadjuvant treatment with tratuzumab + docetaxel, pertuzumab + tratuzumab + docetaxel, pertuzumab + tratuzumab, or pertuzumab + docetaxel . The pathologic complete response rates were 39.3% and 21.5% in the pertuzumab + tratuzumab + docetaxel and the tratuzumab + docetaxel arms, respectively (p = .0063). Moreover, a large phase iii clinical trial showed that pertuzumab gave an increased pfs of 6.1 months and a significant reduction in the risk of progression or death after adding pertuzumab to 1 current standard of care like trastuzumab . The combination therapy might benefit patients better and fda's approval has also embodied this point . However, we should pay more attention to the possible increase of toxicities in the combined therapies . The heterogeneity of included studies is an important factor influencing the validity of the evaluation . These studies were done on different tumor types, different therapies, and even different races . Because of these differences, we found that it was not easy to obtain an objective value of rates . Under this circumstance, we think our results of subgroup analyses are more meaningful than the overall evaluation . The incomplete data of survival outcomes in each article made it hard to draw a specific conclusion of the efficacy of pertuzumab . In addition, the limited number of large phase iii trials on pertuzumab might lead to some deviations with the actual situation . In conclusion, pertuzumab is a safe and relatively effective agent in the therapies for solid tumors, even though it may possess some gastrointestinal toxicities such as diarrhea and nausea . Considering that these toxicities are relatively easy to handle with some mucosa protection agents, its safety can be guaranteed in clinical settings . Pertuzumab - based therapies are promising, and the potency can be further evaluated with more data in the future.
|
Platinum, ruthenium, rhodium, and iridium (platinum group metals) and gold together with silver (copper group metals) are known as noble metals . We discuss the ones that are already used in oncology or have a therapeutic potential . Platinum (pt), with atomic number 78, atomic mass 195.08, density 21.45 g / cm, and melting point 1772c, is quite rare in nature and usually is found together with ruthenium, rhodium, and palladium . In chemical compounds it is mainly found in its oxygenation state of ii, iii, iv, and vi; it has very good properties of electric and thermal conductivity . Platinum was first found in columbia in 1735, named from the spanish platinum, meaning small silver because of its relative lack of usefulness compared to silver, which is called in spanish plata . Platinum is mined in russia, in the republic of south africa, canada, and in the usa . Rosenberg et al . Used cisplatin firstly for the suppression of escherichia coli growth . The most commonly used cytostatics from this group are cisplatin, carboplatin, and oxaliplatin (used from 1978, 1980, and 1988, respectively). They are used in the therapy of many malignant tumours: ovarian cancer, testicular cancer, lung cancer, oesophageal cancer, stomach cancer, prostate cancer, bladder cancer, squamous cell carcinoma of head and neck, cervical cancer combined with radiotherapy, colorectal cancer and non - hodgkin lymphoma, multiple myeloma, neuroblastoma, melanoma, and mesothelioma . Cisplatin is built from one atom of platinum, two chloride ions, and two molecules of ammonia . Carboplatin has one atom of platinum, two molecules of ammonia, and a cyclobutanedicarboxyl ligand with oxygen atom from the carboxyl group . Oxaliplatin, however, is a complex compound of platinum with 1,2-diaminocyclohexane and an oxalate group . The addition of new ligands to platinum atom has been done with the aim of breaking chemoresistance to platinum compounds, which is observed during therapy . This may be a result of the quantity and type of new dna adducts and also of the reduction of treatment side effects [4, 5]. Cytostatics that are platinum derivatives are alkylating agents . By making stable cross bindings with dna (bonds with nucleophilic nitrogen atom n7 of two neighbouring guanines) dna replication the change of dna structure is recognised by specific proteins, including the hmsh2 protein form the high mobility group (hmg), and may cause damage repair; other proteins may be a signal triggering apoptosis [69]. Gong et al . Found that cisplatin may also induce cell death in parallel by activation of suppressor protein p53 and protein p73 . There is, however, evidence that there are other (independent from p53 cell death) pathways in cisplatin based therapies . Cisplatin induces activation of the c - abl tyrosine kinase, which may induce proapoptotic protein p73 [1114]. According to the information enclosed with the drug, the most common side effects (more than 1 out of 10 patients) after cisplatin treatment are: leukopenia, thrombocytopenia, anaemia, hypernatremia, impairment of hearing, decreased appetite, nausea, diarrhoea, kidney malfunction, and fever . In more than 1 out of 100 patients but in less than 1 out of 10 patients peripheral neuropathy side effects of carboplatin include kidney damage (less often than cisplatin), alopecia, fatigue, and elevated liver enzyme activity . Oxaliplatin causes peripheral neuropathy, fatigue, hypernatraemia and hypokalaemia, anaemia, thrombocytopaenia, and leukopaenia . Gold (au), with atomic number 79, atomic mass 197.0, density 19.3 g / cm, and melting point 1063c, is found in its free state and in minerals . In chemical compounds it is mainly in oxygenation states i and iii; it has very good properties of electric and thermal conductivity . The history of gold mining is more than 6000 years old, its colour and timeless value were well known in art and architecture of ancient civilisations . The main producer of gold is the republic of south africa, although it is also mined in other regions of the world . Its complex auranofin is used in rheumatism treatment, and its anticancer potential is also described in both in vitro and in vivo models [1517]. In recent years nanotechnology using structures of 1 nm to 150 nm also involves the use of gold . Gold particles are stable and non - toxic; they can bind drugs, antibodies, or antigens, they can have transport and active substance release capability . They are safe for healthy tissues because they do not disintegrate during transport [15, 18, 19]. They reduce tumour mass also in platinum - resistant cancers, and they have lower toxicity, especially for the kidneys [2022]. The anticancer activity of gold complexes is not known, although some research shows that they may have inhibiting activity towards enzymatic protein complexes like thioredoxin (trx) and thioredoxin reductase (trxr); they may also inhibit proteasome activity a mechanism linked with carcinogenesis [15, 2327]. Thioredoxin and thioredoxin reductase protect the cell from reactive oxygen species and apoptosis, and they are involved in cell growth and proliferation . It is one of the factors that is linked to cell chemoresistance; it is also linked to cells invasive and metastatic potential . Thioredoxin also causes expression of hypoxia - induced factor 1 (hif-1) and increases production of protein products from the vegf gene promoting neoangiogenesis in tumours [15, 28, 29]. Thioredoxin and thioredoxin reductase are found in two forms: cytoplasmic and mitochondrial (trxr1 and trxr2). Gold complexes inhibit thioredoxin reductase in mitochondria by reducing membrane potential, leading to apoptosis [15, 21]. It is thought that the enzymatic complex of thioredoxin thioredoxin reductase can be a target in cancer therapy [26, 28]. This is a complex responsible for degradation of ubiquitin marked proteins that may cause selective apoptosis of cancer cells [16, 20]. Stat pathway is a transcription activator that plays a role in proliferation and has an antiapoptotic effect on cancer cells . Recent research has shown evidence anticancer activity of gold complexes both in vitro and in vivo . It was proven that auranofin in human ovarian cancer cell lines induces apoptosis by inhibition of thioredoxin reductase; it was also proven on cisplatin - resistant cell lines . A similar action of gold (iii) complex was observed on human ovarian cancer stem lines, and in one study it was compared with cisplatin and oxaliplatin . Antiproliferative and proapoptotic actions of gold complexes were stronger than those of platinum derivatives . In another study gold complexes were assessed for their antiproliferative potential in ovarian cancer cell lines and embryonic cell lines a study on human breast cancer showed that the use of auranofin also has an anticancer effect; the inhibition mechanism was linked to the stat pathway and telomerase . It was found that the effectiveness of pegylated gold nanoparticles (aunps) combined with docetaxel on prostate cancer cell lines was 50% only half of cells survived, others were damaged . An even higher effectiveness of gold nanoparticles was observed in xenograft of human prostate cancer in mice with the use of particles having gold au isotope . Gold nanoparticle complex was developed, and this complex was linked to the cetuximab antibody and gemcitabine, which was administered to animals that had hepatocellular carcinoma (hcc) heterografts . Heterografts entered apoptotic pathway, they were found to be necrotic, their proliferative potential was diminished, and healthy tissues were not damaged . An interesting study on auranofin use in transgenic mice with chronic lymphocytic leukaemia (cll) was made . This type of leukaemia has a high remission rate after first - line chemotherapy, although relapses are linked to chemoresistance . It seems that gold complexes and nanoparticles, because of their anticancer activity, will find their way into clinical trials, not only experimental models . Argentum), with atomic number 47, atomic mass 107.86, density 10490 kg / m, and melting point 961.78c, is found in nature in its free state and in minerals like argentite . It is a silver - white metal, with very good thermal and electrical conductivity . Greeks coated plates and cups with silver to stop disease spreading, and they put silver coins into water buckets to extend the water's freshness . They also gave silver spoons to children for sucking, which was believed to protect them from illnesses . The very first silver compound that was used for treatment was silver nitrate, which was discovered by basilius valentinus back in the 15 century . In the 19 century, for the first time, 0.2% solution of silver nitrate was used for burn wound care . In 1874 t. billroth proved the antiseptic properties of silver by using its antibacterial effect on staphylococcus aureus . Later on the antibacterial properties of silver were proven against the following bacteria: streptococcus, pseudomonas and escherichia . In the early 1990s it was observed that people with low concentrations of silver as a trace element often undergo bacterial, viral, or fungal infections . Nowadays many surgical instruments are silver coated, as well as other instruments like dialysis catheters . Everywhere where risk of infection is present, silver can be used . In the last few years oncological research the first report of the cytotoxic effect of silver nanoparticles (agnps) was proven against mcf-7 breast cancer cell line in 2013 . Kathiravan used the extract of melia dubia leaves (a tree growing in india), and sathishkumar used extract from dendrophthoe falcata . Silver nanoparticles developed in this way were proven to have an anticarcinogenic effect on mcf-7 breast cancer cell line . Vasanth, with the use of agnps, stopped replication of a cervical cancer cell line (hela) by induction of apoptosis . To produce silver nanoparticles he used extract from the bark of moringa oleifera . Chinese researchers have proven the cytotoxic effect of silver nanoparticles against aml (acute myeloid leukaemia) cell lines such as shi-1, thp-1, dami . He proved that those complexes inhibit proliferation by inducing cell cycle cessation in phase g1 and s in hepatocellular carcinoma cell line (hepg2). He observed in vivo tumour reduction when a silver nanoparticle was combined with alisertib (selective kinase inhibitor). Iridium (ir), with atomic number 77, atomic mass 192.217, density 22.56 g / cm, and melting point 2466c, is found in nature as osmiridium (an alloy of osmium and iridium). In chemical compounds it is mainly in an oxygenation state of iv; oxygenation states ii, iii, and vi are also possible, and it has good properties of electric and thermal conductivity . Discovered in 1803 by smithson tennant iridium was named after the greek rainbow goddess iris because of its different coloured salts . Annual production of iridium is only 3 tonnes; it is one of the rarest elements in nature . At, iridium has been used together with platinum as a component of electrodes for stimulation . Iridium oxide was used instead of ag / agcl in dry electrodes with microtips that could be used without gel eeg . Because of the high price of iridium there was an attempt to produce electrodes with titanium - iridium oxide . In oncology iridium has found its way as ir isotope in brachytherapy . They can be used in after - loading systems that protect medical staff from radiation . It is one of the basic isotopes used in brachytherapy . In the field of gynaecological oncology it is used mainly in plesiobrachytheraphy in cervical and uterine cancer [48, 49]. Research was made on the use of iridium in flt4 (also known as vegfr3) kinase inhibitor [50, 51]. Ruthenium (ru), with atomic number 44, atomic mass 101.07, density 12.45 g / cm, and melting point 2334c, is found in nature as sulphide, iron, and chrome ores . In chemical compounds some researchers claim that ruthenium was first discovered in 1808 by jdrzej niadecki; he called this element vestium in honour of the discovery of the planet vesta . The first ruthenium compound used in clinical practice was nami - a . A is used together with gemcitabine as second - line chemotherapy in the treatment of metastases in non - small cell lung carcinoma . Other compounds used in clinical practice are kp1019, and soluble salt kp1339, which has finished phase i of a clinical trial in neuroendocrine carcinomas . Electroporation of kp1339 was tested in slovenia, and this method was found to be effective in vivo because of its extra antiangiogenic properties . It may also spread the idea of electrochemotherapy, which is based on local injection of chemotherapeutics accompanied by electrical impulses . Developed dohuru, hothyru, and tothyru, which are aziru derivatives, and together with phospholipids they created stable nanoaggregates . The antiproliferative activity of nanocompounds towards cell lines widr, c6, and mcf-7 was also studied.
|
Nearly all aspects of rna metabolism involve rna helicases, enzymes that use atp to bind or remodel rna and rna protein complexes (1). As one of the largest class of enzymes in rna metabolism, rna helicases are encoded by organisms from all kingdoms of life and by many viruses (2). In structure and sequence, however, rna helicases outnumber their dna bound cousins by a considerable margin and rna helicases often perform functions substantially different from those attributed to dna helicases (13). Rna helicases are not only essential for most processes of rna metabolism including ribosome biogenesis, pre - mrna splicing and translation initiation (13), but also for sensing viral rnas in the context of the innate immune system and for the biogenesis and function of mirnas (4,5). Defects or misregulation of certain rna helicases have been linked to numerous health issues including cancer, neuro - degenerative disorders and infectious diseases (69). Given their central biological roles, rna helicases are subject to intensive ongoing research in diverse fields . To date, more than 7000 articles and roughly 500 reviews have been published on subjects related to rna helicases . Currently, about 500 publications appear per year, with an upward trajectory . With increasing volume and diversity of the accumulating data on rna helicases the need arises to integrate the wealth of information in a timely and readily accessible format . To address this issue, this database is a completely restructured version of the dexh / d protein database from 1999, which covered only a subset of rna helicases (10). We approached the design of the rna helicase database from the view of user who is interested in the fast retrieval of comprehensive information on one or more specific rna helicases, and in examining phylogenetic relations of rna helicases to each other . Therefore, the rna helicase database aims foremost to enable researchers to locate and retrieve comprehensive information about sequence, structure, biochemical and cellular function of rna helicases . The database provides ready access to sequence, structure, biochemical and cellular function of all rna helicases from the most widely used model organisms escherichia coli, saccharomyces cerevisiae, caenorhabditis elegans, drosophila melanogaster, mouse and human . Also included are rna helicases from other organisms that are subject to specific investigation, e.g. Ns3 from hepatitis c virus (11), the p4 rna packaging motor from 12 (12) or rna helicase a from bovine (13). Focus on these rna helicases covers the vast majority of published data on rna helicases (estimated to> 95%), while providing an enduring structure for the database . Notwithstanding, the database can be readily expanded to other organisms, if this need arises in the future . In addition to enabling access to information on individual rna helicases, the database emphasizes phylogenetic relations between related rna helicases . As briefly outlined below and in more detail in several recent reviews, rna helicases are categorized in superfamilies and families, and many features are shared between rna helicases of a given family (3,14,15). Functions and features of one rna helicase often provide clues for other, less well - characterized enzymes from the same family (3). However, family relations are often not apparent to investigators outside the rna helicase field . We therefore believe that emphasizing family relations is particularly useful for database users new to research on rna helicases . The structure of the rna helicase database is based on the most recent helicase classification into helicase superfamilies (sfs) and families (3,14,15). According to sequence and protein structures sfs 1 and 2 contain non - ring - forming helicases, sfs 36 contain ring - forming enzymes . All eukaryotic rna helicases identified to date belong to the non - ring - forming sfs 1 and 2 (3). Although all sf1 and sf2 proteins share extensive structural similarities in the overall fold of their helicase core, the respective families have distinct structure and sequence characteristics that are reflected in specific functional features (3). The cladogram was generated from an structure - aided sequence alignment of all sf1 and 2 proteins in yeast and human, described in (3). The alignment can also be found on the rna helicase primer page of the database . Branch lengths of the cladogram are not to scale . The oval marks uncertainty in the topology . Families containing rna helicases are marked with a circled r, the other families contain dna helicases . (t1r, type 1 restriction enzymes; rha, rna helicase a). Figure 2.structure of the rna helicase database . The bold lines around the homepage, the sf2: dead - box page and one individual dead - box protein page mark pages shown as screenshots in figure 3 . The cladogram was generated from an structure - aided sequence alignment of all sf1 and 2 proteins in yeast and human, described in (3). The alignment can also be found on the rna helicase primer page of the database . Branch lengths of the cladogram are not to scale . The oval marks uncertainty in the topology . Families containing rna helicases are marked with a circled r, the other families contain dna helicases . (t1r, type 1 restriction enzymes; rha, rna helicase a). Structure of the rna helicase database . The bold lines around the homepage, the sf2: dead - box page and one individual dead - box protein page mark pages shown as screenshots in figure 3 . The user enters the database through the homepage (figure 2). From this page, via the main navigation (figure 3a), pages for the helicase sfs 35, as well as pages for the sf1 and 2 families can be accessed (figures 2 and 3b). From these pages, one can directly reach individual protein pages (figure 2). These pages contain information on orthologs of a given rna helicase from s. cerevisiae, c. elegans, d. melanogaster, mouse and human (figure 3c). Dead - box and deah / rha helicases from e. coli are listed on separate pages (figure 2), because there are considerably fewer enzymes than in eukaryotes and because the structure of the individual protein pages, which emphasizes orthologs of multiple organisms, appears not suitable for representing only one protein from e. coli . (a) the main navigation is identical on all pages and provides immediate access to the sf35 and sf1 and 2 family pages, as well as to the search function . Cellular function marks the demonstrated involvement of one ortholog from either organism in the indicated process . (c) page for an individual protein (prp28p). Database links connect directly to the specific protein in the sequence databases indicated . Cellular function is only marked if involvement in a specific process has been directly demonstrated for a given protein . The (prp28/ddx23) literature button provides a direct link to a customized pubmed search for all orthologs listed on the page . (a) the main navigation is identical on all pages and provides immediate access to the sf35 and sf1 and 2 family pages, as well as to the search function . Cellular function marks the demonstrated involvement of one ortholog from either organism in the indicated process . Cellular function is only marked if involvement in a specific process has been directly demonstrated for a given protein . The (prp28/ddx23) literature button provides a direct link to a customized pubmed search for all orthologs listed on the page . Individual protein pages provide links to various sequence databases with original information about a particular rna helicase . Links for each protein exist to genbank and uniprot, as well as to organism - specific databases sgd (s. cerevisiae), wormbase (c. elegans) and flybase (d. melanogaster) (figure 3c). The user also has the option to perform a targeted pubmed literature search for the helicase orthologs (figure 3c). The cellular function of each protein is given only where explicitly tested, although it is generally believed that the cellular functions are largely conserved for orthologs . This alignment enables the user to identify regions of conservation among orthologs that extend beyond the characteristic helicase motifs . Individual protein pages were designed based on our roughly decade - long experience with the dexh / d database . Guided by this experience, we chose to directly refer to the large sequence databases for detailed protein information, and not to copy this information into our database . Directly linking to comprehensive, constantly updated sequence databases further features of the rna helicase database include full - search ability by text - based queries that are commonplace from the ubiquitous google search engine (figure 3a). The search function can be accessed from any page and provides an alternative, yet important route to individual protein pages . A third route of access to individual protein pages is established by a list of proteins in the database (figure 2). This list shows all rna helicases in our database, ordered by sf and family and by the organism of origin . Our rationale for incorporating the various routes of access to the individual protein pages is the heterogeneity in the database users, which ranges from researchers looking for updates on information on a helicase that they have long been working on, to those who retrieve the first comprehensive information on a protein they just came across in their research . Finally, the database also contains other information of interest for research on rna helicases, such as an rna helicase primer, the naming code for ddx / dhx rna helicases and a list of laboratories with specific interest in rna helicases . Funding for open access charge: national institutes of health (gm067700 to e.j . ).
|
A 64-year - old man with a 15-year long history of hypertension was presented to the emergency room with a 24-hour history with symptoms of cyanosis and pain on the right upper extremity, consistent with acute ischemia . The major physical findings revealed that the right upper extremity was pale, cold, and exhibited reduced sensation and power . Blood pressure was 130/80 mmhg and heart rate was regular at 64 beats per minute . Laboratory values indicated an increase in white blood cell count of 11,400/ul, normal hemoglobin value of 15.5 g / dl and elevated creatininc kinasl mb (ck - mb) value of 33.2 ng / ml (normal, 0 - 5 ng / ml). The increased levels of bun (31.9 mg / dl) (blood urea nitrogen) and serum creatinine (1.8 mg / dl) returned back to baseline value within three days . Iu / l) and alanine aminotransferase (range, 28 - 79) were increased . A right transfemoral approach was performed with placement of a 6-f sheath . A 5-f angiographic catheter (h1 angiogram obtained after injection of contrast medium in right axillary artery revealed a smooth, tapered narrowing of the brachial artery without opacification of radial and ulnar artery (figs . 1a, b). At the time of angiography, passing of guide wire across the narrowing and occlusive segment was attempted, but these efforts were unsuccessful . The diagnosis of unusual pattern of raynaud's disease was initially made, eventually incorrect . A fear of gangrenous changes in right upper extremity, he had undergone intraarterial papaverine injection of 30 mg and a right axillary - radial bypass surgery . Over a period of approximately two hours, there was a dramatic improvement in the color of the patient's upper extremity and radial pulses became palpable, but cyanosis and pain persisted at phalangeal area . In addition to intravenous infusion of prostaglandin e1 and heparin, two days later, the patient underwent ipsilateral sympathectomy with the subsequent disappearance of cyanosis and pain on phalangeal area . Arteriography examination demonstrated normal arterial anatomy of the right arm as well as the patent graft (figs . The patient's postoperative recovery was uneventful, and he was discharged in a good condition . Eight days later, the patient returned for the same ischemic symptoms of the right upper extremity . Repeated angiography revealed the similar findings which had been demonstrated during first angiography and also occlusion of graft was noticed . The diagnosis of ergotamine - induced vasospasm was made only after that and treatment was initiated by discontinuing the intake of offending drug and an intravenous infusion of nitroprusside was initiated at a rate of 4 g / kg / minute . The drug infusion was continued over four days until there was relief from pain and cyanosis . We noticed that for over a period of 10 years the patient had been prescribed ergotamine for the treatment of migraine . People who consumed the fungus contaminated grain suffered from limb ischemia and discoloration of extremities . Most of the cases of ergotamine toxicity are due to medication ingestion, either acutely or chronically (2). This particular alkaloid can cause intense peripheral vasoconstriction which can lead to gangrene and amputation . Ergotamine - induced vascular ischemia is rare, but potentially serious complication may be induced through two mechanisms: vasospasm and thrombus formation . The latter may be caused by stasis and a postulated direct endothelial damage may be caused by ergotamine . Toxicity can occur from chronic use of therapeutic doses, acute ingestion of excessive amounts, and acute ingestion of normal doses in hypersensitive patients . A number of conditions are known to potentiate the vasospastic effects of ergotamine like, fever, sepsis, malnutrition, thyrotoxicosis, pregnancy, liver and renal insufficiency, coronary artery disease, and peripheral vascular disease (3). The triggering factor for the development of ergotamine toxicity in the present case is still uncertain, but a possible reason could be hepatitis (elevated liver enzyme) with transient renal dysfunction . Drugs may also be responsible for an increase in the side effects of ergotamine (4, 5): oral contraceptives, xanthine derivatives, antiviral agents, antibiotics interfering with the liver metabolism of ergotamine (i.e. Clarithromycin, ampicillin, erythromycin, and troleandomycin). Recently, baldwin et al . Described a case of ergotamine toxicity in an human immunodeficiency virus infected patient treated with antiviral protease inhibitor (6). Ischemia caused by ergotamine intoxication affects the lower extremities more commonly than the upper extremities . The external carotid arteries are often involved with a rare involvement of coronary, mesenteric, renal, and retinal arteries . The diagnosis of this rare condition requires a high index of suspicion in patients with migraine and a careful inquiry about their medication history . The angiographic findings of the affected vessels reveal thin, threadlike and smooth tapered narrowing of the arteries with or without collateral formation (7). Thrombus results from stasis distal to arterial spasm with either bilateral or symmetrical involvement, and the areas of stenosis may be diffused or localized . Many therapeutic modalities can be used to reverse the vasoconstriction (8, 9). The first step of the treatment is discontinuation from the offending drug . When vascular thrombosis is suspected, heparin, a low molecular weight dextran and streptokinase has been suggested to reduce tissue loss . Nitroprusside, a direct acting vasodilator, is effective but can be used only for shorter periods of time and prompt recurrence of symptoms have been reported after discontinuation . Nifedipine is the most potent peripheral vasodilator of the group and has been successfully used to treat ergotamine toxicity . In severe forms of ischemia refractory to pharmacologic treatment, surgical sympathectomy or intraarterial balloon dilatation can be effective (10), and the management depends on early diagnosis of the symptoms . In our case, uninterrupted medication for migraine is thought to play a significant role in the development of recurrent symptoms . The present case emphasizes the importance of acquiring a detailed medication history . Combination of heparin, prostaglandin e1, and sympathectomy did not prevent the progression of cyanosis in our case, but intravenous injections of nitroprusside could relieve the symptoms . An understanding of the clinical features and angiographic findings of ergotamine - induced ischemia is essential in early diagnosis and treatment to prevent irreversible complications.
|
Emphysematous cystitis is a distinct complicated lower urinary tract infection (uti) characterized by air within the bladder wall and lumen . Patients with chronic utis, indwelling urethral catheters, urinary tract outlet obstruction, or neurogenic bladders are predisposed to complicated utis such as emphysematous cystitis . Air within the urinary tract can also occur due to instrumentation, fistula to a hollow viscus, tissue infarction with necrosis . Patients might have varied presentations, ranging from incidental diagnosis on abdominal imaging to severe sepsis . Gas - forming infections or emphysematous conditions of the urinary tract are potentially life - threatening, and require prompt evaluation and management . We describe a case of emphysematous cystitis that was managed successfully with bladder drainage, intravenous antibiotics, and strict glycemic control . A 45-year - old male who was a known case of type-2 diabetes mellitus for last 16 years, complained of on and off fever, dysuria and turbid colored urine for last 3 months . He had past history of suprapubic catheterization for obstructive uropathy due to meatal stenosis 15 years back . Clinical examination revealed pallor, penile hypospadias, meatal stenosis, bilateral nonproliferative diabetic retinopathy and evidence of sensory neuropathy . Investigations showed anemia (hb7.7 gm / dl), neutrophilic leukocytosis (total leukocyte count 19800 cells / cmm (n, 400011000 cells / cmm) with 90% neutrophils . Serum creatinine was 3.5 mg / dl (n, 0.6 - 1.2 mg / dl) and hba1c was 8.5% ct abdomen revealed intraluminal and intramural gas in the bladder with thickening of bladder wall [figure 1a c]. Kidneys were normal in size and shape and there was no perinephric stranding or gas in renal parenchyma or renal pelvis . Figure 1d shows disappearance of intramural and intraluminal gas on follow up ct imaging after 8 weeks . Serum creatinine was decreased to 2 mg / dl, but not normalized probably because of underlying diabetic nephropathy . (c) axial ct image through lower pelvis showing pneumobladder, intramural air and circumferential mural thickening . (d) axial ct image through lower pelvis after treatment showing disappearance of air; however, mural thickening is persisting other organisms reported include klebsiella pneumoniae, pseudomonas aeruginosa, proteus mirabilis, candida albicans, and candida tropicalis, aspergillus fumigatus, staphylococcus aureus, group d streptococcus, enterococcus faecalis, enterobacter aerogenes, and clostridium perfringens and cl . The clinical presentation of emphysematous cystitis is varied; patients can be asymptomatic, describe pnematuria, or irritative voiding symptoms, or present with an acute abdomen with severe sepsis . Of reported patients with emphysematous cystitis, predisposing factors for emphysematous cystitis include diabetes mellitus, neurogenic bladder, lower urinary tract obstruction, urethral catheter placement, vesicourethral reflex, and end stage renal disease . The effects of diabetes mellitus on the urinary tract include diabetic nephropathy, renal papillary necrosis, renal artery stenosis, and bladder dysfunction secondary to neuropathy . These factors combined with glycosuria and impaired leukocyte function place diabetic patients at greater risk of complicated utis such as emphysematous cystitis . Overall, two - thirds of reported cases of emphysematous cystitis were diabetic and 64% were women . The symptoms of emphysematous cystitis are similar to those of uncomplicated cystitis, consisting of frequency, urgency, and dysuria . Therefore, a high index of suspicion is required for diagnosis especially in patients with risk factors . Plain radiographs of the abdomen reveal radiolucency within the lumen of the bladder as a ring of radiolucency outlining the bladder wall . Computed tomography of the abdomen is superior to plain radiographs as a diagnostic tool because it clarifies the extent and location of the gas collection as observed in our case . A pathological assessment of involved bladder tissue might show bladder wall thickening with vesicles of varying size, and microscopically there are multiple gas filled vesicles predominantly within the bladder mucosa, lined by flattened fibrocytes and multinucleated giant cells . It is thought that the high glucose concentration within the tissues acts as a favourable substrate for organisms to produce carbon dioxide through facultative anaerobic glycolysis . However, this does not account for the significant number of non - diabetic patients with emphysematous infections . In such patients, urinary albumin might act as the substrate for gas production by urinary pathogens . Another theory suggests that an impaired host response, involving vascular compromise and impaired catabolism within the tissues, predisposes patients to gas production within these tissues . The pathogenesis is not yet fully understood, but a multifactorial aetiology of impaired host responses with sugar or protein fermentation seems to be a plausible explanation for the production of gas within the affected tissues . Management consists of adequate urinary drainage, appropriate antibiotic treatment, and good blood glucose control . However, delayed diagnosis may lead to extension to the ureters and renal parenchyma, bladder rupture, and death . The gas is reabsorbed once the infection is eliminated as was seen in our patient [figure 1d]. History of pneumaturia and evidence of intraluminal and intramural gas along with bladder thickening on imaging clinches the diagnosis of emphysematous cystitis.
|
Transverse testicular ectopia (tte) is an uncommon anatomical abnormality in which both the gonads migrate towards the same hemiscrotum . The ectopic testis may lie in the opposite hemiscrotum, in the inguinal canal or at the deep inguinal ring . An inguinal hernia is commonly present on the side to which the ectopic testis has migrated . We present a case of 42-year - old male diagnosed preoperatively as left inguinal hernia with normal ultrasonography findings, who found to have tte on exploration . A 42-year - old married male, having three children, presented to us with history of swelling over left inguinal region for 2 years . The swelling was painless, gradually increasing in size and more prominent on coughing and straining . He was planned for hernioplasty and on exploration, there was a left indirect inguinal hernia with thinned out hernial sac with vas and cord structures of the left side . Surprisingly, both testes could be delivered into the wound with their individual vas deferens and cord structures (fig . 1). Both of them were mobilized, followed by right orchidopexy (of medially located testis) by passing it through a trans - septal incision . He had an uneventful recovery and on follow - up, he had no complications; both the testes were normal to feel with no vascular compromise on doppler study . Figure 1:exploration of left inguinal region revealed both testes with cord structures on the left side . Exploration of left inguinal region revealed both testes with cord structures on the left side . Tte, also called testicular pseudoduplication, unilateral double testis and transverse aberrant testicular maldescent, is an uncommon anatomical abnormality in which both the gonads migrate towards the same hemiscrotum . Adhesion or fusion of developing wolffian ducts, defective or aberrant gubernaculum, testicular adhesion, defective formation of the internal inguinal ring, traction on a testis by persistent mllerian structures and possibility of the development of both testes from the same germinal ridge, are some of the postulated theories for the ectopic testis . Mechanical effect of persistent mllerian duct structures may prevent the testicular descent or lead to both testicles descending towards the same hemiscrotum, producing tte . Tte may have an increased risk of malignancy as any other forms of ectopic testis or undescended testis, so long - term follow - up is required . Tte is classified into three types based on associated abnormalities: type i: accompanied only by hernia (4050%).type ii: accompanied by persistent or rudimentary mllerian duct structures (30%).type iii: associated with disorders other than mllerian remnants, e.g. Hypospadias, true or pseudohermaphroditism and other scrotal abnormalities (20%). Type iii: associated with disorders other than mllerian remnants, e.g. Hypospadias, true or pseudohermaphroditism and other scrotal abnormalities (20%). Patients with tte commonly present as inguinal hernia on one side and absent testis on the other side . The patient had left inguinal hernia and absent testis on the right hemiscrotum, which we could not identify on clinical examination and ultrasonography . One explanation could be that since both the testes were on the left hemiscrotum, the pressure effect of left testis on right one could have pushed the right testis towards further right of the left hemiscrotum giving a false impression on clinical examination that location of right testis was on correct side . There are reports suggesting ultrasonography, ct scan, magnetic resonance imaging and magnetic resonance venography as tools for preoperative diagnosis of tte . The case presented here was managed by orchidopexy of the correctly lateralized testis to the ipsilateral hemiscrotum, and orchidopexy of the crossed testis to the contralateral hemiscrotum through a trans - septal incision, known as the ombredanne procedure . This case is reported with a view that surgeons need to be aware of this anomaly during repair of inguinal hernia, as most cases of tte are diagnosed intraoperatively, hence adequately and safely treat the patient even with tte when discovered unexpectedly, continue long - term follow - up to identify malignancy early, if any . Patients with tte need to be treated by restoring the contralateral testis to its original hemiscrotum through a trans - septal incision . Written informed consent was obtained from the patient for publication of this case report and related photograph . All three authors were involved in the treatment of the patient and wrote and finalized the manuscript.
|
Alzheimer s disease (ad) is a progressive and the most prominent old - age debilitating disease which had a notable epidemic growth in recent years . According to statistical analyses, it is estimated that the number of people suffering from ad will double every twenty years; and by 2050, the number of sufferers from ad in the world would reach 115 million (1, 2). One - eighth of people aged 65 and older and half of people aged 85 and older were diagnosed with ad, approximately; its death toll from 2000 to 2008 has increased by 66% (3). The costs for this disease are so high that one percent of global gdp is spent on ad s consequences (4). Diagnosed patient with ad usually dies after 5 to 7 years (2). In iranian traditional medicine (itm) manuscripts, diseases in which forgetfulness is the main symptom are categorized under nesyan label . In itm manuscripts, one of the types of nesyan which originates from coldness and dryness of the brain has the same symptoms as ad . Forgetting recent events and remembering old happenings, cognitive disturbance, problems in constant talking (language disability), and insomnia are of its most important signs (5, 6) which are similar to ad s according to nincds - adrda criterion (7). Itm takes nourishment as one of the six pillars of health (8, 9); therefore, itm manuscripts have dedicated a considerable part of their content to nutritional recommendations . In the first volume of canon of medicine, avicenna (970 - 1051 a.d . ), the great persian scholar, described those in detail (10). He urged elderly people not to take foods producing black bile (sowd) such as lentil, eggplant, beef, dried meat, and salted foods; and phlegmatic foods such as fish, watermelon, melon, and cucumber . On the other hand, taking milk, shirberenj (an iranian dish consists of milk, rice, sugar, and rosewater), honey milk, and milk with ginger are recommended . Apart from preventive recommendations, nutritional therapeutic recommendations are included to boost medication and shorten illness - period; and nesyan is no exception . Muhammad ibn zakariy rz (rhazes) (865 - 925 a.d . ), another great persian scholar, in his book al - hawi recommended to have poultry (such as chicken, dull - yellow partridge, hoopoe, pheasant, and sparrow meat), their brains, and yolks for people affected to nesyan . At the same time the patients were prohibited from having beef, mutton, goat meat, camel meat, and rabbit meat because they produce black bile; and fish as well for producing phlegm (balgham). Moreover, having nuts such as almond, hazelnut, coconut, and walnut were recommended (12). It is worth mentioning that some other persian scholars such as aghili korasani and chishti had the same idea as rhazes (5, 6). There have been remarkable either observational or experimental studies on the role of diet and nutrients in prevention and treatment of dementia, especially ad . Studies on effects of different kinds of fat such as saturated fatty - acids (sfa), unsaturated fatty - acids (ufa), and cholesterol on ad have been conducted recently . Unsaturated fatty - acids and cholesterol play an important role in the brain; 60 percent of dry weight of the brain is consisted of fat which 20% of it is of unsatu - rated fatty - acids (13). Although the brain is only 2% of the total body mass, it carries 25% of cholesterol of the whole body (14). In the light of the fact that most of the brain is consisted of fat and it uses nutrients as other organs, types and amounts of fat consumption could be vitally important in the brain s health . Studying multi - nutrient diets (instead of one or more nutrients) has a notable importance . One of the multi - nutrient diets which have been frequently studied is the mediterranean diet (table 1) (15). Studies have shown that it has preventive effect on ad (16, 17). Taking types of fat into consideration, this diet has a great deal of ufas and lesser amounts of sfas and cholesterol . Ufas positive impact has been reported in several other researches (18). While the results of studies on therapeutic role of ufas (especially omega-3) on ad are controversial (19, 20), ufas multi - nutrient diets like the mediterranean diet which contains high levels of ufas have abated the incidence of ad (16, 17); the abatement is 13% according to sofi et al . Study on the relationship between the mediterranean diet and health status in 2008 (17). About cholesterol, it plays a vital role in cell membranes, yet its functions in neurons are more prominent . Cholesterol is amassed within lipid rafts in the neuronal cell membrane and is involved in the formation and maintenance of synaptic connections (21). Several studies on the effect of cholesterol on ad had ambiguous results . According to the importance of diets especially fats - in ad, this study attempted to analyze the fat content of itm recommended diet for nesyan (itm equivalent of alzheimer s disease). Since traditional physicians used to recommend distinctive diets based on their own clinical experiences, analyzing these diets would eventuate in new nutritional regimen to improve ad sufferers quality of life . In order to study the traditional recommended diet for nesyan, itm prominent books including al - hawi (rhazes, 10th century), canon of medicine (avicenna, 11th century), zakhire - ye - khawrazmshahi (jorjani, 12th century), kholasat - ul - hekma (aqilikhorasani, 18th century), and exir - e - azam (chishti, 19th century) were searched for recommended and abstinent foods and diets traditionally prescribed for patients afflicted by senescence and/or nesyan (5, 8, 11, 12, 22). To quantify the results, the content of fatty components of each food (including polyunsatu - rated (pufa), monounsaturated (mufa), and saturated fatty acids (sfa) and also cholesterol) were extracted from the database of the department of agriculture of the usa (usda) (23). The content of fatty elements per 100 gr of each recommended food was compared with that of the abstinences and statistically analyzed by mann - whitney test via spss (version 16). About the diet, the sum of the nutrients of recommended and abstinent diets for daily consumption was also measured . Ad dietary recommendations and abstinences which currently published in medical journals were also searched via scopus . Finally, traditional and new dietary suggestions were compared with each other and the results presented as tables and figures . The results show that the recommended foods (presented in the first column of table 2) are fattier than the abstinent ones (presented in the first column of table 3) (p<0.001). There are also meaningful differences between unsaturated fatty acids (p<0.001), saturated fatty acids (p<0.001), and cholesterol (p<0.05) of recommended foods and abstinent foods (fig . These foods form recommended and abstinent diets for nesyan . This recommended diet is fattier than the abstinent diet (4.5 times) (see the last row of table 2 and 3); polyunsaturated fatty acids of recommended diet it is the same story for monounsaturated fatty acids and cholesterol (11 and 1.4 times more than abstinent diet, respectively) (fig . 2). Fatty components in 100 gr of each food traditionally recommended or forbidden for people afflicted by nesyan . * error bars indicate sem comparison between nutritional factors of recommended and abstinent diet in nesyan the results of searching scopus database show that recent studies emphasize on diets with high amounts of unsaturated fatty acids for ad sufferers . A considerable number of papers but not all of them - emphasizes on probable positive role of cholesterol on ad . Nutritional factors of daily diet recommended for patients affected with nesyan in iranian traditional medicine . The last row of the table presents the amounts of nutrients in daily recommended diet nutritional factors of daily diet forbidden for patients affected with nesyan in iranian traditional medicine . The last row of the table presents the amounts of nutrients in daily abstinent diet . Iranian traditional medicine has nutritional recommendations to help curing nesyan (ad equivalent in traditional medicine). In this study, evaluating the ingredients of the recommended foods highlights that it is ufas - rich because of having nuts . The types of meat in the recommendations are mostly poultry (chicken, pheasant, and sparrow); their remark is their greater amount of cholesterol compared to the abstinences . Some recent studies substantiate that cholesterol is a boost to improve memory function (24, 25). When cholesterol is consumed with ufas, it will turn into hdl (26, 27). In 2004, reitz and colleagues have concluded that there is no connection between serum cholesterol level and ad (28). However, some other studies have shown that the higher the serum cholesterol level in the elderly, the better memory functions (24, 25). Some studies also have shown the decline in serum total cholesterol levels is associated with increased dementia risk (29, 30). Furthermore, in a cohort study conducted on 1130 people (published 2010), reitz et al . Conclude that high hdl levels in elderly individuals may be associated with a decreased rate of ad (31). Prior to reitz, singh - manoux and colleagues (2008) indicated that a low level of hdl could be considered as a risk factor of memory dysfunction (32). Bear in mind, there has been no study on hdl destructive effect on ad, so far (33). Therefore, prescribing more amounts of cholesterol along with ufas in itm is in accordance with recent studies . On the other side, recent studies have shown that cholesterol and all of its precursors in cerebrospinal fluid (csf) and its precursorslanosterol, lathosterol, and desmosterol in plasma abate in ad sufferers (34, 35). In 2010, klsch et al . Determined csf and plasma levels of cholesterol and its precursors in ad diagnosed people compared to those of healthy individuals . The results showed that csf levels of cholesterol and all of its precursors and also plasma levels of two of the precursors named lanosterol and lathosterol are lower in ad diagnosed people than those of healthy individuals (34). Sato et al . Showed in 2012 that plasma levels of desmosterol, another precursor of cholesterol, are also lower in alzheimer s sufferers than the levels in healthy ones (35). This casts doubt whether the cholesterol reducing agents have preventive effect on ad or not . There are some studies highlighting that cholesterol reducing agents such as statins are ineffective on ad incidence (36, 37). In a prospective study conducted by zandi et al . (2005) on 5000 elderly people in the usa, the relationship between statins consumption and the onset of dementia or ad has been violated (36). Along the lines of zandi s study, mcguinness and colleagues (2009) co - evaluated two randomized double blind clinical trials containing 26 thousand participants which resulted that there is no relationship between statins consumption and the risk of ad incidence (37). Also, reduction in serum total cholesterol could be considered as a risk factor of dementia in the elderly (29, 30). There are other ingredients in the abstinences which are not considerable in having fats and cholesterol . Pumpkin, lettuce, melon, garlic, onion, cabbage, beans, broad beans, and mushroom are of its examples . According to iranian cuisine in the past, there were foods in itm that have no place in eating habit nowadays; so there is not much information about them . Hoopoe, lark, dull - yellow partridge meat and their brain are of the examples . This diet contains high amounts of unsaturated fatty acids and cholesterol to boost treatment of nesyan (traditional equivalent of alzheimer disease). According to new scientific findings, this kind of diet could be useful as a complementary therapy of alzheimer disease . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
|
Left ventricular hypertrophy (lvh) and increased left ventricular mass (lvm) are strong risk factors for cardiovascular disease and morbidity . Cardiac hypertrophy is characterized by increased cell size, cardiac remodeling of myofilaments, and increased expression of fetal genes . Lvm results from a complex of interaction between genetic, environmental, and lifestyle factors . Increased knowledge concerning genes involved in the modulation of lvm will lead to a better understanding of the etiopathogenesis of lvh . Calcium (ca) is arguably the most important messenger in cardiac muscle and plays a central role in regulating contractility, gene expression, hypertrophy, and apoptosis . It has been well described that ca transient movements regulate the transcription and gene expression that characterize the hypertrophic response of cardiomyocytes [2, 3]. The levels of ca are precisely controlled . A major sensor and mediator of intracellular ca transient movements is calmodulin (cam). The cacam complex binds and activates enzymes, including protein kinases, protein phosphatases, phospholipases, nitric oxide synthases, and endonucleases . Three ca calmodulin dependent enzymes have significant roles in cardiac function: ca calmodulin - dependent protein kinase (camk), protein phosphatase 2b (calcineurin, can), and myosin light - chain kinase (mlck). Camk and can have been shown to play key and often synergistic roles in transcriptional regulation in cardiomyocytes . It has been suggested that camk regulates gene expression via activation of several transcription factors [5, 6]. Ca - cam - dependent kinase ii (camkii), a major cam target protein, is a uniquely regulated multifunctional regulatory enzyme . There are several studies indicating the major role of camkii involvement in cardiac hypertrophy and heart failure . In hypertrophic myocardium of animal models, experimental studies have demonstrated that transgenic mice overexpressing nuclear camkii have increased incidence of cardiac hypertrophy . Inhibition of nuclear camkii activity causes transgenic mice to have smaller hearts than their nontransgenic littermates . Thus, any genetic variants that directly affect cam gene expression or function are promising as candidates involved in modulating lvm . Cam is encoded by a multigene family consisting of three members: calm1, calm2, and calm3 . Discovered that 2622a> g and 3001g> a polymorphism, both located in intron 1, may be associated with osteoarthritis in the japanese population . Liu et al . Indicated that calm2 is a candidate gene for primary open - angle glaucoma . To date, only vasan et al . Have demonstrated, in meta - analysis, the correlation between calm2 polymorphism rs7565161 and echocardiographic diameter lvm in adults . The guanine to adenine transition at nucleotide position 474955027 (g.474955027 g> a, rs7565161) of human chromosome 2p21 is intergenic, adjacent to the calm2 gene . However, there are no reports which have focused on the association of intergenic adjacent calm2 polymorphisms with left ventricular mass in newborns . The factors influencing heart development during fetal life or first days of life, when external environmental factors such as diet, lifestyle, smoking or diseases have not yet had a marked impact, are still being sought . We hypothesize that adjacent intergenic calm2 polymorphism could potentially modify lvm during fetal life and in the first period of life in newborns . In the present study, the relationships between g.474955027 g> a (rs7565161) being adjacent intergenic calm2 gene polymorphism and lvm in a population of polish newborns have been investigated . The population included 206 consecutive healthy polish newborns (92 females and 114 males), born after the end of the 37th week of gestation (from 37 to 40 weeks). Mothers in this study were healthy without any complications such as preeclampsia or eclampsia, and there was no fetal growth restriction . Newborns in this study were appropriately grown for their gestational age (defined as birth mass above the 10th centile). Exclusion criteria were twins, intrauterine growth restriction, chromosomal aberrations and/or congenital malformations, or small for gestational age, that is, below the 10th centile body length (bl), birth weight (bw), or head circumference (hc). At birth, cord blood (500 l) of neonates was obtained for isolation of genomic dna . The gender of the newborn, bl, bw, and hc were taken from standard hospital records . Body surface area (bsa) was calculated using the following equation: (1)bsa=[bl(cm)bw(kg)3600]. A diascope oscillometer (artema) was used to determine systolic and diastolic blood pressure (sbp or dbp, resp . ), and only one of the investigators performed all of the blood pressure (bp) measurements using a standardized protocol . The smallest cuff size that covered at least two thirds of the right upper arm and encompassed the entire arm was selected . Newborn measurements were taken at least one and a half hours following their last feeding or medical intervention . An appropriately sized cuff was applied to the right upper arm, and the newborn was then left undisturbed for at least 15 minutes or until the infant was sleeping or in a quiet awake state . Echocardiographic measurements in newborn on the 3rd day after delivery were made by one pediatric cardiologist . Two - dimensional m - mode echocardiography was performed using an acuson sequoia 512 unit (usa), equipped with a 24 mhz imaging transducer . Measurement techniques were consistent with the american society of echocardiography conventions . In a parasternal long - axis view, lvidd - left ventricular internal diameter - diastolic, lvids - left ventricular internal diameter - systolic, lvpw - left ventricular posterior wall thickness at end diastole, ivs - thickness of interventricular septum at end diastole, lad - left atrial diameter, aod - aortic diameter, pad - pulmonary artery diameter, lvv - left ventricular volume, and lvef - left ventricular ejection fraction were measured (using m - mode formulas). The left ventricular masses (lvm) were calculated from the echocardiographic left ventricular dimension measurements, using the penn convention with the equation modified by huwez et al . (1994) as follows:(2)lvm=1.04[(ivst+lvpwt+lvid)3lvid3], where ivst, lvpwt, and lvid denote interventricular septal thickness, left ventricular posterior wall thickness, and left ventricular internal dimension, respectively . To accurately determine and standardize the left ventricular mass, the lvm was indexed with respect to body length (lvm / bl (g / m)), body weight (lvm / bw (g / kg)), and body surface area (lvm / bsa (g / m)), respectively . Genomic dna from cord blood was isolated using the qiaamp blood dna mini kit (qiagen, germany), according to the manufacturer's protocol . For the analysis of the intergenic g> a calm2 (rs7565161) polymorphism, a polymerase chain reaction - restriction fragment length polymorphism (pcr / rflp) method was designed with the following primer pair: forward 5-agggcctgcaatctaat-3 and reverse 5-atataatccccaccttcag-3 (tib mol biol, pozna, poland). The calm amplicons were subsequently digested with the acii restriction enzyme (mbi fermentas, vilnius, lithuania). The pcr product of 417 base pairs (bp) was cut into fragments of 258 bp, 137 bp, and 22 bp in the presence of the g allele and into fragments of 395 bp and 22 bp in the presence of the a allele . Restriction fragments in each case were electrophoretically separated and visualized in midori green - stained (nippon genetics) 3% agarose gels . To verify the results, each calm2 amplicon was cleaned with genelute pcr clean - up kit (sigma). Sequencing was performed according to the dideoxy sanger method in a geneamp pcr system 9700 thermal cycler (applied biosystems), using bigdye terminator v3.1 cycle sequencing kit (applied biosystems). Afterwards, samples were purified (bigdye xterminator purification kit, applied biosystems), and 20 l deionized formamide (applied biosystems) was added . The sequencing results were read using sequencing analysis software v5.1 (applied biosystems). In each case, the result obtained with pcr - rflp method was identical with that appropriate one from sequencing . The divergence of calm2 genotypes frequencies from hardy - weinberg equilibrium was assessed using tests, and the distribution of each quantitative variable was tested for skewness . Quantitative data were presented as means sd and analyzed either by student's t - test or by one - way anova . Left ventricular mass indexes (lvmis) were tested for association with genotype using multivariate analysis (ancova) in order to adjust for possible confounding factors: neonatal (gestational age, gender, sbp, and apgar at three minutes) and maternal (age, bmi at the beginning and the end of the pregnancy, smoking status, and hypertension status). All data were analyzed with statistica (data analysis software system, version 10.0, statsoft, inc . Characteristics of the newborn cohort (n = 206) are shown in table 1 . The distribution of these characteristics in our cohort approached normality (skewness <2 for all variables). Mean bw and bsa values in boy newborns were significantly higher than those in girls . 69 gg calm2 homozygotes (33.5%), 95 ga heterozygotes (46.1%), and 42 aa homozygotes (20.4%) were identified . There were no significant differences in calm2 genotype or allele distributions between boys and girls (p = 0.273, and p = 0.107, resp . ). The calm genotype distributions conformed to the expected hardy - weinberg equilibrium (p = 0.396). Lvmi measurements were tested for association using multivariate analysis (ancova) in order to adjust for possible confounding factors, after adjusting for newborn (gestational age, gender, sbp, and apgar at three minutes) and maternal (age, bmi at the beginning and the end of the pregnancy, smoking status, and hypertension status) parameters . We revealed a significant association between lvmis (lvm / bw in recessive and additive modes and the calm2 polymorphism). The carriers of the g allele of the calm2 polymorphism had significantly higher lvm / bw values, when compared with newborns homozygous for the a allele (3.1 g / m versus 2.5 g / m, padjusted = 0.036, resp . ). The ag genotype of calm2 was associated with the highest values of lvm / bw, exhibiting a pattern of heterozygote advantage (2.9 g / kg versus 3.1 g / kg versus 2.5 g / kg, padjusted = 0.037) (figures 2 and 3). Carriers of the a allele did not differ in lvm indexes (figure 1). An association was observed between genotype and dbp 90 percentile (p = 0.027). Carriers of the allele a of the calm2 gene had an increased incidence (%) sbp 90 percentile (p = 0.027, 76.2% versus 23.8%). Lastly, the calm2 polymorphism was significantly correlated with maternal history of gestational age (p = 0.019). Genetic factors are estimated to be responsible for between 30% and 70% of cardiac mass variance . Studies in twins [20, 21] and populations [22, 23] showed that lvm is under genetic control . The present study in a cohort of newborns has demonstrated for the first time the significant association between variants of the intergenic adjacent calm2 polymorphism and increases in lvm indices in newborns . Therefore, to minimize the disparities, we carefully selected homogenous group of full - term newborns . To accurately determine lvm, we used lvm in relation to bsa, bl, and bw, which are reported to be more appropriate . It should be emphasized that confounding factors such as especially gestational age may play a role in the development of lvm in fetus . The fetal programming hypothesis states that, for example, birth mass in newborns may be partially related to maternal factors . In this study, the ag genotype of intergenic adjacent calm2 polymorphism was associated with the subtle higher values of lvmi, exhibiting a pattern of heterozygote advantage in results . What is important, in our study, the carriers of the g allele have higher lvm than the carriers of the a allele . These results were similar to those of a large cohort of adults, who were studied by vasan et al . . In this meta - analysis of echocardiographic data associated with interindividual variation in cardiac dimension, it should be mentioned that total sample included those with coronary heart disease, peripheral vascular disease, valvular heart disease, stroke, and circulation heart failure . Current results exhibit a pattern of heterozygote advantage, as heterozygote newborns had significantly higher lvmi than the carriers of homozygote genotypes . The heterozygote advantage hypothesis attributes heterosis to the superior fitness of heterozygous genotypes over homozygous genotypes at a single locus . Some studies suggest that heterozygote advantage is a favorable process, the positive selection over evolution, as a natural consequence of adaptation role of variation in gene [2628]. However, in light of vasan's study, the feature that may be potentially beneficial in early life may lead to predisposition to increase or hypertrophy left ventricular in adults . Williams suggested antagonistic pleiotropy theory, which assumes that some genes responsible for increased fitness in the children, fertile organism contribute to decreased fitness in adults . We conclude that this theory may be relevant here . We hypothesized that genetic variation in the intergenic adjacent calm2 gene polymorphism, analogously to the other common polymorphisms in developmental genes, may cause minor changes in the development or modulation of lvm in newborns . We continue observing our population and consider conducting follow - up, which will show in later years whether the heterozygotes have a predisposition to develop left ventricular hypertrophy or not . However, our results require confirmation in further independent large studies . The connection between calmodulin and modulating cardiac contractile function and growth is well documented [30, 31]. Otherwise, in an experimental animal study, the protein level of cam was shown with a relatively high level of calmodulin appearing on gestational days 14 - 15, followed by a steady but significant decrease at birth and during the first week of postnatal life . It is reported that specific elevation of cam levels directly affects the rate of cell proliferation . Also, gillett et al ., in animal study (fetal sheep), showed that increased calm2 mrna expression levels may reflect an important role for calmodulin in expansion - induced fetal lung growth . A study performed in human showed that genes encoding calmodulin (calm1, calm2, and calm3) are involved in increasing proliferation [35, 36]. Although such knowledge indicates the important role of calmodulin - dependent protein kinases and phosphatases in regulating cardiac hypertrophy, the role of genetic variation in cam in the physiology of the development human heart has not been clarified . Our results suggest that genetic variation of calm2 may be partly involved in regulating myocardial cell proliferation and growth, during embryogenesis and in the first days of life . It is possible that genetic variation in cam may have been involved in regulating the activity or / and levels in serum kinases and phosphorylases (e.g., camkii, calcineurin) during fetal life . In the current study, we investigated healthy newborns born at full term . Our previous studies reported that ras (renin - angiotensin system) or bmp4 (bone morphogenetic protein 4) and bmpr1a (bone morphogenetic protein, receptor type 1a) genetic variation may partially account for subtle variation in lvm or parameters or heart parameters in newborns [37, 38]. To the best of our knowledge, the recent results have never been replicated, and therefore the replication of the study findings in different population is needed . Additionally, an association between calm2 polymorphism, and dbp and map was found, but the mechanism by which this might act is not clear . Blood pressure is regulated by multiple neuronal, hormonal, renal, and vascular control mechanisms, as well as genetic and environmental factors . It is also dependent, inter alia, on the force of contraction of the heart muscle which is connected indirectly to the left ventricular mass . There are many known candidate genes that have huge influence on the blood pressure or development of hypertension [3941]. However, the mechanisms of interaction intensifying effects of these genes are still researched . It is known that changes in signaling mechanisms in the endothelium of vascular smooth muscle (vsm) cause alterations in vascular tone and blood vessel remodeling and may lead to persistent increase in vascular resistance . Vascular tone that is a component of regulating blood pressure can be controlled indirectly by different genes activity . An experimental study demonstrated findings that expression levels of several cam - related proteins are changed in vascular tissues and suggested that cam - related proteins might be at least in part related to the pathogenesis of hypertensive vascular diseases . A recent study reported that camkii inhibitor inhibited the ang ii - induced vascular smooth muscle cell hypertrophy . However, the role of cam - related protein in vascular pathophysiology is not yet fully clarified ., we have shown that the intergenic adjacent calm2 polymorphism is associated with left ventricular mass in newborns . This might be the consequences of variation in cell proliferation and growth, and this finding may indicate an important role for genetic variation of calm2 in expansion - induced heart growth in fetal life.
|
Blood was recovered from 14 individuals with type 2 diabetes who arrived in our patient clinic (sex [m / f], 8/6; a1c, 8 1.2%; age, 55.8 9.46 years; bmi, 28.1 3.22 kg / m; creatinine, 1.06 0.20 mg / dl; waist circumference, 98.8 8.02 cm; total cholesterol, 198 30 mmol / l; hdl cholesterol, 48 12.98 mmol / l; ldl cholesterol, 115 38.94 mmol / l; triglycerides, 159.5 55.23 mg / dl; fasting glucose, 125 18.03 mg / dl; no retinopathy; hypertension in three patients; blood pressure, 142/89 mmhg; cholesterol / apolipoprotein b, 1.3 0.3). A total of 12 blood donors were used as control subjects (sex [m / f], 6/6; age, 47.8 4.85 years; bmi, 21.25 8.07 kg / m; creatinine, 0.90 0.083 mg / dl; total cholesterol, 164.03 9.68 mmol / l; hdl cholesterol, 50 8.4 mmol / l; ldl cholesterol, 85.26 16.72 mmol / l; triglycerides, 131.14 25.03 mg / dl; no retinopathy; no hypertension; blood pressure, 126/70 mmhg; cholesterol / apolipoprotein b, 1.6 0.2). Ethics approval was obtained from both simt (servizio immunoematologia e medicina trasfusionale) and the institutional review board of s. giovanni battista hospital, turin, italy . Testing sessions were as follows: uag (3.0 g kg h i.v . As infusion for 12 h, from 0 to 12 h); ag (1.0 g kg h i.v . As infusion for 12 h, from 0 to 12 h); and isotonic saline (infusion from 0 to 12 h). An indwelling catheter was placed into an forearm vein for slow infusion of isotonic saline . Cells were isolated from blood samples taken at 0, 6, and 12 h. to isolate cacs, peripheral blood mononuclear cells retrieved from healthy subjects (ncacs) or from individuals with type 2 diabetes (dcacs) were plated on fibronectin - coated dishes as described by hill et al . Briefly, the cells were cultured for 4 days in egm-2 medium (cambrex, walkersville, md). To isolate epcs (nepcs from healthy subjects, depcs from individuals with type 2 diabetes), peripheral blood mononuclear cells were recovered and cultured onto collagen-1coated dishes for 21 days in egm-2 medium as described by yoder et al . (26). In selected experiments, cacs or epcs recovered from saline - infused healthy subjects were cultured with 1.2 mg / ml age, h2o2 (100 mol / l), 5 mmol / l glucose, or 25 mmol / l glucose alone or in combination with 1 mol / l uag or 1 mol / l ag; 1 mol / l uag or 1 mol / l ag was also used alone . Fluorescence - activated cell sorter analysis was used to characterize cac and epc surface markers (anti - cd45, anti - cd14, anti - cd34, anti - cd31, anti tie-2, anti - kdr, anti - vwf antibodies; see supplementary methods, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0858/dc1). The plasma glucose and insulin determination for each group of mice (charles river lab, lecco, italy) are reported: 16 8-week - old ob / ob mice (blood glucose, 296 19.6 mg / dl; insulin, 55 9 ng / ml); 16 8-week - old c57bl/6j wild - type mice (blood glucose, 92 7.2 mg / dl; insulin, 10 0.5 ng / ml). Animal procedures conformed to the guide for the care and use of laboratory animals (27). Blood glucose was measured with a one touch ii glucose meter (lifescan, mountain view, ca). Serum insulin was measured with a mouse insulin radioimmunoassay kit (linco research, st . Detection of ros; gtp - rac1 loading assay; senescence assay; western blot analysis; silencing of endogenous p53, akt, and p47 by small interfering rnas (sirnas); matrigel plug assay; immunohistochemistry and immunofluorescence; human and mouse mobilization assays; enzyme - linked immunosorbent assay and radioimmunoassay; isolation and culture of bone marrow derived cells; and evaluation of mmp9 activation, cytofluorimetry analysis, and in vitro migration assays were described in detail in the supplementary methods . In vitro and in vivo results are representative of at least three independent experiments, performed at least in triplicate . Densitometric analysis using a bio - rad gs 250 molecular imager was used to calculate the differences in the fold induction of protein activation or expression . Significance of differences between experimental and control values (*, #,, and indicate p <0.05, statistically significant) was calculated using anova with newman - keuls multicomparison test . Blood was recovered from 14 individuals with type 2 diabetes who arrived in our patient clinic (sex [m / f], 8/6; a1c, 8 1.2%; age, 55.8 9.46 years; bmi, 28.1 3.22 kg / m; creatinine, 1.06 0.20 mg / dl; waist circumference, 98.8 8.02 cm; total cholesterol, 198 30 mmol / l; hdl cholesterol, 48 12.98 mmol / l; ldl cholesterol, 115 38.94 mmol / l; triglycerides, 159.5 55.23 mg / dl; fasting glucose, 125 18.03 mg / dl; no retinopathy; hypertension in three patients; blood pressure, 142/89 mmhg; cholesterol / apolipoprotein b, 1.3 0.3). A total of 12 blood donors were used as control subjects (sex [m / f], 6/6; age, 47.8 4.85 years; bmi, 21.25 8.07 kg / m; creatinine, 0.90 0.083 mg / dl; total cholesterol, 164.03 9.68 mmol / l; hdl cholesterol, 50 8.4 mmol / l; ldl cholesterol, 85.26 16.72 mmol / l; triglycerides, 131.14 25.03 mg / dl; no retinopathy; no hypertension; blood pressure, 126/70 mmhg; cholesterol / apolipoprotein b, 1.6 0.2). Ethics approval was obtained from both simt (servizio immunoematologia e medicina trasfusionale) and the institutional review board of s. giovanni battista hospital, turin, italy . Testing sessions were as follows: uag (3.0 g kg h i.v . As infusion for 12 h, from 0 to 12 h); ag (1.0 g kg h i.v . As infusion for 12 h, from 0 to 12 h); and isotonic saline (infusion from 0 to 12 h). An indwelling catheter was placed into an forearm vein for slow infusion of isotonic saline . To isolate cacs, peripheral blood mononuclear cells retrieved from healthy subjects (ncacs) or from individuals with type 2 diabetes (dcacs) were plated on fibronectin - coated dishes as described by hill et al . Briefly, the cells were cultured for 4 days in egm-2 medium (cambrex, walkersville, md). To isolate epcs (nepcs from healthy subjects, depcs from individuals with type 2 diabetes), peripheral blood mononuclear cells were recovered and cultured onto collagen-1coated dishes for 21 days in egm-2 medium as described by yoder et al . (26). In selected experiments, cacs or epcs recovered from saline - infused healthy subjects were cultured with 1.2 mg / ml age, h2o2 (100 mol / l), 5 mmol / l glucose, or 25 mmol / l glucose alone or in combination with 1 mol / l uag or 1 mol / l ag; 1 mol / l uag or 1 mol / l ag was also used alone . Fluorescence - activated cell sorter analysis was used to characterize cac and epc surface markers (anti - cd45, anti - cd14, anti - cd34, anti - cd31, anti tie-2, anti - kdr, anti - vwf antibodies; see supplementary methods, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0858/dc1). The plasma glucose and insulin determination for each group of mice (charles river lab, lecco, italy) are reported: 16 8-week - old ob / ob mice (blood glucose, 296 19.6 mg / dl; insulin, 55 9 ng / ml); 16 8-week - old c57bl/6j wild - type mice (blood glucose, 92 7.2 mg / dl; insulin, 10 0.5 ng / ml). Animal procedures conformed to the guide for the care and use of laboratory animals (27). Blood glucose was measured with a one touch ii glucose meter (lifescan, mountain view, ca). Serum insulin was measured with a mouse insulin radioimmunoassay kit (linco research, st . Detection of ros; gtp - rac1 loading assay; senescence assay; western blot analysis; silencing of endogenous p53, akt, and p47 by small interfering rnas (sirnas); matrigel plug assay; immunohistochemistry and immunofluorescence; human and mouse mobilization assays; enzyme - linked immunosorbent assay and radioimmunoassay; isolation and culture of bone marrow derived cells; and evaluation of mmp9 activation, cytofluorimetry analysis, and in vitro migration assays were described in detail in the supplementary methods . In vitro and in vivo results are representative of at least three independent experiments, performed at least in triplicate . Densitometric analysis using a bio - rad gs 250 molecular imager was used to calculate the differences in the fold induction of protein activation or expression . Significance of differences between experimental and control values (*, #,, and indicate p <0.05, statistically significant) was calculated using anova with newman - keuls multicomparison test . Several lines of evidence indicate that the number and function of epcs are impaired in diabetes (17,19) and that these events rely mainly on nox - mediated ros production (15). The effect of in vivo uag and ag administration in protecting both cacs and epcs from oxidative damage was first evaluated . Toward this end, cells isolated from uag- or ag - treated individuals with type 2 diabetes and healthy subjects were characterized for cac and epc markers (supplementary fig . 1) (18) and subjected to dichlorofluorescein diacetate fluorescence assay . The results reported in fig . 1a and b demonstrate that uag, but not ag, treatment (6 h) drastically reduced ros production in individuals with type 2 diabetes . Moreover, the number of viable cells was significantly higher after uag treatment compared with before (fig . A protective effect of uag on ros production was also demonstrated in cells cultured with age or high glucose (supplementary fig . These findings, together with the observation that neither in vitro nor in vivo uag administration (supplementary fig . 2c and d) changed age receptor (rage) expression, suggest that effector(s) downstream of rage is the target for protective effect of uag . Because similar results were obtained after 12 h of treatment (data not shown), data throughout the study relates to 6-h uag treatment . A and b: dichlorofluorescein diacetate assay was performed on cacs or epcs, recovered from healthy subjects (ncacs, nepcs) or from diabetic patients (dcacs, depcs) treated with saline, uag, or ag (white area: no treatment; dark gray area: uag infused; light gray area: ag infused). C: cacs and epcs isolated from healthy donors (n) and from diabetic patients (d) treated as above were cultured as described in the research design and methods section . Trypan blue excluded viable cells were counted (* and indicate p <0.05, healthy donors vs. diabetic groups; #p <0.05, saline vs. uag infusion). D: ros production, in response to apocynin alone or in combination with uag, was evaluated on dcacs and depcs isolated from saline - treated patients (white area: no treatment; dark gray area: apocynin; light gray area: apocynin + uag). E: ros production was evaluated on dcacs and depcs isolated from saline - infused patients and transfected with the scrambled sequence or with p47 sirna . Cells were treated or not with uag (white area: scramble; dark gray area: p47 sirna; light gray area: p47 sirna + uag). F: dcacs and depcs retrieved from saline- or uag - infused patients were analyzed for rac1 activation . Cell extracts were either pulled down with gst - pak or directly subjected to sds - page . Cacs and epcs were recovered after a 6-h infusion with saline, uag, or ag as indicated . Apocynin, known to affect the assembly of nox subunits (28), was used to investigate the role of nox in regulating ros production . Cells recovered from saline - infused individuals with type 2 diabetes were subjected to apocynin treatment . 1d), suggesting that nox activity might be controlled by uag . As the assembly of p47 and p67 subunits is required for nox enzymatic activity (29), silencing of p47 in dcacs and depcs (supplementary fig . Once more, this effect could not be further enhanced by the addition of uag (fig . 3b and c) was prevented in cells expressing a dominant - negative racn17 construct . Indeed, rac1 activation was detected in cells recovered from saline - treated individuals with type 2 diabetes, but not from uag - infused patients (fig . Hence, the modulation of rac1 activity is a crucial step in the uag anti - ros protective effect . Rac1 membrane localization and function rely on isoprenylation, which has been correlated with amp - activated protein kinase (ampk)-dependent hydroxymethylglutaryl coa reductase activity (30). To rule out the possibility that inhibition of rac1 activity by uag depends on this pathway, ampk phosphorylation was evaluated . Neither short- nor long - term exposure to uag alone or in combination with age affected ampk activity (supplementary fig . 4). P53, p21, and prb are major regulators of cell senescence (31). The above results prompted us to evaluate whether the increase in ros production, generally considered as an upstream signal, translates into an accelerated onset of senescence and whether uag could rescue this effect . Because both senescence and ros generation (fig . 2a and b) were prevented by silencing p53 (supplementary fig . 5a), we investigated the in vivo effect of uag on p53 expression . Accordingly, uag treatment was able to prevent p53 accumulation, p21 expression, and rb phosphorylation (fig . 2c) and to reduce the number of senescence - associated -galactosidase (sa--gal)-positive dcacs and depcs (fig . A: senescence was evaluated on dcacs and depcs recovered from saline - infused patients transfected with psuper retro containing p53 sirna or the scrambled sequence as control and expressed as the percentage of sa--gal positive cells (* p <0.05, scramble vs. p53 sirna). B: ros production was evaluated on dcacs and depcs recovered from saline - infused patients transfected with psuper retro containing p53 sirna or the scrambled sequence (white area: scramble; gray area: p53 sirna). C: dcacs and depcs retrieved from saline- or uag - infused patients were lysed and analyzed for p53, p21, and prb expression by western blotting . Oxidized ldl treated endothelial cells were used as positive control (+). D: senescence was evaluated on dcacs and depcs recovered from saline- or uag - infused patients and expressed as the percentage of sa--gal positive cells (* p <0.05, saline vs. uag infusion). To assess whether the protective effect of uag also resulted in an enhancement of dcac and depc vasculogenic capability, de novo vessel formation was analyzed in severe combined immunodeficient mice injected with cells recovered from uag - treated individuals with type 2 diabetes . At 15 days after injection, plugs were recovered and analyzed by immunohistochemistry . As shown in fig . 3a and b, the number of functional vessels formed by cells recovered from uag - treated patients was significantly increased with respect to those from saline - treated patients . The origin of neovessels from host vasculogenic cells was excluded because the majority of vessels were lined by human hla class i positive cells (supplementary fig . A: immunohistochemistry of representative functional vessels formed by labeled dcacs and depcs, recovered from saline - infused (left) or from uag - infused (right) diabetic patients . B: quantification of newly formed vessels was expressed as percentage sd of the vessel area to the total matrigel area (* p <0.05, saline infused vs. uag infused). (a high - quality digital representation of this figure is available in the online issue .) Defective epc and cac mobilization has been reported in diabetes (19,20). To further investigate the potential therapeutic effect of uag, cacs and epcs were recovered from 10 normal healthy subjects and 10 individuals with type 2 diabetes, characterized, and counted . Uag treatment led to an increase in the number of recovered cells in individuals with type 2 diabetes compared with that of healthy subjects, and no effect of uag treatment was detected in healthy subjects (fig . 4a). In contrast, no differences between ag- or saline - treated healthy and type 2 diabetic individuals were observed (fig . A: percentage of cacs and epcs recovered after 6 h of saline, uag, or ag treatment: (n) healthy donors and (d) diabetic patients (* p <0.05, diabetic patients vs. healthy donors, #p <0.05 saline vs. uag infusion). B: senescence was evaluated on cacs and epcs recovered as described in a and expressed as the percentage of sa--gal positive cells (* p <0.05, diabetic patients vs. healthy donors, #p <0.05 saline vs. uag infusion). C: percentage of epcs recovered from wild - type or ob / ob mice infused for 12 h with saline, uag, or ag (* p <0.05 wt uag - infused vs. ob / ob uag - infused mice). D: senescence was evaluated on murine epcs treated as described in c and expressed as the percentage of sa--gal positive cells (* p <0.05, wt vs. ob / ob mice, #p <0.05 saline vs. uag infusion). All data are the mean sd obtained by three individual investigators . Circulating stromal derived factor-1 (sdf-1) (33) and vascular endothelial growth factor (vegf) (34) we herein demonstrate that 6- or 12-h (data not shown) uag or ag infusion did not change their serum concentrations (supplementary fig . Similarly, igf-1 (35) serum concentration was not affected by uag treatment (supplementary fig . 7). For validation and characterization of the molecular mechanisms regulating bone marrow mobilization, a mouse model of type 2 diabetes (ob / ob mice) was used . After treatment with saline, uag, or ag, recovered cells were subjected to fluorescence - activated cell sorter analysis for surface markers to confirm epc identity (data not shown). Uag treatment induced a strong increase of recovered epcs only in ob / ob mice (fig . 4c). Finally, the number of senescent cells was significantly lower in uag - treated ob / ob mice compared with untreated or ag - treated animals (fig . As an impairment of enos phosphorylation contributes to defective epc mobilization in the diabetic setting (36), we investigated whether uag modulated enos activity and the activation of its regulatory protein, akt (37), in bone marrow stromal cells . The stromal origin of the enos - expressing cells was confirmed by the presence of mbkitl (fig . Consistent with the pivotal role of a local activation of mmp9 in promoting progenitor cell mobilization (22), gelatin zymography revealed that mmp9 gelatinolytic activity was induced by uag (fig . The role of mmp9 activation and skitl release in controlling this event was further confirmed by functional studies using anti - mmp9 and anti - kitl neutralizing antibodies (fig . 5c). Accordingly, in parallel with effects on mmp9 activation, expression of the mbkitl was decreased in ob / ob mice subjected to uag treatment (fig . Although we cannot rule out the possibility that a paracrine effect of uag occurs in vivo, herein we have shown that in vitro uag treatment for 40 min elicited akt and enos phosphorylation in stromal cells obtained from ob / ob - derived total bone marrow pools (fig . 5d). In agreement with the results measuring epc mobilization, ag failed to induce akt and enos phosphorylation (fig . The finding that uag failed to induce enos phosphorylation after knocking down akt (fig . The above data were validated by the lack of effect of uag treatment in nos3 mice (23) (supplementary fig . A: adherent cells (from total bone marrow populations) obtained from saline-, uag-, or ag - treated wt or ob / ob mice were lysed and analyzed by western blotting using the indicated antibodies . The blots are representative of two wt (12) or three ob / ob (35) samples . B: representative zymogram of mmp9 gelatinolytic activity on serum recovered from saline- or uag - treated mice . As positive control, c: migration assays performed on bone marrow cells using sera recovered from saline- or uag - treated ob / ob mice . Mmp9 or skitl neutralizing antibodies were added where indicated (* p <0.05, saline vs. uag, #p <0.05, uag vs. uag + anti - mmp9 and uag + anti - skitl). D: adherent cells obtained from ob / ob total bone marrow pools were treated as indicated for 40 min and processed for western blotting using the indicated antibodies . E: adherent cells from ob / ob total bone marrow pools were depleted (sirna akt) or not (scrambled) of akt, subjected to uag treatment, and analyzed by western blotting using the indicated antibodies . Based on our collective dataset, we further investigated whether the biological response of cacs to uag was mediated by specific binding sites localized to the plasma membrane . To this end, double immunofluorescence experiments, using the uag analog 488-uag (100 nmol / l) to label putative binding sites and anti phycoerythrin - cd45 antibody as a membrane marker, were carried out at 4c . As shown in fig . 6a, at 4c 488-uag binding sites colocalized with cd45, indicating a plasma membrane localization . In agreement with the functional data, unlabeled uag (1 mol / l) displaced the fluorescent signal from the cell surface, whereas ag (1 mol / l) did not (fig . 6b, after 20-min stimulation, receptor clusters undergoing internalization were visualized as labeled cytoplasmic vesicles . Moreover, increasing concentrations of unlabeled uag specifically displaced the fluorescent ligand from both the plasma membrane and endocytic vesicles (fig . 6c and supplementary fig . A c: living cells were incubated in the absence (ctrl) or presence of 100 nmol / l 488-uag with or without the indicated ligands . The putative receptor is stained in green (488-uag); the plasma membrane in red (phycoerythrin - cd45); and the nucleus in blue (dapi). A: visualization of 488-uag binding site distribution on cac plasma membrane . Cac incubation with ligands was carried out at 4c for 4 h. 488-uag was displaced by 1 mol / l uag but not by 1 mol / l ag (40 magnification). B and c: visualization of 488-uag binding distribution on cacs upon incubation with the indicated ligands for 20 min at 25c . B: representative photomicrograph showing the 488-uag labeled cell surface binding sites internalized into endocytotic vesicles (20 magnification). C: 488-uag binding and internalization were completed by increasing concentrations of the unlabeled uag . (a high - quality digital representation of this figure is available in the online issue .) Several lines of evidence indicate that the number and function of epcs are impaired in diabetes (17,19) and that these events rely mainly on nox - mediated ros production (15). The effect of in vivo uag and ag administration in protecting both cacs and epcs from oxidative damage was first evaluated . Toward this end, cells isolated from uag- or ag - treated individuals with type 2 diabetes and healthy subjects were characterized for cac and epc markers (supplementary fig . 1) (18) and subjected to dichlorofluorescein diacetate fluorescence assay . The results reported in fig . 1a and b demonstrate that uag, but not ag, treatment (6 h) drastically reduced ros production in individuals with type 2 diabetes . Moreover, the number of viable cells was significantly higher after uag treatment compared with before (fig . A protective effect of uag on ros production was also demonstrated in cells cultured with age or high glucose (supplementary fig . These findings, together with the observation that neither in vitro nor in vivo uag administration (supplementary fig . 2c and d) changed age receptor (rage) expression, suggest that effector(s) downstream of rage is the target for protective effect of uag . Because similar results were obtained after 12 h of treatment (data not shown), data throughout the study relates to 6-h uag treatment . A and b: dichlorofluorescein diacetate assay was performed on cacs or epcs, recovered from healthy subjects (ncacs, nepcs) or from diabetic patients (dcacs, depcs) treated with saline, uag, or ag (white area: no treatment; dark gray area: uag infused; light gray area: ag infused). C: cacs and epcs isolated from healthy donors (n) and from diabetic patients (d) treated as above were cultured as described in the research design and methods section . Trypan blue excluded viable cells were counted (* and indicate p <0.05, healthy donors vs. diabetic groups; #p <0.05, saline vs. uag infusion). D: ros production, in response to apocynin alone or in combination with uag, was evaluated on dcacs and depcs isolated from saline - treated patients (white area: no treatment; dark gray area: apocynin; light gray area: apocynin + uag). E: ros production was evaluated on dcacs and depcs isolated from saline - infused patients and transfected with the scrambled sequence or with p47 sirna . Cells were treated or not with uag (white area: scramble; dark gray area: p47 sirna; light gray area: p47 sirna + uag). F: dcacs and depcs retrieved from saline- or uag - infused patients were analyzed for rac1 activation . Cell extracts were either pulled down with gst - pak or directly subjected to sds - page . Cacs and epcs were recovered after a 6-h infusion with saline, uag, or ag as indicated . Apocynin, known to affect the assembly of nox subunits (28), was used to investigate the role of nox in regulating ros production . Cells recovered from saline - infused individuals with type 2 diabetes were subjected to apocynin treatment . 1d), suggesting that nox activity might be controlled by uag . As the assembly of p47 and p67 subunits is required for nox enzymatic activity (29), silencing of p47 in dcacs and depcs (supplementary fig . Once more, this effect could not be further enhanced by the addition of uag (fig . 3b and c) was prevented in cells expressing a dominant - negative racn17 construct . Indeed, rac1 activation was detected in cells recovered from saline - treated individuals with type 2 diabetes, but not from uag - infused patients (fig . Hence, the modulation of rac1 activity is a crucial step in the uag anti - ros protective effect . Rac1 membrane localization and function rely on isoprenylation, which has been correlated with amp - activated protein kinase (ampk)-dependent hydroxymethylglutaryl coa reductase activity (30). To rule out the possibility that inhibition of rac1 activity by uag depends on this pathway, ampk phosphorylation was evaluated . Neither short- nor long - term exposure to uag alone or in combination with age affected ampk activity (supplementary fig . P53, p21, and prb are major regulators of cell senescence (31). The above results prompted us to evaluate whether the increase in ros production, generally considered as an upstream signal, translates into an accelerated onset of senescence and whether uag could rescue this effect . Because both senescence and ros generation (fig . 2a and b) were prevented by silencing p53 (supplementary fig . 5a), we investigated the in vivo effect of uag on p53 expression . Accordingly, uag treatment was able to prevent p53 accumulation, p21 expression, and rb phosphorylation (fig . 2c) and to reduce the number of senescence - associated -galactosidase (sa--gal)-positive dcacs and depcs (fig . Similar results were obtained in age - treated cells (supplementary fig . 5b and c). A: senescence was evaluated on dcacs and depcs recovered from saline - infused patients transfected with psuper retro containing p53 sirna or the scrambled sequence as control and expressed as the percentage of sa--gal positive cells (* p <0.05, scramble vs. p53 sirna). B: ros production was evaluated on dcacs and depcs recovered from saline - infused patients transfected with psuper retro containing p53 sirna or the scrambled sequence (white area: scramble; gray area: p53 sirna). C: dcacs and depcs retrieved from saline- or uag - infused patients were lysed and analyzed for p53, p21, and prb expression by western blotting . Oxidized ldl treated endothelial cells were used as positive control (+). D: senescence was evaluated on dcacs and depcs recovered from saline- or uag - infused patients and expressed as the percentage of sa--gal positive cells (* p <0.05, saline vs. uag infusion). To assess whether the protective effect of uag also resulted in an enhancement of dcac and depc vasculogenic capability, de novo vessel formation was analyzed in severe combined immunodeficient mice injected with cells recovered from uag - treated individuals with type 2 diabetes . At 15 days after injection 3a and b, the number of functional vessels formed by cells recovered from uag - treated patients was significantly increased with respect to those from saline - treated patients . The origin of neovessels from host vasculogenic cells was excluded because the majority of vessels were lined by human hla class i positive cells (supplementary fig . 6) (32). Thus, these data provide evidence that uag restores dcac and depc vasculogenic activity . A: immunohistochemistry of representative functional vessels formed by labeled dcacs and depcs, recovered from saline - infused (left) or from uag - infused (right) diabetic patients . B: quantification of newly formed vessels was expressed as percentage sd of the vessel area to the total matrigel area (* p <0.05, saline infused vs. uag infused). (a high - quality digital representation of this figure is available in the online issue .) Defective epc and cac mobilization has been reported in diabetes (19,20). To further investigate the potential therapeutic effect of uag, cacs and epcs were recovered from 10 normal healthy subjects and 10 individuals with type 2 diabetes, characterized, and counted . Uag treatment led to an increase in the number of recovered cells in individuals with type 2 diabetes compared with that of healthy subjects, and no effect of uag treatment was detected in healthy subjects (fig . In contrast, no differences between ag- or saline - treated healthy and type 2 diabetic individuals were observed (fig . A: percentage of cacs and epcs recovered after 6 h of saline, uag, or ag treatment: (n) healthy donors and (d) diabetic patients (* p <0.05, diabetic patients vs. healthy donors, #p <0.05 saline vs. uag infusion). B: senescence was evaluated on cacs and epcs recovered as described in a and expressed as the percentage of sa--gal positive cells (* p <0.05, diabetic patients vs. healthy donors, #p <0.05 saline vs. uag infusion). C: percentage of epcs recovered from wild - type or ob / ob mice infused for 12 h with saline, uag, or ag (* p <0.05 wt uag - infused vs. ob / ob uag - infused mice). D: senescence was evaluated on murine epcs treated as described in c and expressed as the percentage of sa--gal positive cells (* p <0.05, wt vs. ob / ob mice, #p <0.05 saline vs. uag infusion). Circulating stromal derived factor-1 (sdf-1) (33) and vascular endothelial growth factor (vegf) (34) strictly control progenitor cell mobilization under stress conditions . We herein demonstrate that 6- or 12-h (data not shown) uag or ag infusion did not change their serum concentrations (supplementary fig . Similarly, igf-1 (35) serum concentration was not affected by uag treatment (supplementary fig . For validation and characterization of the molecular mechanisms regulating bone marrow mobilization, a mouse model of type 2 diabetes (ob / ob mice) was used . After treatment with saline, uag, or ag, recovered cells were subjected to fluorescence - activated cell sorter analysis for surface markers to confirm epc identity (data not shown). Uag treatment induced a strong increase of recovered epcs only in ob / ob mice (fig . 4c). Finally, the number of senescent cells was significantly lower in uag - treated ob / ob mice compared with untreated or ag - treated animals (fig . As an impairment of enos phosphorylation contributes to defective epc mobilization in the diabetic setting (36), we investigated whether uag modulated enos activity and the activation of its regulatory protein, akt (37), in bone marrow stromal cells . The stromal origin of the enos - expressing cells was confirmed by the presence of mbkitl (fig . Consistent with the pivotal role of a local activation of mmp9 in promoting progenitor cell mobilization (22), gelatin zymography revealed that mmp9 gelatinolytic activity was induced by uag (fig . The role of mmp9 activation and skitl release in controlling this event was further confirmed by functional studies using anti - mmp9 and anti - kitl neutralizing antibodies (fig . 5c). Accordingly, in parallel with effects on mmp9 activation, expression of the mbkitl was decreased in ob / ob mice subjected to uag treatment (fig . Although we cannot rule out the possibility that a paracrine effect of uag occurs in vivo, herein we have shown that in vitro uag treatment for 40 min elicited akt and enos phosphorylation in stromal cells obtained from ob / ob - derived total bone marrow pools (fig . 5d). In agreement with the results measuring epc mobilization, ag failed to induce akt and enos phosphorylation (fig . The finding that uag failed to induce enos phosphorylation after knocking down akt (fig . The above data were validated by the lack of effect of uag treatment in nos3 mice (23) (supplementary fig . A: adherent cells (from total bone marrow populations) obtained from saline-, uag-, or ag - treated wt or ob / ob mice were lysed and analyzed by western blotting using the indicated antibodies . The blots are representative of two wt (12) or three ob / ob (35) samples . B: representative zymogram of mmp9 gelatinolytic activity on serum recovered from saline- or uag - treated mice . C: migration assays performed on bone marrow cells using sera recovered from saline- or uag - treated ob / ob mice . Mmp9 or skitl neutralizing antibodies were added where indicated (* p <0.05, saline vs. uag, #p <0.05, uag vs. uag + anti - mmp9 and uag + anti - skitl). D: adherent cells obtained from ob / ob total bone marrow pools were treated as indicated for 40 min and processed for western blotting using the indicated antibodies . E: adherent cells from ob / ob total bone marrow pools were depleted (sirna akt) or not (scrambled) of akt, subjected to uag treatment, and analyzed by western blotting using the indicated antibodies . Based on our collective dataset, we further investigated whether the biological response of cacs to uag was mediated by specific binding sites localized to the plasma membrane . To this end, double immunofluorescence experiments, using the uag analog 488-uag (100 nmol / l) to label putative binding sites and anti phycoerythrin - cd45 antibody as a membrane marker, were carried out at 4c . As shown in fig . 6a, at 4c 488-uag binding sites colocalized with cd45, indicating a plasma membrane localization . In agreement with the functional data, unlabeled uag (1 mol / l) displaced the fluorescent signal from the cell surface, whereas ag (1 mol / l) did not (fig . 6b, after 20-min stimulation, receptor clusters undergoing internalization were visualized as labeled cytoplasmic vesicles . Moreover, increasing concentrations of unlabeled uag specifically displaced the fluorescent ligand from both the plasma membrane and endocytic vesicles (fig . 6c and supplementary a c: living cells were incubated in the absence (ctrl) or presence of 100 nmol / l 488-uag with or without the indicated ligands . The putative receptor is stained in green (488-uag); the plasma membrane in red (phycoerythrin - cd45); and the nucleus in blue (dapi). A: visualization of 488-uag binding site distribution on cac plasma membrane . Cac incubation with ligands was carried out at 4c for 4 h. 488-uag was displaced by 1 mol / l uag but not by 1 mol / l ag (40 magnification). B and c: visualization of 488-uag binding distribution on cacs upon incubation with the indicated ligands for 20 min at 25c . B: representative photomicrograph showing the 488-uag labeled cell surface binding sites internalized into endocytotic vesicles (20 magnification). C: 488-uag binding and internalization were completed by increasing concentrations of the unlabeled uag . (a high - quality digital representation of this figure is available in the online issue .) The present data first demonstrate that uag, unlike ag, reverts diabetes - induced epc damage by inhibiting activation of the nox regulatory protein rac1; as a consequence, uag protects diabetic epcs from senescence and improves their vasculogenic capability; again, only uag rescues epc mobilization under diabetic conditions by restoring enos phosphorylation, and specific uag - binding sites mediate its effects . Uag is the most abundant circulating form of ghrelin (3) and plays a positive role on glucose metabolism . In contrast, basic and clinical studies have proposed ag as a diabetogenic hormone (8,38). Indeed, clinical conditions of insulin resistance are associated with an alteration in the circulating ghrelin profile with relative ag excess with respect to uag (12). Thus, it is tempting to speculate that an altered uag / ag ratio might contribute both to metabolic changes and to diabetes - associated complications . Among diabetes - associated complications, abnormal vascular remodeling is believed to play a major role in accelerating vascular disease (39). Historically, it has been assumed that new blood vessels originate from sprouting cells and co - opting of neighboring preexisting vessels . However, both physiological and pathologic angiogenesis are also supported by mobilization and recruitment of other cell types, including the bone marrow derived cells, such as epcs (16,18,40,41). Interestingly, alterations in the number and function of these cells correlate with the risk factor profile (19,20). Overproduction of ross in these pathologic settings seems to contribute to impaired vascular regenerative processes (42). The plasma membrane nox is recognized as one of the major regulators of ros generation (15,29). Activation of the enzyme can occur via many upstream signaling pathways converging on phosphorylation of p47 and activation of rac1 leading to the oxidase assembly (29). Our study shows that uag can protect diabetic epcs from oxidative stress by affecting the nox regulatory protein rac1 . The accelerated onset of senescence contributes to the impaired epc bioavailability in patients with diabetes (17). The tumor suppressor p53 is a transcription factor involved in dna damage mechanisms and is recognized as a negative regulator of cell proliferation in human atherosclerotic and restenosis lesions (43). Moreover, the p53-mediated pathway contributes to epc senescence - like growth arrest in diabetes (44). Accordingly, the present study shows that silencing p53 in epcs isolated from individuals with type 2 diabetes or cultured with age prevents both ros production and senescence . The finding that both in vitro and in vivo exposure to uag negatively modulates p53 accumulation identifies the p53-mediated signal as the primary mechanism through which uag protects epcs from senescence . We also found that, by preventing oxidative stress, uag improves de novo vessel formation . The efficacy of cell therapy certainly depends on the number, functional capability, and successful retention of cells in the site of action . Thus, our data strongly suggest that naturally occurring uag induces improvement of epc function and survival that may translate into a more efficient response to vascular dysfunction . Senescence is also associated with impaired mobilization of bone marrow derived cells (17). The molecular interactions between stem cells and bone marrow stromal cells, and the molecular mechanisms controlling their mobilization in the bone marrow microenvironment, are poorly understood (45). Considerable interest has arisen about agents able to mobilize and augment progenitor cell delivery to sites of vascular injury to enhance revascularization . Among these, sdf-1 and vegf are recognized as primary regulators of bone marrow cell mobilization during stress conditions (22,46). In addition, under physiological stresses, the activation of matrix proteases within the bone marrow microenvironment results in the release of skitl, which enables endothelial and hematopoietic progenitor cells to transit from the quiescent to the proliferative niche and facilitates their mobilization into the circulation (22). The delivery of progenitor cells to sites of neovascularization also relies on functional enos activity (23). Indeed, in pathologic settings associated with blunted enos activity and reduced systemic no bioavailability, defective epc mobilization and impaired vascular regenerative processes occur (24,25). Enos activation through akt has been reported for ag acting on the gq - coupled ghs - r1a in cultured endothelial cells (47). We herein demonstrate that uag can restore enos activity via akt - mediated phosphorylation in a pathologic setting characterized by impaired enos phosphorylation . Such an event was found crucial to epc bone marrow mobilization, because uag had no effect in enos knockout mice . We also showed that enos phosphorylation, occurring in response to uag, is associated with mmp9 activation and possibly with the release of skitl, as suggested by the reduced expression of the mbkitl on stromal cells recovered from uag - treated mice and by functional studies . Although we cannot exclude that uag may act in a paracrine manner by locally inducing the release of vegf from bone marrow stromal cells, we demonstrate that short - term treatment with uag, but not ag, of bone marrow cells in vitro leads to akt and enos phosphorylation and that, in vivo, these events are associated with mmp9 activation and epc mobilization . Furthermore, uag, unlike ag, strongly induced epc mobilization in individuals with type 2 diabetes, but not in nondiabetic subjects . Notably, no change in serum concentrations of primary mobilization factors was detected after uag or ag systemic administration . In addition, our results shed light on the earliest molecular events leading to uag- but not ag - mediated physiological regulation of epc bioavailability . Indeed, we showed that epcs possess specific uag - binding sites, which are not recognized by ag . In addition to ghs - r1a, which is the ag - specific receptor (3), other ghrelin receptor subtypes exist, whose molecular identities have not yet been characterized, but that recognize both ag and uag (3). Thus, our data provide the first evidence of the existence of uag - specific binding sites and of their relevance in human - derived epcs, which could represent a novel target for pharmacological modulation . Preclinical and clinical studies generally support the therapeutic potential of autologous epcs in the treatment of cardiovascular diseases, such as tissue ischemia and myocardial infarction (49). However, epc mobilization may also accelerate atherosclerotic plaque progression (50) and induce tumor (51) or retina (52) neovascularization in individuals with type 2 diabetes . Nonetheless, therapies with statins, the main epc mobilization mediators (53), revealed no concerns in terms of neovascularization . We now have reason to believe that the significant epc mobilization potential of uag, and the lack of its effects on serum levels of sdf-1 and vegf, may be exploited for clinical treatment of diabetes- and atherosclerosis - induced vascular impairment . In the presence of cardiovascular risk factors such as diabetes, epc availability is reduced, restricting the possibility of treating patients in need with directed / cell - based therapies . Besides displaying a positive influence on -cell viability and glucose homeostasis (3), uag mobilizes epcs, protects epcs from oxidative stress and from senescence, and increases de novo vessel formation (see model in fig . This suggests that uag - related peptides or uag receptor specific agonists may be further developed into lead compounds from the perspective of a novel pharmacologic intervention to ameliorate both metabolic control and impaired vascular growth in individuals with type 2 diabetes where ag has failed . The resident bone marrow pool of early and late epcs was mobilized into circulation after uag - mediated akt activation in stromal cells, which leads to enos phosphorylation and mmp9 activation . In turn, mmp9 activation switched on the release of skitl, a determinant for epc exit into the bloodstream . In addition, uag treatment restores diabetic viability of epcs and increases their vasculogenic capability by preventing ros generation and its downstream signaling pathway (p53 accumulation, p21 expression, rb phosphorylation). This effect results from uag - mediated inhibition of rac1 activation, a prerequisite for nadph oxidase assembly.
|
According to the international continence society (ics), overactive bladder (oab) is a condition characterized by frequency (> 8 micturitions per day) and nocturia (waking one or more times at night to void) with or without urge incontinence (involuntary emptying of the contents of the bladder). Many epidemiological and clinical studies have shown that oab affects the physical and mental health of patients and is an economic and social burden to patients . Epidemiological and clinical studies have surveyed the symptoms and causes and the prevalence of oab . Estimates of oab prevalence differ, but almost all studies have shown that its prevalence increases with age . There is also some evidence of an association with depression . Many previous studies on oab have been limited to the elderly or to subjects with incontinence [4 - 6]. We conducted a cross - sectional study of subjects aged over 40 years in an urban and a rural region to measure the prevalence of oab in the community and assessed the risk factors for the condition . The study participants were 1,226 subjects aged over 40 years in guri city and yangpyeong county, south korea, who were approached in october and november 2010 . The response rate was 74.2% (940 responders out of 1,226), and a few participants with incomplete questionnaire were excluded (n=14). Therefore, a total of 926 subjects were included in the final analysis (fig . The protocol of this study was developed by the department of preventive medicine, hanyang university college of medicine . The survey was conducted with the overactive bladder symptom score (oabss) questionnaire (table 1). Oab was defined according to the ics as urgency with or without urge incontinence, and usually with frequency and nocturia . In this study, oab was defined as over 2 points for the urgency score and 3 points for the sum of total scores in the oabss questionnaire . They included dwelling place (rural or urban area), marital status, education, behavioral factors (smoking, drinking, etc), and self - reported medical history, including hypertension, stroke, myocardial infarction, angina, hyperlipidemia, diabetes, osteoporosis, arthritis, tuberculosis, asthma, rhinitis, atopic dermatitis, cataract, hepatitis b, and depression . The individuals surveyed were divided into three groups in relation to smoking: a never smoking group (no history of smoking), an ex - smoking group, and a current smoking group . In the same way, individuals were classified in three categories with regard to drinking: the never - drinkers (no history of drinking), the ex - drinkers, and the current drinkers . Categorical variables were analyzed by using a logistic regression model and were adjusted for age by using a logistic regression model . The characteristics of the subjects are shown in table 2 . Of the 926 subjects, 403 subjects (43.52%) were male and 81 were female (15.5%). A total of 130 subjects (14.1%) were diagnosed with oab, including 49 males (12.2%) and 81 females (15.5%). A total of 694 of the responders lived in the rural area (yangpyeong county), and 79 of them were diagnosed with oab; 332 responders lived in the urban area (guri city), and 51 of them were diagnosed with oab (p=0.20). The distribution of oab among individuals with various other characteristics is presented in table 2 . According to educational status, the prevalence of oab was below 10% in those with an educational status of high school graduate or above; in those with less than a high school level of eduction, the prevalence of oab was over 90% . There were 28 people with a history of stroke, and the prevalence of oab with a history of stroke was 9/28 (32.1%). There were 83 patients with a history of osteoporosis, and the prevalence of oab with a history of osteoporosis was 23/83 (27.7%). There were 27 patients with a history of asthma, and the prevalence of oab with a history of asthma was 9/27 (33.3%). There were 100 subjects with cataract, of whom 32 (32.0%) met the criteria for oab . The prevalence of oab was not related to other risk factors except for those mentioned above . We used age - adjusted p - values to assess the risk factors for oab . Educational status (p<0.0487), stroke (p<0.0414), osteoporosis (p<0.0208), asthma (p<0.0091), rhinitis (p <0.0150), and cataract (p<0.0008) were significantly associated with oab (table 3). Other factors (dwelling place, marital status, smoking, drinking, hypertension, diabetes, hyperlipidemia, myocardial infarction, angina, tuberculosis, atopic dermatitis, hepatitis b, and depression) were not significantly associated with oab . The prevalence of oab reaches 16.6%, and increases to 22.1 to 41.9% in people over 70 years of age [7 - 10]. As part of the national overactive bladder evaluation program in the united states, a large - scale telephone survey was conducted of 5,204 respondents of both sexes aged 18 years . The total prevalence of oab reached 857/5204 (16.5%) and attained 25% or more in people aged over 65 . The prevalence of oab with urge incontinence was 319/857 (6.1%) and the prevalence of oab without urge incontinence was 538/857 (10.4%). In addition, in japan, many epidemiologic surveys and clinical studies have shown that the prevalence reaches 12.4%; in individuals aged 70 to 79 years, it reaches 22.6%, and in those over 80 it reaches 36.8% [11 - 13]. The prevalence of oab was found to increase with age in countries including korea [14 - 16]. In our study, oab prevalence was a little higher than in the korean european prospective investigation into cancer and nutrition (epic) study . However, the study populations differed slightly between the korean epic study and our study; our study population consisted of community - based subjects . In particular, the korean epic study showed that storage lower urinary tract symptoms (luts) were more prevalent than voiding or post - micturition luts . In our study also, storage luts were more prevalent than other voiding symptoms . We obtained the same result for age dependence and also identified other risk factors, though age was the most important risk factor . The differences in oab prevalence between countries may be related to cultural factors including race and cultural circumstances . Stewart et al . Showed that the prevalence of oab without urge incontinence increased more steeply with age in men than in women and was significantly different by sex . In men, oab without urge incontinence increased approximately three - fold, whereas oab without urge incontinence gradually increased in women less than 44 years of age and reached a plateau in women over the age of 44 years . In our study, the prevalence of oab by sex was not significantly different . This was probably because of differences between the populations studied in the united states and those studied in korea . Studies of other risk factors in japanese persons over 70 found that depression (multiple adjusted odds ratio=2.07), a recent drinking history, and obesity (body mass index) were significantly linked to the prevalence of oab . In our study these variables were not risk factors, probably because of differences between the populations studied in japan and in korea, especially in terms of age . In our study, the age - adjusted p - value for depression was 0.0671 . Other studies have examined the relationship between oab and lifestyle, especially smoking, alcohol use, and diet, and reported that controlling these factors improved or prevented oab . In the present study, however, residential area, marital status, smoking, alcohol consumption, hypertension, diabetes, hyperlipidemia, myocardial infarction, angina, tuberculosis, atopic dermatitis, and hepatitis b were found to be unrelated to the risk of oab . This difference may be due to differences in diet and national make - up between the groups surveyed . Previous studies have, like ours, found a clear relationship between lower educational status and risk of oab . There is also a close relationship between socioeconomic status and educational level and it is the former that probably relates most directly to the risk of oab . Persons with a higher educational level are more likely to seek better health behaviors and may have healthier lifestyles, whereas persons with a lower educational level may have a higher prevalence of smoking, poor diet, more labor, and exposure to toxins . The prevalence of oab in the general population is sizeable; considering the odd ratio, it could be over - estimated . Second, the oab group identified by the questionnaire did not receive any clinical follow - up . Despite these limitations, however, our study has clarified the prevalence of oab in korea and has identified several associated risk factors . This study aimed at surveying the prevalence of oab in the community and the multiple risk factors for oab . Analyzing the risk factors for oab may help in the diagnosis of oab . Use of these risk factors may be helpful for creating new criteria for oab with multiple risk factors . The prevalence of oab in the community in korea was 14.1% and the identified risk factors for oab were age, educational status, stroke, osteoporosis, asthma, rhinitis, and cataract . Knowledge of these risk factors should facilitate the diagnosis and also the treatment of oab.
|
Phlegmon is a spreading diffuse inflammatory process associated with the formation of a suppurative exudate or pus . Phlegmonous infection may involve any gastrointestinal tract site, although the stomach is most frequently involved (1). However, phlegmonous involvements of the esophagus, small bowel, or colon are rare (1 - 3). Therefore, strong suspicion and recognition of this disease is a key to the diagnosis and prompt management of patients with acute symptoms . However, the role of surgery has been questioned for the diffuse disease form (2). The authors report a rare case of acute diffuse phlegmonous esophagogastritis . In this case, proper radiologic diagnosis with typical chest computed tomography (ct) findings (4,5) enabled appropriate treatment and timely surgical intervention . A 48-yr - old man presented with left chest pain, abdominal pain, and dyspnea of three days duration . Five days before admission, he had been involved in a minor motorcycle accident, but was asymptomatic for two days . However, his vital signs were stable; heart rate 70/min, respiration 37/min, blood pressure 110/80 mmhg, and body temperature 36.8. a physical examination also revealed no remarkable finding with normal bowel sounds and a soft, flat abdomen with no general or rebound tenderness . Laboratory tests revealed; wbc 3,200/l, c - reactive protein 31.68 mg / dl, and serum glucose 201 mg / dl, and chest radiography on admission showed mediastinal widening and bilateral pleural effusion (fig . The patient underwent endoscopy on the admission day to exclude esophageal rupture, and diffuse thickening of mucosal folds with decreased distensibility and an 1 cm sized mucosal ulcer in upper thoracic esophagus were observed with scattered patches of hemorrhage in the gastric mucosa of the body and antrum . On the evening of first hospital day, the patient was became febrile with a body temperature of 39, and thus, empirical treatment with broad spectrum antibiotics was immediately started under the suspicion of empyema or secondary infection . On the second hospital day, the dyspnea worsened and the amount of left pleural effusion increased on chest radiography . Left closed thoracostomy was performed with pus drainage . On the forth hospital day, a contrast - enhanced chest ct scan was performed and showed diffuse and marked circumferential wall thickening of the entire thoracic esophagus, extending to gastric cardia and associated with diffuse intramural low density and a peripheral enhancing rim (fig . A ct diagnosis of acute phlegmonous esophagogastritis was suggested and bilateral open thoracotomies were performed immediately . Pleural fluid analysis revealed exudates and a surgery was decided due to worsening of clinical condition of the patient and radiologic findings . During surgery, bilateral multiloculated pleural effusions were evacuated through open thoracotomies and the esophagus was freed from adjacent tissue . The adventitial and muscular layers of the esophagus were intact and no perforation was identified . Several separate esophageal myotomies were performed and the submucosal layer was found to have been filled with thick, cheesy materials, which were removed from the mucosa by scraping . Blood and sputum cultures of the patient and a microbiologic examination of pleural fluid demonstrated klebsiella pneumoniae . A follow - up chest ct scan performed on the 49th postoperative day showed reduced diffuse esophageal wall thickening and bilateral pleural effusion (fig . 2c). Phlegmonous infection can affect any site of the gastrointestinal tract, although the stomach is most frequently involved (1 - 3). Involvements of other sites have been rarely reported, but the simultaneous involvement of esophagus and stomach has only been reported in a very limited number (1, 2). Phlegmonous infection usually involves the submucosa and not the mucosa (1 - 3). Diffuse esophagogastric involvement of phlegmonous inflammation was evident in our case by chest ct and during surgery . In its localized form, an area of acute inflammation in submucosa phlegmonous infection may also present as a mass in the gastric wall (6). The inflammation produced may involve the muscularis mucosa and the serosa, and lead to perforation or even peritonitis (1). In its diffuse form, phlegmonous infection can involve the entire stomach, but it rarely extends beyond the cardia or pylorus (6). Reported predisposing factors (4) include immune suppression, alcoholism, peptic ulcer disease, chronic gastritis or some other gastric mucosal injury, achlorhydria, infection, connective tissue disease, and malignancy . Presumably, these conditions predispose the stomach to infection by eliminating various defense mechanisms, such as, inherent gastric cytoprotection or the bactericidal effect of gastric acid (1, 6). Nevertheless, approximately 50% of reported cases were previously healthy and had no significant anteceding risk factors (6). We consider that uncontrolled diabetes mellitus and a recent history of chest trauma in combination with excessive alcohol consumption played an important role in the development of the disease in our patient . Histopathologically, the submucosa is thickened and infiltrated by neutrophils and plasma cells with intramural hemorrhage, necrosis, and thrombosis of submucosal blood vessels (1). The most common pathogens are streptococcus species, staphylococcus species, escherichia coli, haemophilus influenzae, proteus, and clostridia (6). Streptococcus accounts for approximately 70 to 75% of cases, and it is also the organism most commonly associated with death caused by phlegmonous gastritis . The causative pathogen of phlegmonous infection in our patient is believed to be klebsiella pneumoniae, based on positive culture results on blood, sputum and pleural fluid . Phlegmonous gastritis has rarely been diagnosed before surgery, because it is seldom considered in the differential diagnosis of an acute abdomen (3). Other symptoms include nausea, vomiting, hematemesis, hiccups, prostration, and fever (6). On the other hand, when the esophagus is involved, odynophagia, dysphagia, and chest pain are the most common symptoms (1). Phlegmonous infection is usually diagnosed at surgery or at autopsy (3), and because there are no pathognomonic signs or symptoms, phlegmonous gastritis is rarely diagnosed before surgery . Endoscopy of the affected esophagus shows diffuse luminal narrowing with poor distensibility and ulcer - like lesions (3). Endoscopic ultrasonography (eus) findings in previous case reports were diffuse thickening with hypoechoic lesions in the submucosal layer (1, 6). The endoscopic examination of our patient also revealed similar findings of diffuse mucosal fold thickening, a mucosal ulcer in the upper thoracic esophagus, and scattered hemorrhagic patches in gastric mucosa . The reported ct findings of acute phlegmonous esophagitis or gastritis include diffuse esophageal and stomach wall thickening with circumferential intramural low attenuation surrounded by a peripheral enhancing rim . The intramural low attenuation represents severe inflammation and abscess localized to the submucosa and muscularis layer (4, 5). Within the thickened wall, contrast - enhanced chest ct in our patient showed findings typical of acute phlegmonous inflammation with simultaneous esophageal and stomach involvement . The radiographic differential diagnoses included a dissecting intramural hematoma and tubular duplication of esophagus and emphysematous esophagitis or gastritis (5, 7). However, the clinical symptom of a dissecting intramural hematoma is chest pain with no evidence of infection or inflammation, and patients with tubular duplication are likely to have no symptoms or signs . The overall mortality of phlegmonous gastritis in a review of 36 reported cases was 42%, and the mortality rates of the 10 patients that underwent surgical resection as compared with the 26 patients treated conservatively were 20% (2/10) and 50% (13/26), respectively (6). During the last 50 yr, some reports have described patients with phlegmonous gastritis successfully treated with medical therapy alone . Overall, the mortality rate for patients with medially treated localized disease was 17%, whereas that for diffuse disease was 60% . Thus, antibiotic therapy and surgical drainage are effective treatments for acute phlegmonous esophagitis depending on the clinical situation (1, 3, 8). In cases of phlegmonous esophagogastritis, protracted conservative treatment result in surgical resection due to the possibilities of esophageal necrosis, esophageal stricture, gastric mucosal atrophy, and complicated peritonitis (1, 8, 9). Our patient was initially treated with broad spectrum antibiotics and left closed thoracostomy with empyema drainage . However, surgical intervention was decided upon due to a worsening of his condition, the duration of his clinical symptoms, and radiographic findings, which included a proper ct diagnosis of acute phlegmonous esophagogastritis . We consider that combined medical treatment and timely surgical intervention played an important role in the cure achieved in our patient, who experienced no major post - operative complications . In conclusion, although acute phlegmonous esophagogastritis is rare and a preoperative diagnosis is difficult, awareness of this disease entity and prompt diagnosis based on typical chest ct findings are major key factors to successful treatment.
|
An internet - based survey was conducted by harris poll on behalf of dexcom, inc between july 2016 and november 2016 among adults with t1d and insulin - using t2d who either were currently using rt - cgm (current rt - cgm users) or had sought to obtain an rt - cgm device but found that their insurance would not cover it and they could not afford to purchase it on their own (rt - cgm hopefuls). All adults from the dexcom, inc central database who were initially identified as 65 years of age were contacted via email and invited to participate if they confirmed they were 65 years of age and had medicare as their primary insurance or reported that they had no health insurance coverage . Harris poll was responsible for contacting all potential participants and collecting and initial processing of all data . The survey consisted of 3 parts: demographic measures included age, gender, ethnicity (non - hispanic white vs not non - hispanic white), education (years), employment status, income level, type of diabetes, number of years since diagnosis, type of insulin delivery system, and frequency of blood glucose monitoring (self - monitoring of blood glucose). Hypoglycemia experience included the frequency of low blood glucoses (<70 mg / dl) in the past month, with and without symptoms; over the past 6 months, the frequency of moderate hypoglycemic episodes (symptoms of confusion, disorientation, lethargy or being unable to treat oneself) and the number of a variety of events associated with severe hypoglycemia, including episodes requiring assistance from another person, hypoglycemia - related auto accidents, paramedic visits, er visits, and hospitalizations . In addition, subjects estimated the frequency / number of these same events during the retrospective baseline period, defined as the 6-month period before they first started rt - cgm (for the current rt - cgm users) or during the 6-month period before they first sought to acquire rt - cgm (for the rt - cgm hopefuls). Of note, because the hypoglycemia data were severely skewed, we calculated binary (yes / no) values for each of the hypoglycemia variables (ie, whether an event did or did not occur in the specified period of time). Psychosocial measures included the world health organization5 (who-5), a 5-item scale that assesses well - being; the worry subscale of the hypoglycemic fear survey (hfs - ii); and the diabetes distress scale for type 1 diabetes (t1-dds), which assesses worries and concerns specifically related to diabetes and its management and has been shown to be a good marker of diabetes - related emotional distress . The t1-dds includes 7 subscales: powerlessness (a broad sense of feeling discouraged about diabetes), hypoglycemia distress (concerns about severe hypoglycemic events), management distress (disappointment with one s own self - care), negative social perceptions (concerns about the possible negative judgments of others), physician distress (disappointment with current health care professionals), friend / family distress (too much focus on diabetes amongst loved ones), and eating distress (concerns that one s eating is out of control). Chi - square and t tests, as appropriate, were conducted to test for differences in participant characteristics between current rt - cgm users and rt - cgm hopefuls . Linear and logistic regression models examined rt - cgm group differences on individual psychosocial measures and measures of hypoglycemia, first in univariate analyses without covariates, followed by models that adjusted for patient demographic factors (eg, age, gender, ethnicity, education, income, and type of diabetes). Change in hypoglycemia events was examined by comparing the past 6 month period to the 6-month period before starting or seeking to use rt - cgm . Changes in reported unadjusted rates of hypoglycemia events were examined with mcnemar analyses, followed by logistic regression analyses that controlled for patient demographic factors . The survey consisted of 3 parts: demographic measures included age, gender, ethnicity (non - hispanic white vs not non - hispanic white), education (years), employment status, income level, type of diabetes, number of years since diagnosis, type of insulin delivery system, and frequency of blood glucose monitoring (self - monitoring of blood glucose). Hypoglycemia experience included the frequency of low blood glucoses (<70 mg / dl) in the past month, with and without symptoms; over the past 6 months, the frequency of moderate hypoglycemic episodes (symptoms of confusion, disorientation, lethargy or being unable to treat oneself) and the number of a variety of events associated with severe hypoglycemia, including episodes requiring assistance from another person, hypoglycemia - related auto accidents, paramedic visits, er visits, and hospitalizations . In addition, subjects estimated the frequency / number of these same events during the retrospective baseline period, defined as the 6-month period before they first started rt - cgm (for the current rt - cgm users) or during the 6-month period before they first sought to acquire rt - cgm (for the rt - cgm hopefuls). Of note, because the hypoglycemia data were severely skewed, we calculated binary (yes / no) values for each of the hypoglycemia variables (ie, whether an event did or did not occur in the specified period of time). Psychosocial measures included the world health organization5 (who-5), a 5-item scale that assesses well - being; the worry subscale of the hypoglycemic fear survey (hfs - ii); and the diabetes distress scale for type 1 diabetes (t1-dds), which assesses worries and concerns specifically related to diabetes and its management and has been shown to be a good marker of diabetes - related emotional distress . The t1-dds includes 7 subscales: powerlessness (a broad sense of feeling discouraged about diabetes), hypoglycemia distress (concerns about severe hypoglycemic events), management distress (disappointment with one s own self - care), negative social perceptions (concerns about the possible negative judgments of others), physician distress (disappointment with current health care professionals), friend / family distress (too much focus on diabetes amongst loved ones), and eating distress (concerns that one s eating is out of control). Chi - square and t tests, as appropriate, were conducted to test for differences in participant characteristics between current rt - cgm users and rt - cgm hopefuls . Linear and logistic regression models examined rt - cgm group differences on individual psychosocial measures and measures of hypoglycemia, first in univariate analyses without covariates, followed by models that adjusted for patient demographic factors (eg, age, gender, ethnicity, education, income, and type of diabetes). Change in hypoglycemia events was examined by comparing the past 6 month period to the 6-month period before starting or seeking to use rt - cgm . Changes in reported unadjusted rates of hypoglycemia events were examined with mcnemar analyses, followed by logistic regression analyses that controlled for patient demographic factors . A total of 609 patients began the survey, though 251 did not meet entry criteria and a further 62 did not complete the survey . Thus, 296 eligible participants completed the entire survey (48.6% of the total). Of that number, 210 were from current rt - cgm users, 75 from rt - cgm hopefuls and an additional 11 were from former rt - cgm users . This last group was too small for data analysis and was therefore excluded from further investigation . As seen in table 1, mean age was 70.7 (5.0) years, mean diabetes duration was 36.1 years (18.5), 48.1% were female and 56.5% were using csii . The majority of respondents were non - hispanic white (95.7%), had t1d (91.2%), and were not employed either full time or part time (84.6%). Compared to current rt - cgm users, rt - cgm hopefuls reported significantly lower incomes (42.7% vs 14.4% made <$50,000/year; p <.001) and less education (45.3% vs 26.7% had not completed college; p <.05). Of note, blood glucose monitoring was significantly more frequent among rt - cgm hopefuls than among current rt - cgm users (6.5 tests / day vs 5.6 tests / day; p <.01). Finally, the current rt - cgm user sample included fewer it2d patients than the rt - cgm hopeful sample (6.2% vs 16.0%; p = .01). Rt - cgm hopefuls were significantly more likely than current rt - cgm users to report 1 moderate hypoglycemic episode over the past 6 months (90.7% vs 78.1%; p <.05), 1 hypoglycemia - related er visit over the past 6 months (18.7% vs 6.7%; p = .003) and 1 hypoglycemic event requiring the assistance of another person over the past 6 months (80.0% vs 57.6%; p = .001) (table 2). Except for er visits, these group differences remained significant (p <.01) after adjusting for key covariates (age, gender, ethnicity, diabetes type, education level, and income). Group differences on psychosocial and hypoglycemia variables, current rt - cgm users compared to rt - cgm hopefuls . Univariate linear and logistic regression models examined rt - cgm group differences in hypoglycemic events . Adjusted models also controlled for age, gender, ethnicity, education level, annual household income, and type of diabetes . * * p <.01 . * * * p <.001 . Among current users, the likelihood of severe hypoglycemic events in the past 6 months was significantly lower than in the 6-month period before beginning rt - cgm (the retrospective baseline period). As seen in table 3, this includes drops in the incidence of events requiring the assistance of another, hypoglycemia - related hospitalizations, er visits, paramedic visits to the home, and auto accidents . In contrast, among rt - cgm hopefuls, there were no significant differences in the occurrence of severe hypoglycemic events in the past 6 months versus the retrospective baseline period (the 6-month period before they first requested rt - cgm). Current rt - cgm users were significantly more likely than rt - cgm hopefuls to report reductions over the 2 time periods in events requiring the assistance of another, er visits and paramedic visits to the home (in all cases, p <.01). These group differences remained significant after adjusting for key covariates (age, gender, ethnicity, diabetes type, education level and income). Of note, there were no significant group differences in reported hypoglycemic events during the retrospective baseline period, except for paramedic visits to the home (significantly more incidences among rt - cgm current users vs rt - cgm hopefuls, p <.05). Change over time in hypoglycemic - related events for current rt - cgm users and hopeful rt - cgm users . Univariate logistic regression models examined rt - cgm group differences on changes in hypoglycemic events . Adjusted logistic regression models also controlled for age, gender, ethnicity, education level, annual household income, and type of diabetes . P <.05 . * * p <.01 . * * * p <.001 . Rt - cgm hopefuls reported significantly poorer well - being (p <.001), greater hypoglycemic fear (p <.05), and more overall diabetes distress (p <.05) than current rt - cgm users (table 2). Among the t1-dds subscales, rt - cgm hopefuls reported significantly more hypoglycemic distress, more diabetes management distress, and more feelings of powerlessness than current rt - cgm users (in all cases, p <.01). After adjusting for key covariates, significant differences in well - being (p <.001), hypoglycemic distress (p <a total of 609 patients began the survey, though 251 did not meet entry criteria and a further 62 did not complete the survey . Thus, 296 eligible participants completed the entire survey (48.6% of the total). Of that number, 210 were from current rt - cgm users, 75 from rt - cgm hopefuls and an additional 11 were from former rt - cgm users . This last group was too small for data analysis and was therefore excluded from further investigation . As seen in table 1, mean age was 70.7 (5.0) years, mean diabetes duration was 36.1 years (18.5), 48.1% were female and 56.5% were using csii . The majority of respondents were non - hispanic white (95.7%), had t1d (91.2%), and were not employed either full time or part time (84.6%). Compared to current rt - cgm users, rt - cgm hopefuls reported significantly lower incomes (42.7% vs 14.4% made <$50,000/year; p <.001) and less education (45.3% vs 26.7% had not completed college; p <.05). Of note, blood glucose monitoring was significantly more frequent among rt - cgm hopefuls than among current rt - cgm users (6.5 tests / day vs 5.6 tests / day; p <.01). Finally, the current rt - cgm user sample included fewer it2d patients than the rt - cgm hopeful sample (6.2% vs 16.0%; p = .01). Rt - cgm hopefuls were significantly more likely than current rt - cgm users to report 1 moderate hypoglycemic episode over the past 6 months (90.7% vs 78.1%; p <.05), 1 hypoglycemia - related er visit over the past 6 months (18.7% vs 6.7%; p = .003) and 1 hypoglycemic event requiring the assistance of another person over the past 6 months (80.0% vs 57.6%; p = .001) (table 2). Except for er visits, these group differences remained significant (p <.01) after adjusting for key covariates (age, gender, ethnicity, diabetes type, education level, and income). Group differences on psychosocial and hypoglycemia variables, current rt - cgm users compared to rt - cgm hopefuls . Univariate linear and logistic regression models examined rt - cgm group differences in hypoglycemic events . Adjusted models also controlled for age, gender, ethnicity, education level, annual household income, and type of diabetes . P <.05 . * * p <.01 . * * * p <.001 . Among current users, the likelihood of severe hypoglycemic events in the past 6 months was significantly lower than in the 6-month period before beginning rt - cgm (the retrospective baseline period). As seen in table 3, this includes drops in the incidence of events requiring the assistance of another, hypoglycemia - related hospitalizations, er visits, paramedic visits to the home, and auto accidents . In contrast, among rt - cgm hopefuls, there were no significant differences in the occurrence of severe hypoglycemic events in the past 6 months versus the retrospective baseline period (the 6-month period before they first requested rt - cgm). Current rt - cgm users were significantly more likely than rt - cgm hopefuls to report reductions over the 2 time periods in events requiring the assistance of another, er visits and paramedic visits to the home (in all cases, p <.01). These group differences remained significant after adjusting for key covariates (age, gender, ethnicity, diabetes type, education level and income). Of note, there were no significant group differences in reported hypoglycemic events during the retrospective baseline period, except for paramedic visits to the home (significantly more incidences among rt - cgm current users vs rt - cgm hopefuls, p <.05). Change over time in hypoglycemic - related events for current rt - cgm users and hopeful rt - cgm users . Univariate logistic regression models examined rt - cgm group differences on changes in hypoglycemic events . Adjusted logistic regression models also controlled for age, gender, ethnicity, education level, annual household income, and type of diabetes . Rt - cgm hopefuls reported significantly poorer well - being (p <.001), greater hypoglycemic fear (p <.05), and more overall diabetes distress (p <.05) than current rt - cgm users (table 2). Among the t1-dds subscales, rt - cgm hopefuls reported significantly more hypoglycemic distress, more diabetes management distress, and more feelings of powerlessness than current rt - cgm users (in all cases, p <.01). After adjusting for key covariates, significant differences in well - being (p <.001), hypoglycemic distress (p <these findings suggest that rt - cgm may be of significant value among adults with diabetes 65 years . In contrast to those who had tried to obtain rt - cgm but could not do so due to inadequate insurance coverage (rt - cgm hopefuls), current rt - cgm users reported significantly fewer moderate and severe hypoglycemic episodes over the past 6 months as well as significantly better qol (ie, greater well - being, less emotional distress concerning hypoglycemia and less distress regarding feelings of diabetes - related powerlessness). In addition, current rt - cgm users reported significantly greater reductions over time than rt - cgm hopefuls in hypoglycemic events requiring the assistance of another, hypoglycemia - associated er visits, and paramedic visits to the home . Note that all of these results remained significant after adjusting for critical demographic differences (eg, income and education level). While health care cost data were not available, these results suggest that current rt - cgm users may have had lower costs at least over the prior 6 months, due to the relative absence of er and paramedic visits compared to rt - cgm hopefuls . In total, these data are consistent with recent patient - reported findings pointing to impressive glycemic and qol benefits resulting from rt - cgm use in broader populations . It is noteworthy that severe hypoglycemic events, especially among the rt - cgm hopeful group, were far from rare with 80% reporting at least 1 severe event in the past 6 months, 19% reporting at least 1 hypoglycemia - related er visit and/or 1 paramedic visit, and 8% reporting at least 1 hypoglycemia - related hospitalization in that same time period . Indeed, this is in keeping with previous studies indicating that hospitalizations and er visits for hypoglycemia among medicare beneficiaries are, unfortunately, surprisingly common . Given the potential vulnerability of this older population and the resulting costs associated with these events, it is unfortunate that rt - cgm is not at this time covered as a benefit under medicare, thereby often making it all but unaffordable to those in the elderly population at lower or fixed income levels . Not surprisingly, the current study found that income level in the rt - cgm hopeful group was significantly lower than in the rt - cgm current users group . As an illustration, consider that those with incomes <$50,000/year comprised 42.7% of rt - cgm hopefuls versus only 14.4% of rt - cgm current users . The potential value of rt - cgm in older adults is becoming more widely recognized, especially given the growing understanding that reduced hypoglycemic awareness is a major contributor to the problems of severe hypoglycemia in this patient population . Indeed, from the rt - cgm current users group, we informally surveyed a small number of their physicians (n = 26) and found that the vast majority agreed that rt - cgm had helped their patient to achieve better control of their diabetes (96.2%) and had led to an improvement in their patient s qol (100%), while all agreed that medicare should provide rt - cgm coverage in appropriately needy patients over 65 . Major strengths of this study include the use of well - established psychometric instruments as well the inclusion of a relatively large sample of older adults who were interested in rt - cgm but were unable to obtain insurance coverage (the rt - cgm hopefuls); this is, as far as we can ascertain, the first investigation of this patient population . The study was limited to cross - sectional data only, and relied on respondents self - reports of their current and past experiences . In addition, there were key differences between the 2 groups, with the rt - cgm hopeful group reporting significantly lower income and fewer years of education and composing a larger percentage of it2d patients than the rt - cgm current users group . Given the problems with insurance coverage, these differences are to be expected, but it remains as a notable issue even though statistical adjustments were made that the groups were not evenly matched . Finally, it is important to recognize that the overall sample was highly educated and mostly non - hispanic white, as was seen in a previous study of dexcom rt - cgm users, but it is not known whether survey responders are truly representative of the larger population of elderly rt - cgm users . In summary, these data suggest that rt - cgm use in seniors is associated with marked reductions in suffering from severe hypoglycemia and notable improvement in qol . Thus, restrictive access to rt - cgm due to lack of medicare coverage may have significant deleterious health, economic, and qol consequences in this population.
|
A lot of research has been done in the past, and still research is going on to explore tools and techniques for regeneration of lost tissues as a result of the disease process . The use of various grafts and recent tissue engineering techniques including stem cell research are testimony to the ever increasing need for most suitable treatment option to replace / repair lost tissues due to various pathologic processes . The use of autogenous periosteum in general medical treatment has been extensive and has shown promising results [13]; on the contrary in dentistry, the use of periosteum as a regenerative tool has been limited and highly underrated; therefore, the purpose of this paper is to highlight the current status of use of periosteum in dentistry as well as suggesting its future use in various treatment options related specifically to dental field . The periosteum is a highly vascular connective tissue sheath covering the external surface of all the bones except for sites of articulation and muscle attachment (figure 1). The periosteum comprises of at least two layers, an inner cellular or cambium layer, and an outer fibrous layer . The inner layer contains numerous osteoblasts and osteoprogenitor cells, and the outer layer is composed of dense collagen fiber, fibroblasts, and their progenitor cells; osteogenic progenitor cells from the periosteal cambium layer may work with osteoblasts in initiating and driving the cell differentiation process of bone repair characterized by the development of the initial fracture callus and subsequent remodeling . Periosteum can be described as an osteoprogenitor cell containing bone envelope, capable of being activated to proliferate by trauma, tumors, and lymphocyte mitogens . Research on the structure of periosteum has shown that it is made up of three discrete zones . Zone 1 has an average thickness of 1020 um consisting predominantly of osteoblasts representing 90% of cell population, while collagen fibrils comprise 15% of the volume . The majority of cells in zone 2 are fibroblasts, with endothelial cells being most of the remainder . Zone 3 has the highest volume of collagen fibrils and fibroblasts among all the three zones . The morphology of fibroblasts is variable across the three zones (figure 2). It is thicker, more vascular, active, and loosely attached as compared to adults where it is thinner, less active, and firmly adherent . In all age groups, the cells of the periosteum retain the ability to differentiate into fibroblasts, osteoblasts, chondrocytes, adipocytes, and skeletal myocytes . The tissues produced by these cells include cementum with periodontal ligament fibers and bone . The periosteum has a rich vascular plexus and is regarded as the umbilical cord of bone . The vasculature system of the periosteum was first studied in detail by zucman and later by eyre - brook .bourke's studies showed that the capillaries supplying blood to bone reside within the cortex linking the medullary and periosteal vessels; a recent study has even shown that periosteal cells release vascular endothelial growth factor which promote revascularization during wound healing . Recently, studies have reported the existence of osteogenic progenitors, similar to mesenchymal stem cells (mscs), in the periosteum [12, 13]. Under the appropriate culture conditions, the periosteum can be easily harvested from the patient's own oral cavity, where the resulting donor site wound is invisible . Owing to the above reasons, the periosteum offers a rich cell source for bone tissue engineering; hence, the regenerative potential of periosteum is immense . Developing bone substitutes for bone defect repair has inspired orthopedic surgeons, bone biologists, bioengineering researchers to work together in order to design and develop the promising products for clinical applications . Duhame in the year 1742 can be considered the first investigator to study the osteogenic potential of periosteum and published his findings in the article sur le development et la crueded os des animaux . A century later, another french surgeon, ollier, discovered that the transplanted periosteum could induce de novo bone formation . One of the earliest experimental studies to demonstrate osteogenic potential of periosteum was that of urist and mclean who reported that periosteum produced bone when transplanted to the anterior chamber of the eye of the rat . Skoog subsequently introduced the use of periosteal flaps for closure of maxillary cleft defects in humans; he reported the presence of new bone in cleft defects within 36 months following surgery . Since then, surgeons have reported the successful use of maxillary periosteal flaps [18, 19] as well as periosteal grafts from the tibia or rib . Melcher observed that new bone is laid down in parietal bone defects of rats and was deposited by periosteum that had not been previously elevated or disturbed in any other way, while other investigators have suggested that the contact between the periosteal flap or graft and the underlying bone is crucial to stimulation of osteogenesis [21, 22]. More recently, the osteogenic / chondrogenic capacity of periosteum and related mechanisms have been confirmed, and the underlying biology is better understood through a number of studies [2340]. Various research papers have been published explaining the osteogenic potential of human periosteal grafts [41, 42]. The use of periosteum as a gtr has been suggested by many studies [4346], although long - term results are still awaited to establish the regular and the most effective use of periosteal grafts as barrier membranes . The need for a graft, which has its own blood supply, which can be harvested adjacent to the recession defect in sufficient amounts without requiring any second surgical site and has a potential of promoting the regeneration of lost periodontal tissue is a long - felt need . The adult human periosteum is highly vascular and is known to contain fibroblasts and their progenitor cells, osteoblasts and their progenitor cells, and stem cells . In all the age groups, the cells of the periosteum retain the ability to differentiate into fibroblasts, osteoblasts, chondrocytes, adipocytes, and skeletal myocytes . The tissues produced by these cells include cementum with periodontal ligament fibers and bone; in addition the presence of periosteum adjacent to the gingival recession defects in sufficient amounts make it a suitable graft . Recent papers published have shown promising results with the use of periosteum in the treatment of gingival recession defects (figure 3) [47, 48]; moreover, with the advancement in tissue engineering techniques the periosteal derived stem cells have been grown effectively to reconstruct lost tissues . Periosteum - derived progenitor cells may serve as an optimal cell source for tissue engineering based on their accessibility, ability to proliferate rapidly, and capability to differentiate into multiple mesenchymal lineages . The periosteum is a specialized connective tissue that forms a fibrovascular membrane covering all bone surfaces except for that of articular cartilage, muscle, and tendon insertions and sesamoid bones . Cells residing within the periosteum may be excised from any number of surgically accessible bone surfaces; in addition, when properly stimulated, the periosteum has the potential to serve as a bioreactor supporting a dramatic increase in the progenitor cell population over the course of a few days . Further, once the cells are removed from the periosteum, they have the potential to proliferate at much higher rates than bone marrow, cortical bone, or trabecular bone - derived progenitor cells . In addition to their robust proliferation aptitude, it is well established that periosteum - derived progenitor cells have the potential to differentiate into both bone and cartilage . Further, their potential for regenerating both bone and cartilage constructs is superior to that of adipose - derived progenitor cells and comparable with that of bone marrow - derived mesenchymal stem cells . A recent study by de bari et al . Indicates that periosteal progenitor cells are able to differentiate not only into bone and cartilage cells but also into adipocyte and skeletal myocyte cells . There is a growing requirement for dentists to regenerate alveolar bone as a regenerative therapy for periodontitis and in implant dentistry . Concerning the donor site, it is easier for general dentists to harvest periosteum than marrow stromal cells, because they can access the mandibular periosteum during routine oral surgery; also the regenerative potential of periosteum has been effectively used in osteodistraction which has the benefit of simultaneously increasing the bone length and the volume of surrounding tissues . Although distraction technology has been used mainly in the field of orthopedics, early results in humans indicated that the process can be applied to correct deformities of the jaw . These techniques are now utilized extensively by maxillofacial surgeons for the correction of micrognathia, midface, and fronto - orbital hypoplasia in patients with craniofacial deformities . The use of periosteum can revolutionize the success of various dental treatments which require either bone or soft tissue regeneration; particularly the future use of periosteum must be explored in periodontal and implant surgical procedures . Although the regenerative potential of periosteum has been proved by numerous studies, till date the use of periosteum - derived grafts has still not become a standard tool in the armamentarium of dental surgeons, and it may still need some time, and further research before the full regenerative potential of periosteum is utilized.
|
Infections are currently one of the major causes of morbidity and mortality in patients undergoing hematopoietic stem cell transplantation (hsct). One of the most prevalent bacterial infections in these patients is due to gram - positive organisms which have been rising during last decade . Hence many of these patients require empirical antibiotic with aerobic gram positive coverage when developing neutropenic fever . Recent update of clinical practice guideline by the infectious diseases society of america (idsa) for the use of antimicrobial agents in neutropenic patients with cancer, does not recommend vancomycin (or other agents active against aerobic gram positive cocci) as a standard part of the initial antibiotic regimen for fever and neutropenia . These agents have been suggested as an integral part of the empirical management of febrile neutropenia for specific clinical indications, including suspected catheter - related infection, skin or soft - tissue infection, pneumonia, or hemodynamic instability . Adequate empirical antibacterial therapy in febrile neutropenia after hsct may reduce infection - related morbidity and mortality . When deciding to use an antibiotic active against aerobic gram positive cocci as an empirical treatment in febrile neutropenic patients who have underwent hsct, vancomycin is often used concerning its availability and cost . Serum vancomycin concentrations should be monitored to minimize the risk of development of microorganism resistance and to avoid potential concentration - dependent adverse events . It is especially important in hsct patients who often receive vancomycin for longer duration and are under therapy with other nephrotoxic drugs . Optimal vancomycin dosing regimen for empirical treatment of febrile neutropenia in these patients has not been defined and therefore managing the clinical use of vancomycin in this population with complicated medical problems, is very challenging . Pharmacokinetic studies in patients with cancer have shown an increase in volume of distribution (vd) and clearance (cl) of vancomycin . Moreover such pharmacokinetic changes during neutropenia and fever necessitate higher vancomycin doses and routine dosing regimen would be sub optimal in many of these patients . On the other hand, recent recommendations by a consensus statement from three groups, the american society of health - system pharmacists, idsa, and the society of infectious diseases pharmacists consisted increasing vancomycin doses to form elevated target trough levels (15 20 mg / l) especially in severe infections like pneumonia and bacteremia which are common during febrile neutropenia in high risk hsct patients . Determining initial vancomycin dosing regimen in this population of patients is one of the mentioned challenges . Furthermore a single vancomycin dosing regimens cannot be applied to all patient populations and it becomes more important to initiate regimens with a good understanding of population - specific pharmacokinetic parameters . To the best of our knowledge, despite widespread use of vancomycin in hsct, there is just one study regarding adult patients who underwent autologous hsct . Even though, there are some studies evaluating the pharmacokinetic of vancomycin in cancer and hematological malignancies . The purpose of this study was to investigate vancomycin pharmacokinetic parameters in hsct patients and to evaluate current dosing regimen based on trough vancomycin concentration measurement . This prospective study included patients who were treated with vancomycin for neutropenic fever after hsct, in the adult (> 15 yrs) hsct unit at hematology - oncology and stem cell transplant research center/ tehran university of medical sciences (shariati hospital), between december 2012 and april 2013 . The inclusion criterion was receiving at least 3 successive doses of vancomycin (fixed dose and dosing interval) as empiric treatment of febrile neutropenia . Patients, for whom vancomycin was discontinued prior to achieving a steady state, were excluded . Blood samples (5 ml) were collected from central vein and sent to the laboratory within two hours of collection . First steady - state trough vancomycin serum concentrations were measured in blood samples which were drawn within 30 minutes prior to the administration of the fourth dose (css trough or pre - dose sample). Samples collected 60 - 180 minutes after end of vancomycin infusion were used for determination of css peak (post dose sample). Random steady state vancomycin serum concentrations were measured in some patients, instead of determining peak levels . Serum concentrations of vancomycin were analyzed by fluorescence polarization immunoassay (fpia) (cobas integra 400 system from roche diagnostics, switzerland). The lower detection limit of this assay was 0.74 g / ml, and the coefficients of variation (cv%) were 3.0% at 8.70 g / ml, 2.2 at 26.3 g / ml, and 3.3% at 54.6 g / ml . For each patient, the data including concomitant medications, patient weight, height, sex, age, daily laboratory data (such as serum creatinine, bun and albumin), vancomycin dosage and serum sampling histories, including the date, time, dosage, and duration of infusion were registered . Creatinine clearance was calculated using the cockcroft and gault equation using the ideal body weight . Only the first course of therapy was analyzed in patients who received more than one course of therapy with vancomycin . The akin definition was used to identify acute kidney injury (aki) during vancomycin therapy . Severity of kidney injury in patients who developed aki was staged according to the akin criteria . Individual vancomycin pharmacokinetic parameters including elimination rate constant (k, in hour-1), elimination half - life (t1/2, in hour), apparent volume of distribution at steady state (vd, l / kg) and clearance (cl, l / h / kg) were determined assuming a one - compartment model using the following equations: ke=(ln cssmax - ln cssmin)/-t cl = kev v = d / t(l - e - ket)ke[cssmax-(cssmine - ket)] ke is the elimination rate constant (in hour-1), css max and css min are peak and trough concentrations (in mg / l) at steady - state as described above, vd is apparent volume of distribution at steady state in l, d is the administered vancomycin dose (mg), t and are the infusion time and dosage interval (hr). In cases that trough and a random concentration were measured following equation was used to calculate css max and then above equation were used to calculate parameters . Cssmax = c1/e - ket) c1 is the random steady - state concentration, ke is the elimination rate constant, and t is the time between c1 and css max . Correlations between patients demographic and clinical characteristics and vancomycin pharmacokinetic parameters were investigated using bivariate correlations procedure including pearson's correlation coefficient or spearman's rho based on data distribution . Calculated parameters between males and females were compared by mann - whitney u test or independent - sample t test . Median and inter - quartile of pharmacokinetic parameters range are also reported . To compare the values of this study with other reports, mean and 95% confidence interval of the mean pharmacokinetic parameters were determined . Total of 46 patients (mean age of 32.9 12.45), 30 men and 16 women, were included in the study . Patients demographic data patients clinical characteristics of the 46 patients, 13 (28.2%) were more than 30% above their ideal body weight . Among 20 patients in whom pharamacokinetic parameters calculated, 7 (35%) patients were more than 30% above their ideal body weight (ibw). The most popular dosing regimens were 1000 mg q12hr in 32 patients (69.6%) and 1000 mg q8hr in 8 patients (17.4%). Mean (sd) vancomycin total daily dose was 31.9 (10.5) mg / kg . A total of 76 vancomycin serum concentration (46 trough, 18 peak and 2 random levels) were measured of which, 18, 2 and 26 patients had both peak and trough samples, both random and trough samples and only trough samples respectively . Median (inter - quartile range) steady - state peak and trough concentrations in mg / 21 patients (45.7%) had trough concentrations above 10 mg / l . Of these, 9 patients (19.6% of all patients) had trough concentrations above 15 mg / l, 5 of whom (10.9% of all patients) had trough concentrations above 20 mg / l . 25 (54.3%) patients had trough concentrations of <10 mg / l and 6 patients (13%) had trough levels of <more than 90% of measured vancomycin trough concentrations were outside the range of 15 - 20 mg / l . About 38.9% of measured peak levels were either greater than 40 mg / l or lower than 20 mg / l . For 20 patients who had peak (or random) and trough measurements, summary of pharmacokinetic parameters calculated for 20 patients of the study vancomycin pharmacokinetic parameters did not differ significantly between males and females . Values of pharmacokinetic parameters with assumption of one - compartment pharmacokinetic model for vancomycin in this study and different studies on similar populations are shown in table 4 . 95% confidence interval for mean of vancomycin cl and vd were calculated and compared between our results and other studies on similar population to evaluate differences . Mean vancomycin vd in our patients is smaller than those observed in two studies on patients with cancer and hematological malignancies but mean vancomycin cl does not differ significantly (table 4). One - compartment pharmacokinetic parameters (mean standard deviation (95%ci of mean)) of vancomycin from some studies on cancer patients versus this study (boldface) sixty - five percent of patients were leukemic, and the other patients were from other clinical units . Correlation of different demographic and clinical factors with vancomycin pharamacokinetic parameters in enrolled patients was investigated . Creatinine clearance of patients on day of vancomycin sampling was correlated with vancomycin clearance (p <0.01). 38 of 46 patients (82.6%) were on nephrotoxic drugs concurrent with vancomycin . Among them, 16 patients (42.1%, 34.8% of all included patients) and 22 patients (57.9%, 47.8% of all included patients) received one and two nephrotoxic drug(s) concomitant with vancomycin respectively . Of 46 patients, 21 patients (45.7%) developed acute kidney injury (aki) during vancomycin therapy . Among patients who developed aki, 4 and 15 17 patients did not develop aki, even though they were also on nephrotoxic drugs . Of 21 patients who developed aki, 19 patients were akin stage one and 2 patients were akin stage two respectively . Two patients who developed akin stage two aki were on cyclosporine and amphotericin b concurrent with vancomycin therapy . Of 19 patients who developed akin stage one aki, 2 of them did not receive concurrent nephrotoxic drug but remainder were on concurrent nephrotoxic drugs . 13 of these 17 patients were on 2 nephrotoxic drugs, cyclosporine and amphotericin b, concurrent with vancomycin . We conducted our study in order to evaluate vancomycin pharmacokinetics in patients undergoing hsct and to determine if the changes in pharmacokinetic parameters seen in previous studies in cancer and febrile neutropenic patients in different countries are evident in our patients . Several studies showed that vancomycin cl and vd tends to be higher in patients with malignancies and during febrile neutropenia ., have shown that patients with neutropenia have an increased total clearance of vancomycin compared with both intensive care unit and control patients, and an increased vd compared with controls . These results were confirmed by le normand et al ., who further found that the elimination half - life of vancomycin in patients with neutropenia was twice as short as in healthy individuals . Buelga et al ., also reported greater vd (26 to 42%) and cl of vancomycin in patients with hematological malignancies relative to other adult patients population . In a study by al - kofide et al ., on comparison of vancomycin pharmacokinetics in cancer (88% leukemic) and non - cancer patients, both vd and cl were significantly higher in the cancer group . Based on these results, teramachi et al ., also reported that cl and vd were significantly greater in the malignancy group than non - malignancy group in japanese patients . However, in their report some patients in the malignancy group showed similar values of cl and vd to those in the non - malignancy group . Mean vancomycin cl in our patients is similar to results of above studies and nearly 70 - 80% higher than mean cl observed in adult medical & surgical patients . But vancomycin vd in our patients is lower than what were shown in studies on patients with cancer, hematological malignancies or neutropenic fever and is near to what observed in other medical patients . Mean total body weight of our patients was not significantly different with patients included in above studies . In our study, patients were heterogeneous as they had different types of hematological diseases and malignancies . Since our patients with hematological malignancies were in remission when they were admitted for hsct, they may affect vancomycin distribution and clearance during febrile neutropenia in a different way from patients who receive induction chemotherapy for their malignancy and develop neutropenic fever . Moreover little is known how underlying non - malignant hematological diseases like thalassemia would affect vancomycin pharmacokinetics . Some of the studies on patients with hematological malignancies that developed neutropenic fever included few patients who underwent autologous hsct but they were not evaluated separately . To the best of our knowledge, there is no data about vancomycin pharamcokinetics in patients who underwent autologous and allogeneic hsct . In order to investigate factors affecting vancomycin pharmacokinetics in our patients, some demographic and clinical characteristics of patients such as age, total body weight, gender, creatinine clearance, diagnosis and transplantation type were analyzed, and no significant correlation or effect on vancomycin pharmacokinetic parameters was found except for creatinine clearance, which were correlated with vancomycin clearance . This correlation would be expected in vancomycin that its main way of elimination is renal and was shown in other studies on cancer and hematological malignancy patients . Non significance of other expected or presumed correlation may be due to heterogeneity in our patients underlying disease and small number of patients . Al - kofide et al ., recommended several theories regarding why vancomycin cl is significantly increased in this subgroup of patients: (1) glomerular filtration is the main mechanism of vancomycin elimination but there may be some tubular secretion which have been proved in previous trials on vancomycin pharmacokinetics, as this pathway may be enhanced in cancer patients leading to higher cl than expected; (2) vancomycin has some hepatic metabolism mainly through conjugation and this pathway of vancomycin deactivation may be increased in cancer patients leading to lowered vancomycin levels; (3) as a result of high amount of intravenous fluid given to those patients, urine flow may have increased leading to decrease in the re - absorption of vancomycin and enhancing its clearance . High vancomycin clearance that is observed in our patients could be resulted from these proposed mechanisms . Median (inter - quartile range) and mean (sd) steady - state trough concentration in our patients were 9.59 (6.67) and 11.2 (7.4) respectively and 25 (54.3%) patients had trough concentrations of <10 mg / l . Based on evidence suggesting that s. aureus exposure to trough serum vancomycin concentrations of <10 mg / l can produce intermediate resistant strains, recent idsa, ashp and sidp consensus guideline on vancomycin tdm, recommends that trough serum vancomycin concentrations always be maintained above 10 mg mg / l in patients with serious infection like pneumonia, bacteremia, meningitis and osteomyelitis . It is not clear whether this level would be recommended when vancomycin is used as empiric treatment of neutropenic fever and target vancomycin trough level for this indication is not defined in guidelines on neutropenic fever management in cancer patients . But in many febrile neutropenic patients who fulfill the criteria of starting vancomycin empirically, suspected infection is serious enough to dose vancomycin aiming at steady - state trough concentrations of at least 15 mg / l . In a vancomycin drug utilization review done by hayatshahi et al ., in our center, it was shown that among patients in whom vancomycin administration was justified, 42.3% received appropriate dose . But in this study, vancomycin concentrations were not measured and clinical outcomes were not evaluated . In another study of vancomycin utilization evaluation at hematology - oncology ward of a teaching hospital that was conducted by vazin et al . This trough levels seem to be higher than our patients but comparison of 95% ci of means shows that this difference is not statistically significant . Although patients included in above study received fix doses of 1000 mg q 12 hr, mostly as empirical treatment of neutropenic fever, only 3.6% of patients, far from our results, had trough vancomycin concentration less than10 mg / l . Mean (sd) total daily dose of vancomycin was 31.9 (10.5) mg / kg / day in our study and it seems to be higher than 14.7 mg / kg / day that was administered in mentioned study . Furthermore, mean sd (95% ci of mean) tbw of patients in above study is 68.05 12.26 kg (68.89 - 71.20) that seems to be lower than our patients with 74.83 16.6 kg (69.89 - 79.77) but this difference is not significant . On the other hand more than half of their patients had supra - therapeutic trough level which is shown in 10.9% of our patients . By the way, broad spectrum of trough levels among included patients despite fixed equal doses in the study done by vazin et al ., which is shown to some extent in our study, confirms inter and intra individual variability of vancomycin pharmacokinetics which necessitates using individual or same population based pharmacokinetic approach in dosing vancomycin . Based on these findings, we consider that pharmacokinetics of vancomycin may change in hsct patients from other patients and our patients need its unique population based pharamcokinetic approach in vancomycin dosing . Furthermore, considering the observed inter individual variability of vancomycin pharmacokinetics, dosage should be adjusted and individualized based on drug concentrations . The most frequent dosing regimen in our patients was 1000 mg q12hr (69.6%) which is usually determined based on 15 - 20 mg / kg q 8 - 12 hr and often lower doses were chosen due to concerns about nephrotoxicity . Patients who undergo hsct usually receive concurrent nephrotoxic drugs especially after transplantation and during neutropenia . This becomes more important in allogeneic hsct in which, patients receive a calcineurin inhibitor, most of the time cyclosporine in our center, as prophylaxis and treatment of graft versus host disease (gvhd). Calcineurin inhibitors are nephrotoxic drugs and cyclosporine is more nephrotoxic than tacrolimus . In hsct patients if serum creatinine rises with any reason and becomes stable, might lead to changes in cyclosporine dosing regimen which can put the patients under the risk of acute gvhd . Another nephrotoxic drug which might be administered in these patients is amphotericin b which induced aki in a dose dependent manner . Although vancomycin is not considered a nephrotoxic drug, it can aggravate nephrotoxicity of other drugs . Concomitant nephrotoxic agents can increase the incidence of vancomycin - associated nephrotoxicity by up to 35% . But it is shown in a recent systematic review that higher doses administered in order to achieve new target trough levels (15 - 20 mg / l) recommended by guideline in recent years, increases the risk of aki . But it is reported to be dependent on vancomycin therapy duration (mostly occurs after 7 days of therapy) and reversible . Aki occures in 45.7% of our patients which seems to be higher than vancomycin induced aki rate reported in literature . On the other hand 36% of our patients most of patients who develop aki in our study were receiving concurrent cyclosporine and amphotericin b and this high rate of aki cannot be related absolutely to vancomycin . Moreover aki is a common early complication after hsct . In a study by saddadi et al ., on aki in hsct patients in our center it is reported that 37.6% developed aki and higher frequency of aki was observed in patients who received cyclosporine a (40%), patients with allogeneic hsct(42.1%), and those who developed gastrointestinal gvhd (47.3%). Schrier et al ., showed the frequency of aki increased significantly from autologous hsct (21%) to non - myloablative allogeneic hsct (40%) to myeloablative allogeneic hsct (69%). Correlation between vancomycin dose or concentration and aki rate and influence of concurrent nephrotoxic drug could not be shown in our study may be due to small number of patients . With regard to indeterminacy about optimal trough vancomycin concentration in hsct patients with neutropenic fever and existence of many predisposing factor to aki in these patients, we suggest that clinical and microbiological outcome and safety of dosing regimen versus different target trough vancomycin concentration (10 - 15mg / l or 15 - 20 mg / l), be assessed in a randomized clinical trial on these patients . On the other hand, not only therapeutic drug monitoring and dose adjustment is necessary in our patients population and is recommended by mentioned guidelines, but also initial dosing regimen determination method needs to be changed . This study had several limitations, as small sample size and including patients with heterogeneous underlying diseases and different hsct type . Since blood sampling is limited in the clinical setting, therefore only one - compartment model could be used for pharmacokinetic analysis and this could be another limitation of the study . In summary, conventional vancomycin dosage regimens could not lead to recommended therapeutic serum concentrations in our patients although, optimal trough vancomycin concentration in febrile neutropenia in hsct patients needs to be defined . Large variation in vancomycin pharmacokinetic parameters observed among patients of this study along with the difference of vancomycin pharmacokinetics between our patients and other similar studies further explain the need for level monitoring and individualization of vancomycin dosing . A population pharmacokinetic approach in determining vancomycin dosing for these patients needs to be described.
|
Auditory processing disorder (apd) is defined as difficulties in the processing of auditory information in the central nervous system and is characterized by the poor localization, separation, grouping, discrimination, or ordering of sounds . Children with apd have poor speech perception, especially in challenging environments . According to jerger, one possible reason for poor performance in multisource environments is a deficit in auditory figure - ground discrimination, the ability to pick out important sounds from a noisy background . Figure - ground discrimination can be related to the perceptual concept of auditory stream segregation . Since all the surrounding sound signals arrive at the cochlea as a composite, a preliminary analysis of the incoming sound is required to divide the auditory input into distinct perceptual objects . The ability of a listener to segregate a single target from a group of distracting signals is due to a process of perceptual organization known as stream segregation . The process by which sound properties are segregated from the acoustic background (auditory segregation) and then integrate together as discrete perceptual entities (auditory object representation) is known as auditory scene analysis (asa). The ability to combine information from different sensory sources into unified concepts over time (integration processes) is a crucial part of asa in that it allows the listener to understand speech . Working memory capacity plays a critical role in this process, especially because auditory processing relies on the temporal domain . In general, the interplay between bottom - up and top - down mechanisms mediates asa . The separation between simultaneous sound events is based on numerous acoustic properties such as spectral, temporal, and spatial cues (bottom - up mechanisms). Also, stream segregation is a dynamic process that is modulated cognitively by top - down mechanisms, which involve the organization of acoustic components into perceptual object representations based on prior experiences or executive processes (especially working memory capacity and attention). Working memory capacity is defined as the ability to retain and manipulate information . Because speech perception requires the individual to follow, retain, and integrate a stream of auditory information, the effect of the spatial features of competing sound sources on the segregation of target sounds has been known for several decades . The intelligibility of speech in the presence of background noise is higher when the speech and noise come from different sources . Different natural sound sources usually come from different directions in space, and localization cues are extensively used for the segregation of different talkers . The ability to locate the spatial origin of a sound source requires the capacity of the central auditory nervous system to detect and compute a number of acoustic cues such as small differences in the arrival time and intensity of signals reaching the 2 ears . The interaural time differences of the low - frequency (<1.5 khz) components of the sound provide a powerful cue for tracking speech signals on the horizontal plane (or azimuth). Their results suggest that competing auditory streams are less distracting to individuals with high working memory abilities; therefore, listeners with higher working memory capacity may be more adept at separating target signals from a complex situation . Despite the rich history of research into directional hearing, only a few studies have attempted to measure the spatial resolution of the auditory system for simultaneous stimuli, particularly in children . In the present study, we used a measure of directional hearing known as the concurrent minimum audible angle, which is an excellent tool for measuring auditory segregation mediated by the binaural system . The concurrent minimum audible angle is defined as a threshold separation angle required to distinguish 2 stimuli that are presented simultaneously . Perrott measured the concurrent minimum audible angle in adults and found that the threshold separation angle significantly increased with laterality . In addition, the concurrent minimum audible angle increased from 4 to 10 at the front (0 azimuth) to 30 to 45 at a lateral displacement of 67. currently, little information is available on auditory streaming in children . The poor performance of children with apd in multisource environments may stem from their inability to benefit from spatial cues so as to judge the location of a sound source and segregate talkers from competing sounds . Moreover, there is a paucity of data on the effects of cognitive processing such as working memory capacity on auditory segregation in children with apd . Therefore, we sought to investigate specifically (a) working memory capacity and auditory segregation using pairs of concurrent auditory stimuli and (b) the possible influence of working memory capacity on auditory segregation in children with apd and subsequently compare them with those in healthy controls . The data on 15 right - handed children with apd (12 males and 3 females; mean age, 9.1 years; sd, 0.35) and 20 healthy control children (13 males and 7 females; mean age, 9.4 years; sd, 0.5) were included in this study . Children with apd the subjects had a clinical diagnosis of apd according to the multiple - processing auditory assessment subtests . Clinical diagnoses were established by experienced clinicians on the basis of a careful developmental history taking and a battery of tests, comprising the dichotic digit test, pitch pattern sequence test, and monaural selective auditory attention test . The dichotic digit test is composed of naturally spoken digits from 1 to 10 (except for the number 4 in farsi). The original formulation requires that 2 number pairs be presented simultaneously to each ear of the listener, with the subject being required to repeat all 4 numbers . The test presents 3 tones of 500 msec duration each and an interval of 10 seconds . Two of the tones are the same and one varies, and the subject is required to declare the pattern to the tester (verbally, by humming or by pointing to a visual analogue). A total of 30 patterns are presented monaurally to each ear following a brief practice session . The monaural selective auditory attention test compares the ability of the patient to recognize monosyllabic words embedded in a background of competing high - interest speech . Both the target and the competition stimuli are recorded by the same speaker, thereby eliminating speaker recognition cues . The outcome measure is the percentage of the correct responses for each ear . In order to assess relative homogeneity in children with apd, we included only children who displayed auditory deficits evidenced by poor performance on all 3 auditory tests in the study . All the participants had normal hearing (better than 15 db hl at octave frequencies between 250 and 8000 in the audiometry test) and normal iqs (85 on the wechsler revised intelligence scale for children). Subjects with a history of hearing impairment, ear diseases, and neurological difficulties were excluded from our study . This study was approved (#1429) by the local ethics committee of the university of social welfare and rehabilitation . Children who fulfilled the selection criteria were subjected to working memory capacity assessment and auditory stream segregation task . All the tests were performed under controlled test conditions in a sound - treated room with an ambient noise level <30 dba . Is commonly assessed by determining the number of items (i.e., letters, words, or sentences) that a person can keep in mind simultaneously for a short period of time . Both the phonological loop and the central executive (components of working memory capacity) were assessed in this study . Two of the most reliable measures of the phonological loop and verbal working memory capacity that are widely used in studies are forward digit span and non - word repetition tasks . Forward digit span assesses both attention and short - term memory capacity, whereas backward digit span measures working memory capacity . Forward and backward digit spans were obtained using the digit span subtests of the wechsler intelligence scale for children . In each case, digit span was measured for the forward and backward (reverse - order) recall of the digit sequences . The number of the digits was increased from 3 to 9 for forward digit span and from 2 to 8 for backward digit span, and 2 trials using different digit sets were presented at each increasing list length . Testing was ceased when the subject failed to accurately report either trial at 1 sequence length or when the maximal list length was reached (9 digits forward and 8 backward). The validated farsi non - word repetition task was used in this study . The test consisted of 40 non - words, which ranged in length from 1 to 4 syllables . The subjects were instructed to repeat the non - word that they had just heard . Performance in this task was analyzed by counting the error percent for each non - word length . In this study, auditory stream segregation was assessed using a method described by best (2004). In this method, the subjects were presented with 2 simultaneous tones of different frequencies (i.e., 500 hz and 800 hz) and were asked to judge the relative location of the pair by indicating whether the higher tone was to the left or right of the lower tone, on the right hand side of the subjects (figure 1). The subjects were instructed to keep their heads in this position for the duration of the recording process (about 15 min). Testing took place using 3 reference locations on a horizontal plane: 0, 30, and 60. for each reference location, 10 test locations were chosen on the basis of preliminary testing . In each trial, one stimulus corresponded to 1 of the reference locations, and the second stimulus was presented from 1 of the 10 test locations displaced in either azimuth . Prior to data acquisition, the subjects completed training blocks to ensure that they were able to detect the targets . Using a criterion of 75% correct in each test location, we measured the concurrent minimum audible angle . Stimuli were generated using matlab (the mathworks, natick, ma) and sound forge software (v.10 by sonic foundry) with a sampling rate of 44.1 khz . The stimuli were presented through headphones (tdh 39) via an audiometer, at 50 db sl . Schematic diagram of the reference positions around the head on the horizontal plane for the measurement of the concurrent minimum audible angle . The black dots illustrate the 3 reference locations examined: 0, 30, and 60 azimuth, all on the 0 elevation plane at the level of the ears . All the analyses were conducted using statistical package for the social sciences (spss), version 16 . Due to the relatively small group numbers in the study therefore, nonparametric statistics (mann whitney u) were used to compare the between - group differences . The pearson correlation was employed to measure the degree of association between working memory capacity and the localization tests . The significance level adopted was 0.05 (5%), with confidence intervals of 95% . The data on 15 right - handed children with apd (12 males and 3 females; mean age, 9.1 years; sd, 0.35) and 20 healthy control children (13 males and 7 females; mean age, 9.4 years; sd, 0.5) were included in this study . Children with apd the subjects had a clinical diagnosis of apd according to the multiple - processing auditory assessment subtests . Clinical diagnoses were established by experienced clinicians on the basis of a careful developmental history taking and a battery of tests, comprising the dichotic digit test, pitch pattern sequence test, and monaural selective auditory attention test . The dichotic digit test is composed of naturally spoken digits from 1 to 10 (except for the number 4 in farsi). The original formulation requires that 2 number pairs be presented simultaneously to each ear of the listener, with the subject being required to repeat all 4 numbers . The test presents 3 tones of 500 msec duration each and an interval of 10 seconds . Two of the tones are the same and one varies, and the subject is required to declare the pattern to the tester (verbally, by humming or by pointing to a visual analogue). A total of 30 patterns are presented monaurally to each ear following a brief practice session . The monaural selective auditory attention test compares the ability of the patient to recognize monosyllabic words embedded in a background of competing high - interest speech . Both the target and the competition stimuli are recorded by the same speaker, thereby eliminating speaker recognition cues . The outcome measure is the percentage of the correct responses for each ear . In order to assess relative homogeneity in children with apd, we included only children who displayed auditory deficits evidenced by poor performance on all 3 auditory tests in the study . All the participants had normal hearing (better than 15 db hl at octave frequencies between 250 and 8000 in the audiometry test) and normal iqs (85 on the wechsler revised intelligence scale for children). Subjects with a history of hearing impairment, ear diseases, and neurological difficulties were excluded from our study . This study was approved (#1429) by the local ethics committee of the university of social welfare and rehabilitation . Children who fulfilled the selection criteria were subjected to working memory capacity assessment and auditory stream segregation task . All the tests were performed under controlled test conditions in a sound - treated room with an ambient noise level <30 dba . Is commonly assessed by determining the number of items (i.e., letters, words, or sentences) that a person can keep in mind simultaneously for a short period of time . Both the phonological loop and the central executive (components of working memory capacity) were assessed in this study . Two of the most reliable measures of the phonological loop and verbal working memory capacity that are widely used in studies are forward digit span and non - word repetition tasks . Forward digit span assesses both attention and short - term memory capacity, whereas backward digit span measures working memory capacity . Forward and backward digit spans were obtained using the digit span subtests of the wechsler intelligence scale for children . In each case, digit span was measured for the forward and backward (reverse - order) recall of the digit sequences . The number of the digits was increased from 3 to 9 for forward digit span and from 2 to 8 for backward digit span, and 2 trials using different digit sets were presented at each increasing list length . Testing was ceased when the subject failed to accurately report either trial at 1 sequence length or when the maximal list length was reached (9 digits forward and 8 backward). The validated farsi non - word repetition task was used in this study . The test consisted of 40 non - words, which ranged in length from 1 to 4 syllables . The subjects were instructed to repeat the non - word that they had just heard . Performance in this task was analyzed by counting the error percent for each non - word length . In this study, auditory stream segregation was assessed using a method described by best (2004). In this method, the subjects were presented with 2 simultaneous tones of different frequencies (i.e., 500 hz and 800 hz) and were asked to judge the relative location of the pair by indicating whether the higher tone was to the left or right of the lower tone, on the right hand side of the subjects (figure 1). The subjects were instructed to keep their heads in this position for the duration of the recording process (about 15 min). Testing took place using 3 reference locations on a horizontal plane: 0, 30, and 60. for each reference location, 10 test locations were chosen on the basis of preliminary testing . In each trial, one stimulus corresponded to 1 of the reference locations, and the second stimulus was presented from 1 of the 10 test locations displaced in either azimuth . Prior to data acquisition, the subjects completed training blocks to ensure that they were able to detect the targets . Using a criterion of 75% correct in each test location, we measured the concurrent minimum audible angle . Stimuli were generated using matlab (the mathworks, natick, ma) and sound forge software (v.10 by sonic foundry) with a sampling rate of 44.1 khz . The stimuli were presented through headphones (tdh 39) via an audiometer, at 50 db sl . Schematic diagram of the reference positions around the head on the horizontal plane for the measurement of the concurrent minimum audible angle . The black dots illustrate the 3 reference locations examined: 0, 30, and 60 azimuth, all on the 0 elevation plane at the level of the ears . All the analyses were conducted using statistical package for the social sciences (spss), version 16 . Due to the relatively small group numbers in the study therefore, nonparametric statistics (mann whitney u) were used to compare the between - group differences . The pearson correlation was employed to measure the degree of association between working memory capacity and the localization tests . The significance level adopted was 0.05 (5%), with confidence intervals of 95% . The mean scores and sds for the pitch pattern sequence test, dichotic digit test, and monaural selective auditory attention test for the children with apd and the typically developing children are shown in figure 2 . Bar charts comparing the performance of the group with audio processing disorder (apd) with that of the control group on the 3 auditory processing tasks for each ear . The mean scores and sds for the non - word repetition and forward and backward digit span tasks for the children with apd and the typically developing children are depicted in figure 3 . In the non - word repetition task, the control group had near - ceiling scores, whereas the group with apd had markedly lower scores . Both the forward and backward digit span scores were higher in the typically developing children than in the group with apd . The forward digit span scores were higher than were the backward digit span scores in both groups . Between - group comparisons revealed that the group with apd had a significantly lower score than did the control group in all the working memory capacity tests (p<0.001). Means and sds of the non - word repetition and forward and backward digit span tasks for the group with audio processing disorder (apd) and the control group . Table 1 shows the descriptive and inferential statistics of the concurrent minimum audible angle for the children with apd and the typically developing children . The concurrent minimum audible angle increased as a function of the laterality of the sources in both groups . Between - group comparisons revealed that the group with apd had a significantly greater change for the separation of the concurrent stimuli than did the typically developing children on the 0 and 30 reference locations (p<0.05). At the most lateral reference location in this study (i.e., 60 azimuth) means and sds of the cmaa for the children with apd and the typically developing children p<0.05; cmaa: concurrent minimum audible angle; apd: audio processing disorder table 2 presents the correlations between the working memory capacity tasks (i.e., non - word repetition task and forward and backward digit span tasks) and the concurrent minimum audible angle in the group with apd . The results in the children with apd showed higher negative correlations of the working memory capacity variables with the concurrent minimum audible angle results in the most frontal reference location (0 azimuth) and lower negative correlations in the most lateral reference location (60 azimuth). The results showed that the forward digit span task had significant correlations with the concurrent minimum audible angle in the 0 and 30 reference positions (p=0.03 and p=0.05, respectively). The non - word repetition task had a significant correlation only with the concurrent minimum audible angle in the 0 reference position (p=0.04). There were no correlations between the working memory capacity tasks and the concurrent minimum audible angle in the 60 reference position (p>0.05). Correlations between the working memory capacity tasks and the concurrent minimum audible angle in the children with apd p<0.05; apd: audio processing disorder table 3 demonstrates the correlations between the working memory capacity tasks and the concurrent minimum audible angle in the control group . As can be seen, the correlations were different between the typically developing children and those with apd . The results for the typically developing children showed that there were no significant correlations between the working memory capacity tasks and the concurrent minimum audible angle in all the reference positions (p>0.05). Correlations between the working memory capacity tasks and the concurrent minimum audible angle in the typically developing children the mean scores and sds for the pitch pattern sequence test, dichotic digit test, and monaural selective auditory attention test for the children with apd and the typically developing children are shown in figure 2 . Bar charts comparing the performance of the group with audio processing disorder (apd) with that of the control group on the 3 auditory processing tasks for each ear . The mean scores and sds for the non - word repetition and forward and backward digit span tasks for the children with apd and the typically developing children are depicted in figure 3 . In the non - word repetition task, the control group had near - ceiling scores, whereas the group with apd had markedly lower scores . Both the forward and backward digit span scores were higher in the typically developing children than in the group with apd . The forward digit span scores were higher than were the backward digit span scores in both groups . Between - group comparisons revealed that the group with apd had a significantly lower score than did the control group in all the working memory capacity tests (p<0.001). Means and sds of the non - word repetition and forward and backward digit span tasks for the group with audio processing disorder (apd) and the control group . Table 1 shows the descriptive and inferential statistics of the concurrent minimum audible angle for the children with apd and the typically developing children . The concurrent minimum audible angle increased as a function of the laterality of the sources in both groups . Between - group comparisons revealed that the group with apd had a significantly greater change for the separation of the concurrent stimuli than did the typically developing children on the 0 and 30 reference locations (p<0.05). At the most lateral reference location in this study (i.e., 60 azimuth) means and sds of the cmaa for the children with apd and the typically developing children p<0.05; cmaa: concurrent minimum audible angle; apd: audio processing disorder table 2 presents the correlations between the working memory capacity tasks (i.e., non - word repetition task and forward and backward digit span tasks) and the concurrent minimum audible angle in the group with apd . The results in the children with apd showed higher negative correlations of the working memory capacity variables with the concurrent minimum audible angle results in the most frontal reference location (0 azimuth) and lower negative correlations in the most lateral reference location (60 azimuth). The results showed that the forward digit span task had significant correlations with the concurrent minimum audible angle in the 0 and 30 reference positions (p=0.03 and p=0.05, respectively). The non - word repetition task had a significant correlation only with the concurrent minimum audible angle in the 0 reference position (p=0.04). There were no correlations between the working memory capacity tasks and the concurrent minimum audible angle in the 60 reference position (p>0.05). Correlations between the working memory capacity tasks and the concurrent minimum audible angle in the children with apd p<0.05; apd: audio processing disorder table 3 demonstrates the correlations between the working memory capacity tasks and the concurrent minimum audible angle in the control group . As can be seen, the correlations were different between the typically developing children and those with apd . The results for the typically developing children showed that there were no significant correlations between the working memory capacity tasks and the concurrent minimum audible angle in all the reference positions (p>0.05). Correlations between the working memory capacity tasks and the concurrent minimum audible angle in the typically developing children the findings of the current study revealed that the children with apd were significantly poorer than were the control group in both working memory capacity measures and auditory stream segregation according to the concurrent minimum audible angle . Working memory capacity deficits in children with apd showed poor performance in forward and backward digit span tasks in children diagnosed with apd . In a different study, iliadou and bamiou found that the working memory capacity of their children with apd, as measured by non - word repetition and forward and backward digit span tasks, was significantly poorer than that of their control group . These findings support our results indicating poor working memory capacity in children with apd by comparison with typically developing children . This finding is line with the hypothesis that apd cannot be defined as an exclusively modality - specific perceptual dysfunction because the brain is non - modular and the auditory sensory processing in the central nervous system modulated by top - down mechanism influences working memory capacity . Previous studies have shown that that performance in spatial discrimination tasks becomes poorer in the horizontal dimension as the azimuth increases . The results of the present study indicated that at a more lateral reference point (i.e., 60), the angle of separation increased in both the typically developing children and the children with apd . These data are consistent with those reported by some previous studies which have shown that the concurrent minimum audible angle of tones increases in the lateral position . The findings of our study showed that the value of the concurrent minimum audible angle increased as the reference location was moved laterally (60 azimuth) in both groups; nonetheless, the children with apd required a greater change for the separation of concurrent stimuli than did the typically developing children in all the reference locations, especially in the 0 and 30 reference points . The results of the current study revealed significant differences between the 2 groups in the 0 and 30 reference positions, but there was no significant difference in the 60 azimuth reference point . This may be due to the fact that the concurrent minimum audible angle is most acute for sounds presented directly in front of the subject and least sensitive when the stimuli are presented from the lateral side . Currently, there is no information on the effects of cognitive processing such as working memory capacity on auditory segregation using the concurrent minimum audible angle in children with apd . We found significant negative correlations between working memory capacity and the concurrent minimum audible angle in the most frontal reference location (0 azimuth) and lower negative correlations in the most lateral reference location (60 azimuth) in our children with apd . This finding suggests that interventions designed to enhance the individual s cognitive strategies such as working memory capacity may confer better performance in the concurrent minimum audible angle in the frontal reference locations . There were no significant correlations between the concurrent minimum audible angle and working memory capacity in the control group . The difference between the 2 groups may be explained by the notion that in children with lower working memory capacity, the top - down system must work harder and rely more on the bottom - up system to make sense of the acoustic information . This finding underscores the importance of a specific top - down rehabilitation program based on working memory capacity enhancement in children with apd . Conway et al . Demonstrated that the subjects with high working memory capacity did better on the auditory processing task (dichotic listening) than did those with low working memory capacity in their study . The findings of the present study are in line with studies which have suggested that working memory capacity underlies the auditory processing performance . Previous investigations have demonstrated that accurate segregation can be impaired in a noisy environment because the non - target signals place a cognitive load on working memory capacity . Since working memory is a capacity - limited system and capacity comprises processing and storage components, any excessive load for processing due to difficult auditory task and noisy environment will decrease the share of storage component . The current study showed that potentially lower working memory capacity in the children with apd could be the reason for their inability to segregate and group information binaurally and presumably for their listening difficulties in multisource environments . The findings of the present study support the hypothesis that competing auditory streams are more distracting to individuals with low working memory abilities . This study had a relatively small sample size, which suggests the need for further studies with larger samples . We could not match the intelligence factor between the 2 groups due to the small sample size, although there was no significant difference between the 2 groups (iq range, 92 to 105). It should be noted that because apd can range in varying degrees of significance and may coexist with other disabilities, it may be difficult to diagnose accordingly, the term suspected apd may be more appropriate for some cases of this research . Future studies using working memory capacity paradigms with incremental difficulty loads (e.g., white noise and speech noise) may enhance our understanding of the relationship between working memory capacity and auditory stream segregation . Working memory capacity was lower in the children with apd than in the age - matched, normal - hearing children in the present study . Moreover, the group with apd had poorer performance in the concurrent minimum audible angle skills for all 3 reference positions (i.e. 0, 30, and 60), especially in the more lateral position . The results of this study revealed significant negative correlations between working memory abilities and auditory stream segregation skills . Poor working memory capacity in children with apd may be the possible cause of poor performance in the segregating and grouping of incoming information and in turn poor speech perception in complex and noisy environments . Our findings suggest that higher - order dysfunction or inadequate top - down factors such as working memory capacity in children with apd may have a negative effect on their ability to perform auditory stream segregation, not least in challenging environments . Since cognitive systems interact with auditory processing and speech comprehension, clinicians should employ multiple measures (bottom - up and top - down) for children with apd so that management may be beneficial for them . The findings of this study offer support for further research into the potential benefits of auditory working memory training to improve auditory stream segregation abilities in persons with apd . Individuals with apd require comprehensive assessment and an intervention program specifically for each individual s needs.
|
The identification of ligand - binding sites is a crucial part in functional annotation of proteins, which benefits enormously from the knowledge of the protein 3d structure . It can provide clues about the molecular function of a protein, even in cases in which the relationship between molecular and biological function is not clear and where there is scarce sequence similarity between the protein of interest and available annotated proteins . Indeed, a large fraction of the protein structures deposited in protein data bank (pdb) (1) remains with unknown function (2). This happens because methods that are commonly used to transfer functional annotations from homologous proteins, i.e. Blast (3) and dali (4), are not able to capture from the sequence all the information needed to infer the function, especially when the global sequence similarity falls in the twilight zone (below 25% sequence identity) (5). As the protein global fold is more conserved than its sequence in protein families (6), structure - based methods outperform sequence - based methods in functional annotations (7) when they operate in the twilight zone . The increase in size of solved protein structures with poorly characterized biochemical functions or molecular interactions has led to the need for computational methods able to detect and characterize functional sites on protein structures (8). Functional site detection is also important for targeting specific pockets in structure - based and fragment - based drug design (9,10), drug discovery (11) and molecular docking (12,13). The ligand - binding site detection procedure is generally divided in two steps: the identification of the location of an appropriate cavity on the protein surface and the prediction of a suitable ligand that could fit into it . Accordingly, a variety of algorithms have been developed to identify ligand - binding pockets in protein structures to limit the search space in molecular docking pipelines . The available methods use geometric criteria (1417), energy functions (1821) or other types of characteristics, such as surface accessibility, the net charge on the protein residues in a protein as a function of ph, sequence conservation and so forth (2227). Obviously, when the structure of a homologue of the protein of interest is available, the identification of binding sites can take advantage from the transferred structural information . Different methods have been published such as 3dligandsite (28), findsite (29) and firestar (30). They achieve better performances in identifying the correct location of binding sites by superposing homologue(s) of the protein of interest, whenever available, onto the query protein structure, to determine the location of the ligand binding site(s) and/or the residues involved in binding (31). However, the major limitation of these methods is that they cannot be used when no annotated homologues is available . The performance of binding site prediction methods differs according to whether the analysis is performed on apo (ligand - unbound) or holo (ligand - bound) structures because proteins often undergo conformational changes on ligand binding . In general, most of these methods correctly identify the location of the binding site in 7095% of the cases if the protein analyzed is in the bound conformation . In contrast, the same analysis performed on the apo structures achieves a success rate ranging from 50 to 75% (32,33). Although knowledge - based approaches have been developed that use these data to dock ligands onto proteins (3436), no method exists that uses available protein - ligand complexes to predict binding sites on a query structure, irrespective of the nature of the ligand . For this reason, we have developed the pdbinder algorithm (37), a knowledge - based method based on the observation that unrelated binding sites often share small structural motifs that bind the same chemical fragments, irrespective of the type of ligand they are able to bind . The method correctly identifies residues belonging to the binding site in 77% of the cases . In particular, we have proved it to be the best available method on both holo and apo protein structures, obtaining for the latter performances similar to those for proteins in their bound conformation . These results are extremely important for all the real world cases where the query protein has been crystallized without a ligand and is also difficult to obtain clear similarities with bound pockets from holo pocket libraries . In this web server version, the method has been improved by the addition of a novel conservation scoring function with an improvement of 3% in positive predictive value and 13% in sensitivity both in the apo and holo test set . The interface of webpdbinder is designed to facilitate the input process and to obtain a clear and user - friendly graphical output that makes the method accessible to a broad audience . The webpdbinder is based on the pdbinder method for the identification of protein structure residues in contact with a putative ligand . Pdbinder searches for small (three residues) similarities between a query structure and two libraries of binding and non - binding residues using superpose3d (38), a fast local structure comparison method . The binding and non - binding residue datasets are derived from a subset of the pdb protein structures obtained from the blastclust (39) sequence clusters at 30% sequence identity . Binding pockets were defined by selecting all the residues having an atom closer than 3.5 to any atom of a ligand . This distance threshold was determined during the training of the method . In total, the ligand - binding data set was composed of 1896 binding pockets comprising 25 905 residues and the non - binding one of 423 556 residues not interacting with any ligand . When the residues are compared with those of the query structure, they are considered similar by superpose 3d if they can be superimposed with a root mean square deviation (rmsd) lower than a given threshold, using a two point (c - alpha and side chain centroid) amino acid representation . The ratio of similarities identified in the two sets (binding and not - binding) is then used to derive a propensity value for each residue belonging to the protein of interest . The pdbinder method has been tested on a data set of 239 holo and apo protein structures . The method achieved an average sensitivity of 30%, an average specificity of 98% and a precision of 41% on holo protein structures . Using the apo test set, the method achieved average sensitivity of 25%, specificity of 98% and precision of 37% . The ability of the classifier in correctly identifying binding residues from non - binding ones is 77% in both holo and apo protein structures . An improved version of the algorithm that takes in account the sequence conservation is optionally available on the web server for all those cases where a pfam domain (40) can be associated to the query structure . A residue conservation score is derived from the available pfam multiple alignments in two steps . (i) the percentage of similar residues (blosum62 scores 1) in each alignment columns is computed . (ii) the score is normalized across differently overall conserved pfam families, by using for each residue the percentile score of its conservation versus the distribution of conservation scores of the whole protein . This modified version of the algorithm has been trained on the same training data set of the pdbinder method (1356 high - quality non - redundant protein structures). We were able to assign a conservation score to 1237 of these proteins, and we identified a combination of conservation threshold (58) and propensity value threshold (0.125) that obtained the best performance . The application of these new thresholds on the data set produced a 5% increase on the positive predictive value of the method while leaving all the other values almost unchanged (data not shown). After the identification of the best combination of conservation and propensity value thresholds, we tested the new version of pdbinder on the ligasite (41) test set used by the older version of pdbinder (239 holo and apo protein structures). The results (table 1) show that the combination of conservation and propensity value increases the performance of pdbinder both on bound and unbound protein structures . We obtained a slight increase both in positive predictive value and specificity, an increase of 13.5 and 12.7% in sensitivity, 0.071 and 0.071 in matthew s correlation coefficient, respectively, on holo and apo protein structures . Table 1.results for pdbinder and the modified version in webpdbinder (pdbinder + conservation score) on the original test set of 239 holo and apo protein structures (ligasite) in terms of sensitivity (sens), specificity (spec), positive predictive value (ppv) and matthew s correlation coefficient (mcc)methodsensspecppvmccdatasetpdbinder0.2950.9830.4130.313holopdbinder + cons0.4300.9680.4330.384pdbinder0.2510.9840.3720.271apopdbinder + cons0.3780.9690.4000.342 results for pdbinder and the modified version in webpdbinder (pdbinder + conservation score) on the original test set of 239 holo and apo protein structures (ligasite) in terms of sensitivity (sens), specificity (spec), positive predictive value (ppv) and matthew s correlation coefficient (mcc) we tested the method in conditions that mimic the prediction for protein structures without known homologues in the pdb . We performed a leave - one - out experiment using protein structures from the data set used in the original pdbinder manuscript, comprising 1356 high - quality protein structures . For each protein analyzed, we used for comparison only residues from the binding and non - binding data sets that belong to protein structures sharing less than a fixed threshold of sequence identity with the query protein binding pocket . Table 2 reports the performances of pdbinder for different thresholds of binding pockets sequence identity, in terms of sensitivity, specificity, positive predictive value and matthew s correlation coefficient . The results show that also in the worst scenario in which we are able to use only structures that share <5% sequence identity with the query protein in the binding pocket, the method identifies 27% of the binding site residues, without loosing in precision (positive predictive value). Table 2.pdbinder results after the removal of protein structures at different thresholds of sequence identity in their binding pocketssequence identity threshold (%) sensspecppvmcc50.2710.9770.4410.300100.2690.9790.4500.304150.2670.9800.4560.305200.2660.9810.4610.306the sequence identity threshold refers to the maximum percentage of sequence identity between the query protein - binding pocket and the binding pockets of each protein of the binding and non - binding residues data set . The results report performances in terms of sensitivity (sens), specificity (spec), positive predictive value (ppv) and matthew s correlation coefficient (mcc). Pdbinder results after the removal of protein structures at different thresholds of sequence identity in their binding pockets the sequence identity threshold refers to the maximum percentage of sequence identity between the query protein - binding pocket and the binding pockets of each protein of the binding and non - binding residues data set . The results report performances in terms of sensitivity (sens), specificity (spec), positive predictive value (ppv) and matthew s correlation coefficient (mcc). To submit a job to webpdbinder, the user can: (i) input a pdb i d (or a list of pdb ids) in the textbox of the run your job section or (ii) upload a pdb formatted file in the upload your file section . In both modes by using the advanced parameters, the user can choose to run a more or less stringent search . The user can change the rmsd threshold used in the structural comparison phase as well as the propensity value and conservation score used in the identification of the binding residues . The rmsd thresholds can be set to 0.5, 0.6 and 0.7, the propensity threshold can be set anywhere in the range from 0 to 1 and the conservation threshold can range from 0 to 100 . Default parameters as specified in methods and experimental results section are 0.7 for rmsd, 0.125 for the propensity value and 58 for conservation score . To use the old version of pdbinder (without the sequence conservation) the propensity and the conservation thresholds must be fixed to 0.143 and 0, respectively . The user can also provide an email address to which links to the results will be sent, although providing an email address is not mandatory . The results page (figure 1) contains a summary of the input data, reporting the query protein and parameters used in the analysis (a). Buttons are available that can be used to download the results in a parsable text file (c), or go back to the summary page (d). Using the redraw button (b), the user can change the propensity value and the conservation score thresholds and view the new results without the need to re - run the whole search . The analyzed structure is shown using the jmol java applet, an open - source java - based viewer for 3d chemical structures (http://www.jmol.org/). By default, the protein structure is represented as a gray ribbon, whereas predicted binding residues are represented in balls and sticks mode and colored in red (e). Under the jmol applet interface, some shortcuts options are available to modify the default visualization (f) together with a button for the visualization of a table with the predicted binding residues (g). This table (figure 2) shows the residues identified in a binding site and for each prediction information is reported about the residue name (a), number (a) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . The user can also highlight binding residues on the jmol structure by checking the associated residue s radio button (f). A usage guide is provided to the user, which describes every step graphically and by means of simple instructions . The figure shows the prediction made on the orotidine 5-monophosphate decarboxylase from methanobacterium thermoautotrophicum (pdb code 3g1s) with the default parameters (an rmsd threshold of 0.7, a propensity value of 0.125 and a conservation score of 58%). In the upper part, a summary of the parameters used in the search is reported (a), together with a button to download a parsable result file (c), a button to go back to the summary page (d) and a button to re - submit a new job after changing parameters (b). In the java applet, the predicted residues are colored in red and displayed as ball and sticks, whereas the query protein is showed in ribbon style and colored in gray (e). In the bottom part, buttons are available to change the jmol visualization options (f) and to view a list of the predicted residues (g). For each prediction, information is reported about the residue name (a), number (b) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . Users can highlight binding residues on the jmol structure by checking the relative residue s radio button (f). The figure shows the prediction made on the orotidine 5-monophosphate decarboxylase from methanobacterium thermoautotrophicum (pdb code 3g1s) with the default parameters (an rmsd threshold of 0.7, a propensity value of 0.125 and a conservation score of 58%). In the upper part, a summary of the parameters used in the search is reported (a), together with a button to download a parsable result file (c), a button to go back to the summary page (d) and a button to re - submit a new job after changing parameters (b). In the java applet, the predicted residues are colored in red and displayed as ball and sticks, whereas the query protein is showed in ribbon style and colored in gray (e). In the bottom part, buttons are available to change the jmol visualization options (f) and to view a list of the predicted residues (g). The list of the binding site predicted residues shown in the result page . For each prediction, information is reported about the residue name (a), number (b) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . Users can highlight binding residues on the jmol structure by checking the relative residue s radio button (f). To submit a job to webpdbinder, the user can: (i) input a pdb i d (or a list of pdb ids) in the textbox of the run your job section or (ii) upload a pdb formatted file in the upload your file section . In both modes by using the advanced parameters, the user can choose to run a more or less stringent search . The user can change the rmsd threshold used in the structural comparison phase as well as the propensity value and conservation score used in the identification of the binding residues . The rmsd thresholds can be set to 0.5, 0.6 and 0.7, the propensity threshold can be set anywhere in the range from 0 to 1 and the conservation threshold can range from 0 to 100 . Default parameters as specified in methods and experimental results section are 0.7 for rmsd, 0.125 for the propensity value and 58 for conservation score . To use the old version of pdbinder (without the sequence conservation) the propensity and the conservation thresholds must be fixed to 0.143 and 0, respectively . The user can also provide an email address to which links to the results will be sent, although providing an email address is not mandatory . The results page (figure 1) contains a summary of the input data, reporting the query protein and parameters used in the analysis (a). Buttons are available that can be used to download the results in a parsable text file (c), or go back to the summary page (d). Using the redraw button (b), the user can change the propensity value and the conservation score thresholds and view the new results without the need to re - run the whole search . The analyzed structure is shown using the jmol java applet, an open - source java - based viewer for 3d chemical structures (http://www.jmol.org/). By default, the protein structure is represented as a gray ribbon, whereas predicted binding residues are represented in balls and sticks mode and colored in red (e). Under the jmol applet interface, some shortcuts options are available to modify the default visualization (f) together with a button for the visualization of a table with the predicted binding residues (g). This table (figure 2) shows the residues identified in a binding site and for each prediction information is reported about the residue name (a), number (a) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . The user can also highlight binding residues on the jmol structure by checking the associated residue s radio button (f). A usage guide is provided to the user, which describes every step graphically and by means of simple instructions . The figure shows the prediction made on the orotidine 5-monophosphate decarboxylase from methanobacterium thermoautotrophicum (pdb code 3g1s) with the default parameters (an rmsd threshold of 0.7, a propensity value of 0.125 and a conservation score of 58%). In the upper part, a summary of the parameters used in the search is reported (a), together with a button to download a parsable result file (c), a button to go back to the summary page (d) and a button to re - submit a new job after changing parameters (b). In the java applet, the predicted residues are colored in red and displayed as ball and sticks, whereas the query protein is showed in ribbon style and colored in gray (e). In the bottom part, buttons are available to change the jmol visualization options (f) and to view a list of the predicted residues (g). Figure 2.the list of the binding site predicted residues shown in the result page . For each prediction, information is reported about the residue name (a), number (b) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . Users can highlight binding residues on the jmol structure by checking the relative residue s radio button (f). The figure shows the prediction made on the orotidine 5-monophosphate decarboxylase from methanobacterium thermoautotrophicum (pdb code 3g1s) with the default parameters (an rmsd threshold of 0.7, a propensity value of 0.125 and a conservation score of 58%). In the upper part, a summary of the parameters used in the search is reported (a), together with a button to download a parsable result file (c), a button to go back to the summary page (d) and a button to re - submit a new job after changing parameters (b). In the java applet, the predicted residues are colored in red and displayed as ball and sticks, whereas the query protein is showed in ribbon style and colored in gray (e). In the bottom part, buttons are available to change the jmol visualization options (f) and to view a list of the predicted residues (g). For each prediction, information is reported about the residue name (a), number (b) and chain (c), the propensity value achieved (d) and, if available, the residue conservation score (e) in its pfam family . Users can highlight binding residues on the jmol structure by checking the relative residue s radio button (f). Pdbinder is a web server for the prediction of ligand - binding pockets on protein structures . The identification of ligand - binding sites is a difficult task when there is scarce sequence similarity between the protein of interest and available annotated proteins or when the similar structures are only crystallized in their apo form . The analysis of apo / holo structure pairs shows that the performance of pdbinder is almost similar in both cases . This could be explained by the fact that, even though the ligand induces some rearrangements in the overall structure of the binding site, the local conformation of small sets of residues, which is the level of detail relevant for pdbinder, does not vary much upon binding . Therefore, pdbinder can be applied to all those structures of unknown function that lack homologue(s) and have been crystallized without the ligand . This web server provides a user - friendly version of the pdbinder method, enriched with a new parameter, the conservation value and improved performance . It gives an interactive and easy to use interface to visualize the predicted binding sites on the query structure directly on the web, without the need to install locally the program . Airc [ig 10298 to m.h.c . ]; firb futuro in ricerca [rbfr08zsxy to g.a . ].
|
Inflammatory bowel disease (ibd) is a group of chronic conditions of the colon and small intestine, consisting of crohn's disease (cd) and ulcerative colitis (uc), characterized by acute pain, vomiting, and diarrhea symptoms followed by remission . A single etiology has not been identified, but rather the pathogenesis of ibd is very complex and involves the external environment, genetic makeup, intestinal microbial flora, and immune system . Although new and powerful medical treatments are available, many are biological drugs or immunosuppressants, which are associated with significant side effects, in particular infection and increased risk of malignancy, and elevated costs which require optimal medical treatment adjustment . As a result, major attempts have been made at identifying clinical characteristics, concurrent medical therapy, and serological and genetic markers as predictors of response to biological agents . Only few reports exist on how mucosal / tissue markers are capable of predicting clinical behaviour of the disease or its response to therapy . Due to its ability of interfering with intestinal barrier function and stimulating local and systemic inflammation, dextran sodium sulfate (dss) is often used as a mouse model of colitis which can mimic clinical and histological features of ibd with uc characteristics . Most commonly, experimental colitis is induced by heparin - like polysaccharide dss because of its capacity of inducing colonic lesions . . Showed that oral administration of 5% of dss in drinking water of balb / c mice was able to induce a chronic colitis after several cycles of dss . This study was followed by a report from cooper et al . Who induced chronic colitis by (a) 7 days of oral dss followed by 7 days of h2o (for 1, 2, and 3 cycles) and (b) 7 days of oral dss followed by 14 and 21 days of h2o . The results of this study showed that chronic colitis induced after only 7 days of dss may serve as a useful model to study the effects of pharmacologic agents in human inflammatory disease and mechanisms of perpetuation of inflammation and gave an extensive description of histological lesions, showing that the main histological changes consisted of focal crypt loss, which was followed by signs of both acute and chronic inflammation . The present study aimed to investigate the effect of fr-91 on the attenuation of the chronic experimental colitis induced by dss in swiss mice . Furthermore, we investigated if the chronic phase was characterized by a regulation in the expression of apoptotic genes and by a dysregulation of t helper 1 (th1)/t helper 2 (th2) balance and how this would relate to mucosal regeneration . Twenty - six specific pathogen - free swiss cd1 female mice (7 weeks old; santiago de compostela's university animal breeding core, spain) were maintained (two or three per cage) in isolator plastic cages with shavings under standard laboratory conditions (sterilizable diet, 50% humidity, 23 - 24c temperature, and 12-h light / dark cycle). All mice were quarantined 3 weeks after arrival and then randomized by body weight into experimental and control groups . All mice were permitted free access to a commercial diet and treatment or normal drinking tap water in individual bottles . All procedures conformed to the guidelines established by the european communities council directive of 24 november 1986 (86/609/eec) and by the spanish royal decree 1201/2005 for animal experimentation and were approved by the ethical committee of ebiotec . The design of the present study was focused primarily on inducting colitis - associated dysplasia and/or ulcerative hallmarks by administering synthetic dextran sulfate sodium (dss) to mice and then treating them with different fr91 (standardized lysate of microbial cells belonging to the bacillus genus) dilutions as shown in figure 1 . At the age of 7 weeks, the animals were divided into two control groups (1 and 2, n = 4 each group) and three experimental groups (35, n = 6 each group). Along the entire experimental procedure, distilled water containing different fr91 dilutions (5% in group 3, 10% in 1 and 4, and 20% in 5) onwards, distilled water containing 20 g / l (2%) synthetic dextran sulfate sodium (dss; mol mass 5000; d4911, sigma - aldrich; mo, usa) was also administrated to animals of groups 25 . For comparison, control groups 1 and 2 received dss or the fr91 treatment alone, respectively, as untreated control . All mice were sacrificed at the end of the experiment (8th week), at the age of 15 weeks . Experimental colitis was induced to mice of groups 2, 3, 4, and 5, by repeated administrations of 2% (wt / vol; 20 this dose was empirically reported to induce moderate to severe colitis while minimize mortality in mice . None of the mice died before the termination of this experiment study at day 50 . Mice were deeply anesthetized with ether and intracardially perfused with saline buffer and then fixed by 4% paraformaldehyde in 0.1 m phosphate buffer (ph 7.4). The entire colorectum (from colocecal junction to the anal verge) was removed, measured, examined macroscopically, washed with saline buffer, and immediately fixed by immersion in the same fixative for 48 h. part of the colon was divided into three equal segments (proximal, middle, and distal), and portions were determined under a dissecting stereomicroscope (leica, m125). Intestine portions were cryoprotected with 30% sucrose in 0.1 m phosphate buffer, embedded in oct compound (tissue tek, torrance, ca), and frozen with liquid - nitrogen - cooled isopentane . Parallel series of transverse sections of 1416 m thick were obtained on a cryostat (starlet 2212, bright, uk) and mounted on superfrost plus (menzel - glser) slides . Routine histological examination was performed on hematoxylin and eosin (h&e)-stained sections, where different morphological alterations that occur during inflammation- associated colorectal carcinogenesis (such as cryp abscess, mucosal dysplasia, adenomas, and adenocarcinomas), were identified and diagnosed according to previous published studies, see keohane et al . . To detect the expression of colorectal histopathological markers such as catenin-, p53, bcl-2, mlh1, and apc, we used immunohistochemical techniques . The sections were pretreated with h2o2 to eliminate endogenous peroxidase, rinsed twice in phosphate - buffered saline (pbs) at ph 7.4 (10 minutes each), and then sequentially treated with nonspecific binding blocked solution (0.1 m pbs containing 0.2% tween 20 and 15% normal goat serum from dako; glostrup, denmark) for 1 h, primary rabbit policlonal antibodies such as anti - catenin-, anti - p53, anti - bcl-2, anti - mlh1, and anti - apc antibodies (rabbit antibodies that were affinity purified from rabbit antiserum by affinity chromatography using mouse epitope - specific immunogen; bioworld technology, mn, usa; cat . Bs3603, bs3736; bs1511, bs2418, bs1017 respectively, dilution 1: 200) overnight, pbs (two 10-min rinses), goat anti - rabbit igg serum biotinylated (dako, dilution 1: 100) for 1 h, pbs (two 10-min rinses), vectastain abc kit (vector laboratories, burlingame, ca, usa) for 1 h, and pbs (two 10-min rinses). As a negative control, omission of the primary, secondary or tertiary antibodies were used, and no immunostaining was observed . At the last step, the immunoreaction was developed with 0.005% diaminobenzidine (dab; sigma - aldrich) and 0.003% h2o2 . All dilutions were made in pbs containing 0.2% tween 20, and incubations were made in a humid chamber at room temperature . Finally, the sections were dehydrated, mounted, and coverslipped . Antibody characterization and specificity . According to the technical information supplied by the manufacturer (bioworld technology, mn, usa), the primary antibodies used were raised against denatured mouse epitopes from rabbit antiserum, and they were affinity purified by chromatography using epitope - specific immunogen with purity higher than 95% (by sds - page). Its specificity has been assessed by western blot; it recognizes a single - protein band of approximately 8690 kd (-catenin), 4345 kd (p53), 2628 kd (bcl-2), 8486 kd (mlh1), and 270280 kd (apc). Moreover, antibodies have wide species cross - reactivity and were used for demonstrating their expression in mouse, rat, and human . Lesions were classified as positive for catenin-/bcl-2/mlh1/apc if cytoplasmic / nuclear staining was detected, and p53 was considered positive if nuclear expression was detected . Two different observers evaluated individually and independently the experimental group slides in a double - blind manner and achieved a high level of concordance . Three sections of each mouse colorectal segment were coded and scored for lesions according to the extent ulceration (0, not present and 1 present), severity of lesions, hyperplasia, and area involved, graded as follow: 0, normal; 1, mild; 2, moderate; 3, severe . The sections were photographed with an olympus microscope (bx50) equipped with a color digital camera (dp10). The photographs were converted to gray scale and adjusted for brightness and contrast with corel draw (corel, ottawa, canada), and the plates composed with corel photo paint . Quantitative detection of gm - csf, ifn-, il-1, il-2, il-4, il-5, il-6, il-10, il-17, and tnf- was performed by using a flowcytomix mouse th1/th2 10plex (bms820ff) from bender medsystems which allowed to measure multiple analytes in a single 50 microliter aliquot of mice sera . In brief, microparticle beads were dyed with differing concentrations of two fluorophores to generate distinct bead sets . Captured analyte was detected using a biotinylated detection antibody and streptavidin - phycoerythrin (s - pe). A facscan flow cytometer from becton dickinson was used to acquire samples . For calculation of results, the mice that received repeated administrations of 2% dss and lower or absent levels of fr91 (groups 2 and 3) showed bloody stools during the second half of the experiment, (from the fifth week onwards), whereas no such internal inflammation feature was observed in the other mice groups . Macroscopically, we have identified numerous gross inflammatory polypoid lesions in mice of groups 2 (6/6; 100%) and 3 (5/6; 83.3%), mainly on the middle and distal portions of the colorectal segment, and very few were observed in group 4 (1/6; 16.6%). Remarkably, none of the mice group 5 (dss/20%fr91) showed any ulcer formation in the colorectal segment analyzed, as well as the treatment control mice group 1 (10%fr91) that was also free of colitic ulcerations . These macroscopical observations were confirmed by histological analysis of the intestinal morphology emphasizing the alterations regarding the integrity and inflammation of colonic mucosa and submucosa, dysplastic epithelium, and the presence of ulcers . This histological examination of transverse sections staining with h&e (figure 2) showed ulcers with moderate - to - severe morphological alterations (multifocal areas of inflamation in the submucosa or ulcers that covered large mucosal areas), mild - to - severe crypt hyperplasia (lining epithelium was two to three times normal thickness, marked hypercromasia of cells, and multiple crypts with arborizing pattern), epithelial dysplasia (alteration in the differentiation of epithelial cells that may progress to invasive carcinoma), and large affected areas of crypt loss . However, severity of these colorectal lesions differed significantly among mice groups, being the mice group 2 (dss) the one with a high severity level, while the mice group 3 (dss/5%fr91) showed a mild - to - moderate severe level, and the mice group 4 (dss/10%fr91) presented a few mild scattered lesions . No colitis characteristic lesions were observed in the colorectal segment of mice group 5 (dss/20%fr91) or in the treatment control mice group 1 (10%fr91), (figure 2), as described previously in the macroscopical exam . Histological scoring data obtained from the colorectal lesions examination are presented in table 1 . Immunohistochemical techniques used to identify cell markers of the colorectal lesions showed expression of catenin- (cellular adhesion regulator), bcl-2 (apoptotic regulator), mlh1 (dna - mismatch repair), apc, and p53 (tumour suppressor proteins) in all colonic mice lesions observed and described above . Catenin- antibody detected endogenous expression levels of catenin- protein mainly in the cytoplasm of adenocarcinoma and dysplastic cells . Intense catenin- expression was observed in the proximal and middle (figure 3(f)) colon of mice group 2 (dss) whereas a moderate - to - intense immunoreactivity was also observed in the colorectal segments (figure 3(k)) of mice group 3 (dss/5%fr91). Catenin--immunoreactive (-ir) cells were localized in the dysplastic criptal cells and adenocarcinoma cells, at the internal criptal layers (figures 3(f) and 3(k)). Colorectal portions of mice groups 1, 4, and 5 showed a weak or absent catenin--positive reaction in their cryptal cells (figures 3(a), 3(p), and 3(u)), considered as catenin- cellular basal expression . Bcl-2-ir and p53-ir cells were observed at colorectal portions of mice groups 2 (figures 3(g) and 3(j)) and 3 (figures 3(l) and 3(o)), showing an intense staining in adenocarcinoma and cryptal cells, particularly strong in mice group 2 . Immunoreactivity to bcl-2 and p53 was absent in colorectal section of mice groups 1, 4, and 5 studied (figures 3(b), 3(q), 3(v), 3(e), 3(t), and 3(y)). Strong staining mlh1-ir cells were observed at colorectal segments of mice groups 2 (figure 3(h)) and 3 (figure 3(m)), showing an intense staining in adenocarcinoma and cryptal cells of the dysplastic epithelium, particularly intense in mice group 2 . Mlh1-ir cells were absent in colorectal section of mice groups 1, 4, and 5 studied (figures 3(c), 3(r), and 3(w)). Apc immunoreactivity was intensely observed in all colorectal portions of mice groups 2 (figure 3(i)) and 3 (figure 3(n)) although cryptal cells of mice group 2 showed a stronger positivity . Colorectal portions of mice groups 1, 4, and 5 showed a weak apc immunoreactivity in their cryptal cells (figures 3(d), 3(s), and 3(x)). The incidence of colon lesions showed by these cell markers in the group 5 was 8.2% (4%), whereas it was 38.2% (6%), 33.3% (6%), and 20.4% (3%) in groups 2, 3, and 4, respectively (see figures 4 and 5). Similar histological incidence was observed in mice group 5 when compared with negative control group 1 (7.8%, 2%). Two - factor anova of data for each immunohistological markers in the colorectal portion showed significant differences among experimental groups 1/5 and 2/3/4, (figure 5). Group 5 was the most resistant mice group to dss - induced lessions in the colorectal portion, as indicated by the lowest value for each marker, similar to that observed in the control group 1 . Groups 2, 3, and 4 showed more susceptibility to dss - induced lessions, consistent with high values . Significant group differences were found between group 1/5 and 2/3/4 in dss susceptibility, being correlated with differences in the fr91 mean consumption per group . We next considered potential mechanisms which might underlie the colitis exhibited by dss treatment and the effect of fr-91 in the treated mice groups . As shown in table 2, dss treatment increased only the production of ifn- proinflammatory cytokine . No significant changes were detected in il-1, tnf-, il-6, il-10, and il-17 in both treated and untreated groups . More than 20,000 bioactive compounds synthesized by microorganisms have been identified, and over 10,000 of these secondary metabolites are produced by actinomycets, representing 45% of all bioactive metabolites discovered . Among actinomycetes, around 8,000 compounds are synthesized by streptomyces species . In addition, many of these compounds, such as anthracyclines (aclarubicin, daunomycin, and doxorubicin), peptides (bleomycin and actinomycin d), aureolic acids (mithramycin), enediynes (neocarzinostatin), antimetabolites (pentostatin), carzinophilin, mitomycins, and others [9, 10] have also been tested for the inhibition of chemically induced carcinogenesis in both in vitro and in vivo animal models . In the present study, we investigated the effect of fr91, a standardized lysate of microbial cells belonging to the bacillus genus which has been previously shown to have significant immunomodulatory effects tested on human tumor cell lines, on colonic inflammation induced by 8-week exposure of 2% dss in the drinking water and, in particular, whether fr91 affects colorectal inflammation . We found that the six - week treatment resulted in a slightly reduction of colorectal lesions at lower dosis (5% fr91) and a moderate - to - complete reduction at higher dosis (1020% fr91). Moreover, histopathological data showed that fr91 has no pathological effect on the morphological organization of the mice colon tissues, as observed when administering fr91 alone during the entire experimental study . The data obtained suggests that fr91 may be an important chemopreventive agent against intestinal inflammation in mice colon . In our experiment, we induced a wide range of colorectal lesions to better evaluate the effects of an anticancer agent (fr91) on chronic ulcerative colitis in mice . The repeated administration of dss as an inductor of ulcerative lesions in mice models of colitis was extensively reported [1318], being essential in advancing our understanding of the complex interactions between the environment, genetics, and epithelial barrier dysfunction in the human - related inflammatory bowel disease [1922]. In this study, the use of dss in drinking water during five weeks resulted in epithelial damage and a robust inflammatory response, obtaining a valid mice model acute injury colon to test an eight - week treatment with fr91, as reported in previous studies [2326]. Our results demonstrated that the optimal dose response was the 20% fr91 concentration tested in mice group 5, where no histological alterations or mild lesions were observed . Routinary histological staining [20, 23, 24, 27] and pretumoral cell markers [18, 20, 23, 28] used to evaluate the severity of lesions confirmed the protective effect of fr91 against the inflammation effect of dss . These pretumoral cell markers such as apc, p53, mlh, bcl-2, catenin-, and cytokines, among others, take part in the molecular pathogenesis pathway of chronical colorectal inflammation that has been reported to derive at further stages in the development of sporadic colorectal carcinoma and colitis - associated colon cancer [22, 2931]. The present results show the same significant interaction of these genetic markers in the pathologic characterization of the dss - induced lessions observed . As reported in similar studies, a dosis - dependent effect is normally associated with the chemoprevention process in dss - induced colitis [25, 26]. Therefore, we tested other lower fr91 concentrations in drinking water, obtaining gradual colorectal lesions as the fr91 concentrations decreased . Moreover, we also tested the effects of fr91 in mice during a large period of time (8 weeks), obtaining similar histological results as the nontreated mice, which indicates a chemopreventive action against carcinogenesis without interfering with healthy epithelial structures of the mice colon . Chemopreventive effects of a wide range of compounds on colonic tumors induced in mice have been reported previously, such as organosulfur compounds, n acetylcysteine, tetrandrine, phytosteryl ferulates, and dibenzoylmethane derivatives . The dss - induced lessions reported in these studies are similar to that observed in the preset work, where generally predominated in the midcolon [7, 35] and distal [24, 36] intestinal portions . These particular locations have been attributed to several factors such as the selective uptake of dss in certain colonic portions, the presence of weak intestinal barrier regions, and different distribution of macrophages populations along the mice colon . Although the real impact of these findings in the pathogenesis of ibd remains a controversial issue, as it is unclear whether they are primary or secondary factors involved in the regulation of the mucosal intestinal immune system, they can be considered as markers in the differentiation of groups of patients . In active ibd, an unbalance between regulatory and effector cells has been described, which mainly involves effector t cells (th1 and th2) and regulatory t cells (tregs, th3). Cd is associated with a th1 t - cell cytokine profile, including ifn-, tnf-, and il-12, whereas uc is associated with a modified th2 type response cytokine profile including il-15 and il-10 . In addition, these findings have been recently complemented by the discovery of the il-23/il-17 axis, that is, part of the effector t - cell immunological response and seems to be involved in ibd . Levels of expression of il-23 and il-17 are increased in patients with active ibd . Although specific determination of the fr91 metabolic action in the colitis prevention and treatment will require further investigations, we showed that fr91 prevented ulcerative lesions in mice models of colitis, inhibiting the development of colorectal tumors . Fr91 has proved to be an interesting and promising investigational agent for studying chemoprevention of carcinogenesis.
|
Diabetic retinopathy (dr) is a one of the most common microvascular complications of diabetes . In 2012, there are more than 371 million people suffering from diabetes, and it is being projected that the number of diabetic patients will reach 550 million in 2030 (http://www.eatlas.idf.org/; assessed 29-nov-2012). Diabetes can be generally divided into two types: type 1 (insulin dependent) and type 2 (insulin independent), although patients of both types will have hyperglycemia . A study reported that about one - third of the diabetic patients have signs of dr and about one - tenth of them even have vision - threatening retinopathy . Nearly 60% and 35% of dr patients progress to proliferative dr and severe vision loss in 10 years, respectively . Clinically, dr can be classified into nonproliferative (npdr) and proliferative (pdr). Npdr can be further graded into mild, moderate, and severe and is characterized by the presence of microaneurysms, hemorrhages, hard exudates (liquid deposits), cotton wool spots, intraretinal microvascular abnormalities, venous beading, and loop formation . Npdr may develop into pdr, where hallmarks of neovascularization of the retina and vitreous hemorrhage are found . Moreover, maculopathy, including macular edema and ischemia, can occur at any stage of dr; it accounts for the majority of the blindness due to dr . In fact, the growing number of diabetic patients and a longer life span in the aging population imply an increase in patients suffering from dr, which not only affects the quality of life of the individuals and their families but also increases the medical and economical burden to the society . As a consequence, effective therapy is urgently needed . In order to develop effective drugs, detailed understanding of the pathophysiological progression of dr is required . Over half a century ago, histological studies have been performed in postmortem retinas of diabetic patients . In retinal vessels and capillaries, selective endothelial and mural cells loss, presence of mural cell ghosts, endothelial clusters, acellularity, and microaneurysms were found to be increased in diabetic patients [4, 5]. Basement membrane thickening, presence of hemorrhage in the inner nuclear layer (inl), and outer plexiform layer (opl) as well as eosinophilic exudates in the opl were also reported . Nowadays, immunological studies evidenced an increased glial fibrillary acidic protein (gfap) expression in the mller cell processes throughout the inner and outer diabetic retina, suggesting that these cells were hypertrophied . There was also increased apoptosis in diabetic retina . Abu el - asrar et al . Further showed that proapoptotic molecules were expressed in ganglion cells, together with the activation of glial cells, which expressed several antiapoptotic molecules . Elevated vascular endothelial growth factor (vegf) immunoreactivity was found in retinal blood vessels in diabetic humans with preproliferative or no retinopathy, further consolidated the role of vegf in angiogenesis and vascular permeability . Alternation in other factors, including somatostatin, cortistatin, a and b - crystallins, advanced glycation end products (ages), and receptor for age (rage) as well as apolipoprotein a1 (apoa1), were also observed in the postmortem tissues . Somatostatin and cortistatin, which are neuropeptides with a very similar structure, were both downregulated in diabetic retinas, and their expression levels are inversely correlated with glial activation and apoptosis . On the other hand, upregulations of a-, b - crystallin, age, rage, and apoa1 in the diabetic retinal tissue were reported . These morphological studies provide a better picture, yet without the mechanistic pathway, of the pathogenesis of dr at a cellular level . Moreover, advanced technologies further allow us to study the mrna or protein expressions of various chemokines [1417], cytokines [1518], inflammatory markers [16, 19, 20], angiogenic factors [16, 17, 1921], and other factors [19, 22, 23] in aqueous humor, serum, or urine from diabetic patients, thereby predicting the pathological pathways of dr . With the aid of the sophisticated computerized equipments and technologies, clinicians would even be able to monitor or predict the progression structural lesion [2429] as well as functional defects [30, 31] in live patients with dr . Although a lot of important information or clues on the development of dr can be obtained from human studies, the mechanisms of dr development still cannot be elucidated . Emergence of animal models, therefore, not only enables us to have a more comprehensive understanding of the etiology of dr at a molecular level in a controlled manner, but also fulfills the need for drug screening tools . With these models, we may even be able to discover the early markers for dr in the body fluids from diabetic patients . This not only allows a faster and more convenient screening but also serves as an alarm for diabetic patients before the presence of cellular or functional lesion . Until now, many studies on the pathogenesis of dr have been carried out in animal models . A cascade of events, including oxidative stress, inflammation, protein kinase c (pkc) activation, accumulation of age and sorbitol, and upregulation of rennin - angiotensin system (ras) and vegf, contribute to retinal vascular endothelial dysfunction as a result of hyperglycemia . Based on the mechanistic studies, drugs targeting different molecules in the cascade are being developed . In order to evaluate the effect of the drug properly, reliable and appropriate animal models are required . Throughout the years, many animal models of dr have been developed; however, none of them can mimic the entire pathophysiological progression as observed in human . While most animal models only show the early symptoms of dr, some show the late stage proliferative angiogenesis . Researchers have to select an appropriate model or models which can compensate each other in order to address their research questions . In this review, we focus on the animal models of dr that researchers have used, briefly describe how the models were generated, highlight the morphological and functional changes in the retina, and finally discuss the strengths and weaknesses of each model . In general, mice have been routinely used in many in vivo studies since they are small in size and therefore easy to handle and inexpensive to house . Indeed, mechanistic studies of dr have been carried out extensively in mice as these models share similar symptoms of early dr as in human . More importantly, the availability of a collection of transgenic and knockout mice allows researchers to study the role of particular genes, which may even be cell type specific, in the development and pathophysiological progression of dr . There are three main types of mouse models to study dr; the first two involve mice with hyperglycemia development either via pharmacological induction or inbreeding of mice with endogenous mutation while the third type focuses on pathological angiogenesis found in transgenic animals or induced by experimental procedures, in mice without diabetes . Type 1 diabetes can be induced in mice by injection of chemicals, including streptozotocin (stz) and alloxan, both of which are toxic to and therefore destroy the -cells in the pancreatic islets . Stz - induced mice have been routinely used as a dr model in a lot of mechanistic studies and therapeutic drug testing for a long period of time owing to the abundant reports on the phenotypes . Depending on the injection dosage, the onset of diabetes can be achieved within a few days after injection in the wild - type animals, making it a popular diabetic model . Nevertheless, there are many variations in the injection protocol in terms of dosage, route of injection, and with or without insulin compensation that are usually based on the practice in individual laboratories; nonetheless, all mice end up with hyperglycemia in 1 to 4 weeks after stz injection . For an easy reference, a summary of dr studies using stz - induced mice in the past five years is presented in table 1 . This table aims to provide the researchers with a general idea of the appropriate dosage or injection method in mice of different age and/or with genetic background . Amongst these methods, intraperitoneal injection of single high - dose injection of 150 mg / kg and multiple low doses of 50 mg / kg for 5 consecutive days to c57bl/6 mice without insulin compensation are the standard protocols recommended by the animal models of diabetic complications consortium (http://www.diacomp.org/; accessed on 9-dec-2012). In the stz - induced diabetic mice, transient astrocyte activation as well as increased astrocyte number gfap upregulation in glial cells and reactive gliosis were also evidenced at the same time . Retinal ganglion cells (rgcs) are reduced starting from 6 weeks [34, 35] while thinning of inl and onl were observed at 10 weeks of hyperglycemia . Apoptosis of rgcs and vascular cells can be identified at 6 weeks and 6 months of hyperglycemia, respectively . Yet, some studies showed that there is no significant in ganglion cell death even after a long time, up to 9 to 10 months of hyperglycemia [3639]. Increased leukocyte number, together with leukostasis, was reported at 8 weeks of hyperglycemia . For vascular pathogenesis, upregulation of vascular permeability was being observed as early as 8 days of hyperglycemia, resulting in vessel leakage at 2 months . After 17 weeks of hyperglycemia, thickening of capillary basal lamina and neovascularization were reported . Acellular capillaries and pericyte ghosts were found in retina in mice after 6 to 9 [32, 37] months of hyperglycemia . Decreased retinal arteriolar and venular rbc velocities, retinal arteriolar and venular blood flow rates, and arterial velocity although decreased arteriolar and venular diameters were also reported in mice after 4 weeks of hyperglycemia, it is controversial in other studies . Functional defects were described in some electroretinography (erg) studies including decreased op3 and ops, prolonged implicit time of op2 - 3 at 4 weeks of hyperglycemia [49, 50]; decreased a - waves and b - waves at 6 months of hyperglycemia; and decreased pattern erg amplitude at 7 weeks of hyperglycemia . The variations in the above observations may be due to difference in mouse strains, stz dosage, or observation time points . Moreover, individual animals may be resistant to stz and fail in hyperglycemia induction; therefore, it is essential for the experimenters to confirm the blood glucose level of the animals and exclude those without hyperglycemia development . On the other hand, alloxan is less commonly used in mice, which may be due to the absence of the inducible cellular and vascular lesions associated with hyperglycemia . Morphologically, the dendrites of microglial cells were found to be shortened without any ganglion cell apoptosis after 3 months of hyperglycemia . At the same time functional abnormalities, however, were being reported in erg, in which b - wave amplitude [129, 130] and b / a wave amplitude ratio were found to be decreased at 3 weeks and 3 months of hyperglycemia, respectively . Nevertheless, cellular and vascular lesions are possibly detectable after a longer period of hyperglycemia as suggested by the presence of functional defects in this model ., the blood aldohexose concentration is elevated in the animal without affecting other metabolic abnormalities, such as alterations in concentrations of insulin, glucose, fatty acids, and amino acids . This allows the researchers to study the consequential retinal complications solely due to the elevation of hexose concentration . Galactose - fed mice have a longer life span than other diabetic models; therefore, an extended monitoring period of up to 26 months can be allowed [131133]. Endothelial cell loss and increased acellular capillaries were observed starting from 15 months of hyperglycemia . For a further 6 months of hyperglycemia, other morphological lesions including the presence of pericyte ghosts, saccular microaneurysms as well as basement membrane thickening of retinal capillaries were also evidenced [131133]. Amongst the mouse models currently available, the animals in this model have the least mortality at around 2 years old of age, which allows a longer period of hyperglycemia, and therefore phenotypes associated with increment of hexose concentration can be targeted . Researchers should be aware that it takes a relatively longer period of time to develop retinopathy in these mice, which in turn leads to a higher cost . Apart from injection or intake of chemicals, spontaneous hyperglycemia can be found in mice carrying endogenous mutation . By inbreeding the mutated mice with the wild - type animals, researchers can further expand the colonies and use them as mouse models for diabetes studies . Although breeding is a time - consuming process, further manipulations, such as injections and feeding with specialized chow, are avoided . Retinopathies in terms of morphological and functional lesions have been observed in a few type 1 and type 2 diabetic models, including ins2, nonobese diabetic (nod), db / db, and kka mice . In these animals, onset of hyperglycemia takes place spontaneously as a result of the presence of the transgene or mutation; a relatively consistent phenotype as well as a higher success rate in induction of hyperglycemia can be obtained . These mice carry a point mutation in the insulin2 gene, which causes a conformational change in the protein that accumulates in the pancreatic -cells, and ultimately leads to cell death . Cellular lesions, such as reactive microglia, are evidenced as early as 8 weeks of diabetes . By 12 weeks of onset of hyperglycemia, immunological studies showed abnormal swelling in somas, axons, and dendrites of rgcs, and the number of these cells was reduced in the peripheral region; while more dendritic terminals, increased total dendrite length, and greater dendritic density were observed in the on - type rgcs . It has been reported that the number of rgcs was significantly reduced in the peripheral regions after 22 weeks of hyperglycemia; yet, another study showed that there was no ganglion cell death in these mice even up to 10 months of hyperglycemia . Morphological change in astrocytes was also observed where they had short projections and became in less contact with the vessels . Moreover, the ipl and inl became thinner, which may be due to the decrease of the cholinergic and dopaminergic amacrine cells as evidenced in retina after 6 months of hyperglycemia . Vascular lesions such as increased of leukocyte number are already found in mice upon 8 weeks of hyperglycemia and retinal vascular permeability was increased in 12 weeks of hyperglycemia . The presence of acellular capillaries and neovascularization were described after 8 to 9 months of hyperglycemia . Abnormal vascular functions were also reported in a study which showed that the arteriolar and venular rbc velocity, shear rate, and retinal blood flow rate were significantly decreased in the diabetic animals with 26 weeks of hyperglycemia . A decrease of a- and b - wave amplitudes in the erg after 8 month indicates functional problem associated with the cellular defects or degeneration . Although the diabetic animals have an average life span of 305 days, they provide a stable induction of hyperglycemia while projecting the early and some of the late dr symptoms in human . Thus, this model could be very useful in drug screening, and it has received more attention in the field of dr . The nod mice are another model of type 1 diabetes, in which pancreatic -cells were destroyed via an autoimmune process by the cd4 and cd8 cells . The onset of hyperglycemia in these animals is 12 weeks of age, and the frequency of having hyperglycemia at the age of 30 weeks old is about 80% in female and less than 20% in male . Owing to the low induction rate and inconsistency in the male mice, female nod mice were commonly used . Using transmission electron microscopy, ultrastructural changes including apoptosis of pericytes, endothelial cells, and rgcs, perivascular edema, and retinal capillary basement membrane thickening were reported as early as 4 weeks of hyperglycemia, and these retinopathogeneses became more obvious after 12 weeks of hyperglycemia . At about 4 months of hyperglycemia, vascular abnormalities were described in the nod mice . Vasoconstriction or degeneration was observed in some of the major vessels, together with the presence of poorly defined microvessels and disordered focal proliferation of the new vessels . The presence of these vascular pathologies and the etiology of the development of type 1 diabetes in the nod mice are relatively similar to those of human, making this model unique . However, there is a big variation in the time of onset of diabetes; frequent and regular monitoring of the blood glucose levels is therefore required . More importantly, since female animals were used in these studies, estrogen, which plays a role in regulation of metabolism, may have a protective function in dr . This further complicates the mechanistic studies or contributes unknown effects in drug screening, thereby affecting the accuracy . The db / db mice spontaneously develop type 2 diabetes owing to the deficiency in the leptin receptor . Hyperglycemia and obesity were observed in the homozygous mice at 4 to 8 weeks old . Reduction of rgc number and thickness of the central total retina, inl, and photoreceptor layers were identified in the histological sections of mice after 6 weeks of hyperglycemia . After 18 weeks and 13 months of onset of hyperglycemia, pericyte loss and glial reactivation were reported, respectively . Vascular lesions including capillary basement membrane thickening, the presence of acellular capillaries, increased vessel density in the inl, and vessel leakage were observed in the diabetic retina . Compared with other mouse models, the reported glial reactivation and vessel leakage occurred relatively late in db / db mice, which could be explained by a relative late time point chosen in a long - term study . The use of db / db mice to study dr is not very popular, potentially due to a low birth rate resulting from the unsatisfactory mating performance in the male homozygotes and failure to reproduce in the female homozygotes (http://jaxmice.jax.org/; accessed on 15-dec-2012). Kka mouse is a combined model made by the introduction of the yellow obese gene, a, into the kk mouse, in which moderate diabetic traits are thought to be inherited by polygenes . These mice spontaneously develop diabetic characteristics, such as hyperglycemia, hyperinsulinemia, and obesity, at around 6 to 8 weeks of age, but revert to normal at the age of 40 weeks . Of the limited dr studies using this mouse model, increased apoptosis of the retinal neuronal cells was found in the rgc layer and the inl in mice after 4 weeks and 3 months of hyperglycemia, respectively . Owing to the limited retinopathologic findings and the uncertain etiology of this model, this model is not popularly used in dr studies . In order to compensate for the lack of proliferative pathogenesis in the retinal vasculature in most of the above diabetic mouse models, researchers developed a number of nondiabetic models, which allow them to specifically target neovascularization in the ocular region . When using these models, however, researchers should be aware of the fact that the etiology of the progression of vascular abnormalities is different owing to the absence of classical systemic characteristics as seen in diabetes . Proliferative retinopathy can be achieved mainly from two approaches: the first one is via introduction of ischemia to the eyes, such as oxygen - induced retinopathy (oir) and retinal occlusion; the second one is by direct injection or genetically induction of the angiogenic factor, vegf, into the ocular region . Owing to the presence of neovascularization, this model is also adapted for studying the angiogenesis as seen in proliferative dr . In brief, postnatal day 7 (p7) neonatal mice were put into a 75% oxygen chamber for five days and then returned to room air [151, 152]. Vessel loss in the central area of retina, which is associated with hypoxic challenged, is observed immediately at this time . Neovascularization extending from the inner retina into the vitreous begins at two days after the return to room air, peaks on p17, and is gradually regressed and spontaneously resolved by p25 . A comprehensive study was carried out in this model, in which mice at p18 were analyzed . The total retinal thickness was reduced in the midperipheral region, while the ipl and the outer segment length were reduced in the central and midperipheral regions . The number of vessels was also reduced in the ipl in the central region; and in the deep plexus in the central and midperipheral regions . Retinal function was examined by erg, in which reductions in the amplitudes of a - wave, b - wave, op3, and op4, and delayed b - wave implicit time were revealed . Mouse oir model showed a number of vascular, neuronal, and glial changes in the retina; however, the spontaneous regression of the neovascularization within a week confines its application in therapeutic drug research . Since dr can also be considered as an ischemic disorder in the retina, retinal occlusion models, such as unilateral ligation of pterygopalatine artery (ppa) and external carotid artery (eca), branch retinal vein occlusion, and elevating the intraocular pressure (iop), were also applied in studies of vasculature abnormalities . In these occlusion models, increased apoptotic cells, reduced thickness of retinal cell layers, reduced a - wave, b - wave, and ops amplitudes of the erg were evidenced . Nevertheless, the acute induction of ischemia, particularly those followed by reperfusion, to the retinal tissue makes these models less appropriate for studying dr, in which chronic ischemia is persistently involved . Kimba (trvegf029) is a transgenic mouse model of neovascularization, as a result of transient overexpression of human vegf165 in the rhodopsin - expressing cells with which it peaks at p10 to p15 and declines at p20 . Characterization studies have been carried out as early as at p7 . At that time, reduced thickness of the rgc layer, inl, outer nuclear layer (onl), and the total retinal layer was observed . By p28, such reduction was found in ipl, the outer segment, and the total retinal layer . Vascular leakage was also observed at p28, but it ceased at 9 weeks of age potentially due to the absence of over - expression of vegf . Increased adhered leukocytes were found in veins and capillaries, together with increased acellular capillaries by 6 weeks of age . Topological and fractal analysis of retinal vasculature showed that vessel - covered area, vessel length, and crossing points in the 9-week - old kimba mice were reduced . Varied degrees of the pathogenesis were being reported, which were separated into two groups based on the assessment of fundus fluorescein angiography . This transgenic mouse is not commercially available, it is not a popular model in dr . In order to generate an ideal mouse model to study dr, a new mouse model of dr was created by crossing the kimba mice with the ins2 mice, named akimba . These mice inherit the key systemic diabetic phenotypes from their parental strains, making it a unique model . At 8 weeks of age retinal edema and reduced photoreceptor layer thickness, together with retinal detachment, were observed . Abnormal microvasculature, including microaneurysms, capillary dropout, hemorrhage, neovascularization, venous loops, vessel tortuosity, vessel beading, vascular dilatation, and vascular leakage, were also evident in mice of 8 weeks old, although the leakage stopped by 20 weeks of age . The akimba mouse model displays a number of vascular changes; however, more complete mechanistic studies are essential before its utilization in therapeutic drug studies . A summary of the earliest reported morphological and functional lesions in different mouse models of dr is shown in table 2 . Although rats have a slightly bigger size than mice, they are still easy to handle with a low cost of maintenance, making them to be another popular animal frequently used in in vivo studies . The use of rats in dr study is particularly common owing to a relatively larger tissue size, with which functional assessment and morphological and molecular analyses can be done . Similar to dr studies in mice, three types of rat models were used; these include pharmacological induction of hyperglycemia, spontaneous diabetic rats, and models of angiogenesis without diabetes . A summary of the morphological and functional lesions in different rat models of dr is shown in table 3 . Similar to mice, hyperglycemia can be induced in rats by injection of stz or alloxan or by ingestion of galactose . Compared to mice, rats are more susceptible to the toxicity of stz; therefore, usually a much lower dosage of stz is used . In order to minimize the mortality, insulin complementation table 1 summarized most of the induction method of stz in the past 3 years and served as a reference for the researchers to select the most appropriate dosage, injection paradigm, and rats with different genetic background for their studies . Amongst the methods, a single dose of 6065 mg / kg of weight is the most popular one . Variation of the retinal lesions was reported, which can be explained by the genetic background . Indeed, a comparative study showed a strain difference in the rate of developing early dr symptoms in rats upon stz challenge . After 8 months of hyperglycemia, lewis rats displayed accelerated degeneration of retinal capillaries and rgc loss, whereas wistar rats only showed the capillary degeneration and sprague - dawley (sd) rats showed no morphological defects to a significant level . Increased apoptotic cells after 1 month of hyperglycemia, the number of astrocytes in the peripheral region was reduced; however, the number of mller cells and microglial cells is increased [160, 161] with the accompany of microglial hypertrophy . The density of astrocyte was further reduced in the central region, together with the reduction of astrocyte processes in the peripheral region after 6 weeks of hyperglycemia . Decreased total retinal thickness, as well as decreased number of cells in the rgc layer, the onl, and the inl was also reported . Regarding the vascular changes, blood - retinal - barrier (brb) breakdown was evident at 2 weeks of hyperglycemia [161, 163]. Increased adherent leukocytes and arterial or venous capillaries basement membrane thickening retinal function was affected from 2 weeks after the onset of hyperglycemia as reflected by the erg . Reduced b - wave, ops, and a - wave amplitudes were progressively found at 2 weeks, 8 weeks, and 10 weeks of hyperglycemia . At around the same time, morphological and functional studies suggested that stz - induced diabetic rats only showed early dr symptoms, which is comparable to those in stz - induced mice . The use of alloxan in dr studies is not very common nowadays, and the existing morphological studies were mainly focused on the vascular lesions . Neovascularization was already observed from 2 months of induction of hyperglycemia starting from the midperiphery region and progressing to the whole retina after 9 months of hyperglycemia . Extravascular macrophage accumulation and capillary endothelial cells swelling were also identified after 2 months and 5 months of hyperglycemia, respectively . By 8 months, increased cell death in the retinal microvasculature was evident . Acellular capillaries, basement membrane thickening, and pericyte loss were also reported upon 12 months of hyperglycemia . Nevertheless, appearance of the lesions varied between studies; it would be due to the different time points selected by the authors or different dosage of alloxan being injected . Reported lesions with the earliest onset similar to mice, dr can be studied in rats fed with galactose, with the equivalent advantage of longer life span [172, 198]. Other vascular lesions, such as acellular capillaries and basement membrane thickening as well as pericyte loss, were observed after 12 months of feeding with galactose . A long - term study demonstrated cellular lesions, including gliosis and disruption of retinal layers, together with vascular abnormalities, capillary dilation and microaneurysm formation in the inner plexiform layer (ipl) and the inl, in rats fed with galactose for 28 months . Owing to the differences in galactose concentration and time points selected by various studies, the earliest onsets of the lesions were listed in this review . These include type 1 diabetic model: biobreeding (bb) as well as type 2 diabetic model: wistar bonn / kobori (wbn / kob) rats, zucker diabetic fatty (zdf) rats, otsuka long - evans tokushima fatty (oletf) rats, nonobese goto - kakizaki (gk) rats, and nonobese spontaneously diabetic torii (sdt) rats . Like nod mice, the bb rats spontaneously develop polygenic autoimmune type 1 diabetes, in which the pancreatic -cells were selective destroyed [175, 199]. After 4 months of hyperglycemia, absence of infolding and derangement of the basal plasma lemma of the rpe were also observed . The number of pericyte and the pericyte to endothelial cell ratio were reduced [174, 175] after 8 months of hyperglycemia . Lesions associated with the retinal microvasculature, including capillary dilation and basement membrane thickening, were found from 2 months and 4 months of hyperglycemia, respectively . Microinfarctions with areas of nonperfusion were evident whereas no neovascularization was detected up to 11 months . Several inbred and outbred lines, such as bb / wor, bb / e, and bb / ph, have been produced and named based on the origin of the breeding colony . Since genetic variations and potential differential phenotypes the wbn / kob rats are a type 2 diabetes model owing to endo - exocrine pancreatic insufficiency, and only male offspring develop diabetic symptoms . Retinal degeneration was already observed before the animal becomes hyperglycemic at around 9 to 12 months of age . Thickness of outer segments and onl was reduced in wbn / kob rats at 5 months of age whereas high blood glucose was evident in these rats at 10 months old . About 2 months after becoming hyperglycemic, these rats also showed reduction in the visual cells, the opl, and the total retinal layer . Vascular lesions were also identified, and capillaries clustered into small tortuous knots after about 1 month of hyperglycemia . After 5 to 6 months of diabetes, capillary basement membrane thickening, increased capillary loop, and reduced number of capillary were also observed . After a prolonged hyperglycemia of 12 months, some rats showed increased proliferation of fibrovascular element in the vitreous, intraretinal neovascularization, and hyalinization of intraretinal vessels . Wbn / kob rats, which display the symptoms of the progressive dr, may serve as a model for testing therapeutic drug targeting angiogenesis . However, the early onset of neuronal degeneration (before hyperglycemia commencement) suggests that the etiology of retinal degeneration may not be the same as that in human; therefore, further studies need to be carried out before this can be used as a model for dr . They carry an inherited obesity gene mutation, which results in impairment of glucose tolerance and insulin resistance (http://www.criver.com/sitecollectiondocuments/zdf.pdf; accessed on 19-nov-2012). Excessive body weight gain was observed in male zdf rats in the first 6 months of life, but the weight decrease to a level similar to the lean controls afterwards . Hyperglycemia starts at 6 to 7 weeks of age and maintains high throughout their life . Thickening of the capillary basement membrane and increased capillary cell nuclear density were reported in rats after 5 months of hyperglycemia [180, 181]. Apoptosis of endothelial cells and pericytes was higher in these rats compared to the lean controls, together with an increased number of acellular capillaries and pericyte ghosts upon 6 months of diabetes . Retinal functional analysis and long - term morphological studies of the retinal neuronal and glial cells of these rats remain to be elucidated . Another type 2 diabetic rat model is oletf rats; they significantly gained more weight from 1 to 6 months of age, but they lost weight from 9 to 10 months of age . Elevated blood glucose was observed from 5 months of age and it maintained high [182, 183]. After about 6 months of hyperglycemia, despite no significant difference in the number of acellular capillaries and pericyte ghosts, oletf rats with 9 months of hyperglycemia showed reduced ratio of pericyte area to the total capillary cross - sectional area and damaged endothelial cells . By 14 months of hyperglycemia, the inl and the photoreceptor layer became thinner, accompanied with shortening of the rpe height and poorly developed basal infoldings . Relatively early microvessel - related symptoms were reported in these rats, in which leukocyte entrapment was evident in rats after 6 weeks of hyperglycemia . Other abnormalities, including thickening of capillary basement membrane, tortuosity, microaneurysms, loop formation in capillary, caliber irregularity and narrowing of arteries, were also described in rats after 9 to 12 months of diabetes [182, 183, 185]. No hemorrhages, emboli, and exudates were found in these rats up to 14 months of diabetes . Moreover, erg revealed that oletf rats fed with sucrose for 8 weeks had a prolonged peak latency of ops . The absence of acellular capillaries as well as the late onset of diabetes and the related symptoms diminished the popularity of using this model to study dr . The gk rat is a spontaneous model of non - insulin - dependent diabetes without obesity . These rats are originated from normal wistar rats and they were selected via repeated inbreeding exercise using glucose intolerance as a selection index [186, 204]. Rats at 46 weeks of age develop hyperglycemia [186, 187]; they also showed reduction of retinal segmental blood flows and prolonged retinal mean circulation time after 1 month of hyperglycemia . Increased brb permeability and endothelial / pericyte ratio were also evident in 3 months and 7 months after the onset of hyperglycemia owing to the limited publications on the retinopathology in the gk rats, further characterizations on the non - vascular - related lesions need to be performed . The sdt rat, which is a substrain of the sd rat, is another model of nonobese type 2 diabetes . Glucose intolerance and impaired insulin secretion were demonstrated in the male sdt rats at 14 weeks, followed by hyperglycemia and glucosuria at 5 months of age . These rats showed a sexual differentiation in the development of diabetes that the cumulative incident is about 100% in males at 40 weeks of age and only about 33% in females up to 65 weeks of age [190, 205]. Retinal dysfunction was observed after 4 weeks of hyperglycemia, as evident by delayed peak latency of the ops . The amplitudes of a - wave, b - wave, and ops were significantly reduced with prolonged implicit times at 24 weeks of hyperglycemia . At the same time, leukostasis and the number of apoptotic cells in the gcl and the inl were increased in the retinas of sdt rats . Vascular lesions, such as acellular capillaries and pericyte loss, have been described by kakehashi et al . . Advanced lesions, including leakage of fluorescein around the optic disc as well as distortion of retina and protruded optic disc, were also observed after 48 weeks of hyperglycemia . More importantly, a few studies showed that proliferative dr can be detected in some of the aged sdt rats, which have been exposed to hyperglycemia for more than 48 weeks [190, 191, 205, 206]. The reported symptoms include retinal hemorrhages, tortuous vessels, capillary nonperfusion, neovascularization, and tractional retinal detachment with fibrous proliferation . Amongst the diabetic rat models mentioned in this review, the sdt rat is the only one that shows severe ocular complications similar to those seen in human . Although some common phenotypes in human dr, such as microaneurysms and development of avascular area, are rare in this model, this is a unique model to study proliferative dr [205, 207]. Similar to the mouse models for studying angiogenesis, oir and occlusion models were also applicable to rats . Owing to the relevance of ischemic - induced neovascularization, we will focus on the oir in this section . The basic principle of oir in rats is very similar to that in mice, which involves the induction of neurovascularization in nondiabetic animals . Different from the standard protocol of oir in mice, several paradigms with varied oxygen concentrations and duration of the exposure period have been applied in rats . In brief, the newborn pups are exposed in alternative hyperoxia - hypoxia cycles for 11 to 14 days and then returned to room air [194, 195, 208210]. Peripheral astrocyte degeneration was observed soon after the rats were exposed to room air . At p18, the number of astrocyte was reduced almost throughout the whole retina with prominent mller cell reactivity in the regions that are devoid of intraretinal blood vessels . Reduction of thickness in the inl, the ipl, and the total retinal layers was evident; the outer segment layer also became thinner and disorganized . While the number of pericytes was comparable to the room air control, the pericyte - endothelial interactions were impaired . Intravitreal neovascularization, incomplete development of the outer vascular plexus and extension of the abnormal endothelial functional lesions were also studied using erg, in which the a- and b - wave amplitudes were reduced . This model is useful in therapeutic drug screening or in the study of the mechanisms in angiogenesis, yet special equipments are required . Moreover, strain - dependent difference in the degree of retinal vascularization and abnormalities in vascular morphology have been reported . The albino sd, the pigmented dark agouti, and hooded wister rats were more prone to the hyperoxia - hypoxia challenge, and they showed severe vascular attenuation following the oxygen exposure as well as severe vascular pathologies when compared to other strains . In summary, rodents are very popular models to study the pathogenesis and examine the efficiency of therapeutic drugs of dr in laboratories . They have the advantage of being small in size which allows easier handling; however, this also makes in vivo examinations, such as fundus photography, fundus fluorescein angiography, and optical coherence tomography, difficult . Despite the lack of proliferative dr symptoms as described in most of the models mentioned above, researchers also focus on other animals in order to obtain the most representative model of dr, which ideally displays the comparable dr symptoms as seen in human patients . Higher mammals not only can serve as a platform for easier examinations but also allow easier treatment particularly those involving sophisticated surgical procedures . In these animals, sampling of body fluid, for example, vitreous and blood, can also be performed routinely . Similar approaches have been applied to rabbits to induce dr; these include pharmacologically induced and dietary - induced diabetic models as well as vegf - induced angiogenesis in the retina without affecting the blood glucose level . Hyperglycemia can be induced in rabbit by stz, although this method is not very frequently used . A study showed that intravenous injection of stz (100 mg / kg) in rabbits can elevate their blood glucose level . Fundus examination was done after 19 weeks of hyperglycemia and all eyes showed certain degree of retinopathy, of which 50% showed proliferant retinopathy; 40% showed serious vasculopathy with serious retinal and preretinal hemorrhages, vascular lesions, hemovitreous and venous thrombosis; and the remaining 10% showed moderate vasculopathy with hard or soft exudates and widespread hemorrhages . Early dr can be found in rabbit models of diet - induced impaired glucose tolerance plus hyperlipidaemia . Rabbits were fed with standard chow with 10% lard, 40% sucrose, and 0.10.5% cholesterol for a period of 24 weeks . The blood glucose level slightly elevated in the animals after feeding with 12 weeks of the special diet, and they became hyperglycemic by the end of the study period . Histological findings suggested that increased microaneurysms and hyperfluorescent dots were already present before the rabbit becomes hyperglycemic, while those pathological symptoms further progressed with prolonged feeding . Although this model mimics the natural development of type 2 diabetes in human, the drawback is the slow progression of dr symptoms . In brief, a polymeric pellet containing human recombinant vegf was implanted into the vitreous cavity of the rabbit . After 7 days of implementation, increased dilation and tortuosity of retinal vessels were observed . During 14 to 21 days after implementation, fluorescein angiography further showed profuse leakage of dye, together with the presence of numerous small tortuous blood vessels, suggesting induction of neovascularization . However, such vascular changes stopped afterwards and neovascularization almost totally regressed after 35 days of implementation . The authors suggested that the regression of vessels may be due to depletion of the vegf, implying that choosing the experimental endpoint is crucial when screening therapeutic agents in this model . Therefore, another group generated a similar model, in which human recombinant basic fibroblast growth factor (bfgf) was also incorporated into the polymeric pellet besides the human recombinant vegf . In this model, similar retinopathologies were observed but they only required approximately half of the time to develop when compared with the vegf - induced model previously described . In addition, hemorrhage from the new vessels and even total traction retinal detachment were also observed . Moreover, differential retinal angiogenic response to vegf / bfgf was reported in different rabbit strains, where dutch belt rabbits are more susceptible than the nzw / black satin cross rabbit . It is evident that vascular retinopathy could be observed in the rabbit models mentioned above; however, researchers should be aware of the fact that retinal vasculature in the rabbit differs from those in other species . In rabbit, the optic artery branches into major blood vessels in a bidirectional horizontal manner; they further arborized into capillaries, forming a ring - like network . Moreover, the visual streak of rabbit is located below this region; functional defects may not be able to be detected if the lesion site is in the medullary ray where the blood vessels are . As compared with other animals, such vascular system is only present in a small area of the retina in rabbit; therefore, the global deleterious contributions by the vessels may be underestimated . On the other hand, if researchers aim to study the vessel - to - cell interaction at a molecular level, this model provides an alternative choice with an additional advantage of a bigger eyeball size than rodents . Therefore, more precise and delicate experiments can be performed, but the problem of limited housing space needs to be attended to . The majority of the dr studies in cats are induced by pancreatectomy with or without alloxan injection . The animal will become hyperglycemic 1 to 2 weeks after the surgery [216218]. Capillary basement membrane thickening was first described from 3 months of pancreatectomy, where no change was observed in the number of endothelial cells and pericytes as well as the contacts between endothelial cells and pericytes up to 10 months . A case report showed that microaneurysm was first observed in one eye in a diabetic cat after 5 years of pancreatectomy; and by 6.5 years, both eyes showed microaneurysms and small intraretinal hemorrhages in the area centralis . Region of capillary nonperfusion and intraretinal microvascular abnormalities (irma) were also evident from 7.5 years . At 8.5 years, presence of small foci of neovascularization was suggested . Cotton - wool spots, venous beading, extensive preretinal neovascularization, or microvascular changes were not found in the peripheral retina . On the other hand, another study showed that only one out of two experimental diabetic cats showed microaneurysms, but not hemorrhages or area of nonperfusion, after 7 years of pancreatectomy, while the other diabetic cat did not show any microaneurysm or hemorrhage in the retina . Cats only showed mild cataracts upon diabetes, thereby allowing visualization of the fundus angiography and erg . However, the studies of dr in cat are very limited and the described phenotypes are less consistent . A long follow - up period for the development of retinal pathology and lack of reagents in molecular studies may be the drawbacks for using this animal model . Attempts of using dogs for studying dr have also been made, in which most of them are about inducible hyperglycemia either by injection of stz or alloxan or feeding the animals with galactose . It has been suggested that galactose - fed dog is the animal model that shares the retinal lesions morphologically and clinically as those developed in human diabetic patients . Induction of diabetes in dogs by intravenous injection of stz and alloxan resulted in basement membrane thickening in 3 years of injection, and it was recognized in some vessels from the first year . Loss of pericytes and smooth muscle cells was observed in the retinal arterioles from 4 years of postinjection; no microaneurysm was noted towards the end of this 5-year study . Moreover, a comparative study showed that increased microaneurysms, acellular capillaries, pericyte ghosts, endothelial cells to pericytes ratio, and basement membrane thickening were evident in the dogs after 5 years of galactosemia than those of alloxan - induced diabetes . In the galactose - induced dr model cellular lesions such as presence of pericyte ghosts and uneven distribution of endothelial cells were observed in retina of dogs after feeding with galactose for 19 and 24 months, respectively, followed by the formation of microaneurysms [222, 223]. Dot and blot hemorrhages were found from 33 months, which became more confluent, progressing to the preretinal and intravitreal regions after 66 months of feeding . Nonperfusion was evident in dogs from 37 months of feeding [223, 224], and the area was broadened with time . After 36-month feeding of galactose, acellular capillaries and endothelial cells to pericytes ratio were increased . Other vascular lesions, such as abnormalities in intraretinal microvessels, occlusion of arterioles, presence of large arteriovenous shunts, and node formation on arterial and arteriolar walls, were also reported after feeding for about 5 years . At about the same time, presence of soft exudates and gliosis in the nerve fiber layer was reported . Further advanced retinopathy of neovascularization was described in dogs being galactose fed for 68 to 84 months [222, 224]. It has been suggested that the onset of dr symptoms is age dependent in galactose - fed dogs; younger animals develop dr symptoms earlier than the older ones . The biggest advantage of using dogs as a model is that they develop similar retinal morphological lesions as compared with human . Routine in vivo vasculature assessments, however, were impeded owing to the spontaneous diabetic cataract, particularly in the galactose - fed model; additional lensectomy is necessary [219, 223, 224]. Moreover, high maintenance cost, long - term follow - up period, and lack of molecular reagents, such as antibodies, make this model less commonly used for studying dr . Pig eye has become a useful tool in eye research because of its close similarities in the size as well as the basic retinal structure and vasculature to the human eye . A number of models have been generated in order to study the retinopathy in swine upon diabetes, which include alloxan- and stz - induced type 1 diabetic models . There is also a recently developed model of proliferative vitreoretinopathy that involved surgical procedures and intravitreal injection of retinal pigment epithelial (rpe) cells . There are only limited reports on the retinal morphology of the chemically induced diabetic pigs . Instead, researchers make use of the large amount of specific retinal cells and vitreous available in the pig eyes for in vitro experiments [227, 228]. Nevertheless, reactivation of mller cells was evident from the increased gfap immunoreactivity from the onl extending to the outer limiting membrane in 2 to 3 months after onset of alloxan - induced diabetes . At around 4 months of hyperglycemia, pericyte degeneration in parallel to reduced the total number of brb capillaries and capillary collapse were also observed . Retinal vascular lesions, such as basement membrane thickening [230, 231] and rarefaction, were reported in pigs after 18 weeks of stz - induced diabetes . Development of hyperglycemic cataract was also reported in this animal after 32 weeks of hyperglycemia that constrain the visualization of the vasculatures, such as fundus angiography . Recently, a new swine model of proliferative vitreoretinopathy has been described . In brief, vitreal and retinal detachments were initially induced by vitrectomy and injection of subretinal fluid, respectively, prior to injection of cultured rpe cells into the vitreous cavity . Formation of contractile membranes on the inner retinal surface as well as localized tractional retinal detachments was evident and maintained after 14 days of induction while the retina reattached in the control animals at 3 days after the surgery . Further characterization of this model needs to be carried out before its use in therapeutic drug screening . Although pig is a valuable model for disease study in human, high maintenance cost, requirement of special housing facilities, and lack of biochemical reagents make this model less commonly being used . Monkey, a nonhuman primate, is considered to be a potential model in eye research owing to its structural similarity to human and, in particular, the presence of macula . The studies of dr in monkey can be divided into 3 groups: type 1 diabetic model, type 2 diabetic model, and model of vegf - induced neovascularization . In an attempt to produce dr in monkeys, monkeys with type 1 diabetes that developed spontaneously as well as that resulted from total pancreatectomy or stz injection were being used . Unexpectedly, 37 out of 39 of these monkeys did not show any significant dr within 5 years of hyperglycemia . Animals with hyperglycemia of 6 to 15 years only showed mild disruption of the blood - retinal barrier . On the other hand, spontaneous or pharmacological induction of hypertension in the hyperglycemic monkeys, either by stz injection or with spontaneous diabetes, resulted in ischemic retinopathies, such as cotton - wool spots which were found in the peripapillary region, microaneurysms, capillary dropout, capillary dilatation, focal intraretinal capillary leakage spots, arteriolar and venular occlusions, and atrophic macula, between 6 and 15 years of diabetes . The authors suggested that the fluctuating blood glucose levels and systemic blood pressure, but not hyperglycemic alone, play a role in the pathogenesis of dr . Dr studies have also been carried out in monkeys that spontaneously develop type 2 diabetes . While moderate retinal lesions can be identified in a case of monkey with 3 years of diabetic history, no detectable retinopathy was reported in a monkey with 15 years of diabetes . The presence of these lesions was variable in individual animals, making it hard to deduce the precise onset of symptoms based on the diabetic duration . Among those showing retinopathies, cotton - wool spots, intraretinal hemorrhages, and nonperfused areas were the early observations . Progressive lesions, such as growing nonperfused area, which are associated with the formation small irmas and microaneurysms, as well as macular edema were also evident . Similar observations were also reported in another case study in which the subject is a monkey with at least 5 years of diabetes . The authors have mentioned other histological abnormalities, including reduction of the thickness of the onl and the inner and outer segments of the photoreceptor layers . Functional lesions were suggested by a loss in the amplitudes in the multifocal erg, and they were virtually correlated to the nonperfused areas . Progressive reduction of amplitudes and delayed a - waves were also observed in the dark - adapted ganzfeld erg, suggesting a loss of function in the both inner and outer retina and reduced sensitivity in the photoreceptors, respectively . Moreover, it is reported that the occurrence of retinopathy is correlated with hypertension, which is coincidently similar to the descriptions in the type 1 diabetic monkey model . Vegf - induced proliferative retinopathy has also been carried out in nonhuman primates . In brief, a pellet containing human recombinant vegf was implanted into the vitreous cavity of the animal . At 2 weeks after the implementation, severe brb breakdown was noted . Apart from the variations in the onset of morphological abnormalities and the absence of advanced retinopathies, low birth rate, high cost, long duration of study, and the heightened ethical concern make this model unfeasible for the purpose of drug screening . Despite the enormous ethical concern in the laboratory use of the mammals mentioned above, in particular the primates zebrafish is extensively used in the study of visual development and impairments owing to its similarity to those seen in human . The distinctive pattern of the mammalian retinal cell layers, ranging from ganglion cell layer to retinal pigment epithelium, is observed in zebrafish . Blood supply to the retina is supported by the optic artery, which branches into four to nine major blood vessels . These vessels further arborize into smaller vessels towards the peripheral of the retina where anastomosis between the neighboring capillaries is present . This radial vascular network covers the entirely inner surface retina with direct contact with the gcl . Oxygen - deprived blood is collected in the circumferential vein surrounding the retina where the cilliary marginal zone is . Dr can be studied in zebrafish via direct elevation of glucose in the surrounding as well as angiogenesis without the involvement of glucose . In brief, zebrafish was exposed to freshwater with alternation between 2% and 0% glucose in every 24 hours for 30 days . Hyperglycemia can be achieved in the animal in 1 day of immersion in the 2% glucose freshwater and maintained for at least 30 days with repeated hyperglycemic spikes every time after the removal from the glucose - freshwater . After 28 days of persistent hyperglycemia, the thickness of the ipl was significantly decreased, and yet no other abnormality has been observed . The mechanism of glucose uptake in zebrafish is regulated by osmoregulation, in which influx of water, together with glucose, goes into their body as a result of high internal salt concentration . It has been reported that teleosts also have endocrine islet tissue containing hormone - producing cells which converge in the fish body, and the secretory teleost insulin is functional and is homologous to the human insulin . This further validates the potential use of glucose - induced diabetic zebrafish in studying the retinopathy . Yet two models to study angiogenesis in zebrafish are described below, namely, environmentally and transgenic - induced models . Retinal neovascularization can be achieved by keeping the zebrafish in hypoxic aquaria where the air saturation is gradually reduced to 10% (820 bbp) over a course of 48 to 72 hours and maintained for 12 days [240, 241]. In these studies, fli - egfp - tg zebrafish, which is a transgenic line that overexpresses egfp in the vascular endothelium, after 12 days of hypoxic challenge, neovascularization was observed in the retina evident by increased number of branch points, sprouts, and vascular area as well as reduced intercapillary distance . This model can be useful for studying the development of angiogenesis or possibly for screening antiangiogenic pharmacological agents . Zebrafish carrying vhl mutation displays an upregulation of hypoxia - inducible factor, which in turns triggers vegf production and expression of the vegf receptors . By 5.75 days after fertilization (dpf), increased hyaloids and choroidal vascular networks were observed, followed by vascular leakage at 7.25 dpf . Excessive blood vessels were evident in the ipl, together with severe macular edema and retinal detachment at 7.5 dpf . However, this model is not commercially available, which limits its use in the field even though severe neovascularization and proliferative retinopathy are observed . Zebrafish is very small in size; therefore, its maintenance is simple, convenient, and inexpensive . They have a short life span and a large breeding size, which in turn allow a shorter experimental turnover time . Moreover, a number of studies showed that genes of interest can be specifically induced, deleted, or overexpressed in zebrafish, allowing mechanistic studies of diseases . As a consequence, researchers have developed certain zebrafish models in order to study dr, including glucose - induced diabetic model and models specifically of angiogenesis . However, the retinal cells layers differ in thickness and thereby the number of cells, the findings may under- or overestimate the contribution of a specific cell type in regard to the pathogenesis of dr . In terms of the vasculature in zebrafish, the growth of the tertiary plexus of blood vessels in the inl is absent and the venous system is different from those in human . Therefore, researchers should be aware that using zebrafish may lead to potential discrepancy in cellular and vascular aspects and may not truly reflect the pathological development of dr in patients . Moreover, owing to the limited supply of tissue from a single animal, skillful techniques and a large quantity of eyeballs are required in dissection and for molecular analysis . A summary of the temporal morphological and functional lesions of the animal models, other than rodents, described above is shown in table 4 . Animal models are very important in understanding the pathogenesis of diseases in human, defining novel therapeutic targets as well as screening of novel therapeutic drugs . In this review, a number of animal models of dr have been described and compared, ranging from different species to different induction methods of diabetes or angiogenesis, together with their corresponding temporal morphological and functional lesions . Up to date, there is no single model which can mimic the development of dr as in human, that is, from the very early cellular and vascular abnormalities to the proliferative stage, and subsequently retinal detachment, as a result of prolonged hyperglycemia . Rodents have been extensively used in dr studies owing to their small size and the ability to develop retinopathies within a relatively short period of time . The availability of a collection of transgenic mice further aids in elucidating the role of target molecules in dr . Since the stz - induced diabetic rodents are the most frequently used models in studying the associated retinopathy, we have summarized the administration dosage and paradigm published in the recent years as a reference to other researchers . Nevertheless, a majority of the diabetic rodent models only demonstrated the early symptoms of dr, which restricts their applications in mechanistic studies and drugs screening targeting the early progression of dr . Some higher - order animals showed relatively advanced retinopathies, such as neovascularization, upon induction of diabetes, yet they still cannot imitate the later stage of dr as seen in human . Moreover, high maintenance cost, long duration of study, and lack of molecular reagents, such as antibodies, as well as ethical concern further limit their use in studies . Zebrafish is another model that emerged recently in studies of dr; however, further characterization needs to be done . The presence of neovascularization is controversial in some animal models; such variation may come from animals of different strain and age, individual variation, and/or even the detection methods . Therefore, we suggested that researchers should have a bigger sample size, use at least two detection methods, such as fluorescence angiography, immunohistochemical staining of blood vessel marker on retinal flat mounts or cross - sections in combination with molecular analysis, in order to have a more convincing claim . Furthermore, overexposure of the fluorescence staining and cleanness of the section, particularly in the flat mounts, are other issues that researchers should be aware of . Although neovascularization can be observed in animals overexpressing vegf, either via transgenic approach or direct introduction, the development of neovascularization is not caused by prolonged hyperglycemia . Therefore, using these models in studies of the etiology of the disease or the development of preretinal neovascularization should be avoided . Another approach for induction of neovascularization is by hypoxic challenge in rodents; however, regression was reported within a few days, which may limit the duration of the drug treatment versus the formation of new vessels . As outlined in this review, individual model of dr has different strengths and weaknesses; careful consideration should be made in choosing appropriate models to address the research questions.
|
To evaluate the interactive effects of different self - adhesive resin cements and tribochemical treatment on bond strength to zirconia . The following self - adhesive resin cements for bonding two zirconia blocks were evaluated: maxcem (ma), smartcem (sm), rely x unicem aplicap (un), breeze (br), biscem (bi), set (se), and clearfil sa luting (cl). The specimens were grouped according to conditioning as follows: group 1, polishing with 600 grit polishing paper; group 2, silica coating with 110 m al2o3 particles which modified with silica; and, group 3, tribochemical treatment - silica coating + silanization . Specimens were stored in distilled water at 37c for 24 hours before testing shear bond strength . Silica coating and tribochemical treatment significantly increased the bond strength of the ma, un, br, bi, se and cl to zirconia compared to #600 polishing . For both #600 polished and silica coating treatments, mdp - containing self - adhesive resin cement cl had the highest bond strengths to zirconia . Applying silica coating and tribochemical treatment improved the bond strength of self - adhesive resin cement to zirconia, especially for cl.
|
Colorectal cancer (crc) is one of the most common malignancies and usually ranks high in incidence and mortality among all malignancies in the western world . Carcinoma of the rectum and sigmoid is one of the most sites of gastrointestinal tract malignancy and accounts for 20% of all gastrointestinal malignancies . The age - adjusted incidence rates of crcs in all the indian cancer registries are very close to the lowest rates in the world . Imaging in rectal cancer plays a crucial role in optimizing radiotherapy target definition to avoid adjacent vital structures . The modalities utilized for the evaluation of rectal carcinoma range from digital rectal examination, x - rays, barium enemas, transrectal ultrasounds, and colonoscopies . Due to the limitations of the abovementioned techniques recently, few reports have shown that computed tomography (ct) staging in rectal cancer is quite accurate in estimating the extent of disease and helpful in planning the treatment of rectal cancer . Ct is used for staging of rectal carcinomas before treatment, staging recurrent disease, and for detecting the presence of distant metastases after surgery . These days, as a part of presurgical planning, ct is being used for preoperative assessment of the growth and involvement of adjacent structures including the fat and pelvis muscles . Considering these points, the present study was planned with aims and objectives to assess the extent and spread of colorectal malignancy on ct scan and to correlate the ct findings with histopathological diagnosis . This retrospective (1 year) as well as prospective (1 years) study was carried out at a tertiary hospital in punjab from november 2011 to may 2014 using (128 slice philips ingenuity high - speed ct scan machine). A detailed history of altered bowel habits, bleeding per rectum, pain abdomen, loss of appetite, anemia, loss of weight, or obstructive symptoms were obtained from all the patients . All patients included in the study underwent basic and specific investigations which included hemoglobin estimation, total leukocyte count, serum creatinine, liver function tests, and levels of carcinoma embryonic antigen (cea). Rectal biopsy reports of the patients were obtained from the department of surgery and histopathology . Only those patients who underwent biopsy were included in the study . Those patients, in whom the biopsy specimen or the reports were not available due to any reason, were excluded from the study . Radiological imaging for comparison was done for all patients with biopsy confirmed diagnosis of crc . Abdominal ultrasound, ct chest, and magnetic resonance imaging (mri) findings were included wherever possible . The images were retrieved from data available with picture archiving and communication system (pacs) in the department of medical informatics . The biopsy findings of type of growth, differentiation, mucosal changes if any along with the operative findings from the surgeons operative notes, and the resultant tumor node metastasis (tnm) staging was compared with ct findings of colorectal region . These were correlated with mri images wherever possible or where images were available with pacs for comparison and radiological interpretation of tnm staging . The ct findings were staged according to the criteria modified by zinkin [table 1] and modified duke's criteria [table 2]. Staging of computerized tomography findings (modified from zinkin) tumor node metastasis / modified dukes classification system the primary tumor was visualized and noted for its exact location, measurement, extent, and features . The surrounding structures were also analyzed for the evidence of any metastatic lesions or local tumor spread particularly spread to perirectal fat, pelvic organs, pelvic side wall, bone involvement, enlarged lymph nodes, and distant organs if any . Gross description of the surgically removed specimen was obtained from the surgical notes and surgical findings were scrutinized for relevant information on growth site, size of the affected lesion, pararectal growth if any and abnormal findings in the surgical anatomy of the region dissected . Lymph nodes involvement on clinical examination or on operative findings was also documented . Wherever laparotomy or pelvic surgery were done information on involvement of liver, adjacent viscera or other visible organs in the surgical field as mentioned in the surgical notes the reports of the biopsy were analyzed for the type of tissue, differentiation, and mucosal involvement . All patients who had definite diagnosis as per the defined criteria were included in the study . The data of both the retrospective group as well as the prospective group were analyzed using kappa (a measure of inter - rater agreement for categorical scales when there are two raters) test of agreement and an attempt to draw a correlation between different diagnostic modalities was made using spss software . All calculations were done using spss version 16 (ibm corporation, 1 new orchard road, armonk, ny 1050y-1722 usa). The primary tumor was visualized and noted for its exact location, measurement, extent, and features . The surrounding structures were also analyzed for the evidence of any metastatic lesions or local tumor spread particularly spread to perirectal fat, pelvic organs, pelvic side wall, bone involvement, enlarged lymph nodes, and distant organs if any . Gross description of the surgically removed specimen was obtained from the surgical notes and surgical findings were scrutinized for relevant information on growth site, size of the affected lesion, pararectal growth if any and abnormal findings in the surgical anatomy of the region dissected . Lymph nodes involvement on clinical examination or on operative findings was also documented . Wherever laparotomy or pelvic surgery were done information on involvement of liver, adjacent viscera or other visible organs in the surgical field as mentioned in the surgical notes the reports of the biopsy were analyzed for the type of tissue, differentiation, and mucosal involvement . The primary tumor was visualized and noted for its exact location, measurement, extent, and features . The surrounding structures were also analyzed for the evidence of any metastatic lesions or local tumor spread particularly spread to perirectal fat, pelvic organs, pelvic side wall, bone involvement, enlarged lymph nodes, and distant organs if any . Gross description of the surgically removed specimen was obtained from the surgical notes and surgical findings were scrutinized for relevant information on growth site, size of the affected lesion, pararectal growth if any and abnormal findings in the surgical anatomy of the region dissected . Lymph nodes involvement on clinical examination or on operative findings was also documented . Wherever laparotomy or pelvic surgery were done information on involvement of liver, adjacent viscera or other visible organs in the surgical field as mentioned in the surgical notes the reports of the biopsy were analyzed for the type of tissue, differentiation, and mucosal involvement . All patients who had definite diagnosis as per the defined criteria were included in the study . The data of both the retrospective group as well as the prospective group were analyzed using kappa (a measure of inter - rater agreement for categorical scales when there are two raters) test of agreement and an attempt to draw a correlation between different diagnostic modalities was made using spss software . All calculations were done using spss version 16 (ibm corporation, 1 new orchard road, armonk, ny 1050y-1722 usa). A total of 31 patients showing variable bowel wall thickening involving the colon / rectum on contrast - enhanced ct were included in the study . Most common age group of the patients with colorectal lesions in our study was found to be 6170 years (38.7%). Males were more commonly affected as compared to females . Altered bowel habit (77.4%) was the most common symptom in patients presenting with carcinoma of the bowel followed by obstructive symptoms and weight loss . Hemoglobin was found to be abnormally low in 11 patients; however, it was normal in 20 patients . The total leukocyte count was abnormal in only 3 patients and rest 28 patients had normal counts . Only one patient had abnormal liver function test, whereas in the other thirty cases, the liver function was normal . Cea was found to be increased in 19 patients, whereas 11 patients had normal cea values . Lung lesions were found in one case, while the thirty cases had normal chest x - ray findings . Rectum was the most common site of involvement [figure 1] followed by the recto - sigmoid . Of the 31 cases, focal length of involvement of the bowel was seen in 18 cases, 11 cases had segmental involvement, and 2 cases had diffuse involvement . Presence of enlarged lymph nodes and perirectal / pericolic fat stranding was seen in 45.2% of the cases and 24 (77%) patients, respectively . Metastasis was observed in 5 cases out of the 31 malignant cases [figure 2]. Ct had a sensitivity of 83.3%, specificity of 92%, and positive predictive value of 71.4% and a negative predictive value of 95.8% in the diagnosis of t1 and t2 lesions . Ct had a sensitivity of 88.2%, specificity of 93.8%, and positive predictive value of 93.8% and a negative predictive value of 86.7% in the diagnosis of t3 lesions . Ct had a sensitivity of 100%, specificity of 100%, and positive predictive value of 100% and a negative predictive value of 100% in the diagnosis of t4 lesions . Axial contrast - enhanced computed tomography section of abdomen showing heterogeneously enhancing asymmetric wall thickening involving the rectum (t2 lesion) marked by arrow computed tomography carcinoma rectum with involvement of prostate (t4) sagittal contrast - enhanced computed tomography sections of abdomen and pelvis showing heterogeneously enhancing wall thickening involving the rectum with loss fat planes between the rectum and prostate suggestive its involvement) marked by arrows computed tomography carcinoma cecum and proximal colon (t4) axial contrast - enhanced computed tomography sections of abdomen showing heterogeneously enhancing mass with necrotic component involving the caecum and ascending colon infiltrating into the pericolic fat and adjacent bowel (t4 lesion) marked by arrows reported the age groups (in years) in their studies ranging from 34 to 92 and 44 to 86, respectively . Reported the age groups (in years) in their studies to be ranging from 42 to 78 and 37 to 81, respectively . Chamadol et al ., 2005, smith et al ., 2007, and hennedige et al ., 2010, reported the age groups (in years) in their studies to be ranging from 28 to 75, 33 to 89, and 29 to 94, respectively . In the present study, the age group ranged from 25 to 80 years most of the studies reported male predominance, which was in concordance with the present study where males (20, 65%) were more commonly involved as compared to females (11, 35%). In a study done by khanbhai et al ., 2014, preoperative anemia was observed in 88 (44%) patients with mean hemoglobin levels below the lower limit of normal for that sex, whereas in the present study, anemia was found in 11 (35%) patients; however, it was normal in twenty patients . Wanebo et al ., 1978, in a study on patients with dukes a, b, c, and d disease demonstrated proportions of increased values of cea-3%, -25%, -45%, and -65%, respectively . Rectum was the most common site of involvement in the present study . A study done by hennedige et al ., 2010, did a study and also found rectum (53.71%) as the most common site of involvement . In studies done by balthazar et al ., 1991, and macari et al ., 2001, it was found that focal bowel involvement was a feature of malignancy which was in concordance with our study . Eleven cases had segmental wall thickening which according to their study was seen in benign conditions . Focal bowel wall thickening may be caused by tumors or inflammatory conditions, whereas segmental or diffuse wall thickening can be seen in benign conditions . In a study done by chamadol et al . Enlarged lymph nodes were found in 14 (45%) cases of a total of 31 patients . Pericolic / perirectal fat stranding was present in 24 cases (77%) of bowel malignancies and was absent in 7 cases (23%). In their study found the role of ct in detecting serosal / pericolic fat invasion had a sensitivity of 100%, specificity of 57%, and accuracy of 75% and these have been staged into t3 category . These criteria may not be very reliable and might result in overstaging of lesions . A study done by pereira et al ., 2004, described that pericolic fat stranding is commonly seen in inflammatory conditions of the colon . Adjacent organ infiltration was seen in 8 cases (25.8% of total cases); however, the rest of the 23 cases did not show any involvement of viscera which means that the rate of detection of infiltration was 100% in our study . Liver was found to be the most commonly involved organ in a study done by horton et al ., 2000 . In our study, of the five cases with metastases, only liver metastases was seen in one case, one case showed involvement of lung, one of the cases showed involvement of both lung and liver . Omental metastasis was seen in one case, omental and adrenal metastases in one case . In their study were able to stage t1 and t2 correctly in 93% of the cases . In the present study, of the seven cases staged as t1 and t2 on histopathologically, filippone et al ., 2004, was able to correctly stage 90% of the cases as t3 lesions . In our study, 16 cases staged as t3, ct correctly staged 15 cases (93.7%). A study done by hennedige et al ., 2010, histopathological examination showed that the t - stage of the tumors was t2 in 5 (5%), t3 in 62 (63%), and t4 in 32 (32%) patients . The overall accuracy of ct for t - stage for the two readers was 45.5% and 60.6% (k is 0.30), respectively . We conclude that multiplanar reformatted imaging obtained in ct scan is an excellent modality in diagnosing malignant lesions of the colon and rectum as it can accurately describe the extent of involvement of primary or secondary lesions . The combined approach of using operative findings, histopathological diagnosis, and radiological images helps in precisely staging the crc . Multidetector ct with axial and multiplanar images are useful tools to differentiate early colorectal carcinoma and advanced cancer and also provides minute details regarding peri - colic / rectal abnormalities associated with tumor, presence of lymph nodes, infiltration of adjacent viscera as well as the involvement of distant organs.
|
The design of efficient water oxidation catalysts (wocs) based on nonprecious materials remains an important challenge for achieving a clean and sustainable solar fuels - based energy economy . We have previously shown that active wocs can be formed by anodic electrodeposition of metal - oxides from neutral and near - neutral buffered aqueous solutions of cobalt, nickel, and recently, manganese . In particular, the cobalt oxygen - evolving catalyst (co - oec) has been studied in detail, resulting in an understanding of the electrochemical kinetic mechanisms of its formation, catalysis, and charge transport . The structural and electronic properties of co - oec have been clarified using xas, x - ray pdf, epr, and x - ray gid . These studies have revealed that the electrodeposited catalyst films comprise molecular to nanoscale - sized metalate clusters composed of edge - sharing coo6 octahedra with a mixed valence co(iii / iv) resting state . The development of soluble molecular wocs based on co as well as other transition metals, such as ir, ru, cu, and fe have also been a subject of intense focus . Molecular wocs are attractive research targets because they provide a tractable means to characterize catalytic mechanisms and to identify reactive intermediates, thus forming the basis for the continued development of new wocs . However, the true identity of the active catalyst must be clarified prior to a detailed interrogation of the woc mechanism . Indeed, some molecules that were thought to be wocs have subsequently been shown to be precursors of heterogeneous or colloidal materials, which are the active catalysts . Proper catalyst identification is especially challenging for the study of molecular cobalt wocs because extremely small amounts of co - oec may be produced from the decomposition of the molecular catalyst . An exemplar of this challenge is the all - inorganic cobalt polyoxometalate [co4(h2o)2(pw9o34)2] (co4pom), which was suggested as a woc . Re - examination of the molecule showed that electrochemically driven oxygen evolution arose from the formation of co - oec on glassy carbon (gc) electrodes at 1.1 v vs ag / agcl . Because the co4pom was unstable at higher potentials, water oxidation activity could not be conclusively attributed to the co4pom, as opposed to its role as a molecular precursor to co - oec . The co4pom has now been suggested to exhibit water oxidation activity but under specific photochemical conditions where ru(bpy)3 is the oxidant . (left) molecular structure of co4o4 cubane structure 1 and (right) thermal ellipsoid representation at the 50% probability level of the one - electron oxidized cubane, 1[pf6]. Atoms are color - coded: gray (carbon), blue (nitrogen), red (oxygen), dark blue (cobalt), green (fluorine), and yellow (phosphorus). Against this backdrop, cubane co4o4 clusters, such as co4o4(oac)4(py)4, (1, figure 1), have come under investigation as a class of molecular cobalt complexes that are potential wocs . We had previously investigated 1, first synthesized by das and co - workers, and a related co4o4 cubane of christou, in order to gain valuable insights into the electronic characteristics and proton - coupled electron transfer (pcet) behavior of co(iii / iv) in a co - oec environment . The structure of 1 has been previously reported (figure s1, supporting information); the crystal structure of the oxidized cubane 1 was known as a perchlorate salt and is now obtained as a pf6 salt, as shown in figure 1 . In our studies, we did not find any evidence that these cubanes were active wocs . Motivated by the recent reports to the contrary and subsequent computational work outlining a detailed mechanistic pathway for 1 as a woc, we renewed our investigation of these molecules . A comparison of the h nmr spectra of (black line) 10 mm crude 1 and (red line) 10 mm pure 1 in d2o . Herein, we report that a co(ii) impurity in as - synthesized cubane 1 is primarily responsible for the reported catalytic water oxidation activity . We present a series of experiments that are useful for determining whether a small amount of a co(ii) impurity may lead to formation of a heterogeneous woc . We further emphasize the utility of differential electrochemical mass spectrometry (dems) for clarifying how anodic potentials affect the decomposition of glassy carbon electrodes, which are commonly used in the study of wocs . The reported experiments are aimed at establishing a standardized approach to evaluate the presence of co(ii) impurities in molecular complexes under investigation as water oxidation catalysts . We synthesized and isolated 1 by precisely following the one - pot procedure developed by others . Despite satisfactory elemental analyses for 1 (table s1), we determined that this as - synthesized material, which was isolated by concentrating a dichloromethane (dcm) extraction, was not pure . The presence of impurities was indicated by the observation of many small peaks in the h nmr spectrum (figures 2 and s2s4) and by the presence of slowly moving bands that eluted behind the product band on a silica thin layer chromatography (tlc) plate (figure s5). On the basis of the tlc result, purification of the compound was performed by column chromatography on silica, eluting with a gradient of 210% meoh in dcm . Along with the slowly moving green bands, a comparison of h nmr spectra for crude (i.e., as - synthesized) and purified 1 is shown in figure 2 . Several peaks that are observed in the aromatic region in the nmr of the crude sample are absent in the nmr of the purified sample . Molecular impurities are also indicated by many peaks in the m / z range of 300700 in the esi - ms of crude 1; these peaks are absent in the purified sample (figure s6). A structural variant, 1-coome, was also synthesized according to das original procedure; the final product was isolated by precipitation and filtration . No diamagnetic impurities were detected in the h nmr spectra of the precipitated 1-coome . However, to remove possible paramagnetic impurities, the precipitated 1-coome was subject to further purification by chromatography . Interestingly, the same h nmr spectrum was obtained for precipitated and chromatographed 1-coome (figure s7), though the former was observed to have impurities that were not removed by precipitation . Background corrected cvs of crude (black dotted) and purified (red solid) samples of 1 (0.852 mg / ml) in 0.2 m kpi buffer, ph = 7 . Two scans are presented for the crude sample demonstrating the loss of activity upon the second scan . The reported water oxidation activity of 1(36,39) could not be replicated using purified samples . Figure 3 compares the cvs of crude and purified 1 (0.852 mg / ml, 1 mm assuming 100% purity). The catalytic current, peaking at 1.3 v (all potentials are referenced to ag / agcl), in the crude sample is consistent with the woc activity that has been previously reported of 1 in the presence of proton accepting electrolytes . However, a similar catalytic wave in the purified sample is completely absent; only a reversible co(iii)3co(iv)/co(iii)4 couple centered at e1/2 = + 1.05 v is observed . Interestingly, the catalytic current detected with the crude sample is only prominent in the first scan of the cv . A similar behavior is observed for 1-coome where precipitated samples exhibit a large catalytic current in the cv and chromatographed samples show only the reversible co(iii)3co(iv)/co(iii)4 couple, as shown in figure s8 . The e1/2 of the reversible couple is at a more positive potential than for 1, due to the electron withdrawing nature of the methyl ester substituents on the pyridine ligands . The crude sample also showed a catalytic current (ep = 1.4 v, figure s9), which was absent in the purified sample . The only observed difference between the cvs in carbonate and phosphate electrolyte is that the catalytic peak current of the crude sample occurs at a more positive (80 mv) potential in carbonate electrolyte . To confirm that the catalytic current in the crude sample was associated with the oxygen evolution reaction, electrochemical oxidation was performed in a dems experimental setup, which allows for the immediate and simultaneous detection of all gaseous products formed at the electrode surface . The catalytic current from an unpurified sample shown in the red trace of the top of figure 4a is accompanied by the production of o2, as shown in the middle panel of figure 4a . Purified 1 and 1-coome were also investigated using dems under the identical conditions employed for that of the crude sample . As shown in the top panels of figure 4b, c for purified 1 and 1-coome, respectively, the faradaic current density decreases by over an order of magnitude from that of the crude sample . The waveform of the cvs in figure 4 are different than those of cvs taken on stationary gc electrodes (e.g., figure 3, red trace) owing to the flow conditions of the dems experiment; similar waveforms are observed, for instance, at rotating disk electrodes where there is forced solution flow across an electrode surface . The signal from the mass channel of o2 for the purified samples (middle panels in figure 4b, c) shows no o2 production for applied potentials below 1.4 v; at potentials of 1.4 v or greater, an extremely small amount of o2 is observed (pa intensities as opposed to na intensities of crude samples). We note that for all three samples, the mass channel of co2 exhibits a sizable signal when the electrode potential surpasses 1.2 v. the high level of evolved co2 is observed even in the background scans of blank gc electrodes (black lines in the bottom panels in figure 4a c). Dems experimental data for three samples: (a) crude 1-coome, (b) purified 1 and (c) purified 1-coome . Top panels display the faradaic current density vs potential; middle and bottom panels display the current collected for mass channels 32 (o2) and 44 (co2) m / z, respectively . Red lines are representative data from the samples, and black lines are the data from the corresponding blank gc electrodes . We sought to place a limit on the level of o2 produced by the cubane cluster within the error of our measurements . The middle panel of figure 4b indicates that there is a small but non - negligible amount of o2 produced in purified samples of 1 at applied potentials> 1.4 v. we therefore wished to quantify the amount charge passed with the current associated with the slight downturn in the red cv trace at potentials above 1.4 v in figure 3 . Three separate voltammograms (using three independently prepared gc electrodes) were collected with a sample of purified 1 (black traces in figure s10b d). A simulated cv (figure s10a) was subtracted from the background corrected raw data to remove the current that is due to the reversible co(iii)3co(iv)/co(iii)4 couple, thus leaving only the current that may be attributed to oxygen evolution (red traces in figure s10b d). From these data, the average current density was 0.11 0.04 ma / cm at 1.5 v. assuming that all of this current leads to the production of o2, then a tof of 0.06 mol o2/mol catalyst is calculated at an overpotential of 0.89 v (see si for details). This low current density and tof is consistent with catalysis from ppb concentrations of co(ii) produced from decomposition of the cubane (see discussion). Solution [o2] measurements during illumination of crude samples of 1 (black), purified 1 (red), and without added 1 (green). Photochemical reactions were performed in the presence of 0.5 mm ru(bpy)3, 35 mm na2s2o8, and 100 mm kpi ph = 7 buffer . The concentration of crude and purified 1 was 0.33 mm, assuming 100% purity for the crude material . Cvs of 2 mm (assuming 100% purity) crude 1 and [edta] = 0 (black), 0.10 (red), 0.25 (blue) and 0.50 (green) mm in 0.2 m kpi (ph = 7). Arrow and cross indicates the initial point and direction of scan . To exclude the possibility of chemistry specific to a 1:gc interaction, pt, au, and fto a similar behavior was obtained as for the gc experiments: the cvs of the crude 1 showed significant water oxidation current, which was absent in the cvs of the purified material (figure s11). In addition to electrochemical woc activity, photochemical water oxidation has been reported for as - synthesized samples of 1 using the ru(bpy)3/s2o8 sacrificial oxidant system . The photochemical assay was performed in triplicate according to the literature procedure, with the exception that phosphate buffer was used instead of carbonate (see si for details). The concentration of o2 was measured for samples of crude 1, purified 1, and without added catalyst . A fluorescence - based o2 sensor was immersed into n2 purged solutions containing [ru(bpy)3] = 0.5 mm, [s2o8] = 35 mm, and = 0.33 mm, and the cuvettes were photolyzed with a hg / xe arc lamp (exc> 400 nm). The yield of o2 over 400 s of photolysis decreased from 167 15 m for the crude samples to 31 6 m for the purified samples (figure 5). (a) p nmr spectra of the phosphate signal of a 0.5 mm solution (0.426 mg / ml) of purified 1 in 0.2 m kpi (ph = 7) with added co(ii) at the indicated concentrations . (b) the measured full - width at half - maximum (fwhm) of the phosphate p nmr signal is linearly dependent on the concentration of added co(ii). The equation of the linear calibration curve is fwhm = {(936 8) [co(ii)]} + (7.2 0.4). (c e) p nmr spectra of the phosphate signal for three separate batches of 0.426 mg / ml of crude 1 in 0.2 m kpi at ph = 7 . Using the calibration curve of (b), the amount of line broadening corresponds to a co(ii) concentration of 0.086 0.004 mm, 0.091 0.008 mm, and 0.065 0.006 mm for samples (c), (d) and (e), respectively . To identify and quantify the impurity found in the crude samples of 1, a series of spectroscopic and the epr spectrum of a solid sample of crude 1 reveals a broad paramagnetic signal over the range g = 10 to 2, which is absent in the purified sample (figure s12). To confirm the presence of a co(ii) impurity, edta was titrated into a cv solution of the crude sample . Figure 6 shows the cvs for the addition of edta (00.5 mm) into a 2 mm solution (assuming 100% purity) of crude 1 in 0.2 m kpi ph = 7 . Nearly complete suppression of the catalytic current was observed at 0.5 mm edta addition . As a control, a 50 m solution of purified 1 was treated with 10 mm edta in 0.2 m kpi at ph = 7 for 1 h, and no changes in absorbance were observed (figure s13), confirming that 1 is kinetically stable in the presence of edta . The cv wave of the co(iii)/co(iv) couple of purified 1 with addition of edta (figure s14) is fully reversible, indicating that 1 is also stable to edta on the time scale of the cv experiment . The amount of co(ii) introduced by dissolving the crude preparation of 1 in aqueous media could be quantified by applying p nmr line broadening analysis, which we previously employed to quantify the self - healing properties of co - oec . A calibration curve was constructed by adding increasing amounts of a 1:1 mixture of co(oac)2:pyridine to a 0.5 mm solution (0.426 mg / ml) of purified 1 in 0.2 m kpi buffer (figure 7, see si for experimental details). This calibration curve was used to determine the amount of co(ii) in batches of crude 1 . Although cv experiments were performed with 1 at a concentration of 0.852 mg / ml, at this concentration of crude 1, the broadening of the phosphate signal is too great to construct a calibration curve over a wide enough range . Thus, we performed p nmr line broadening experiments at half the concentration used for cv experiments . Figure 7 shows the p nmr signals of phosphate upon dissolving 0.426 mg / ml of crude 1 for three separately prepared batches . Per the calibration curve, we determine that the co(ii) ion concentration in solution is [co(ii)] = 0.086 0.004 mm, 0.091 0.008 mm and 0.065 0.006 mm for samples (c), (d) and (e), respectively ([co(ii)]avg = 0.08 0.01 mm). Translating this result to the concentrations used for cv experiments, a sample of 0.852 mg / ml of crude 1 introduces an average concentration of [co(ii)] = 0.16 0.02 mm into solution . The results of the p nmr experiments were confirmed by an electrochemical titration, in which [co(ii)] was correlated with the catalytic current observed by cv (figure s15). With increasing [co(ii)], the peak current of the catalytic wave at 1.3 v increases linearly . A calibration curve was again constructed and used to assess [co(ii)] in the three batches of crude 1 at the concentration used for cv experiments . The results of this assay shows excellent agreement with the p nmr experiment, albeit with larger error bars, giving 0.153 0.019 mm, 0.178 0.020 mm, and 0.120 0.016 mm for the three samples, with a [co(ii)]avg = 0.15 0.03 mm . Because of the insolubility of co3(po4)2 in aqueous media, the measured co(ii) concentration could be diminished due to loss of cobalt in the form of a co3(po4)2 precipitate . However, at these low [co(ii)], precipitation of co(ii) by phosphate is negligible due to the slow kinetics of formation of the co3(po4)2 on the time scale of the electrochemical or photochemical experiments, which take minutes to complete . To experimentally verify that no co3(po4)2 formed under our experimental conditions, a 0.15 mm solution of a 1:1 mixture of co(oac)2:pyridine in the presence of 0.2 m kpi at ph = 7 was monitored by p nmr line broadening over a 4 h period (figure s16). The p nmr spectrum establishes that the concentration of co(ii) in solution does not significantly decrease over this time period . The p nmr line broadening experiment is also a sensitive measure of compound stability . Solids of purified 1 can be stored on the benchtop for at least 25 days without decomposition . The p nmr line broadening analysis of 0.5 mm 1 in 0.2 m kpi buffer solution shows that the presence of co(ii) ions after 25 days is negligible (figure s17). In addition, comparison of the h nmr spectra of 1, hours after purification and after 25 days are identical (figure s18). Since crude 1 introduces co(ii) into the solution, we would expect that at anodic potentials, co - oec will be deposited . Indeed, bulk electrolysis of a 1 mm solution of crude 1 at 1.2 v for 5 min resulted in the deposition of co - oec material on the electrode surface, which was readily observed by scanning electron microscopy (sem) and energy dispersive x - ray spectroscopy (eds) (figures s19a and s20a, respectively). Bulk electrolysis of the crude sample at a higher potential of 1.4 v results in significantly less co - oec detected on the electrode surface (figures s19c and s20c), despite more charge being passed (figure s21). Per the dems experiment, current is redirected from water splitting (o2 production) to degradation of the gc electrode (co2 production at higher potential). Although bulk electrolysis performed over 300 s of a purified sample at 1.2 v resulted in an eds spectrum that is indistinguishable from that of a blank sample (figure s20b, d), the sem images of the pure and blank samples showed a subtle difference . The density of light contrast material was increased in the pure sample as compared to that of the blank sample . We therefore pursued further characterization of the electrode surface by xps analysis, which is more selective to analysis of surface materials than eds . A comparison of high - resolution co 2p xps spectra of crude, pure, and blank gc electrodes after 300 s of bulk electrolysis at 1.2 v is shown in figure s22 . A trace signal at the co 2p3/2 peak of the pure sample is barely distinguishable over background, whereas a large co 2p3/2 signal is observed for electrodes removed from bulk - electrolyzed solutions of crude 1 . As - synthesized samples of 1 contain significant amounts of impurities in two forms . The many aromatic peaks in the h nmr spectra of crude 1 (figure 2) and the slowly eluting bands on tlc plates are likely co(iii) clusters of smaller nuclearity, which are known to be stable compounds . Of greater significance, as demonstrated by epr spectroscopy (figure s12), electrochemical measurements in the presence of the ion scavenging edta (figure 6) and p nmr line broadening analysis (figure 7), a co(ii) impurity is present in crude samples of 1 . Electrochemical titration experiments and p nmr line broadening experiments quantify significant amounts of co(ii) in as - synthesized preparations of 1 . Repeated experiments on different batches of as - synthesized 1 show that the concentration of co(ii) is 16% of the expected concentration of the cubane molecule, 1 . Because the co(ii) impurity is soluble in dcm, the ligation of the co(ii) ion likely involves solubilizing organic groups, such as the acetate or pyridine reactants of 1, as salts of co(ii) with outer - sphere anions, such as acetate or nitrate, are unlikely to have significant solubility in dcm . Ligation of the solubilizing groups appears to be sufficiently weak that co - oec is easily formed (vide infra). As a cautionary note, the absence of line broadening in the h nmr spectra of 1 does not provide sufficient evidence that co(ii) is not present in solution . The lack of significant line broadening in the h nmr spectra upon titrating 1:1 co(oac)2:pyridine into a sample of purified 1 (figure s23) indicates that this is not a sensitive measure of paramagnetic impurities, presumably because 1 (a neutral, weakly basic molecule) does not interact significantly with the co(ii) ion . As figure 7 demonstrates, the phosphate p nmr signal is a much more sensitive measure of the presence of co(ii) impurities . The co(ii) ion impurities do not elute on silica and thus are easily removed from 1 . The same behavior is observed for 1-coome, where silica gel chromatography can be used to remove co(ii) impurities from as - synthesized or precipitated samples . The co(ii) impurity acts as a source for the formation of the known water oxidation catalyst, co - oec . The formation of heterogeneous co - oec occurs from solutions of co(ii) with any proton accepting electrolyte, as long as the concentration of the electrolyte is sufficiently high to control ph . Moreover, co - oec will be formed from co(ii) either electrochemically or (photo)chemically as long as the potential is sufficient to oxidize co(ii) to co(iii) in the presence of electrolytes such as phosphate or carbonate . Consistent with the formation of co - oec, the catalytic wave in figure 3 has the same peak potential and onset current as found for a cv of co(ii) solutions from which co - oec electrodeposits (figure s24). However, unlike a well - behaved catalytic process, as is typical of co - oec on fto, a peak response is observed in the cyclic voltammogram . A peak in the catalytic wave will result from either depletion of substrate or catalyst deactivation . Since the solvent, h2o, is the substrate, ph is maintained by a high concentration of phosphate, and current densities are low, we can safely rule out substrate depletion as the cause for the peak in figure 3 . However, a peak will result if the catalyst were to be removed from the electrode in a parasitic side reaction, or as in this case, if oxidative degradation of the electrode is significant (vide infra). Once the impurities are removed by column chromatography, the large catalytic waves in cvs of solutions of unpurified 1 (figure 3) and 1-coome (figure s8) disappear completely . This behavior is observed on other electrode materials (pt, au, and fto, figure s11) as well . Crude 1 shows higher currents at anodic potentials than purified 1, providing further evidence that an impurity is responsible for the woc, as opposed to spurious activity arising from a specific deleterious interaction between the cobalt cubane molecule, 1, and a gc electrode . Sem, eds, and xps support the formation of a heterogeneous co catalyst, which we attribute to co - oec, which deposits on electrodes from bulk electrolyzed solutions of crude 1 . Even in purified samples of 1, xps indicates that indeed a small amount of cobalt can be detected on the electrode . The production of co - oec from purified 1 explains the small amount of o2 observed in the dems experiment (figure 4b, middle panel) and the minute amount of current beyond background (figure 3, red trace) at potentials above 1.4 v vs ag / agcl . If all the current at 1.5 v goes to the production of o2, the tof at this potential would be 0.06 mol o2/mol of 1 . However, only an extremely small amount of cobalt in the form of co - oec is needed to support the current density associated with this tof . Using the tafel slope and the known dependence of the exchange current density on the thickness (i.e., co content) of films of co - oec, it was determined that only 70 ppb of 1, with its 4 cobalt atoms, would need to decompose to furnish enough cobalt to form co - oec and produce this observed current density (see si for details of the calculation). However, we note that the amount of co - oec and o2 produced is negligible as compared to the co - oec formed from as - synthesized samples of 1 . At potentials above 1.4 v, the dems results show that the observed current is predominantly due to the production of co2 when a gc electrode is used as the anode . As eds and xps results show, the process is so efficient at 1.4 v, that the current is largely redirected from co - oec production from the co(ii) impurity to oxidative degradation of the electrode . Importantly, the direct evidence of co2 formation (figure 4a, bottom) under conditions that thermodynamically favor the formation of co - oec argues against the possibility that the co - oec catalyst is unstable at these high potentials . If the potential is such that the rate of degradation of the gc surface is rapid, as stracke et al . Have noted, one cannot interpret the absence of deposited heterogeneous material after electrolysis as evidence of actual molecular catalysis, since surface catalyst will be lost upon degradation of the underlying electrode . Consistent with this argument, sem and eds analysis show a decrease of observable co - oec on the electrode for bulk electrolysis experiments performed at 1.4 v vs 1.2 v (figures s19 and s20). Any carbon material (e.g., graphene, carbon nanotubes . Etc .) May be compromised due to degradation at high anodic potentials and thus water oxidation experiments performed on carbon - based anodes should be subject to dems or other mass spectrometric analysis to ensure that the current is not due to electrode oxidation to co2 . As in electrochemical experiments, removing the co(ii) impurity from photochemically driven woc also leads to a dramatic reduction in the amount of o2 observed (figure 5). In the photolysis experiment, persulfate (s2o8) is used as a sacrificial oxidant to form ru(bpy)3 upon irradiation . The reduction potential of ru(bpy)3 is 1.06 v vs ag / agcl . At ph = 7, co - oec is formed from co(ii) at potentials in the range of 0.750.80 v vs ag / agcl . Therefore, under the conditions of the photolysis experiment, co(ii) can be oxidized to co - oec by ru(bpy)3 . Furthermore, the onset of woc by co - oec is 0.900.95 v vs ag / agcl, and so ru(bpy)3 is thermodynamically capable of driving catalyst turnover . In addition, the quenching reaction of ru(bpy)3 by persulfate to produce ru(bpy)3, also produces so4 as a potential oxidant, which has ample overpotential to drive water oxidation (e 2.2 v vs ag / agcl). Thus, the major pathway giving rise to water photooxidation activity with as - synthesized 1 is consistent with the formation of co - oec from the in situ oxidation of co(ii) ions . Although all photochemical studies have used as - synthesized 1, and thus water oxidation may be supported by co - oec, the present study shows the photochemical oxidation of purified 1 also results in the production of measurable quantities of o2 (31 6 m) over 400 s of photolysis, leading to a tof = 2.3 10 s. at the potential of ru(bpy)3, which is within the co(iii)3co(iv)/co(iii)4 wave (figure 3), no o2 is produced as measured by dems (figure 4b). Therefore, ru(bpy)3 is not a potent enough oxidant to turn over 1; a greater overpotential is required, if 1 is indeed a molecular catalyst under these specific photochemical conditions . As noted above, the protocol of the photochemical experiment produces the strongly oxidizing species so4 . This species is free not only to react directly with ru(bpy)3 but also to react with 1 because the concentrations of [ru(bpy)3] = 0.5 mm and = 0.33 mm are similar . Therefore, the observed o2 emanating from the photolysis conditions used for purified 1 in figure 5 is likely due to the interaction of 1 with so4, which has a considerably more positive reduction potential than ru(bpy)3 . H bond (bdfe = 123 kcal / mol) of water directly to produce the radical, oh . H bonds of the ligands, and thus the molecule itself, to be thermodynamically stable with respect to hydrogen atom abstraction given the extreme potentials provided by the electron accepting so4 and proton accepting phosphate buffer species . If the cubane were to decompose, co - oec is a likely product of the decomposition pathway . Alternatively, computational investigations into the mechanism of woc by 1 suggest that two oxidations of 1 to the level of co(iii)2co(iv)2 and an acetate ligand dissociation were required prior to water attack and subsequent o o bond formation . We cannot confirm if so4 is capable of oxidizing 1 because the electrochemical window limits the range of potentials for investigating the behavior of 1 at potentials beyond 1.5 v. if a higher oxidized cubane is capable of water oxidation activity, it occurs at extremely high overpotentials . Without purification by silica chromatography, the co(iii) oxo cubanes can be contaminated with co(ii) impurities, which are responsible for the observed water oxidation activity reported for these molecules . We have shown that an edta titration can be used to test for the presence of co(ii) and a p nmr experiment can be used for the co(ii) quantification; these experiments are more definitive than h nmr spectroscopy for identifying paramagnetic co(ii) impurities . Beyond co(ii) as an impurity, the use of any co(ii) complex should be assessed as an authentic woc versus precursors for heterogeneous catalysts such as co - oec owing to the proclivity of co(ii) complexes to undergo rapid ligand substitution . We note that water oxidation activity of a catalyst should not depend on whether an anodic potential is supplied electrochemically or (photo)chemically for mechanisms involving outer sphere electron transfers . In instances where homogeneous and heterogeneous o2 evolution experiments do not concur, it is appropriate to consider whether other species are responsible for catalytic activity . Finally, when inspecting carbon - based electrode surfaces for the deposition of heterogeneous catalysts, care must be exercised in the choice of oxidizing potentials, as extreme values can give rise to spurious current that is associated with co2 evolution and electrode degradation as established by dems.
|
A 50 year male presented on july 2011 to the emergency department with right heel pain and inability to bear weight following falling from height . Clinical examination revealed mild uniform swelling of the right heel and moderate tenderness with full ankle range of motion . 1) revealed undisplaced calcaneal fracture which was treated conservatively and the lesion was not noticed initially . He was followed up in outpatient clinic and the new x - rays (fig . 2) revealed the presence of pathological fracture with a well - defined osteolytic lesion . Mri showed a well demarcated expansile lesion (34 mm 17.3 mm 27.8 mm). It was hypointense on t1 and hyperintense on t2 and the findings were suggestive of giant cell tumor (fig . 3). Lab results including complete blood count, sedimentation rate and c - reactive protein were within normal ranges . After 4 months he underwent curettage of lesion using burrs through posterolateral approach (fig . Histopathological examination revealed multiple bone fragments and the soft tissue infiltrated by multinucleated giant cells, hemosiderin laden macrophages, cholesterol cleft and hemorrhages (fig . Postoperative lipid profile was normal and the diagnosis of primary xanthoma of calcaneus bone was made . Postoperatively the patient was well with complete relief of pain and the patient started full weight bearing ambulation after 6 weeks . The patient is still under follow up with no signs of recurrence after 2 years . Xanthomatous changes have been reported in various lesions of bone, e.g. Fibrous dysplasia, giant cell tumor, aneurysmal bone cysts, non - ossified fibroma, chondroblastoma, fibrous histiocytoma, and xanthogranulomatous osteomyelitis . Defined primary xanthoma as a condition in which the xanthomatous pattern is extensive and when it is not confirmed as secondary phenomenon in pre - existing lesion . Some authors define this lesion as a variant, because xanthoma and giant cells may be seen in many non - neoplastic and neoplastic lesions of the bone . Classification of xanthoma may be helpful to allow diagnosis and treatment:(1)xanthomatous variant: xanthomatous changes in advanced stage of skeletal benign or malignant pre - existing lesions. (2)secondary xanthoma: forms in the skeletal system of type-2 and 3 hyperlipidemic patients. (3)primary xanthoma with normal lipid metabolism . Xanthomatous variant: xanthomatous changes in advanced stage of skeletal benign or malignant pre - existing lesions . All material should be examined microscopically, the radiological features of the lesion should be studied properly and lipid profile should be investigated to differentiate between primary and secondary xanthoma . Primary xanthoma may be treated with curettage and bone graft while secondary xanthoma is treated nonsurgically and the skeletal manifestations would disappear with systemic treatment of hyperlipidemia . Skeletal primary xanthoma is a rare benign lesion and it is difficult to diagnose using only clinical and imaging techniques . Detailed histopathological examination throughout the specimens is essential to establish the diagnosis of primary xanthoma and to exclude the underlying lesion . It is important to histologically and radiologically differentiate a primary xanthoma from secondary changes in other benign or malignant tumors . As the prognosis of primary xanthoma is excellent, curettage and bone grafting is an effective way of treatment . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Dr . Ghalib ahmed: operating surgeon 1, writing the manuscript and review of literature . Moutasim el mahi: obtaining all the patient's data (imaging and histopathology). Sameh abolfotouh: writing the manuscript, reviewing the patient's file & author of correspondence.
|
Angular deformities around the knee joint necessitate special consideration to restore normal alignment during total knee arthroplasty (tka). Valgus knees are defined as those with> 10 of mechanical tibiofemoral angle on standing hip to ankle anteroposterior (ap) radiographs . Typically, a valgus deformity may be due to bony deformities such as hypoplastic lateral condyle, tibial bone loss, or due to soft tissue contracture involving iliotibial band (it band), biceps femoris, lateral collateral ligament (lcl) or posterolateral capsule,1234 or may be due to both bony and soft tissue involvement . Consequently, attenuation of medial soft tissue structures may be a late secondary event.1 an ideal approach for valgus knees must provide adequate exposure with minimal complications due to approach per se . Several studies 5678910 had demonstrated the use of lateral capsular approach and modified lateral capsular approach with repositioning of vastus lateralis or tibial tubercle osteotomy (tto). In addition, a lateral subvastus 1112 approach has been described, but it may require snip of vastus lateralis obliquus 11 or tto 12 to shift the patella medially . However, these conventional approaches may result in short and long term deficit in quadriceps muscle function post - tka 131415 or complications related to tto . Subsequently, this may reflect lower patient satisfaction due to reduced mobility and significant pain in postoperative period.13 with the recent emphasis on minimally invasive muscle sparing approach in orthopedic surgery including tka, the subvastus approach has been commonly described for varus knees . Furthermore, this approach has definite advantages of maintaining extensor mechanism integrity, minimal effect on patellar tracking and preservation of patellar blood supply.1617181920 ultimately, these lead to faster recovery periods, shorter hospital stay, minimal postoperative physiotherapy, improved patellar tracking and less postoperative pain,1317202122 thereby resulting in better functional outcomes . Therefore, the present study aimed to evaluate the outcomes of tka and efficacy of minimally invasive subvastus (mini - subvastus) approach in valgus knees in terms of: (1) early functional recovery (2) postoperative limb alignment and (3) incidence of complications . We hypothesized that mini - subvastus approach can be well utilized for tka in valgus knees and it results in early functional recovery with minimal complications 112 knees in 108 patients with valgus deformity operated for elective primary tkas by subvastus approach between january 2006 and december 2011 (out of 3000 consecutive primary tka's patients) were included in this retrospective study . Exclusion criteria were patients with previous arthrotomy of knee, neurological problems and those requiring revision tka . All surgeries were performed by senior author (nas) using mini - subvastus approach without using pneumatic tourniquet . Tranexamic acid,23 15 mg / kg, was given 30 minutes prior to surgery and 2 doses 10 mg / kg were given 3 and 6 h postsurgery . A skin incision about 4 inches in length [figure 1] was made slightly medial to the midline of the knee extending from the superior pole of patella to the tibial tubercle in 90 of flexion . Intraoperatively, saline adrenaline (1:300,000) was infiltrated into skin and subcutaneous tissue to reduce bleeding . An l - shaped capsulotomy [figure 2] made with horizontal limb of the l along the inferior margin of vm until the superior pole of patella and vertical limb of l was extended from here until tibial tubercle . The patella was displaced laterally to expose the suprapatellar synovium that was divided medially keeping the suprapatellar pouch intact [figure 3]. Peroperative photograph showing mini incision used for subvastus total knee arthroplasty intraoperative photograph showing l - shaped arthrotomy used for subvastus technique intraoperative photograph showing division of suprapatellar synovium at this stage, the femoral trochlea was visible . If present, prominent osteophytes in supratrochlear region were removed . The dissection on medial side was kept to a minimum and no ligament release was performed medially . The distal femoral cut was made first using downsized intramedullary jig with the appropriate valgus angle, generally 3. an extramedullary check was made preoperatively to confirm that this was indeed the correct valgus angle before making the femoral cut . The femoral pulse was felt and a marker (a stick on electrocardiography lead with metal) was placed over this . On this, a small vertical marker (an empty inverted water for injection sterile plastic ampoule) was strapped on in such a way that it would be easy to feel through the drapes . Before cutting the distal femur, the extramedullary femoral guide was used to ascertain that the rod was pointing to this marker applied preoperatively . The tibial cut was made perpendicular to its mechanical axis using an extramedullary jig (i.e., neutral varus - valgus). The depth of the cut was 810 mm from the intact medial condyle (in valgus knee). The angle that is the slope of the cut was 03. a spacer block was utilized to check extension space . If necessary, lateral release was performed to establish a symmetrical extension space as follows [figure 4a and b]: with the knee in extension and distracted with lamina spreader, the posterolateral capsule was released from the tibia . Typically, this was done all along the tibial margin from 6 to 9 clock position . If further, posterolateral release was required, it was done with knee flexed at 90. care was taken not to detach the popliteus tendon as it is important to maintain stability in flexion . If still further release was required, it band was released from gerdy's tubercle . The lcl release although well described in literature, was not required in our cases.82425 the anterior and posterior femoral cuts were made using the ap cutting jig . In all cases, we used the transepicondylar axis as a reference for jig placement [figure 5]. Jig was utilized to size and resect the patella if patellar resurfacing was to be carried out . Trial components were inserted and careful check was made regarding range of motion (rom), stability and patellar tracking . All knees used were fixed bearing metal backed components (cruciate retaining [cr] or posterioir stabilized [ps]; [nexgen; lps; zimmer inc ., an apical stitch at the angle of the l was first taken to ensure that the capsule was neither advanced nor recessed . The knee was infiltrated with 20 cc of mixture containing 0.25% bupivacaine, cefuroxime and normal saline . At the end of the procedure, a bulky dressing was applied for the first 24 h. intraoperative photograph showing (a) asymmetrical extension gap with tight lateral structures . (b) released lateral capsule intraoperative photograph showing jig placement parallel to the transepicondylar axis a continuous femoral nerve block technique was used for 12 h postoperatively for pain control and early recovery . Static quadriceps exercises and straight leg raising (slr) exercise were started from day 0 and rom exercises beginning from day one . Chemical prophylaxis for deep vein thrombosis was in form of tablet aspirin 75 mg once a day for 3 weeks . Patients were encouraged to get out of bed and walk as tolerated from day 1 . All clinical information was collected from database system maintained from predesigned data sheets by an independent investigator (one of authors). The clinical information included demographic data, preoperative and postoperative clinical status [figure 6a and b] including degree of valgus deformity, the correctability, rom, patients categories based on krackow et al.26 classification of valgus knees and postoperative outcomes (at 2 weeks, 6 weeks, 3 months, 6 months, 12 months and yearly thereafter). Postoperative pain was assessed using visual analog scale (vas) on postoperative day (pod) 1 and pod2 . Early quadriceps recovery was measured in form of time to active slr and staircase competency . Preoperative clinical statuses and postoperative outcomes were evaluated using american knee society (aks) knee and functional score.22 postoperatively, a standing whole - limb ap radiograph was taken after surgery and yearly thereafter to measure mechanical tibiofemoral angle [figure 7a and b]. Knee series including ap view, lateral view [figure 7c and d] and an additional merchant view radiograph were also taken and evaluated . Clinical photograph showing (a) severe valgus deformity before total knee arthroplasty and (b) after total knee arthroplasty (a) preoperative scanogram of a patient showing valgus deformity . (b) postoperative scanogram after total knee arthroplasty showing correction of deformity (c) postoperative radiograph with cruciate retaining prosthesis, anteroposterior view . (d) postoperative radiograph with cruciate retaining prosthesis, lateral view two of the authors (npj, nas) made all radiographic measurements using full length weight bearing ap radiographs . We measured mechanical tibiofemoral angle of knee, which was defined as the angle formed by the intersection between mechanical axes of the femur (line from the femoral head center to the femoral intercondylar notch center) and the tibia [line from the centre of ankle (talus) center to the center of knee (tibial spine tips)]. To determine the intra and inter - observer reliabilities of radiographic assessments, two investigators performed all radiographic assessments in 20 randomly selected radiographs twice with an interval of 1-week . The intra- and inter - observer reliabilities of assessments of all radiographic measurements were evaluated using intraclass correlation coefficients (iccs). The iccs of the intra- and inter - observer reliabilities of all measurements were> 0.90 . Because the measurements were judged reliable, measurements taken by a single investigator (npj) were used in the analyses . Statistical analyses were performed using spss for windows (version 20.0, ibm, chicago, il, usa). The difference was considered significant with p <0.05 at a probability level of 95% for all comparisons . Statistical significance was determined using student's t - test for continuous variables and the chi - square, or the fisher's exact test for categorical variables . All surgeries were performed by senior author (nas) using mini - subvastus approach without using pneumatic tourniquet . Tranexamic acid,23 15 mg / kg, was given 30 minutes prior to surgery and 2 doses 10 mg / kg were given 3 and 6 h postsurgery . A skin incision about 4 inches in length [figure 1] was made slightly medial to the midline of the knee extending from the superior pole of patella to the tibial tubercle in 90 of flexion . Intraoperatively, saline adrenaline (1:300,000) was infiltrated into skin and subcutaneous tissue to reduce bleeding . An l - shaped capsulotomy [figure 2] made with horizontal limb of the l along the inferior margin of vm until the superior pole of patella and vertical limb of l was extended from here until tibial tubercle . The patella was displaced laterally to expose the suprapatellar synovium that was divided medially keeping the suprapatellar pouch intact [figure 3]. Peroperative photograph showing mini incision used for subvastus total knee arthroplasty intraoperative photograph showing l - shaped arthrotomy used for subvastus technique intraoperative photograph showing division of suprapatellar synovium at this stage, the femoral trochlea was visible . If present, prominent osteophytes in supratrochlear region were removed . The dissection on medial side was kept to a minimum and no ligament release was performed medially . The distal femoral cut was made first using downsized intramedullary jig with the appropriate valgus angle, generally 3. an extramedullary check was made preoperatively to confirm that this was indeed the correct valgus angle before making the femoral cut . The femoral pulse was felt and a marker (a stick on electrocardiography lead with metal) was placed over this . On this, a small vertical marker (an empty inverted water for injection sterile plastic ampoule) was strapped on in such a way that it would be easy to feel through the drapes . Before cutting the distal femur, the extramedullary femoral guide was used to ascertain that the rod was pointing to this marker applied preoperatively . The tibial cut was made perpendicular to its mechanical axis using an extramedullary jig (i.e., neutral varus - valgus). The depth of the cut was 810 mm from the intact medial condyle (in valgus knee). The angle that is the slope of the cut was 03. a spacer block was utilized to check extension space . If necessary, lateral release was performed to establish a symmetrical extension space as follows [figure 4a and b]: with the knee in extension and distracted with lamina spreader, the posterolateral capsule was released from the tibia . Typically, this was done all along the tibial margin from 6 to 9 clock position . If further, posterolateral release was required, it was done with knee flexed at 90. care was taken not to detach the popliteus tendon as it is important to maintain stability in flexion . If still further release was required, it band was released from gerdy's tubercle . The lcl release although well described in literature, was not required in our cases.82425 the anterior and posterior femoral cuts were made using the ap cutting jig . In all cases, we used the transepicondylar axis as a reference for jig placement [figure 5]. Jig was utilized to size and resect the patella if patellar resurfacing was to be carried out . Trial components were inserted and careful check was made regarding range of motion (rom), stability and patellar tracking . All knees used were fixed bearing metal backed components (cruciate retaining [cr] or posterioir stabilized [ps]; [nexgen; lps; zimmer inc ., all implants were fixed with cement . An apical stitch at the angle of the l was first taken to ensure that the capsule was neither advanced nor recessed . The knee was infiltrated with 20 cc of mixture containing 0.25% bupivacaine, cefuroxime and normal saline . At the end of the procedure, a bulky dressing was applied for the first 24 h. intraoperative photograph showing (a) asymmetrical extension gap with tight lateral structures . (b) released lateral capsule intraoperative photograph showing jig placement parallel to the transepicondylar axis a continuous femoral nerve block technique was used for 12 h postoperatively for pain control and early recovery . Static quadriceps exercises and straight leg raising (slr) exercise were started from day 0 and rom exercises beginning from day one . Chemical prophylaxis for deep vein thrombosis was in form of tablet aspirin 75 mg once a day for 3 weeks . Patients were encouraged to get out of bed and walk as tolerated from day 1 . All clinical information was collected from database system maintained from predesigned data sheets by an independent investigator (one of authors). The clinical information included demographic data, preoperative and postoperative clinical status [figure 6a and b] including degree of valgus deformity, the correctability, rom, patients categories based on krackow et al.26 classification of valgus knees and postoperative outcomes (at 2 weeks, 6 weeks, 3 months, 6 months, 12 months and yearly thereafter). Postoperative pain was assessed using visual analog scale (vas) on postoperative day (pod) 1 and pod2 . Early quadriceps recovery was measured in form of time to active slr and staircase competency . Preoperative clinical statuses and postoperative outcomes were evaluated using american knee society (aks) knee and functional score.22 postoperatively, a standing whole - limb ap radiograph was taken after surgery and yearly thereafter to measure mechanical tibiofemoral angle [figure 7a and b]. Knee series including ap view, lateral view [figure 7c and d] and an additional merchant view radiograph were also taken and evaluated . Clinical photograph showing (a) severe valgus deformity before total knee arthroplasty and (b) after total knee arthroplasty (a) preoperative scanogram of a patient showing valgus deformity . (b) postoperative scanogram after total knee arthroplasty showing correction of deformity (c) postoperative radiograph with cruciate retaining prosthesis, anteroposterior view . (d) postoperative radiograph with cruciate retaining prosthesis, lateral view two of the authors (npj, nas) made all radiographic measurements using full length weight bearing ap radiographs . We measured mechanical tibiofemoral angle of knee, which was defined as the angle formed by the intersection between mechanical axes of the femur (line from the femoral head center to the femoral intercondylar notch center) and the tibia [line from the centre of ankle (talus) center to the center of knee (tibial spine tips)]. To determine the intra and inter - observer reliabilities of radiographic assessments, two investigators performed all radiographic assessments in 20 randomly selected radiographs twice with an interval of 1-week . The intra- and inter - observer reliabilities of assessments of all radiographic measurements were evaluated using intraclass correlation coefficients (iccs). The iccs of the intra- and inter - observer reliabilities of all measurements were> 0.90 . Because the measurements were judged reliable, measurements taken by a single investigator (npj) were used in the analyses . A continuous femoral nerve block technique was used for 12 h postoperatively for pain control and early recovery . Static quadriceps exercises and straight leg raising (slr) exercise were started from day 0 and rom exercises beginning from day one . Chemical prophylaxis for deep vein thrombosis was in form of tablet aspirin 75 mg once a day for 3 weeks . Patients were encouraged to get out of bed and walk as tolerated from day 1 . All clinical information was collected from database system maintained from predesigned data sheets by an independent investigator (one of authors). The clinical information included demographic data, preoperative and postoperative clinical status [figure 6a and b] including degree of valgus deformity, the correctability, rom, patients categories based on krackow et al.26 classification of valgus knees and postoperative outcomes (at 2 weeks, 6 weeks, 3 months, 6 months, 12 months and yearly thereafter). Postoperative pain was assessed using visual analog scale (vas) on postoperative day (pod) 1 and pod2 . Early quadriceps recovery was measured in form of time to active slr and staircase competency . Preoperative clinical statuses and postoperative outcomes were evaluated using american knee society (aks) knee and functional score.22 postoperatively, a standing whole - limb ap radiograph was taken after surgery and yearly thereafter to measure mechanical tibiofemoral angle [figure 7a and b]. Knee series including ap view, lateral view [figure 7c and d] and an additional merchant view radiograph were also taken and evaluated . Clinical photograph showing (a) severe valgus deformity before total knee arthroplasty and (b) after total knee arthroplasty (a) preoperative scanogram of a patient showing valgus deformity . (b) postoperative scanogram after total knee arthroplasty showing correction of deformity (c) postoperative radiograph with cruciate retaining prosthesis, anteroposterior view . (d) postoperative radiograph with cruciate retaining prosthesis, lateral view two of the authors (npj, nas) made all radiographic measurements using full length weight bearing ap radiographs . We measured mechanical tibiofemoral angle of knee, which was defined as the angle formed by the intersection between mechanical axes of the femur (line from the femoral head center to the femoral intercondylar notch center) and the tibia [line from the centre of ankle (talus) center to the center of knee (tibial spine tips)]. To determine the intra and inter - observer reliabilities of radiographic assessments, two investigators performed all radiographic assessments in 20 randomly selected radiographs twice with an interval of 1-week . The intra- and inter - observer reliabilities of assessments of all radiographic measurements were evaluated using intraclass correlation coefficients (iccs). The iccs of the intra- and inter - observer reliabilities of all measurements were> 0.90 . Because the measurements were judged reliable, measurements taken by a single investigator (npj) were used in the analyses . Statistical analyses were performed using spss for windows (version 20.0, ibm, chicago, il, usa). The difference was considered significant with p <0.05 at a probability level of 95% for all comparisons . Statistical significance was determined using student's t - test for continuous variables and the chi - square, or the fisher's exact test for categorical variables . The mean duration of followup was 40 months (range 2484 months). In no case, this approach was abandoned and the approach proved effective irrespective of the degree of valgus deformity [table 1]. According to krackow et al.,26 category for valgus knee, 76 knees were type 1, 32 knees were type 2 and 2 knees belonged to type 3 category . Release of the lcl or popliteus was not performed in any case . In all these cases, a cr knees were used in 89 patients and ps knees in 20 patients and constrained condylar knee in one patient with severe combined valgus and recurvatum deformity and patellar resurfacing was done in 36 cases . Demographic characteristics of patients undergoing total knee arthroplasty the mean (standard deviation [sd]) vas on pod1 and pod2 at rest was 2.73 (0.67) and 2.39 (1.11), respectively and after mobilization was 3.28 (0.68) and 3.08 (1.20), respectively (p <0.001). The quadriceps recovery was good, and 92 (86.7%) patients were able to do active slr by pod1 with mean (sd) time of 21.98 (4.09) h. the mean (sd) time for reciprocal gait and staircase competency was 43.05 (6.59) h. the mean (sd) length of hospital stay was 3.3 (0.44) days . The aks and function score showed significant improvement from preoperative mean of 39 (11.58) and 36 (11.27) to 91 (5.04) and 79 (8.30), respectively at latest followup (p <0.001). The mean rom increased from 102 (10) preoperatively to 119 (9) at recent followup (p <0.001). The mean tibiofemoral valgus angle was corrected from preoperative 16 (range 1035) to 5 (range 39) of valgus (p <0.001). There were three outliers with two patient having 9 valgus each and one with 8 valgus . Moreover, the component positioning and cementation appeared satisfactory on radiographs with no radiolucency's and signs of loosening in any patient . Furthermore, the outcome of tka using either cr or ps knee showed similar results without any significant difference [table 2]. Comparison of outcomes among cr and ps implant groups two patients underwent revision surgery, one for patellar component malposition; one had liner exchange for hyperextension . Also, one patient had foot drop postoperatively probably due to peroneal nerve injury that recovered gradually and completely within 6 weeks . The most important finding of the present study is that medial - subvastus approach provides satisfactory and adequate exposure for tka in valgus knees . Tka in valgus knees is considered to be more challenging 122 as it is relatively uncommon in practice . Moreover, it has a different pathoanatomy: femur is internally rotated and tibia externally rotated, lateral femoral condyle is deficient in contrast to varus knee where tibia is usually involved, lateral and posterior contractures are present, and ligament balancing is difficult.23427 thus, the present study was undertaken to demonstrate the efficacy of mini - subvastus approach in valgus knees . Our findings support the hypothesis that mini subvastus approach can be utilized for tka in valgus knees and that it results in good functional outcome . The present study showed early postoperative recovery in patients post tka with lower mean vas score,28 early mobilization with active slr and staircase competency . The findings of the present study of lower mean vas score is considerably better than the similar vas score assessed by huang et al.22 using median parapatellar approach . Moreover, several studies 19202930 in past have evidently endorsed the benefits of muscle sparing subvastus approach in faster recovery and less postoperative pain . Also, recently published study 28 on effect of far medial - subvastus technique in fixed valgus type 2 krackow knees showed similar results . The functional outcome at the latest followup assessed by mean aks score showed significant improvement . Moreover, the mechanical alignment was good with mean valgus angle of 5. similarly, comparable findings were reported in several studies [table 3] using different approaches for tka in valgus knees . Summary of studies reporting outcomes of total knee arthroplasty in valgus knees medial parapatellar is universally accepted due to its familiarity to most surgeons and providing satisfactory exposure in valgus knees, even for lateral soft tissue release.192031 however, several studies 63233 have reported inferior outcomes with medial capsular approach . Particularly, it may be due to additional release of lateral soft tissue structures jeopardizing patellar blood supply.34 multiple previous studies 567891011 had described lateral parapatellar and subvastus approaches for valgus knees . Moreover, one advantage of lateral approach is that it can directly address the disturbed pathoanatomy of valgus knee . Furthermore, lateral approach maintains intact medial soft tissue structures thereby rendering patellar vascularity 34 undisturbed . However, difficulties related to lateral capsulotomy is medial patellar eversion, its unfamiliarity to most surgeons and problems related to tto.2610 in spite of having obvious advantages over other conventional approaches, mini - subvastus approach is seldom used for tka in valgus knees . In fact, it is considered to be relative contraindication in valgus knees.31 moreover, the approach is considered difficult as it is not a familiar approach . Theoretically, it can be as good as or even better than median parapatellar approach, as illustrated by several studies.1719202135 nonetheless, it preserves the patellar vascularity even after lateral soft tissue release due to intact quadriceps mechanism . Furthermore, major criticism for subvastus technique includes difficulty in subluxation and eversion of patella, poor, and unpredictable exposure, more so of lateral structures and malalignment of components.29 in valgus knees, the patella tends to subluxate laterally due to tight lateral structures and attenuation of medial structures.36 thus, it in fact makes the surgeon's job easier to dislocate the patella laterally if vm is released adequately from intermuscular septum.35 moreover, synovial division further helps in lateral displacement of patella.35 also, our surgical technique involves eversion of patella after tibial and femoral cuts were taken as quadriceps gets relaxed . Although, all the parts of the knee may not be seen simultaneously, symbiotic use of retractors and use of mobile skin window to accomplish the sequential steps with adequate exposure are the key factors in the mini - subvastus approach.3537 in our series, we were able to gain exposure that even suffice for release of the lateral structures including posterolateral capsule and it band . In addition, in this study, posterolateral capsule was released in 86 (78.18%) cases while it band was released in 62 (56.36%) knees using piecrust technique . While none of the cases required extensive lateral release including lcl and popliteus, and medial advancement techniques . Likewise, several studies 82425 had revealed the importance of isolated it band release or titrated release of lateral structures by pie crusting method for gap balancing . Furthermore, the present study did not observe any component malalignment, which has also been case with similar other studies.1838 however, a detailed analysis of component positioning would form the basis of another study . Appropriate exposure of lateral tibial plateau 35 and use of transepicondylar axis for referencing instead of posterior condylar referencing 1 for femur helps us to minimize the component malalignment in valgus knees . In present study, a recent study 39 demonstrated the efficacy of cr implants in valgus knees and that survival of implant is improved when lateral stabilizers like lcl and/or popliteus tendon are preserved . Moreover, we assessed the sagittal plane stability intraoperatively by adequacy of posterior cruciate ligament (pcl), and the decision to retain or substitute the pcl was made intraoperatively . Sacrifice of pcl was done in cases of laxity and deformity not correctable without the release of pcl . Furthermore, the outcome of patients with both cr and ps implant types were similar with no significant differences [table 2]. Only one patient needed constrained condylar knee with severe combined valgus and recurvatum deformity . Likewise, several studies in past had reported the use of constrained knees using various approaches.5740 patellar resurfacing was done in selected 36 knees, especially those with significant disease of femoral trochlear surface . In our series, one knee had patellar component malpositioning, due to surgical error, which can be avoided by carefully identifying the boundaries of patella after resection . It may be due to peroneal nerve injury,4142 direct traction on the nerve, traction on the surrounding tissues resulting in vascular compromise to the nerve, direct pressure on the nerve from the postoperative dressing, or a combination of these factors . The complication rates were comparable to other series using various conventional approaches [table 3]. The limitations of the study are: first, this is a retrospective study with all its inherent biases and limitations . However, all the patients were managed by single surgeon senior author (nas), using same protocol thereby decreasing the influence of the confounding factors . Second, the current study is a midterm followup study with average followup of 40 months . Third, this study does not involve any comparison with the other approaches used for valgus knees . But, the senior author exclusively uses subvastus approach for all cases of tka including varus knees and revisions with satisfactory outcomes . Fourth, the assessment of vas scores was done on postoperative day 1 and 2 . However, the results may have been affected by the use of femoral nerve block though it has been used for 12 h postoperatively only . A mini - subvastus medial quadriceps approach provides adequate exposure for tka in valgus knees including the lateral structures, without increase in incidence of complications . It provides excellent early recovery phase.13172021 midterm followup showed good outcome in terms of mechanical alignment and the functional scores.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.