text
stringlengths 0
868k
|
|---|
Lemierre's syndrome is a septic thrombophlebitis of the internal jugular vein (ijv) commonly caused by anaerobic oropharyngeal flora that is usually followed by fulminant sepsis and rapid death in the pre - antibiotic era . Since the introduction of antibiotics, the morbidity and mortality associated with this syndrome have been dramatically decreased . However, delay in diagnosis and antibiotic treatment resulting in poor clinical outcome is not uncommon as physicians are less familiar with this infection and initial manifestations are often non - specific . We describe a case of a patient with lemierre's syndrome whose the diagnosis was not suspected until blood culture grew fusobacteirum necrophorum . An otherwise healthy 36-year - old male presented to our institute with a 4-day history of low - grade fever accompanied by sore throat, myalgia and nausea . Physical examination was remarkable for a temperature of 38.1c and an injected pharynx without any neck tenderness or swelling . Complete blood cell count showed thrombocytopenia with platelet of 45,000/ul, hemoglobin of 14.8 g / dl and cell count of 8700 cells / ul (neutrophil of 85% and band form of 6%). He was diagnosed with viral upper respiratory tract infection and was admitted to general medicine service for rehydration . He received 2 l of intravenous normal saline over night; however, on the 2 day of hospitalization, he developed high fever of 39.2c along with pleuritic chest pain and low blood pressure of 80/50 mmhg . Blood cultures were obtained and empirical antibiotics (vancomycin and piperacillin / tazobactam) were initiated . Chest x - ray revealed bilateral patchy and irregular parenchymal opacities and subsequent chest computed tomography demonstrated right - sided pleural effusion and multiple thick - walled cavitary and nodular opacities consistent with septic emboli [figure 1]. His blood cultures grew f. necrophorum on the following day and his antibiotic therapy was narrowed down to piperacillin / tazobactam . His blood pressure was normalized without using any vasopressor or mechanical ventilation (he received 5 l of intravenous normal saline in total). Venous duplex ultrasonography was immediately obtained after the blood culture and demonstrated thrombus in the left ijv . Patient was finally diagnosed with lemierre's syndrome and remained stable through rest of the hospital course . Piperacillin / tazobactam was continued for 7 days and he was discharged home with a 4-week course of intravenous ertapenem and recovered well from the infection . (b - d) chest computed tomography showed multiple thick - walled cavitary and solid nodules (arrows) and right - sided pleural effusion (arrow heads) lemierre's syndrome or postanginal sepsis is a rare, but potentially fatal infection of the ijv . It is usually caused by f. necrophorum although a wide variety of bacteria, including bacteroides, eikenella, porphyromonas, prevotella, proteus, streptococcus, peptostreptococcus and staphylococcus aureus has been reported as causative organisms . The infection typically starts in the palatine tonsils or peritonsillar tissue and spread into the ijv - containing lateral pharyngeal space though causing septic thrombophlebitis though infection originated from pharynx, middle ear, sinus and parotid gland has also been described . This septic thrombophlebitis is usually followed by distal septic embolization, resulting in multi - organ involvement with lung being the most commonly affected site with reported incidence of 97% . Other commonly involved sites are joints, muscle, soft - tissue, meninges, spleen and liver . Why f. necrophorum, a normal inhabitant of human oropharynx, becomes invasive is unclear . Loss of pharyngeal mucosal integrity caused by bacterial or viral infection might play a major role as several cases of lemierre's syndrome proceeded by acute mononucleosis have been reported . The increased production of leucotoxin is also pivotal for the pathogenesis as it can avidly activate platelet resulting thrombus formation in the ijv . Lemierre's syndrome is classically described as a constellation of symptoms of fever, sore throat, neck swelling, pulmonary involvement and arthralgia that frequently affects young healthy adults . Nevertheless, initial clinical presentation can be subtle and sometimes persistent fever is the only prominent symptom and the syndrome is frequently not suspected until the microbiologic data is available hence high - level of clinical suspicion is needed for the timely diagnosis . Physical examination might reveal an exudative tonsillitis or milder form of pharyngitis; however, these oropharyngeal signs might not be evident as the septic thrombophlebitis or metastatic complication usually occurs 1 - 3 weeks after the primary infection . Typical signs of ijv thrombophlebitis are pain and swelling along the sternocleidomastoid muscle, but they are found in only approximately a half of patients . Diagnosis of lemierre's syndrome is established on the presence of thrombus in ijv and positive blood culture . Computed tomography of neck with contrast is the diagnostic modality of choice to demonstrate the thrombus . Doppler ultrasonography is an alternative since it is less invasive and can be done at bedside though it is less sensitive particularly in the area deep to clavicle and mandible and can miss newly formed thrombus with low echogenicity . Prolonged course of intravenous antibiotic (3 - 6 weeks) covering f. necrophorum and oral streptococci is the cornerstone of treatment . As beta - lactamase producing strain of f. necrophorum appropriate first - line antibiotics should be one of the following: beta - lactam / beta - lactamase inhibitor, carbapenem, ceftriaxone + metronidazole and clindamycin . The role of anticoagulation is unclear, but is generally not indicated unless there is evidence of expansion of the thrombus . Surgical ligation or excision of the ijv might be necessary in the case of uncontrolled sepsis or septic emboli despite adequate antibiotic . We report a case of healthy young male who presented with flu - like symptoms and was initially mistaken for viral upper respiratory tract infection . Intensivists should have a high index of suspicion for this diagnosis in otherwise healthy young adult . History of preceding pharyngitis or evidence of septic emboli, especially to the lung may provide an additional clue to the diagnosis.
|
In the us, ~800,000 women are diagnosed with pelvic inflammatory disease (pid) each year.1 however, the us centers for disease control and prevention (cdc) estimates that more than one million women experience an episode of pid each year taking into account missed cases of pid.2 the rates of pid are concerning given the serious potential sequelae of pid, including tubal infertility, ectopic pregnancy, and chronic pelvic pain (cpp). Missed and/or improperly or inadequately treated cases of pid increase the risk of complications of pid.3 not only does the severity of these complications highlight the seriousness of the disorder, but also young women indicated that they are willing to give up 12 years of their life to prevent pid and its associated sequelae, as reported in a recent health economics study using time trade offs to assess patient utilities for the health states associated with pid in a general population sample.4 pid is an infection of the female upper reproductive tract, including the endometrium, fallopian tubes, ovaries, and pelvic peritoneum.5 sexually transmitted infections (stis), such as chlamydia trachomatis and neisseria gonorrhoeae, are commonly implicated in cases of pid, but they are not the only organisms associated with clinical disease . The diagnosis of pid is made difficult by variation in clinical manifestations: subclinical patients with pid are asymptomatic, while patients with more severe disease present with abdominal pain requiring surgical intervention.6,7 subclinical pid is defined as inflammation of the upper reproductive tract in the absence of signs and symptoms of acute pid.7 according to the cdc 2015 sexually transmitted diseases treatment guidelines, any young sexually active woman or woman at risk for stis with unexplained lower abdominal or pelvic pain and at least one of the following clinical criteria noted on pelvic examination should receive presumptive treatment for pid: cervical motion tenderness, uterine tenderness, and adnexal tenderness (table 1).8 in this review, we aim to discuss the current state of pid management and propose new strategies for optimal management . Data from the national survey of family growth (nsfg) from 2006 to 2010 showed that 5.0% of women reported being treated for pid in their lifetime.9 using secondary analysis of data from the pid evaluation and clinical health (peach) study (a multicenter, randomized control trial designed to compare outpatient and inpatient treatment regimens in women with pid7) conducted by trent et al,10 reported that 7 years after a diagnosis of pid, 21.3% of women experienced recurrent pid, 19.0% developed infertility, and 42.7% of women reported having cpp . The study of pid in younger populations has revealed that adolescents are at even greater risk of developing pid and associated complications . An estimated one in five cases of pid occur in women younger than 19 years, and in one study, adolescents and young women aged 1721 years were twice as likely as other age groups to be diagnosed with pid.11,12 the increased risk of pid in adolescents is thought to be secondary to a combination of behavioral and biological factors.13 in terms of behavioral risk, adolescents are likely to have multiple sex partners, engage in unprotected sex, and have short duration and high frequency monogamous relationships.14 biologically, adolescents have a greater proportion of surface area for microorganisms to infect.13,15 trent et al also found in the peach study that adolescents aged 19 years with recurrent pid were five times more likely to report cpp 7 years after being diagnosed with pid . Additionally, adolescents in the peach study developed recurrent pid in a shorter period of time than adult women.10 there are also significant health disparities associated with pid.1621 sutton et al1 found that the rates of pid diagnosis in black women were two to three times greater than those in white women in hospital and ambulatory settings . Consistent with this racial disparity, goyal et al12 more recently found that race was associated with a diagnosis of pid in adolescent patients evaluated in the emergency department . Furthermore, a retrospective analysis of the nsfg from 2006 to 2010 showed that women with an income of <150% of the federal poverty level as measured by the us census22 and less than a high school education have the highest self - reported frequency of pid treatment.23 prevention of pid falls broadly into the following two categories: 1) prevention of the first pid episode and 2) prevention of recurrent disease . Women who have had one episode of pid need to prevent sti infection given the relationship between recurrent stis, such as c. trachomatis and infertility.24 prevention of the first episode of pid requires early diagnosis of stis and therefore improved provider adherence to the united states preventive screening task force and cdc guidelines . In the 2015 sexually transmitted diseases treatment guidelines, the cdc recommends annual chlamydia and gonorrhea screening in all sexually active women younger than 25 years of age and in sexually active women 25 years of age and older at increased risk defined as women who have a new sex partner, those who have more than one sex partner, those whose sex partner has concurrent partners, or those with a sex partner who has an sti.25 the cdc also recommends considering regular screening for trichomonas vaginalis in women receiving care in high sti prevalence settings and women engaged in high risk behaviors, such as sex with multiple partners, exchanging sex for money or drugs, use of illicit drugs, and prior history of an sti . Women who test positive for an sti should be rescreened for stis 3 months after sti treatment, particularly if they reside in sti - prevalent communities and/or new behavioral risks are identified at the follow - up visit.8 randomized control trials of women diagnosed with c. trachomatis suggest that screening can lead to a reduction in pid incidence.26,27 unfortunately, physicians have largely failed to screen eligible women according to national standards . An analysis of the nsfg from 2006 to 2010 estimates that 40% of sexually active us women aged 1521 years were screened for c. trachomatis.28 additional concern is raised for newly recognized stis, such as mycoplasma genitalium, for which commercial testing is not yet available in the us . Several studies have demonstrated that both t. vaginalis and m. genitalium are associated with pid.29,30 not only does failure of asymptomatic sti screening lead to inadvertent spreading of and increasing the national burden of stis, but also untreated stis predispose women to pid . Screening and early treatment of stis can also decrease the incidence of subclinical pid, which has similar morbidity to acute pid . The exact incidence of subclinical pid is difficult to determine, but studies have suggested that incidence is high . In a cross - sectional study, using endometrial biopsies of women diagnosed with or at risk for stis in clinical settings, wiesenfeld et al31 detected subclinical pid in 26% of women with neisseria gonorrhoeae and 27% of women with c. trachomatis . Biopsy specimens demonstrate that subclinical pid may be as destructive to fallopian tubes as acute symptomatic pid32 and is also associated with infertility.7 given that subclinical pid lacks overt clinical signs and symptoms, asymptomatic sti screening and early treatment are critical . It is well established that patients with recurrent pid are at risk for greater reproductive sequelae than those who avoid subsequent disease . Using a scandinavian inpatient cohort of patients diagnosed with pid between 1960 and 1984, westrm similarly, using data from the peach study, trent et al10 found that women with recurrent pid were almost two times more likely to report infertility and over four times more likely to report cpp . Among women with pid, data from the peach study shows that <3 years after initial pid diagnosis, 14.5% of participants had recurrent pid, and at 7 years,> 21% had repeat pid.34 these data suggest that additional efforts to implement clinical interventions aimed at adequate treatment and prevention of recurrent disease are warranted . Damage to the female reproductive tract from pid is usually irreversible; therefore, prompt antibiotic treatment is necessary to prevent any scarring of the reproductive tract.35 treatment of pid per cdc guidance includes broad spectrum antibiotic coverage (table 2). Parenteral and oral antibiotic regimens have been found to have similar efficacy in women with mild to moderately severe pid,36,37 and smith et al38 demonstrate that inpatient hospitalization for the treatment of pid is not economically feasible; therefore, the cdc recommends oral regimens in this subgroup of patients in the outpatient setting . Inpatient treatment is recommended for patients who meet any of the following criteria: 1) unable to exclude a surgical emergency, 2) tubo - ovarian abscess, 3) pregnancy, 4) severe illness (eg, nausea, vomiting, and high fever), 5) inability to tolerate outpatient regimen, and 6) failure to respond to oral regimen with persistent and/or worsening symptoms . Additional evaluation and/or hospitalization for parenteral antibiotics may be indicated for patients who do not show clinical improvement at this time . Male sexual partners from the last 60 days should be evaluated, tested, and treated for c. trachomatis and gc . The 72-hour visit is critically important to assess the clinical status of the patient, particularly given the rise in multidrug - resistant n. gonorrhoeae . The spread of cephalosporin- resistant gc is estimated to lead to an additional 75,000 cases of pid over a 10-year period.39 these clinical scenarios are likely to be more complicated since they cannot be easily treated, further increasing the potential for reproductive health sequelae . While the cdc no longer recommends differential treatment for adolescents,8 there are limited data to support the management of early and middle adolescents in the outpatient setting . The mean age of adolescents in the peach study cohort was 18 years (sd 1 year).34 while providers struggle with the disposition plans for adolescents,40 careful consideration of developmental status, social support, and actual ability to follow or tolerate an outpatient regimen should guide these decisions.3 provider adherence to cdc treatment guidelines in the us is poor.41 in an analysis of quality improvement data from pediatric ambulatory settings within a single urban institution, trent et al42 found that only 62% of patients received treatment according to national standards . An analysis of the national hospital ambulatory medicare care survey data from 2000 to 2009 suggests a more dire national picture . Of 704,882 females aged 1421 years diagnosed with pid in us emergency departments, only 37.1% were prescribed antibiotics that adhered to the cdc guidelines.43 even more concerning results were seen in an analysis by woods et al44 in which only 6% of subjects who met diagnosis criteria of pid were correctly treated with appropriate coverage in an outpatient setting . Woods et al44 cite a disconnect between theoretical concepts and real - world applications and low overall knowledge of pid as causes of poor provider adherence to cdc treatment guidelines . Two studies, however, have demonstrated that with provider education, provider adherence to cdc guidelines can improve.45 even when providers prescribe the regimens according to national standards, patients are unlikely to strictly adhere to the prescribed treatment regimens . In an analysis using the peach study data, dunbar - jacob et al found that on average, patients with pid in the study took only 70% of the prescribed doses of medication . More specifically, patients in the peach study did not take any medication on ~25% of their outpatient days and took medications twice daily as prescribed less than half of their outpatient treatment days . Additionally, the patients in the peach study took <17% of their doses within 1113 hours of the previous dose for the twice daily treatment regimen.46 dunbar - jacob et al46 associate poor patient adherence with the length of the antibiotic course and frequency of dosing and suggest that shorter courses of less frequent dosing may improve adherence . In a study by trent et al,42 patients reported additional reasons for low adherence to medication regimens, including vomiting, loss of medication, and being told by the primary care physician to stop because of negative cultures . Patients also have difficulty adhering to recommendations to follow - up with 72 hours of diagnosis . In a study of urban adolescents, only 10% of adolescents with pid returned for follow - up evaluations within 72 hours.42 after an institutional intervention in the same setting that included provider education and treatment algorithm, provision of a 14-day course of antibiotics at discharge, detailed written discharge instructions, and telephone follow - up, 61% of adolescents reported completed all doses of the medication, 67% practiced temporary abstinence, and 86% notified their partner for treatment.42 the authors reported that the patients reasons for lack of follow - up included not being aware of the need to follow - up, no access to transportation, inability to get an appointment, and lack of a primary care provider.42 the current state of pid management approach to treatment is highly focused on self - management in outpatient settings . The use of inpatient hospitalization is expensive and simply no longer a cost - effective strategy for all women.47 there may be, however, alternative strategies that optimize the use of clinical services while continuing to reduce the cost of pid care delivery . Two potential strategies worth consideration include observation units (ous) and community health nursing . Ous are units within or adjacent to emergency departments where patients are admitted when they require additional diagnostics or therapies, but discharge is anticipated within 24 hours.48 the ou model has been found to have many benefits, including improved patient care, decreased hospital admissions, cost effectiveness, and improved emergency department efficiency.49 the model of ous has been applied to a variety of conditions, including chest pain, asthma, skin infections, and allergic reactions, and has been shown to be effective in several studies.5053 ous are increasingly being recognized as effective treatment strategies, and the use of observation status by medicare beneficiaries increased by 26% from 2006 to 2008.54 in order to reimburse for ou care, the centers for medicare and medicaid services require an observation time of at least 8 hours,55 with a maximum of 48 hours in most circumstances.56 ous have been shown to be effective in both the pediatric and adult populations . Lane et al57 performed a retrospective review of 853 patients younger than 18 years admitted for skin and soft tissue infection treatment to an ou from the emergency department between january 2003 and june 2009 . Similarly, in a randomized clinical trial of 222 patients with asthma aged 1855 years comparing treatment outcomes in an ou and an inpatient setting, similar patients treated in an ou had asthma relapse and other morbidity rates at 8 weeks equivalent to that of patients treated with standard inpatient therapy, and cost, patient satisfaction, and quality of life outcomes favored the ou approach.58 ou has been an effective model for a variety of conditions in both the pediatric and adult populations, including infectious disease, which suggests that this treatment model holds promise for the management of pid . In regard to pid, ous are likely to be more cost effective than inpatient hospitalization and could allow for significant benefits regarding medication administration, consultation, patient education, and risk reduction counseling for prevention of recurrent disease . Observing patients during a short 12-hour period allows for two medication doses to be delivered, adequate counseling, mobilization of support, and assistance with prescription filling in large institutional settings . Given the increased length of stay over the emergency department for pid care, the patient s visit would likely overlap in time with the daytime staff allowing for greater access to resources, such as social work services, hiv counseling and testing, and risk reduction counseling services . However, clinical care in ous should be time efficient because longer clinical encounters are associated with a decline in subsequent medication adherence . In a study of adolescents treated for pid in the emergency department, hill et al59 found that patients with above average length of service were significantly less adherent with their pid medications than patients with less than average length of service . Health service research is needed to evaluate the effectiveness of utilizing ous for treatment of pid with concurrent cost analyses . Another promising strategy to facilitate self - care patients with pid is community health nursing . Community health nursing has been found to be an effective risk reduction strategy in minority and low income adolescents.6065 this strategy is most well - studied in the field of maternal child health . Community health nursing is associated with decreased rates of premature birth,60,62 cesarean sections,61 pregnancy - induced hypertension,62 longer infant hospitalizations,61 child injuries,62 and greater resource utilization and prenatal care visit attendance.63 community health nursing has also shown promise in the field of stis and hiv . Preliminary data from the technology - enhanced community health nursing study have demonstrated that community health nursing combined with text messaging support is both feasible and acceptable for use in urban adolescents with pid.65 the program utilizes the sister to sister intervention,66 a cdc - approved evidence - based intervention along with text delivery of the 72 hours intervention by a trained community health nurse and text messaging support during the 14-day treatment period . While promising, research is ongoing to evaluate the impact of the intervention delivered by community health nurses on recurrent stis after pid . An additional gap in current pid prevention and treatment is the notification and treatment of male sexual partners . As mentioned earlier if treatment efforts are focused solely on females, male sexual partners will continue to propagate infections . Both strategies that we propose, ous and community health nurses, include risk reduction counseling, which includes counseling of females with pid on the importance of notifying their male sexual partners and referring them to treatment . Trent et al42 have shown that in pediatric ambulatory settings, an intervention, including nurse telephone follow - up at 2448 hours and 2 weeks following discharge with pid diagnosis, was associated with high rates of partner notification and partner receipt of treatment . Additional research will need to be conducted to evaluate the effects of risk reduction counseling on male partner notification and treatment . The current state of pid management approach to treatment is highly focused on self - management in outpatient settings . The use of inpatient hospitalization is expensive and simply no longer a cost - effective strategy for all women.47 there may be, however, alternative strategies that optimize the use of clinical services while continuing to reduce the cost of pid care delivery . Two potential strategies worth consideration include observation units (ous) and community health nursing . Ous are units within or adjacent to emergency departments where patients are admitted when they require additional diagnostics or therapies, but discharge is anticipated within 24 hours.48 the ou model has been found to have many benefits, including improved patient care, decreased hospital admissions, cost effectiveness, and improved emergency department efficiency.49 the model of ous has been applied to a variety of conditions, including chest pain, asthma, skin infections, and allergic reactions, and has been shown to be effective in several studies.5053 ous are increasingly being recognized as effective treatment strategies, and the use of observation status by medicare beneficiaries increased by 26% from 2006 to 2008.54 in order to reimburse for ou care, the centers for medicare and medicaid services require an observation time of at least 8 hours,55 with a maximum of 48 hours in most circumstances.56 ous have been shown to be effective in both the pediatric and adult populations . Lane et al57 performed a retrospective review of 853 patients younger than 18 years admitted for skin and soft tissue infection treatment to an ou from the emergency department between january 2003 and june 2009 . Similarly, in a randomized clinical trial of 222 patients with asthma aged 1855 years comparing treatment outcomes in an ou and an inpatient setting, similar patients treated in an ou had asthma relapse and other morbidity rates at 8 weeks equivalent to that of patients treated with standard inpatient therapy, and cost, patient satisfaction, and quality of life outcomes favored the ou approach.58 ou has been an effective model for a variety of conditions in both the pediatric and adult populations, including infectious disease, which suggests that this treatment model holds promise for the management of pid . In regard to pid, ous are likely to be more cost effective than inpatient hospitalization and could allow for significant benefits regarding medication administration, consultation, patient education, and risk reduction counseling for prevention of recurrent disease . Observing patients during a short 12-hour period allows for two medication doses to be delivered, adequate counseling, mobilization of support, and assistance with prescription filling in large institutional settings . Given the increased length of stay over the emergency department for pid care, the patient s visit would likely overlap in time with the daytime staff allowing for greater access to resources, such as social work services, hiv counseling and testing, and risk reduction counseling services . However, clinical care in ous should be time efficient because longer clinical encounters are associated with a decline in subsequent medication adherence . In a study of adolescents treated for pid in the emergency department, hill et al59 found that patients with above average length of service were significantly less adherent with their pid medications than patients with less than average length of service . Health service research is needed to evaluate the effectiveness of utilizing ous for treatment of pid with concurrent cost analyses . Another promising strategy to facilitate self - care patients with pid is community health nursing . Community health nursing has been found to be an effective risk reduction strategy in minority and low income adolescents.6065 this strategy is most well - studied in the field of maternal child health . Community health nursing is associated with decreased rates of premature birth,60,62 cesarean sections,61 pregnancy - induced hypertension,62 longer infant hospitalizations,61 child injuries,62 and greater resource utilization and prenatal care visit attendance.63 community health nursing has also shown promise in the field of stis and hiv . Preliminary data from the technology - enhanced community health nursing study have demonstrated that community health nursing combined with text messaging support is both feasible and acceptable for use in urban adolescents with pid.65 the program utilizes the sister to sister intervention,66 a cdc - approved evidence - based intervention along with text delivery of the 72 hours intervention by a trained community health nurse and text messaging support during the 14-day treatment period . While promising, research is ongoing to evaluate the impact of the intervention delivered by community health nurses on recurrent stis after pid . An additional gap in current pid prevention and treatment is the notification and treatment of male sexual partners . As mentioned earlier, recurrent pid is not uncommon and is associated with significant reproductive sequelae . If treatment efforts are focused solely on females, male sexual partners will continue to propagate infections . Both strategies that we propose, ous and community health nurses, include risk reduction counseling, which includes counseling of females with pid on the importance of notifying their male sexual partners and referring them to treatment . Trent et al42 have shown that in pediatric ambulatory settings, an intervention, including nurse telephone follow - up at 2448 hours and 2 weeks following discharge with pid diagnosis, was associated with high rates of partner notification and partner receipt of treatment . Additional research will need to be conducted to evaluate the effects of risk reduction counseling on male partner notification and treatment . This review of the literature has identified the need for more vigilant screening for asymptomatic stis in eligible female patients in order to prevent pid through early treatment of stis with the goal of preventing damage to the reproductive tract that predisposes patients to infertility, ectopic pregnancy, and cpp . Importantly, behavioral interventions designed to improve provider and patient adherence to cdc treatment guidelines work, but must be widely implemented for improvement in population outcomes . The authors postulate that established interventions, such as ous and community health nursing, used in new ways have promise for improving patient outcomes after pid.
|
The presence of fluid in the middle ear without symptoms or signs of infection is defined as otitis media with effusion (ome). Otitis media with effusion is different from acute otitis media because it is characterized by the presence of fluid in the middle ear accompanied by signs of acute inflammation of the middle ear (1). It is a disease caused by gram - negative and gram - positive bacterial pathogens in the middle ear of infants or children (2). In children, it is the most common cause of hearing loss and requires antibiotic therapy and surgical management . It can lead to significant side effects on hearing, and if these effects continue for a long period of time, they can cause lack of language development and speech in children (3). However, bacterial infection, eustachian tube dysfunction, allergy and immunological factors are known as major causes for this disease . Many studies have reported detection of various species of bacterial agents in middle ear effusion; haemophilus influenzae, streptococcus pneumoniae and moraxella catarrhalis have commonly been identified . The bacterial etiology of acute ome varies in different individuals, where s. pneumoniae is the most commonly found bacteria, present in 29 - 32% of cultures . Moraxella catarrhalis as a pathogen in otitis media has increased during the last two decades . In studies based on pcr, especially on patients with a negative culture this has resulted in the consideration of bacterial infections as an important factor in the pathogenesis of ome . The introduction of polymerase chain reactions (pcr) has resulted in a highly increased sensitivity and specificity of bacterial detection in middle ear effusion (5). Due to the prevalence of ome in children, we decided to investigate bacterial agents that cause diseases such as a. otitidis, h. influenzae, s. pneumonia and m. catarrhalis in these subjects . Forty - five children between one and 15 years of age were selected for this study . The main reason for this selection was that the prevalence of this disease (ome) is highest in children . Bacteriological analysis was performed on samples taken by swabbing the middle ear cavity during a cochlear implant operation . From the patients medical history, particular attention was paid to the following variables: gender, age, date of onset of ome, history of conditions such as allergies, respiratory tract infection, otitis media (acute, with effusion and recurrent acute), hearing level, and unilateral or bilateral hearing impairment . Next, the external auditory canal was cleansed by 70% alcohol for one minute and a myringotomy was conducted . Middle ear fluid has high viscosity, thus an amount of 0.5 ml of normal saline was inserted into the middle ear canal and the fluid was extracted by swabbing . Seventy middle - ear samples were collected from 45 children between one and 15 years old, who had been afflicted to ome . Each specimen was divided into two portions; one portion of the extracted middle ear fluid was transmitted into micro tubes with pbs buffer for ordinary bacterial culture and the other was stored at -70c for the pcr assay . For primary isolation of bacteria, specimens were inoculated to several culture media under aerobic conditions with 5% co2 at 35c for 24 - 72 hours according to chapin . The following culture media were used: muller hinton with 5% sheep blood agar (a. otitidis and s. pneumoniae), chocolate agar with vancomycin (5 mg / ml), clindamycin (1 g / ml) and bacitracin (300 g / ml) for h. influenzae, chocolate agar with vancomycin (5 g / ml), clindamycin (1 g / ml) and bacitracin (300 g / ml) and acetazolamide (for m. catarrhalis). Since all media were incubated at 37c, with the blood agar and chocolate agar plates in a microaerophilic atmosphere and brucella agar in aerobiosis . The genomic dna was extracted by high pure pcr template preparation kit (roche, germany). Furthermore, pcr was done with dna extracts using universal primers (table 1). The specific primers that were used for this study included; rdr125: acttttg - gcggttactctat and dg74: tgtgcctaatttaccagdat for h. influenza (5, 9, 10), str1: gatcctctaaatgattctcaggtgg and dg74: actatagaagaaaggg - aagtttcca for s. pneumonia (5, 9, 10), mca: ttggcttgtgctaaaatatc and mcat2: gtcatcgctatcattcacct for m. catarrhalis (5, 9, 10), and mer21: ctacgca - tttcaccgctacac and mer20: ggggaagaacacggatagga for a. otitidis (11 - 14). Initial denaturation at 95c for five minutes, 35 cycles of denaturation at 95c for 30 seconds, annealing at (66c for s. pneumoniae and a. otitidis, 55c for m. catarrhalis and 52c for h. influenzae) for 30 seconds, extension at 72c for 30 seconds and final extension at 72c for seven minutes were carried out using a dna thermal cycler eppendorf . Electrophoresis was used for 60 minutes in 2% agarose gel for the detection of amplified products . Specimens of this study with consistent pcr results were sequenced by the bioneer company (korea) and used as positive controls, while distilled water was used as a negative control . Seventy middle - ear samples were collected from 45 children between one and 15 years old, who had been afflicted to ome . Each specimen was divided into two portions; one portion of the extracted middle ear fluid was transmitted into micro tubes with pbs buffer for ordinary bacterial culture and the other was stored at -70c for the pcr assay . For primary isolation of bacteria, specimens were inoculated to several culture media under aerobic conditions with 5% co2 at 35c for 24 - 72 hours according to chapin . The following culture media were used: muller hinton with 5% sheep blood agar (a. otitidis and s. pneumoniae), chocolate agar with vancomycin (5 mg / ml), clindamycin (1 g / ml) and bacitracin (300 g / ml) for h. influenzae, chocolate agar with vancomycin (5 g / ml), clindamycin (1 g / ml) and bacitracin (300 g / ml) and acetazolamide (for m. catarrhalis). Since all media were incubated at 37c, with the blood agar and chocolate agar plates in a microaerophilic atmosphere and brucella agar in aerobiosis . The genomic dna was extracted by high pure pcr template preparation kit (roche, germany). Furthermore, pcr was done with dna extracts using universal primers (table 1). The specific primers that were used for this study included; rdr125: acttttg - gcggttactctat and dg74: tgtgcctaatttaccagdat for h. influenza (5, 9, 10), str1: gatcctctaaatgattctcaggtgg and dg74: actatagaagaaaggg - aagtttcca for s. pneumonia (5, 9, 10), mca: ttggcttgtgctaaaatatc and mcat2: gtcatcgctatcattcacct for m. catarrhalis (5, 9, 10), and mer21: ctacgca - tttcaccgctacac and mer20: ggggaagaacacggatagga for a. otitidis (11 - 14). Initial denaturation at 95c for five minutes, 35 cycles of denaturation at 95c for 30 seconds, annealing at (66c for s. pneumoniae and a. otitidis, 55c for m. catarrhalis and 52c for h. influenzae) for 30 seconds, extension at 72c for 30 seconds and final extension at 72c for seven minutes were carried out using a dna thermal cycler eppendorf . Electrophoresis was used for 60 minutes in 2% agarose gel for the detection of amplified products . Specimens of this study with consistent pcr results were sequenced by the bioneer company (korea) and used as positive controls, while distilled water was used as a negative control . All middle - ear samples were taken by aspiration during the surgery and were then analyzed . Based on the conventional method (culture and staining), polymorphonuclear leukocytes were not seen in any of the patients . Of the 70 samples that were obtained from 45 children with ome, the average age of onset was 4.5 years . About 20 out of 45 patients (45%) with unilateral involvement and 25 out of 45 patients (55%) with bilateral involvement had samples positive for bacterial dna . During surgery, the quality of the effusion was analyzed visually and was mucous in 32 (71.2%) children and serous in 13 (28.8%) patients . A total of 70 samples were taken from the 45 children, 25 cases were positive for bilateral presentation; it was possible to take a sample from both ears . When analyzing bilateral samples, the samples that were obtained from both sides were 100% similar . Among the 70 samples, bacterial cultures were positive in six (13.4%) samples . The microorganisms that were isolated from cultures, included: a. otitidis, m. catarrhalis and s. pneumoniae . As visualized by agarose gel electrophoresis of the pcr products, a. otitidis was the bacterium most frequently isolated; there were 18 positive samples amongst a total of 55 (25.7%), and bacterial dnas related to a. otitidis were detected in 33% and 67% of unilaterally and bilateral affected patients, respectively . Amongst 12 patients with bilateral ome caused by a. otitidis, unilateral infection was caused by h. influenzae and s. pneumoniae in one and two cases, respectively . The distribution of bacterial agents isolated from patients with ome based clinical data; sex and age are summarized in table 2 . The pcr assay results showed that 55 samples were positive for bacterial dna as tested by universal primers . In these samples, a. otitidis, h. influenzae, (%). A, 1: 50 bp dna ladder 2: negative control 3: positive control 4 - 13: samples, haemophilus influenza; b, 1: 100 bp dna ladder 2: negative control 3: positive control, 4 - 12: samples, streptococcus pneumonia; c, 1: 50 bp dna ladder 2: positive control 3 - 11: samples 12: negative control, moraxella catarrhalis; d, 1: 50 bp dna ladder 2: positive control 3 - 11: samples 12: negative control . As visualized by agarose gel electrophoresis of the pcr products, a. otitidis was the bacterium most frequently isolated; there were 18 positive samples amongst a total of 55 (25.7%), and bacterial dnas related to a. otitidis were detected in 33% and 67% of unilaterally and bilateral affected patients, respectively . Amongst 12 patients with bilateral ome caused by a. otitidis, unilateral infection was caused by h. influenzae and s. pneumoniae in one and two cases, respectively . The distribution of bacterial agents isolated from patients with ome based clinical data; sex and age are summarized in table 2 . The pcr assay results showed that 55 samples were positive for bacterial dna as tested by universal primers . In these samples, a. otitidis, h. influenzae, (%). A, 1: 50 bp dna ladder 2: negative control 3: positive control 4 - 13: samples, haemophilus influenza; b, 1: 100 bp dna ladder 2: negative control 3: positive control, 4 - 12: samples, streptococcus pneumonia; c, 1: 50 bp dna ladder 2: positive control 3 - 11: samples 12: negative control, moraxella catarrhalis; d, 1: 50 bp dna ladder 2: positive control 3 - 11: samples 12: negative control . In the pathogenesis of ome, bacterial infection has been known as an important factor, and many studies have demonstrated that a. otitidis, m. catarrhalis, s. pneumoniae and h. influenzae are the most common bacterial pathogens in this infection . It has been supposed that these bacteria are included in the normal flora of the middle ear canal (15). However, many previous studies have demonstrated that some of these bacteria, such as a. otitidis have immune - stimulatory ability (16) thus could not be part of the normal flora of this tract . Detection of these bacterial agents could be performed by pcr assay and ordinary bacterial culture . However, isolation of a. otitidis via conventional culture methods is difficult because it grows slowly and requires a special medium to grow in vitro (11). The rate of isolation of these bacteria by standard culture does not yield more than 45% . Nonetheless, when the pcr method is used the isolation rate of these bacterial agents is significantly increased and, a. otitidis is often the most common pathogen isolated (11, 16). Therefore, pcr is useful for the detection of pathogens that have slow growth rate, are difficult to culture in a diagnostic laboratory or require a special medium . Furthermore, pcr is the most functional technique for determination of the existence of pathogenic bacteria dna in culture - sterile effusions of the middle ear . Thus these bacterial agents can easily be detected by the pcr assay (4, 16). We used both methods to study the bacterial etiology of ome in 70 children under 15 years old . The average age of onset was 4.5 years and the most common age of onset was less than five years . In this study, using ordinary bacterial culture, bacteria were detected in only six (8.6%) cases, while using the pcr assay bacterial dna was detected in 55 (78.6%) cases . This rate is lower than that reported by previous studies performed in iran (17). In this study, the rate of culture positivity was 8.6% (6 out of 70 samples), while the rate of culture positivity that was reported by khoramrooz et al . Was about 47.6% (17); overall, our results were lower than other reports (4, 11, 16). M. catarrhalis was the most prevalent (4.3%) bacterial isolate among middle ear fluid samples that was detected by culture, however, our detection rate of this isolate was lower than that previously reported by khoramrooz et al . (9.5%) (17) yet similar to reports from lebanon (4%) (10). Furthermore, a. otitidis was isolated from 1.4% of samples while other studies from various regions have reported different isolation rates; iran 23.8% (17), spain 48.2% (11), turkey 58% (18), and the united states 5% and 4.7% (7). The third most isolated bacteria, by culture, from the middle ear fluid samples in this study, was s. pneumoniae (2.9%), which was isolated at lower rates than that reported by a similar study from iran 9% (17), yet similar to a study from spain 3.4% (19) and brazil 12.5% (20). However, no h. influenzae was isolated using ordinary culture in this study . Furthermore, in this study we compared pcr with culture as a possible means of obtaining evidence of bacterial involvement in this study . According to the pcr method, which confirmed the results of the culture method, a. otitidis was the most prevalent (25.7%) bacterial isolate among the middle ear fluid samples . This isolation rate was lower than that reported by a similar study from iran (17), but higher than that reported by some other studies (18.5%) (11) and lower than that reported from turkey 35% (18) and japan 60.5% (13). Using the pcr assay m. catarrhalis, s. pneumoniae and h. influenzae were detected in 12.8%, 20% and 20% of samples, respectively, and these results were somewhat similar to that reported by a study from iran (17). The specificity and sensitivity of the pcr assay was higher than the culture method in detection of bacterial infection that caused ome . There is no reasonable description for this disagreement due to the difference in the distribution of these pathogens . In conclusion, based on this study, we accepted that a. otitidis, s. pneumoniae, h. influenzae and m. catarrhalis are major bacterial pathogens in otitis media with effusion, where a. otitidis was the most often isolated bacterium in iranian children with middle ear effusion . Many studies have suggested that the remaining bacteria due to an inadequate use of antibiotics may be the cause of ome . Thus bacterial infection plays an important role in the progression of acute otitis media to ome, which in turn causes hearing loss, social malformation and high medical costs.
|
The so - called feminization of medicine is likely to have important implications in patient - physician relationship, local and societal delivery of care, and the medical profession itself . When specialty choices are examined, women are proportionately over represented in the primary care fields . They are underrepresented in most surgical fields, with the exception of obstetrics and gynecology, where women now comprise the majority of practicing physicians . Why anesthesiology is not a more popular specialty choice among women is difficult to determine . Lifestyle issues are often cited as an important consideration in the selection of a specialty for residency training, and anesthesiology is often included in lists of specialties said to be associated with favorable lifestyles . However, data indicate that anesthesiologists rank among the busiest specialists, with an average of 61 h / week committed to professional activities and an average of 59 h / week dedicated to patient care . Income expectations and personality factors gender discrimination and sexual harassment may be important factors . Some factors that may influence women on the choice of anesthesiology as a career is sparse or even no contact with anesthesiologists during the preclerkship medical school curriculum . Careers in medicine historically demanded a selfless emphasis on caring for one's patients, sometimes at the expense of one's marriage, children, and personal life . As women entering the medical field is increasing in numbers, the conflicts between career and family became more prominent . Thus, many challenges must confront woman physicians in balancing their multiple roles as physician, mother, and spouse . Women are underrepresented in anesthesia and with an effort to equalize the numbers of men and women within the medical school, one might expect the number of women entering anesthesiology to increase concomitantly mansoura is the capital city of dakahlia which is one of the most important egyptian provinces and is famous with many great medical centers . The total number of anesthesiologists in mansoura city at the time of our study was 224 and the proportion of women among them was 25.9%, and the proportion of women among the doctors in general was nearly 51% . The aim of our work was to evaluate the implications of anesthesiology as a profession on personal and family life of women anesthesiologists . We also wished to elicit the differences between academic and nonacademic women anesthesiologists with respect to these effects and the effect of women anesthesiologists on the profession . A descriptive comparative study was conducted by surveying women anesthesiologists in mansoura, egypt during the period between january and may 2013 . The survey involved woman anesthesiologists affiliated with mansoura university hospital (academic anesthesiologists) and others working in hospitals related to ministry of health at mansoura (nonacademic anesthesiologists). During the study period, a convenience sample of 51 women were recruited, and 46 agreed to participate in the study with a nearly 90% response rate . Nonparticipation was due to lack of interest in the study, absence during the study period and incomplete questionnaires . Approval to conduct our study was granted by our institution's review board and from the management of the involved hospitals . The researchers introduced themselves to participants and informed them about the aims of the study . The content validity was determined by consulting a panel of experts . To ensure reliability, the questionnaire was pretested through a pilot study on a group of doctors who were not included in the final analysis and cronbach alpha coefficient of internal consistency was 0.87 . The constructed survey instrument was finally edited in english version and consisted of four sections: the first section elicited some personal information of the respondents (sociodemographic characteristics). The second part consists of 6 items exploring the potential reflection of anesthesiology on family life of women (implications on family life), the third contains 12 items asking about the possible reflection of anesthesiology on woman personality (implications on personality and personal life) and the final section elicits 11 items reflecting the perceived impact of women on anesthesiology as a profession (job implications). The responses were coded using the variables in the responses to determine the coding guide . To facilitate quantification and analysis of data, respondents had options of strongly agree scored as five; agree scored as four; undecided scored as three; disagree scored as two and strongly disagree scored as one on a five point likert scale . Data were analyzed using spss program (statistical package for social sciences) version 13 windows (ibm, inc ., chicago, illinois, usa). Descriptive statistics (i.e., mean, frequency, percentage, and standard deviation) and inferential statistics (i.e., chi - square test, fisher's exact, and t - test) were used . For comparison in order to evaluate the agreement among academic and nonacademic, items with multiple response levels were collapsed into binomial variables of agree and disagree . A score of three (undecided) on likert scale was considered as disagree . The age of the anesthesiologists with an academic career was not significantly different from those without academic career (33.1 vs. 31.8 years). Nearly, one - fifth of our woman anesthesiologists were single (21.7%). The number of children in the two groups was not significantly different [table 1]. Sociodemographic characteristics of the studied woman anesthesiologists the implications on family life were significantly much more afflicted by an academic career compared to nonacademic career in the form of: delayed marriage (87% vs. 44%), delayed first baby (78% vs. 30%), child rearing (96% vs. 30%), maternity rights (91% vs. 26%) and poor fulfillment of family demand (83% vs. 44%) respectively [table 2]. Implications on family life among the studied woman anesthesiologists the majority of studied women reported personality changes . The positive implications on personality and personal life of anesthesiology as independence, empowerment and positive social interaction were not significantly different between the two groups . Furthermore, most of anesthesiology drawbacks on personality (aggression, nervousness, depression, stressful attitude, and drug experimentation) were significantly more cited by women with academic careers . However, the financial limitation was significantly more complained by the noncareer anesthesiologists (p = 0.032). The other negative effects observed in a large number of women in both groups were affection of feminine attitude, sense of discrimination, and poor social acceptance [table 3]. Implications on personality and personal life of among the studied woman anesthesiologists anesthesiology was perceived privileged due to women's employment in the field by soothing the work environment, more emotional reaction to patient complaints and increased perfectionism (perceived by about 91%, 89% and 76% respectively). On the other hand, findings revealed that increased conflict with the surgeons (98%), poor surgeon acceptance (87%), poor patient acceptance and recurrent change of work schedule (80% each) were the most common items perceived by women as negative implications on the field of anesthesiology as a result of women's employment . Difficult to manage night shifts was more significantly mentioned by academic career anesthesiologists compared to the others (p <0.001) [table 4]. We cannot deny that rearing and caring at home are the primary role for any woman whatever her level of education, especially in arab countries . Biologically, the most appropriate time for the woman to have children coincides with the period when career demands are most intense, making the balancing of career and family demands particularly difficult during this period . This critical period usually overlaps with the medical study and training, particularly with financial limitations and high work demands . The implications on family life were significantly much more expressed by women anesthesiologists with academic career, and more than 50% of both women groups perceived that their family life was exposed to negative implications . Although only 9% of women with delayed marriage blamed anesthesiology work as a predisposing factor for their pregnancy problems, however this needs consideration . These findings were concomitant with a previous study which reported that most doctors recommended postponing pregnancy until after the completion of training . In contrast, another survey study conducted on pediatricians found that they gave birth to their first child during residency . Our results could be explained by the fact that most of the academic career anesthesiologists have an intense schedule with teaching, research and regular or duties . The present findings were also coinciding with the study that found woman resident physicians experienced more pre - eclampsia and preterm labor than other women . Unfortunately, our results emphasized that the interest of female doctors in academic medicine is reduced . This could be explained by many concerns that may range from balancing their multiple roles to the worry of physician - mother on the child's safety while she is away from home . Furthermore, the view of some colleagues to a woman doctor's pregnancy and family commitments as evidence of a diminished dedication to medicine and career can be a contributory factor ., support some of the previous concerns by concluding that decreased academic progress was related to childbearing . The present work showed that the maternity rights were affected for more than 58% of our women anesthesiologists, and this was significantly higher among career group . In egypt, even with the presence of a law that allows 3 months of full paid maternity leave, some women - doctors due to fear of demotion in their career, are pushed to sacrifice their maternity rights . It was surprising to know that many american physicians do not take the entire 6 weeks of maternity leave to which they are entitled . This action was partly explained by the concern of their colleagues attitudes toward their staying home with their infant or by their feeling guilty about being away from their patients and work . Regarding implications on personality, the present study established that our ladies were privileged by their choosing anesthesia as a career, where most of them felt independent and empowered besides developing positive social interaction . Previous studies support our finding by demonstrating that woman had greater adaptability to clinical situations, better vigilance, perceptual speed and associative memory that might give them an edge over males to recall more details . University staff in general has a better income compared to nonacademic which is a privilege granted by higher education committee in egypt to encourage the graduated physician to be a university staff . This can partly explain the significant financial problems encountered by nonacademic anesthesiologists in comparison to those in academic careers . The sense of discrimination due to gender is considered as a major factor that has a great negative impact on our woman anesthesiologists and represents 78% in this study . Gardner et al ., have reported that although woman anesthesiologists in south africa have higher career satisfaction; gender discrimination and harassment were found to be more likely among women . In contrast, a canadian study revealed an absence of gender discrimination . Regarding the implications on profession the current study showed that around 98% of woman anesthesiologists complained from increased conflict with surgeons and this may give an explanation, not only for the high stressful attitude of two - third of our sample but also for the women perversion from anesthesia specialty . Regardless of gender bias, conflicts with surgeons could be explained by the facts that surgeons have often been perceived by other physicians with negative features such as aggressive, dominating, cold, impatient, and selfish . These conflicts were commonly attributed to poor communication, and limited contact between males and females in our culture, especially in a society like mansoura . In this study, alternative change of work schedule, delayed response to on call and difficult to manage night shifts were reported by 80%, 54% and 52% of the studied groups, respectively . One study concluded that 85% of women were more prone to modify their job tasks or alter their career for the benefit of their families and children compared to only 35% of male physicians . Job stress and its implications were so clear in our study, and this was supported by a previous egyptian study which observed more fatigue and psychological distress among anesthesiologists . Kinzl et al ., have reported that woman anesthesiologists showed higher concentration and limited possibilities to control work environments as compared to their male colleagues . It is not surprising, that our findings revealed high significant domination of an academic career over noncareer woman anesthesiologists regarding most of the anesthesiology drawbacks reflected on women, which were discussed in this study . Hence, we can use our findings to explain the results of another study, which reported that the percentage of women faculty members in all specialties who reach the designation of full professor insulates well - behind that of men, and this is definitely true for anesthesiology, the findings of our study are discouraging as literature has revealed that the healthy development of anesthesiology requires a vital increase in the number of women affiliate to academic anesthesiology . Gender disparities in academic promotion leading to less likelihood of external grant funding and fewer publications than men could be a contributory factor . Furthermore, the junior partners are assigned to more work pressures, less desirable pay and they are frequently scheduled for later hours, on weekends and during holidays . One of the major limitation is the cross - sectional design of the study that was based on self - reported questionnaires provided by women . Furthermore, the small sample size may be another limitation to detect the accurate gender associations . Also the exclusion of male's opinions from the survey; and the sociocultural factors of this study that make the number of woman anesthesiologists limited may interfere with the generalizability of our results to anesthesiologists in other societies . However, as we try to recruit most women anesthesiologists working in mansoura hospitals, the results have external validity of women working as anesthesiologists in mansoura, egypt . The study delineated the implications on the personality and family life of women who selected academic anesthesiology as a specialty and career . Furthermore, anesthesiology as a profession is significantly benefited by women joining in the academic ranks.
|
Wiihabilitation is a new idea that came about after introduction of nintendo wii fit (wii) for rehabilitation1 . The nintendo wii is a low - cost commercial gaming system that provides an attractive means of facilitating exercise2, 3 . Nintendo wii fit games encourage lower extremity movement, challenge balance, and require the player to remain in a standing position during play . The wii has been used across a variety of clinical specialties and may potentially be a useful in the rehabilitation of a wide variety of conditions . Virtual reality - based training is a feasible and suitable therapeutic intervention for dynamic balance in older adults5, 6 . The nintendo wii has been used as a tool that provides a novel way to interact with games in order to promote physical activities . It directs the user s motor response to be either specific or global to train motor abilities such as the range of motion of different limbs and whole body balance training7 . Addition of the wii balance training program to conventional exercise programs has been recommended to improve ankle muscle strength in patients with functional ankle instability at a low cost8 . It has also been reported that virtual reality programs improve the static balance and dynamic balance of subjects with functional ankle instability and can be used safely and efficiently by patients9 . The foot and ankle make up complex anatomical structures that contribute significantly to the function of the whole lower limb10 . Ankle joint stability involves co - contractions of surrounding muscles, recognized as agonist / antagonist activity, to facilitate reciprocal planar motion and protects and ensures efficient function of the joint11 . The strength ratios between antagonistic muscle groups have received considerable attention from clinicians during examinations and in monitoring of rehabilitation progress13 . Also, they are thought to be clinically relevant because co - activation of opposing muscles across a joint may be important in maintaining dynamic joint stability14 . The agonist / antagonist ratio was advocated to answer the dilemma regarding a means of more objectively evaluating and comparing the muscle balance (or imbalance) around a joint . Ratios for various muscle groups in both the upper and lower extremities have been developed and have become an improved gold standard for evaluation15 . Impaired foot function can give rise to many problems, such as strains on ligaments, poor co - ordination, and impairment of the function of the muscles12 . Injuries to the ankle account for a large portion of the injuries to the lower extremity . It has been reported that approximately 80% of ankle sprains lead to injury recurrence and instability16 . Ankle injury programs for prevention and treatment have disadvantages relating to time and cost . Repeated episodes of ankle sprain often occur despite introduction of many rehabilitation programs . Further research clearly is needed in this area in terms of both treatment and suggestions to reduce the rate of ankle sprains17 . To the knowledge of the authors, there are no previous studies investigating the effectiveness of nintendo wii fit training on muscle strength ratios of ankle muscles . Additionally, many studies have investigated the inversion / eversion ratio, but patients still suffer from ankle instability . Furthermore, it has been reported that the concentric dorsiflexion / plantar flexion strength ratio was affected in chronic ankle instability (cai) patients . Therefore, this study was conducted to investigate the effect of nintendo wii fit training on the dorsiflexion / plantar flexion strength ratio as a new concept in the field of prevention and rehabilitation of ankle injuries . Thirty- two healthy male college students from the faculty of physical therapy, cairo university, participated in the study . They were randomly assigned, using simple blind randomization by using procedures such as coin tossing into two equal groups: an experimental group (group i) and control group (group ii) (table 1table 1.general characteristics of the participants in the experimental and control groupsexperimental group (n=16)control group (n=16)age (years)19.6 1.319.6 1.6weight (kg)76.9 5.672.9 6.8height (cm)173.2 5.5171.8 5.7). Participants in group i performed the nintendo wii fit training program . Participants in group ii were instructed to avoid participation in any strength training programs until after the post - training testing . Participants were included in the study if they had good ankle muscle strength (grade four), normal flexibility of the ankle muscles, and a normal foot posture index . Participants were excluded if they had a history of previous ankle surgery or ankle injury, had a history of vestibular disorder, had previously participated in a strengthening or athletic training program, or had pronated or supinated foot postures . The foot posture index total score reference values were as follows: normal = 0 to + 5, pronated = + 6 to + 9, highly pronated 10 +, supinated = 1 to 4, and highly supinated 5 to 12 . The ethical committee of the faculty of physical therapy, cairo university, approved this study . All participants signed an informed consent form assuring that their participation was voluntary . A brief orientation session about the protocol of the study, its aims, and the tests to be performed was provided to each participant . Nintendo wii fit includes over 40 games covering strength training, yoga, aerobics, and balance . The wii training program in this study included an initial balance game (table tilt game) for 2/3 of session s total duration followed by a muscle strength game (standing rowing squat game) for 1/3 of the session s duration . The sessions lasted up to 30 minutes and were performed 3 times per week for 6 weeks . The selected games target agonist - antagonist muscle contraction specifically dorsiflexion and plantar flexion . The participant tries to move a ball into a hole in a tilting platform . The platform tilted according to weight redistribution on pressure sensors in a wii balance board (wbb). This game allowed motion in antroposterior and mediolateral directions around the ankle joint . Furthermore, it trained the participant to control the position of the center of gravity (cog) during rapid changes of body movement . The standing rowing squat game is a muscle conditioning game that requires the player to perform squats by flexing the knees from a standing position until the flexed knee reach the required level . The required level was determined by cog movement displayed on the screen as a red dot that must be kept in a blue area in the final position of each squats . They increase joint compressive forces leading to increased joint stability, increased muscle co - activation, and decreased joint shear forces18 . They also dynamically recruit most of the lower - body musculature, including the quadriceps femoris, hip extensors, hip adductors, hip abductors, and triceps surae19 . A biodex system 3 isokinetic dynamometer (biodex medical systems, shirley, ny, usa) was used for measuring the peak torques / body weight (nm / kg) of the ankle dorsiflexors and plantar flexors to calculate the dorsiflexion / plantar flexion strength ratio . Each participant was instructed to perform 5 sets of ankle plantar flexion and dorsiflexion through a 60 range of motion (rom) (from 40 plantar flexion to 20 dorsiflexion) an angular velocity of 60/sec . This is the best angular velocity for measuring muscle strength because it is easy, safe, and a large number of motor units are recruited at low angular velocities20 . The test procedures were performed twice, once before and once after the wii training program in the experimental group and at the beginning of the study and then after 6 weeks in the control group . Statistical analysis was performed with ibm spss statistics for windows version 20 (ibm corp ., armonk, ny, usa). 2 2 mixed design analysis of variance (anova) was conducted to compare the isokinetic ankle dorsiflexion / plantar flexion strength ratio between the experimental and control groups before and after the training . Initially and prior to final analysis, data were screened for normality assumption using shapiro - wilks normality test . The mean values of the ankle dorsiflexion / plantar flexion strength ratio decreased significantly (f=7.41, p=0.01) between before and after the training . The mean values of the ankle dorsiflexion / plantar flexion strength ratio were significantly decreased in the experimental group after the training when compared with before the training . However, there was no significant difference between before and after the training period in the control group (table 2table 2.comparison of the mean changes in the ankle dorsiflexion / plantar flexion strength ratio between the experimental and control groupsexperimental groupcontrol groupbeforeafterbeforeafterankle dorsiflexion / plantarflexion strength ratio (%) 78.8 31.757 18.2 * 66.1 31.758.5 28.6*significant difference within group (p<0.05)). * significant difference within group (p<0.05) nintendo wii fit was released just over six years ago as a mean of improving basic fitness and overall well - being . It has been adopted by a number of practitioners to assist in the treatment of various impairments . However, much work remained to be done to identify which type of participants would benefit from it, which system features are critical, and what types of training routine levels would work best . In addition, there have been few studies with randomized controlled designs that have investigated its effect on agonist / antagonistic muscle ratios and how this kind of training should be carried out . The results of the current study revealed a significant decrease in the ankle dorsiflexion / plantar flexion strength ratio after the training compared with before the training in the experimental group . Meanwhile, there was no significant difference between before and after the training period in the control group . This might indicate an effect caused by the wii training program as the control group did not receive training . In the present study, the decreased strength ratio can be attributed more to the increased peak torque of the plantar flexors than the dorsiflexors, as the mean sd values for the peak torque of the plantar flexors increased from 54.1 22.85 nm / kg before the training to 96.1 30.83 nm / kg after the training, an improvement of 42% . On the other hand, the mean nm / kg before the training to 55.73 15.37 nm / kg after the training, an improvement of 17.27% . This may be explained by wii training acting as a form of neuromuscular training with feedback . Neuromuscular training is defined as a multi - intervention program with a combination of balance and strength training21, 22 . It improves mechanical leg muscle strength due to training - induced gains in neuromuscular function including strength gains23, 24 . Previous literature reported that lower extremity functional retraining depends not only on lower - limb mobility and bilateral coordination, but also requires other motor skills, such as balance control21 . Therefore, better controlled movement of joint results from increased muscle strength4 . For this reason, combined strength and balance training should be incorporated into lower limb rehabilitation to augment the potential outcomes of training and rapid recovery . Moreover, the squat is considered one of the best exercises for improving quality of life because of its ability to recruit multiple muscle groups in a single maneuver26 . The squat has biomechanical and neuromuscular similarities to a wide range of athletic movements and thus is included as a core exercise in many sports routines which designed to enhance athletic performance28 . The feedback provided in wii training is very important for user motivation and positive reinforcement2 . This feedback in the form of either knowledge concerning performance or knowledge concerning results, has been found to enhance motor skill learning29 . Motion about the ankle joint is controlled by combined actions of at least one pair of opposing muscles (the tibialis anterior and gastrocnemius). Therefore, the calf muscles are important in maintaining an erect posture and have a major role in controlling the ankle joint, which is often one of the first joints to help the body restore its equilibrium after perturbation31 . Pronator weakness, evertor weakness, and calf dysfunction are all terms used to describe the cause of chronic ankle instability cai15 . Cai patients have higher ankle dorsiflexion / plantar flexion strength ratio) resulting from lower plantar flexors strength32 . In the same context, findings of the current study showed a decreased ankle dorsiflexion / plantar flexion strength ratio . For this reason, cai patients may benefit from the wii training principles, as the training program combines the benefits of balance training, closed kinetic chain exercise, and feedback effects . Neuromuscular training programs are implemented with the aim of optimizing performance, preventing injury, or providing rehabilitation in functional ankle instability patients33 . Mcguine and keene34 showed the effectiveness of neuromuscular training in reducing sport - related injury risk . Any neuromuscular training program should incorporates a variety of physical activities that supports increasing strength and balance36 . This study was limited to healthy male adults who had no ankle deficits, and it only lasted for six weeks . The selected games for the training protocol were (rowing squats and table tilt) activities from nintendo wii fit . Based on the findings of the current study, wiihabilitation is recommended as a preventive measure and treatment modality for ankle instability in sedentary individuals and athletes . Thus, the field of physical therapy may improve the rehabilitation protocol for ankle injuries by introducing wiihabilitation as a novel method for rehabilitation . Further studies should be carried with wider age categories, as this would be valuable for determining the responses of different age categories to wii training . It is recommended to explore the correlation between the effect of wii training and the results of functional performance tests . Additionally, extending the training period beyond two months may be advisable to elicit more significant effects.
|
Endoscopic surgery, either by laparoscopy or thoracoscopy, was achieved through a trocar that inserted into the cavity where the target organ was located . All surgeons were obliged to use trocars as long as they adopted the co2 gas insufflation method . Because the first trocar was always inserted through the abdominal or chest wall, a risk has always been present of inadvertently injuring an abdominal or thoracic organ, as well as the possibility of bleeding . Reusable trocars have the potential advantage of costing less than disposable trocars, if they can be used many times without losing the sharpness of the knife . Dull reusable trocars might tear the abdominal wall much more than a sharp disposable trocar on insertion . Injury on insertion of the trocar has been among the possible major complications of laparoscopic surgery . The safety shield system in which the knife popped in and out across the tip of the trocar was later developed, and this improvement has decreased injuries . However, a problem that surgeons cannot ignore has remained in regard to the procedure for inserting the trocar: bleeding from abdominal wall muscles torn by the trocar knife . Drops of blood along the trocar conceal the target organ from laparoscopic view and create problems for surgeons . In a french survey, we developed an ultrasonic (us) vibrating trocar, the sharpness of which was not diminished even with more than 900 repetitive insertions, overcoming the disadvantages of commercially available trocars, and also preventing bleeding from the tract at insertion . However, the friction due to movement of the obturator generated heat in the adjacent tissue along the insertion tract . Therefore, we examined the degree of histological damage along the insertion tract and the recovery of abdominal wall tension by comparing port - site skin tensile strength with each trocar, in a porcine model . A generator and ultrasonic vibrating trocar (olympus optical co., tokyo, japan) were used in this study . The frequency of the generator was set at 23.5 khz, the vibration amplitude at 150 m . The ultrasonic trocar is composed of an obturator, which conducts ultrasonic vibratory movements, and a trocar (figure 1). The diameter of the obturator is 12.6 mm, and the diameter of the trocar is 14.8 mm . Swine were purchased from sumichiku limited, and six 9- to 11-week - old female swine were raised on specific - pathogen - free food for young swine purchased from shimizukou feed company . General anesthesia was achieved with midazolam (yamanouchi, japan) 0.2 mg / kg and medetomidine hydrochloride (meiji seika, japan) 40 g / kg for presedation, ketamine hydrochloride (sankyo, tokyo, japan) 10 to 15 mg / kg for induction, and isoflurane (dainihon pharm . Sodium sulbactam / sodium ampicillin (1.5 g) was administered intravenously during the operation . Veterinary ampicillin was administered orally (2 g / day) for 5 days after the operation . The phantom was a block of swine muscle 200 mm x 300 mm x 35 mm . The ultrasonic trocar attached to a digital push - pull gauge (aiko engineering co., tokyo, japan, model-9500) (figure 2) was pushed into the muscle block, and the strength of the force was measured and recorded by a computer . Four trocars were compared: a new ultrasonic trocar (usn), a conventional trocar (uso) that had been inserted 900 times, a 12-mm dilating tip (dt) trocar (ethicon endosurgery, usa) and a 12-mm versaport (ve) trocar (us surgical co., tokyo, japan). The force required for insertion into the abdominal wall could be varied according to the means of insertion . Therefore, we kept in mind the necessity of arranging the times for insertion so as to be the same length, and compared the levels of force among the trocars . It took an average of 6.5 seconds to completely insert the new and conventional us trocars; the average insertion time was 6.6 seconds for the dt trocar and 6.4 seconds for the ve trocar . The average force was calculated and statistical significance was evaluated with the student t test . An 18-mm incision was made in the skin of a pig, and the us trocar, dilating tip trocar, and versaport trocar were inserted into the abdominal cavity through the incision . Trocars were then removed, and the wound was closed with 2 skin staples . Bleeding from under the skin was equally controlled by monopolar electrocautery with all 3 types of trocars . In the actual procedure, 1 vertical full - thickness skin stitch up to the muscle fascia layer was placed 1 cm from the wound line, and the suture was retracted with a digital push - pull gauge . The force at which the wound opened 5 mm was recorded as the break strength . The port site not used in the tensile strength evaluation was saved for pathological examination . The full thickness of the abdominal wall around the port was removed, fixed with formalin, and stained with hematoxylin - eosin (he). The temperature around the port site was measured and recorded with a thermal video system tvs 8000 (nihon avionics, tokyo, japan) to detect temperature elevations . Statistical analysis was performed with the student t test, and p <0.05 was considered significant . We compared the force necessary to insert the trocar through swine muscle (table 1). The new and conventional us trocar insertion forces were significantly less than the forces of the other 2 trocars, but the insertion procedure was performed in almost the same time . The dt and ve trocars required the same level of force . Required force at insertion . Usn = new us trocar; uso = conventional us trocar; dt = dilating tip trocar; ve = versaport trocar . The respective break forces at 1 and 2 weeks were 2.4 0.7 kg (n = 4) and 4.8 0.3 kg (n = 4) for the us trocar, 1.3 0.2 kg (n = 4) and 5.7 0.6 kg (n = 3), for the dt trocar; and 2.9 0.9 kg (n = 4) and 3.9 0.4 kg (n = 4) for the ve trocar (figure 3). The break forces for the us and ve trocars were higher than that of the dt trocar at 1 week, while that of the dt trocar was highest at 2 weeks . . Tensile strength at the us trocar site was greater than at the sites where the other 2 tro - cars were used . Degenerative changes caused by burning were found in the muscle tissue when the us trocar was used . No difference was found between the us and dt trocars in the epidermal layer (figure 4). The width of the scar was greater at the us port site than that at the dt port site . We measured temperature changes produced by the us trocar because the other 2 trocars did not produce friction that generated heat . Skin temperature around the port site started to increase after the trocar was inserted, and rose to 78.8c just before the peritoneum was broken . We developed an ultrasonic trocar that does not lose blade edge sharpness, and prevents the problem of bleeding . The insertion force of the new us trocar through the abdominal wall was 34% of the force required by commercially available dt trocars . We examined the force with the conventional us trocar, which had been used 900 times . The conventional us trocar insertion force decreased to only 22% less than that of the new us trocar, maintaining ease of insertion as compared with other trocars . The value of the insertion force for the conventional us trocar was only 42.3% of that of the dt trocar, and 45.8% of that of the ve trocar . The us trocar maintained its capacity even with 900 insertions, and this novel instrument had the added advantage that the heat generated by friction between the ultrasonic vibrating trocar and adjacent tissue induced protein denaturation and thereby decreased bleeding . The force of the us trocar insertion was less than that required by the dt and ve trocars . This meant that the us trocar was inserted through the abdominal wall more easily than either the dt or the ve trocar . When we did not insert the trocar smoothly through the abdominal wall, we pushed the trocar more forcefully than usual . The insertion force through the abdominal wall by the us trocar was less than that required by either the dt or the ve trocar . The us trocar had the advantage of a lower probability of abdominal organ injury when not vibrated, even when an organ was touched, because the edge of the us trocar tip was made nontraumatic in order to decrease injuries . Therefore, we speculated that the us trocar might decrease the probability of injuring an abdominal organ, or vessels, or both, and thereby decrease potentially fatal complications . This observation indicated that we had developed a reusable trocar with the advantage of cost - effectiveness . Bleeding from the port requiring conversion to open surgery was reported in 10 out of 537 cholecystectomies in the japan society of endoscopic surgery 1998 survey . We have used us tro - cars in clinical practice since 1998 and have performed 35 cholecystectomies, 5 gastrectomies, and 10 colonic resections . We have never encountered bleeding when inserting the us trocar . This advantage may be attributable to the nontraumatic tip of the us trocar, which decreased the likelihood of injuring vessels and may also be ascribed to the ultrasonic vibrating tip dividing tissues and thereby preventing vessels from being torn . The us trocar produced friction that generated heat in adjacent tissues . Despite the wider scar generated by the us trocar, as compared to the dt trocar, in he - stained specimens, the tensile strength of port site at 1 week was 2.4 kg, which was no less strong than those of the others . The strength at 2 weeks was 4.8 kg and was almost the same as the 5.7 kg achieved with the dt trocar and was stronger than the 3.9 kg achieved with the ve trocar . These findings confirmed the absence of clinical problems in regard to the tensile strength of the port site with the us trocar . However, this thermal scar might allow surgeons to add a stitch between the fascia split made by the us trocar . The skin burn injury associated with temperature elevation has the potential to delay the healing process . Shortening the time of contact between the obturator and tissue could decrease the degree of the burn injury . This was accomplished by making the trocar surface smoother and thinner, which decreased resistance during insertion and allowed the trocar to be inserted quickly . The issue of the burning effect on the peritoneum remains to be resolved, but it is anticipated that resolution will be achieved with a smoother and thinner trocar . We developed a reusable ultrasonic vibrating trocar that could be bloodlessly and smoothly inserted more than 900 times through the abdominal wall.
|
Hepatitis b virus (hbv) infection is an important global health problem [1, 2] especially in asia, africa, southern europe, and latin america . About 2 billion people are infected with hbv worldwide [47], among them, 400 million suffer chronic hbv infection . In brazil, the hbsag positivity ranges from 1.6% to 8.5%, corresponding to approximately 3 to 16 million infected individuals [813]. The residual hbv risk in screened blood transfusion ranges from 1: 10,700 to 1: 62,734 and is markedly higher compared to europe, north america [17, 18], australia, and japan . Further, the identification of blood donors with occult hbv infection (obi) individuals negative for hepatitis b antigen (hbsag) with detectable circulating hbv dna has created concern related to the safety of the blood supply [21, 22]. Hepatitis b virus continues to offer the greatest risk of transfusion - transmission infection despite hbsag screening of blood donations . Residual risk of hbv transfusion - transmission results from occult hbv infection, window period donations, and possible escape variants . There is a need to develop cost - effective algorithms using available serological and nat methods to increase blood safety without compromising the availability of blood . False - positive results in anti - hbc testing and false - negative results in nat methods can hamper the identification of occult hbv infection . In anti - hbc testing, false - positive result to anti - hbc are attributed to nonspecific reactions associated with competitive anti - hbc enzyme immunoassay, possiblly due to iga or igm - related molecules produced from nonspecifically activated hbv - specific b lymphocytes or cross - reactivity with other serum components . In donor testing using nat pooling methods, the low viral load found in most obis may affect blood safety and screening algorithms in which confirmation depends upon dna detection . The reasons for low hbv dna levels in absence of detectable hbsag in obi remain undefined, but it is conjectured that both host and viral factors are important in suppressing viral replication and maintaining control of the infection [5, 6, 23]. T - cell mediated responses contribute to the control of viral replication, protect against reinfection, and may lead to spontaneous resolution of infection in obi . Patients who successfully clear the virus present a t - cell response to hbsag, core and polymerase proteins [25, 26]. Additionally, increased hbcag- and hbeag - specific t - helper cell responses are also seen in patients with viral clearance . The t - cell response in individuals with an anti - hbc only profile showed a typical protective memory when compared to anti - hbc - negative blood donors that have not been exposed to hbv . Cellular and humoral immune response pressure against hbv envelope proteins are the principal mechanisms originating obi . In this context, the aim of this study was to develop algorithms / methods to confirm anti - hbc test results . A new method is proposed: detection of hbcag - specific t - cell responses . The blood donor population from colsan - associao beneficente de coleta de sangue (so paulo, brazil) was tested between january 2010 and october 2011 . We selected 2,126 donors found positive only for anti - hbc from a total of 125,068 donations . During the process, obi donors were identified, and their hbcag - specific t - cell response was analyzed and compared to donors with chronic (hbsag positive) and recovered (anti - hbc only) infection . As control subjects, we enrolled 100 healthy blood donors that had no reactivity for hbv including hbv pcr, and who were nonreactive for hepatitis c virus (hcv), human immunodeficiency virus (hiv), human t - lymphotropic virus (htlv), syphilis, and chagas diseases . All subjects gave their informed consent, and the study was approved by the unifesp ethical committee . Blood units collected at colsan - associao beneficente de coleta de sangue (so paulo, brazil) were screened for the presence of serum anti - hbc and hbsag using a commercial enzyme linked immune - assay (elisa) (biomrieux, france). Hbe, anti - hbe, anti - hbs, and core igm testing was performed using the elfa system (biomreiux, france). All the samples were also screened by elisa for possible hcv, htlv, hiv infections, syphilis, and chagas diseases (elisa) (biomrieux, france). Serum samples were stored at 20c and thawed immediately before use . For detection of hbv dna, dna was extracted and subsequently subjected to a commercial test for hbv - dna (cobas ampliprep / cobas taqman hbv test, v2.0) with a range from as low as 20 iu / ml to as high as 1.7 e + 08 iu / ml . Peripheral blood mononuclear cells (pbmcs) were freshly isolated from heparinized blood by ficoll - hypaque density gradient centrifugation with lymphoprep (axis - shield, oslo, norway) as previously described . Subsequently, cells were resuspended in complete rpmi-1640 medium (gibco, invitrogen, beijing, china), which contained 10% heat - inactivated fetal bovine serum (gibco, invitrogen, australia), 2 mm l - glutamine, 100 u / ml penicillin, and 100 g / ml streptomycin . T - cells were cultured at 10 cells per ml in rpmi-1640 (gibco, invitrogen, beijing, china) supplemented with 10% heat - inactivated human ab serum, 2 mmol / l l - glutamine, 100 u / ml penicillin, and 100 g / ml streptomycin and incubated overnight at 37c and 5 percent co2 . Recombinant hbcag (rhbcag) expressed in escherichia coli are based on cloned hbv dna of hbv genotypes a, b, c, d, and f was purchased from diasorin, saluggia, italy . Seventeen overlapping 20-mer peptides covering the entire hbv core sequence (amino acids 1 to 183) were synthesized with a multiple - peptide synthesizer using standard 9-fluorenylmethoxy carbonyl chemistry (syro, multisyntech, bochum, germany). Recombinant - hbcag (10 g / ml) was added, and cells were further incubated for 5 days . Control cultures included 2 g / ml phytohemagglutinin (pha), medium alone, and recombinant hcv ns5 protein, (american research products, belmont, ma). Results were expressed as counts per minute (cpm) for pha - stimulated cultures and as stimulation index (si), for example, the ratio between median cpm in the hbcag - containing cultures and median cpm of control hcv ns5-containing cultures . The 99th percentile of hbcag - specific si in 10 healthy blood donors was 2.01 . For practical purposes, the antigen used for the human ifn- elispot assays was the same used in hbcag t - cell response (rhbcag). Multiscreen - ip 96-well plates (millipore, billerica, ma) were coated overnight at 4c with 10 g / ml anti - human ifn- monoclonal antibody (1-dik; mabtech, sweden). Plates were washed seven times with dpbs and blocked with rpmi 1640 supplemented with 10% fetal bovine serum for 2 hours at room temperature . Freshly isolated or frozen - thawed after washing, 50 l of 1 g / ml biotinylated monoclonal antibody to inf- (7-b6 - 1; mabtech, sweden) was added to each well and incubated for 2 hours at room temperature; plates were subsequently washed seven times and 50 l per well of 1 g / ml streptavidin - alkaline phosphatase (mabtech, sweden) was added, and plates were further incubated for 1 hour at room temperature . Plates were washed seven times, and 100 l per well of bcip / nbt (diluted by distilled water; zymed bcip / nbt substrate kit, invitrogen, camarillo, ca) was added . After 10 minutes, the colorimetric reaction was stopped by distilled water and washed three times with distilled water . Plates were air dried, and the immunospot s4 macro analyzer (cellular technology ltd, usa) was used for spot counting . Results were expressed as numbers of spot - forming cells (sfc) per 10 pbmcs . The number of specific ifn--secreting cells was calculated by subtracting the value of the unstimulated control from the value of the stimulated sample . The positive control consisted of pbmcs stimulated with 10 g / ml of pha, and the criteria for a positive response for the ex vivo elispot assays were more than 5 sfc per well and more than twice the number of sfc than the unstipulated control well . Therefore, in this study, more than 20 sfc per 10 pbmcs would be a positive response . Comparison of paired data from patients at different times of followup was performed by wilcoxon's signed - rank test . Correlation between hbv dna and hbc - specific si was assessed by spearman's test . A total of 2,126 of 125,068 donations, (1.7%) were positive for anti - hbc, and none of them had detectable hbsag in the serum . Reactivity only hbsag was found in 125 (0.1%) donations, and hbsag plus anti - hbc was observed in 563 (0.45%) donations . Both hbsag and anti - hbc were absent in 122,254 (97.75%). Among 2,126 (hbsag/anti - hbc+) only 21 samples had detectable hbv dna . Among the 125 samples with primary infection (hbsag+/anti - hbc), 27 samples had detectable hbv dna . Among 563 samples with chronic infection (hbsag+/anti - hbc+), 438 had detectable hbv dna (figure 1). Between january 2010 and july 2010, when hbv dna screening was performed using minipools of 6 samples, we did not observe positive samples in a total of 12.000 screened samples from blood donors with hbsag and anti - hbc negative . In the 21-month study period, 21 blood donors with anti - hbc alone profile were identified as obi (1 in each 5955 donors). In the same period, the number of blood donors with reactivity for hbsag and anti - hbc was 113 (1 in each 1106 blood donors). Among the group of 2,126 samples with anti - hbc only, test reactivity (represented as co / s) ranged between 0.008 and 0,975 . The samples were divided in two groups based on a threshold of co / s = 0.1 and further tested for hbv dna . 21 samples had hbv dna detectable and co / s 0.1 and then was classified as obi, and 2,105 anti - hbc only segregating into 1,293 anti - hbc co / s 0.1 and 812 co / s <0.1 (figure 1). The specificity of the anti - hbc response in these two groups of anti - hbc only samples was investigated further by analyzing the hbcag t - cell response through t lymphocyte proliferation and inf- response to specific and nonspecific stimuli . The proliferative response of peripheral blood lymphocytes to nonspecific (pha) and specific stimuli (hbv core antigen; hcv ns5 antigen) was analyzed in hbv carriers, obi, healthy donors, and two groups based on a threshold of co / s 0.1 and co / s 0.1 . The relevant finding was the observation that anti - hbc only subjects with co / s 0.1 (n = 1.293) did not have either hbcag - specific t - cells or detectable hbv dna in any analyzed samples . False - positives for anti - hbc, corroborated by the absence of reactivity to anti - hbc in the subsequent donations . The median signal value obtained in the false - positive group was equal to healthy blood donors (si <3,0). All anti - hbc only with co / s 0.1 (n = 833) presented hbcag - specific t - cell responses; however, 21 out of 833 presented detectable hbv dna (obi). The median si obtained in hbv carriers and the obi group was 13,6 and 12,2, respectively . The subjects (n = 812) with co / s 0.1 and hbcag t - cell response and undetectable hbv dna are classified as spontaneous hbv resolvers . Spontaneous hbv resolvers showed a large peripheral blood mononuclear cell (pbmc) response (si = 36,2) to hbcag when compared to hbv carriers and obi (si = 12,2) (p <0.001) (figure 2). In the subset of 21 obi subjects, 9 collected samples viral load was quantified in all donations and fluctuated between <10 and 118 iu / ml, whereas in three samples hbv dna was not detected, but hbcag t - cell response remained positive in all the study period (figure 3). Elispot - inf- assays were positive in hbc only with co / s 0.1, obi, and positive control . The magnitude of t - cell responses to hbcag in hbc only with co / s 0.1 ranged from 1,020 to 1,628 iscs/10 pbmcs, whereas among obi ranged from 132 to 548 iscs/10 pbmcs, among positive controls from 160 to 582 iscs/10 pbmcs, and among hbc only co / s> 0.1 and healthy blood donors from 8 to 15 iscs/10 pbmcs . The frequency of positive ifn- elispot responses in spontaneous hbv resolvers indicated a higher chance to have demonstrable hbv - specific t - cell responses than among positive controls (p <0.001) and among obi (p <0.001) (figure 4). Serological markers of hbv exposure or vaccination (anti - hbs) were observed in 9.1% (3/40) from primary infection (hbv carriers); 21% (21/100) of healthy donors; 23,5% (303/1293) of hbc only with co / s 0.1; 32.4% (263/812) of hbc only with co / s 0.1; and 10,2% in obi . Reactivity to igm anti - core was observed in 2.5% (1/40) and 5.0% (2/21) of hbv carriers and obi, respectively . Hbe antigen was observed in all blood donors with obi and in hbv carriers but not in healthy donors and hbc only . However, 10.5% (2/21) of obi and 12.5% of (5/40) hbv carriers showed anti - hbe - positive . In healthy donors and hbc only, no reactivity to anti - hbe and core igm was observed (figure 5). Hepatitis b virus presents a higher residual risk of transmission by transfusion than hepatitis c virus (hcv) or human immunodeficiency virus (hiv), especially in countries of south america, like brazil, where the prevalence of hbsag in the general population ranges from 2 to 20% . In this study we found hbv dna detectable in 21.6% of blood donors with primary infection (hbsag (+) anti - hbc () and 77.8% of chronic blood donors (hbsag (+) anti - hbc (+)). These data are consistent with the observation by several authors about hbv persistence in chronic infection [29, 30]. The persistence of hbv dna was observed like obi in 0.98% of the 1.7% of blood donors which were anti - hbc positive, corroborating results of previous studies that observed 3.3% obi subjects into of 5.6% of blood donors with anti - hbc alone profile . The same assays for detection of hbsag and anti - hbc were used in both studies, and the detection limit in hbv dna pcr was similar . In the general blood donor population, the prevalence of obi in this study was 1 in 5,955 (0.017%), and, in the same period, hbv carrier rate was 1 in 1,106 blood donors . The obi among blood donors varies from country to country in different parts of the world . For example, in the european countries such as poland, italy, spain, and germany, the obi prevalence rates of 0.006%, 0.22%, 0.05%, and 0.0006%, respectively, have been reported by candotti et al . . In addition, it seems that the prevalence of obi in blood donors has a regional variance, not only internationally but also nationally . This national discrepancy can be observed in brazil, where hbv prevalence differs regionally, varying from 27% in the north east to 275.6% in north west . In this context, testing for anti - hbc is important, principally in the detection of cases where hbsag is negative and hbv dna detectable (obi). However, a high frequency of reactivity to anti - hbc is observed in brazil ranging from 1.0% to 5.0% in northeast, midwest, southeast, and south of brazil but can reach alarming levels of 75.6% in the amazonia region . In this study, we observed a 1.7% of frequency of reactivity to anti - hbc in the absence of hbsag, according with frequency found in southeast of brazil . However, the presence of hbv dna observed was low representing only 0.98% of the 1.7% of anti - hbc only blood donors . These data raise the question what is the meaning of anti - hbc reactivity in absence of detectable hbv dna in blood donors? In the serological routine in blood bank, it is not uncommon to find isolated reactivity for anti - hbc and hbv dna undetectable in first donation followed by nonreactive anti - hbc results in the next donation, suggesting that the initial result was false - positive . The determination of the frequency of true anti - hbc only in blood donors is very important to blood safety strategy and to indentify recovered infection, escape mutants, and obi . Algorithms including multiple successive assays are necessary but not sufficient to identify true reactivity to anti - hbc . To overcome this difficulty, japanese blood banks have set up an anti - hbc cutoff agglutination title of 32 and, below this level, donations are considered noninfectious (presumably false - positive or with undetectable anti - hbs). Actually japanese blood bank defers all donors with any reactive result for anti - hbc . In this study we had relevant findings about the correlation between threshold (co / s) values in anti - hbc competition assay and hbv dna detection . Among anti - hbc only subjects with detectable hbv dna, all had co / s 0,1 . However, among blood donors with co / s> 0.1, none had detectable hbv dna . Distinguishing in this group between hbv exposure and false - positive to anti - hbc appears to be defined by the hbcag t - cell response . We found that, among the anti - hbc only group with co / s <0.1, and in the presence of hbv dna, all donors had a response for hbcag t - cell in all subjects that we classified as occult hbv infection . In anti - hbc only co / s> 0.1 and in the absence of hbv dna when there was an hbcag t - cell response, we classified these individuals as having spontaneous hbv clearance, and in absence of hbcag t - cell response we classified them as false - positive to anti - hbc . These findings are corroborated by the difference in magnitude of hbcag t - cell response between the groups (hbv carriers and healthy groups), obi subjects with serial collected samples and elispot - inf- data . We found a large hbcag t - cell response for spontaneous hbv clearance, positive controls, and obi, all subjects with previous hbv exposure when compared healthy group . We observed hbv dna fluctuation in 9 cases of obi with serial collected samples; however, the presence of hbcag t - cell response was observed in all serially collected samples . In the follow - up of cases of obi, we observed fluctuation of viral load but the hbcag t - cell response was always positive . This is very important to the identification of obi because it eliminates several problems that are due to false results in hbv dna detection, like viral load, assay sensitivity, fluctuation of viral load, repeat of the hbv dna detection, and other factors (mutant, variants, mosaic, and quasispecies). In the other 11 remaining obis, we observed linear hbv dna detection in two subsequent donations . These blood donors will be followed for more two donations, and the results will be analyzed . In transfusion medicine, assays to detect anti - hbc hbcag specific t - cell response showed high sensibility in distinguishing true positive for false - positive to anti - hbc . The results observed in hbcag- t - cell response corroborate with elispot - inf- data . We observed that spontaneous hbv resolvers presented higher frequency of positivity in this assay when compared to hbv carrier, healthy donors, anti - hbc false - positive results, and obi (p> 0.001). In addition, the magnitude of t - cell responses to hbcag in hbv spontaneous resolvers was clearly higher when compared to hbv carriers, healthy donors, anti - hbc false - positive results, and obi (p> 0.001). These data suggest that antibody titers indeed correlated with hbcag- t - cell response and elispot - inf-. The presence of immune response was found in elispot - inf- in spontaneous hbv resolvers, and obi and hbv carriers are according to findings of zerbini et al . Who reported that the presence of memory t - cell response in anti - hbc positive individuals with obi could be important for maintaining viremia under control but persistent . Despite all the evidence pointing to efficiency of hbcag t - cell response to confirm anti - hbc result in the competition assay, the discrepancy of hbcag t - cell response in the obi and positive groups when compared to findings of zerbini and cols in 2008 and bes and cols in 2012 was an important point to elucidate . We suggest that the discrepancy between our results and these researchers could be principally due to process of selection of study groups, because if we introduce the group classified for us as false - positive to anti - hbc, the magnitude of hbcag t - cell response is equal between obi and positive control, if it is considered to be the median of stimulation index found in true positive and false - positive to anti - hbc, agreeing with zerbini and bes studies . Hbcag t - cell response proved to be an important test to eliminate false - positive results for anti - hbc and that could be used in the research and in blood bank routine . In brazil, the cost of discarding anti - hbc false - positive donation is high, and the cost to use hbcag t - cell response in the laboratory that had previous laminar flow cabinet and co2 incubator is low, five times smaller than the cost of false - positive donation . We cannot forget the stigma in the donor to receive a result with positive serology and indirect cost for the public health service to conduct additional tests in order to confirm the positive anti - hbc result . The presence of hbcag t - cell response in the absence of hbv dna in cases of obi suggests that hbcag t - cell response could be a complementary or in specific cases an alternative to nat . Even with detecting other serological markers of hepatitis b like core igm, hbeag, anti - hbe and anti - hbs, the identification of obi in anti - hbc only is difficult . Firstly, we investigated the concentration of anti - hbs in obi, spontaneous hbv resolvers, and hbv carrier, and we observed that frequency was 10.2%, 32,4%, and 9.1%, respectively . Several studies showed that some individuals with obi or hbv, who have recovered from hbv infection, produce neutralizing anti - hbs . In these same individuals we may observe continuous hbv dna replication at low levels that are detectable for years in the liver, peripheral blood mononuclear cells or serum [32, 33, 3639]. The frequency of anti - hbs found in spontaneous hbv resolvers was higher than hbv carriers and obi probably due to important immunity role of anti - hbs in protection against hbv infection . The presence of anti - hbs in obi has been reported by many authors with frequency varying from 0.5% to 15% still tested positive for serum hbv dna, through at a very low titer which is in accordance according with our findings in this study . Another serological marker studied was anti - hbe, an important marker of hbv chronic carriage . We observed in obi (10.5%) and hbv carrier (12.9%) the presence of anti - hbe in lower concentration when compared to levels of anti - hbc . This data could be explained by the variable proportion of samples with hbc alone profile, in which anti - hbe is detected . Although, with lower titers of anti - hbe compared to anti - hbc, there comes a point when the former is no longer detectable, leaving the latter as the only serological marker of infection . Hbeag was observed in all blood donors with viremia, including obi and hbv carrier . Igm anti - hbc is the first antibody detectable in acute hbv infection, which is usually detected within 1 month after appearance of hbsag . The presence of igm anti - hbc with high index value usually indicates a recent hbv infection, and this antibody usually disappears within 6 months . However, the index value of igm anti - hbc may increase to levels usually detectable in acute infection in 1020% of chronic hepatitis b patients with acute exacerbation or hepatitis flare that often leads to a misdiagnosis of acute hepatitis b . In our study we observed that the frequency of high index value of igm anti - hbc was 5.0% in obi and 2.5% in hbv carrier, suggesting a recent hbv infection . Our data suggest that hbcag - specific t - cell response could be used to confirm anti - hbc serological status distinguish previous exposure to hepatitis b virus and anti - hbc false - positive.
|
The national statistical office (2015) anticipates the elderly population to reach 15.7% (8.08 million) in 2020 and 40% or more in 2060 . Considering current state compared to statistical change the disabled older person showed symptoms of high level of dependence, anxiety, phobia, depression, and deterioration of health, low level of satisfaction towards living, and insufficient economic standard of living (kim, 1996; lee, 2010; song, 2011). In addition, older persons with disability had problems with maintaining activities of daily living as well as instrumental activities of daily living . Many studies showed that physical activity is an essential part for improving quality of life in later lives . Regular physical activity is an efficient means that has roles of primary prevention and secondary prevention which diminish manifestation of chronic disease such as diabetes, cardiovascular disease, cancer, osteoporosis . This also has functional ability improvement, elevation of muscular strength, alleviation of depression, and stress for physically challenged people . Physical activity is prominent for enhancing ability in daily lives, personal health - promotion and affects psychological aspects positively such as improvement of self - esteem and self - efficacy (fernandez and petetti, 1993; graham and reid, 2000; hicks et al ., 2003; sherrill, 2004). People with disabilities are living longer as they typically have better health care and support than in earlier years . However, many studies showed that people with disabilities are less likely to engage in regular moderate physical activity than people without disabilities, yet they have similar needs to promote their health and prevent unnecessary disease . In the united states, only 25% of physically disabled older adults participate in recommended physical activities . Likewise, practical participation rate of physical activities is trivial compared to its beneficial effects . Under consideration of current state,, there was few research regarding older adults with disability and restrictions of physical activity participation . However, there were a few studies discussing about adults with disability and barriers for participating physical activity . For example, ku and kim (2011) found that weather, tiredness, physical condition, lack of information, accessibility, convenience, lack of information were reasons not to participate in physical activity . In addition, koo and oh (2012) reported that shortage of facilities, economical difficulty, lack of time, inconvenience of getting transportation were main factors that put limits on the disabled adults participating in physical activities . These complicated conditions make worsen to regularly participate in any form of physical activity and there are not many studies looking at factors related to physical activities . Therefore, it was very necessary to find out barriers and difficult factors affecting physical activity participation in older persons with disability to promote the physical activities for in their lives . In particular, not only looking at how many a particular concept appears in the text but also examining the relationship between each concept using the structural analysis might be necessary . Therefore, the purpose of this study was to find out factors to hinder older adults with disability to participate in physical activity by analyzing keywords based on barriers of physical activity participation as well as their connected patterns employing keyword network analysis . The study results would help us to grasp the real meaning of the messages from older adults with disability and to visually understand the relationship between the important concepts . Additionally, results from the study will utilize to develop strategies for promoting physical activity participation for older adults with disability . Two hundred twenty - nine older adults with disability who were over 65 including aging with disability and disability with aging in type of physical disability and brain lesions defined by disabled person welfare law partook in the open questionnaire assessing barriers to participate in physical activity . Demographic characteristic of the participants represented 129 males, 100 females by gender and 76 people of 6569 years old, 72 people of 7074 years old, 48 people of 7579 years old, and 33 people of 80 years old or more by age . By types of disability, it demonstrated 48 people for brain lesions, 171 people for physical disability, and 10 for other disability . An open questionnaire was used to acquire barriers to participate in physical activities in older adults with disability . The researchers conducted questionnaire configurations literature analysis (kasser and lytle, 2005; korean paralympic committee, 2011; rimmer et al ., 2004) and the questionnaire was modified and fabricated through the inter - meeting - related two professionals in the area of adapted physical activity and physical activity with older adults . Next, it confirmed the primary keyword based on the questionnaire in order to carry out the purposes of this study, duplicate or means were reanalyzed the same word . Krtitle (co - occurrence) frequency to the text analyzed by the network matrix . Also it was used to visualize and analyze the connections centrality by nodexl (ver . 1 . Network analysis is a method for a visual representation to identify the relationship between structure and properties of the connection centered on the interaction of the object for communication as one of the social analysis methodology interstate quantitatively (kim and ko, 2004). In recent years, it was gradually increasing its scope, ranging from the social sciences, applied sciences, and management . Techniques to interpret the phenomena displayed by a network of relationships between words appearing in the text; analyze the network (choi and park, 2011; sim, 2011). And the language and knowledge made through each word is a methodology that the network configuration between the networks (sowa, 1984) is based on the perception that the relationship between language and the language encoding (popping, 2000). In the sociological part has adopted a text link analysis and network analysis techniques, widely used in promoting understanding of such phenomena and research about him (cho, 2011). The keywords of the data collected in the network analysis appeared in the form of a matrix, it was used if there was a relationship between the objects shown as 1, otherwise, the analysis method shown to zero . The term node refers to keywords, relationship between the criteria used with the paper, it meant a topic . It calculated as the number of links connected to a node for the central value and it was higher in the central connection network that represents a lot of connections with many other nodes . Next, a node measures the degree to which position on the shortest path between other node, different groups or nodes joining the cluster, the more the parameters were higher centrality . It was also described as a parameter representing the degree centrality of the mediator or mediator role of a point in the network . Therefore, the central connection, identify the number of links connected to the node degree, was connected to the central high means that the relationship with other nodes were high . Centrality parameter was intended to mean the extent to which the position on a shortest path between the node and the node . Two hundred twenty - nine older adults with disability who were over 65 including aging with disability and disability with aging in type of physical disability and brain lesions defined by disabled person welfare law partook in the open questionnaire assessing barriers to participate in physical activity . Demographic characteristic of the participants represented 129 males, 100 females by gender and 76 people of 6569 years old, 72 people of 7074 years old, 48 people of 7579 years old, and 33 people of 80 years old or more by age . By types of disability, it demonstrated 48 people for brain lesions, 171 people for physical disability, and 10 for other disability . An open questionnaire was used to acquire barriers to participate in physical activities in older adults with disability . The researchers conducted questionnaire configurations literature analysis (kasser and lytle, 2005; korean paralympic committee, 2011; rimmer et al ., 2004) and the questionnaire was modified and fabricated through the inter - meeting - related two professionals in the area of adapted physical activity and physical activity with older adults . Next, it confirmed the primary keyword based on the questionnaire in order to carry out the purposes of this study, duplicate or means were reanalyzed the same word . Krtitle (co - occurrence) frequency to the text analyzed by the network matrix . 1 . Network analysis is a method for a visual representation to identify the relationship between structure and properties of the connection centered on the interaction of the object for communication as one of the social analysis methodology interstate quantitatively (kim and ko, 2004). In recent years, it was gradually increasing its scope, ranging from the social sciences, applied sciences, and management . Techniques to interpret the phenomena displayed by a network of relationships between words appearing in the text; analyze the network (choi and park, 2011; sim, 2011). And the language and knowledge made through each word is a methodology that the network configuration between the networks (sowa, 1984) is based on the perception that the relationship between language and the language encoding (popping, 2000). In the sociological part has adopted a text link analysis and network analysis techniques, widely used in promoting understanding of such phenomena and research about him (cho, 2011). The keywords of the data collected in the network analysis appeared in the form of a matrix, it was used if there was a relationship between the objects shown as 1, otherwise, the analysis method shown to zero . The term node refers to keywords, relationship between the criteria used with the paper, it meant a topic . It calculated as the number of links connected to a node for the central value and it was higher in the central connection network that represents a lot of connections with many other nodes . Next, a node measures the degree to which position on the shortest path between other node, different groups or nodes joining the cluster, the more the parameters were higher centrality . It was also described as a parameter representing the degree centrality of the mediator or mediator role of a point in the network . Therefore, the central connection, identify the number of links connected to the node degree, was connected to the central high means that the relationship with other nodes were high . Centrality parameter was intended to mean the extent to which the position on a shortest path between the node and the node . Traffic which was total of 21 times (3.47%) and the same proportion as in the personal and economical. Looking at the top ten item showed high price, state policy, cost, feeling, chance, weather, helper in order . It was the total keyword more than eight times shown, in 49 items, it had been used 605 times (table 1). It was the same and represented an illustration of the central node and related thereto, and represented the degree used with both keywords . In the connectivity analysis, according to the various terms it had been made around the in addition, it was confirmed that the two groups formed in each area (fig . 2). Any keyword could be represented as a network . At a basic level, the keywords, or the concepts were the nodes, and their relations were the edges of the network . Once a keyword was represented as a network, a wide range of tools from network and graph analysis could be used to perform quantitive analysis . As we could see, exercise was the central term in this text and it was also adjacent to the most words in the network . The term disabled, facility, athletic, and traffic had a high degree . And lower betweenness centrality words helper, weather, feeling, which had a lower degree measure . This indicated that the words disabled, athletic, gym, leisure sports, chance, program, facility, traffic, and inconvenience are an important local hub that binded together a cluster of terms . The term exercise, traffic, facility, athletic, disabled, and wheelchair had a relatively high in and out degree for its high betweenness centrality . That could indicate that the term exercise it is used more to connect contextual clusters together than define a certain context within the text (table 2). Average degree was obtained by dividing the total number of edges by the number of nodes (newman, 2010), showing how many connections (on average) each word had to other unique words in the keyword . A lower number could also be obtained if the algorithm used for keyword scanning did not make connections between the paragraphs and the paragraphs were short (thus indicating dispersed paragraph structure within a keyword). So it could be safely said that this keyword s connectivity was relatively medium and a few but significant number of concepts function as the central, more frequently used ones . The purpose of this study was to find out restriction factors for participating physical activities in older adults with disability and to provide basic data for developing physical activity participation strategies for them . Data were collected through the open questionnaire and were analyzed utilizing the keyword network analysis . Based on the analysis, exercise was considered the most central keywork for participating in physical activity and keywords such as facility, physical activity, disability, program, transportation, gym, discomfort, opportunity, and leisure activity were associated with exercise . These results demonstrated that older adults with disability did understand physical activity as exercise which was very closely related to health instead of understanding a concept of physical activity as all movements including everyday activities such as washing dishes, cleaning, etc . In other words, older adults with disability had more difficulties when they tried to regularly participated in physical activity which was more planned and it could not be revealed in the previous studies (koo and oh, 2012; ku and kim, 2011). The study showed that exercise, the central keyword, was very closely related to the words such as gym, program, inconvenience, leisure sports, and chances . If we looked at this a little more closely, older adults with disability had difficulties to participate in physical activity in the context of social and physical environment such as lack of opportunities and inconvenience using facilities, programs, etc due to individual s physical function and abnormalities . Ultimately, older people with physical disability recognized exercise as a physical activity instead of a true meaning of physical activity . That leaded older adults with disability perceived their personal physical and environmental problems were barriers to participate in physical activity . Therefore, in order to promote the appropriate physical activity, education and pubic relations about physical activity should be delivered to older persons with disability and it was very necessary to develop a system that was providing more opportunities for physical activity participation and decreasing inconvenience in facilities, programs, and transportation . It is very helpful to understand to promote physical activity for older adults with disability if a future study employs theoretical model because older persons with disability have their own stage of physical activity awareness and readiness of physical activity . In addition, to draw continuous physical activity participation, there is need to make promoted exercise environment from the physical activity planning stages and systemized the management is also needed . First, studies of motivation related to physical activity will be needed based on elderly with physical disabilities exercise constraints . Second, employing a more realistic and effective measures in the area of the policy research for older adults with disabilities should be conducted.
|
Autoimmune hepatitis (aih) is an immune - mediated chronic liver disease characterized by hepatocellular inflammation, necrosis, and fibrosis, which can progress to cirrhosis and fulminant hepatic failure if left untreated . Aih has a female predominance occurring in all ages and races, and both the median and mean age of initial disease presentation are in the forties, similar to many other autoimmune diseases . Diagnostic criteria are based on demonstration of characteristic autoantibodies, elevated immunoglobulins, and histological features of hepatitis in the absence of viral liver disease . Standard treatment of aih includes corticosteroids alone or in combination with azathioprine (aza) that aims at the normalization of transaminase and immunoglobulin g (igg) levels in serum which correlate with histological disease activity . It is reported that although majority of the patients respond well to the standard therapies, about 20% of patients do not due to either intolerance or refractory disease . In treatment failure, alternative immunosuppressive and biological agents including mycophenolate mofetil (mmf), tacrolimus, cyclosporine and anti tnf antibodies should be considered . The patient we report here is a 48-year old woman who was diagnosed with autoimmune hepatitis and was treated with standard therapy corticosteroids and aza . However, she could not tolerate the side effect of aza induced pancytopenia and skin rash . Mmf in combination with corticosteroid was opted as second - line treatment and the patient was able to achieve remission with these treatments . A 48 year - old woman was admitted to department of hepatology due to fatigue and jaundice which lasted for approximately 10 days . She had history of heavy drinking (60 g of alcohol every day) and herbal tea intake (solomons seal tea twice a week) for recent 6 months . On physical examination, icteric sclera was observed but there was neither hepatomegaly nor splenomegaly . Upon admission, the laboratory findings were as follows: alanine aminotransferase (alt) level 472 iu / l, aspartate aminotransferase (ast) level 556 iu / l, alkaline phosphatase (alp) 123 iu / l, total bilirubin 3.44 mg / dl, direct bilirubin 1.91 mg / dl and prothrombin time internal normalisation ratio (inr) 1.05 . Viral markers including hepatitis a antibody immunoglobulin m (hav ab igm), hepatitis b surface antigen (hbsag) and hepatitis c antibody (hcv ab) were negative . Since the patient was a middle aged woman, further assessments to rule out autoimmune hepatitis were also performed . Anti - smooth muscle antibody (sma) and antinuclear antibody (ana) were positive with the ratio of 1:640 for ana and igg was increased to 1,940 mg / dl . Liver biopsy was performed and the histologic findings revealed mild portal inflammation with lymphoplasmacytic, neutrophilic and eosinophilic infiltration along with minimal interface activity (fig . 1). As the histologic findings were not typical for autoimmune hepatitis along with spontaneous slow decrease in ast (48 iu / l) and total bilirubin (0.64 mg / dl) levels the patient was followed up as out - patient without treatment . Follow up ana was positive with the ratio of 1:1,280 and igg level was further elevated to 2,420 mg / dl (fig . 2a, b). Based on the lab findings and fluctuation of ast and alt levels, diagnosis of autoimmune hepatitis type she was initially prescribed with prednisolone 30 mg which was tapered to 5 mg in in 4 months and was maintained in combination with aza 25 mg daily . The patient showed treatment response with decrease in serum ast and alt levels along with decrease in total igg levels after 3 months of treatment (fig . After 3 months of maintenance treatment, aza - related side effect, pancytopenia and alopecia developed . Hemoglobin level decreased to 9.6 g / dl, white blood cell count decreased to 2,150 mm/l (absolute neutrophil count 377 mm/l) and platelet count decreased to 82,000 mm/l (fig . 2c). Furthermore, hair loss occurred 2 months after treatment with aza which aggravated until the patient had to wear a wig . Therefore, aza was discontinued after 5 months of treatment and was maintained on 5 mg of prednisolone daily . After discontinuation of aza, complete blood count returned to normal range within 1 month while hair growth returned to normal 2 months later . Although the symptoms subsided after quitting aza, there were wax and wane in ast and alt levels after 27 months of steroid monotherapy, exacerbation of aih occurred . The steroid dose was escalated to 30 mg again in combination with 50 mg of azathioprine . Unfortunately, after 20 days of combination treatment, aza - related side effect occurred again, especially severe alopecia was noted, unabling the patient to maintain on standard treatment . As remission was not achieved with first - line treatment, steroid monotherapy was maintained for another 2 months which was decreased to 15 mg during that duration and mmf 1 g per day was added thereafter . After administration of mmf, her symptoms had subsided and normalization of liver enzymes and igg level was achieved . The patient is still on 5 mg of steroid and 500 mg of mmf and is stable for 12 months after the acute exacerbation of aih . Autoimmune hepatitis (aih) was first reported in 1951 as a fluctuating persistent hepatitis of young woman with marked elevations of serum immunoglobulins . The median and mean age of initial disease presentation are in the forties and the etiology of aih is unknown, but it carries all features of an autoimmune disease: genetic predisposition, spontaneous disease fluctuations, circulating autoantibodies, auto - reactive t cells, inflammatory infiltrations in liver, and a good response to immunosuppressive agents [1,5,7 - 9]. Aih can be diagnosed when compatible clinical signs and symptoms, laboratory abnormalities (increased serum ast or alt, and total igg), serological (autoantibodies), and histological (interface hepatitis, lymphocytic and lymphoplasmacytic infiltrates in portal tracts and extending in the lobule, hepatic rosette formation, or chronic hepatitis with lymphocytic infiltration) findings are present; and other conditions that can cause chronic hepatitis, including viral, metabolic, cholestatic, hereditary, and drug - induced diseases, have been excluded . Studies reported that when aih is left untreated, as many as 40% of the patients with severe disease die within 6 months and of the remaining 40% develop cirrhosis . Therefore, when clinical, laboratory or histologic features of active liver inflammation is present, immunosuppressive treatment should be initiated . Standard treatment includes corticosteroids alone or in combination with aza that aims at the normalization of transaminase and igg levels in serum which correlate with histological disease activity . In adults with aih, standard treatment can be started with prednisolone (starting with 30 mg daily and tapering down to 10 mg daily within 4 weeks) in combination with azathioprine (50 mg daily or 1 - 2 mg / kg body weight) or prednisolone alone (starting with 40 - 60 mg daily and tapering down to 20 mg daily within 4 weeks). Although most of the patients respond very well to immunosuppressive treatment, 20% of patients do not respond to or are intolerant to standard therapy . The overall frequency of aza - related side effect is 10%, which can be improved after dose reduction or discontinuation . Aza is a non - selective immunosuppressant that acts by inhibition of several enzymes involved in purine synthesis and this contributes to side effects including bone marrow suppression, nausea, rash, alopecia, arthralgias, neoplastic and malabsorption . The frequency of cytopenia in azathioprine treated patients with autoimmune hepatitis is 46%, and the occurrence of severe hematologic abnormalities is 6% . Thiopurine s - methyltransferase (tpmt) is part of a cascade of enzymes responsible for the metabolism of thioprine drugs including aza, 6-mercaptopurine (6-mp) and 6 thioguanine (6-tg). Some studies reported that activity of tpmt could be used to predict those who would respond to treatment and those who would show hematologic side effects as the patients with deficient tpmt activity are at severe risk of developing bone marrow suppression [15 - 17]. However, tpmt testing is not routinely performed as it is time consuming and not widely available in the past 15 years alternative immunosuppressive and biological agents for those who cannot tolerate standard treatment were evaluated . Unfortunately, the treatment options for patients who failed to respond to standard therapy is still limited . Mmf, an ester pro - drug of mycophenolic acid which acts as a noncompetitive inhibitor of inosine monophosphate dehydrogenase, the rate - limiting enzyme involved in the de nevo synthesis of purines were studied as an alternative to standard treatment . According to the aasld practice guidelines, mmf or cyclosporine have had the most empiric use as alternative medications and mmf (2 g daily orally) is the most promising current agent where improvement of hepatitis can be expected in 39 - 84% of patients . Several studies suggested mmf as an alternative treatment for those who are either refractory or intolerant to steroid and azathioprine combination therapy . Study by zachou et al . Prospectively studied the efficacy and safety of mmf in treatment nave aih patients where 88% of 59 patients responded to the treatment and even allowed rapid steroid tapering with eventually withdrawal of steroid . Another study by sharzehi et al . Based on retrospective cohort including 90 patients showed that those who were unable to continue corticosteroid and azathioprine well tolerated mmf with 88% of patients maintaining complete remission . These studies initiated mmf at a dose of 1.5 - 2 g / day in the former while 1g / day in the latter study . The reported side effect was gastrointestinal symptoms including nausea, vomiting and diarrhea, rash and hair loss but no evidence of bone marrow suppression was observed . Our patient did not experience any of the mentioned side effects after 10 months of mmf treatment . Although the second - line therapy with mmf seems promising, the response rates varied according to reason for stopping aza treatment where patients with aza intolerance had higher response rates to mmf than those who had shown insufficient response to aza (43% vs. 25%). In our case, pancytopenia and alopecia occurred after 3 months of standard treatment (corticosteroid and aza). Unfortunately after 27 months of corticosteroid monotherapy, hepatitis flare recurred and was stabilized with addition of aza but again the same side effect, pancytopenia and alopecia developed . Like other studies, alternative treatment with mmf was considered as a good option and we expect better treatment response for our patient as she had shown sufficient response to aza.
|
Malaria is recognised as a major public health issue, affecting more than 90 countries with ongoing transmission and rendering nearly half of the world's population at risk . In 2012, an estimated 207 million cases occurred globally, causing around 627 000 deaths, mostly african children under five years of age . Plasmodium falciparum and p. vivax account for most cases, with p. falciparum being the species causing substantial morbidity and the majority of the mortality . P. vivax infection, although rarely life - threatening, nevertheless is responsible for important morbidity especially in young children that are the most vulnerable to severe outcome . The multi - pronged strategy to fight malaria includes prompt diagnosis and treatment, reduction of the number of people being infected and control of the insect vector (indoor residual spraying, environmental management and biological control). With regard to the antimalarial treatment policy, the objective is to reduce morbidity and mortality by ensuring rapid complete cure of infection, in addition to curtailing the transmission of malaria by reducing the parasite reservoir of infection and infectivity . However, resistance is an increasing problem in the treatment of falciparum malaria, rendering conventional monotherapy less effective . Hence, to counter this threat and to improve treatment outcome, who recommends that artemisinin - based combination therapy (act) be used for the treatment of malaria in areas where p. falciparum is the predominant infecting species . As such, pyronaridine tetraphosphate / artesunate (pyramax) and piperaquine tetraphosphate / dihydroartemisinin (eurartesim), two newly approved acts, fulfil the who recommendation for the treatment of acute, uncomplicated malaria, providing a rapid reduction in parasitaemia with a three - day regimen, thereby improving compliance and reducing the risk of recrudescence through the slower elimination of the partner component . For both products, prequalification by who has been applied for and meanwhile already been obtained for one of them (pyramax). This can be viewed as an important step as it provides option for bulk purchase for distribution in resource limited countries . The requested who prequalification, followed initial regulatory assessment and approval of both acts by the european medicines agency's (ema, the agency) main scientific committee (chmp). For these products, the applications were submitted under different eu legal basis, as outlined in box 1, i.e., article 58 of eu pharmaceutical legislation (no . 726/2004) in relation to pyramax and eu centralised marketing application route subsequent to the orphan designation of eurartesim . Since the above eu regulatory pathways serve different main objectives, the article summarises this regulatory experience, describing strengths and limitations in the use of these registration routes for new pharmaceuticals against tropical infections . Prequalification of new medicines is a who initiative, first established in 2001, to facilitate access to medicines that meet unified standards of quality, safety and efficacy and thus addressing an unmet need in countries with limited access to quality medicines . Although initially focused on hiv drugs, it has since expanded to encompass medicines for priority disease programmes . Assessment of product data, by who staff and national regulatory authorities, is undertaken following voluntary submission of data by applicants, provided the medicines are on the who invitation list for expression of interest. Article 58 of regulation (ec) no 726/2004 of the european parliament and of the council was established for the purpose of scientific opinion by chmp in the context of cooperation with the who . The applicability is limited to prevent or treat diseases of major public interest, notably medicinal products for who target diseases (e.g., malaria, tuberculosis, hiv / aids, lymphatic filariasis, trachoma, leishmaniasis, schistosomiasis, african trypanosomiasis, onchocerciasis, dengue fever, chagas disease, leprosy and intestinal helminths), vaccines used or of possible use in the who expanded programme on immunization (epi), vaccines for protection against a who public health priority disease and vaccines that are part of a who managed stockpile for emergency response . It is meant exclusively for markets outside the eea, but does not preclude a subsequent application for european marketing authorisation . Orphan drug designation eu centralised marketing application route forms the obligatory licensing pathway for a community recognised orphan drug . The criteria of such designation as set out in regulation (ec) no 141/2000, require that the proposed medicinal product is intended for the treatment, prevention or diagnosis of a disease that is life - threatening or chronically debilitating; the prevalence of the condition in the eu must not be more than five in ten thousand or it must be unlikely that marketing of the medicine would generate sufficient returns to justify the investment needed for its development; and no satisfactory method of diagnosis, prevention or treatment of the condition concerned is already authorised, or, if such a method exists, the medicinal product must be of significant benefit to those affected by the condition . Pyramax film - coated tablets, fixed dose combination containing pyronaridine tetraphosphate and artesunate (p / a) (shin poong pharmaceutical co., ltd, korea), received a positive scientific opinion from chmp in february 2012, for treatment of acute, uncomplicated malaria infections caused by p. falciparum or p.vivax in adults and children weighing 20 kg and more . Chmp recommended a positive benefit - risk for use only as a single treatment course (once daily for three consecutive days) in any given patient and is limited to delineated geographic areas of low transmission with evidence of resistance to artemisinin containing therapy in line with the global plan for artemisinin resistance containment project recently launched by who . Following confirmation of eligibility by who, the application submitted in april 2010 in accordance with article 58, had similar structure and content as applications intended for european marketing authorisations, but with caveat of being exempted from legally submitting any environmental risk assessment report or paediatric investigation plan (pip). Furthermore, at scientific opinion stage, the pharmaceutical sponsor committed to further develop an age appropriate dose formulation, suitable to the youngest (infants and children with a body weight 5 kg and <20 kg). Since then, an application for supplemental approval of a fixed - dose granule formulation has indeed been received . At the time of initial evaluation, two pivotal multicentre non - inferiority studies had been conducted in patients with uncomplicated p. falciparum malaria . These involved a total of 2543 adults and children weighing 20 kg and over and compared p / a with other artemisinin combinations (artesunate plus mefloquine [as + mq] or artemether / lumefantrine [a / l]). The main efficacy endpoint was pcr - corrected adequate clinical and parasitological response (acpr) at day 42, defined as the absence of parasitaemia, irrespective of body temperature, without the patient meeting any of the criteria of early treatment failure, late clinical failure or late parasitological failure according to who . As depicted in table 1, table 1.pcr-corrected acpr in ee population (pyramax pivotal trials - plasmodium falciparum)study sp - c-00406study sp - c-00506pyramaxas+mqpyramaxa / ln=698n=339n=746n=342patients excluded from the ee population150 (17.9%)84 (19.8%)103 (12.1%)81 (19.1%)pcr - corrected acpr on day 42available observations698339746342number of patients cured (cure rate)661 (94.7%)329 (97.1%)729 (97.7%)337 (98.5%)between group comparisondifference2.40.895% ci4.7 to 0.42.4 to 1.3conclusionnon - inferioritynon - inferiorityp - value0.0880.374acpr: adequate clinical and parasitological response; as+mq: artesunate + mefloquine; a / l: artemether lumefantrine; ee: efficacy evaluable (all randomized patients who received any amount of study treatment, excluding those with new infections and those lost to follow - up prior to analysis time point).study sp - c-00406: a phase iii comparative, open - label, randomised, multi - centre, clinical study to assess the safety and efficacy of fixed dose formulation oral pyronaridine / artesunate (180:60 mg tablet) versus mefloquine (250 mg tablet) plus artesunate (100 mg tablet) in children and adult patients with acute uncomplicated plasmodium falciparum malaria.study sp - c-00506: a phase iii comparative, double - blind, double - dummy, randomised, multi - centre, clinical study to assess the safety and efficacy of fixed dose formulation of oral pyronaridine / artesunate tablet (180:60 mg) versus coartem (artemether / lumefantrine) in children and adult patients with acute uncomplicated plasmodium falciparum malaria . The two - sided ci for between group comparison was calculated using newcombe - wilson method . Non - inferiority was concluded if the lower limit of the two - sided 95% ci for the difference was above -5% . Test for superiority (performed only when non - inferiority had been demonstrated). Pcr - corrected acpr in ee population (pyramax pivotal trials - plasmodium falciparum) acpr: adequate clinical and parasitological response; as+mq: artesunate + mefloquine; a / l: artemether lumefantrine; ee: efficacy evaluable (all randomized patients who received any amount of study treatment, excluding those with new infections and those lost to follow - up prior to analysis time point). Study sp - c-00406: a phase iii comparative, open - label, randomised, multi - centre, clinical study to assess the safety and efficacy of fixed dose formulation oral pyronaridine / artesunate (180:60 mg tablet) versus mefloquine (250 mg tablet) plus artesunate (100 mg tablet) in children and adult patients with acute uncomplicated plasmodium falciparum malaria . Study sp - c-00506: a phase iii comparative, double - blind, double - dummy, randomised, multi - centre, clinical study to assess the safety and efficacy of fixed dose formulation of oral pyronaridine / artesunate tablet (180:60 mg) versus coartem (artemether / lumefantrine) in children and adult patients with acute uncomplicated plasmodium falciparum malaria . The two - sided ci for between group comparison was calculated using newcombe - wilson method . Non - inferiority was concluded if the lower limit of the two - sided 95% ci for the difference was above -5% . Test for superiority (performed only when non - inferiority had been demonstrated). Another study involved a total of 456 adults and children weighing 20 kg and over, suffering acute, uncomplicated p. vivax malaria . This non - inferiority trial, conducted at five sites in asia, compared p / a with chloroquine standard treatment . In the efficacy evaluable population, 97.1% (202/208) of patients taking p / a were cleared of p. vivax parasites after 28 days compared with 97.0% (192/198) of patients treated with chloroquine (95% two sided ci for treatment difference=3.5 to 3.9). Hence, the effect of repeat treatment courses of p / a needed first to be studied before possible introduction of this new act in high transmission settings, e.g., equatorial africa . An ad hoc expert group, which included independent advisors to who and an observer from an african regulatory authority, concluded though that in the meantime p / a could be an important gain to the therapeutic armamentarium in geographic areas of low transmission with recognised / rapidly emerging act resistance, involving resistance to the partner component (e.g., amodiaquine, lumefantrine, mefloquine and piperaquine). As such, its initial use has been restricted to a few areas within the asia pacific region . Cohort event monitoring for liver function is planned in the initial launch countries whilst focus is also placed on enhanced post - marketing surveillance in special populations (e.g., patients with hiv / aids, severely malnourished patients and pregnant women). A pregnancy register will be set up to monitor the outcomes of treated pregnant women in africa, once the terms of use have been broadened (based on further, recently submitted data) to make that region eligible for treatment . In may 2012, three months following chmp opinion, the who prequalification programme added pyramax to its list of recommended medicines . Since then, based on who prequalification, national regulatory authorisations for pyramax have been submitted in countries of the greater mekong subregion . Eurartesim (piperaquine tetraphosphate / dihydroartemisinin; pq / dha) film - coated tablets (sigma - tau industrie farmaceutiche riunite s.p.a ., italy) received an eu commission decision in october 2011 (approving its use in the european economic area [eea]), indicated for the treatment of uncomplicated p. falciparum malaria in adults, children and infants 6 months and over and weighing 5 kg or more . Pq / dha was designated as an orphan medicinal product during august 2007 for the indication treatment of malaria, based on assessment that the condition is rare (mainly to be viewed as import pathology in returning travellers from endemic areas and migrants returning from visiting friends and relatives) though potentially life threatening to those affected and although other satisfactory treatment has been authorised in the eu community, presumptive justifications were that the product may be of significant benefit to those affected by the condition . The marketing application dossier contained an ema decision on the agreement of a pip, with some measures deferred at time of submission of the marketing application (july 2009). As per agreed pip, a separate paediatric formulation will be submitted in future covering the vulnerable group of children, aged six months to five years . The effects of pq / dha were first tested in experimental models before being studied in humans . Also, as part of the requirements, the applicant conducted an environmental risk assessment for both active substances . This fixed dose act was further investigated in two main studies in patients with uncomplicated p. falciparum malaria . In the first trial, conducted in 1150 predominantly adult asian patients, the aim was to demonstrate that the pcr - corrected cure rate of pq / dha was non - inferior to that of the comparator (as+mq). This cure rate was defined as the proportion of patients with acpr at day 63 plus those treatment failures identified as new p. falciparum (by pcr) and non - falciparum infections . Those patients lost - to - follow up for unknown reasons before day 63, were excluded from intent - to - treat (itt) population (m - itt analysis). Non - inferiority was shown if the lower limit of the one - sided 97.5% ci for the difference between groups was greater than 5% . In the second trial, pq / dha was compared with another antimalarial act, containing a / l (tablets 20 mg/120 mg) in 1553 african children (minimum age of 6 months; mean age 2.4 years). The main measure of efficacy was the proportion of patients who were cured at day 28 of follow - up (pcr corrected results). Those patients lost - to - follow up for unknown reasons before day 28, were excluded from itt population (m - itt analysis). For both trials, table 2.pcr-corrected acpr in m - itt population (eurartesim pivotal trials - plasmodium falciparum)study dm040010study dm040011eurartesimas+mqeurartesima / ln=726n=361n=1027n=497patients excluded from the m - itt population43 (5.6%)20 (5.3%)12 (1.2%)17 (3.3%)pcr - corrected acpravailable observations7263611027497number of patients cured (cure rate)704 (97.0%)344 (95.3%)952 (92.7%)471 (94.8%)between group comparisondifference1.72.1ll 97.5% ci0.84.6conclusionnon - inferioritynon - inferiorityp - value0.1610.128acpr: adequate clinical and parasitological response; as+mq: artesunate + mefloquine; a / l: artemether lumefantrine; ll: lower limit; m - itt: modified intent - to - treat (all randomized patients who received at least one dose of study treatment, excluding those lost to follow - up for unknown reasons).study dm040010: a phase iii, randomised, non - inferiority trial, to assess the efficacy and safety of dihydroartemisinin + piperaquine phosphate (dha / pqp, artekin) in comparison with artesunate + mefloquine (as+mq) in patients affected by acute, uncomplicated plasmodium falciparum malaria.study dm040011: a phase iii, randomised, non - inferiority trial, to assess the efficacy and safety of dihydroartemisinin + piperaquine phosphate (dha / pqp, artekin) in comparison with artemether + lumefantrine (a / l, coartem) in children with uncomplicated plasmodium falciparum malaria . Pcr - corrected acpr on day 28 . The one - sided ci for between group comparison was calculated using the normal approximation (wald method). Non - inferiority was concluded if the lower limit of the one - sided 97.5% ci for the difference was above -5% . Test for superiority (performed only when non - inferiority had been demonstrated). Pcr - corrected acpr in m - itt population (eurartesim pivotal trials - plasmodium falciparum) acpr: adequate clinical and parasitological response; as+mq: artesunate + mefloquine; a / l: artemether lumefantrine; ll: lower limit; m - itt: modified intent - to - treat (all randomized patients who received at least one dose of study treatment, excluding those lost to follow - up for unknown reasons). Study dm040010: a phase iii, randomised, non - inferiority trial, to assess the efficacy and safety of dihydroartemisinin + piperaquine phosphate (dha / pqp, artekin) in comparison with artesunate + mefloquine (as+mq) in patients affected by acute, uncomplicated plasmodium falciparum malaria . Study dm040011: a phase iii, randomised, non - inferiority trial, to assess the efficacy and safety of dihydroartemisinin + piperaquine phosphate (dha / pqp, artekin) in comparison with artemether + lumefantrine (a / l, coartem) in children with uncomplicated plasmodium falciparum malaria . . The one - sided ci for between group comparison was calculated using the normal approximation (wald method). Non - inferiority was concluded if the lower limit of the one - sided 97.5% ci for the difference was above -5% . Test for superiority (performed only when non - inferiority had been demonstrated). Electrocardiographic qt interval prolongation (corrected for influence of heart rate; prolongation defined as qtcb or qtcf> 450 msec in adult males and children up to 12 years of age or> 470 msec in adult females), albeit asymptomatic in all cases observed during clinical trials, has been identified as principal safety concern . The qtc effect and associated clinical outcomes (torsade de pointes, sustained arrhythmias, sudden death) are flagged as important identified concerns in the risk management plan . During the marketing application process, an ad hoc expert committee gathered to discuss the cardiac safety aspects of pq / dha and concluded that the fixed dose act poses an unpredictable risk for a small proportion of people, but that based on pharmacokinetic considerations, cardiac risk could be further contained by administering pq / dha in fasting state . Clinical data were missing from some patient populations, such as pregnant and lactating women, children younger than 6 months of age or below 5 kg body weight, elderly, hiv infected and malaria patients with caucasian ethnicity . Regarding the latter, results from a pharmacokinetic study revealed there were no significant differences in exposure between healthy caucasian and healthy asian volunteers . Also, the effects in pregnant women exposed to pq / dha are to be monitored in a european multi - centre pregnancy registry, whilst pq / dha has also been included in the pregact project, which studies safety and effectiveness of various acts for african pregnant women with malaria . On obtaining the marketing authorisation, the orphan drug criteria were re - assessed, mainly to confirm the significant benefit over existing therapy . At that time, first line treatment for the condition in the eea mainly offered choice between fixed combinations atovaquone / proguanil and artemether / lumefantrine oral treatment, with the latter being the only previously approved act for use in the european market . It was argued that pq / dha fasting dosing regimen may offer an advantage in clinical practice, since malaria patients are frequently nauseated . Further on, the sponsor considered that pq / dha could provide a valuable alternative treatment option for the returning traveller, even from regions with recognised artemisinin resistance (cambodia and border regions of thailand with myanmar), since such resistance is considered fluid, largely influenced by the partner drug used in the act and thus patients will still recover, provided that they are treated with an act containing an effective partner drug . However, prior to completion of this evaluation, the applicant requested to relinquish the orphan designation status for this new act . By the end of october 2012, it was first launched in cambodia in september 2012, whilst ghana became the first african country to approve eurartesim during early 2013 . Since then it has become available in other key african states taking part in the african research phase iv iness programme, gathering data on safety and effectiveness of new acts . A dossier was submitted to who in june 2012 to add eurartesim to its list of recommended medicines in the who prequalification programme . Who prequalification guides procurement decisions of united nations agencies and other authorities (e.g., allowing disbursement by the global fund to fight aids, tuberculosis and malaria) primarily for medicines used in treating hiv / aids, malaria, tuberculosis and for reproductive health . As a general principle, the approval requirements for prequalification are aligned to those set by stringent medicines regulatory agencies . Indeed, if a product has been previously assessed and approved by such a regulatory authority, an abbreviated evaluation procedure helps speed medicines through the prequalification process . Moreover, it is noted that no further assessment is required if scientific opinion was obtained under article 58 of eu pharmaceutical regulation (no 726/2004), as demonstrated by the experience with pyramax, which received quasi instant prequalification approval following its assessment by chmp . This is in line with agreed ema and who alignment evaluation procedures facilitating early access of such medicines of high public health need and underscores the aim of the article 58 process . So far however, the agency's experience with article 58 has received a mixed reception . Earlier approvals were mainly intended to prevent re - importation into europe of already available products (e.g., antiretroviral lopinavir / ritonavir fixed combination). Recently though, more substantial regulatory experience was gained, in relation to a hexavalent childhood immunisation vaccine (hexaxim, sanofi pasteur, lyon, france), misoprostol indicated to reduce post - partum bleeding due to uterine atony, in situations where intravenous oxytocin is not available (hemoprostol, linepharma, paris, france) and also for pyramax . The article 58 process encourages early regulatory interaction with who experts in order to fully elucidate the benefit - risk within the applicable epidemiological context . Feedback obtained to date, also identified a further need to engage representatives of national regulatory agencies drawn from countries of intended use, to build understanding and trust in the purpose of the article 58 procedure . This also chimes with the recent review by doua and van geertruyden covering registration of medicines for low - income countries, stressing the need for participation of such local expertise . Of note, during the article 58 evaluation of pyramax, close collaboration took place with independent experts advising who on malaria . This guided the chmp to reach a fully informed opinion on the benefit - risk balance of the product, specifically to its intended use in populations residing in endemic areas . Mainly guided by the uncertainties in the safety profile, carefully weighed against the obtained clinical trial efficacy data and the need of further acts, the experts recommended its initial use to be limited to areas with low malaria transmission and with evidence of resistance to acts, and this in conjunction to the adherence of stringent risk minimisation measures . In parallel to authorised products for eu community use, article 58 products are indeed subject to ongoing obligations, e.g., regular periodic safety update reports and risk management plan updates . The feasibility in collecting reliable data might be challenging though in some target endemic countries . Therefore, the effectiveness of routine pharmacovigilance (expedited reporting) and of enhanced pharmacovigilance activities (registry and close monitoring) in the recipient countries need to be sufficiently reassuring prior to receiving a scientific opinion from chmp . Once available in endemic areas, and in light of possible emerging safety signals, chmp also retains the option to amend the initial scientific opinion provided to who . A drawback though concerning the article 58 scheme is the lack of incentives offered to the pharmaceutical industry . Indeed, no automatic fee reductions or exemptions are in place although these can be granted on a discretional basis, by executive decision . At least this is perceived as cumbersome, since independent requests for such fee reduction have to be made at various stages of the product's life cycle, e.g., in relation to scientific advice, main application fee, different inspection fees and annual retention dues . Motivated reasons have to be provided in terms of public health need and minimal financial returns potential for the commercial sponsor relative to the substantial development costs . In contrast to the above, the european pharmaceutical legislation offers multiple incentives within the framework of the orphan drug designation, as illustrated in table 3 . If granted orphan drug designation by the european commission, regulatory scientific assistance (protocol assistance) may be offered partially or totally free of charge and various regulatory fees be waived in part or in total . In addition, on re - examining and reconfirming the orphan status at time of licensing, the product obtains marketing exclusivity in the eu for 10 years duration; i.e., the community and the member states shall not, for a period of 10 years, accept another application for a marketing authorisation, or grant a marketing authorisation or accept an application to extend an existing marketing authorisation, for the same therapeutic indication, in respect of a similar medicinal product. Table 3.article 58 versus orphan designation: comparison of requirements and incentivesregulatory aspectsarticle 58orphan medicinal productmedicinal productpre - submission phaseeligibilityneeded (in collaboration with who)needed (assessed by comp)sme statuscan be grantedcan be grantedscientific advicepossiblepossiblepipnot legally requiredlegally required (compliance check prior to maa submission)accelerated review requestpossiblepossibleevaluation phaseenvironmental risk assessmentnot legally requiredlegally requireddata applicable to eu populationnot requiredrequiredapplication fee reductioneligible (case - by - case)yesinspections fee reductioneligible (case - by - case)full fee reductionchmp opinionconditional or exceptional circumstancespossiblepossiblepost - opinion phasemarketing authorisation (eea)no (allows future maa submission in the eu)yesmarket exclusivityno (since no eu maa)yesphv system / rmpneeded (adapted to local use)neededpsursubmission mandatorysubmission mandatoryfee reductionseligible (case - by - case)yescomp: committee for orphan medicinal products; eea: european economic area; ema: european medicines agency; maa: marketing authorisation application; phv: pharmacovigilance; pip: paediatric investigation plan; psur: periodic safety update report; rmp: risk management plan; sme: micro, small and medium - sized enterprises . See details in the explanatory fee note: http://www.ema.europa.eu/docs/en_gb/document_library/other/2014/04/wc500164415.pdf article 58 versus orphan designation: comparison of requirements and incentives comp: committee for orphan medicinal products; eea: european economic area; ema: european medicines agency; maa: marketing authorisation application; phv: pharmacovigilance; pip: paediatric investigation plan; psur: periodic safety update report; rmp: risk management plan; sme: micro, small and medium - sized enterprises . See details in the explanatory fee note: http://www.ema.europa.eu/docs/en_gb/document_library/other/2014/04/wc500164415.pdf regarding eurartesim, this new act easily fulfilled the first two criteria of the orphan drug designation by the fact that acute malaria has an annual disease incidence rate of around three new cases per hundred thousand population in the eea and that the condition can rapidly progress to a complicated course and be fatal, especially if left untreated in non - immune european patients . The innovator also argued significant benefit over existing therapy already authorised in the eu, based on administration advantage (fasting) and by offering an alternative treatment option to the returning traveller, even if returning from areas with recognised artemisinin resistance . Prior to completion of the re - assessment of the orphan drug criteria by the agency's orphan committee though, the commercial sponsor of eurartesim voluntary chose to withdraw the orphan drug status, foregoing subsequent market exclusivity . In this context, it has previously been questioned if market exclusivity afforded to orphan medicinal products indicated for tropical infectious diseases indeed serves the best interest of the wider community, since arguably it may rather hinder the development of new medicines in the same therapeutic area . Conversely, experience shows that the orphan drug legislation had some catalysing effect, especially on smaller sized companies with new business models (partnerships with non - profit organisations) and academic institutions in their quest to develop new medicines combatting tropical infectious diseases . It is also stressed that market authorisation would only be denied if there would be similarity in structure and mechanism of action to a previously licensed orphan medicine with the same therapeutic indication . In case of confirmed similarity, derogation rules exist based on obtained consent from the marketing authorisation holder of the earlier approved orphan product, supply shortages for that product already on the market or if the newer product is safer, more effective or otherwise proves to be clinically superior over the previously authorised orphan medicinal product . With regards to eu licensing (either as orphan or non - orphan drug), it is however remarked that the benefit - risk balance derived on the use of a product directed against a tropical infectious pathology shows inherent relevance to the european population . Hence, it does not necessarily account for the local context encountered in low / middle - income countries (e.g., in relation to implementation of the safety specificities), although large study data gathering would normally only be feasible outside the eu community, i.e., within endemic areas . Specifically, in relation to studies on malaria treatment, adult and paediatric patients enrolled in regions, characterised by low, seasonal transmission (australasia, central and south america), can act as a valuable proxy and thus be predictive for outcome in non - immune european travellers . This is though in contrast to the situation in sub - saharan africa, with its perennial and intense transmission dynamics, rendering most adults and older children (semi)-immune to clinical attacks . Therefore, non - immune children under five years of age are usually the segment of the african population most susceptible to symptomatic malaria . They act as further proxy for eu patients with malaria and lend additional support to the paediatric extension of the therapeutic indication . Nevertheless, the pharmacokinetic profile may differ substantially between ethnic populations, largely due to genetic polymorphism . Differences can either result in poor treatment outcome associated with sub - optimal drug exposure or observed increased toxicity based on overexposure . Hence, bridging pharmacological data form a standard requirement in support of a european authorisation . Such supplementary data were obtained for eurartesim, comparing the pharmacokinetics of piperaquine tetraphosphate and dihydroartemisinin between subjects grouped by ethnic origin (caucasian versus asian). Also, the european marketing authorisation requires a paediatric plan to be submitted for assessment and opinion by the agency's paediatric scientific committee, prior to submission of the main marketing application . The agreed pip will set out the conditions and further tests to be undertaken in the paediatric subpopulations, with often these measures initially deferred . Specifically, in aid of the youngest, a separate paediatric formulation might need to be developed . Finally, notwithstanding the consideration by a given pharmaceutical innovator to bring the newly approved anti - infective agent to the market in a non - eu endemic area, using the eu authorisation as a valid basis (e.g. For subsequent prequalification process), the european licensing route puts the obligation to actually place the medicinal product on the eu community market, within 3 years following its authorisation . Failure to do so, would lead for the marketing authorisation to be ceased within the eu . Who prequalification guides procurement decisions of united nations agencies and other authorities (e.g., allowing disbursement by the global fund to fight aids, tuberculosis and malaria) primarily for medicines used in treating hiv / aids, malaria, tuberculosis and for reproductive health . As a general principle, the approval requirements for prequalification are aligned to those set by stringent medicines regulatory agencies . Indeed, if a product has been previously assessed and approved by such a regulatory authority, an abbreviated evaluation procedure helps speed medicines through the prequalification process . Moreover, it is noted that no further assessment is required if scientific opinion was obtained under article 58 of eu pharmaceutical regulation (no 726/2004), as demonstrated by the experience with pyramax, which received quasi instant prequalification approval following its assessment by chmp . This is in line with agreed ema and who alignment evaluation procedures facilitating early access of such medicines of high public health need and underscores the aim of the article 58 process . So far however, the agency's experience with article 58 has received a mixed reception . Earlier approvals were mainly intended to prevent re - importation into europe of already available products (e.g., antiretroviral lopinavir / ritonavir fixed combination). Recently though, more substantial regulatory experience was gained, in relation to a hexavalent childhood immunisation vaccine (hexaxim, sanofi pasteur, lyon, france), misoprostol indicated to reduce post - partum bleeding due to uterine atony, in situations where intravenous oxytocin is not available (hemoprostol, linepharma, paris, france) and also for pyramax . The article 58 process encourages early regulatory interaction with who experts in order to fully elucidate the benefit - risk within the applicable epidemiological context . Feedback obtained to date, also identified a further need to engage representatives of national regulatory agencies drawn from countries of intended use, to build understanding and trust in the purpose of the article 58 procedure . This also chimes with the recent review by doua and van geertruyden covering registration of medicines for low - income countries, stressing the need for participation of such local expertise . Of note, during the article 58 evaluation of pyramax, close collaboration took place with independent experts advising who on malaria . This guided the chmp to reach a fully informed opinion on the benefit - risk balance of the product, specifically to its intended use in populations residing in endemic areas . Mainly guided by the uncertainties in the safety profile, carefully weighed against the obtained clinical trial efficacy data and the need of further acts, the experts recommended its initial use to be limited to areas with low malaria transmission and with evidence of resistance to acts, and this in conjunction to the adherence of stringent risk minimisation measures . In parallel to authorised products for eu community use, article 58 products are indeed subject to ongoing obligations, e.g., regular periodic safety update reports and risk management plan updates . The feasibility in collecting reliable data might be challenging though in some target endemic countries . Therefore, the effectiveness of routine pharmacovigilance (expedited reporting) and of enhanced pharmacovigilance activities (registry and close monitoring) in the recipient countries need to be sufficiently reassuring prior to receiving a scientific opinion from chmp . Once available in endemic areas, and in light of possible emerging safety signals, chmp also retains the option to amend the initial scientific opinion provided to who . A drawback though concerning the article 58 scheme is the lack of incentives offered to the pharmaceutical industry . Indeed, no automatic fee reductions or exemptions are in place although these can be granted on a discretional basis, by executive decision . At least this is perceived as cumbersome, since independent requests for such fee reduction have to be made at various stages of the product's life cycle, e.g., in relation to scientific advice, main application fee, different inspection fees and annual retention dues . Motivated reasons have to be provided in terms of public health need and minimal financial returns potential for the commercial sponsor relative to the substantial development costs . In contrast to the above, the european pharmaceutical legislation offers multiple incentives within the framework of the orphan drug designation, as illustrated in table 3 . If granted orphan drug designation by the european commission, regulatory scientific assistance (protocol assistance) may be offered partially or totally free of charge and various regulatory fees be waived in part or in total . In addition, on re - examining and reconfirming the orphan status at time of licensing, the product obtains marketing exclusivity in the eu for 10 years duration; i.e., the community and the member states shall not, for a period of 10 years, accept another application for a marketing authorisation, or grant a marketing authorisation or accept an application to extend an existing marketing authorisation, for the same therapeutic indication, in respect of a similar medicinal product. Table 3.article 58 versus orphan designation: comparison of requirements and incentivesregulatory aspectsarticle 58orphan medicinal productmedicinal productpre - submission phaseeligibilityneeded (in collaboration with who)needed (assessed by comp)sme statuscan be grantedcan be grantedscientific advicepossiblepossiblepipnot legally requiredlegally required (compliance check prior to maa submission)accelerated review requestpossiblepossibleevaluation phaseenvironmental risk assessmentnot legally requiredlegally requireddata applicable to eu populationnot requiredrequiredapplication fee reductioneligible (case - by - case)yesinspections fee reductioneligible (case - by - case)full fee reductionchmp opinionconditional or exceptional circumstancespossiblepossiblepost - opinion phasemarketing authorisation (eea)no (allows future maa submission in the eu)yesmarket exclusivityno (since no eu maa)yesphv system / rmpneeded (adapted to local use)neededpsursubmission mandatorysubmission mandatoryfee reductionseligible (case - by - case)yescomp: committee for orphan medicinal products; eea: european economic area; ema: european medicines agency; maa: marketing authorisation application; phv: pharmacovigilance; pip: paediatric investigation plan; psur: periodic safety update report; rmp: risk management plan; sme: micro, small and medium - sized enterprises . See details in the explanatory fee note: http://www.ema.europa.eu/docs/en_gb/document_library/other/2014/04/wc500164415.pdf article 58 versus orphan designation: comparison of requirements and incentives comp: committee for orphan medicinal products; eea: european economic area; ema: european medicines agency; maa: marketing authorisation application; phv: pharmacovigilance; pip: paediatric investigation plan; psur: periodic safety update report; rmp: risk management plan; sme: micro, small and medium - sized enterprises . See details in the explanatory fee note: http://www.ema.europa.eu/docs/en_gb/document_library/other/2014/04/wc500164415.pdf regarding eurartesim, this new act easily fulfilled the first two criteria of the orphan drug designation by the fact that acute malaria has an annual disease incidence rate of around three new cases per hundred thousand population in the eea and that the condition can rapidly progress to a complicated course and be fatal, especially if left untreated in non - immune european patients . The innovator also argued significant benefit over existing therapy already authorised in the eu, based on administration advantage (fasting) and by offering an alternative treatment option to the returning traveller, even if returning from areas with recognised artemisinin resistance . Prior to completion of the re - assessment of the orphan drug criteria by the agency's orphan committee though, the commercial sponsor of eurartesim voluntary chose to withdraw the orphan drug status, foregoing subsequent market exclusivity . In this context, it has previously been questioned if market exclusivity afforded to orphan medicinal products indicated for tropical infectious diseases indeed serves the best interest of the wider community, since arguably it may rather hinder the development of new medicines in the same therapeutic area . Conversely, experience shows that the orphan drug legislation had some catalysing effect, especially on smaller sized companies with new business models (partnerships with non - profit organisations) and academic institutions in their quest to develop new medicines combatting tropical infectious diseases . It is also stressed that market authorisation would only be denied if there would be similarity in structure and mechanism of action to a previously licensed orphan medicine with the same therapeutic indication . In case of confirmed similarity, derogation rules exist based on obtained consent from the marketing authorisation holder of the earlier approved orphan product, supply shortages for that product already on the market or if the newer product is safer, more effective or otherwise proves to be clinically superior over the previously authorised orphan medicinal product . With regards to eu licensing (either as orphan or non - orphan drug), it is however remarked that the benefit - risk balance derived on the use of a product directed against a tropical infectious pathology shows inherent relevance to the european population . Hence, it does not necessarily account for the local context encountered in low / middle - income countries (e.g., in relation to implementation of the safety specificities), although large study data gathering would normally only be feasible outside the eu community, i.e., within endemic areas . Specifically, in relation to studies on malaria treatment, adult and paediatric patients enrolled in regions, characterised by low, seasonal transmission (australasia, central and south america), can act as a valuable proxy and thus be predictive for outcome in non - immune european travellers . This is though in contrast to the situation in sub - saharan africa, with its perennial and intense transmission dynamics, rendering most adults and older children (semi)-immune to clinical attacks . Therefore, non - immune children under five years of age are usually the segment of the african population most susceptible to symptomatic malaria . They act as further proxy for eu patients with malaria and lend additional support to the paediatric extension of the therapeutic indication . Nevertheless, the pharmacokinetic profile may differ substantially between ethnic populations, largely due to genetic polymorphism . Differences can either result in poor treatment outcome associated with sub - optimal drug exposure or observed increased toxicity based on overexposure . Hence, bridging pharmacological data form a standard requirement in support of a european authorisation . Such supplementary data were obtained for eurartesim, comparing the pharmacokinetics of piperaquine tetraphosphate and dihydroartemisinin between subjects grouped by ethnic origin (caucasian versus asian). Also, the european marketing authorisation requires a paediatric plan to be submitted for assessment and opinion by the agency's paediatric scientific committee, prior to submission of the main marketing application . The agreed pip will set out the conditions and further tests to be undertaken in the paediatric subpopulations, with often these measures initially deferred . Specifically, in aid of the youngest, a separate paediatric formulation might need to be developed . Finally, notwithstanding the consideration by a given pharmaceutical innovator to bring the newly approved anti - infective agent to the market in a non - eu endemic area, using the eu authorisation as a valid basis (e.g. For subsequent prequalification process), the european licensing route puts the obligation to actually place the medicinal product on the eu community market, within 3 years following its authorisation . Failure to do so, would lead for the marketing authorisation to be ceased within the eu . Article 58 scientific opinion and orphan drug marketing application are two valuable tools facilitating authorisation of medicinal products indicated for treatment or prevention of infectious diseases, burdensome to endemic areas outside europe . As such, they form basis for who prequalification, allowing subsequent purchase agreements for use in resource limited countries . Both regulatory options provide their own set of real and perceived regulatory advantages and drawbacks . Hence, the ultimate choice of regulatory route taken by the innovator will need to be aligned with their overall strategic objectives . So far, in reference to tropical infectious diseases, both procedures remain largely untested . As such, the present contribution aims to disseminate our experience to date and to invite further interest in these regulatory pathways.
|
Hepatitis b virus (hbv) can cause chronic and acute infection and remains a global health problem with a considerable morbidity and mortality . It was estimated that there are currently more than 350 million carriers all over the world . Chronic hepatitis b virus (hbv) infection is a major cause of hepatocellular carcinoma (hcc). Hbv chronic carriers, including those carrying vaccine - escape mutants, have a greater than 100-fold increased relative risk of developing the tumor . Despite characterization of integrated hbv genome in chromosomes of hcc, a comprehensive understanding of the underlying mechanism needs further elucidation . Tumor progression is a complex multistage process, making the cells from normal to malignant by a series of alterations including cell adhesion and movements . One of the important characteristics of the tumor cells is that they have the ability to escape from the normal controls during proliferation, differentiation, apoptosis, and migration . In metastasis, tumor cells detached from their place of formation, move, and form new tumors in distant healthy tissues . Cell migration is a key activity of many important normal and abnormal biological processes, including tumor cell metastasis . Adhesion of tumor cells to host cell layers and subsequent transcellular migration are important processes in cancer invasion and metastasis, which involves the extracellular matrix (ecm) degradation [810]. High motility and cell migration might be the premonition of malignancy of chronic viral infection . The rho small gtpases, which contains the rho, rac, cdc42 subfamilies, regulate cell migration through the reorganization of actin cytoskeleton, which is considered as a driving force of cell motility [11, 12]. The rho gtpases act as molecular switches cycling between active gtp - bound forms and inactive gdp - bound forms . Such cycling is regulated by guanosines nucleotide exchange factors (gefs) and gtpase - activating proteins (gaps). In addition, rho gtpases activation has been linked to virus replication such as hiv-1, hsv (herpes simplex virus) and hbv [1517]. Rho a, rho c, and rac1 have been reported significantly elevated in a variety of tumors, especially in the more metastatic forms [18, 19]. During the tumor progression, the loss of the cell characteristics results in morphological changes, such as cell - cell adhesion, gene expression, and motility rate . For example, the adhesion velocity has been shown to be affected by hbv replication . Our laboratory has recently reported that hbv - replicating hepg2 cells display similar morphology with those expressing the constitutively activated rac1, mediated by hbx . Hbx can directly interact with a rac1 nucleotide exchange factor pix, by an sh3 binding motif and affect the cell morphology . Our data are in line with earlier reports on the potential invasion ability of hbx through indirect activation of matrix metalloproteinase (mmps) [21, 22]. We now report that the rac1 gtpase was involved synergistically with hbx in the migration of hbv - replicating cells . The replicative hbv genome comprising a 3.5 kb linear fragment was constructed as described in mammalian expression vector pcdna3.1 (invitrogen, usa), using a two step cloning strategy . Wild - type replicative hbv genome was used as template to generate proline to alanine mutation by site - directed mutagenesis as described in . Four prolines in hbx on the replicative genome were mutated into alanine: esrgr29plpg33plgalppas42p43pivptdh to esrgr29alpg33algalppas42a43aivptdh . The plasmids of rac1 wide type, constitutively activated rac1, and dominant negative rac1 were constructed into a mammalian vector pxj40 with a ha tag at n - terminal as described in [24, 25]. Hepg2 cells were maintained and passaged in gibco dulbecco's minimal essential medium, supplemented with 10% fetal bovine serum, 1% antimycotic, and controlled 5% co2 . Rna of the hepg2 cells transfected with various plasmids was extracted using rneasy mini kit (qiagen, usa) as described in . The concentration and quality of rna were obtained by the absorbance at od260 and the absorbance ratio of od260 and od280 . Rt - pcr was performed to confirm gene expression from the replicative hbv genome as described in . The primers used for rt - pcr were as follows: -actin forward: 5-cttagttgcgttacaccctttc-3, -actin reverse: 5-accttcaccgttccagtttt-3, hbsag forward: 5-tcaccatattcttgggaacaa-3, hbsag reverse: 5-gttttgttagggtttaaatg-3, hbcag forward: 5-atctcctagacaccgcctca-3, hbcag reverse: 5-ttccaaattattacccaccc-3. Hepg2 cells transfected with individual constructs were collected 48 hours after transfection . Western blot analysis was carried out using specific anti - ha or anti - actin antibodies as described . Cell motility was assessed by transwell migration assay kit (bd falcon, usa). The inserts were put into the 24-well plate and both sides of the membrane of the inserts were coated with collagen (bioscience, usa) for more than 2 hours . 36 to 48 hours after transfection, the hepg2 cells were trypsinized and cell number was adjusted to 20,00030,000 cells per 200 l volume by cell numbering . The cell suspension was deposited onto the collagen - coated membrane in each insert in the 24-well plate . The plate was put into 37c, 5% co2 incubator and cultured for 8 hours to overnight . This was needed to allow cell migration to take place, from the upper side to the lower side of the collagen - coated membrane . The medium was then removed and the upside cells of the inserts were gently mopped with cotton bars . The cells at the lower side of the membrane were fixed with 100% methanol for 15 minutes . The cells were stained with 0.04% giemsa solution (sigma aldrich, usa) for 1015 minutes . Four fields were randomly selected in each insert for counting and microscopic images were taken . Hepg2 cells were transfected using nucleofector to achieve high efficiency of transfection, as indicated by the high percentage of cells expressing egfp (figure 1). The expression of hbsag from the replicative genome in transfected hepg2 cells was assessed by rt - pcr, whereas the expression of wild - type rac1, rac1, rac1 was determined by western blot analysis using anti - ha antibody.how ever -actin was used as an internal control . Results were shown in figure 2 and table 1 showed the normalized densities of the bands shown in figure 2(a). The density levels of rac1 wt were used as standards, other bands were normalized based on it . It indicated that all three constructs of rac1 gtpase were successfully expressed in hepg2 cells at comparable level . In addition, both hbsag and hbv core antigen (hbcag) could be detected in hepg2 cells transfected by replicative hbv genome (lane 2, figure 2(b)) and p - a mutant hbv (lane 3, figure 2(b)), with the empty vector pcdna3.1 used as control (lane 1, figure 2(b)). The motility of hepg2 cells expressing rac1 alone, and those expressing both rac1 and replicative hbv genome was then analysed by transwell assay, as indicated by the number of cells migrated to the lower side of the collagen - coated membrane (see section 2). Seven sets of constructs were used in this analysis: wild - type rac1 alone; constitutively activated rac1 alone; dominant negative rac1 alone; wild - type rac1 and wild - type hbv genome; wild - type rac1 and p - a mutant hbv genome; wild - type hbv genome alone; and p - a mutant hbv genome alone . Results shown in figure 3 indicated that hepg2 cells displayed differential motility depending on the transfected constructs, with the highest number of cells (indicated by arrow heads) in cells transfected either with rac1 alone (figure 3(b)) or with wild - type rac1/wild - type hbv genome (figure 3(d)). A graphical representation of the motility assay was summarized in figure 4 after cell counting and analysis . Hepg2 cells transfected with the constitutively activated rac1 showed a 2.5-fold increase in cell motility (lane 2, figure 4) as compared with those expressing wild - type rac1 alone (lane 1, figure 4) or those expressing the dominant negative rac1 (lane 3, figure 4). Interestingly, cells co - transfected with wild - type rac1 and replicative hbv genome showed similar motility as those transfected with constitutively activated rac1 . This suggested that the cell motility was enhanced by hbv replication, likely via activation of wild - type rac1 to its gtp - bound state as recently reported . To validate our findings, the p - a mutant hbv genome (with four proline residues mutated to alanine residues in the proline rich domain) was co - transfected with the wild - type rac1 . Results shown in figure 4 (lane 5) indicated that the p - a mutant hbv genome abrogated the cell motility significantly, to a level comparable with expressing cells . Meanwhile, the expression of replicative hbv genome itself enhanced the cell migration also (lane 6), which may imply the endogenous rac1 activation by the hbv replication . Not surprisingly, the p - a mutant hbv genome abrogated the cell motility (lane 7). How ever the cell migration level caused by endogenous rac1 was less than that caused by the overexpressed rac1 v12, which suggested that endogenous wild - type rac1 was not sufficient for the activation caused by hbv replication . And such activation was confirmed by the augmentation of cell movements induced by overexpression of rac1 wt . In other words, the endogenous rac1 was enough to be activated by hbv replication and passed away cellular signal inducing high cell motility, but the over - expressed rac1 can even increase such activation in a certain degree . Taken together, our results suggested that the cell migration can be caused by hbv replication through the activation of rac1 gtpase . Rho gtpases comprise a family of proteins which are highly conserved from lower eukaryotes to plants and animals . Rho gtpases were implicated in various cellular processes including cytoskeletal reorganization, cell cycle and division, motility, angiogenesis, and phagocytosis . For cytoskeletal reorganization, processes such as cell adhesion, cell migration, cell polarity, spindle formation and locomotion were covered . It has been reported that the hbx activates erks and pi-3k / akt pathways25, and further activates matrix metalloproteinase-919 with a potential function of invasion and metastasis . We have recently demonstrated the same activation of erk1/2 and akt by hbx using sh3 binding domain located in hbx . Our recent investigation has also indicated that rac1 gtpase can be activated by hbv replication, which in turn sustains hbv replication . Interestingly, the activation of rac1 and hbv replication has been found to be significantly decreased in cells transfected with p - a mutant hbv genome . Our findings can be further validated by careful design of hbx knockdown in the context of the whole hbv genome, without affecting the proper viral replication . Furthermore, the involvement of rac1 can be supported by titration experiments in which the same amount of hbv genome is introduced into the cells with various amount of rac1 (activated v or inactivated n). Findings in this report have provided an extension on the consequences of the rac1 activation by hbv replication, in terms of cell motility . To our knowledge, this is the first report to show the potential relationship between proline rich domain in hbx (in the context of hbv replication) and cell motility, and should shed new lights on the understanding of the mechanism of hcc development.
|
The most recent national hospital discharge survey reported over 400,000 patients underwent cardiac surgery in the united states in 2010 . In cardiac patients, respiratory problems following extubation are the most significant cause of postoperative comorbidity, despite considerable improvement in postoperative care and monitoring . In a recent study of 7,105 cardiac patients, 216 were readmitted to the intensive care unit (icu) due to respiratory complications . This represented 39% of all icu readmissions in that study . In recent study of the 7.8% of patients readmitted to the icu following cardiac surgery, respiratory failure was reported to be the cause for 39% of them [2, 4]. Current trends in cardiac anesthesia recommend early extubation, but that is not always feasible and prolonged endotracheal intubation and mechanical ventilation place cardiac patients at an increased risk of respiratory complications . Previous data show that the airway can constrict immediately after extubation as a result of mechanical irritation to the upper airway and prolonged supine position . Cardiopulmonary bypass patients are at an even greater risk since they can develop temporary pulmonary ischemia that decreases the production of surfactant and stiffens respiratory tissue . Timely detection and prevention of respiratory compromise in this population has become a priority . Despite the inherent dangers caused by respiratory complications, current in - hospital monitoring is still lacking . A non - invasive technology that could reliably measure respiratory function after extubation and give early warning signs of respiratory compromise before harmful events occurred could markedly improve patient care and safety . Subjective clinical assessment and respiratory rate (rr) monitoring are both inconsistent and unreliable indicators of respiratory sufficiency, and current clinical practice relies heavily on continuous pulse oximetry or capnography . Though used in almost every clinical setting, pulse oximetry can be unreliable and studies have shown nearly two - thirds of alarms triggered by the oximeter to be false [6, 7]. Furthermore, oxygen saturation is a lagging indicator, as it decreases only after a significant drop in ventilatory adequacy and readings are often confounded by the use of supplemental oxygen leading to possible delay in interventions and risk to patient safety . One of the difficulties with capnography in the non - intubated patients is patient compliance and maintaining proper placement of the sampling cannula . Both oximetry and capnography are indirect measurements of respiratory performance, as they do not directly monitor the adequacy of respiration, but are rather surrogate measures of respiratory status . While a skilled clinician may measure a patient s rr by counting chest wall movements, an obstructed airway or chest muscle contraction could result in this same movement rather than true respiratory effort . In the obese population, observing a chest rise and fall is increasingly challenging and even if one can accurately count the rr, one would not be able to easily distinguish between adequate and inadequate breathing . The currently available measures are limited and often do not provide enough clinically relevant information to trigger healthcare provider response and early intervention to prevent respiratory compromise . Recent development of a non - invasive respiratory volume monitor (rvm) that provides quantitative, continuous, real - time measurements of mv, tv and rr in non - intubated patients has addressed a number of these challenges . With the recommended electrode placement and calibration algorithms, strong correlations (0.96 0.16, mean 95% ci for regular and erratic breathing) between rvm and spirometric measurements the rvm can quantify ventilation in non - intubated patients and help identify patients at risk for respiratory complications following cardiac surgery and in other clinical settings [11 - 15]. The goal of this study was to demonstrate that an alternate electrode placement, to accommodate the sternal dressing, would not affect the rvm correlations to the ventilator and to show the utility of using rvm to monitor mv, tv, and rr in cardiac surgery patients after median sternotomy . It was hypothesized rvm would provide accurate, continuous measurements of mv, tv, and rr in this cohort before and after extubation . Fourteen cardiothoracic patients (four females and 10 males, average age 69 11.8 years, average bmi 29 6.0 kg / m, eight coronary artery bypasses, four valve replacements, and two myomectomies, table 1) were enrolled in an irb approved protocol for monitoring respiratory status in the tufts cardiothoracic unit (ctu). Respiratory traces were recorded from thoracic electrodes using an impedance - based rvm system (exspiron, respiratory motion, inc ., all cardiothoracic procedures were performed under general anesthesia and all patients arrived in the ctu intubated and sedated . Upon arrival in the ctu, the exspiron electrode padset was positioned to the right of the sternal dressing, approximately at the right mid - clavicular line, instead of the standard midsternal placement . The device was calibrated while the patient was on the ventilator (puritan - bennett 840, covidien, mansfield, ma) during synchronous intermittent mandatory ventilation mode (simv) with setting at 6 - 8 ml / kg ibw as determined by the anesthesiologist . Respiratory data (mv, tv and rr) were acquired only every 15 s from the ventilator, as the ventilator did not support continuous respiratory trace streaming . Rvm - based mv, tv, and rr were calculated from continuous 30-s segments . Rvm data were recorded continuously from ctu arrival until 24 h after extubation or ctu discharge, whichever occurred first . Arterial blood gases were collected before extubation and again approximately 1 - 2 h after extubation in a subset of patients (n = 12) as deemed necessary by the surgical care team . Rvm traces were continuously recorded in the ctu for 27 3.7 h (6 - 49 h). After extubation, patients remained in the ctu and were monitored by the rvm for another 18 2.5 h (2 - 29 h). Twelve of 14 of the patients had ventilator reading for analysis . During mechanical ventilation, tvs measured by the rvm strongly correlated with tvs reported by the ventilator (r = 0.97). This correlation was maintained during both mandatory ventilation (simv) and during spontaneous breathing with pressure support (ps) modes . Patient average error in tv measurements between rvm and the ventilator was -2.6%, the average precision was 23.9% and average accuracy was 26.2% . An example of simultaneous rvm and ventilator recordings for 30 min is shown in figure 1 . During this time, the ventilator measured an average mv of 6.3 l / min, a tv of 520 ml, and a rate of 12 breaths / min, while rvm measured an average mv of 5.9 l / min (7% error), an average tv of 490 ml (6% error), and an average rr of 12.2 breaths / min (3% error). Measured mv, tv, and rr over a 30-min period using rvm (red) and the puritan bennett ventilator in simv mode (black) for one example patient . Average errors between rvm and the ventilator for mv, tv, and rr are less than 10% . Before and after extubation, the rvm recorded respiratory traces continuously, in real - time, and captured a distinct pattern of post - extubation respiratory variation . Based on body surface area, the average predicted mv was calculated to be 7.6 0.6 l / min for the 14 patients . During 2 min of breathing on simv mode on the ventilator, the average baseline ventilation was slightly above the predicted at 8.2 0.4 l / min (1095% of predicted). Analysis of the exspiron data from the 14 studied patients showed mv was significantly reduced 30 min after extubation to 779% of baseline (8.2 0.4 to 6.4 0.9 l / min, p <0.05) and tv was significantly reduced to 719% of baseline (520 40 to 370 40 ml, p <0.01) relative to the pre - extubation baseline mv (table 2, fig . Mv began to increase and by 60 min after extubation, average mv and tv had returned to baseline levels (mv: 11816% of baseline (9.6 1.2 l / min); tv: 10516% of baseline (490 50 ml); p> 0.4). Thirty minutes after extubation, rr was 1138% of baseline (17.1 1.5 to 17.5 1.0 breaths / min, p = 0.4). It is important to note that rr is the only direct and continuous respiratory parameter currently monitored after extubation . Sao2 monitoring was recorded every hour by the nursing staff and revealed no significant drops in blood oxygen saturation after extubation (fig . (a) mv, tv, and rr as percent of baseline before and after extubation . A nadir in ventilation occurs 30 min after extubation with mv significantly reduced to 779% of baseline (* p <0.05) and tv significantly reduced to 719% of baseline (* p <0.01), while rr is not significantly different at 1138% of baseline . Sixty minutes after extubation, mv has returned to 11816% of baseline and tv has returned to 10516% of baseline . (b) absolute values of mv, tv, and rr measured before and after extubation . Mv falls significantly from 8.2 0.4 l / min at baseline to 6.4 0.9 l / min 30 min after extubation and tv was significantly reduced from 520 40 ml at baseline to 370 40 ml after extubation . The minimum spo2 value recorded at each time point among all subjects is shown as a blood gas measurements were taken on average 56 25 min before extubation and 106 27 min after extubation . Spo2 remained unchanged from before to after extubation (98 0.4 vs. 98 0.8, p = 0.21, table 3). There was a slight significant increase in bicarbonate from before to after extubation, but was of no clinical importance (21.3 0.5 vs. 22.3 0.4, p = 0.04). Example respiratory traces from a representative patient (60-year - old male, bmi 29). As the patient awakes from anesthesia and progresses toward extubation, faster and shallower spontaneous breaths predominate with an occasional ventilator breath (b). Just after extubation, the patient s breathing pattern is more irregular (c, d) and tvs and mvs decrease (d, e). Tv and mv measurements increase over time after successful extubation (f, g, h). While intubated, rvm - based mv, tv and rr correlated well with ctu ventilator measurements in patients after median sternotomy . After extubation, rvm continuously reported mv, tv and rr, providing a continuous, non - invasive, quantitative assessment of respiratory competence . A pattern of mv and tv decrease during the first 30 min after extubation was noted in all patients . Subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . Rvm showed distinct changes in mv and tv after extubation, while rr showed no significant variations . Although no patients in this study required reintubation, based on data from other studies collected after extubation in premature infants, we propose that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . Further studies to evaluate the use of rvm in postoperative cardiac surgical patients for early detection of respiratory failure for development of reintubation protocols are ongoing . This study demonstrated that, while intubated, rvm - based mv, tv and rr correlated well with ventilator measurements (r = 0.97). In addition, the change in the padset placement to accommodate the sternal wound and dressing did not affect the device measurements . This confirms that the rvm can provide accurate measurements of mv, tv and rr in patient s post - median sternotomy using the modified positioning of the electrode padset . After extubation, rvm continuously reported mv, tv and rr, providing a real - time, non - invasive, quantitative assessment of respiratory competence . A pattern of mv and tv decrease during the first 30 min after extubation subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . This shows that rvm is capable of providing patterns and trends in ventilation status not available to healthcare providers with other technology . Respiratory complications are one of the leading causes of readmission to the icu for cardiac surgery patients . This study shows the benefits of this new technology and its application in the ctu and possibly other locations . Pulse oximetry is the leading technology used to assess respiratory status in non - intubated patients; however, spo2 levels do not begin to decline until well after respiratory decompensation has begun and is known for being prone to inaccuracies [13, 17]. Intermittent blood gas measurements were taken intermittently and on average over 1 h after extubation, well after rvm confirmed a recovery in mv . Rvm showed distinct changes in mv and tv after extubation, while rr, generally measured with cardiac monitoring, showed no significant variations . The time it takes a patient to return to baseline mv is inversely proportional to successful extubation, therefore demonstrating the importance of obtaining mv measurements . Additionally, determination of mv after extubation using rvm could potentially aid in quicker assessment of the necessity and timing of reintubation, or provide an early indication of when institute non - invasive ventilation (niv), in the form of continuous positive airway pressure or biphasic positive airway pressure . Although no patients in this study required reintubation, based on data from other studies collected after extubation in premature infants, it is hypothesized that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . Recently, the american society of anesthesiology has voiced the opinion that quantitative monitoring of respiratory status is superior over qualitative methods . Qualitative clinical signs such as chest excursion and auscultation of breath sounds are useful, but they can only be obtained periodically and are often inaccurate . Carbon dioxide monitoring is also a qualitative sign of respiration in non - intubated patients and its accuracy is dependent on many factors . However, non - invasive mv and tv have been previously unavailable in non - intubated patients . The rvm permits a more comprehensive, quantitative assessment of respiratory status . With this functionality, rvm - derived respiratory data can bring forth reproducible and comparable data across patients over a wide range of breathing patterns . This can promote better evaluation of respiratory status in the ctu and other healthcare settings . While intubated, rvm - based mv, tv and rr correlated well with ctu ventilator measurements in patients after median sternotomy . After extubation, rvm continuously reported mv, tv and rr, providing a continuous, non - invasive, quantitative assessment of respiratory competence . A pattern of mv and tv decrease during the first 30 min after extubation was noted in all patients . Subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . Rvm showed distinct changes in mv and tv after extubation, while rr showed no significant variations . Although no patients in this study required reintubation, based on data from other studies collected after extubation in premature infants, we propose that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . Further studies to evaluate the use of rvm in postoperative cardiac surgical patients for early detection of respiratory failure for development of reintubation protocols are ongoing . This study demonstrated that, while intubated, rvm - based mv, tv and rr correlated well with ventilator measurements (r = 0.97). In addition, the change in the padset placement to accommodate the sternal wound and dressing did not affect the device measurements . This confirms that the rvm can provide accurate measurements of mv, tv and rr in patient s post - median sternotomy using the modified positioning of the electrode padset . After extubation, rvm continuously reported mv, tv and rr, providing a real - time, non - invasive, quantitative assessment of respiratory competence . A pattern of mv and tv decrease during the first 30 min after extubation was noted . Subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . This shows that rvm is capable of providing patterns and trends in ventilation status not available to healthcare providers with other technology . Respiratory complications are one of the leading causes of readmission to the icu for cardiac surgery patients . This study shows the benefits of this new technology and its application in the ctu and possibly other locations . Pulse oximetry is the leading technology used to assess respiratory status in non - intubated patients; however, spo2 levels do not begin to decline until well after respiratory decompensation has begun and is known for being prone to inaccuracies [13, 17]. Intermittent blood gas measurements were taken intermittently and on average over 1 h after extubation, well after rvm confirmed a recovery in mv . Rvm showed distinct changes in mv and tv after extubation, while rr, generally measured with cardiac monitoring, showed no significant variations . The time it takes a patient to return to baseline mv is inversely proportional to successful extubation, therefore demonstrating the importance of obtaining mv measurements . Additionally, determination of mv after extubation using rvm could potentially aid in quicker assessment of the necessity and timing of reintubation, or provide an early indication of when institute non - invasive ventilation (niv), in the form of continuous positive airway pressure or biphasic positive airway pressure . Although no patients in this study required reintubation, based on data from other studies collected after extubation in premature infants, it is hypothesized that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . Recently, the american society of anesthesiology has voiced the opinion that quantitative monitoring of respiratory status is superior over qualitative methods . Qualitative clinical signs such as chest excursion and auscultation of breath sounds are useful, but they can only be obtained periodically and are often inaccurate . Carbon dioxide monitoring is also a qualitative sign of respiration in non - intubated patients and its accuracy is dependent on many factors . However, non - invasive mv and tv have been previously unavailable in non - intubated patients ., the rvm permits a more comprehensive, quantitative assessment of respiratory status . With this functionality, rvm - derived respiratory data can bring forth reproducible and comparable data across patients over a wide range of breathing patterns . This can promote better evaluation of respiratory status in the ctu and other healthcare settings.
|
The scope of newborn screening has expanded greatly in the 52 years since robert guthrie published his microbial assay for phenylalanine and the use of dried blood spots in screening for phenylketonuria . Though guthrie and others went on to develop blood - spot screening methods for further disorders none were taken up very widely until the development of immunoassays and the ability to screen for congenital hypothyroidism, now the most widely practiced screen worldwide . Immunoassay - based screens for other disorders followed, cystic fibrosis and congenital adrenal hyperplasia in particular, but none have achieved general acceptance . More recently, tandem - mass - spectrometry (ms - ms), with its ability to measure a wide range of metabolites simultaneously, has opened up a further range of disorders, many of which are very rare but can be incorporated with screening for phenylketonuria at little additional cost . Thus, in large parts of the usa screening covers over 50 conditions (1) though this total is inflated counting sickle - associated haemoglobin variants as separate diseases . European countries with equally well - developed medical systems have very different screening policies: in 2009, the maximum number of conditions covered was 30 and some countries were screening for four or less (2). There was little consensus regarding information provision, informed consent, storage and disposal of residual specimens, screening technologies and disease definition . The reasons for these differences are not always obvious though clearly funding issues and the availability of an adequate clinical infrastructure must play a part . All formal policy reviews have acknowledged the ten principles enunciated by wilson and jungner in 1968 (3). These are couched largely in qualitative terms, there should be a suitable test which should be acceptable to the population and there should be an accepted treatment . Nevertheless, the uk national screening committee has until very recently emphasized the importance of having firm numerical data and evidence from a high - quality randomized controlled trial before accepting a new condition (4). However, it is recognized that for clinically heterogeneous and relatively rare disorders, such as those now readily accessible through ms - ms screening, a degree of compromise is required . Medium - chain acyl - coa dehydrogenase deficiency was accepted on the basis of a large - scale pilot study (5) and preliminary studies on five additional disorders detectable by ms - ms are underway . The approach in the usa has been quite different, with federal policy based largely on the results of a survey carried out by the american college of medical genetics (6). This canvassed opinions (rather than data) from a wide range of professional and lay personnel in the usa and abroad and commissioned literature reviews on specific diseases from practicing academic clinicians . This resulted in the identification of 29 conditions for which screening should be mandated and an additional 25 conditions that would be identified as part of differential diagnosis . The work was subsequently taken forward and amplified by the secretary s advisory committee on hereditary disorders in infants and children (7), forming the basis for both federal and state legislation . Screening policy is ultimately decided at state level and based on explicit legislation, with significant regional variations in both the number of disorders covered (1) and practices such as how long the blood collecting cards are retained after screening has finished (8). This overt political dimension leaves policy - makers exposed to pressure from groups such as the save babies through screening foundation and there is almost a degree of competition as to which state screens for the most disorders . In countries like the uk where screening is offered as part of the national health service with no direct legislative basis policy tends to attract less public attention though nevertheless the uk screening programmes for cystic fibrosis and sickle cell diseases were introduced following direct pressure at the political level rather than through the formal advisory channels . The wilson and jungner analysis was based mainly on adult disease and largely neglected the family dimension of newborn screening: the value of genetic information and the way that prompt diagnosis, even of an incurable condition, can ease the family journey . Family impact is the main rationale behind the welsh screening programme for duchenne muscular dystrophy which has been well - accepted locally but requires considerable professional input and is not supported in the rest of the uk . Cystic fibrosis is an obvious example as in the absence of screening diagnosis is often considerably delayed, leading to significantly worse outcomes . Diagnostic odyssey and has no warning of the possibility of future children also being affected . Attitudes of at - risk couples towards antenatal diagnosis of cystic fibrosis are ambivalent (9) but overall the introduction of newborn screening has resulted in a significant decrease in the number of babies born with the condition (10). Even before antenatal diagnosis became possible families with a phenylketonuric child diagnosed by screening tended to limit family size subsequently (11). However, in general policy - makers focus their attention on the value of newborn screening to the baby concerned and have mixed views about wider genetic implications . Genetic exceptionalism is the view, strongly held by some civil liberties groups, that genetic information is special and must be treated differently from other types of medical information . Dna analysis may reveal carrier status in individuals with no family history of the disorder concerned and in some countries is prohibited without a specific request from a registered medical practitioner . Such sensitivities are reflected in some of the screening protocols, particularly those for cystic fibrosis . Several screening programmes have retained the original two - step irt approach and require a second blood sample despite the convenience and greater specificity of analysing the cftr gene on the initial sample . Programmes that do use dna analysis vary greatly in the mutation panel used: some restricting it to a few relatively common mutations associated with severe disease, others using a much broader panel with a corresponding increase in the number of unaffected carriers found . Other programmes include a pap (pancreatitis associated protein) step in an attempt to maintain specificity but minimise or avoid carrier detection (12, 13). The uk protocol attempts to minimise carrier detection but by different means (figure 1, panel a) while also recognising that a mutation panel optimised for northern european populations has inherent disadvantages for those of other geographical origin (panel b). Complicated protocols of this type place a considerable administrative burden on the laboratory . Travelling in the opposite direction, studies of the potential of exome sequencing as a first - line method of newborn screening and the possibility that genomic data be made available as a resource for parents and doctors throughout infancy and childhood to inform health care there is usually less anxiety about genetic information obtained at the protein level even though, with haemoglobin variants for example, this may inform directly on the underlying dna sequence . Indeed, when a baby has received a blood transfusion prior to the screening sample being taken some programmes use dna analysis rather than waiting several weeks for the infused erythrocytes to be removed . Newborn screening for sickle cell diseases and related haemoglobin abnormalities detects a significant number of carriers: 1 baby in 71 born in england in 201112 . There are different views on whether this is desirable despite the presence of an antenatal screening programme and, as far as possible, linkage between the two programmes . Ms - ms methods capable of detecting individual haemoglobin variants without the corresponding carriers have been developed (15) and it remains to be seen whether this will affect practice . With improvements in analytical performance the definition of normal has tended to be drawn ever more tightly . However, the primary purpose of screening is prevention or amelioration of disease rather than the detection of a biochemical / genetic abnormality as such . Thus, not all children with a persistently increased blood phenylalanine concentration will become mentally impaired: there is fairly good evidence for a threshold of about 600 this threshold has been adopted in france and germany but is ignored in many other countries . Similarly with congenital hypothyroidism, improvements in assay sensitivity have resulted in many screening centres adopting lower cut - offs and consequently finding an increased number of cases . However, their gender distribution is markedly different from that in cases diagnosed clinically prior to the start of screening and there is no firm evidence that most of these additional cases benefit from their treatment . The biological level (gene, protein, enzymic activity, metabolic pathway, individual metabolite) at which screening and confirmatory investigations are performed also has an important impact on disease definition . Thus, medium - chain acyl - coa dehydrogenase deficiency (mcadd) is readily detectable by increased blood - spot octanoylcarnitine on ms - ms screening . In the netherlands enzyme assay using phenylpropionyl - coa is regarded as the gold - standard confirmatory test . The current uk screening protocol defines mcadd in terms of having two mutations in the mcad (acadm) gene and genotyping is central to the clinical follow - up protocol . However, data from the pilot study (5) show that all babies except one with genotypes that have previously been reported from clinically - presenting cases showed urinary hexanoylglycine> 5 micromol / mol creatinine on immediate follow - up . This would appear to be a more effective indicator of the risk of metabolic decompensation (which is what we are really wishing to screen for) than mutation analysis and avoids the complication of inadvertent carrier detection . Viewed in the context of everything else that can go wrong in pregnancy, childbirth and afterwards, newborn screening seems a fairly insignificant thing to worry about but the importance of having suitable information available if required is universally recognized . The way that this is provided and the amount of detail given vary considerably . The uk national screening committee requires that evidence - based information, explaining the consequences of testing, investigation and treatment, should be made available to potential participants to assist them in making an informed choice . The emphasis on choice is in keeping with current political philosophy but it could be argued that if parents were truly informed then choosing to have their baby screened would be automatic . Even carefully worded information can leave room for misunderstanding: we read the form and our understanding was that the conditions were hereditary . We did nt want to cause baby the pain of having a needle in her heel . Come on then let s get on with it. We both looked at each other and were afraid to say anything so the baby screamed and we felt bad for doing it . She saved our daughter (with phenylketonuria) to grow up a lovely healthy bright little girl (17). Should we really be presenting screening as an option which rational parents might like to consider? . In some us states screening is compulsory, required by law, so that (in theory at least) every baby gets screened . The supreme court of ireland upheld the right of parents who already had a child with phenylketonuria not to have their newborn baby screened (18). The united nations convention on the rights of the child states that the best interests of the child must be a top priority in all actions . However, whether screening is truly in the interests of the affected child is sometimes debatable, particularly for disorders where treatment is invasive and the effect is to slow the progression of a debilitating disease rather than prevent it . Most disorders show some degree of heterogeneity and this may make a clear answer impossible: for example, severe propionic acidaemia is almost untreatable, with an inexorable deterioration, but patients with milder variants can survive and go on to lead virtually normal lives if diagnosed and treated early . The current diversity of national policies relating to newborn screening reflects both practical limitations in health care organization and funding and widely different philosophical approaches to a variety of highly emotive issues . Decisions will become more difficult still as screening technology advances, with the use of orbitrap mass spectrometry for example, and the number and variety of disorders readily accessible increases still further.
|
Intravesical instillation of bacillus calmette - guerin (bcg) is an established option for the treatment and prophylaxis of non - muscle - invasive bladder cancer . Low - grade fever and irritative bladder symptoms are common side - effects of intravesical bcg instillation therapy . Penile lesions or balanitis as complications of bcg treatment, we present a patient who underwent intravesical treatment with bcg and subsequently developed penile lesions and bilateral inguinal lymphadenopathy . The pathologic diagnosis was pta, g2 transitional cell carcinoma and carcinoma in situ (who 1973). He was offered six weeks of bcg instillation (oncotice, tice strain, administered intravesically after reconstitution in 50 ml saline). The patient was unable to complete the treatment cycles consecutively due to severe irritative symptoms; hence at the second and fourth week, treatment cycles were cancelled for a period of one week and his symptoms were treated with antibiotics and antispasmodics . He was administered five cycles of bcg at full dose, atraumatically, by a staff urologist using a 12fr hydrophilic nelaton catheter . One week after the last instillation the patient reported penile swelling and tenderness, itching at suprapubic areas . Two days later, he presented with a penile lesion and indurated lesions at the suprapubic area . Physical examination demonstrated two areas of painless indurated lesions at the pubic area and shallow ulceration on the penil shaft [figures 1a and b] and bilateral palpable inguinal lymphadenopathy . Chest x - ray was unremarkable and computed tomography (ct) of abdomen revealed bilateral inguinal adenopathy (maximal length of diameter 1 cm on the left and 1,5 on the right side). Laboratory data showed slight elevation of c - reactive protein and erythrocyte sedimentation rate, and otherwise blood chemistry was normal . Polymerase chain reaction (pcr) for urine tubercle bacilli was negative, and thereafter urine cultures were also negative for mycobacterium . (a, b) penile ulcerated lesion and papule at pubic area before treatment; (c, d) appearance at three months (c) and six months (d) after treatment the patient underwent diagnostic biopsy from the papules of pubic areas and cystoscopy at the same time . Cystoscopy showed several erythematous areas in the bladder and cold - cut biopsy was obtained from these areas . Pathology of the bladder biopsies revealed acute and chronic inflammation with granulomatous changes; there was no evidence of malignancy . The pathologic examination of biopsy samples from endurated pubic lesions demonstrated granulomatous inflammation with caseous necroses [figure 2] and multinucleated giant cells of langhans type, which was compatible with bcg - induced granulomatous skin infection . Histological appearance of granulomatous inflammation with caseous necroses (h and e, 10) intravesical bcg instillation therapy was discontinued and the patient was given a three - drug antitubercular regimen including rifampicin, isoniazid, and pyrazinamide . The total treatment course was six months, with discontinuation of pyrazinamide after two months . Complete resolution of penile, pubic lesions and inguinal adenopathy was achieved at six months of treatment [figures 1c and d]. Follow - up cystoscopy showed no evidence of tumor recurrence and ct of abdomen and chest x - ray were unremarkable . Side - effects of bcg usually occur when bcg is given immediately after transurethral resection of a bladder tumor, or when the patient had a traumatic catheterization or concurrent cystitis during intravesical instillation . Use of immunosuppressive agents or genetic factors may also play significant role . During the instillation cycles of bcg, urine culture was negative however this may not preclude urinary tract infection and may have predisposed to bcg side - effects . Although catheterization was atraumatic in the present case unnoticed trauma during catheterization could have played a role in the bcg toxicity determined in our patient . Although our patient had no co - morbidities such as diabetes or immunosupression, his older age may have been a factor for the progression of side - effects . Granulomatous reaction associated with bcg treatment is known to occur in the bladder, epididymis, prostate, kidney, lung and liver . However, occurrence of balanitis is uncommon and only a few cases of balanitis associated with bcg instillation have been reported . Granulomatous balanitis symptoms include penile edema, papules and ulcers, occasionally associated with inguinal lymphadenopathies as in our case . Therefore, clinical diagnoses are made in the majority of cases by histopathology and by the history of bcg therapy . Although the stain and culture were negative for mycobacterium, given the recent history of intravesical instillation of bcg, these lesions likely represent dissemination of inoculums . The mechanism of infection presumably occurred via direct inoculation of the penis during the instillation of bcg, followed by dissemination to the superficial inguinal lymph nodes . Histological appearances of these changes typically show epithelioid granuloma with central necroses and giant cells of langhans type as determined in our case . As bcg - induced penile ulcer and adenopathy is a rare complication of intravesical bcg therapy, treatment for this disease is not yet standardized . However, modern short - course anti - tuberculosis drug regimens for genitourinary tuberculosis are also recommended for the treatment of such cases . According to the world health organization anti - tuberculous drug treatment is based on an initial two - month intensive phase of treatment with three or four drugs with rifampicin, isoniazid, pyrazinamide, and ethambutol to destroy almost all tubercle bacilli . Treatment is followed by a four - month continuation phase with only two drugs, rifampicin and isoniazid . In our case, adverse effects of bcg intravesical administration affect several organs in the genitourinary system and can disseminate to distant organs . The clinician must be alert to any complaints the patient has after treatment, and investigate accordingly . Physicians should be aware of the possibility of bcg - induced granulomatous balanitis and concomitant adenopathy . When these clinical features appear in patients, adequate therapy should be started as soon as possible . We consider that immediate antituberculous therapy should be commenced to achieve prompt resolution and management of clinical findings.
|
Lung cancer is the main cause of mortality related to cancer in the most developed countries . However, some of the patients at initial stages of disease (stage i, ii) are curable . One of the most important factors in deciding for treatment of these patients is preoperative staging with the most common form being tnm staging . Since surgical resection is the basic treatment of the patients at stage i, ii and is associated with good results of survival (long - term survival of 50 - 65%), determining of a preoperative accurate staging method is effective in planning the treatment strategy . Although for tnm staging, history, clinical examination, chest ct scan, pet scan, mediastinoscopy, and endobronchial ultrasound are routinely performed; the results are not accurate enough for determining the stage and can be associated with over and under staging . Since nowadays multi - modality treatments require accurate staging; more invasive methods in staging have been suggested . Among these methods is vats which can more accurately evaluate t, n, and m in the patients and can prevent unneeded surgeries . The aim of this study was to evaluate the role of vats in staging of non small cell lung cancer (nsclc) patients and detection of vats diagnosis accuracy for accurate evaluation of preoperative surgery . In this prospective study, all the patients with lung cancer type nsclc referred to ghaem hospital of mashhad university of medical sciences were evaluated in terms of preoperative staging (history, clinical examination, chest ct scan, cardiac evaluation, pet, mediastinoscopy, routinely and chest or brain mri, and bone scan if needed). Before main surgery, the patients immediately underwent vats surgery with single port and were evaluated in terms of t (tumor extending to mediastinal elements, plural involvement), n (n2 station involvement), and m (satellite lesion that involved other lobe). If the patients had no contraindication for surgery, such as other metastatic plural involvement confirmed by pathology or satellite lesion at involved lobe confirmed by pathology or + n2 station lymph node involvement confirmed by pathology, thoracotomy by posterolateral incision if the patients were not candidates for surgery according to the results of vats with mentioned criteria, the surgery would be terminated and the patients were referred to oncology department for appropriate treatment . The data were collected and evaluated in terms of age, sex, type of tumor pathology, method of pathology, results of ct scan, results of vats (t: plural involvement or mediastin elements), n2 involvement, m1 involvement (satellite lesion of involved lobe), results of main thoracotomy surgery, type of pulmonary resection, and vats diagnosing accuracy . To evaluate mediastinal extension in vats, the patients were divided into three groups based on the results of preoperative ct scan, and vats . Patients with confirmatory ct scan findingpatients without confirmatory ct scan findingimpossible to confirm ct scan finding . Patients with confirmatory ct scan finding patients without confirmatory ct scan finding impossible to confirm ct scan finding . Data were statistically analyzed by spss software version 11.5 and to evaluate vats diagnosing accuracy, we also used distribution, mean, and standard deviation for quantitative variables and frequency for qualitative variables . Diagnostic accuracy was estimated by table of test validity, for calculating diagnostic accuracy we devided the summation of true positive and true negative by the number of total cases . Mediastinoscopy was performed with standard technique in the patients at supine position under general anaesthesia by a small incision in supra sternal notch . Sampling was classically performed for all patients from (2l, 2r, 4l, 4r, 7) areas, and were sent for pathology evaluation . Vats was also performed immediately before main surgery by double lumen ventilation and evaluation was performed by single port vats (in terms of plural involvement, tumoral adhesion satellite lesion, n2 station ln involvement); in case of any doubt, sampling was performed and were sent for frozen section and decision was made based on the results of pathology . If there was no contra - indication for main surgery, final surgery was performed by standard posterolateral thoracotomy incision and open technique . Mediastinoscopy was performed with standard technique in the patients at supine position under general anaesthesia by a small incision in supra sternal notch . Sampling was classically performed for all patients from (2l, 2r, 4l, 4r, 7) areas, and were sent for pathology evaluation . Vats was also performed immediately before main surgery by double lumen ventilation and evaluation was performed by single port vats (in terms of plural involvement, tumoral adhesion satellite lesion, n2 station ln involvement); in case of any doubt, sampling was performed and were sent for frozen section and decision was made based on the results of pathology . If there was no contra - indication for main surgery, final surgery was performed by standard posterolateral thoracotomy incision and open technique . A total of 40 patients entered the study with ratio of m / f = 21/19 . Mean age of the patients was 57.2 16.64 yrs (min 15 and max 65 yrs). Other symptoms were hemoptysis in 27 patients (67.5%) and exertion dyspnea in 33 cases (82.5%) and pleuritic chest pain in 17 cases (42.5%). In the preoperative evaluation, important findings in ct scan with iv contrast were as follows: observation of mass lesion in 40 patients (100%), observation of hilar or mediastinal lymphadenopathy in 17 cases (42.5%), and observation of effusion in 9 cases (22.5%) which cytology of pleural liquid and pleural biopsy were negative in all of these 9 patients . There was the possibility of involvement of mediastinal elements (direct extension) (22.5%). Flexible bronchoscopy and bal were performed for all patients before surgery and 29 patients (72.5%) had endobronchial mass and biopsy was performed for them . For 11 cases (27.5%) because of peripherally located lesions and no endobronchial mass, tissue samples were taken by the method of ttnb under the guide of ct scan . All the patients underwent standard mediastinoscopy with samples from (2l, 2r, 4l, 4r, 7) areas and the results of pathology were negative in all . The patients who were candidates for main surgery underwent vats immediately before final surgery and the results of vats immediately before final surgery were unresectable tumors in 6 patients (3 cases (7.5%) due to seeding plural metastasis confirmed by pathology, 2 cases (5%) due to n2 station (one case in station 4 and one cases in station 9), and one case (2.5%) due to satellite mass that involved other lobe). The remainder 34 patients (85%) underwent thoracotomy immediately after vats and surgical resection was performed successfully in 31 cases (77.5%), but in 3 cases (7.5%) due to adhesion of tumor to hilum, tumor was not resectable . Table 1 shows type of surgical resection and the frequency of pulmonary resection in 31 patients underwent surgery . Table 2 shows the frequency of pathological results . In terms of diagnosing accuracy of vats for evaluation of tumor direct extension based on the results of ct scan, in 9 patients (22.5%) there was report by ct scan that involvement of hillum of the lung and mediastin elements; vats showed that in 5 cases (12.5%), tumor was resectable (not confirmed by ct scan finding), and in 4 cases (10%), we could nt determine whether tumor was resectable or not (impossible to confirm ct scan finding). Frequency and type of pulmonary resection frequency and type of pathological result based on the final results of surgery, all the patients in the group of non confirmatory ct scan findings) (5 cases = 12.5%) had successful pulmonary resection . In 4 cases (10%) which we could nt determine whether tumor was resectable or not (impossible to confirm ct scan finding), tumor was resectable in 1 case (2.5%) and not resectable in 3 cases (7.5%). According to the above results, vats diagnosing accuracy for accurate evaluation of preoperative surgery was 92.5% . Performing tnm staging in lung cancer type nsclc is important for deciding the patients treatment and prognosis . One of the criteria for determining preoperative staging is t and m stage which can be evaluated by bronchoscopy, ct scan, mri, and needle biopsy . Nevertheless, some of the patients which are considered to be at stage iiib can be in lower stages and the patients which are estimated to be at stage i and stage ii can be at higher stage and more accurate evaluation is needed . The study of passlick and co - workers reported that vats was a suitable method in evaluation of pleural involvement, finding lymph node (n2), or pulmonary (n1) metastases on the other side . They even reported that in patients with effusion and negative cytology, vats can confirm plural spreading in 60% of cases and recommended performing vats before thoracotomy for prevention of un - needed thoracotomies . The main problem in treatment planning of these patients is evaluation of n stage, since an important factor for treatment planning and survival estimation is n2 or 3 stations involvement . De langen, et al . Performed a study in 2006 about evaluation of n staging . They attempted to answer the question of whether lymph node size observed in ct scan is a criterion for performing complementary methods to obtain tissue samples . They showed that it is better for all of these patients to undergo fdg - pet after ct scan and divided the patients into three groups: group i: 10 - 15 mm, group ii: 16 - 20 mm, group iii:> 20 mm . They found that the patients with tumor size: 10 - 15 mm with negative pet (the possibility of lymph metastasis is <5%) were not candidates for other methods for obtaining tissue samples; other patients with either positive or negative pet scans were candidates for mediastinoscopy . Another study by bill, et al . In 2009 showed that lymph node size and the results of negative pet were not accurate for evaluation of the patients in terms of n2 stage involvement and they recommended routinely performing of mediastinoscopy for all patients . Standard mediastinoscopy is a gold standard method and is confirmed by the most researchers for all patients with lung cancer, and tissue sampling should be performed in 5 areas: (2l, 2r, 4l, 4r, 7); for increasing the diagnosing accuracy of mediastinoscopy, other methods are mentioned . Block and colleagues in 2010 reported that performing endobronchial ultrasound is a complementary method in n staging and declared that biopsy of all stations is performable by ebu and it is better to perform two biopsies of each station to increase diagnosing accuracy . In study performed by gomez et al . Using ebus with needle biopsy is considered helpful to diagnose central lymphadenopathy . Kuzdza, et al . In 2007 mentioned that performing transcervical extended mediastinal lymphadenectomy is a suitable method in mediastinoscopy for n evaluation . The results of this method were similar to mediastinoscopy and the rate of invasion was also similar to mediastinoscopy . Of course, these studies were limited and the more studies are required . To increase diagnosing accuracy, vats is usually combined with mediastinoscopy to cover the areas which mediastinoscopy cannot observe . Since vats can perform sampling of lymph nodes in these areas, it is a good replacement for extended mediastinoscopy . Of course, standard mediastinoscopy has sensitivity of 81% and specificity of 91% and cannot evaluate some patients . A study performed by witte, et al . On combination of mediastinoscopy with vats to increase diagnosing accuracy showed that this combination was helpful to increase diagnosing accuracy of standard mediastinoscopy . Among accurate diagnosing methods in n2 station is dye injection in tumor and evaluation of sentinel lymph nodes by vats . In the study of yamashita, et al . In 2011, they could find sentinel lymph nodes by injection of indocyanine green fluorescence image guide surgery and recommended to dissect the lymph node if they were not involved; diagnosing accuracy of this method was 80.7% . Since treatment planning and prognosis determination require accurate evaluation of tnm staging, it seems that preoperative vats can help to determine tnm staging and prevents unnecessary thoracotomy in some patients and we recommend this method . However, the numbers of the patients in our study are limited and a definite conclusion needs further studies.
|
It is a leading infective cause of mortality in children under 5 years of age . In 2013, bronchopneumonia caused death in 935,000 of children under 5 years . Since pediatric population is vulnerable and specific, clinical features are often non - specific and conditioned by numerous factors . These factors include certain age group, presence of comorbidity, exposure to risk factors, carried out immunization etc . The most reliable way to diagnose bronchopneumonia is through chest x - ray, but that is not enough to determine the ethiological agent, so the treatment of bronchopneumonia is clinical rather than ethiological in most cases . Since bronchopneumonia is an infectious disease, antimicrobic agents must be used in the treatment, along with additional supportive and symptomatic treatment . However, frequent use of antibiotics leads to a rise in bacterial resistance (1). Bacterial resistance, along with limitations in establishment of timely diagnosis and difficult ethiological classification, often leads to severe clinical features and inadequate response to therapy, which results in increased number of treatment days, as well as increased consumption of antimicrobials . The aim of this study was to determine the most often proscribed antibiotics and supporting concomitant therapy in treatment for bronchopneumonia at the pediatric clinic in sarajevo, and to determine whether the treatment is in accordance with the british thoracic society guidelines . The study included patients under 18 with diagnosis of bronchopneumonia, patients with detailed history of the disease and detailed information on diagnostics and treatment carried out at the pediatric clinic, and patients who were hospitalized in the pulmonary department in the period from 1 july to 31 december 2014 . Analysis results are displayed in tables and graphs as per number of cases, percentage, and arithmetic mean (x) with standard deviation (sd), standard error (se) and a range of values (min - max . ). Testing of differences between age groups was performed using wilcoxon signed rank test and one - way analysis of variance (anova) with significance level of p <0.05 which was considered to be statistically significant ., there was a higher number of male subjects (60 or 57.7%) than female patients (44 or 42.3%). According to the formed age groups, the highest number of patients was in the preschool and school age groups (39 patients each or 37.5%), followed by the age group of infants (22 or 21.2%). The youngest patient was 1 month old and the oldest was 192 months old (16 years). According to the data in patient s history, some of the symptoms were dominant in clinical features . Cough was present in 88 or 84.6% of patients, with average body temperature of 38.70.9; 37 - 40.2 c. chest pain was experienced by 66 or 63.5% of patients, and vomiting was experienced by 64 or 64.5% of patients . Duration of hospital stay (number of days of hospitalization) averaged 5.22.6 days, with shortest stay of 1 day and longest stay of 15 days . Out of total number of subjects, 66 or 63.5% were immunized regularly . In the period of the study (july - december), the largest number of patients67 of them (64.2%)had three dominant symptoms in clinical features . In newborn and infant age group, the following symptoms prevailed: cough, increased body temperature, and vomiting . In preschool children age group, cough was present in 87.18%, increased body temperature in 97.44%, chest pain in 66.67%, and vomiting in 41.03% of the subjects . In school children age group, cough as a symptom was present in 79.49%, increased body temperature in 94.87%, chest pain in 94.87%, and vomiting in 7.69% of the subjects . In adolescent age group, cough, chest pain and increased body temperature were present in all subjects, while vomiting was not observed at all . Upon admission, crp was elevated in 100% of newborns and adolescents, in 81.82% of infants, 79.49% of preschoolers, and in 92.31% of school - age children . Upon admission, white blood cell count was elevated in 50% of newborns, 72.73% of infants, 71.79% of preschoolers, 58.97% of school - age children and in 100% of adolescents . Used antibiotic therapy penicillin antibiotics were administered intravenously to 26 (25%) subjects . Within this group, the most widely used medicine was ampicillin (17.68%), with an average dose of 1138.89 491 mg (450- 2000), and the average duration of therapy 3.56 1.42 days (table 1). Analysis of use of penicillin group of antibiotics first - generation cephalosporins were administered to 42 patients (40.4%), intravenously in all cases . The only medicine in this group that was administered was cefazolin with average dose of 1,464.3 530 mg (300 - 3000) and average treatment duration of 4.3 1.6 days (2 - 7). Analysis of use of the i generation cephalosporin third - generation cephalosporins were administered to 33 or 31.7% subjects (intravenously in all cases). The most often used drug in this group was ceftazidime with an average dose of 1568 585.34 mg (250 - 2400), and the average duration of therapy was 5.76 2.62 days (figure 1). Analysis of use of the iii generation cephalosporins total duration of the antibiotic therapy averaged 4.5 1.9 days and ranged from 1 to 11 days . Recommended therapy for treatment continuation medicines from the group of penicillins were recommended for continuation of treatment of 28 patients (26.9%). The most commonly recommended medication in the aforementioned group was ampicillin in two forms (suspension and tablets). The average dose of ampicillin was 11.2 4.59 ml in form of suspension and 1.160 634.35 mg as tablet . The most recommended medication in this group was cefixime, with an average recommended daily dose of 8.74 4.78 ml in the form of a suspension and 828.57 455.8 mg in the form of tablets (table 3). Among other drugs recommended for treatment continuation at home, antipyretics were recommended in 54 or 51.9% of cases, methylprednisolone in 53 or 51% of the cases, and montelukast in 75 or 72.1% of cases . We present the results of 104 patients who were hospitalized at pulmology department of the pediatric clinic with diagnosis of bronchopneumonia . According to the results of our study we recommend oral administration of first - generation cephalosporins and penicillin antibiotics as effective treatment for bronchopneumonia in the pediatric population . In the last 30 years, a lot of research has been done with the purpose of achieving a more effective treatment of bronchopneumonia in the pediatric population and a reduction in bronchopneumonia - caused mortality . The turning point was year 1985 when the world health organization undertook activities to establish a unified strategy to combat pneumonia worldwide (1). The pediatric clinic of the university clinical center of sarajevo has also based its principles of treating bronchopneumonia on observing guidelines and protocols, as well as principles of good clinical practice . Hence the usual empirical treatment is based on proven connection of certain causative agents with specific populations, while etiological treatment is very rare . A study done on 385 hospitalized children in africa in 2014 found that there is a very low risk of failure when using drugs mentioned in the guidelines and protocols relative to the targeted etiological treatment (0.37 (95% ci -0.84 to 0.51)(2). According to the research done by the world health organization, for quality management of bronchopneumonia, certain criteria must be met in order to refer a child to hospital treatment: a child with persistent high body temperature or fever should be considered as a potential pneumonia patient; if symptoms persist or if there is no response to treatment prescribed by pediatricians or family doctors, it is necessary to reassess and to consider the gravity of the clinical situation; children with less than 92% oxygen saturation or children who show severe signs of respiratory distress should be hospitalized; auscultatory absence of respiratory sounds and dull sound on percussion indicate the possibility of pneumonia with complications and can be used as an indication for hospital admission; children with elevated parameters of acute inflammation; children under 6 months of age with signs of disease and children with poor general health (3). Treatment of bronchopneumonia involves administration of medicines and use of high calorie dietary regimes with adequate hydration . Antimicrobials used in the treatment of bronchopneumonia are first and third generation of cephalosporins, as well as penicillin based antibiotics . In our study, antibiotic therapy lasted 4.5 1.9 days on average and ranged from 1 to 11 days . Cefazolin in the group of first - generation cephalosporins was administered in 42 patients, or in 40.4% of all subjects . In all patients, cefazolin was administered intravenously at a dose of 1,464.3 530 mg (900 - 3,000) and the average duration of treatment was 4.3 1.6 days third - generation cephalosporins have been administered intravenously to 33 patients, or 31.7% . The most commonly used medicine in the group of third - generation cephalosporins was ceftazidime . A total of 17 subjects in the treatment received ceftazidime, the lowest dose was given in infants (900 mg) and the highest dose was given to school - aged children (2,400 mg). Ampicillin as the most often used drug from the penicillin group was administered in 18 patients with an average dose of 1,173.1 500 mg (450 - 2,000) and the average treatment duration of 3.96 2 days . Studies in india from 2013, conducted on a total of 1,116 children at the pediatric departments in 20 hospitals, showed that the treatment with penicillin antibiotics is more effective in comparison to treatment with other antibiotics (4). Study showed that the second and third generation of cephalosporins were used in infants, but not in adolescents . In the treatment of children of preschool age, first - generation cephalosporins were most often used, while third - generation cephalosporins were most often used in school - aged children . In determination of difference in the use of antibiotic therapy in relation to age of patients, statistically significant difference was only demonstrated in the use of penicillin antibiotics (p <0.05). According to the dose of administered antibiotic, it has been shown that dose increases linearly with age, with the lowest dose administered in infants . A significant difference was observed only in patients to whom cefazolin and ceftriaxone were administered (p <0.05). There were no statistically significant differences in average duration of treatment in relation to age group (in all <0.05), but still there were some noticeable differences . Duration of treatment with third - generation cephalosporins was longest in infants (7 days) and shortest in children of preschool age (4.7 days). According to the guidelines of the british thoracic society, certain guidelines every child with a clear diagnosis of pneumonia should receive antibiotic therapy since it is not possible to make immediate reliable differentiation of bacterial and viral pathogens (5). Intravenous administration of antibiotics is recommended for children suffering from pneumonia in cases when a child cannot tolerate oral intake of drugs or their absorption (i.e. Due to vomiting), and also for hospitalized children with more severe clinical features (6). Recommended intravenous antibiotics for treatment of severe bronchopneumonia are: amoxicillin, co - amoxiclav, cefuroxime and cefotaxime or ceftriaxone . Use of these antibiotics can be rationalized if microbiological diagnostics is performed (7). It is advisable to consider oral administration of medicines in patients to whom antibiotics were administered intravenously and who subsequently experienced noticeable improvement in clinical features (8). American thoracic society recommends the so - called switch therapy, which implies switching from parenteral to oral antibiotics . The main problem is the lack of clear definition of the moment or conditions when the patient should make the switch to oral administration (9). Orally administered antibiotics and concomitant therapy are recommended for continuation of treatment, and than can be considered as a variant of the switch therapy . Studies conducted in italy in 2012, showed that intravenous administration of antimicrobials has several far - reaching effects on pediatric patients and treatment itself (10). In the opinion of child psychologists, parenteral route of administration is considered to be traumatic for the child, with more rapid appearance of adverse effects (11). Studies of the american thoracic society from 2013 indicated that patients with respiratory disease should have a specific diet rich in minerals and vitamins with a moderate amount of easily digestible proteins, poor in carbohydrates and rich in fat (12). It is necessary to work on prevention in order to reduce the incidence of morbidity . Studies conducted in uk in 2003 showed that introduction of vaccination revolutionized prevention of infectious diseases . It has been shown that introduction of vaccines against measles reduced incidence of mortality by 2.5 million a year . Studies conducted in the united states in the period 2009 - 2013 have shown that introduction of the conjugate vaccine against streptococcus pneumoniae would make the biggest advance in prevention of pneumonia, since it is the most common etiologic agent of this type of pneumonia . Controlled study with use of who standardization of radiographic definition of pneumonia included 37,868 children . Vaccination effectiveness of 30.3% (95% ci 10.7% to 45.7%, p0.0043) has been observed in the study, taking into account age, sex and year of vaccination . During this four - year program implemented in the entire country, the incidence of disease was reduced by 39% (26 children) in children under 2 years of age . Italian single - blind study from 2012 showed that there was a statistically significant difference in occurrence of bronchopneumonia in children who are not immunized compared to those who are (13). According to study conducted on patients hospitalized at the pulmonary department of the pediatric clinic, 38 patients (37%) did not receive immunization regularly . Increase in use of third - generation cephalosporins, and aminopenicillins is a cause for concern . Since such increase is also observed in vulnerable pediatric population, current situation must be analyzed and restrictive - educational measures ought to be recommended based on results of such analysis . Study results showed that pediatric clinic has access to modern diagnostic tests, the treatment is carried out in accordance with the protocols and guidelines, which largely correspond to the guidelines of the british thoracic society . The study shows that the results of bronchopneumonia treatment at the pediatric clinic of the university clinical center of sarajevo are comparable to the results of other studies that were conducted at pediatric clinics . First and third generation cephalosporins (cephazolin and ceftriaxone, respectively) and penicillin antibiotics (ampicillin) were most commonly used antimicrobial agents with the average duration of antibiotic therapy of 4.3 days, all of which is consistent with the guidelines of the british thoracic society . Concomitant therapy usually consisted of antipyretics (diclofenac and paracetamol), 2 adrenergic receptor agonist (salbutamol), leukotriene receptor antagonists (montelukast), and corticosteroids (methylprednisolone). Availability and performance of diagnostic tests, as well as pharmacological measures conform to the guidelines of the british thoracic society . For the purpose of preventing bronchopneumonia in pediatric population, specific epidemiological measures ought to be taken, and they should involve all levels of health care . Awareness of early signs and symptoms of bronchopneumonia should be raised in the population, and especially parents, in order to begin treatment a timely manner . To reduce the incidence of disease, introduction of the pneumococcal vaccination
|
Dendritic cells play a key role not only in asthma during the initiation of the allergic immune response but also in the effector phase of the allergic inflammation leading to typical clinical symptoms [1, 2]. Basically, the dendritic cells can be divided into three groups: a small population of plasmacytoid dendritic cells, a predominant population of conventional dendritic cells, and, during inflammation, the monocyte - derived or inflammatory dendritic cells . The dendritic cells isolated and analysed in this study were the so - called conventional dendritic cells, which are positive for cd11c and mhcii . In addition, the expression of cd8 was used to separate cd8 from cd8 dendritic cells . Upon comparison, fewer cd8 dendritic cells than cd8 ones were found in the lung tissue . The cd8 dendritic cells were more concentrated in the draining lymph nodes, making them a lymph node - resident dendritic cell population [4, 5]. Furthermore, within lymph nodes the cd8 dendritic cells contribute to cytotoxic t cell responses via cross presentation of exogenous antigens [2, 4, 6]. Cd8, but not the cd8, sorted dendritic cells from schistosoma - infected mice prevented allergic responses . Cd8 and cd8 dendritic cells from bcg - infected mice suppressed allergic t cell responses in vitro and in vivo . In recent years, the expression of cd103 and cd11b has been introduced for phenotyping dendritic cells in asthma and elsewhere . The lymphoid resident dendritic cells are characterized as cd103 dendritic cells (cd11b, cd8, and cd8). In contrast the nonlymphoid residents are characterized as cd103 dendritic cells (cd11b, cd8, and cd8). Our approach to the gene expression of conventional dendritic cells compared cd8 and cd8 conventional dendritic cells, revealing an interesting panel of regulated genes . Since there is a close relation between dendritic cells in the tissue and the draining lymph nodes, both compartments were taken for analysis . The majority of dendritic cells pick up allergen not only in the bronchi but also in the alveoli and migrate to lymph nodes where the allergen is presented to b cell and t cells initiating and maintaining humoral and cellular lymphocyte responses . Lymphocytes become activated and recirculate through the tissues including the lung where dendritic cell immigration and activation are mediated [1, 2]. The present study had the aim to compare the gene expression of distinct dendritic cells isolated from the lung tissue and the lung - draining lymph nodes in mice with induced asthmatic - like inflammation and controls . A further aim of the presented study was to compare lung tissue and lymph node - derived dendritic cells from control animals and animals suffering from allergic inflammation . The more the subsets that are defined using multiple markers, the more the difficult the harvesting of a sufficient number of dendritic cells . Therefore, a strategy was chosen to obtain sufficient numbers of dendritic cells in a medium scale approach, using less than fifty animals each for the disease group and the control group . The classical combination of cd11c and mhcii defined the small numbers of conventional dendritic cells which yielded the draining mediastinal lymph nodes . For the bigger lung tissue yield of dendritic cells, the expression of cd8, which is relevant for pulmonary allergy, was additionally included . Data from gene arrays in murine macrophages and dendritic cells from lung tissue is available, but to our knowledge there is no data on gene arrays in dendritic cells from allergic or asthmatic - like inflamed lungs . Furthermore, no approach could be found including the analysis of dendritic cells from lung - draining lymph nodes . All experiments were carried out using c57bl/6 mice (812 weeks old, charles river, sulzfeld, germany). Mice (n = 38) were sensitized by intraperitoneal injection of 10 g ovalbumin (grade vi) emulsified in 1.5 mg aluminium hydroxide in a total volume of 150 l on days 1, 14, and 21 . Control mice (n = 42) were sham - sensitized with 1.5 mg alum in pbs . Ova provocation (1% ova grad v in pbs for 20 min) was performed on days 28 and 29 on all mice . Lungs were obtained and cut into small fragments, digested with collagenase, and dnase and enriched by gradient centrifugation and magnetic depletion of granulocytes, lymphocytes, and erythrocytes . Bronchial lymph nodes cells were isolated by passing the tissue through a metal mesh, directly followed by the magnetic depletion of granulocytes, lymphocytes, and erythrocytes . Remaining cells isolated from lung tissue and bronchial lymph nodes were resuspended in pbs and stained for 30 minutes with -cd11c, -mhcii, and -cd8 (bd biosciences). After washing, the stained cells were analysed and dcs (cd11c and mhcii) were sorted by using a mo - flo - system (cytomation). The total rna was isolated using the rneasy mini kit (qiagen, hilden, germany) according to the manufacturer's recommendations . Samples for microarray analysis were generated by applying an mrna - specific double linear amplification protocol (affymetrix). Briefly, double - stranded cdna was generated in vitro in a reverse transcription using the t7dt23 primer (5-ggccagtgaattgtaatacgactcactatagggaggcgg(t)23 - 3; metabion, planegg, germany) and superscript ii reverse transcriptase (invitrogen, karlsruhe, germany), followed by a second - strand cdna synthesis involving dna polymerase i (invitrogen) and e. coli dna ligase (invitrogen). For the first amplification round the promega p1300 ribomax kit for t7 amplification (promega, mannheim, germany) was used to synthesize unlabeled crna from the purified cdna . A second amplification round was performed starting with the amplified crna and reverse transcription by using random hexamer primers (pharmacia, freiburg, germany) and superscript ii reverse transcriptase for the first - strand synthesis . The second - strand synthesis, again using t7dt23 primers and additional rnase h treatment, was performed as mentioned above . For the final amplification round, the genechip expression 3-amplification reagent kit for labeling (affymetrix, san francisco, ca, usa), producing biotinylated crna, was used . Samples were fragmented and hybridized to a mouse genome 430 2.0 array (affymetrix). Analysis of microarray data was performed using genespring gx 10.0 software (agilent technologies). The robust multiarray analysis (rma) the experiments and sorting procedures were performed with animal groups of 5 to 7 animals and repeated to finally reach the number of 42 control mice and 38 asthmatic - like mice for the cell isolation from lung tissue and the number of 15 control and 15 asthmatic - like mice for the cell isolation from lung - draining lymph nodes . The yield of dendritic cells from lung tissue was as follows . From 42 control mice in total 121.000 cd8 and 843.000 cd8 dendritic cells (cd11c / mhcii) were obtained from the tissue of whole lungs . From 38 asthmatic - like mice in total the yield of dendritic cells from the lung - draining lymph nodes was as follows . From 15 control mice in total 168.000 dendritic cells (cd11c / mhcii) were obtained and from 15 asthmatic - like mice 140.000 dendritic cells were obtained . The reanalysis in flow cytometry led to a purity of at least 95%, and in most experiments, the purity was 97 to 99% . In the cd8 subset of lung tissue - derived dendritic cells 871 transcripts were upregulated with a fold change> 2 in the comparison between induced allergic inflammation and controls (figure 1). Again this is in contrast to the cd8 subset in the same comparison, where only 19 transcripts were upregulated and 152 were downregulated (figure 1). The cd8 subpopulation is more constant and the few genes regulated are downregulated (figure 1). This does not exclude a distinct function of the cd8 dc subpopulation, like cross presentation of external antigen, for instance . Since considerable lower numbers of dendritic cells could be obtained from the lung - draining lymph nodes, all dendritic cells were analyzed and again those from asthmatic - like lungs were compared to those of control lungs . Here, one can speculate whether the cd8 dendritic cells, being part of the sorted lymph node dcs were again those with the most regulated transcripts . It is known that, during inflammation, there is a constant flow of migrating dendritic cells to the draining lymph nodes, which induces massive changes in the cellular microenvironment in the lymph node . This is interesting and may support a role of the lymph nodes in controlling the immune response and inflammation . A venn diagram (figure 2) was used to display the overlap between regulated transcripts in all three populations: 66 were shared between the cd8 and cd8 dendritic cell population and 4 were shared by all dendritic cells, including the lymph node - derived ones . The small overlap of regulated genes amongst the three dc populations may underline their phenotypical distinctness . Moreover, the fact that the total lymph node dcs contain both cd8 and cd8 dc populations, but still show little overlap between the regulated genes found in asthmatic - lung - derived cd8 or cd8 dcs clearly shows that dc functions in asthma are dependent on the cellular environment . On the assumption that many cd8 dendritic cells had migrated to the lymph nodes, the intense interaction with the stimulated micromilieus might have changed their phenotype . In tables 1 and 2, gene enrichment analysis of cd8 dendritic cells is presented because cd8 dendritic cells seemed to be the most highly regulated during allergic inflammation . In the kegg pathway enrichment significantly regulated genes have been found, which are involved in chemokine signaling, cytokine / receptor - interaction, fcr - mediated phagocytosis, and tlr signaling (table 1). No significant kegg pathway enrichment was found in the comparison of cd8 dendritic cells (asthma versus control, see supplemental table 5 in supplementary materials available online at http://dx.doi.org/10.1155/2015/638032). In the go analysis, mainly changes of the plasma membrane and vesicles are prominent (table 2). In the cd8 dc go analysis, changes of the plasma membrane were prominent (supplemental table 5). In the dendritic cells from draining lymph nodes consisting of total dendritic cells (cd8 and cd8), only few components are overrepresented (supplemental table 6). No significant changes occurred on cell surfaces but rather intracellular compartments (table 3) seem to be modulated which might be related to the intense antigen processing and antigen presentation which is the core task of dendritic cells in the lymph node . From the abundant regulated genes in the cd8 dendritic cells highly upregulated genes were, amongst many others, distinct serpins, arl5b, and kif3b (supplemental material, excel sheet of regulated genes). Since it was not the primary aim of this study, no candidate genes were selected to perform confirming pcr analyses . The most prominent transcriptional alterations could be observed in the cd8 dc compartment from asthmatic - like mice when compared to cd8 dc from control mice . In general genes that are being upregulated more than 10-fold under these conditions are, for example, ear11, abcd2, cd209e, fabp1, and slc7a2 . Ear11, officially known as rnase2a, encodes for the ribonuclease, rnase a family, 2a (liver, eosinophil - derived neurotoxin) protein . It has been previously reported to be asthma - induced in short - term, intermediate term, and long - term ovalbumin exposure of the lung . It encodes for the atp - binding cassette, subfamily d (ald), member 2, a protein belonging to the large group of atp - binding cassette (abc) transporters responsible for cross membrane transport of various substances . Abcd2 is, for example, involved in the peroxisomal import of fatty acids . Cd209e also known as signr4 is a mouse homologue to the human dc - sign protein . Dc - sign is a type ii c - type lectin that functions as an adhesion molecule on the surface of dendritic cells . In the context of asthma, it has been reported that dc - sign on human mddcs mediates cellular responses to, for example, bermuda grass pollen antigens in vitro leading to the production of tnf- . Fabp1 (fatty acid binding protein 1, liver) is upregulated + 10.5-fold in cd8 dcs from asthmatic - like mice . That fatty acid binding proteins in principle are involved in dc function that has been demonstrated with regard to fabp4 (also known as ap2), another protein from the same family with at least nine members . Mice lacking ap2 were shown to produce less il-12 and tnf and were less potent in inducing t cell proliferation . However, expression of fabp1 on dcs in an asthmatic - like context has not been described so far . Slc7a2 stands for solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 and belongs to the amino acid - polyamine - organocation family of transport proteins . A comparably small group of genes in cd8 dcs were found to be downregulated in an asthma - dependent manner . For example, the two heat shock proteins 1a and 1b (hspa1a and hspa1b) show a drastic loss of expression (10.6- and 10.3-fold). Hspa1a and hspa1b are also known as heat - shock 70-kd proteins 1a and 1b, respectively . They are involved in cellular stress responses and act as chaperons . Of note, the toll - like receptor 3 (tlr3) tlr3 is a pattern recognition receptor sensing double - stranded rna typically associated with viral infections . As the cell surface is an important immunological interface of dcs, it is interesting to observe that genes whose protein products are associated with the cell surface are significantly enriched in the gene ontology analysis . In this category, the serotonin receptor 2c (htr2c) is highly upregulated (+ 7.1-fold) under asthmatic - like conditions . Htr2c expression has been also demonstrated on epidermal dcs in context of a contact allergy model in mice . Interestingly, cd2 human pdcs were shown to comprise a distinct dc population producing higher amounts of il-12p40 and expressing higher levels of costimulatory cd80 compared to cd2 pdcs following an influenza a virus infection of the lung . The cd200 receptor 4 (cd200r4) is upregulated + 4.6-fold on cd8 dcs under allergic conditions and is a receptor for the ox-2 ligand (also known as cd200). This is of particular interest since it has been recently reported in a rat asthma model that local delivery of recombinant cd200 strongly reduces ova - induced lung accumulation of myeloid dcs in the lung . Cd22 also known as siglec2 is upregulated 4-fold in cd8 dcs and belongs to the family of sialic - acid - binding lectins . Originally cd22 is thought to be a b cell restricted protein inhibiting the b - cell antigen receptor (bcr) signaling . However, there are reports demonstrating its expression also on pdcs . On the other hand, the induction of asthma led in cd8 dcs also to the reduced expression of some surface proteins or at least their according transcripts . The killer cell lectin - like receptors klrb1b (5.6-fold), klrd1 (4.0-fold, also known as cd94) and klrk1 (2.1-fold, also known as nkg2d) are all downregulated in cd8 dcs compared to nonasthmatic - like conditions . Interestingly, genes involved in antigen presentation like h2-oa and h2-ob which encodes for the histocompatibility 2 o region loci alpha and beta are slightly downregulated (h2-oa: 2.7-fold, h2-ob: 3.2-fold). Of note, the costimulatory protein cd86, working in conjunction with mhc class ii proteins to activate cd4 t cells, is downregulated as well (2.2-fold). With regard to the lysosomal compartment genes like pla2g15, sort1, and several cathepsins phospholipase a2 group 15 (pla2g15, + 5.3-fold) is involved in the eicosanoid synthesis, a substance class also containing prostaglandins and leukotrienes which have pro- and anti - inflammatory potential . Sortilin 1 (sort1, + 4.7-fold) very efficiently binds serum lipoproteins but can act as a multiligand type-1 receptor . The group of cathepsins (cathepsins a, b, d, f, k, and l) is upregulated in cd8 dcs from asthmatic - like lungs (ctsa: + 3.2-fold, ctsb: + 2.1-fold, ctsd: + 3.0-fold, ctsf: + 3.3-fold, ctsk: + 2.4-fold, and ctsl: + 3.3-fold). Cathepsins represent a group of endoproteases typically abundant in the lysosomal compartment and hydrolytically degrade, for example, the extracellular matrix and basal membranes . In the functional group of chemokine and cytokine signaling, genes like cd24 (+ 6.1-fold), ccl24 (+ 6.1-fold), and pdgfc (+ 5.8-fold) were highly upregulated . Cd24 is a protein that is able to provide costimulatory signals to t cells and has been described to occur in the context of dc differentiation from cd8 to cd8 dcs . Interestingly, it was reported that cd24-deficient mice exhibit increased susceptibility to danger but not pathogen - associated molecular patterns . Ccl24 is a chemokine also known as eotaxin-2 and is upregulated + 6.1-fold in cd8 dcs . Platelet - derived growth factor c polypeptide (pdgfc, + 5.8-fold) is a potent mitogen for cells of mesenchymal origin . Furthermore, genes like lepr (leptin receptor; + 4.7-fold), adcy3 (adenylate cyclase 3; + 3.7-fold), ccr1 (chemokine c - c motif receptor 1; + 2.7-fold), ccl6 (chemokine c - c motif ligand 6; + 2.4-fold), ccl8 (chemokine c - c motif ligand 6; + 2.4-fold), and cxcr3 (chemokine c - x - c motif receptor 3; 4.5-fold) were differentially regulated to a smaller extend . Dendritic cells and their subsets play a key role in initiating and maintaining allergic inflammation . Dendritic cells are present in low numbers in lung tissue and in very low numbers in lung - draining lymph nodes . Gene analysis requires the separation of dendritic cells from huge numbers of animals, limiting the analysis of very rare subsets . The present analysis showed a regulation, up and down, of many more transcripts in the cd8 conventional dendritic cells of the lung tissue as compared to the cd8 dcs supporting the pathophysiological predominance of the cd8 subset . Surprisingly, the transcriptional reaction in the dendritic cells of the draining lymph nodes was moderate indicating the role of the lymph nodes more as a stabilizer or controller than as a booster of the allergic inflammation . Conventional cd8 and cd8 dendritic cells are distinct subsets with differentiated roles in allergic inflammation . Further investigations will investigate whether the sorting of alternative dendritic cell subsets will show an overlap to those analyzed in this study.
|
Approximately 795 000 strokes occur every year in the united states, 87% of which are ischemic, and 6.6 million living adults have experienced a stroke.1 it is the fifth leading cause of death, the leading cause of longterm disability, and costs $33 billion per year in health care expenses and lost productivity.1 effective healthcare delivery can prevent strokes through risk factor modification,1 and can improve longterm recovery and outcomes after stroke,2 but insurance status affects access to healthcare.3 in the united states, employersponsored private health insurance covers about half of the population.4 private insurance covers the majority of healthcare costs, with patients accountable for only a copay or deductible usually amounting to less than 10% of total costs . Medicaid is a public insurance program for persons earning <138% of the federal poverty level and covers all services without any patient obligation . The uninsured receive no financial assistance with the costs of care and must pay for doctor visits, medications, procedures, and hospitalizations in full out of pocket . Being uninsured increases mortality for cancer,5, 6 trauma,7, 8 sepsis,9 heart failure,10 and acute myocardial infarction.11 medicaid insurance status is also associated with the risk for death in several of these conditions.5, 6, 10 there is evidence that disability and mortality are also higher for medicaid and uninsured patients after stroke,12, 13 with the largest and most recent study being specific to hemorrhagic strokes.14 despite the affordable care act, in the united states the uninsured rate remained at 11.9% in the fourth quarter of 2015.15 therefore, the objective of this study was to determine whether patients without insurance or with governmentsponsored insurance had worse care or outcomes in acute ischemic stroke (is) than the privately insured, using a large, nationally representative stroke registry . We specifically sought to investigate differences in prevention, presentation, inhospital care, acute outcomes, and use of rehabilitation services after discharge . We used clinical data from the american hospital association's get with the guidelines (gwtg)stroke, a continuous stroke registry, details of which have been published previously.16 quintiles (cambridge, ma) is the data collection coordination center for the gwtg programs . Duke clinical research institute (dcri) serves as the data analysis center for gwtg, and the reported analyses of aggregate deidentified data were approved by the duke university medical center institutional review board . Participating hospitals nationwide use trained hospital personnel to enter deidentified patientlevel data into the database for all of their stroke hospitalizations . Data collected include patient demographics, medical history, and comorbidities, inhospital treatment, discharge treatment and counseling, mortality, and discharge destination . The registry began in 2003, and this study presents data collected between october 1, 2012 and june 30, 2015 to minimize shifts in is care and insurance trends that have occurred over time . Patients with stroke types other than ischemic, or with missing insurance or discharge information, were excluded from this study, leaving 589 320 is patients treated in 1604 us hospitals analyzed here (figure 1): 197 474 (33.5%) patients from 1534 hospital sites were aged <65 years of age (15.9% uninsured, 53.0% private, 12.0% medicare, 19.1% medicaid), and 391 846 (66.5%) patients from 1593 hospital sites were aged 65 years of age and older (1.0% uninsured, 39.4% private, 52.1% medicare, 7.4% medicaid). Presenting characteristics include information on arrival to the hospital, initial nih stroke scale score, initial vital signs, and laboratory results on admission such as cholesterol and hemoglobin a1c levels . Hospital characteristics include stroke center designation by the joint commission, teaching status, rural location, geographic region, number of beds, and annual volume of is admissions . Quality achievement measures analyzed include use of iv tpa in patients arriving within the treatment window, early antithrombotics, and prophylaxis for venous thromboembolism (vte) acutely, as well as discharge with antithrombotics, anticoagulants in patients with atrial fibrillation or atrial flutter, statins in patients with ldl>100 mg / dl, and smoking cessation prior to discharge for smokers.17 the quality of care delivered is summarized by the defectfree care measure, which measures whether or not a patient's hospital treatment met all get with the guidelines quality measures.17, 18 outcomes analyzed include inhospital mortality (excluding patients who transferred out or left against medical advice), ambulatory status at discharge, modified rankin scale at discharge, and discharge destination . Ambulatory status and discharge destination measures excluded those who died during hospitalization . Patient and hospital characteristics and quality and outcomes measures were initially compared using chisquared tests for categorical variables and kruskalwallis tests for continuous variables . The associations among quality measures, stroke outcomes, and insurance status were evaluated using unadjusted and adjusted logistic regression models and with generalized estimating equations (gee) to account for hospital clustering . Covariates in adjusted analyses included patient characteristics (demographics, comorbidities, initial nih stroke scale score, offhour arrival), and hospital characteristics (region, teaching status, size, rurality, annual stroke and tpa volumes, and joint commission stroke center designation). To handle missing data, multiple imputation with 25 independently created imputation data sets and the fully conditional specification approach, also known as multiple imputation by chained equations, were performed in sas (all variables had <5% missing data with the exception of initial nihss with ~18% missing). All analyses were stratified by age less than or 65 years because the majority of the population becomes eligible for medicare at age 65 . All analyses were conducted using sas software version 9.4 (sas institute, cary, nc). Patient and hospital characteristics for is patients under 65 are shown in table 1 and table s1 . Uninsured and medicaid patients were more likely to be black or hispanic than privately insured or medicare patients . Uninsured is patients were less likely than privately insured, medicare, or medicaid patients to be taking strokepreventative medications including antiplatelets, anticoagulants, antihypertensives, cholesterolreducers, and diabetes mellitus medications, including those with preexisting conditions that would indicate need for such medications . Patient and hospital characteristics for acute ischemic stroke in patients younger than 65 years old, overall and by insurance statusa mi indicates myocardial infarction; nih, national institutes of health; tia, transient ischemic attack; tjc, the joint commission . Due to large sample size, all pvalues are statistically significant to <0.0001 . Continuous / ordinal row variables designated by * are presented as median (iqr). Patients with is who were uninsured arrived to the hospital later after symptom onset, and fewer arrived by ambulance than medicaid or medicare patients (table 1). However, uninsured and privately insured patients were more likely to be able to ambulate independently when they arrived than medicare or medicaid patients . The private and uninsured is patients also had lesser stroke severity by nihss at presentation than medicare or medicaid patients . Characteristics of is patients aged 65 and older are similar and can be found in table s2 . Medicaid patients under the age of 65 and uninsured and medicaid patients aged 65 and older were less likely to be treated in designated primary stroke centers, more likely to be treated in academic hospitals, and more frequently treated in hospitals with slightly lower annual ischemic stroke volumes (table 1 and tables s1 and s2). The majority of all is admissions in the data set occurred in the south, and the south had a larger share of uninsured is patients than other areas of the country . Process of care, quality, and outcome measures by insurance status are shown in table 2 and tables s3 and s4 . Although nearly all of the differences were statistically significant due to the large sample size, there were few absolute differences in achievement or quality measures by insurance status that were large enough to have a clinical impact, including the provision of defectfree care that met all get with the guidelines quality measures and evaluation for rehabilitation . Inhospital mortality was lower in privately insured patients under 65 and higher in uninsured patients aged 65 and older (tables s3 and s4), and uninsured patients were more likely to go home and less likely to go to rehab facilities after discharge . During their stroke hospitalization, uninsured patients were more likely to receive a new diagnosis of diabetes mellitus that had not been previously known . Process of care measures and other outcomes of interest in acute ischemic stroke patients younger than 65 years old, overall and by insurance statusa ama indicates against medical advice; gwtg, get with the guidelines . Due to large sample size, all pvalue are significant to <0.001 with the exception of iv tpa, arrive by 3.5 hours, and treated by 4.5 hours, p=0.0047 . Continuous / ordinal row variables designated by are presented as median (iqr). Quality of care as measured by the provision of defectfree care was less likely in medicare and medicaid patients but slightly more likely in the uninsured than the privately insured (figure s1). Uninsured patients were more likely to receive a statin when indicated by high ldl, and medicare and medicaid patients were less likely to receive antithrombotics, but there were no other differences in quality indicators . In patients aged 65 and older, medicaid patients were less likely to receive tpa when arriving within the window, and uninsured patients remained more likely to receive a statin, but other quality indicators and the provision of defectfree care were equal among insurance groups (figure s2). The uninsured had 30% higher odds of dying in hospital than the privately insured, and the odds of death increased to 1.5 for the uninsured aged 65 and older (figure 2; figure s2). Forest plot for unadjusted and adjusted ors (95% ci) among patients with age <65 years . The first pvalue within each outcome tests if or differs by at least 2 insurance categories; all other pvalues test if or differs significantly from 1 . Covariates in adjusted model include patient age, sex, and race; patient medical history of atrial fibrillation or flutter, stroke / tia, cad / mi, carotid stenosis, diabetes mellitus, pvd, hypertension, dyslipidemia, or smoking; arrival offhours, nihss score; and hospital region, teaching status, number of beds, annual ischemic stroke volume, annual iv tpa volume, rurality, primary stroke center . Compared with the privately insured, patients with medicaid were more likely to be considered for rehab but had 14% to 24% lower odds of being discharged to an inpatient rehabilitation facility . Instead, patients on medicare or medicaid under age 65 had about 25% higher odds of being discharged to hospice and were twice as likely to be discharged to a skilled nursing facility as the privately insured . Uninsured patients were equally likely to be considered for rehabilitation as the privately insured but had 37% lower odds when under 65 and 44% lower odds when aged 65 and over of being discharged to inpatient rehabilitation, 45% lower odds when aged 65 and older of being discharged to skilled nursing, and more than twice as high odds of being discharged home than the privately insured . We investigated whether insurance status affected prevention, presentation, inhospital care, acute outcomes, or use of rehabilitation services after discharge among patients with acute is . First, uninsured patients have poorer control of several risk factors for stroke when their is occurs . Third, medicaid patients are less likely to receive iv tpa when arriving within the window time for is . Finally, uninsured and medicaid patients have lower utilization of inpatient rehabilitation services after is, whereas medicaid and medicare patients have higher utilization of skilled nursing facilities and hospice after is than the privately insured . Mortality was particularly increased in the uninsured is patients but also slightly increased in medicaid patients aged 65 and older and in both medicare and medicaid patients under 65 . Increased mortality in uninsured is patients under age 65 has previously been suggested in survey data13 and demonstrated for all uninsured patients with hemorrhagic stroke12, 14 and for all patients with is with any status other than privately insured19 in national registry data . This study confirms the increased risk of death and adds more information on presenting, prehospital, and inhospital factors that can be used for future investigations into the etiology of the mortality disparity . Differences in prestroke preventative care and initial hospital arrival may partially explain the mortality difference for uninsured patients, particularly because stroke severity and provision of highquality processes of care did not differ . Uninsured patients with risk factors for stroke such as diabetes mellitus, high blood pressure, or high cholesterol were less likely to be taking the appropriate medications for primary stroke prevention and had more poorly controlled cholesterol levels than other groups . They were also less likely to be aware of their risk factors for stroke, as evidenced by more frequent firsttime diagnosis of diabetes mellitus during the hospitalization for is . In addition, the uninsured arrived almost 45 minutes later on average after stroke onset than other is patients . These findings correlate with prior evidence that the uninsured delay needed care due to costs,20 have undiagnosed chronic disease,21 do not take appropriate control medications to decrease stroke risk,22, 23 and have poorer control of risk factors for stroke such as blood pressure.24, 25 in the united states the uninsured must pay out of pocket for a physician visit at least once a year at an average cost of $160 to renew prescriptions for preventative medications,26 not including any laboratory tests required to screen for or monitor risk factors such as diabetes mellitus or high cholesterol, and an average of $166 per month for 1 antihypertensive and 1 statin.27 the uninsured are mostly lowincome workers for whom $100 represents a large percentage of their monthly income and are more likely to work at hourlywage jobs without sick leave, limiting access to physician offices during weekday working hours.3 the uninsured are more likely to have low health literacy28 and may live in areas with limited access to primary care.29 all of these factors likely contribute to poorer preventative care and worse stroke outcomes in this group . Although this study was unable to evaluate longterm outcomes such as recurrent stroke or longterm disability, if these patients remained uninsured after their is, evidence from this and prior studies30 suggests that they will also be less likely to achieve adequate secondary prevention for recurrent stroke . Although some differences did exist in quality of care delivered to is patients by insurance status, they had minimal clinical impact, with less than 10% absolute difference with the exception of iv tpa for medicaid patients over the age of 65 . Medicaid patients were less likely to be treated at designated primary stroke centers, which could contribute to this disparity, but it persists after adjustment . Medicaid patients had worse disability and were less likely to walk independently at discharge, but they were also less likely to walk independently at admission, so it is uncertain whether this poorer functional status relates to lack of iv tpa or to more severe prestroke disability . Although is patients who were uninsured were equally evaluated for rehabilitation, they had more than twice the odds as the privately insured of going home after stroke, and 40% to 50% lower odds of going to inpatient rehabilitation or a skilled nursing facility . Going home is typically viewed as a positive outcome after stroke, but in this group it may be inappropriate . Medicaid patients had lower odds of going home but higher odds of going to hospice (if under 65 years of age) and higher odds of going to skilled nursing rather than inpatient rehabilitation . Similar results have been found in previous national samples of stroke patients, but those have been limited to different subpopulations of stroke patients or to evaluation for rehabilitation without placement data.14, 31, 32 all comparisons were made to privately insured patients, who use inpatient rehabilitation more than the other groups, but ideal utilization levels are unknown, and it is not clear that utilization by privately insured patients represents appropriate utilization rather than overutilization . However, after suffering is, patients are at high risk for permanent disability, but evidence shows that rehabilitation improves functional outcomes, particularly when started early.2, 33, 34 lower utilization of postacute care has also been demonstrated in the uninsured after trauma and sepsis.8, 34 unfortunately, postacute care is expensive, and acceptance into such programs is highly dependent on ability to pay and insurance authorizations, which likely explains the differences observed in this study . Limited access to rehabilitation after ischemic stroke for the uninsured and medicaid populations may increase the number of poststroke patients who become disabled, increasing their longterm costs . Insurance status is correlated with sociodemographic variables, which may also play a role in the different stroke outcomes found in this study . For example, people on medicaid qualify due to poverty, and the uninsured are also a lowincome group.3 persons under the age of 65 on medicare are typically disabled, whereas almost all us citizens aged 65 and older qualify for medicare . In the group aged 65 and older, the overall uninsured rate is very low, and those who remain uninsured likely are either not us citizens or have poor social circumstances such as lack of personal identification due to homelessness that prevent them from obtaining medicare . Persons on medicaid over the age of 65 are generally dually eligible for medicare and medicaid and are impoverished and elderly . However, some lowincome persons may have excellent employersponsored insurance, and some wealthy persons may be uninsured,3 suggesting the importance of insurance status as an independent adjustment factor for stroke population analyses, especially for the under65 population . The affordable care act has reduced the number of uninsured persons in the united states . However, over 30 million people remain uninsured, and medicaid enrollment has increased by 12 million.3, 36 therefore, the findings of this study remain relevant as we consider how to increase insurance coverage and how that coverage equates with access, affordability, and outcomes . Future research should examine how highdeductible health plans, which are nearly ubiquitous in the marketplace plans that 10 million people have purchased through the aca and are increasing in prevalence in employersponsored plans, will affect stroke outcomes.36, 37 high deductibles may provide incentives similar to those the uninsured face in barriers to appropriate primary prevention medications prestroke and may or may not affect utilization of rehabilitation poststroke, depending on deductible amounts relative to the cost of stroke hospitalization . First, although get with the guidelines data represent a large number of stroke admissions across the country, they depend on the accuracy of data collection and entry by staff members at over 1500 different hospitals . As noted, 127 168 patients, or 18% of all acute ischemic strokes, were excluded from this study because they were missing key data, and some of the patients included were still missing other data points that, although predicted using multiple imputation, may introduce bias into the results . Second, all included hospitals are participating in a program to improve stroke quality, and their results may not be generalizable to other hospitals not participating . Third, this was a retrospective observational study, and some factors important to stroke severity or severity of comorbidities may not have been measured, introducing unmeasured or residual confounding . In particular, several socioeconomic factors that may interact with insurance status were not available, such as income level and employment status . Retrospective studies also cannot prove causality of insurance status on stroke outcomes . Finally, although differences were found in acute outcomes and discharge destinations after is, this registry is limited to hospitalassociated outcomes, and longterm outcomes such as functional status and disability, recurrent stroke, and survival were not analyzed . Preventative care prior to is, time to presentation for acute treatment, access to rehabilitation, and outcomes including mortality differ by patient insurance status . This study suggests that even highquality processes of stroke care in hospital cannot overcome the prestroke health status, socioeconomic drivers, and choices of patients in how and when to seek care that vary by insurance status . Because insurance status was independently associated with inhospital outcomes, expanded insurance coverage may help reduce death and disability due to is . The research analysis for this study was funded through a grant from the american heart association . Dr fonarow receives research funding from patient centers outcome research center, is a member of the gwtg steering committee, is employed by ucla, and holds a patent on an endovascular device . Dr bhatt discloses the following relationships advisory board: cardax, elsevier practice update cardiology, medscape cardiology, regado biosciences; board of directors: boston va research institute, society of cardiovascular patient care; chair: american heart association quality oversight committee; data monitoring committees: duke clinical research institute, harvard clinical research institute, mayo clinic, population health research institute; honoraria: american college of cardiology (senior associate editor, clinical trials and news, acc.org), belvoir publications (editorinchief, harvard heart letter), duke clinical research institute (clinical trial steering committees), harvard clinical research institute (clinical trial steering committee), hmp communications (editorinchief, journal of invasive cardiology), journal of the american college of cardiology (guest editor; associate editor), population health research institute (clinical trial steering committee), slack publications (chief medical editor, cardiology today's intervention), society of cardiovascular patient care (secretary / treasurer), webmd (cme steering committees); other: clinical cardiology (deputy editor), ncdraction registry steering committee (vicechair), va cart research and publications committee (chair); research funding: amarin, astrazeneca, bristolmyers squibb, eisai, ethicon, forest laboratories, ischemix, medtronic, pfizer, roche, sanofi aventis, the medicines company; royalties: elsevier (editor, cardiovascular intervention: a companion to braunwald's heart disease); site coinvestigator: biotronik, boston scientific, st . Jude medical; trustee: american college of cardiology; unfunded research: flowco, plx pharma, takeda . Dr peterson reports serving as principal investigator of the data analytic center for aha gwtg; receipt of research grants from johnson & johnson and janssen pharmaceuticals; and serving as a consultant to bayer, boehringer ingelheim, johnson & johnson, medscape, merck, novartis, orthomcneiljanssen, pfizer, valeant, westat, the cardiovascular research foundation, webmd, and united healthcare . Dr schwamm receives research funding from patient centered outcome research center and ninds, is a member of the gwtg steering committee, and chair of the gtwtg stroke clinical workgroup . Additional patient and hospital characteristics for acute ischemic stroke in patients younger than 65 years old, overall and by insurance status table s2 . Patient and hospital characteristics for acute ischemic stroke patients aged 65 years or older, overall and by insurance status table s3 . Additional stroke process of care measures and other outcomes of interest in acute ischemic stroke patients younger than 65 years old, overall and by insurance status table s4 . Process of care measures and other outcomes of interest in acute ischemic stroke patients aged 65 years or older, overall and by insurance status figure s1 . Forest plot for unadjusted and adjusted ors (95% ci) among patients with age <65 years . Forest plot for unadjusted and adjusted ors (95% ci) among patients with age 65 years.
|
These include evolution from fiberoptic imaging to generation of images using a charge - coupled device and high definition digital imaging . Enhanced endoluminal imaging techniques have included chromoendoscopy and modalities that aspire to optical biopsy . Among techniques for enhanced optical diagnosis, narrow band imaging (nbi) is a proprietary imaging modality in which the endoscope processor filters standard white light to specific wavelengths in the blue green spectrum (415 nm and 540 nm). Nbi thereby capitalizes on the peak absorption of hemoglobin and has the ability to accentuate visualization of the mucosal vasculature 1 . Proposed clinical applications of nbi include endoscopic evaluation of barrett s esophagus and endoscopic diagnosis of colorectal polyps . Studies of nbi in endoscopic inspection of barrett s esophagus have demonstrated high sensitivity of nbi in detection of barrett - associated high grade dysplasia 2, and the ability of nbi to detect dysplasia in a higher proportion of patients with fewer biopsy samples compared with standard white light endoscopy 3 . With respect to colorectal polyps, an nbi - based classification scheme has been developed which may accurately distinguish adenomatous from hyperplastic polyps 4, although it is not certain that use of nbi improves polyp detection rates 5 6 7 . Despite data regarding potential gastrointestinal endoscopic applications of nbi, the degree to which nbi use has been adopted into clinical practice legitimate questions exist regarding the degree to which efficacy of nbi as demonstrated in clinical studies will translate into effective use of nbi in actual practice 8 . The aim of this study, therefore, was to prospectively define the rate of nbi use among patients referred to a large group endoscopy practice for diagnostic endoscopy (esophagogastroduodenoscopy and colonoscopy), and to identify procedural factors associated with nbi use . Approval to conduct this study as a quality assurance protocol was granted by the institutional review board at the study institution . This study was conducted at the endoscopy center of a tertiary care academic center, where both inpatient and outpatient procedures are performed in a hospital - based suite . Each procedure room is equipped with nbi capability (180 series gastroscope or colonoscope, cv-180 evis exera ii video processor, and clv-180 light source; olympus medical systems, tokyo, japan). Each consecutive esophagogastroduodenoscopy (egd) and colonoscopy was directly observed by in - room endoscopy technicians, who assist the endoscopist with equipment setup and when endoscopic accessory use (i. e. biopsy forceps, polypectomy snare, endoscopic hemostatic device, etc .) A technician is present in each procedure room for the entire duration of each procedure . For each eligible procedure, the technician documented whether or not nbi was used . Procedures performed by the study author were not included; otherwise all faculty endoscopists were eligible for observation . The following endoscopic procedures were excluded from the analysis: egd or colonoscopy with therapeutic intent, specifically endoscopic dilation, endoluminal stent maneuvers, or delivery of endoscopic hemostatic therapy; egd for nasoenteral or percutaneous feeding tube placement; balloon- or spiral - assisted small - bowel enteroscopy; endoscopic retrograde cholangiopancreatography; egd with endoscopic ultrasound; ileoscopy and pouchoscopy . Following completion of the 2-week observational study period, operative reports including reports generated by olympus endoworks software and dictated operative notes were manually reviewed by the study author, who was not blinded to study design or intent . The following data were extracted: procedure type, procedure indication, identification of attending endoscopist, trainee involvement, patient type (inpatient versus outpatient), procedure start time (a.m. vs. p.m.), sedation - type (endoscopist - directed conscious or deep sedation vs. monitored anesthesia care with anesthesia staff support); performance of endoscopic polypectomy, either by snare or forceps biopsy; performance of endoscopic tissue biopsy for intent other than polypectomy . Extracted data were stored in a microsoft excel spreadsheet, and statistical analyses were performed using jmp 10.0.0 software (sas institute, cary, nc, usa). The chi - squared or fisher s exact test was used for comparison of categorical variables . Two - sided p values of <0.05 were considered statistically significant . During the two - week observational study period in july august 2013, data regarding nbi use were recorded for 318 elective endoscopic procedures, consisting of 106 egds and 212 colonoscopies . The most common indications for egd were evaluation of abdominal pain / dyspepsia (22%) and evaluation of gastroesophageal reflux disease (19%). Additional indications included evaluation of weight loss, anemia or suspected gastrointestinal bleeding, and diarrhea . The most common indication for colonoscopy was screening / surveillance for colorectal cancer (56%). Additional indications included evaluation of suspected or established inflammatory bowel disease, anemia or suspected gastrointestinal bleeding, and diarrhea . This included use of nbi in 4.7% (5/106) of egds and 7.5% (16/212) of colonoscopies (p = 0.47 for comparison). No difference in rate of nbi use was found when comparing egd with or without biopsy (5.5% [3/55] vs. 3.9% [2/51]; p = 1), or when comparing colonoscopy with or without biopsy (10.5% [8/76] vs. 5.9% [8/136]; p = 0.28). Nbi use was significantly higher in colonoscopy with polypectomy when compared with colonoscopy without polypectomy (13% [10/77] vs. 4.4% [6/135]; p = 0.03) (fig . 1). Rates of narrow band imaging (nbi) use for all study procedures, esophagoduodenoscopy (egd) with and without biopsy, colonoscopy with and without polypectomy ., there was no association between patient type (outpatient vs. inpatient), procedure start time, sedation type, or trainee involvement and use / non - use of nbi . For both egd and colonoscopy, there was no association between procedure indication and use / non - use of nbi . Nbi use was observed in zero of seven egds with a documented primary procedural indication of screening for or surveillance of barrett s esophagus . Nbi use was observed in 2 of 9 (22%) colonoscopies with a documented primary indication of surveillance in the setting of chronic ulcerative colitis . No use of an alternative imagine modality, such as methylene blue chromoendoscopy or high magnification endoscopy was described in any operative report . Observed endoscopic procedures were performed by 23 faculty endoscopists, with a procedure volume ranging from 1 to 58 per endoscopist during the 2-week study period . The rate of nbi use ranged from 0 to 100% of procedures per endoscopist . After excludsion of endoscopists who performed fewer than five endoscopies during the study period, the rate of nbi use for the remaining 15 endoscopists ranged from 0 to 23% . There was a significant difference in rate of nbi use (p <0.01 for overall comparison) amongst these 15 endoscopists . Nbi use among the 5 highest volume endoscopists ranged from 0 to 16% . Among cases with observed nbi use, photodocumentation of nbi use was present in 24% (5/21) of operative reports . This observational study detected use of nbi in 6.6% of elective endoscopic procedures . The highest rate of nbi use was observed in colonoscopies with polypectomy (13%), and this rate was significantly higher than that observed in colonoscopies without polypectomy . This study also detected a significant difference in the rate of nbi use in global comparison of individual endoscopists . Specific factors that influence the adoption of nbi use into routine practice by individual endoscopists were not examined in this study . Endoscopists were not asked to self - report nbi use and were not informed of the study . The study was designed in this fashion to avoid the potential of a hawthorne effect, wherein performance may be influenced in subjects who are aware that they are being observed . The endoscopists were blinded to the study, making the study design and findings unique . A survey of european university hospitals reported use of nbi or alternative commercial enhanced - imaging technology in 67% of institutions in the evaluation of barrett s neoplasia 9, but did not report a per - case use rate . In the current study, there was no a priori hypothesis regarding the rate of nbi use expected in this observational study, as there are limited standard recommendations or guidelines for routine nbi use in diagnostic endoscopy, and existing guidelines are open to flexible interpretation . For instance, the american gastroenterological association medical position statement on barrett s esophagus suggests that chromoendoscopy or electronic chromoendoscopy is not necessary in the routine endoscopic surveillance of barrett s esophagus, but may be helpful in guiding biopsies for patients with dysplasia or visible mucosal abnormalities 10 . The rate of nbi use in this study can therefore not be subjectively designated as high or low, but instead serves as a baseline metric in this study setting against which future nbi use can be measured . Adoption of nbi use in routine diagnostic endoscopy may have implications for application of future enhanced - imaging technologies . In the hands of the endoscopist no additional equipment is required other than an existing video monitor and nbi - equipped scope and processor . An endoscopist can toggle between nbi and standard white light literally in seconds, without use of additional endoscopic devices, accessories, or medications . And while there may be a learning curve for interpretation of nbi images 11 12, endoscopist interpretation of endoluminal nbi images would seem less a departure from white light endoluminal images than interpretation of images generated by other optical techniques, such as endomicroscopy, that focus on cellular structures . Based on these criteria, one would speculate that adoption and use of imaging technologies requiring additional equipment or capital investment, additional time with respect to procedure duration, and/or increasingly complex image analysis would be lower than that for nbi . Finally, it is worthwhile to note that documentation of nbi use was uncommon . Photodocumentation of nbi use was provided in 24% (5/21) of operative reports from cases in which nbi use was observed . Future consideration may be warranted as to whether documentation guidelines should exist for procedural use of nbi or other adjunct imaging modalities . An american society of gastrointestinal endoscopy preservation and incorporation of valuable endoscopic innovations (pivi) statement on real - time endoscopic assessment of histology of colon polyps suggests that lesion photocumentation is necessary if a resect - and - discard strategy is to be implemented 13 . While extending the study duration to increase sample size would increase statistical power and eliminate the possibility of type ii error in examining factors associated with nbi use, the study as completed is likely to have strong internal validity, in that the observed range of endoscopic procedures during the 2-week time period is likely to offer an accurate representation of the range of endoscopic practice in this setting . It may not be possible, however, to generalize the study findings to other institutions or endoscopy settings which may have differing practice patterns . Instances of nbi use may not have been documented if not observed or not recognized by the endoscopy technician . An alternative would have been to video record the entire procedure for subsequent review; however maintenance of adequate blinding with this approach would be challenging . Documented cases of nbi use cannot distinguish between intentional and unintentional nbi use for instance, if the endoscopist had inadvertently pressed the button on the scope handle for application of nbi when he / she had intended instead to press the button for image capture . In addition, there was limited heterogeneity in some of the procedural variables (e. g. trainee involvement) to adequately assess for potential association with nbi use / non - use . A post hoc survey of participating endoscopists might offer insight as to whether their opinions on the role of nbi match their actual practice, but has no bearing on the aim of this study, which was to objectively document rate of nbi use . In summary, additional large - scale prospective data are needed to assess the magnitude of impact of nbi on routine endoscopic practice.
|
Keratinocyte cancer (kc), including squamous cell carcinoma (scc) and basal cell carcinoma (bcc), is the most commonly diagnosed cancer in the united states . While ultraviolet radiation is an established risk factor for kc, growing evidence suggests infection with cutaneous human papillomavirus (hpv) may increase the risk of cutaneous scc [38]. We previously reported an increased risk of scc associated with the presence of four or more types of cutaneous hpv dna in eyebrow hairs . Serological responses to genus beta hpv types were found to be associated with increased risk of scc . Further, poor tanning ability was associated with 6.9 times increased risk of scc among those who were seropositive to beta hpv type . Collectively, these findings suggest that cutaneous hpv may play a role in the pathogenesis of scc . However, it should be noted that some previous case - control studies reporting an association between beta hpv and scc included only primary cases of scc [6, 9], while others [3, 4] did not differentiate between primary and subsequent sccs . Therefore, the role of cutaneous hpv infection in the development of subsequent scc is unknown . As compared to bccs, sccs are more likely to be clinically aggressive with a propensity to recur and metastasize [1, 10]. As reviewed previously, patients with metastatic scc have less than 20% survival rate over 10 years . Varying recurrence rates for scc have been reported based on the site of involvement, metastasis, and grade . In a retrospective study, 30% sccs involving temporal bone others have reported lower scc recurrence rates of 915% [12, 13]. As summarized by alam and ratner, risk factors for recurrence of sccs include tumor size, site, tumor depth, perineural invasion, history of treatment for scc, and tumor differentiation . While these factors may aid in the identification of scc cases at high risk of recurrence, they provide limited scope for intervention beyond treatment or close surveillance to prevent the recurrence of scc . Scc cases are also at a high risk of developing second primary sccs . In a large population based study of over 25,000 swedish scc cases, a significantly increased risk of second primary scc was observed (standardized incidence ratio = 15.6). As cautioned by marcil and stern, some of the previous studies examining the risk of a subsequent scc included index scc cases with a history of> 1 scc or did not provide such information . Thus, the index sccs may have comprised both first and recurrent sccs . The high morbidity associated with development of subsequent sccs warrants further research . Given the increased risk of scc observed in association with cutaneous hpv infection as described above, it is reasonable to hypothesize that patients with sccs associated with cutaneous hpv infection are more likely to develop subsequent sccs compared to patients with sccs that are not associated with hpv . Using a subset of scc cases (n = 150) from our previously conducted study [3, 4], we conducted a retrospective cohort study to examine the association between cutaneous hpv infection at the time of scc diagnosis in the parent study with the risk of subsequent scc . Infection with cutaneous hpv was assessed using three biomarkers: serum antibodies to hpv, presence of hpv dna in eyebrow hairs, and presence of hpv dna in scc tumors . Briefly, a clinic based case - control study was conducted at moffitt cancer center in tampa, florida, in 20072009 . Histologically confirmed cases of scc (n = 173) were identified through the university of south florida (usf) dermatology clinic . Both newly diagnosed primary sccs and cases with a prior history of scc were included in the case group . Controls included patients without history of any type of cancer and who were negative for skin cancer based on a full - body screening exam at the time of enrollment . Of the 173 scc cases enrolled in the parent case - control study, 150 scc cases were followed through 2014 . The remaining cases either did not return to the clinic or were only referred to usf dermatology clinic for moh's surgery . Cases without complete follow - up were similar in age and gender distribution to the cases with complete follow - up . The 150 index scc cases with complete follow - up through 2014 were included in the present analyses . Serology data on 33 cutaneous hpv types, including hpv types in the alpha, beta, and gamma genera (n = 150), as well as beta hpv dna (n = 25 beta hpv types) status in eyebrow hairs (n = 145) and scc tumor tissue (n = 131), at the time of enrollment of index scc, were available from the parent study [3, 4]. Self - reported data on demographics, smoking, alcohol consumption, and skin cancer risk factors, including history of blistering sunburns, sun exposure, and tanning ability were also available from the parent study . For the current retrospective cohort, subsequent scc was defined as the scc, including recurrent and second primary scc, detected after the index scc was diagnosed at the enrollment biopsy in the parent case - control study [3, 4]. Medical charts of index sccs were reviewed, and data on the date of past history of scc prior to enrollment of an index scc case in the parent case - control study, date of subsequent scc diagnosed after the index scc enrollment, site and tumor dimensions of subsequent scc, other incident keratinocyte cancers and date of last contact or death were abstracted . All participants provided written informed consent, and the study protocol was approved by the institutional review board at usf . Serum samples obtained from the index scc cases at the time of their enrollment in the parent study were examined for antibodies to major capsid protein l1 for 33 cutaneous hpv types including genera alpha (2, 3, 7, 10, 27, 57, and 77); beta [beta 1 (5, 8, 20, 24, 36), beta 2 (9, 15, 17, 23, 38, 107), beta 3 (49, 75, 76), beta 4 (92), and beta 5 (96)], gamma (4, 48, 50, 65, 88, 95, 101, 103), mu (1), and nu (41). As described previously, antibodies were detected using an enzyme linked immunosorbent assay [17, 18] and fluorescent bead - based multiplex serology . Measurement of hpv dna in eyebrow hairs and fresh - frozen scc tumors has been described in detail previously [3, 4]. Briefly, hpv dna was extracted from eyebrow hairs and scc tumor tissue with the qiagen ez1 dna tissue kit, and hpv genotyping was performed using a type specific multiplex assay detecting dna from 25 genus beta hpv types (5, 8, 9, 12, 14, 15, 17, 19, 20, 21, 22, 23, 24, 25, 36, 37, 38, 47, 49, 75, 76, 80, 92, 93, and 96) [20, 21]. Follow - up time was defined as the time interval between the date of index scc biopsy at enrollment in the parent study and date of diagnosis of subsequent scc or date of last contact . Five - year cumulative incidence of subsequent scc was estimated using person - years of follow - up . Demographic, lifestyle factors, and skin cancer risk factors were compared between those who developed a subsequent scc and those who did not, using chi square and fisher's exact tests, as appropriate . Cox proportional hazards ratios (hr) and corresponding 95% confidence intervals (cis) were estimated for associations of seropositivity to cutaneous hpv, overall and by genera, with the risk of subsequent scc, adjusting for age and gender . Seropositivity to any hpv was defined as proportions of scc cases that were positive for an antibody to at least one hpv type across all genera (overall cutaneous hpv seropositivity), within the specific genera (genus specific seropositivity) or within specific species (species - specific seropositivity). Seropositivity to multiple hpv infections was defined as the presence of antibodies corresponding to 2 beta hpv types . Any beta hpv infection in eyebrow hairs, overall and by species, was defined as the proportion of cases who had dna corresponding to at least one hpv type in genus beta or in a given species within genus beta, respectively . Multiple hpv infections were defined as the presence of hpv dna corresponding to 2 beta hpv types . Since scc tumors have lower viral dna load compared to eyebrow hairs, hpv dna status in tumors was categorized as cox proportional hazards ratios and corresponding 95% cis were estimated for associations of beta hpv dna positivity, overall and by species, with the risk of subsequent scc, adjusting for age and gender . Associations of both beta hpv seropositivity and beta hpv dna positivity in eyebrow hairs with the risk of subsequent scc were stratified by scc tumor beta hpv dna status . As seen in table 1, scc cases included in this study were all white, with an average age at index scc diagnosis of 64.5 years, with 92.8% cases reporting a prior history of scc . Of the 150 index scc cases, 105 (70%) were diagnosed with at least one kc during follow - up . Ninety - one out of the 150 scc cases were found to have at least one subsequent scc since their enrollment in the previous case - control study [3, 4]. Up to five scc tumors per case, the majority in the head and neck region, were detected at the time of diagnosis of subsequent scc . Subsequent sccs were detected within an average of 1 year from the date of scc biopsy at enrollment visit . Scc cases with a past history of scc or bcc or both were significantly more likely to have a subsequent scc (table 2). None of the other demographic or lifestyle characteristics were associated with subsequent scc (table 2). Seropositivity to cutaneous hpv infections, overall, by genera and beta hpv species, was not associated with the risk of subsequent scc (table 3). Presence of beta hpv dna in eyebrow hairs was not associated with the risk of subsequent scc, overall or by species (table 4). However, after stratification by tumor beta hpv dna, any beta hpv infection in eyebrow hairs was significantly associated with 70% reduced risk of subsequent scc among cases who were positive for any beta hpv dna in tumor tissue (table 5). Further, species - specific analyses showed that any beta-2 hpv infection in eyebrow hairs was associated with 68% significantly reduced risk of subsequent scc among tumor dna positive index scc cases (table 5). Beta hpv seropositivity was not associated with subsequent scc after stratification by tumor beta hpv dna status (table 5). Cutaneous sccs contribute substantial morbidity due their tendency to recur and associated high risk of development of second primary malignances of the skin and other organs . With the rising incidence of scc, the prevalence of recurrent and second primary sccs will also increase contributing substantially to public health burden . It is important to identify factors predisposing to recurrent and second primary sccs to guide development of better follow up protocols, characterize high risk sccs, and inform preventive strategies aimed at reducing the morbidity associated with subsequent sccs . In this retrospective cohort study, while no association was observed between cutaneous hpv seropositivity and the risk of subsequent scc, a significantly inverse association was observed between cutaneous beta hpv infection in eyebrow hairs detected at the time of index scc diagnosis and subsequent scc development, among scc cases with hpv dna positive index scc tumors . These findings are in contrast to the positive association reported between cutaneous hpv infection, measured by hpv serology and presence of hpv in eyebrow hairs, and scc [3, 4]. However, our findings are consistent with findings from previous studies on mucosal hpv infection associated cancers . Mucosal hpv infection has been previously associated with improved survival [2325] or reduced rate of recurrence in some cancers . For example, in a small study of 41 cases, recurrence rate of nasopharyngeal carcinoma was 75% in hpv tumor dna negative patients compared to 11% in tumor dna positive patients . Reported that hpv positive oropharyngeal cancers had 70% significantly improved survival compared to hpv negative cases, with significant survival benefits for men versus women . As discussed previously, increased sensitivity to radiation treatment and reduced occurrence of p53 mutations in hpv tumor positive cases have been suggested as possible mechanisms of improved prognosis in association with mucosal hpv infection . In the context of cutaneous scc, which is mainly treated by excision, it is not clear whether the underlying mechanisms of improved prognosis of hpv positive sccs are similar to those suggested for prognosis of mucosal hpv associated cancers . Cutaneous hpv infection is thought to be involved in the initiation, but not the maintenance of scc [27, 28]. One explanation of the observed inverse association between beta hpv infection and subsequent scc could be that beta hpv infection in index scc tumors may be immunogenic and could potentially stimulate host immune response that prevents the development of subsequent sccs . Our findings may suggest different mechanisms driving tumor progression in hpv dna positive versus hpv dna negative scc cases . Immunological and genetic factors that are associated with hpv dna negative tumors should be explored further . Previously, we showed that, among a subset of scc cases included in the present study, single nucleotide polymorphisms (snps) in epidermodysplasia verruciformis genes, regulating immune response against hpv, were associated with reduced risk of beta hpv dna positive scc tumors . The findings from our study should be interpreted with caution . A majority (92.8%) of index scc cases had a history of scc prior to their enrollment in the parent case - control study . Thus, external validity of our findings may be limited to those cases with a past history of scc . Therefore, association of change in hpv infection status over time with the risk of subsequent sccs could not be evaluated . Hpv dna status in subsequent scc tumors detected during follow - up was not measured . Due to limited sample size, robust statistical analyses for hpv type specific association with subsequent scc development could not be conducted . The subsequent sccs detected in this study could be recurrent sccs, presenting at the same anatomic site as primary scc, or second primary sccs and the analyses stratified by these two outcomes were not conducted due to small sample . Conversely, combining recurrent and second primary sccs as one outcome may have attenuated the true effect of hpv infection in index scc on the development of recurrent or second primary sccs . To our knowledge, this is the first prospective study reporting an association between cutaneous hpv infection in scc cases and subsequent sccs . Of the 173 scc cases enrolled in the parent case - control study, 86.7% cases were included in the present analyses highlighting complete follow - up on a large proportion of the cases . Since 92.8% scc cases reported a prior history of scc, the findings from our study may help further prognostic stratification of these sccs using a biomarker of infection . These cases may represent ideal candidates to direct infection related prevention measures due to the high morbidity associated with risk of developing subsequent sccs among sccs . Based on the observed inverse association between hpv seropositivity and risk of subsequent scc (table 3), although not significant, immune response against hpv may protect against the development of subsequent sccs . Thus, acquired immunity through vaccination against cutaneous hpv could potentially be explored among scc cases . Additional strengths of this study include, examination of biomarkers of both, present hpv infection (eyebrow hair dna and hpv serology) and past hpv infection (hpv serology) and evaluation of hpv infection as a prognostic marker by hpv genera and species . In conclusion, the results from our prospective cohort study suggest that cutaneous hpv infection in eyebrow hairs is inversely associated with the development of subsequent sccs in a subset of scc cases with hpv dna positive tumors . The observed association supports previous reports of lack of a role for cutaneous hpv infection in progression of sccs . While cutaneous hpv may not be directly involved in the prognosis of scc, this line of research may eventually lead to discovery of underlying immunological factors involved in scc development and progression . Cutaneous hpv infection status could potentially be used as a biomarker for prognostic stratification of sccs.
|
The us chinese anti - cancer association (uscaca,, http://www.uscaca.org/) is a non - profit professional organization founded in 2009 . With members from academia, industry and government, uscaca facilitates collaboration among cancer research and physicians in the united states and china . Our current focus is on expediting novel cancer drug development by fostering clinical trial networks, sharing best practices and knowledge of clinical trials, and providing education and training opportunities . Uscaca collaborates with chinese anti - cancer association (caca,), chinese society for clinical oncology (csco), and other pro - fessional associations . The uscaca - csco joint session organizing committee co - chairs: jian ding, helen chen, li yan uscaca: roger luo, pascal qian
|
Portal vein embolization (pve) has been widely accepted as an effective means to increase the future remnant liver volume (frlv) in patients requiring extensive liver resection . The safety and efficacy of pve have been confirmed by several studies and a recent meta - analysis.14 pve induces atrophy of the ipsilateral liver segments with concomitant compensatory hypertrophy of the future remnant liver (frl). Preoperative pve is recommended when the frlv is less than 3040% of the total liver volume (tlv) as determined by computed tomography (ct) volumetry, depending on the presence of underlying liver disease (e.g., steatosis, cholestasis).5,6 liver regeneration is generally assessed by ct volumetry . Liver volume, however, does not necessarily represent liver function during liver regeneration.7,8 liver function can accurately be assessed by technetium-99 m mebrofenin hepatobiliary scintigraphy (tc - mebrofenin hbs).7,9 the underlying mechanism of liver regeneration after partial liver resection or pve is not fully understood . One suggested trigger for regeneration of the nonembolized liver lobes after pve or resection is the instant increase in portal blood flow to the frl.1012 when right pve is performed, the portal blood flow is preoperatively diverted to the left liver lobes . As a consequence, minimal changes in portal blood flow are induced at the time of partial liver resection and therefore, this trigger for posthepatectomy liver regeneration is lacking . The aim of this study was to evaluate the effect of preoperative pve on postoperative liver volume and function 3 months after major liver resection . Eighteen patients underwent pve of the right portal system prior to (extended) right hemihepatectomy at our institution between january 2005 and november 2007 . Only those patients in whom a complete set of ct scans was obtained were included in the study, i.e., a four - phase ct scan prior to pve, 34 weeks after pve (before liver resection), and 3 months after liver resection (n = 10). In all the patients, hbs was performed before pve and in nine patients 3 months after liver resection . Patients who had undergone (extended) right hemihepatectomy without prior pve in the same period and of whom a ct scan had been obtained prior to and 3 months after liver resection were included in the control group (n = 13). Twelve of the 13 patients underwent hbs prior to pve, which was repeated 3 months after liver resection in 11 patients . Patient characteristics, including gender, age, and number of patients with a compromised liver were compared for both groups . Indications for surgery in the control group were colorectal metastasis (n = 5), hilar cholangiocarcinoma (n = 4), hepatocellular carcinoma (n = 1), and other metastases (n = 3). In the pve group, the indications were colorectal metastasis (n = 5), hilar cholangiocarcinoma (n = 1), hepatocellular carcinoma (n = 3), and neuroendocrine tumor (n = 1). Iv, v) according to the revised 2004 clavien classification.13 liver volumes were measured using ct . The total liver, the frl, and tumor mass were manually delineated on each 5-mm slide of the portal phase images . The tlv, tumor volume (tv), and frlv were calculated using dedicated software (mx - view 3.52, philips medical systems, the netherlands; fig . 1). The percentage frlv before pve was calculated by:14\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{frlv}}{}_{{{\text{pre - pve}}}} = {\left ({\frac{{{\text{frlv}}_{{{\text{pre - pve}}}}}} {{{\left ({{\text{tlv - tv}}} \right)}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document}figure 1ct cross section of the liver showing total liver (yellow delineation) and the future remnant liver (red delineation). Ct volumetry showed that the future remnant liver was markedly increased 3 weeks after portal vein embolization (pre - op, 507 ml) compared to before portal vein embolization (pre - pve, 392 ml). Three months after partial liver resection, the remnant liver volume almost reached its original total liver volume . For interpretation of the references to color in this figure legend, the reader is referred to the online version of this article . Ct cross section of the liver showing total liver (yellow delineation) and the future remnant liver (red delineation). Ct volumetry showed that the future remnant liver was markedly increased 3 weeks after portal vein embolization (pre - op, 507 ml) compared to before portal vein embolization (pre - pve, 392 ml). Three months after partial liver resection, the remnant liver volume almost reached its original total liver volume . For interpretation of the references to color in this figure legend, the reader is referred to the online version of this article . To obtain the percentage, frlv after pve was computed by: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{frlv}}_{{{\text{pre - op}}}} = {\left ({\frac{{{\text{frlv}}_{{{\text{pre - op}}}}}} {{{\left ({{\text{tlv - tv}}} \right)}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document} the remnant liver volume (rlv) 3 months after liver resection was calculated as a percentage of the initial total functional liver volume (tlv - tv): \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{rlv}}_{{3\;{\text{months}}}} = {\left ({\frac{{{\text{rlv}}}}{{{\text{(tlv - tv)}}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document} hbs was performed using tc - mebrofenin as previously described.7 briefly, after injection of 85 mbq of tc - mebrofenin (bridatec; ge - amersham health), dynamic images were acquired with a -camera (diacam, siemens, milwaukee, wi, usa) for 60 min . During the first 10 min, 60 frames of 10 s were acquired (liver uptake phase) followed by 50 frames of 1 min (liver excretion phase). Total hepatic tc - mebrofenin uptake rate was calculated as described by ekman et al.15 on preoperative scan, regions of interest (rois) were drawn around the total liver, the heart (serving as blood pool), and the total field of view . From these rois, three time the total hepatic tc - mebrofenin uptake rate, representing total liver function (tlf), was calculated as percent per minute (of the injected dose) based on these three parameters . Calculations of the hepatic tc - mebrofenin uptake rate were performed using measured values obtained between 150 and 350 s postinjection to ensure that hepatic uptake calculations were performed during a phase of homogenous distribution of the agent in the blood pool, before occurrence of the rapid phase of hepatic excretion . To compensate for differences in individual metabolic requirements, the tlf was divided by the body surface area and expressed as percent per minute per square meter . Pve was performed in patients in whom the estimated frlv, based on ct volumetry, was <30% in case of normal liver parenchyma and <40% in patients with compromised liver parenchyma due to steatosis, cholestasis, or fibrosis . After retrograde catheterization via a peripheral portal branch (segment 6 or 7), the right portal trunk and intrahepatic tributaries were occluded using a combination of polyvinyl alcohol particles (300500 m, cook, bloomington, in, usa) and platinum coils of various sizes (tornado embolization microcoil, cook). Statistical analysis was performed using statistical package for social sciences (spss, chicago, il, usa). An independent sample t test was performed to assess the difference in future remnant liver volume and function between the two groups prior to surgery . A mixed analysis of variance was conducted to assess whether there were pve and time differences in ct volumetry and hbs outcomes between the two groups after liver surgery . The correlation between variables was tested using the pearson correlation coefficient r. all tests were two - tailed and differences were evaluated at the 5% level of significance . Eighteen patients underwent pve of the right portal system prior to (extended) right hemihepatectomy at our institution between january 2005 and november 2007 . Only those patients in whom a complete set of ct scans was obtained were included in the study, i.e., a four - phase ct scan prior to pve, 34 weeks after pve (before liver resection), and 3 months after liver resection (n = 10). In all the patients, hbs was performed before pve and in nine patients 3 months after liver resection . Patients who had undergone (extended) right hemihepatectomy without prior pve in the same period and of whom a ct scan had been obtained prior to and 3 months after liver resection were included in the control group (n = 13). Twelve of the 13 patients underwent hbs prior to pve, which was repeated 3 months after liver resection in 11 patients . Patient characteristics, including gender, age, and number of patients with a compromised liver were compared for both groups . Indications for surgery in the control group were colorectal metastasis (n = 5), hilar cholangiocarcinoma (n = 4), hepatocellular carcinoma (n = 1), and other metastases (n = 3). In the pve group, the indications were colorectal metastasis (n = 5), hilar cholangiocarcinoma (n = 1), hepatocellular carcinoma (n = 3), and neuroendocrine tumor (n = 1). Liver volumes were measured using ct . The total liver, the frl, and tumor mass were manually delineated on each 5-mm slide of the portal phase images . The tlv, tumor volume (tv), and frlv were calculated using dedicated software (mx - view 3.52, philips medical systems, the netherlands; fig . 1). The percentage frlv before pve was calculated by:14\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{frlv}}{}_{{{\text{pre - pve}}}} = {\left ({\frac{{{\text{frlv}}_{{{\text{pre - pve}}}}}} {{{\left ({{\text{tlv - tv}}} \right)}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document}figure 1ct cross section of the liver showing total liver (yellow delineation) and the future remnant liver (red delineation). Ct volumetry showed that the future remnant liver was markedly increased 3 weeks after portal vein embolization (pre - op, 507 ml) compared to before portal vein embolization (pre - pve, 392 ml). Three months after partial liver resection, the remnant liver volume almost reached its original total liver volume . For interpretation of the references to color in this figure legend, the reader is referred to the online version of this article . Ct cross section of the liver showing total liver (yellow delineation) and the future remnant liver (red delineation). Ct volumetry showed that the future remnant liver was markedly increased 3 weeks after portal vein embolization (pre - op, 507 ml) compared to before portal vein embolization (pre - pve, 392 ml). Three months after partial liver resection, the remnant liver volume almost reached its original total liver volume . For interpretation of the references to color in this figure legend, the reader is referred to the online version of this article . To obtain the percentage, frlv after pve was computed by: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{frlv}}_{{{\text{pre - op}}}} = {\left ({\frac{{{\text{frlv}}_{{{\text{pre - op}}}}}} {{{\left ({{\text{tlv - tv}}} \right)}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document} the remnant liver volume (rlv) 3 months after liver resection was calculated as a percentage of the initial total functional liver volume (tlv - tv): \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\% {\text{rlv}}_{{3\;{\text{months}}}} = {\left ({\frac{{{\text{rlv}}}}{{{\text{(tlv - tv)}}_{{{\text{pre - pve}}}}}}} \right)}\; \times \;100\% .$$\end{document} hbs was performed using tc - mebrofenin as previously described.7 briefly, after injection of 85 mbq of tc - mebrofenin (bridatec; ge - amersham health), dynamic images were acquired with a -camera (diacam, siemens, milwaukee, wi, usa) for 60 min . During the first 10 min, 60 frames of 10 s were acquired (liver uptake phase) followed by 50 frames of 1 min (liver excretion phase). Total hepatic tc - mebrofenin uptake rate was calculated as described by ekman et al.15 on preoperative scan, regions of interest (rois) were drawn around the total liver, the heart (serving as blood pool), and the total field of view . From these rois, three time the total hepatic tc - mebrofenin uptake rate, representing total liver function (tlf), was calculated as percent per minute (of the injected dose) based on these three parameters . Calculations of the hepatic tc - mebrofenin uptake rate were performed using measured values obtained between 150 and 350 s postinjection to ensure that hepatic uptake calculations were performed during a phase of homogenous distribution of the agent in the blood pool, before occurrence of the rapid phase of hepatic excretion . To compensate for differences in individual metabolic requirements, the tlf was divided by the body surface area and expressed as percent per minute per square meter . Pve was performed in patients in whom the estimated frlv, based on ct volumetry, was <30% in case of normal liver parenchyma and <40% in patients with compromised liver parenchyma due to steatosis, cholestasis, or fibrosis . Pve was performed using the ipsilateral percutaneous transhepatic approach . After retrograde catheterization via a peripheral portal branch (segment 6 or 7), the right portal trunk and intrahepatic tributaries were occluded using a combination of polyvinyl alcohol particles (300500 m, cook, bloomington, in, usa) and platinum coils of various sizes (tornado embolization microcoil, cook). Statistical analysis was performed using statistical package for social sciences (spss, chicago, il, usa). An independent sample t test was performed to assess the difference in future remnant liver volume and function between the two groups prior to surgery . A mixed analysis of variance was conducted to assess whether there were pve and time differences in ct volumetry and hbs outcomes between the two groups after liver surgery . The correlation between variables was tested using the pearson correlation coefficient r. all tests were two - tailed and differences were evaluated at the 5% level of significance . There were no significant differences between the two groups with respect to gender, age, and number of patients with a compromised liver . Table 1patient characteristics of patients undergoing liver resection with (pve group) or without (control group) prior portal vein embolization pve group (n = 10)control group (n = 13)p valuefemale / male6/48/5n.s.mean age in years (range)56.1 (4974)55 (3971)n.s.compromised / noncompromised6/47/6n.s.standard / extended hemihepatectomy5/510/3n.s.postoperative complications (minor / major)5 (3/2)7 (4/3)n.s.mean sd% frl volume before pve33.0 8.045.6 9.1<0.01mean sd% frl volume preoperative41.7 9.545.6 9.1n.s.mean sd% frl 3 months after liver resection81.9 8.979.4 11.0n.s.mean sd frl function before pve7.1 1.67.9 1.5n.s.mean sd frl function 3 months after liver resection6.2 1.86.5 2.1n.s.both groups were comparable for gender, age, number of patients with a compromised liver, postoperative complications, and preoperative future remnant liver volume . Future remnant liver volume before pve was significantly smaller in the pve group than in the control group, which was equalized 34 weeks after pve . Three months after major liver resection, the remnant liver gained up to 80% of its initial total functional liver volume in both groupsaccording to the revised 2004 clavien classification (7): minor = grades i and ii; major = grades iii and abovepearson s chi - square testindependent sample t - test patient characteristics of patients undergoing liver resection with (pve group) or without (control group) prior portal vein embolization both groups were comparable for gender, age, number of patients with a compromised liver, postoperative complications, and preoperative future remnant liver volume . Future remnant liver volume before pve was significantly smaller in the pve group than in the control group, which was equalized 34 weeks after pve . Three months after major liver resection, the remnant liver gained up to 80% of its initial total functional liver volume in both groups according to the revised 2004 clavien classification (7): minor = grades i and ii; major = grades iii and above pearson s chi - square test independent sample t - test the frlv was based on the actual removed part of the liver . Prior to resection, the% frlv was calculated taking into account the maximum volume of liver that would need to be resected to achieve complete removal of all lesions . In some patients, the extent of the resection was less than expected based on intraoperative findings, resulting in a higher% frlvpre - pve . The% frlvpre - pve was 33.0 8.0% in the pve group compared to a% frlvpre - op 45.6 9.1% in the control group (p = 0.002). Three to 4 weeks (mean 23 days) after pve, the% frlvpre - op increased to 41.6 9.5%, resulting in no significant difference between the two groups prior to liver resection (p = 0.33). Liver scintigraphy showed a mean tc - mebrofenin uptake rate in the total liver of 7.90 1.5%/min / m in the control group and 7.11 1.6%/min / m in the pve group before any intervention (p = 0.24). The increase in percentage remnant liver volume from preoperatively to 3 months after major liver surgery was not different between the two groups (p = 0.81). Three months after surgery, the mean rlv in the pve group was 81.9 8.9% of the initial total liver volume compared to 79.4 11.0% in the control group (p = 0.57; table 1; fig . 2). In addition, the postoperative increase in liver function did not differ between both groups (p = 0.471). Three months postoperatively, the rlf regained 88.1 17.4% of the original total liver function in the pve group compared to 83.3 14% in the control group (p = 0.50; fig . 3). No correlation was found between liver volume and function (r = 0.13, p = 0.59). Mean percentage of (future) remnant liver volume (frlv) in relation with initial total functional liver volume . Prior to pve (pre - pve), this percentage was significantly lower in the group requiring pve (* * p <0.01). Three to 4 weeks after pve (pre - op), the frlv increased with 8.7% in the pve group, leading to comparable values in the two groups . Three months after partial liver resection (3 m post - op), remnant liver volumes reached approximately 80% of initial total functional liver volume in both groups.figure 3uptake of tc - mebrofenin by the total liver prior to any intervention and 3 months after partial liver resection . There were no significant differences in uptake between the pve and the control groups at both time points . The remnant liver function reached 88.1% and 83,3%, respectively, of the original total liver function in both groups (p = 0.50). Mean percentage of (future) remnant liver volume (frlv) in relation with initial total functional liver volume . Prior to pve (pre - pve), this percentage was significantly lower in the group requiring pve (* * p <0.01). Three to 4 weeks after pve (pre - op), the frlv increased with 8.7% in the pve group, leading to comparable values in the two groups . Three months after partial liver resection (3 m post - op), remnant liver volumes reached approximately 80% of initial total functional liver volume in both groups . Uptake of tc - mebrofenin by the total liver prior to any intervention and 3 months after partial liver resection . There were no significant differences in uptake between the pve and the control groups at both time points . The remnant liver function reached 88.1% and 83,3%, respectively, of the original total liver function in both groups (p = 0.50). The main goal of this study was to evaluate the influence of pve on volumetric and functional liver regeneration after major liver resection . The increase of the% frlv after pve (% frlvpre - op pre - pve) was 8.7% in 23 days . In a recent meta - analysis, a mean increase of 11.9% was reported 29 days after pve.16 however, results between the various studies are difficult to compare due to substantial differences in the time interval between pve and subsequent ct volumetry and the different techniques of embolization . For example, farges et al . Observed an increase in frl of 16% 48 weeks after pve17 whereas elias et al . Reported an increase of 13% 1 month after pve.18 ribero et al.19 and madoff et al.20 showed an increase of 8.8% and 7.7%, 28 and 24 weeks after pve, respectively, using a calculation based on body surface area . Three months after partial liver resection, the remnant liver volume regenerated to approximately 80% of its original total volume in both groups . Liver function increased to 83% in the control group and to 88% in the pve group . There was no correlation between volumetric and functional recovery, confirming the postulation that liver volume does not necessarily reflect liver function during liver regeneration.7 to our knowledge, there are no studies that compared postoperative liver volume increase and functional increase after partial liver resection in patients with and without prior pve . Although there could have been a difference in initial regenerative response following liver resection, our results show comparable restoration rates of liver volume 3 months after (extended) hemihepatectomy in both groups . Most data on the process of hepatocyte regeneration have been obtained from animal or in vitro studies . The time course of liver regeneration after pve and after partial liver resection appears to be similar as has been shown in a rat model.21 although various mediators and pathways involved in liver regeneration have been described, the initial trigger of the entire process remains elusive.2225 the instant change in portal blood flow after partial liver resection is believed to be a trigger for liver regeneration . Experimental studies have shown decreased posthepatectomy liver regeneration in rats receiving a portacaval shunt.26,27 when performing pve prior to surgery, the change in portal blood flow is negligible in case of a standard right hemihepatectomy and less profound in case of an extended right hemihepatectomy because the portal blood had already been diverted to the left portal vein at the time of pve . Our study shows that the liver regenerates up to 80% of its original total liver volume 3 months after major liver resection, in spite of prior pve . One might speculate that instead of the change in portal blood flow, the change in arterial blood flow after hepatic resection induces liver regeneration . A study in rats showed that ligation of the hepatic artery alone did not affect liver regeneration.28 however, it is questionable whether the rat model is an appropriate surrogate model for studying the effects of altered hepatic arterial blood flow on liver regeneration or function . It is possible that the hypertrophy response of the remnant liver is slower after prior pve in the first weeks after liver resection, but this ultimately did not result in dissimilar liver volumes after 3 months . The remnant liver regenerates up to approximately 80% of its initial total liver volume and over 83% of its original total liver function 3 months after major liver resection with or without prior pve.
|
Nevertheless, many people do not have adequate physical activity and sedentary lifestyle has become an important public health issue in all age groups, including adolescents . Because of increasing consumption of high - calorie food, use of digital technologies, and adopting a sedentary lifestyle in older age, physical activity promotion has become more important in adolescents . Nowadays, about 80% of adolescents have neither severe nor mild physical activity more than 60 min per day . Many studies show that self - efficacy (se) is one of the major determinants of physical activity . This construct plays an important role as the predictor of exercise, and people who have more confidence about their ability show greater participation in physical activity . Likewise, those who engage more in exercise programs also achieve a higher level of general se . According to bandura, se expresses one's beliefs in his or her ability to successfully carry out a course of action . He posits that cognitive constructs such as se have a great impact on physiologically and/or psychologically demanding behaviors like physical activities . The role of se is strongest during the early stages of participation in physical activities and when this behavior is difficult to do because of some barriers such as fatigue and time constraints . Se has indirect effects on behavior too, exerting its influence through goals, ideas, outcome expectations, intentions, and perceived barriers and opportunities . Physical activity is a multiple behavior and its performance needs the involvement of a range of motor skills . Therefore, se about physical activity reflects a range of capabilities required to achieve a final consequence . Some aspects of se that play a role in initiation of physical activity may differ from other aspects of se that relate to maintenance of physical activity . According to bandura, beliefs of se on special behavior include multiple detention set of management of intellectual, emotional, motivational, and functional processes . Because attention to these dimensions can be helpful in the achievement of better understanding of the relationship between se and physical activities, it is necessary to identify the relationship between different aspects of se and physical activity . Mcauley and mihalko explained task se and regulatory se as the two main types of se . Task se is defined as beliefs on ability to perform constituent components of a behavior or a skill . When we consider the type, intensity, duration, and frequency of physical activity, task se should be studied . Barrier se is one of the most common and known aspects of regulatory se that is applied in explanation, prediction, and modification of physical activity . Other aspects of regulatory se like goal setting efficacy, scheduling efficacy, relapse prevention efficacy, asking efficacy, and environmental change efficacy have already been studied . It seems that different aspects of regulatory se have more importance in promoting participation in physical activity in public health issues . Se reflects confidence of a person to management and coordination between a set of abilities and skills, not only in countering the barrier but also in commonplace condition . This shows the importance of se in design and execution of program, besides its ability to overcome the barriers . For this reason, some researchers believe that adoption and maintenance of physical activities require the se beliefs in goal setting, designing, and implementing . Maddux found that the effect of se on setting and performing a program is more fundamental than task efficacy . Nevertheless, few researchers have considered barrier se and se in designing and implementation of physical activities, simultaneously . Nowadays, most studies are performed by considering in addition, researchers who intend to perform cross - sectional or interventional studies on physical activities in iranian population have attempted to design, translate, or re - translate se measurement tools . However, there is no evidence of a specially designed questionnaire for measuring barrier se, program designing se, and program execution se among iranian male adolescents . Because the lack of attention to different aspects of se can lead to bias in the results of studies and interventions that deal with the relationship between se and physical activities, this study aims at introducing and evaluating the psychometric properties of the se questionnaire of leisure time physical activity among iranian male adolescents, emphasizing the barrier se, program designing se, and program execution se . This study was cross - sectional in design and was conducted in isfahan in the central region of iran in 2013 . Recommended sample size for confirmatory factor analysis (cfa) is at least 5 to 20 cases per parameter . Comrey and lee recommended the sample sizes of 200 as fair, 300 as good, and 500 as very good for exploratory factor analysis (efa). Because cfa and efa were used to evaluate the psychometric properties of the questionnaire, the main sample was divided into two separate samples for each analysis . Overall, 750 adolescents aged 1519 years were recruited, of whom 16 participants were excluded while completing the questionnaire . Thus, 734 male adolescents aged 1519 who fulfilled the inclusion criteria remained and were randomly divided into sample 1 and 2 . While entering the data, it was found that the 62 questionnaires had to be excluded due to incomplete filling (ntotal = 672). The data of sample 1 (n1 = 325) were used for item analysis and efa and those of sample 2 (n2 = 347) for cfa . In order to increase generalizability, isfahan was divided into three regions with low, intermediate, and high socioeconomic levels, based on previous studies and expert opinions . Then five high schools were selected randomly in each region, as clusters of sampling (totally 15 high schools). After calculating the study sample size (750), the allocated sample size to each high school inclusion criteria were parental consent and student assent, lack of health problem that prevented them from performing physical activities, and not being a member of a professional sport teams . Data were gathered via a self - administrated questionnaire that consisted of three main parts: some of main characteristics of participants, such as age and familial income (demographic characteristics)physical activity was measured using the long - version of international physical activity questionnaire (ipaq). This questionnaire was designed in 1998 by a group of italian researchers and suggested as the international measurement of physical activity for the age range of 1569 by the world health organization (who) and the centers for disease control and prevention (cdc). Ipaq is used to evaluate a subject's estimated metabolic equivalent (met) on five domains of physical activity consisting of occupational, home and domestic, transportation, and leisure time physical activity (ltpa). Ipaq divides individuals into three groups of total pa: low activity (less than 600 met - min / week), moderate activity (between 600 and 3000 met - min / week), and severe activity (more than 3000 met - min / week). The amount of ltpa is divided into three levels based on the leisure time that a person spends per week for pa: less than 60 min, 60180 min, and over 180 min assumed as low, medium, and high ltpa, respectively . Reliability and validity of persian version of ipaq were verifiedthe questionnaire offered for se consisted of 13 items . Content of the items and the process of selection and generation are described in the following sections . These items measured the degree of confidence of participants in their ability in overcoming barriers, goal setting, and implementation of programs about physical activity using a 5-point likert scale (1 = absolutely correct, 5 = absolutely incorrect). Some of main characteristics of participants, such as age and familial income (demographic characteristics) physical activity was measured using the long - version of international physical activity questionnaire (ipaq). This questionnaire was designed in 1998 by a group of italian researchers and suggested as the international measurement of physical activity for the age range of 1569 by the world health organization (who) and the centers for disease control and prevention (cdc). Ipaq is used to evaluate a subject's estimated metabolic equivalent (met) on five domains of physical activity consisting of occupational, home and domestic, transportation, and leisure time physical activity (ltpa). Ipaq divides individuals into three groups of total pa: low activity (less than 600 met - min / week), moderate activity (between 600 and 3000 met - min / week), and severe activity (more than 3000 met - min / week). The amount of ltpa is divided into three levels based on the leisure time that a person spends per week for pa: less than 60 min, 60180 min, and over 180 min assumed as low, medium, and high ltpa, respectively . Reliability and validity of persian version of ipaq were verified the questionnaire offered for se consisted of 13 items . Content of the items and the process of selection and generation are described in the following sections . These items measured the degree of confidence of participants in their ability in overcoming barriers, goal setting, and implementation of programs about physical activity using a 5-point likert scale (1 = absolutely correct, 5 = absolutely incorrect). Generation of the items and evaluation of psychometric properties of the questionnaire were done in a current and logical direction that included the following stages: creating the initial draft of the instrument and selection or generation of items, establishing a jury of experts for completing the qualitative review, and completing the quantitative review based on lawshe, venezizno, and hooper method . In this method, content validity ratio (cva) and content validity index (cvi) were estimated and then, reliability of the questionnaire was evaluated by efa and cfa . From the very moment of designing and/or item selection, the validity of the questionnaire was tried to be achieved . So, after review of the literature and some current questionnaires, the main aspects of se were extracted according to the characteristics of the target group . Then 30 items for the evaluation of se were designed in persian on the three following domains: overcoming barriers, program adjustment, and implementation of programs . So, the process of translation and backward translation of these items from english into persian was performed by two independent health professionals who were fluent in both languages . To evaluate the we requested five independent health professionals to give their opinions about the face validity and cultural adaptation of the initial questionnaire . Thirty items were evaluated based on criteria such as simplicity, intelligibility, relevance, and appropriateness to the target group and also absence of ambiguity . At this stage, content validity was primarily evaluated by an expert panel that consisted of 10 health educators . They were asked about some of the qualitative characteristics of items, such as compliance to principles of grammar, wording, item allocation, and scaling . According to lawshe's method, the minimum acceptable cut - off for cvr was 0.62 . Based on related equation, in addition to quantitative evaluation of cvr, propositions for reform were requested from experts for each item that was selected as an unnecessary item . Cultural and linguistic characteristics of iranian population are the main criteria for item evaluation . According to lynn's method, simplicity, clarity, and specificity were considered to calculate cvi . Since 0.79 was selected as the criterion for acceptable cvi, all the 13 items had the efficient criterion for remaining in the questionnaire . Prior to the pilot study, comprehensibility of the questionnaire was evaluated through the opinions of 35 adolescent boys, none of whom was a member of either sample 1 or sample 2 . They stated their opinions about each item via a likert scale that consisted of the options, quite understandable, the number of selected options of quite understandable and understandable was divided by 35 and comprehensibility coefficient of each item was calculated . Acceptable criterion for comprehensibility of each item was equal to or greater than 0.79 and all items met this criterion . Finally, for estimation of reliability of the questionnaire, internal consistency and test retest methods were used . In a pilot study, the questionnaires were given to 73 members of the target group who were not from the study population . They completed the questionnaire 2 weeks prior to the study, and then cronbach's alpha coefficient of the first survey and pearson correlation coefficient between both surveys were calculated . We considered cronbach's alpha coefficient and correlation coefficient equal to or greater than 0.70 as satisfactory . A total of 62 students participated in the second survey and pearson correlation coefficient between test and retest showed a strong correlation between se score in the first and second steps (r = 0.73, n = 62, p <0.005). Item analysis was performed for the evaluation of reliability of the questionnaire and its items on sample 1 (n1 = 325). So, inter - item correlation, item total correlation, variance, squared multiple correlation, and cronbach's alpha if item deleted were evaluated for each item . If the mean score of an item greatly diverged from the total mean score of the questionnaire or its variance was near to zero, that item was deleted . In addition, we used efa to evaluate the construct validity of the questionnaire on sample 1 . Since the suggested questionnaire consisted of three types of se, extraction step was performed by pre - assumption of principle component analysis . We also chose direct oblimin rotation because of the possibility of correlation between components . Based on pre - assumption of statistical software, the amount of eigenvalue (variance of the factor) was determined to be equal to 1 and the number of items of rotation to establish an appropriate rotational factor was determined to be equal to 25 . Recent procedure is suitable for the evaluation of some characteristics such as unidimensionality of items . So, cfa was performed on sample 2 (n2 = 347), for determination of construct validity, performed to test the fit of data to the model that was suggested by efa . In this stage, several alternative models were tested . We used amosgraphic version 20 software (amos graphic) with maximum likelihood estimation procedure assumption and evaluated absolute, comparative, and parsimonious fit indices . The model was considered acceptable if cmin / df was between 1 and 5, cfi was greater than 0.8, parsimonious comparative fit index (pcfi) was less than 0.6, root mean squared error of approximation (rmsea) was less than 0.8, and pclose was greater than 0.005 . Fitness of model was confirmed if p value of cmin was greater than 0.05, cmin / df was between 2 and 3, cfi was greater than 0.9, and pcfi was less than 0.5 . The study was started after it was approved by isfahan university of medical sciences and isfahan education organization . Ethical approval was granted by the deputy of research and technology of isfahan university of medical sciences (i d: 39147, date: december 30, 2012). The purpose and procedures of the study were explained to the participants, and researcher emphasized on the confidentiality of the data and voluntary nature of participation . This study was cross - sectional in design and was conducted in isfahan in the central region of iran in 2013 . Recommended sample size for confirmatory factor analysis (cfa) is at least 5 to 20 cases per parameter . Comrey and lee recommended the sample sizes of 200 as fair, 300 as good, and 500 as very good for exploratory factor analysis (efa). Because cfa and efa were used to evaluate the psychometric properties of the questionnaire, the main sample was divided into two separate samples for each analysis . Overall, 750 adolescents aged 1519 years were recruited, of whom 16 participants were excluded while completing the questionnaire . Thus, 734 male adolescents aged 1519 who fulfilled the inclusion criteria remained and were randomly divided into sample 1 and 2 . While entering the data, it was found that the 62 questionnaires had to be excluded due to incomplete filling (ntotal = 672). The data of sample 1 (n1 = 325) were used for item analysis and efa and those of sample 2 (n2 = 347) for cfa . In order to increase generalizability, isfahan was divided into three regions with low, intermediate, and high socioeconomic levels, based on previous studies and expert opinions . Then five high schools were selected randomly in each region, as clusters of sampling (totally 15 high schools). After calculating the study sample size (750), the allocated sample size to each high school inclusion criteria were parental consent and student assent, lack of health problem that prevented them from performing physical activities, and not being a member of a professional sport teams . Data were gathered via a self - administrated questionnaire that consisted of three main parts: some of main characteristics of participants, such as age and familial income (demographic characteristics)physical activity was measured using the long - version of international physical activity questionnaire (ipaq). This questionnaire was designed in 1998 by a group of italian researchers and suggested as the international measurement of physical activity for the age range of 1569 by the world health organization (who) and the centers for disease control and prevention (cdc). Ipaq is used to evaluate a subject's estimated metabolic equivalent (met) on five domains of physical activity consisting of occupational, home and domestic, transportation, and leisure time physical activity (ltpa). Ipaq divides individuals into three groups of total pa: low activity (less than 600 met - min / week), moderate activity (between 600 and 3000 met - min / week), and severe activity (more than 3000 met - min / week). The amount of ltpa is divided into three levels based on the leisure time that a person spends per week for pa: less than 60 min, 60180 min, and over 180 min assumed as low, medium, and high ltpa, respectively . Reliability and validity of persian version of ipaq were verifiedthe questionnaire offered for se consisted of 13 items . Content of the items and the process of selection and generation are described in the following sections . These items measured the degree of confidence of participants in their ability in overcoming barriers, goal setting, and implementation of programs about physical activity using a 5-point likert scale (1 = absolutely correct, 5 = absolutely incorrect). Some of main characteristics of participants, such as age and familial income (demographic characteristics) physical activity was measured using the long - version of international physical activity questionnaire (ipaq). This questionnaire was designed in 1998 by a group of italian researchers and suggested as the international measurement of physical activity for the age range of 1569 by the world health organization (who) and the centers for disease control and prevention (cdc). Ipaq is used to evaluate a subject's estimated metabolic equivalent (met) on five domains of physical activity consisting of occupational, home and domestic, transportation, and leisure time physical activity (ltpa). Ipaq divides individuals into three groups of total pa: low activity (less than 600 met - min / week), moderate activity (between 600 and 3000 met - min / week), and severe activity (more than 3000 met - min / week). The amount of ltpa is divided into three levels based on the leisure time that a person spends per week for pa: less than 60 min, 60180 min, and over 180 min assumed as low, medium, and high ltpa, respectively . Reliability and validity of persian version of ipaq were verified the questionnaire offered for se consisted of 13 items . Content of the items and the process of selection and generation are described in the following sections . These items measured the degree of confidence of participants in their ability in overcoming barriers, goal setting, and implementation of programs about physical activity using a 5-point likert scale (1 = absolutely correct, 5 = absolutely incorrect). Generation of the items and evaluation of psychometric properties of the questionnaire were done in a current and logical direction that included the following stages: creating the initial draft of the instrument and selection or generation of items, establishing a jury of experts for completing the qualitative review, and completing the quantitative review based on lawshe, venezizno, and hooper method . In this method, content validity ratio (cva) and content validity index (cvi) were estimated and then, reliability of the questionnaire was evaluated by efa and cfa . From the very moment of designing and/or item selection, so, after review of the literature and some current questionnaires, the main aspects of se were extracted according to the characteristics of the target group . Then 30 items for the evaluation of se were designed in persian on the three following domains: overcoming barriers, some of these items also had already and similarly been used in previous studies . So, the process of translation and backward translation of these items from english into persian was performed by two independent health professionals who were fluent in both languages . To evaluate the we requested five independent health professionals to give their opinions about the face validity and cultural adaptation of the initial questionnaire . Thirty items were evaluated based on criteria such as simplicity, intelligibility, relevance, and appropriateness to the target group and also absence of ambiguity . At this stage, eight items were revised and changed in wordage and 10 items were deleted . Content validity was primarily evaluated by an expert panel that consisted of 10 health educators . They were asked about some of the qualitative characteristics of items, such as compliance to principles of grammar, wording, item allocation, and scaling . According to lawshe's method, the minimum acceptable cut - off for cvr was 0.62 . Based on related equation, in addition to quantitative evaluation of cvr, propositions for reform were requested from experts for each item that was selected as an unnecessary item . Cultural and linguistic characteristics of iranian population are the main criteria for item evaluation . According to lynn's method, simplicity, clarity, and specificity were considered to calculate cvi . Since 0.79 was selected as the criterion for acceptable cvi, all the 13 items had the efficient criterion for remaining in the questionnaire . Prior to the pilot study, comprehensibility of the questionnaire was evaluated through the opinions of 35 adolescent boys, none of whom was a member of either sample 1 or sample 2 . They stated their opinions about each item via a likert scale that consisted of the options, quite understandable, the number of selected options of quite understandable and understandable was divided by 35 and comprehensibility coefficient of each item was calculated . Acceptable criterion for comprehensibility of each item was equal to or greater than 0.79 and all items met this criterion . Finally, for estimation of reliability of the questionnaire, internal consistency and test retest methods were used . In a pilot study, the questionnaires were given to 73 members of the target group who were not from the study population . They completed the questionnaire 2 weeks prior to the study, and then cronbach's alpha coefficient of the first survey and pearson correlation coefficient between both surveys were calculated . We considered cronbach's alpha coefficient and correlation coefficient equal to or greater than 0.70 as satisfactory . A total of 62 students participated in the second survey and pearson correlation coefficient between test and retest showed a strong correlation between se score in the first and second steps (r = 0.73, n = 62, p <0.005). Item analysis was performed for the evaluation of reliability of the questionnaire and its items on sample 1 (n1 = 325). So, inter - item correlation, item total correlation, variance, squared multiple correlation, and cronbach's alpha if item deleted were evaluated for each item . If the mean score of an item greatly diverged from the total mean score of the questionnaire or its variance was near to zero, that item was deleted . In addition, we used efa to evaluate the construct validity of the questionnaire on sample 1 . Since the suggested questionnaire consisted of three types of se, extraction step was performed by pre - assumption of principle component analysis . We also chose direct oblimin rotation because of the possibility of correlation between components . Based on pre - assumption of statistical software, the amount of eigenvalue (variance of the factor) was determined to be equal to 1 and the number of items of rotation to establish an appropriate rotational factor was determined to be equal to 25 . All these statistical tests were performed using spss version 20 software . Today, use of cfa is common for semantic matching of questions with factors . Recent procedure is suitable for the evaluation of some characteristics such as unidimensionality of items . So, cfa was performed on sample 2 (n2 = 347), for determination of construct validity, performed to test the fit of data to the model that was suggested by efa . In this stage, several alternative models were tested . We used amosgraphic version 20 software (amos graphic) with maximum likelihood estimation procedure assumption and evaluated absolute, comparative, and parsimonious fit indices . The model was considered acceptable if cmin / df was between 1 and 5, cfi was greater than 0.8, parsimonious comparative fit index (pcfi) was less than 0.6, root mean squared error of approximation (rmsea) was less than 0.8, and pclose was greater than 0.005 . Fitness of model was confirmed if p value of cmin was greater than 0.05, cmin / df was between 2 and 3, cfi was greater than 0.9, and pcfi was less than 0.5 . The study was started after it was approved by isfahan university of medical sciences and isfahan education organization . Ethical approval was granted by the deputy of research and technology of isfahan university of medical sciences (i d: 39147, date: december 30, 2012). The purpose and procedures of the study were explained to the participants, and researcher emphasized on the confidentiality of the data and voluntary nature of participation . Main characteristics of the participants including samples 1 and 2 are shown in table 1 . Characteristics of male adolescents who participated in study after deletion of outliers and missing data, the average of physical activity and ltpa, based on met - min / week, was equal to 2421 (sd = 1543) and 902 (sd = 938), respectively . Based on the correlation matrix of sample 1, each of the suggested items had a correlation coefficient higher than 0.4 at least with one of the other items (p 0.005). According to the results shown in table 2, all items were suitable and there was no need to remove any item . Statistics of self - efficacy questionnaire abut leisure time physical activity in iranian male adolescents the data of sample 1 were analyzed so as to extract the principal components with direct oblimin rotation . Olkin (kmo) index was equal to 0.89 and the results of bartlett's test of sphericity were significant at the confidence interval of 95% (= 1544, df = 78, p 0.00). According to the adequacy of sample volume and proportion of correlation matrix with factor analysis, the data were entered into the efa process . Regarding the theoretical framework of the study and as the questionnaire consisted of three aspects of se however, principle component analysis showed two components with eigenvalue up to 1 . Observing a point of failure after three components convinced us to examine other probable solutions . In addition, results of parallel analysis that were analyzed by monte carlo physical activity software also supported the two - component solution . Based on these results performed with 13 variables, 325 participants, and 100 repeats and match assumption, only two components had eigenvalue higher than the criterion values that were appropriate with randomized data . These two components explain 51.6% of variance of se and the results of rotated pattern matrix are shown in table 3 . Rotated component and pattern matrix with pca and direct oblimin rotation for items of self - efficacy questionnaire related to leisure time physical activity in iranian male adolescents in order to verify the construct validity of the questionnaire, fitness of several models, including 13 items, was specified and evaluated with the sample 2 using cfa . The second - order model demonstrated more acceptable indices compared to first - order model . However, only some fit indices supported the acceptable fitness of second - order model with data of sample 2, so the model needed to be modified (cmin = 212.50, cmin / df = 3.32, cfi = 0.92, pcfi = 0.76, rmsea = 0.082, pclose = 0.000). Since all unstandardized estimated parameters were significantly different from zero at the 0.001 level (two - tailed), no items were removable . It was found that addition of two parameters between error variables of items 2 and 4 and items 6 and 12 led to a decrease in chi - square . Moreover, theoretical framework of the study supported the correlation between error variables of these items . So, corrected model was designed via two rating reduction of degree of freedom . Fitness indices approved the appropriateness of the corrected model totally (cmin = 165.53, cmin / df = 2.67, cfi = 0.95, pcfi = 0.75, rmsea = 0.069, pclose = 0.007). Results of descriptive and bivariate correlation test such as main score of se and its subconstructs are shown in table 4 . The mean, standard deviation, and reciprocal correlation between different aspects of self - efficacy and leisure time physical activity in adolescent boys based on the correlation matrix of sample 1, each of the suggested items had a correlation coefficient higher than 0.4 at least with one of the other items (p 0.005). According to the results shown in table 2, all items were suitable and there was no need to remove any item . The data of sample 1 were analyzed so as to extract the principal components with direct oblimin rotation . Olkin (kmo) index was equal to 0.89 and the results of bartlett's test of sphericity were significant at the confidence interval of 95% (= 1544, df = 78, p 0.00). According to the adequacy of sample volume and proportion of correlation matrix with factor analysis, the data were entered into the efa process . Regarding the theoretical framework of the study and as the questionnaire consisted of three aspects of se however, principle component analysis showed two components with eigenvalue up to 1 . Observing a point of failure after three components convinced us to examine other probable solutions . In addition, results of parallel analysis that were analyzed by monte carlo physical activity software also supported the two - component solution . Based on these results performed with 13 variables, 325 participants, and 100 repeats and match assumption, only two components had eigenvalue higher than the criterion values that were appropriate with randomized data . These two components explain 51.6% of variance of se and the results of rotated pattern matrix are shown in table 3 . Rotated component and pattern matrix with pca and direct oblimin rotation for items of self - efficacy questionnaire related to leisure time physical activity in iranian male adolescents in order to verify the construct validity of the questionnaire, fitness of several models, including 13 items, was specified and evaluated with the sample 2 using cfa . The second - order model demonstrated more acceptable indices compared to first - order model . However, only some fit indices supported the acceptable fitness of second - order model with data of sample 2, so the model needed to be modified (cmin = 212.50, cmin / df = 3.32, cfi = 0.92, pcfi = 0.76, rmsea = 0.082, pclose = 0.000). Since all unstandardized estimated parameters were significantly different from zero at the 0.001 level (two - tailed), no items were removable . It was found that addition of two parameters between error variables of items 2 and 4 and items 6 and 12 led to a decrease in chi - square . Adding these covariance parameters had methodological acceptance . Moreover, theoretical framework of the study supported the correlation between error variables of these items . So, corrected model was designed via two rating reduction of degree of freedom . Fitness indices approved the appropriateness of the corrected model totally (cmin = 165.53, cmin / df = 2.67, cfi = 0.95, pcfi = 0.75, rmsea = 0.069, pclose = 0.007). Results of descriptive and bivariate correlation test such as main score of se and its subconstructs are shown in table 4 . The mean, standard deviation, and reciprocal correlation between different aspects of self - efficacy and leisure time physical activity in adolescent boys this article reports the development process and evaluation of psychometric properties of a questionnaire for the determination of se about leisure time physical activity (selpa). Selpa was developed to evaluate the main aspects of se among iranian male adolescents via 13 items . After item generation or translation (first stage), comprehensibility of the items was evaluated (second stage). The psychometric properties of selpa were evaluated in a current and logical direction, including face validity (third stage), content validity (fourth stage), item analysis (fifth stage), and construct validity by efa (sixth stage) and cfa (seventh stage). Brons and gorow believe that review of literature, obtaining comments from experts, and targeted population are the most important steps to achieve content validity of the measurement tools . In the current study, after the literature review, recommendation of 10 health experts from the research group helped us to achieve content validity . Cultural and linguistic characteristics of the target group were considered in modifying the remaining items in different aspects of se related to ltpa in all stages . In addition to expert panel, during the primary study, the members of the target group represented their recommendation about comprehensibility of the questionnaire . Reliability was evaluated in three steps by internal consistency and test retest method . In each stage, the results supported the reliability of the questionnaire . One of the main strengths of this study is that two different populations were employed for the evaluation and confirmation of construct validity of the questionnaire by efa and cfa . Efa showed that two factors with eigenvalues greater than 1.00 loaded on all 13 items significantly and explained 51.6% of the variance of se . The first factor loaded on items 6, 7, 8, 9, 10, 11, 12, and 13, as we expected . These items addressed the current impediments and challenges of ltpa in iranian male adolescents that were derived from literature review and expert panel . This factor is called barrier se and its related items consist of obstacles such as fatigue, lack of money, lack of support, time conflict, bad weather, lack of facilities, and present other competitor entertainment . The highest correlation was related to item 12 (0.86). This item was considered the participant's ability in continuing physical activity even in the compacted curriculum . The lowest correlation rate was allocated to item number 11 (0.52) that is associated with lack of suitable place for physical activity . Results of this study about the beliefs of adolescents about overcoming barriers may be different from those of other investigations . Reported that the strongest and weakest factor loading belonged to feeling depressed and feeling physical discomfort after exercise, respectively . That investigation was conducted on iranian diabetic women and the difference in characteristics of the target groups justifies such results . The second factor loaded on items 1, 2, 3, 4, and 5 . This can be attributed to the confidence of a person to his or her ability to design a program for physical activity . All the items on which factor 2 loaded were related to scheduling se . Compared to other questionnaires that commonly focus on barrier se, selpa considers an important aspect of regulatory se, named scheduling se about physical activity in leisure time . Rodgers et al . Noted that considering scheduling se is essential for improving the effectiveness of interventions in physical activity . Since using cfa is recommended to confirm the fitness of conceptual model suggested by efa, the research group operated this statistical analysis on a separate population . Correction of the model was conducted based on modification indices by adding two covariance to the model, all fit indices shift into good fitness as noroozi's study . Results of descriptive and bivariate correlation test, such as main score of se and its subconstructs, can be considered as the evidence that target group members also perceive moderate confidence to overcome the barriers and design or operate program for physical activity [table 4]. Robbins et al . Showed a similar result in american adolescents in 2004 and reported the perceived se score of adolescents as 34.262.5 . This result is consistent with previous researches, especially those that have posited the importance of social cognitive constructs on physical activity . For example, sriramatr et al . Explained a moderate correlation between coping (barrier) (r = 0.33) and scheduling se (r = 0.35) with energy consumption via physical activity in 364 young students in thailand . Kim et al . Showed a moderate correlation between se and exercise in adolescents too (r = 0.45). Taymoori et al . Have reported the highest correlation coefficient (r = 0.62) between barrier se and physical activity in iranian female adolescents . This difference can be justified by population characteristics, idiographic nature of barriers, or instruments specifications . Finally, the correlation pattern supports the importance of barrier compared with scheduling se, similar to other investigations . Since the availability of a specific questionnaire based on specific characteristics of the target groups is important and as all important subconstructs of se should be taken into consideration, selpa was developed for the assessment of important aspects of self - regulatory efficacy, such as barrier and schedule se, in iranian male adolescents . Findings support that barrier and scheduling se about physical activity can be conceptually and statistically distinguished from each other . This study supported the comprehensibility, face validity, content and construct validity, reliability, and internal consistency of selpa . However, further investigations are necessary to evaluate the reliability, concurrent validity, comprehensibility, and applicability of the questionnaire through supplementary descriptive and interventional studies . Also, regression analysis is recommended to explore the predictive power of this questionnaire on physical activity . We thank those who helped us in conducting this investigation, including all involved students, teachers, and school managers . In addition, the expert panel is appreciated for revising and estimating the questionnaire's validity and the research and technology deputy of isfahan university of medical sciences for funding this research.
|
In 2008, the greater london authority and the london health consortium, with funding provided by the big lottery, instigated a series of health interventions entitled well london. These activities were set up in 20 of london's most disadvantaged neighbourhoods, in an effort to promote healthier life - styles as a way of combating chronic disease (wall et al . An evaluation of the project was undertaken in which a series of in - depth interviews were conducted with 60 residents across three of the well london areas; a key component of the interview was to enquire about the environment and residents perceptions of their neighbourhood . A frequent and vociferous complaint that arose unprompted concerned the prevalence of dog excrement, or to use local terminology: dog poo. Not only was the frequency of the complaint remarkable, but also its specificity and distinctive nature, making further detailed investigation necessary . Apart from an element of antipathy, there was also considerable anger expressed in relation to: who was responsible; the lack of care demonstrated by its ongoing presence; and fear over its risk to human health . Dog - poo was not the only form of pollution complained about in the three areas, but it was the most frequently cited . In terms of risk to human health, for example, since 2000 between one and eight laboratory confirmed reports of toxocarosis have been received annually by the health protection agency (hpa 2011). In addition, a keep britain tidy report into litter cites a 40% drop in the incidence of dog faeces in the uk over recent years (2007). Despite this lack of evidence concerning risk or prevalence, canine faeces continues to be a significant cause for complaint, requiring further explication in order to understand its relevance for public health . In a study of urban environmental factors that impact on health, kennedy (2000) cites residents complaints of dog faeces as a blight that affected their sense of wellbeing . Similarly, two separate studies by jones (1996) and cresswell (1992) report residents complaints of dog faeces in urban areas of the uk affected by poverty and environmental neglect . Therefore, the presence of dog faeces has associations and implications that can be linked with more subjective responses . One key facet of the complaints raised by residents in the well london study was a sense of disgust evoked by therefore, the challenge was to explore not the grievance itself (whether dog poo existed or its potential as a disease carrying agent) but rather the symbolic this article critically engages with residents explicitly focused disgust with canine faecal matter and generates understanding of its symbolic value that helps clarify what has to date, been a poorly resolved public health issue . Sixty qualitative interviews were conducted in total: 20 individuals in each of the three well london areas, which were located in the north, east and south of the city . All three areas were characterised by high levels of unemployment, poor health, environmental neglect and a mixed indigenous and global migrant population . Quality assurance procedures were undertaken whereby three randomly selected interviews were recoded, blind to the initial coding, by two independent researchers . The three versions of each interview were then compared to identify new codes and establish the degree of consensus in applying a particular code to similar text . A major part of the interview focused on what residents thought about the area where they lived . Recurrent and spontaneous reference was made to the prevalence of dog faeces in the area and, more subjectively, the feelings that were evoked by its presence . Dog poo (most frequently cited among all its synonyms), over all other complaints . Extended coding of the interviews revealed the contextual significance of these complaints . Incivility emerged as a recurrent theme: a lack of respect for the neighbourhood environment by residents and negligence by local authorities whether the police or local council . This meant carrying out repairs, cleaning and ensuring personal safety, especially in relation to the presence of gangs, local drug dealers and other types of criminality . Further, measurement of actual incidence of dog foul across london was undertaken: 40 areas were examined and divided into 211 were found to contain no dog faeces; 72 had a small amount and eight had a moderate amount . However, 117 coded references pertaining to dog poo (and its synonyms: dog shit / muck / litter / mess / fouling) were found in all 60 interviews . The disparity between high numbers of complaints and the limited presence of actual faecal matter required an alternative mode of analysis that would help locate, more specifically, residents concerns . Interpreting how meaning is expressed through cultural symbols in this instance analysing the symbolic content and context in which the complaints occurred, highlighted compelling evidence of its link to social neglect, including criminality, dirt and the absence of cohesive community relations . The work of social anthropologist douglas (1966) is seminal in the symbolic interpretation of matters pertaining to pollution . Also, studies by van der geest (1998, 2007, 2008), stallybrass and white (1986), laporte (2000), enzensberger (1972) and miller (1997) offer useful theoretical perspectives on dirt and disgust; especially regarding bodily substances that transgress boundaries in relation to social morality, inequality and taboo . The inherent value of examining cultural symbols shows how in this instance, they express not only fears of the transgression of boundaries, but also how dog poo is constructed as a metonym for the disgust felt by residents about their experience of incivility . This includes neglect of the environment, and a lack of respect by local authorities and fellow neighbours alike, as one resident implied: and the worst thing is they just, they poo everywhere in the buildings a month back there was dog poo in our own building . I don't know whose poo it is whether it's human or dog poo, but i seen it. Another described a similar sense of repulsion: the outside spaces, there's dog foul . I mean wherever you put your feet and it's unsafe because the poo of the dog and you put your foot oh no! The focus on canine excrement did not exclude other complaints: of drugs, gangs, noisy neighbours and the lack of intervention by either police or local authorities . However, complaining about dog poo conveyed a powerful message about these neighbourhoods blighted by multiple problems, and often by unknown perpetrators: like this drug dealing problem going on, on my doorstep . You don't know who's done it, or why they done it, or where did they come from . And they're smoking, they've got needles there on the stairs, they wee do on the stairs, everything we can't say nothing . And my lift is still broken . (sita) the notion of incivility evoked through residents descriptions of their environment determined the appropriateness of symbolically linking complaints of dog poo, with the experiences of social neglect . As requests to improve living conditions and expressed worries about safety and cleanliness were ignored, a pervasive sense of hopelessness took over . Right, the area is dangerous, dirty, very, very unkempt and has been basically forgotten by the powers that be for the past, i'd say, 15 years . In as much as one person who i spoke to at the local housing office who was at the time in charge of major works, didn't even know where i was living . Didn't know where it was, so that's the it's just been a forgotten little area and it's been left to rot and decay . (robert) for stallybrass and white: what is socially peripheral, is so frequently symbolically central (1986: 5, authors italics). This resonates with the well london residents sense of social marginalisation that was marked by the absence of effective management of the neighbourhood, as explicitly articulated above . But, when these explicit complaints were neither heard nor acted upon, they became symbolically represented by excreta, which defined their experience of marginality . The path as you go up there, there's always glass up there or dogs poo, always there's dogs poo along there and it's, well, it's just disgusting. Van der geest (1998, 2007, 2008) has written extensively on attitudes towards defecation, including an historical examination of the origins of our revulsion towards bodily functions and their management. He suggests that without the containment of bodily matter, there is nothing to prevent chaos and disorder (2007). Therefore, if faeces, animal or human, is taken as an effective metonym that represents disorder, it follows that managing dirt has as its main function the restoration of order primarily, social order as part of a civilising process . Dirt in its rightful place ordered and bounded within a set of social rules of behaviour . Douglas' (1966) work on symbolism and in particular matter out of place, states that dirt is defined by its place or context; in other words, where it is found and who is responsible for it . For example, faecal matter inside the body is less problematic than when it becomes external to it, where it is an object of revulsion . The attitude and management of excrement, both human and animal, is linked with the state as it intervenes in the management and consequent attitudes towards dirt; segregation of public and private means that all faecal matter is consigned to private rather than public space (enzensberger 1972, laporte 2000). Faeces, now considered taboo in the public domain, contrasts with the pre - victorian era when horse manure covered the streets of london and running sewers were open to public senses (pike 2005). This segregation of public and private in relation to cleanliness was also acknowledged among residents: when we moved to this area, we saw dog poo now it's a little bit clean, my area is, because it's a private area. Another spoke of her annoyance at her neighbour who pushed rubbish over to her side of the passageway, invading her private space and breaking boundaries . But, complaints also illustrated a more extreme form: the permeability of private space that could be infiltrated by bad smells and noise: yeah, the noise . My downstairs neighbours, they're singing like five o'clock in the morning and it wakes you up and you just can't do anything . And then they smoke marijuana and you know this is a converted building? So there's lots of holes in the you see those things? Yeah, every time they smoke, every time they drink if they're vomiting in their toilet, it all comes up (here). Dog poo has salience within their particular social and cultural milieu of urbanised, inner city london where neighbourhoods are unsafe, environmentally polluted and often without social cohesion . Anger and blame is placed on those who seem to ignore the boundaries i.e dog owners, dirty neighbours, the police, or the local authorities responsible for the management of the neighbourhood . Dog poo is therefore a transgression of not only spatial boundaries, but also social norms of what is considered civil behaviour; especially when focused on personal responsibility: and that's one thing as well, the dog fouling, they don't pick up . They don't pick up their dog fouling, do you know what i mean? And i'll tell you what, it would be a big sense of achievement if they actually put cameras in every direction to catch these people out, because it's terrible . You've got kids playing around and every time they're playing football, they stop in dog foul . As campkin and cox (2007) suggest theorising about dirt is constitutive of space and social relations. Here, vociferous complaints of canine faeces in the absence of actual evidence of high incidence indicated a more hidden form of distress or grievance that was better understood by examining its symbolic content, as well as its context . By taking dog poo as a metonym for the disgust with which residents experienced their neighbourhoods, the authorities and each other it was possible to gain deeper insight into the problem . Acknowledgement of this has implications for intractable public health problems, where not only the contextualisation of complaints is important, but also analysis of their deeper symbolic components; especially in the face of frequent, inexplicable complaints . Conducting such an analysis uncovered the distress of residents living in some of london's more deprived neighbourhoods where grievances were frequently ignored, leading to frustration and anger . Had the issue of dog faeces clean up operation alone, this would never have uncovered the scale of the problem or the depth of feeling in relation to the issues, which can be defined as poor social relations and inadequate or ineffective communication with local authorities . Investigations and analyses of this kind lend themselves to the development of constructive, inclusive public health policies that can improve the wellbeing of marginalised populations by understanding how people articulate their concerns . The approach used here is effective in this, because it can: generate new insights into intractable public health problems; offer alternative and useful methods to understand and communicate complex social issues in relation to public health; advance theoretical knowledge; and broaden the scope of analytic tools with which to understand well - being and society.
|
The enclosure of eukaryotic genomes within the nuclear envelope evolutionarily generated the necessity to transport macromolecules selectively between nucleus and cytoplasm . Following their synthesis in cytoplasm, histones and nucleic acid polymerases have to reach the nucleus, while specifically cytoplasmic proteins have to be kept out . Mature mrna, trna and rrna molecules and their associated proteins have to follow the opposite route, while their immature precursors have to be kept in 1 ., 2 ., 3 ., 4 ., 5 .. eukaryotic mrna is enzymatically metabolized and compacted with proteins within nuclei to generate functional messenger ribonucleoprotein (mrnp) particles 6 ., 7 .. the control of protein biosynthesis involves regulation of intranuclear functions with participation of specific proteins, many of which seem to enter from the cytoplasm as a time - specific event 3 ., 4 ., 5 ., 7 .. the heterogeneous nuclear ribonucleoproteins (hnrnps) comprise a group of important regulators engaged in these cellular processes 8 ., 9 ., 10 .. extensive research efforts have been devoted to the cloning and molecular characterization of numerous ribonucleoproteins (rnps) in the context of their active role in mrna biogenesis and metabolism 1 ., 2 ., 9 ., 10 ., 11 ., as well as in terms of their involvement as autoantigens in human diseases (11). Hence, emphasis is put on the roles of various rna - binding motifs and their subsequent roles in governing cellular activities, both in health and pathology (9). Recently, there has been considerable interest in the participation of these rna - binding particles in triggering the immune response in human autoimmune disorders (11). Substantial research both at cdna and protein level have been performed on immunochemical features of human autoantigens (http://www.zoo.uni-heidelberg.de/mol_evol/mb/ana_base.html). Of particular interest is the group of mammalian hnrnps, which constitutes a part of spliceosome, which itself is an autoimmune target (12). Novel nucleotide sequences are continuously reported, which afterwards are used to delineate homology among various members based on previously determined nucleotides and protein sequences . The mechanism of contribution of numerous hnrnps with a similar structural rnp motif (13) to the induction of different immune reactions is sequence - specific (14). Phylogenetic approach is essential to find functionally important genomic sequences based on detection of their high degree of conservation across different species . Such approach shows the level of improvement of the prediction of gene - regulatory elements in the human genome . This necessitates the study of the degree of homology of rna recognition motifs (rrm) among these proteins, requiring an evolutionary computation . Having considered the importance of submitting new sequences for further functional characterization, the newly cloned and expressed cdna of previously unknown member of the hnrnp a / b family of proteins (figure 1) is presented here . Its rna - binding properties and tissue - specific gene expression profiles were recently determined (15). Based on the concept of correlation between sequences and rna - binding modes, a systemic search was performed for nucleic acid association by evaluating sequence conservation using multiple sequence alignments search tools . The aim of the presented work herein was to isolate novel cdna sequences with important functional implications in human pathology . Our efforts have been devoted to the cloning and subsequent tissue - specific gene expressions of numerous human rnps from the hnrnp a / b family of proteins (figure 1; ref . The objective was to search for molecular basis of autoimmunity by applying comparative analysis of the sequences of diverse autoantigens . In this context, evolutionary computation approach could give us major clues on how evolutionarily conserved mrna transport machinery fails are linked to development of human autoimmune disorders . We were mainly interested in cdnas, which might encode the yet undescribed hnrnp b2 . The need for this was based on two observations . On the one hand, autoantibodies directed against hnrnp a2 crossreact with hnrnp b1 and hnrnp b2 . Since hnrnp b1 is an alternatively spliced variant of hnrnp a2, this suggests that hnrnp b2 might be an alternatively spliced form of hnrnp a2/b1 . However, no attempts to clone a cdna encoding hnrnp b2 were successful so far . On the other hand, cdnas closely related to hnrnp a1 and hnrnp a2 have been previously isolated from a human fetal brain library and from a xenopus laevis library, respectively . Their close relationships with hnrnp a2 suggested that one of these cdnas might actually encode hnrnp b2 (15). To isolate the searched cdna, human liver and brain cdna expression libraries were screened by pcr using primers complementary to 5- and 3-untranslated regions of the fbrnp cdna . Since the obtained new sequence shared close identity to the xenopus laevis hnrnp a3 cdna sequence (entrez; accession number l02956), the protein was termed human hnrnp a3 . Nucleotide sequence comparisons between fbrnp, xenopus laevis hnrnp a3 and our newly determined human hnrnp a3 proteins revealed that extensive sequence conservation exist in rna - binding regions . The majority of sequence variations were seen at the gly - rich domain, composed of amino acids at positions 211 - 373 . These sequences were observed more at nucleotide level, as expected, compared to the translated protein sequences (figure 2). Only protein sequences are shown for brevity . Identification of various nucleic acid - binding domains of diverse hnrnps was achieved by cloning and sequencing of cdnas encoding these motifs . In general, all known human hnrnp proteins contain at least one rna - binding module and one another auxiliary domain fragment . The rna - binding motifs contain the rnp consensus sequences (cs - rbd), the rna recognition motif (rrm; ref ., 13 ., 17 . ), the rnp-80 motif, the rgg box (18), and the kh domain (19). This domain is found in hnrnps in various amounts, ranging from 1 (in hnrnp c) to 4 (e. g. in poly a - binding protein; ref . Figure 1 shows the general modular structure of hnrnp a / b type of rnp particles . Their general structure is composed of two domains: the first 195 residues comprise the so - called up1 domain, containing two canonical rna - recognition motifs (rrm 1 and rrm 2), each of which is comprised from the conserved rnp-2 and rnp-1 submotifs . The gly - rich c - terminal domain comprises an rgg box and a nuclear localization motif . This motif contributes to protein - protein interaction patterns, as well as to subcellular localization (18). Two conserved solvents exposed phe residues at the centre of the -sheet in each rrm - contacted rna . The least conserved 3 loop in u1a is engaged in extensive rna interactions, whose conformation changes upon rna binding 17 ., 20 .. the rnp domain interacts with a flexible single - strand rna and the -sheet provides a large surface for extensive interaction with nucleotides . Regions outside of the rrm may also play important roles in rna binding (10). Identification of these motifs as rna - binding domains has been used for prediction of this activity in various proteins of yet undescribed function possessing these domains . As seen in figure 2, the newly isolated human hnrnp a3 cdna encodes a protein of 296 amino acids (a.a . ). Amino acids numbered 198 comprise rbd1, 112209 comprise rbd2, 209296 comprise the gly - rich domain, while 99111 contain inter - rrm linker (irl) segments . To our surprise, comparison with the previously reported fbrnp cdna sequence, encoding a 269 a.a . Therefore, it was assumed that the currently presented cdna encodes a novel and yet undescribed protein . Despite the close homologies among the rna - binding regions (95%), remarkable differences can be seen in the c - terminal domain (figure 2), where deletions and insertions are apparent . Shorter and there are fewer conserved residues in the c - terminal part . Both cdnas also show high homologies to the cdna encoding hnrnp a3 from xenopus laevis except for a stretch of 14 a.a . At the rbd1 n - terminal part . The rna - binding regions of the three proteins are almost identical, while the auxiliary domains are less conserved . The xenopus laevis protein shows 75% homology with fbrnp and 83% with the newly cloned human hnrnp a3 protein, respectively (figure 2). The reduced length of the human hnrnp a3, as compared to the xenopus laevis homologue (296 vs. 373 a.a . ), is compatible with differences observed between xenopus laevis and rat hnrnp a1, which are composed of 365 and 320 residues, respectively (15). The assumption that the presented clone encodes the human counterpart of frog hnrnp a3 is further reinforced, when conserved residues in the auxiliary domains of the a / b polypeptides are considered . Thus, a stricking homology is apparent at the c - terminus, which is well conserved between frog and human hnrnp a3 with 15 of the last 18 a.a . Both proteins end with a triplet rrf, which is also present in hnrnp a1, but neither in fbrnp nor in hnrnp a2/b1 . Moreover, a glutamic acid located at the boundary of rbd2 and the auxiliary domains of xenopus laevis and human hnrnp a3 (a.a . Position 207) is substituted by valine in fbrnp, a further indication that the novel protein is indeed the human counterpart of xenopus laevis hnrnp a3 . Interestingly, this result is reported also for the murine hnrnp mbx protein, which is highly homologous to both human fbrnp and xenopus laevis hnrnp a3 (21). Most of the conformational differences between the two rrms occur either at the c - terminal end of the b helices, or at the tip of loop 3, which is tilted and twisted in rrm1, as opposed to rrm2 (figure 3). The rnp domain interacts with a flexible single - strand rna and the -sheet provides a large surface for extensive interaction with nucleic acids . The two aromatic side chains of rnp1 and one aromatic side chain of rnp2 provide a convenient template for base stacking of the rna with neighbouring protein side chains, forming hydrogen bonds with the stacked bases . Although the major groove of the a - type rna helix is too narrow and deep to provide a site for sequence - specific association, an rna loop with exposed nucleotides provides a large surface for protein binding . However, the rna - binding is not a unique feature of the -sheets . Despite the evolutionary conservation of the rrms, which are necessary for both general and sequence - specific nucleic acid binding, regions outside of the rrms may also play important roles in rna binding (10). For instance, the flexibility of the linker sequence connecting both rrms, resulting from two pairs of arg and asp involved in irl salt bridges and the ordered residues, creates a position which is highly probable for this sequence to be involved in direct rna binding . Figure 3 shows the rrm sequences of 12 hnrnp a / b type of proteins, extending the previous data set of mayeda et al . There is extensive sequence homology between these various proteins, which are conserved throughout evolution from insects to man . Each of the rrms forms an ungapped alignment with both rrms of hnrnp a1 . In all of the shown proteins, the evolutionary links between the rrms of human hnrnp a3 and other hnrnp a / b proteins are depicted in a phylogenetic tree (figure 4). The sequences of rrm1 and rrm2 cluster in two separate groupings, representing insect and vertebrate proteins . The patterns of branching for rrm1 and rrm2 sequences are nearly identical, except for the placement of the branch representing the minor human variant hnrnp a0 . The almost identical pattern of branching for both rrms suggests that these fragments have evolved in parallel . Obviously, each of the insect and vertebrate proteins is equally distant from each other . Apparently, this fact indicates independent gene duplications of ancestral hnrnp a / b - like protein, in agreement with mayeda et al . The independent evolution of individual tandemly repeated protein domains and their functional relevance has always being an intriguing issue . The rnp domain is commonly encountered scaffold among the nearly 350 different folds, that is, the favourable secondary arrangements of around 10,000 protein structures covered by the currently used databases 22 ., 23 ., 24 ., 25 .. comparisons of various protein structures, in combination with their nucleotide analyses serve as a clue for their evolution . The debate is whether these structures have evolved for achievement of specific functions or for thermodynamic stability and/or for kinetic folding reasons . The same structural topology can determine numerous activities, preserved through evolution . In biological systems, enzymes evolve by acquiring of new thermodynamic or kinetic properties by the already existing protein folds . Generally, only the overall folding pattern is conserved in protein groups, and as the sequence diverges, the structures deform . Among the widespread catalytic folds, such as the tim barrel and the globins, the rrm domain attracts research efforts into delineating the advancements of evolution starting from all - helical proteins via all -sheet proteins and reaching a group of /-proteins . In this route, the /-barrel is the most frequently seen enzymatic fold and appears to be a selected topology for the directed evolution of new biocatalysts . It is worth studying how the present /-barrels are linked evolutionarily to each other and through which way they have evolved from simpler ancestors . The topic becomes more attractive when these folds comprise a domain involved in a disease state, such as autoimmunity ., 11 .. the rapidly growing information on structures and functions of numerous hnrnps will be invaluable for understanding the pathological mechanisms by which these particles participate as targets of autoantibodies . Of particular interest is the determination of the role of rna - protein folding patterns in development of disease - specific epitope formation . In this context, the evolution of selected nucleic acid - binding sequences and how this contributes to disease establishment remain unknown . Therefore, this study was devoted to presentation of evolutionary connections between the various hnrnps and their rna - binding domains . A phylogenetic tree is given to depict these motifs in the major group of these particles, including also the recently cloned and sequenced novel human hnrnp a3 (15), followed by remarks on the lastly selected sequences, relevant in diseases . Figure 1 shows the general 2xrbd - gly type of structure of the a / b type of human hnrnps . The two canonical rrm-1 and rrm-2, containing the conserved rnp-2 and rnp-1 submoieties, and the rgg c - terminal part constitute the main domains . The translated sequences of the recently characterized human hnrnp a3 particle is presented herein (figure 2), solely to demonstrate the high degree of sequence homology among the different rrms . Its protein sequence is compared to that of other two members of this protein family the selected three members in figure 2 are functionally related quite distantly from each other, each having a buried core tryptophan and there are disulphide bonds on the highly conserved irl - segments (16). The sequence comparisons of the three closely related hnrnp a3 members showed that the general need for a large buried hydrophobic moieties is well satisfied . This represents a possible case, where structural constraints make evolution towards a different conformation unlikely . The high level of conservation of these residues is related to the interlocking interactions and restraints of the loop connecting the -sheets, by providing the huge hydrophobic template necessary for core packing . In addition, having large hydrophobic inner part and suitable hydroxyls capable of hydrogen - bond formation, these residues (e.g. Tyrosines) could be conserved for structural stability needs . Performing amino acid mutations, or substitutions at the sites thus removing hydrophobic packaging interactions, would provide further evidence for the core packing of hnrnp globule . These are buried in the compacted core and are expected to participate in overall folding of the scaffold . However, to verify whether this is the case, more mutational analyses, combined with thermodynamic, kinetic, structural and evolutionary computation data are needed . Amino acid sequence comparisons of rrm structures (figure 3) depicted the hydrophobic core residues, conserved among different rrms . The inserted sequence of the human hnrnp a3 shared extensive sequence homology (up to 90%) existing between rrms of all these numerous proteins, which are conserved throughout evolution . A phylogenetic tree (figure 4) depicted the evolutionary history of the rrms of human hnrnp a3 and other hnrnp a / b proteins . The objective was to deduce whether the observed patterns of conservation resulted due to structural features for this type of fold architecture, or alternatively, were the consequence of divergent evolution . Parallel symmetric groupings of rrm1 and rrm2 in two different clusters, which belong to insect and vertebrate members is well seen . With the slight deviation of hnrnp a0, this branching pattern is an indication of parallel proceeding evolution, in accordance with relevant studies 16 ., 26 .. each of the members of these two subgroups are equally distant from each other . These results suggest that these branching patterns originated from an ancestral hnrnp a / b - like protein probably through independent gene duplications . Phylogenetic analyses of this sort provide evidence for evolutionary history and origin of the modular structure of hnrnps and their contemporary functional implications . This approach helps to delineate whether rna - binding (rbd) and protein - protein (auxiliary) domains have evolved in parallel or follow another evolutionary history . In this context evolutionary computation on every newly characterized hnrnp particle the sequence of human hnrnp a3 was inserted in the data set at figure 4 and becomes a further support of the evolutionary trend of these rnp family of proteins, appearing also in previous studies 16 ., 26 .. these earlier studies proved that the origin of hnrnps is a consequence of independent gene duplication . In their landmark work, fukami - kobayashi et al . (26) showed that the ancestral gene of the hnrnps had have two rna - binding domains even before the divergence of invertebrates and vertebrates and that it diverged to contemporary hnrnp genes while preserving the tandemly repeated structures . The origin of natural selection of particular nucleotide sequences and their conservation from primitive rna - based catalysis to eukaryotic chromosome evolution remain to be elucidated (http://manske.virtualave.net/genetik/vorlesung_ws99/teil1-3/rna_und_die_evolution.htm; ref ., there is now sufficient data to prove the substitution of ancestral rnas by more efficient rna - protein complexes with subsequent replacement of the latter by proteins (27). By using molecular modelling approach, it has been recently shown (28) that in this transition position, the two rna - binding sites of the simulated proto - protein interact with target sites to form a stable rnp complex . Since the selected proteins were unable to resolve misfolded rna, in vivo selected protein associated with the two rna - binding sites, indicating that the protein facilitates the correct folding of the ribozyme . This provides evidence that these modelled self - splicing rna - protein complexes can be considered as a primitive form of splicing factors or rna chaperones, which contribute to correct rna folding (28). In terms of molecular evolution of primitive catalysts, these self - splicing intron assemblies possibly became splicing rnps, suggesting that an active rnp particles could have originated from a primordial ribozyme (28). The evolutionary driving force for this is the small structural cost, through which the protein binding compensates for some folding deficiencies in the rna (29). This serves as another proof that the evolution from rna to rnp - determined catalysis represents an evolutionary design against misfolding rather than for the maintenance of a protein binding site . Our preliminary biophysical results (30) suggest that this is the case with human hnrnp a3, as well . The current study presents the sequence conservation of mainly hydrophobic residues of human hnrnp a3, which form the hydrophobic packing cores and are essentially and evolutionarily conserved in other rna - binding domains in the hnrnps studied (fig . This indicates that the rna - binding domains have evolved from a common hnrnp a / b - type proto - protein, supporting further previous models 16 ., 26 .. interestingly, while the majority of models of rbd protein family built up to now are based on divergent evolutionary principles, another view claims that this is open to doubt in cases of similar, but more distantly related functions and structures (31). Their model suggests that even though the ancient rbds could have developed separately by divergent evolution, these rbds have evolved conserved rnp motifs with a similar structure and function on similar surfaces . The authors emphasize that rnp motifs are conserved both in scaffold architecture and in function, which provides an intriguing case of convergent evolution . Further advancements in sequence comparison techniques will help to understand whether these functional sites have arisen multiple times during evolution (http://online.itp.ucsb.edu/online/infobio01/higgs1/pdf/higgs1.pdf; ref . 22 ., 23 ., 24 ., 32 . ). Regarding the evolutionary conservation of hnrnp domains, two possibilities exist for explaining their nowadays existence they are either hyperadaptable, or they may have developed features required to perform vital cellular functions (32). Despite the case with cold shock domain (31), hnrnp a / b proteins appear to possess eukaryotic origins, because prokaryotic homologs could not be detected until now . All these rbds have similar dimerization roles leading to similar three - dimensional architectures, suggesting that they may have arisen from a common ancestor, which have diverged in sequence afterwards (32). These domains are found also in chloroplast protein sequences, implying the link with endosymbiont hypothesis, and also implys that the multicellularity in plants and animals did not evolved independently 26 ., 32 .. domain evolution of hnrnps rises the question that whether they are consequences of continuous or discontinuous evolution . Fukami - kobayashi et al . (26) showed that the rbd fused with the sr - rich domain proceeded the divergence of splicing factors, and that these two domains have arisen together thus conserving the fused domain organization . The existence of gly - rich domain (figure 1), also supports the proposal of domain organization of the unique origin of hnrnps, followed by duplication and divergence of rbds and structural transitions of the auxiliary domain (18). This indicates that the auxiliary domain shared by functionally related rnps diverged in parallel together with the rbds (26). It is thus implied, that these ancestral repeats must have oligomerized afterwards to adopt a similar structure seen in contemporary homologs (32). In the light of the fact that hnrnp a / b particles are considered as disease genes, an intriguing issue becomes the use of protein domain data of various hnrnps to delineate the link and etiology of diseases . As stated earlier, the majority of these gene activities related to autoantigenic hnrnps are covered by relevant databases . Respect, identification of human paralogous disease genes generates further pathological gene candidates to be sequenced, because paralogous genes are frequently encountered as mutated versions in similar diseases (32). The sequence comparison, however, may be insufficient for deduction of its functional role for patients diagnozed with the suspected disease . Therefore, we followed the suggestion of ponting, c.s . And russell, r.r . (32) and combined our sequence determination of human hnrnp a3 with its gene expression profiles, its molecular interaction features (30), and its tissue - specific gene expression patterns (15). Interestingly, our molecular characterization of human hnrnp a3 showed that while the recombinant hnrnp a3 with its 296 a.a . Migrates as expected as a 32 kda protein on sds - page analysis, it is recognized by the patients sera as a 50 kda protein . This is attributed to alternative splicing or due to tissue - specific expression of a highly related yet unknown crossreactive protein . Surprisingly, neither the 50 kda nor the 32 kda protein was detected in helanuclear extracts, further supporting the assumption that hnrnp a3 is not ubiquitously expressed as hnrnp a1 or hnrnp a2 . Northern blotting analysis showed the variable expression patterns of hnrnp a3 mrna in human tissues . Thus, it is highly expressed in spleen, ovary, small intestine, lung, liver, skeletal muscle, kidney and pancreas, whereas expression in thymus, testis, colon and peripheral blood was hardly detectable . Expression in prostata, heart, brain and placenta was low, but clearly detectable (15). In addition, circular dichroism and fluorescence spectroscopic measurements demonstrated that the human hnrnp a3 protein is a stable particle the free energy of unfolding of the full - length hnrnp a3 is 58c, as shown by both urea and temperature denaturation (30). This particle increases its apparent stability upon interaction with rna fragments r(uuaggg)4 to higher temperature values . The high binding affinity to this repeat indicates its preference for association with purine - rich consensus sequences and targeting features towards deleterious g - tetrad structures . The latter fact suggests its active participation in alternative splicing a common feature of well - known telomitic repeats interactions of hnrnp a1 . This rna fragment, hnrnp a3 particle recognition, can act by facilitating the splicing of alternative intron of the pre - mrna . Since this represents a case of regulation of splice - site selection with further functional implication in human disease 11 . The first one is comprised of both rbd1 and rbd2, and the second one is composed of rbd2 and certain parts of gly - rich domain 15 ., 30 .. this epitope recognition pattern differs from the epitope determined for the highly related hnrnp a1 and hnrnp a2, respectively . Thus, in hnrnp 2 the rbd2 was found to contain the major epitope, which was recognized by patients suffering from rheumatoid arthritis or systemic lupus erythenathosus . This particular region was also found to be essential for interaction with rna and the patients autoantibodies strongly inhibited rna binding . As oppose to these, autoantibodies derived from patients diagnozed with mixed connective tissue disease recognized an epitope comprising rbd1 and rbd2 . Interestingly, the major epitope of hnrnp a1 also comprises both rbds, which were also targeted by patients with rheumatoid arthritis and systemic lupus erythemathosus . Taken together, these data confirm that rheumatoid arthritis, systemic lupus erythemathosus and mixed connective tissue disease are immunochemically linked by systemic autoimmunity to the functionally important rna - binding regions of hnrnp a / b proteins . The observed trend brings the question of why so closely related and evolutionarily conserved rbd domains are differentially recognized by the autoantibodies . We proposed recently (30) the overall folding patterns of these domains, and the protein antigenicity arising from these patterns is the determining factor . The present study combined with previously determined sequences of u1a, hnrnp c, hnrnp a1 and drosophila sex lethal (sxl) protein structures reveals that they have the same fold, but have different placing of the second and fourth -strands . Individual rrms have preferences towards various rna sequences, due to differences in surface amino acids found outside the conserved rnp submotifs . In our opinion in certain cases, the two rrms somehow act in concerted fashion to give rise to the overall rna- and antibody - binding characteristics, whereas in other cases the presence of only one rrm is sufficient for autoantibody and rna recognition . Thus, rbd1 itself bound strongly to rna fragments, however, the joining of rbd2 to rbd1 that increased the overall affinity indicats that rbd2 also strongly affects rna - binding . To isolate the cdna, human liver and brain cdna libraries were screened by pcr using primers complementary to sequences in the 5- and 3-untranslated regions of the fetal brain (fbrnp) cdna, as described (15). Screening of cdna expression library resulted in isolation of a clone, which is a member of a 2xrna - binding domain (rbd)the glycine family of hnrnp proteins . Human hnrnp a3 polypeptide, highly homologous to the fetal brain cdna, as well as to hnrnps a1 and a2 . At the nucleotide level, the cdnas encoding rna - binding fragments of hnrnp a3 sequence were generated by pcr as deletion mutants, starting from the full - length human hnrnp a3 . Pcr mix was prepared by adding 660 l water, 220 l 10 mm dntp mix (pharmacia biotech, uppsala, sweden), 220 l 10 cloned pfu polymerase buffer (promega, madison, usa), and 122 l 25 mm mgcl2 for twice . 20 l of each oligonucleotide (100 pmol / ml) was taken and added to 480 l water . Pcr reactions were run by taking 172 l of the pcr mix (i. e., 86 l per reaction), and mixing this amount with 12 l of both primers . Denaturation was achieved by incubating at 94 c for 30 sec, while annealing temperature was 52 c for 1 min . The amplified fragments were cloned into ligation independent cloning (lic) vector (novagen, madison, usa). All the dna sequencings were performed by the vienna biocenter oligo team (http://emb1.bcc.univie.ac.at/gem). Nucleotides and deduced protein sequences of previously determined rna - binding domains of rnps from various species and human hnrnp a3 were aligned employing clustalw programme (http://www2.ebi.ac.uk/clustalw/; ref . To isolate the cdna, human liver and brain cdna libraries were screened by pcr using primers complementary to sequences in the 5- and 3-untranslated regions of the fetal brain (fbrnp) cdna, as described (15). Screening of cdna expression library resulted in isolation of a clone, which is a member of a 2xrna - binding domain (rbd)the glycine family of hnrnp proteins . Human hnrnp a3 polypeptide, highly homologous to the fetal brain cdna, as well as to hnrnps a1 and a2 . At the nucleotide level, the cdnas encoding rna - binding fragments of hnrnp a3 sequence were generated by pcr as deletion mutants, starting from the full - length human hnrnp a3 . Pcr mix was prepared by adding 660 l water, 220 l 10 mm dntp mix (pharmacia biotech, uppsala, sweden), 220 l 10 cloned pfu polymerase buffer (promega, madison, usa), and 122 l 25 mm mgcl2 for twice . 20 l of each oligonucleotide (100 pmol / ml) was taken and added to 480 l water . Pcr reactions were run by taking 172 l of the pcr mix (i. e., 86 l per reaction), and mixing this amount with 12 l of both primers . Denaturation was achieved by incubating at 94 c for 30 sec, while annealing temperature was 52 c for 1 min . The amplified fragments were cloned into ligation independent cloning (lic) vector (novagen, madison, usa). All the dna sequencings were performed by the vienna biocenter oligo team (http://emb1.bcc.univie.ac.at/gem). Nucleotides and deduced protein sequences of previously determined rna - binding domains of rnps from various species and human hnrnp a3 were aligned employing clustalw programme (http://www2.ebi.ac.uk/clustalw/; ref.
|
Periodontal disease is accompanied by inflammation of the gingiva and destruction of periodontal tissues, leading to alveolar bone loss in severe clinical cases . Prostaglandin e2 (pge2), interleukin- (il-)6, and il-8 are known to play important roles in inflammatory responses and tissue degradation . Pge2 has several functions in vasodilation, the enhancement of vascular permeability and pain, and the induction of osteoclastogenesis and is believed to play important roles in inflammatory responses and alveolar bone resorption in periodontal disease . Il-8 acts as a chemoattractant for neutrophils that produce proteases such as cathepsin, elastase, and matrix metalloproteinase- (mmp-)8, leading to tissue degradation . Recently, we reported that several kampo medicines, shosaikoto, hangeshashinto, and orento, suppress lipopolysaccharide- (lps-) induced pge2 production by hgfs and suggested that these kampo medicines have anti - inflammatory effects in periodontal disease . Another kampo medicine, kakkonto (tj-1), has been clinically used for various diseases such as the common cold, coryza, the initial stage of febrile diseases, and inflammatory diseases . There are several reports that kakkonto shows antiallergic effects [8, 9] and antiviral effects [1013] in animal and in vitro experimental models . For anti - inflammatory effects therefore, we considered the possibility that kakkonto decreases pge2 production by human gingival fibroblasts (hgfs) and has anti - inflammatory effects with respect to periodontal disease . Moreover, lps - treated hgfs produce inflammatory chemical mediators such as pge2 and inflammatory cytokines such as il-6 and il-8 [2, 15, 16]. Moreover, because hgfs have sustained production of pge2, il-6, and il-8 in the presence of lps, these mediators and cytokines in periodontal tissues are thought to be derived from hgfs . Therefore, we believe that examining the effects of drugs on hgfs, as well as on monocytes and macrophages, is important in the study of periodontal disease . In the present study, we examined the effect of kakkonto on lps - induced pge2, il-6, and il-8 production using this in vitro model . Kakkonto was purchased from tsumura & co. (tokyo, japan; lot number: d23122), and its components are listed in table 1 . Kakkonto was suspended in dulbecco's modified eagle's medium (d - mem, sigma, st . Louis, mo, usa) containing 10% heat - inactivated fetal calf serum, 100 units / ml penicillin, and 100 mg / ml streptomycin (culture medium) and was rotated at 4c overnight . Then, the suspension was centrifuged and the supernatant was filtrated through a 0.45 m - pore membrane . Lps from porphyromonas gingivalis 381 was provided by professor nobuhiro hanada (school of dental medicine, tsurumi university, japan). Hgfs were prepared as described previously . In brief, hgfs were prepared from free gingiva during the extraction of an impacted tooth with the informed consent of the subjects who consulted matsumoto dental university hospital . The free gingival tissues were cut into pieces and seeded onto 24-well plates (agc techno glass co., chiba, japan). Hgfs were maintained in culture medium at 37c in a humidified atmosphere of 5% co. for passage, hgfs were trypsinized, suspended, and plated into new cultures in a 1: 3 dilution ratio . This study was approved by the ethical committee of matsumoto dental university (number 0063). The numbers of cells were measured using wst-8 (cell counting kit-8; dojindo, kumamoto, japan) according to the manufacturer's instructions . In brief, hgfs (10,000 cells / well) were seeded in 96-well plates (agc techno glass co., chiba, japan) and incubated in serum - containing medium at 37c overnight . Then, the cells were treated with various concentrations of kakkonto (0, 0.5, 1, 2, 5, and 10 mg / ml) in the absence or presence of lps (10 ng / ml) for 24 h (200 l each well) in quadruplicate for each sample . Then, the media were removed by aspiration and the cells were treated with 100 l of mixture of wst-8 with culture medium for 2 h at 37c in co incubator . Optical density was measured (measured wavelength at 450 nm and reference wavelength at 655 nm) using an imark microplate reader (bio - rad, hercules, ca, usa), and the mean background value was subtracted from each value . Hgfs (10,000 cells / well) were seeded in 96-well plates and incubated in serum - containing medium at 37c overnight . Then, the cells were treated with various concentrations of kakkonto (0, 0.01, 0.03, 0.1, 0.3, and 1 mg / ml) in the absence or presence of lps (10 ng / ml) for 24 h (200 l each well) in triplicate for each sample . After the culture supernatants were collected, viable cell numbers were measured using wst-8 as described above . The concentrations of pge2, il-6, and il-8 in the culture supernatants were measured by elisa according to the manufacturer's instructions (pge2, cayman chemical, ann arbor, mi, usa; il-6 and il-8, biosource international inc ., camarillo, ca, usa) and were adjusted by the number of viable cells . Data are represented as ng or pg per 10,000 cells (mean sd, n = 3). The effects of kakkonto on the activities of cyclooxygenase (cox)-1 and cox-2 were analyzed using a cox inhibitor screening assay kit (cayman chemical, ann arbor, mi, usa) according to the manufacturer's instructions . Cox activities were evaluated by the measurement of prostaglandin produced from arachidonic acid by cox-1 or cox-2 . These values were normalized to a relative value of 100% for cells without lps or kakkonto treatments, and are represented as means sd (n = 3). Hgfs were cultured in 60 mm dishes and treated with combinations of lps and kakkonto for the indicated times . Then, cells were washed twice with tris - buffered saline, transferred into microcentrifuge tubes, and centrifuged at 6,000 g for 5 min at 4c . Supernatants were aspirated and cells were lysed on ice in lysis buffer (50 mm tris - hcl, ph 7.4, 1% nonidet p-40, 0.25% sodium deoxycholate, 150 mm nacl, 1 mm ethyleneglycol bis(2-aminoethylether) tetraacetic acid (egta), 1 mm sodium orthovanadate, 10 mm sodium fluoride, 1 mm phenylmethylsulfonyl fluoride, 10 g / ml aprotinin, 5 g / ml leupeptin, and 1 g / ml pepstatin) for 30 min at 4c . Then, samples were centrifuged at 12,000 gfor 15 min at 4c, and supernatants were collected . The protein concentration was measured using a bca protein assay reagent kit (pierce chemical co., rockford, il, usa). The samples (10 g of protein) were fractionated in a polyacrylamide gel under reducing conditions and transferred onto a polyvinylidene difluoride (pvdf) membrane (hybond - p; ge healthcare, uppsala, sweden). The membranes were blocked with 5% ovalbumin for 1 h at room temperature and incubated with primary antibody for an additional 1 h. the membranes were further incubated with horseradish peroxidase - conjugated secondary antibodies for 1 h at room temperature . Antibodies against cox-2 (sc-1745, 1: 500 dilution), cytoplasmic phospholipase a2 (cpla2, sc-438, 1: 200 dilution), annexin1 (sc-11387, 1: 1,000 dilution), and actin (sc-1616, 1: 1,000 dilution), which detects a broad range of actin isoforms, were purchased from santa cruz biotechnology (santa cruz, ca, usa). Antibodies against extracellular signal - regulated kinase (erk; p44/42 map kinase antibody, 1: 1,000 dilution) and phosphorylated erk (phospho - p44/42 mapk (thr202/tyr204) (e10) monoclonal antibody, 1: 2,000 dilution) were from cell signaling technology (danvers, ma, usa). Horseradish peroxidase - conjugated anti - goat igg (sc-2020, 1: 20,000 dilution) was from santa cruz, and anti - rabbit igg (1: 20,000 dilution) and anti - mouse igg (1: 20,000 dilution) were from dakocytomation (glostrup, denmark). Differences between groups were evaluated by the two - tailed pairwise comparison test with a pooled variance, followed by correction with the holm method (total 16 null hypotheses; 5 null hypotheses without kakkonto versus with kakkonto in the absence of lps, 5 null hypotheses without kakkonto versus with kakkonto in the presence of lps, and 6 null hypotheses without lps versus with lps) (figures 1 and 2). Differences between the control group and experimental groups were evaluated by a two - tailed dunnett's test (figure 3). Dunnett's test was performed using the glht function in the multcomp package . The viability of hgfs was approximately 90% at up to 1 mg / ml of kakkonto for a 24 h treatment in the absence or presence of lps (figure 1). The viabilities were approximately 70% and 20% at 5 mg / ml and 10 therefore, we used kakkonto at the concentrations of up to 1 mg / ml in further experiments . We examined whether kakkonto affects the production of pge2 and inflammatory cytokines (il-6 and il-8) by hgfs . Because kakkonto affects cell viability, the concentrations of pge2, il-6, and il-8 needed to be adjusted according to viable cell number . When hgfs were treated with 10 ng / ml of lps, hgfs produced large amounts of pge2, il-6, and il-8 . Indomethacin decreased lps - induced pge2 production in a concentration - dependent manner but slightly decreased lps - induced il-6 and il-8 production (data not shown). Kakkonto significantly decreased pge2 production in a concentration - dependent manner (figure 2(a)). In the absence of lps in contrast, kakkonto increased lps - induced il-6 and il-8 production (figures 2(b) and 2(c)). In the absence of lps, up to 0.1 mg / ml of kakkonto did not affect il-6 and il-8 production, but above 0.3 mg / ml of kakkonto, their concentrations were increased (figures 2(b) and 2(c)). Similar results were obtained using human skin fibroblast tig-103 cells (data not shown). Because pge2 production is regulated by cox enzymes and suppressed by acid nsaids such as aspirin and diclofenac sodium, which inhibit cox activities, we examined whether kakkonto inhibits cox-1 and cox-2 activities . Kakkonto decreased cox-1 activity to approximately 70% at 1 mg / ml but did not affect cox-2 activity (figure 3). Cpla2 is the most upstream enzyme in the arachidonic acid cascade and releases arachidonic acid from plasma membranes . Kakkonto did not alter cpla2 expression in the absence or presence of lps (figure 4). However, kakkonto did not alter lps - induced cox-2 expression (figure 4). Annexin1, also named lipocortin1, is an anti - inflammatory mediator produced by glucocorticoids that inhibit cpla2 activity [19, 20]. However, neither lps nor kakkonto showed an effect on annexin1 expression (figure 4). Cpla2 is reported to be directly phosphorylated at ser505 by erk, resulting in cpla2 activation [21, 22]. Erk phosphorylation was enhanced at 0.5 h after lps treatment and thereafter was attenuated . One mg / ml of kakkonto suppressed lps - induced erk phosphorylation at 0.5 h to 2 h (figure 5). In the present study, we examined the effect of kakkonto on lps - induced pge2, il-6, and il-8 production by hgfs . Kakkonto concentration dependently decreased lps - induced pge2 production but did not affect pge2 production without lps treatment, similar to shosaikoto, hangeshashinto, and orento [57]. Moreover, kakkonto suppressed lps - induced erk phosphorylation . In contrast, kakkonto increased lps - induced il-6 and il-8 production . It is widely known that pge2 leads to inflammatory responses such as vasodilation, enhanced vascular permeability, and pain generation . Acid non - steroidal anti - inflammatory drugs nsaids show anti - inflammatory effects by suppression of pge2 production, even though they do not affect il-6 and il-8 production . Our findings showing that kakkonto decreases lps - induced pge2 production suggest that kakkonto also has anti - inflammatory effects in periodontal disease and that its effects are mainly mediated by suppression of pge2 production even though kakkonto increased lps - induced il-6 and il-8 production . Previously, we demonstrated that orento inhibits lps - induced erk phosphorylation and cpla2 activation, leading to the suppression of pge2 production in hgfs . Therefore, we consider that kakkonto decreased lps - induced pge2 production through the suppression of erk phosphorylation in hgfs . Although kakkonto increased cox-2 expression in the absence of lps, kakkonto did not alter pge2 production . We consider a likely reason to be the suppression of cpla2 activation through the inhibition of erk phosphorylation and/or the suppression of cox-1 activity . Our results showed that kakkonto increased lps - induced il-6 and il-8 production by hgfs . Previously, we reported that the activation of the protein kinase a (pka) pathway by adrenaline or aminophylline increases lps - induced il-6 and il-8 production in hgfs and that h-89, a pka inhibitor, decreases lps - induced il-6 and il-8 production [23, 24] in general, steroidal anti - inflammatory drugs (saids) suppress the expression of cpla2, cox-2, and inflammatory cytokines (such as il-6 and il-8) and induce the expression of annexin1 . However, kakkonto did not affect cpla2, annexin1, or lps - induced cox-2 expression, and it increased il-6 and il-8 production . This therefore suggests that the mechanism by which kakkonto decreases pge2 production is different from that of saids . Many studies have demonstrated that nsaid administration prevents gingival inflammation and several clinical studies have indicated that the concentration of pge2 in gingival crevicular fluid (gcf) is increased in periodontal disease and is decreased by oral administration or mouthwash with nsaids [27, 28]. Considering that both nsaids and kakkonto suppress pge2 production, it is possible that administration of kakkonto also decreases the pge2 concentration in gcf and results in the improvement of gingival inflammation . Therefore, kakkonto may be useful for the improvement of gingival inflammation in periodontal disease . Importantly, kakkonto did not affect the basal level of pge2, although kakkonto decreased cox-1 activity to approximately 70% . Because pge2 produced by cox-1 protects gastric mucosa, these results suggest that kakkonto may cause minimal gastrointestinal dysfunction . We demonstrated that kakkonto suppresses lps - induced erk phosphorylation, resulting in the suppression cpla2 activation and further pge2 production by hgfs . These results suggest that kakkonto is clinically useful for the improvement of inflammatory responses in periodontal disease.
|
Chronic liver diseases are amongst the top leading causes of death worldwide (13). Chronic liver diseases are characterized by unrelenting progression of liver inflammation and fibrosis over a prolonged period of time, usually more than 20 years, which may eventually lead to cirrhosis (4). Renal dysfunction is a common complication of liver cirrhosis with ascites, occurring in 20% of patients with cirrhosis who are admitted to a hospital (5). A wealth of evidence indicates that impairment in circulatory function is the main cause of renal dysfunction in cirrhosis . Some studies (7, 8) have found that patients with cirrhosis and ascites without hepatorenal syndrome show a typical circulatory pattern of increased total plasma volume, cardiac index and heart rate, along with reduced peripheral vascular resistance and arterial pressure . When hepatorenal syndrome develops, the mechanisms of further derangement of cardiovascular function become even more complex because a decreased cardiac function is also involved . Furthermore, studies performed by tristani and cohn (9) as well as lebrec (10) have shown that a significant number of patients with hepatorenal syndrome exhibit arterial hypotension . These studies also indicated that reduced cardiac output with a tendency for peripheral vascular resistance is slightly higher in the aforementioned subjects than in ascitic subjects without hepatorenal syndrome . Cardiac failure in cirrhosis, named portal or cirrhotic cardiomyopathy (ccm), it comprises systolic and diastolic dysfunctions, mainly of the left heart chamber, and electromechanical abnormalities including a prolongation of the q - t interval . The histopathology of ccm is nonspecific and more evident in patients with ascites (12). The most common way to study lv systolic and diastolic functions is by echocardiography . For the analysis of diastolic function, the mitral e / a ratio has been analyzed in most reported studies of ccm, concluding that a ratio 1 is associated with increased mortality risk . A mitral e / a ratio 1 is present in 5070% of patients with end stage liver disease (esld); this becomes more evident with disease progression (14, 15). By providing noninvasive correlates of intracardiac pressure and flow, doppler echocardiography may offer a complete hemodynamic assessment to help guide diagnosis and treatment of patients who are critically ill . Mrv / tvilvot> 0.27 had a 70% sensitivity and a 77% specificity to identify systemic vascular resistance (svr)> 14 wu . Mrv / tvilvot <0.2 had a 92% sensitivity and an 88% specificity to identify svr <10 wu . Normal svr> 10 wood units (wu) and <14 wu (16). The diameter of the ivc and the calculation of the caval index should be measured 3 cm from where it enters the right atrium . The inspiratory and expiratory diameter of the ivc can then be measured on the m - mode image, at the smallest and largest locations, respectively . In patients with decreased intravascular volume, the diameter of the ivc will be decreased and the percentage of collapse will be greater than 50% . With complete collapse, the ivc may become difficult to visualize . Volume overload patients with increased intravascular volume will have a large ivc diameter and minimal collapse on inspiration . In severe cases, there may not be any notable respiratory variation seen in m - mode (17). The general objective of this study was to evaluate circulatory dysfunction in patients with decompensated liver cirrhosis either with or without functional renal failure . The specific objectives were to evaluate: 1) cardiac performance by echocardiography and electrocardiography, 2) systemic vascular resistance, and 3) fluid status in both patients groups and subsequently compare them to normal subjects and to each other . Sixty adult patients with cirrhosis and ascites were recruited from the gastroenterology and hepatology department of the theodor bilharz research institute . The ethical committee of tbri approved the study, and was conducted in accordance with helsinki declaration (1975). Patients diagnosed as having liver cirrhosis caused by hcv infection were included in the study . Group 1 included 30 patients (50%) with decompensated liver cirrhosis, with ascites and with creatinine values 1.5 mg / dl . Group 2 included 30 azotemic cirrhotic patients (50%) with ascites, with creatinine values> 1.5 mg / dl, and with diagnostic criteria of hrs . The hrs diagnosis was established based on the 2007 international ascites club criteria: cirrhosis with ascites; serum creatinine> 1.5 mg / dl; no improvement of serum creatinine (decrease <1.5 mg / dl) after volume expansion; absence of shock; no treatment with nephrotoxic drugs; absence of parenchymal kidney disease as indicated by proteinuria> 500 mg / day, microhematuria (> 50 rbcs / high power field), and/ or abnormal renal ultrasound scanning (18). A third group (group 3) consisting of 20 healthy subjects (of matched age and sex to the group 1 and group 2 patients) was also included in this study as a control group . Subjects with heart disease, pulmonary disease, diabetes mellitus, hypertension (blood pressure> 140/85 mmhg), hyperlipidemia, any malignancy, alcohol consumption, pregnancy, hbv co - infection and liver malignancy were excluded . None of the patients were receiving any drugs that could interfere with the cardiovascular, hepatic or renal function, however the use of diuretics and/or beta - blockers was permitted . Treatment using diuretics or beta - blockers was temporarily discontinued for 3 days before the investigations in order to eliminate a pharmacological influence on cardiac work or volume status . All patients were additionally subjected to blood sampling for comprehensive blood picture, including: hemoglobin percent, liver function tests, renal function tests, serum electrolytes, lipid profiles, hbs antigen and hcv antibody . The qt interval duration was manually calculated from the beginning of the q wave to the end of the t wave in all 12 leads . Moreover, qt intervals were corrected (qtc: corrected qt interval) in accordance with the rate using the bazet formula: qtc = qt / rr . Abdominal ultrasound scanning was performed on all participants using a toshiba nemo 30 scanner equipped with a 3.5 mhz linear transducer . These scans were carried out by one trained investigator who, it is important to note, was unaware of all other clinical and laboratory data . All echocardiographic measurements were performed according to the recommendations of the american society of echocardiography (21), by more than one member of the study team, with an average was taken . M - mode, two dimensional echocardiography, and doppler ultrasound studies (pulsed, continuous wave and color flow imaging) were made using a high resolution (alt 5000 hdi) toshiba nemo 30 scanner equipped with a 2.5 mhz transducer . With m - mode, measurements of interventricular septum (ivs) and left ventricle posterior wall (pwt) thicknesses, separately at end diastole and end systole, were done . Furthermore, left ventricle end - diastolic (lved) and end - systolic (lves) diameters were determined . The size of the left atrium was determined from the parasternal long axis view at end systole . Left ventricular ejection fraction ef% was measured from m - mode dimensions using teichholz formula (22). With doppler echocardiography accompanied by electrocardiogram, flow characteristics and rates of mitral, tricuspid, pulsed doppler spectral recordings were obtained in the apical 4-chamber view from a sample volume positioned at the tips of the mitral leaflets . The transmitral, pulsed doppler velocity recordings from 3 consecutive cardiac cycles were used to derive measurements using the peak values of e and a velocities . Impaired relaxation was defined as an e / a ratio <1 (23). The left ventricular (lv) outflow time - velocity integral (tvilvot) in centimeters was obtained by placing a pulsed wave sample volume in the lv outflow tract when imaged from the apical 3-chamber view . A continuous wave doppler was used to determine peak mitral regurgitant velocity (mrv) in m / s from the apical 4-chamber view . The highest velocity obtained from multiple echocardiographic views systemic vascular resistance was calculated from the equation svr= mrv / tvilvot (16). Vena cava sonography was performed in the supine position with 2-dimensional guided m - mode echocardiography, using a 3.5 mhz ultrasound probe . From a subxiphoidal long axis view most studies agree that the measurement should be distal to the junction with the right atrium and within 3 cm of that point (2527). The inspiratory and expiratory diameter of the ivc can then be measured on the m - mode image, at the smallest and largest locations, respectively . In patients with decreased intravascular volume, the diameter of the ivc will be decreased and the percentage of collapse will be greater than 50% . With complete collapse, the ivc may become difficult to visualize . Patients with increased intravascular volume will have a large ivc diameter and minimal collapse on inspiration . In severe cases, there may not be any notable respiratory variation seen in m - mode (17). The demographic data of the patients groups (1&2) and the control group revealed mean ages 43.59.95, 41.5510.53 and 43.98.8 years, respectively . In group 1; 18 were males (60%) and 12 were females (40%). In group 2; 20 were males (66.6%) and 10 were females (33.4%). In the control group there was significant decrease in both systolic & diastolic bp with increase in pulse rate in both patient groups (groups 1 and 2) as compared to the control group (p<0.01). Moreover, there was significant decrease in systolic & diastolic bp in group 2 as compared to group 1 (p<0.01) (table 1). There was an overall significant decrease in liver span as well as a significant increase in portal vein and spleen diameter in both patient groups as compared to the control group (p<0.01) (table 2). The electrocardiographic data showed a statistically significant increase in heart rate and qtc in both patient groups as compared to the control group and a statistically significant increase in qtc in group 2 as compared to group 1 (table 2). The laboratory data showed a significant increase in k, alt, ast, total bilirubin (tbil), direct bilitubin (dbil), wbcs and inr with a significant decrease in na, alb and platelets in both patient groups as compared to the control group . Additionally, there was a significant increase in creatinine, bun and wbcs with a significant decrease in na, albumin & platelets in group 2 as compared to group 1 (table 3). The echocardiographic data showed a statistically significant increase in la, ao, ivst, pwt, edd (p<0.01), esd and lv mass in both patient groups as compared to the control group and a statistically significant decrease in early to late diastolic flow ratio (e / a ratio) in both patient groups as compared to the control group . A significant increase in la and ao was also demonstrated in group 2 as compared to group 1 (table 4). There was significant decrease in svr and ivc diameter in both patient groups as compared to the control group . There was normal ivc collapsibility in group 1 and 2 and insignificant decrease in ivc collapsibility in group 2 (table 5). In our study we found a significant decrease in both systolic & diastolic bp with a significant increase in heart rate in both patient groups as compared to the control group . Our results are in agreement with the results of moller and henriksen who found hyperdynamic syndrome in patients with cirrhosis (28). Additionally, there was a significant decrease in systolic and diastolic bp in group 2 (hepatorenal syndrome patients) as compared to group 1 . Hemodynamic studies performed by tristani and cohn (9) and lebrec (29) have shown that a significant number of patients with hepatorenal syndrome exhibit arterial hypotension . In our study, there was a significant decrease in liver span and a significant increase in portal vein and spleen diameters in both patient groups as compared to the control group . This is in agreement with studies of mandal, sudha rani and colleagues (31, 32). The electrocardiographic data in our study showed a statistically significant increase in heart rate and qtc in both patient groups as compared to the control group and a statistically significant increase in qtc in group 2 as compared to group 1 . Our study agrees with other studies that showed similar findings (13, 32, and 33). Our study showed a significant decrease in na in both patient groups as compared to the control group . Furthermore, there was a significant decrease in na in group 2 as compared to group 1 . These findings agree with many studies that have concluded that hyponatremia is common in patients with cirrhosis and esld, that it is associated with increased risk of morbidity and mortality in these patients, and that hyponatremia is also associated with the development of hepatorenal syndrome (34, 35). Hyponatremia is associated with numerous complications in liver disease patients, including severe ascites, hepatic encephalopathy, infectious complications, renal impairment, increased severity of liver disease, increased hospital stay, and neurologic / infectious complications post - transplant (36). The laboratory data in our study showed a significant increase in alt, ast, tbil, dbil, wbcs and inr and a significant decrease in alb and platelets in both patient groups as compared to the control group . Also, there was a significant increase in creatinine, bun and wbcs and a significant decrease in na, alb and platelets in group 2 as compared with group 1 . Our study agrees with the study done by fisher and brown, which showed clinical onset of hrs with pre - renal features of low urine output in the absence of diuretics, urinary sodium excretion, dilutional serum hyponatremia, moderate hyperkalemia, and a rise in plasma creatinine concentration; with a subsequent decline in creatinine clearance as well as a decrease in alb, platelets, and an increase in wbcs in hrs; due to increased incidence of infection specially spontaneous bacterial peritonitis in these patients (38). Our echocardiographic data showed a statistically significant increase in la diameter, ao diameter, ivst, pwt, edd, esd, lv mass and a statistically significant decrease in early to late diastolic flow ratio (e / a ratio) in both patient groups as compared to the control group and a significant increase in la and ao diameters in group 2 as compared to group 1 ., found an increase in edv in patients with cirrhosis (39); wong et al . Other studies have found that patients with cirrhosis have altered hemodynamics leading to a hyperdynamic syndrome (41, 42). Increase in the left ventricle mass is a physiological response to the increased work as reflected by increased co. the increased co also explains why child b patients showed a significant higher stroke volume, end systolic volume and end diastolic volume than child a patients during stress . These are likely the earliest changes towards the hyperdynamic syndrome seen in advanced cirrhosis with decreased svr, increased co, increased left ventricular mass together with subtle hormonal changes (28, 43). In an autopsy study of 133 patients with cirrhosis, cardiomegaly and left ventricular hypertrophy were found in up to 43% of the patients (44). Similar to our results, moller and henriksen also reported an increase in both systolic and diastolic volumes of the left ventricle in cirrhotic patients (45). Also, finucci et al . Reported that cirrhotic patients demonstrate an increase in left ventricular end - diastolic, left atrium and stroke volumes (46). In our study, we found preserved systolic function in the patient groups with no change in ejection fraction between all three groups . This is in agreement with the study of gins who found no difference in systolic lv function in cirrhotic patients both with and without ascites, and those without renal failure or with hrs, despite marked differences in the activity of the renin these features indicate an impaired response of cardiac chronotropic and inotropic function to changes in systemic hemodynamics (47). Reported that systolic function is preserved in liver cirrhosis patients with normal or even increased ejection fraction at rest (48). Similar to our results concerning diastolic function in cirrhotic patients, moller and henriksen and sawant et al . Concluded that cirrhotic patients have diastolic dysfunction with left ventricular hypertrophy, left atrial enlargement, isovolumetric relaxation time prolongation, and decreased early to late diastolic flow ratio (e / a ratio) (11, 49). In our study, there was a significant decrease in svr in both patient groups as compared to the control group . Our results agree with a recent study that observed a statistically significant inverse correlation between svr and all validated liver disease severity models (50). The exact mechanism of vasodilation with a drop in svr in patients with decompensated liver cirrhosis is not yet fully understood . It has been postulated that endotoxemia in cirrhosis induces expression of nitric oxide synthase within the vessel walls . Nitric oxide synthesized in this way is a potent vasodilator with a profound impact on mean arterial blood pressure and svr (52, 53). This vasodilatory effect is further exacerbated by inefficient hepatic clearance of nitric oxide due to portal other potential local vasodilatory mediators in cirrhosis include carbon monoxide (56), prostacyclin (57), and hydrogen sulfide (58). As cirrhotic patients progress from compensated to decompensated, with or without hepatorenal syndrome (hrs), there is a progressive decline in systemic vascular resistance and decreased blood pressure . Moreover, there is a progressive rise in plasma norepinephrine (ne), plasma renin activity, and arginine vasopressin (avp), with resultant hyponatremia during progression of cirrhosis to hrs; all known risk factors for increased mortality in cirrhosis (59). Thus, the primary systemic arterial vasodilation hypothesis, causing arterial underfilling, has been proposed to explain the pathogenesis of renal sodium and water retention in cirrhotic patients (60). Therefore, svr could, theoretically, be a predictor for severity of liver disease (61). In our study there was a significant decrease in ivc diameter in both patient groups as compared to the control group . There was normal ivc collapsibility in normal volunteers and patients with decompensated liver cirrhosis and ascites, with creatinine 1.5 (ivc collapsibility> 50%). In patients with decompensated liver cirrhosis and ascites, with creatinine> 1.5, there was an impairment in ivc collapsibility (ivc collapsibility <50%). Our study agrees with the study of davenport who found that ivc diameter and ivc collapsibility are of value in the prediction of intravascular fluid status in liver cirrhosis especially with acute renal injury (ari) (62). On the other hand, the study of kitamura and kobayashi found that interpretation of caval physiology is hindered by conditions that restrict the physiologic variability of the ivc; such as liver cirrhosis and fibrosis, masses causing external compression, and elevated intra - abdominal pressure (63). The finding of a small - diameter ivc with large inspiratory collapse (high caval index) correlates with low volume states . Conversely, a large ivc with minimal collapse (low caval index) suggests a high volume state (64). A recent study suggested that every 1ml / kg of intravascular fluids (ivfs) administered should change the ivc collapsibility by 0.86 1.00% . This anticipated change in ivc diameter can be used to gauge a patient s response to intravascular volume repletion (65). The most effective method currently available for the management of hrs is the administration of vasoconstrictor drugs . The administration of midodrine, an orally active - adrenergic agonist, in patients with cirrhosis and ascites, improved circulatory functions . This was indicated by an increase in arterial pressure and suppression of the activity of renin angiotensin and sympathetic nervous systems . Consequently, a marked improvement of circulatory function was observed, with associated increase in renal blood flow, glomerular filtration rate and urinary sodium excretion . No significant side effects were reported in short - term studies (66, 67). The addition of systemic oral vasoconstrictors that interfere with the early circulatory dysfunction of patients with decompensated cirrhosis and with decreased svr, without waiting for the advent of renal impairment, may postpone hrs occurrence and improve survivals . In conclusion, patients with decompensated liver cirrhosis have low systemic vascular resistance and that doppler echocardiography provides an easy noninvasive tool to assess this resistance . Follow - up of svr by doppler echocardiography may be a predictor for severity of liver disease . Decompensated cirrhotic patients have a small ivc diameter with normal collapsibility, which indicates low effective plasma volume . Thus, measuring ivc diameter and collapsibility are of value in the prediction of intravascular fluid status in liver cirrhosis, especially with renal dysfunction . The addition of systemic oral vasoconstrictors that interfere with the early circulatory dysfunction of patients with decompensated cirrhosis and with decreased svr, without waiting for the advent of renal impairment, may postpone hrs occurrence and improve survivals . Patients with decompensated liver cirrhosis have lv diastolic dysfunction and prolonged qt interval in the ecg with preserved systolic function . The reduced afterload, secondary to the systemic arterial vasodilatation, compensates for both a decreased preload and contractile dysfunction . Regular re - evaluation of cardiac status should be undertaken to minimize the risk of decompensation.
|
Gliomas are the most frequent primary tumors of the central nervous system (cns) and represent approximately 2% of all malignant diseases . Their annual incidence is about 11.5 new cases per 100.000 persons per year [1, 2]. The who classification of tumors of the central nervous system distinguishes the subtypes of glioma according to morphology and grade . High - grade gliomas (hgg, who - grade 3 and 4 glioma) are malignant tumors with a poor survival outcome . In a pivotal phase iii trial, where patients diagnosed with glioblastoma (gb, who - grade iv glioma) who were treated with postoperative radiation therapy (rt) and concomitant temozolomide (tmz) followed by six cycles of adjuvant tmz, the median survival was 14,6 months, while the overall survival (os) was 27.2% at 2 years, 16.0% at 3 years, 12.1% at 4 years, and 9.8% at 5 years . The prognosis of patients with who - grade iii glioma is superior to that of gb patients but much more heterogeneous and correlated with the histopathological and molecular - genetic subtype [5, 6]. Following initial resection and postoperative rt, anaplastic gliomas recur after a median of 2 - 3 years . Most often, recurrent grade iii glioma will have transformed into a more aggressive tumor at recurrence (a so - called secondary glioblastoma). The survival of patients with recurrent high - grade glioma following prior therapy with alkylating chemotherapy is grim and no treatment has demonstrated to improve the survival in a randomized clinical trial [6, 7]. Hgg are among the most angiogenic tumors and typically express high amounts of vascular endothelial growth factor (vegf). Vegf is a key molecular mediator of tumor - associated neoangiogenesis and its expression level has been correlated with tumor vascularisation, who - grade and prognosis [8, 9]. Hgg also express the vegf - receptors and frequently carry an amplicon of chromosome 4q12 comprising the vegf - receptor-2 (vegfr2), pdgfr - alfa, and ckit genes in 2330% of cases [1012]. Coexpression and/or amplification of both the vegf and vegfr2 constitute an autocrine / paracrine loop . Bevacizumab (bev; avastin, roche, basel, switzerland) is a humanized immunoglobulin g1 monoclonal antibody that binds to and inhibits vegf . It has proven to be active in combination with cytotoxic agents and is registered by the fda and ema as part of a combination treatment regimen with chemotherapy for metastatic colorectal cancer, non - small - cell lung cancer, and breast cancer, and in combination with interferon - alfa in metastatic renal cell carcinoma [8, 1319]. On may 5, 2009, the fda granted accelerated approval to bevacizumab as a single agent for the treatment of patients with recurrent glioblastoma . The approval was based on the results of two phase ii clinical trials (avf3708 g and nci 06-c-0064e). The largest phase ii trial, involving a total of 167 patients with recurrent gb, randomized patients between treatment with bev (at a biweekly dose of 10 mg / kg) in one arm and the combination of bev (at the same dose) and irinotecan in a second arm . In the bevacizumab - alone and the bevacizumab - plus - irinotecan groups, the objective response rates were 28.2% and 37.8%, and the estimated 6-month progression - free survival rates were 42.6% and 50.3%, respectively . The number of adverse events in the bev plus irinotecan population was higher (65.8% versus 46.4% grade 3 adverse events), while median overall survival times was comparable between the two arms (9.2 months and 8.7 months, resp ., compared to 7.5 months in a historical population). In a single - arm phase ii trial, investigating the sequential use of bev and the combination of bev and irinotecan, no activity was found for the combination after failure of bev as a single agent . Bev has also demonstrated antitumor activity as a single agent in patients with recurrent anaplastic glioma [22, 23]; in combination with a variety of cytotoxic agents [2426], and when administered on a once every 3-week schedule (at a dose of 15 mg / kg every 3 weeks). Mri - based tumor evaluation in patients treated for recurrent glioma have been characterized by a rapid regression of tumor - associated edema and restoration of the blood - brain / tumor barrier . Progression of disease by diffuse, non - gadolinium - enhancing infiltration of the brain (= gliomatosis) may occur in patients that respond to bev . Notwithstanding these atypical patterns of progression, updated overall survival of the patients treated in the brain (avf3708 g) study indicated that 16% of patients remained alive at 30 months of followup, a percentage that compares favorably with historical controls . Besides the effect of bev on glioma - associated vasculature, responses documented by positron emission tomography (pet) using fluorothymidine (flt), an imaging marker of cell proliferation, were correlated with an improved overall survival in patients treated with irinotecan and bev [30, 31]. On 19 november 2009, the chmp (ema) refused to change the terms of the marketing authorization for bevacizumab in the eu to include recurrent glioblastoma . From april to november 2009, the belgian riziv / inami provided partial (60%) reimbursement for bevacizumab following an individual request to the bijzonder solidariteitsfonds / fonds spcial de solidarit . This paper reports the first experience with bevacizumab for recurrent glioma in patients treated at two brussels university hospitals . This observational (noninterventional) study was performed with the clinical data that were retrospectively retrieved from the medical files of all patients with recurrent high - grade glioma who initiated bev treatment between 9 january 2009 and 27 january 2010 . These patients represent the first patients treated with bev for recurrent glioma at two belgian university hospitals, the uz brussel and ulb erasme . We collected data regarding the general clinical and neurological evolution during bev treatment, the bev treatment disposition (table 3), as well as laboratory tests performed during bev therapy . Adverse events were classified according to the common terminology criteria for adverse events v3.0 (ctcae)., we made the sums of the maximal cross - sectional radii of the contrast enhancing tumor measured by consecutive contrast mr . A complete response (cr) was defined as a disappearance of all contrast enhancing tumor, with the patient neurologically improved or stable and off corticosteroids . A partial response (pr) was defined as a 50% or more decrease in the size of the contrast - enhancing tumor with the patient neurologically improved or stable and with the corticosteroid dose stable or decreased . Progressive disease (pd) was defined as a 25% or more increase in the size of the contrast enhancing tumor or appearance of a separate tumor . Stable disease (sd) was defined for all other situations . In addition, we assessed the abnormalities on sequential t2 and flair mri sequences in a similar fashion, and changes on pet scan of the brain for the subgroup of patients evaluated by this imaging modality . Bev treatment disposition, bev - related adverse events, demographic and baseline patient, and disease characteristics were summarized using descriptive statistics . Kaplan - meier statistics were used to estimate the probability of survival (spss inc ., chicago, illinois 60606, usa). Nineteen patients (11 men and 8 women) with recurrent supratentorial hgg were identified to have received treatment with bev for progressive disease following failure after prior treatment including surgery, radiation therapy, and chemotherapy . The median patient age at the initiation of bev treatment was 40 years (range 28 to 70). Eighty - nine percent of the patients were younger than 50 years at the start of bev treatment . Eight (53%) patients had a pathological diagnosis of primary gb, 4 (21%) of secondary gb, and 5 (26%) of recurrent grade iii glioma . In six patients, initial treatment consisted of surgery followed by radiotherapy . In 13 patients, the initial treatment consisted of surgery, followed by rt with concomitant tmz and adjuvant tmz (median number of adjuvant tmz cycles: 6, range 1 to 12). Three patients had been treated with radiation therapy at recurrence (one patient was administered fractionated radiotherapy at a dose of 55,5 gy, two patients were treated using -knife radiosurgery). Twelve patients underwent additional modalities of salvage therapy for recurrent disease (chemotherapy, dendritic cell vaccination) before initiating bev therapy . Three patients initiated bev at a dose of 5 mg / kg every 2 weeks (in one of them, the dose was escalated to 10 mg / kg every 2 weeks after the first administration), 14 patients at a dose of 10 mg / kg every 2 weeks, and 2 patients at a dose of 15 mg / kg every 3 weeks, according to bev administration regimens published in the literature [20, 21, 24, 27, 3335]. A total number of 123 bev treatment cycles were analyzed in this study . A median number of 4 cycles were administered per individual patient (range 1 to 16). Three patients were simultaneously treated with a cytotoxic drug (hydroxyurea, tmz, or ccnu). Fourteen patients (74%) were treated with corticosteroids at the initiation of bev treatment . The dose of corticosteroids could be tapered in 4 patients and stopped in two of them . Nine bev - related adverse events were encountered, of which none were grade 4 or 5 (table 2). Two grade 3 adverse events (ulceration of skin striae and an abdominal pain syndrome) necessitated stopping bev administration in the absence of documented tumor progression . Four patients (21%) experienced a rapid increase in disease - related symptoms after the initiation of bev . Their clinical condition prohibited an objective tumor evaluation with mri after the initiation of bev . In all 4 patients, fifteen (79%) patients were assessable for tumor response on t1 gadolinium - enhanced mri - sequences (gd - t1). Tumor regression was complete in 2 patients and more than 50% in an additional 3 patients . This correlates to an objective response rate of 33% according to the macdonald criteria for the 15 evaluable pts on mri and 26% for the intent to treat population . All of these patients had stabilization or improvement of disease - related symptoms and none of them had an increase in corticosteroid dose . Seven patients (47%) obtained a stable disease, and 3 (20%) patients experienced immediate progression of disease during bev therapy (figures 1 and 2). Assessment of tumor response by t2/flair mri - sequences was available for the same 15 patients who were evaluable by t1-weighted mri . Complete disappearance of nonenhancing lesions was observed in 1 patient, and partial regression was observed in 6 additional patients (47%; for an objective tumor response according to the rano criteria of 37%). No change was observed in four patients (27%), and an increase of abnormalities at the first evaluation was observed in 4 patients (27%) (figures 1 and 3). Four patients were evaluated by 2-(18f)-fluoromethyl - l - phenylalanine pet (fmp - pet) or 11c - methionine - pet of the brain before and during bev treatment . A reduced uptake of amino - acid tracer on pet - scan was documented in 3 out of 4 pts during bev treatment, in 2 patients with the most favorable progression - free survival, and a complete normalization of pet - tracer uptake was observed during bev therapy (figure 4). As of october 2010 (the time of this analysis), two patients (10,5%) remained free - from progression after 1 year of bev treatment . In one of these patients bev was stopped after 1-year of therapy in the absence of metabolic activity on methionine - pet and normalization of gadolinium enhancement on t1-mri . The second patient developed progression of disease following 18 months of remission on bev therapy . The six - month progression - free survival rate (6mpfs%) was 21% (95% ci 2.739.5), and the 6mos% was 47.4% (95% ci 24.869.9). The median pfs and overall survival (os) were 10 weeks (95% ci 225) and 25 weeks (95% ci 1732), respectively (figure 5). High - grade gliomas are highly aggressive and therapy resistant malignant tumors . With contemporary standard treatment options for patients diagnosed with gb, the prognosis remains grim and most patients do not survive for more than 2 years following the diagnosis . Salvage therapies with cytotoxic agents are seldom successful (<10% orr) [7, 36]. Uncontrolled clinical studies with the vegf targeted igg1 monoclonal antibody bevacizumab have shown unprecedented tumor response rates and survival outcomes that compare favorably with historical control series . Within the context of these prospective clinical trials, bev - associated toxicities have been acceptable and reflect a typical spectrum of side effects that are associated with vegf(r) targeted therapies . As most of the prospective trials have used quite stringent patient recruitment criteria, safety and activity of bev when used outside of a clinical trial merit consideration . We, therefore, retrospectively analyzed the clinical outcome of nineteen patients treated with bev for recurrent hgg during the first year that bev became available in this indication at two university hospitals in belgium . As expected, the baseline characteristics of the patients included in our analysis compared unfavorably with those of the patients treated in the pivotal phase ii trial . A larger proportion of patients treated in our series were treated at second or third relapse, and the baseline kps was less or equal to 60% in a significant proportion of patients . We, therefore, consider that the results from our study, although preliminary, indicate that the safety profile of bev for recurrent hgg outside the context of a prospective clinical trial is comparable to what has been reported in the literature . Nevertheless, two patients needed to stop treatment because of bev - related side effects in the absence of documented progression . It, therefore, needs to be considered that frail patients might be at higher risk for bev - related adverse events . The objective tumor response, either analyzed by gadolinium - enhanced t1 mri and/or t2/flair imaging, was interestingly high in our patient population . Reflecting the poor baseline prognostic characteristics of our population, both time to progression (ttp) and overall survival (os), in contrast, were low when compared to published series . However, two patients in our series experienced a durable complete response and progression - free survival for over 1 year following bev therapy for recurrence, indicating the potential for a durable therapeutic effect in a subgroup of patients . Patterns of tumor response and progression during antiangiogenic therapy are a matter of controversy in the recent literature . In our small series, the tumor response pattern to bev was heterogeneous and could be divided in three distinct patterns . A first group of patients demonstrated no evidence of response (clinical or radiological) to bevacizumab therapy . Such was the case in four patients, who deteriorated rapidly and could not be evaluated by mri, and three (20%) of the fifteen assessable patients on gadolinium - enhanced t1 mri . A second group of patients initially responded to therapy on gadolinium - enhanced t1 mri, but subsequently showed early (<6 months) regrowth of the gadolinium - enhancing tumor mass (n = 7; 47%) or deteriorated clinically without characteristic increase in the diameter of gadolinium - enhancing t1 mri abnormities (n = 3, 20%). In these 3 patients, there was a marked progression of abnormalities on t2/flair mri, most likely representing vegfr - independent tumor cell infiltration of the brain . A small third group of patients (2 patients; 13%) experienced a very favorable and sustained tumor response to bev therapy, evident on both gd - t1 and t2/flair mri . Further useful differentiation of response to bev may be obtained by metabolic tumor imaging using pet . Pet - imaging has proven to be useful in assessing the response of recurrent glioma treated with a variety of modalities . Likewise, flt - pet has been correlated with clinical outcome of patients treated with the combination of irinotecan and bevacizumab . In our series, normalization in pet tracer accumulation was observed in the 2 cases with the most favorable evolution on mri and survival . These case observations indicate that single agent bev can be associated with a reduction of pet - tracer uptake by the tumor, suggestive of a metabolic effect . These observations merit further study of pet as a tool for response assessment in patients with recurrent glioma treated by bev . Pet response may be more predictive for survival as opposed to response assessment by mri . We conclude that our analysis of the first experience with bev for the treatment of patients with recurrent hgg is in line with the reported tolerability and activity of this new treatment from prospective clinical studies . Our observations support the usefulness of bev as a new treatment option for patients with recurrent hgg taken into account the absence of alternative treatment options with proven activity . Further observational study of the use of bev in this indication should be considered to optimize its use in daily practice . Correlative studies between clinical, radiological, pet parameters with molecular - genetic features of the hgg should be conducted to provide predictive markers for response and survival benefit from bev.
|
Successful treatment of root canal infections depends on destroying the causative organisms and preventing re - infection . Irrigating solutions and other intra - canal medicaments are necessary anti - microbial adjuncts to mechanical cleaning . Several studies have shown that vast areas of canal walls, especially in the apical third and in bar- and oval - shaped canals, cannot be efficiently cleaned via mechanical cleaning . Chemical disinfection is an important cornerstone to achieve a successful outcome; because it can eliminate the bacteria and fungi in dentinal tubules, porosities and branches of the root canal system [1, 2]. During the 1970s, antibiotics were widely used to sterilize the infected root canals; most antibiotic pastes contained an antifungal agent such as nystatin or sodium caprylate . At that time, there was a tendency towards antifungal therapies for the infected root canals but topical antibiotics lost their popularity after which, due to potential emergence of resistant microorganisms and host sensitivity, antifungal property of endodontic disinfectants was given less attention [3, 4]. Over time, various irrigants have been introduced for root canal disinfection . Although sodium hypochlorite solution is commonly used for root canal irrigation, it is toxic to the living tissues and its extrusion from the tooth apex can cause post - treatment pain, swelling and necrosis . Besides, it has a disagreeable smell and taste for patients and its vapor causes eye irritation . This solution, which is a bisbiguanide, has amphiphatic and antiseptic effects and is biocompatible . Tooth discoloration and some other side effects such as loss of sense of taste, irritation of oral mucosa, dry mouth and tongue discoloration limit its use as an irrigant . Mtad, which is a combination of tetracycline, citric acid and detergent, was an attempt to achieve a better cleaner, but in vitro studies showed that its efficiency in killing microbes was lower than that of sodium hypochlorite . Due to the increasing rate of antibiotic - resistant microorganisms and the complications caused by synthetic drugs, generally, herbal formulations are harmless and nontoxic and they have proven to have strong anti - bacterial effects . Anti - bacterial effects of zataria multiflora boiss, triphala, morinda citrifolia, satureja khuzistanica jamzad and green tea have been investigated [68]. Tea is the second most consumed beverage in the world; it is produced from the leaves and buds of camellia sinensis . Depending on the manufacturing process, teas are classified into three main categories: non - fermented green tea, semi - fermented oolong tea and fermented black and red tea . Green tea contains higher catechins (a type of polyphenol) than black and oolong tea . Catechins, especially epigallocatechin gallate (egcg), have shown strong antioxidant properties in vivo and in vitro . Recent human studies have demonstrated that green tea reduces the risk of cardiovascular diseases and some types of cancer, it improves oral health and physiological functions, it has anti - hypertensive effects, it controls body weight and protects from ultraviolet rays of the sun, it increases bone mineral density and has neuroprotective, anti - bacterial and anti - viral properties . Evaluated antibacterial effects of herbal detergents such as triphala, green tea with mtad and 5% sodium hypochlorite against e. faecalis biofilm in vitro and showed that 5% sodium hypochlorite had maximum antibacterial efficacy; triphala, green tea and mtad also showed significant antibacterial activity . The researchers expressed that the use of herbal solutions as root canal irrigants may be more useful due to certain undesirable properties of sodium hypochlorite . Hirasawa and takada evaluated the antifungal activity of green tea (catechin) against different strains of c. albicans in various ph conditions using the broth dilution method and concluded that the antifungal activity of egcg was weakened in acidic conditions . The mic90 of egcg increased by more than 10 folds as the ph decreased from 7.0 to 6.5 . They also showed synergic antifungal activity of the combination of egcg and amphotericin b or fluconazole against antimycotic - susceptible and resistant c. albicans . Antifungal activity of catechin was correlated with ph, and egcg in a ph of 6 with a concentration of 2000 mg / l, in a ph of 6.5 with a concentration of 5001000 mg / l and in a ph of 7 with a concentration of 15.6250 mg / l inhibited the growth of 90% of the c. albicans colonies . Studied different types of green tea against 24 bacterial strains in vitro and concluded that they were effective on most of them, including obligate anaerobes . The researchers attributed this function to the high content of polyphenols, mainly catechins . Due to easy availability, cost - effectiveness, long shelf life, low toxicity and the lack of microbial resistance, we sought to examine antifungal effects of green tea as an irrigant against biofilms formed by c. albicans on extracted teeth . Polyphenol oxidase (ppo) activity of tea leaves was destroyed by dipping them in boiling water for three minutes . After rinsing and drying, all reagents and chemicals with analytical grade were purchased from merck (darmstadt, germany) and sigma - aldrich (gillingham, dorset, uk) companies . Tea extract was prepared as follows: ten grams of dry sample were extracted three times using 150 ml of hot distilled water (80c). After cooling to room temperature and filtration, the extract was exposed to the same volume of chloroform to remove caffeine and pigments . Candida albicans strain (ptcc 5027) was obtained from the collection center of industrial fungi and bacteria of iran . A 0.5 mcfarland solution was prepared from the mentioned organism and cultured on sabouraud dextrose agar using the streak method . To determine the minimum inhibitory concentration (mic), eight test tubes were prepared and 2 ml of green tea extract was poured in tube one, and 1 cc of sabouraud dextrose broth was poured into tubes two through eight . Then, 1 cc of the first tube contents was transferred to the second tube and after shaking thoroughly, 1 cc of the solution was transferred to the third tube . We continued this to tube eight and then discarded 1 cc of the last tube . Thus, tube one contained undiluted extract (100%), tube two contained the extract diluted to 50% (1/2), tube three contained the extract diluted to 25% (1/4) and tubes four to eight contained extracts diluted to 1/8, 1/16, 1/32, 1/64 and 1/128, respectively; 0.1 ml of candida suspension (turbidity equivalent to 0.5 mcfarland) was added to all test tubes . After 24 hours of incubation at 37c, loop - full samples from transparent tubes were subcultured in order to count candida colonies and calculate mic and mfc90 of sodium hypochlorite and green tea extract . Forty - five extracted single - rooted mandibular premolar teeth with fully formed apices were selected . To confirm that they had one root canal, radiographs were obtained from mesiodistal and buccolingual dimensions . Debris, plaque and tissue residues were removed and the teeth were stored in saline . To standardize the samples, all teeth were cut by a diamond disc under the cementoenamel junction to obtain 8-mm long samples . Apical area was prepared to size f3 . At all stages of canal cleaning and shaping, samples were randomly divided into three 30-member groups (a, b, c) and placed in test tubes and autoclave - sterilized . We added 3 ml of the culture medium (sabouraud dextrose broth) to the tubes containing the samples and inoculated them with 0.5 ml of candida suspension (turbidity equivalent to 0.5 mcfarland) and then incubated them at 37c for 96 hours . To prevent the accumulation of toxic materials and nutrient shortage, after 96 hours, the liquid culture medium was removed and we added 3 ml of green tea extract to each tube in group a; 3 ml of sodium hypochlorite was added to each tube in group b and 3 ml of saline was added to each tube in group c. after five, 10 and 15 minutes, the tubes' contents were evacuated and the samples were washed with 5 ml of distilled water . For qualitative analysis, a sterile swab was rubbed on each tooth surface and cultured on the sabouraud dextrose agar plates . Inoculated plates were incubated at 37 c for 48 hours for growth investigation . For quantitative analysis, 2 ml of sterile saline was added to the remaining tubes, and after severe vortexing (about one minute), the resulting solution was pour - plated in sabouraud dextrose agar plates and after 48 hours of incubation at 37c, the number of colonies was counted as colony forming units per milliliter (cfu / ml). Polyphenol oxidase (ppo) activity of tea leaves was destroyed by dipping them in boiling water for three minutes . After rinsing and drying, all reagents and chemicals with analytical grade were purchased from merck (darmstadt, germany) and sigma - aldrich (gillingham, dorset, uk) companies . Tea extract was prepared as follows: ten grams of dry sample were extracted three times using 150 ml of hot distilled water (80c). After cooling to room temperature and filtration, the extract was exposed to the same volume of chloroform to remove caffeine and pigments . Candida albicans strain (ptcc 5027) was obtained from the collection center of industrial fungi and bacteria of iran . A 0.5 mcfarland solution was prepared from the mentioned organism and cultured on sabouraud dextrose agar using the streak method . To determine the minimum inhibitory concentration (mic), eight test tubes were prepared and 2 ml of green tea extract was poured in tube one, and 1 cc of sabouraud dextrose broth was poured into tubes two through eight . Then, 1 cc of the first tube contents was transferred to the second tube and after shaking thoroughly, 1 cc of the solution was transferred to the third tube . We continued this to tube eight and then discarded 1 cc of the last tube . Thus, tube one contained undiluted extract (100%), tube two contained the extract diluted to 50% (1/2), tube three contained the extract diluted to 25% (1/4) and tubes four to eight contained extracts diluted to 1/8, 1/16, 1/32, 1/64 and 1/128, respectively; 0.1 ml of candida suspension (turbidity equivalent to 0.5 mcfarland) was added to all test tubes . After 24 hours of incubation at 37c, loop - full samples from transparent tubes were subcultured in order to count candida colonies and calculate mic and mfc90 of sodium hypochlorite and green tea extract . Forty - five extracted single - rooted mandibular premolar teeth with fully formed apices were selected . To confirm that they had one root canal debris, plaque and tissue residues were removed and the teeth were stored in saline . To standardize the samples, all teeth were cut by a diamond disc under the cementoenamel junction to obtain 8-mm long samples . Apical area was prepared to size f3 . At all stages of canal cleaning and shaping, samples were randomly divided into three 30-member groups (a, b, c) and placed in test tubes and autoclave - sterilized . We added 3 ml of the culture medium (sabouraud dextrose broth) to the tubes containing the samples and inoculated them with 0.5 ml of candida suspension (turbidity equivalent to 0.5 mcfarland) and then incubated them at 37c for 96 hours . To prevent the accumulation of toxic materials and nutrient shortage, after 96 hours, the liquid culture medium was removed and we added 3 ml of green tea extract to each tube in group a; 3 ml of sodium hypochlorite was added to each tube in group b and 3 ml of saline was added to each tube in group c. after five, 10 and 15 minutes, the tubes' contents were evacuated and the samples were washed with 5 ml of distilled water . For qualitative analysis, a sterile swab was rubbed on each tooth surface and cultured on the sabouraud dextrose agar plates . Inoculated plates were incubated at 37 c for 48 hours for growth investigation . For quantitative analysis, 2 ml of sterile saline was added to the remaining tubes, and after severe vortexing (about one minute), the resulting solution was pour - plated in sabouraud dextrose agar plates and after 48 hours of incubation at 37c, the number of colonies was counted as colony forming units per milliliter (cfu / ml). Mic90 of green tea extract was 0.625 mg / ml after 24 hours and its mfc was 1.25 mg / ml after 24 hours . Mic90 and mfc of tested solutions against c. albicans the statistical results showed that the effects of material and time and the interaction effect of material and time were all significant (all ps<0.01, table 2). Analysis of the effect of material on the number of colonies (table 3) indicated that the average number of colonies after five, 10 and 15 minutes of contact with green tea extract decreased dramatically (p<0.01). In the sodium hypochlorite group, reduction in the average number of colonies during five, 10 and 15 minutes was significant (p<0.01). In other words, within 15 minutes of exposure to c. albicans, green tea reduced the average number of colonies to one - third of the initial value . However, in the sodium hypochlorite group, this reduction was half the initial value . Comparison of the mean number of colonies in nine groups using duncan s post - hoc test showed that the lowest number of colonies was grown in sodium hypochlorite and then in green tea extract group after 15 minutes of exposure (p<0.01); the difference between these experimental groups was not statistically significant (p>0.05). The highest number of colonies was grown in saline at five, 10 and 15 minutes of exposure . There was no significant difference over time in these groups (p>0.05, table 4). In terms of antifungal activity and reduction in number of colonies, sodium hypochlorite after 10 minutes of exposure (mean=100) ranked second and sodium hypochlorite after five minutes of exposure (mean=150) and green tea extract after 10 minutes of exposure (mean=150) ranked third . Green tea extract after five minutes of exposure (mean=230) only had a superior antifungal activity to saline . Two way anova for different groups the mean number of colonies in cfu / ml (mean sd) in different groups p value *: one - way anova to compare microorganisms at the three different time points p value * *: one - way anova to compare microorganisms among the three different groups duncan test for comparison of the mean number of colonies in the nine groups this in vitro study evaluated the antifungal efficacy of green tea as a root canal irrigant against c. albicans biofilm formed on tooth substrates . Based on preliminary results, mic of green tea was 0.625 mg / ml and we accordingly used 1% green tea as an irrigant . In our study, antifungal activity of green tea was found to be time - dependent and its inhibitory action increased over time . Within 15 minutes of exposure of c. albicans to green tea, the average number of colonies reduced to one - third of the initial mean value, while this reduction in sodium hypochlorite was one - half . Anti - bacterial and anti - viral activities of catechins against different viral and bacterial pathogens have been previously demonstrated . Parbhakar et al, and horiba et al . Proved satisfactory anti - bacterial effects of green tea . Reported that 2.5% black tea extract completely inhibited trichophyton mentagrophytes and trichophyton rubrum, but its 10% extract had no effects on c. albicans . The important point in the methodology of the aforementioned studies is direct contact of microorganisms with different concentrations of the disinfectant at various ph values (in the culture medium not the teeth). In our study, c. albicans was grown in the form of biofilm, which is an imitation of intraoral conditions . On the other hand, given the loss of antimicrobial activity of irrigants such as chlorhexidine, sodium hypochlorite and potassium iodide / iodine in the presence of dentin, the antifungal efficacy of this substance on tooth substrate examined the inhibitory role of dentin against this natural irrigant . It has been proven that the ability to make biofilm and organize the biofilm structure is affected by the chemical nature of the substrate . An experimental work performed on polycarbonate or glass substrates would not be real proof of the microorganism - substrate interactions . Therefore, in our study, biofilm was formed on tooth substrate . In conditions where microorganisms can grow as biofilm, changes in genetic and metabolic processes prevent penetration and performance of antimicrobial agents in the biofilm matrix . Cells in biofilm gain antibiotic resistance up to 1500 times the rate in planktonic cells . As a result, examination of the efficacy of an antimicrobial irrigant on planktonic cells will not reflect its efficacy under in vivo conditions . We also studied antifungal activity of different irrigants on the biofilm media in order to simulate intraoral conditions . The results of studies on antibacterial activity of catechins against phytopathogenic bacteria were consistent with studies on c. albicans . Investigated the mechanism of bactericidal efficacy of catechins and suggested that catechins operate mainly by damaging the bacterial membrane . Antibacterial activity of catechins is mainly related to gallic acid and hydroxyl groups . By inducing rapid leakage of small molecules toyoshima et al, also evaluated the mechanism of action of green tea catechin exposed to t. mentagrophytes using an electron microscope and suggested that catechin causes lysis of hyphae and conidia by attacking the cell membrane . Sodium hypochlorite, which is a strong irrigant, has a broad - spectrum antimicrobial activity and destroys proteins and amino acids by releasing free chlorine . Since c. albicans has been isolated from primary endodontic infections, especially in cases of treatment failure from infected root canals, it is of particular importance to disinfect the infected canals from this microorganism . Therefore, our study used c. albicans to test the antifungal effectiveness of irrigating solutions . Candida albicans is a pleomorphic microorganism that can grow in different forms such as germ tubes, yeasts, pseudo- and true - hyphae and chlamydospores depending on the environmental conditions . Showed that c. albicans can grow in various forms in the root canal walls and penetrate into dentinal tubules . The idea of potential healing effects of herbs has long been considered, but recently it has regained importance and attention . It has been proven that green tea polyphenols are safe and composed of active elements that have physiological effects in addition to anti - oxidant and anti - inflammatory effects [7, 9] and they may have additional beneficial effects compared to common root canal irrigants . Easy access, cost - effectiveness, long shelf life, low toxicity and lack of antimicrobial resistance are the main benefits of natural alternatives, which have been reported to date . The use of green tea as an endodontic irrigant can be helpful, since it is a biocompatible antioxidant and lacks the serious risks associated with the use of sodium hypochlorite . Preclinical and clinical trials are recommended for evaluating its safety and biocompatibility before its use as an intracanal irrigating solution in the clinical setting.
|
The overall annual incidence of intussusception in adults in the general population has been reported to be as low as 2 cases/1 000 000 persons; adults account for ~5% of confirmed intussusceptions . As high as 90% of cases of adult intussusception are due to a pathological process, with neoplasms accounting for ~60% of identifiable leadpoints . One 6-year prospective study encompassing screening of 380 999 computed tomography (ct) scan reports that were read as intussusception, 0.04% of cases were in adults . In adults, surgery is typically performed owing to the likelihood that a neoplastic or otherwise chronic pathology is the cause of the intussusception . Indications to take any case to the operating room include large caliber of telescoped bowel, long length of telescoped portion, identifiable lead point and evidence of obstruction [24]. The former indications owe to the increased likelihood of malignancy requiring surgical exploration and incision, and bowel wall and mesenteric ischemia in the setting of large intussusceptions . A 61-year - old gentleman presented with a 3-day history of right - greater - than - left lower quadrant abdominal pain, distention, anorexia and one episode of emesis . The patient also reported only consuming liquids for 57 days prior to presentation as solid foods caused significant discomfort . Three weeks prior, colonoscopic evaluation of his cramping was aborted at 20 cm due to an impassable sigmoid stricture . Several hyperplastic polyps and one tubular adenoma his abdomen was distended and tympanic, with tenderness and fullness appreciated in the right lower quadrant . 1) demonstrated small bowel obstruction due to an ileocolic intussusception, from the ileocecal valve to the splenic flexure, and collapsed distal colon . Figure 1:top left: origin (arrow) of invagination in the right lower quadrant . The telescoped bowel contained terminal ileum, cecum, appendix and the entire ascending colon (fig . A 4.5 cm 5 cm mass was identified at the lead point, the ileocecal valve . Resection included the right hemi - colon, cecum, appendix and 15 cm of terminal ileum . A diverting ileostomy was created as well as a mucus fistula for post - operative antegrade colonoscopic evaluation of the remaining colon . Figure 2:left: stills from intraoperative video recording demonstrating the reduction of the intussusception in order to explore the lead point . Right: ischemic terminal ileum (arrow) and palpation of the lead point at the ileocecal valve . Left: stills from intraoperative video recording demonstrating the reduction of the intussusception in order to explore the lead point . Right: ischemic terminal ileum (arrow) and palpation of the lead point at the ileocecal valve . Additional tubulovillous adenomas, tubular adenomas and hyperplastic polyps were identified throughout the excised portion of bowel . Figure 3:low - power (left) and high - power (right) views of lead point tumor demonstrates> 50% of the tumor composed of pools of mucin (solid arrow), invasive tumor cells (dotted arrow) with hyperchromatic chromatin, crowded nuclei, surrounded by pools of mucin [57]. Low - power (left) and high - power (right) views of lead point tumor demonstrates> 50% of the tumor composed of pools of mucin (solid arrow), invasive tumor cells (dotted arrow) with hyperchromatic chromatin, crowded nuclei, surrounded by pools of mucin [57]. This patient's presentation is exceptionally unique for both the size and cause of intussusception . To our knowledge, the few cases we found were always in the setting of malignancy, the patients presented with a similar chronologic progression with escalation of symptoms including liquid - only diets shortly before presentation . Additionally, the very large intussusceptions were always found in the setting of malignancy [1012]. It seems that a favorable (mobile) anatomy with an indolent process is a common thread amongst these rare cases . Further compounding the uniqueness of this case is the lead point tumor's location and histology, along with the presence of additional terminal ileum and colonic polyps . The annual incidence in the united states of small bowel adenocarcinoma from 1973 - -2005 is 6.8 cases per 1,000,000 person years, as calculated by surveillance epidemiology and results (seer) program . Additionally, ileocecal adenocarcinoma of any type is sparsely described outside of a few case reports [8, 9, 1315]. Mucinous adenocarcinoma tends to be a locally aggressive tumor, and metastasizes by redistribution phenomenon rather than vascular or lymphatic invasion . Presently, we have no unifying diagnosis to correlate the multiple lesions found throughout the telescoped bowel and distal 20 cm of colon and rectum . However, it is currently estimated that up to 40% of patients with extensive polyps and a positive family history are ruled out for hnpcc by genetic testing for mismatch repair and msi, as was the case for this patient . Nevertheless, the unique presentation of this patient allowed for expeditious removal of a classically aggressive tumor, in what appears to be the first reported case of a long - tract intussusception secondary to a mucinous adenocarcinoma of the ileocecal valve.
|
Obsessive compulsive disorder (ocd) is the fourth most common psychiatric illness, with a lifetime prevalence of 1%3%.1 the world health organization rates ocd as one of the top 20 most disabling diseases.2 if untreated, the course is usually chronic, or waxing and waning . Only approximately one - third of ocd patients receive appropriate pharmacotherapy, and fewer than 10% receive evidence - based psychotherapy.1 as ocd patients often acknowledge the senseless nature of their intrusive, recurrent thoughts and also the repetitive, unwanted behaviors, it may lead to shame, and reluctance to seek help.2 people with this disorder have long delays in accessing effective treatments; 17 years on average in one study.2 there is growing evidence that stigmatization and negative attitudes toward mental disorders are important factors that prevent these patients from seeking appropriate medical help.37 aversion to psychiatric treatment and ambivalence about mental health services because of the fear of labeling and stigma have been found throughout the world.8 in addition, medical professional attitudes might impact the quality of treatment as well as the outcome . Various studies on doctors attitudes toward psychiatric patients, including psychiatrists attitudes, brought out some discordant findings.9 gateshill et al reported that the majority of mental health and nonmetal health professions felt sympathy for those with mental disorders, wanting to help them, and favoring their treatment in the community.4 however, some studies suggested that psychiatrists tended to have more positive attitudes toward mentally ill patients than nonmetal health professionals did.4,10,11 arvaniti et al found that familiarity with mental illness was associated with less negative attitudes, such as less social discrimination and less social restriction, in which case psychiatric staff had more positive attitudes than other staff.10 addison and thorpe studied the factors involved in the formation of attitudes toward mentally ill patients and found that people who had personal experience with mental illness sufferers were generally more positive in their attitudes than those who had no previous experience.11 in contrast, some studies revealed that psychiatrists had negative attitudes toward psychiatric patients, which resembles the attitude of other doctors and general public.1214 while there have been a variety of studies on the attitudes toward general psychiatric patients, and some studies on schizophrenia or major depression,12,13 rarely have the attitudes toward ocd been focused on . We found only one study by simonds and thorpe in 2003 about the attitudes toward the different subtypes of ocd symptoms, for which undergraduate students were used as subjects.15 vignettes of different subtypes of ocd symptoms were used, and it was found that the vignette describing a person with doubting, violent, and blasphemous obsessions and related compulsions received the more negative social evaluations when compared with the vignette describing a person with cleansing rituals and checking compulsions.15 to our knowledge, no studies focusing on the attitudes of psychiatrists toward ocd patients have been published before . Therefore, our research aimed to specifically study psychiatrists attitudes toward ocd patients . This study was approved by the ethics committee of the faculty of medicine, ramathibodi hospital, bangkok . Exclusion criteria were mainly directed to those psychiatrists who had close friends or relatives diagnosed with ocd, or had themselves been diagnosed with ocd before . The questionnaire was developed from a focus group interview of ten psychiatrists which centered on their attitudes and feelings toward ocd patients, and the different emotions or perceptions when compared with those prevalent when facing other psychiatric disorder sufferers . The data were then transformed into a self - reported questionnaire, which consisted of three parts . The first part is about the socio - demographic information of the psychiatrists, such as sex, age, duration of practice as a psychiatrist, workplace, and the estimated number of outpatients they have seen in one period (approximately 3 hours). The second part centers on their experience with ocd patients including the estimated number of ocd patients they used to have experience in treatment, the estimated time spent with ocd patients at their first visit and in follow - up sessions, their preferred mode of treatment for ocd, their experience and proficiency in exposure and response prevention (erp), and finally their confidence in treating ocd patients with various approach . The third part concerns their attitudes toward ocd patients, reflected in 16 items to reply to, according to the four - point likert scales ranging from strongly agree to strongly disagree . More specifically, there are seven items about the attitudes and feelings toward ocd patients, three items about their perceptions toward ocd patients compliance, and six items regarding the emotions and perceptions toward ocd patients comparing with patients with other psychiatric disorders . A statistical analysis was performed using the spss version 18 for windows xp (spss inc . Psychiatrists characteristics and experience with ocd patients were reported by frequency; all attitude items were reported in percentage . Pearson s chi - squared () test and fisher s exact test (fet) were used to analyze the association between psychiatrists characteristics and their attitudes toward ocd patients . Twelve psychiatrists were excluded due to having relatives diagnosed with ocd; as a result, 91 psychiatrists remained in the study . Most of the participating psychiatrists were female (63.7%), and approximately 80% were under the age of 45 . Almost half of them (44%) have been practicing as a psychiatrist for less than 5 years . They have been working in 32 different hospitals all over thailand, which included 15 psychiatrists from northern area, 9 psychiatrists from southern area, 5 psychiatrists from northeastern area, 4 psychiatrists from western area, and 48 psychiatrists from middle area of thailand . The remaining 10 psychiatrists reported only the type of hospitals they have been working for, but did not specify their hospital name . Regarding the types of hospital, the largest group of participants (41.8%) has been practicing in 19 different general / provincial hospitals, followed by 29.7% in seven different medical university hospitals, 25.3% in four different mental hospitals, and 3.3% from private hospital or others . Almost half of them (47.3%) estimated the number of outpatients they treated per period (3 hours) to be more than 30 (table 1). Approximately 40% of the participating psychiatrists had experience in treatment for fewer than 10% ocd patients . About half of them spent approximately 1530 minutes for the first visit with ocd patients, and less than 15 minutes for follow - up sessions . Approximately 70% of the psychiatrists chose medications combined with behavioral therapy as the most preferred mode of treatment . Only 7.7% of them reported that they were proficient in erp, whereas almost 70% of the participants reported using erp for their patients but were not proficient in it . Most of the psychiatrists (76.9%) had confidence in treating ocd patients, but the number of psychiatrists who had confidence in treating with medications (91.1%) was much higher than those expressing confidence in behavioral therapy (51.7%) and other psychotherapy (39.6%) (table 1). More than 80% of the participating psychiatrists agreed with the benevolent attitudes toward ocd patients such as pity, understanding, and empathy, but only 18.7% stated that these patients were admirable . In term of negative attitudes, 33% of psychiatrists felt tired when treating ocd patients, and 14.3% felt these patients were annoying . The number of psychiatrists who perceived that ocd patients had poor compliance with behavioral therapy (52.8%) and other psychotherapy (30%) was higher than those reporting poor compliance with medications (7.7%). When compared with other psychiatric disorders, approximately 30% of psychiatrists thought that ocd patients talk too much, ask too much, need more time and patience, and 14% reported that they do not really want to treat ocd patients . Only 7.7% stated that building therapeutic relationship with these patients was more difficult than in the case of other psychiatric disorder sufferers (table 2). Degree of association between all characteristics and attitudes and level of statistically significant difference are shown in tables s1s3 . Some psychiatrists characteristics are significantly associ - ated with the attitudes toward ocd patients, such as the duration of practice as a psychiatrist, which is associated with the feeling of annoyance (=16.657, df=6, p=0.011) and the perception that ocd patients have poor compliance with medications (=15.568, df=6, p=0.016). The group of psychiatrists who have practiced for 610 years felt annoyed and perceived that ocd patients had poor compli - ance, in the highest number . The workplace also associated with the feeling of annoyance (=12.764, df=6, p=0.047). Psychiatrists in general / provincial hospitals felt that ocd patients were annoying in the highest numbers, followed by psychiatrists in mental hospitals, while psychiatrists in medi - cal university hospitals clearly least agreed with this attitude . The estimated number of outpatients psychiatrists treated in one period (approximately 3 hours) is related to feeling of admiration (=17.401, df=9, p=0.043); the group that has less than ten patients most agreed that ocd patients were admirable . The estimated number of outpatients was also evidently associated with the perception that ocd patients have poor compliance with behavioral therapy (=24.596, df=9, p=0.003), and the notion that ocd patients need more time when compared with other psychiatric disorder sufferers (=24.788, df=9, p=0.003). Regarding psychiatrists experience with ocd patients, the estimated number of ocd patients they had treated is associated with the perception that ocd patients have poor compliance with behavioral therapy (=19.009, df=9, p=0.025). The group who has 1120 patients least agreed with this attitude . The estimated time psychiatrists spent dur - ing the first visit with ocd patients the group who spent less than 15 minutes with patients least agreed that these patients were pitiful, whereas psychiatrists who spent more than 45 minutes with them most agreed with this attitude . This characteristic is also related to the perception that ocd patients have poor compliance with behavioral therapy (=19.531, df=9, p=0.021). All of the psychiatrists who spent less than 15 minutes with patients agreed with this attitude, while only 33.3% of those who spent more than 45 minutes agreed . The estimated time psychiatrists spent during the follow - up session with ocd patients is related to the perception that building a therapeutic relationship with ocd patients is more effortful than other psychiatric disorder sufferers (=9.524, df=4, p=0.049). Psychiatrists experience and proficiency in erp is associated with feelings of admiration (=18.279, df=9, p=0.032) and pity (=34.144, df=9, p=0.001); 57.2% of psychiatrists who were proficient in erp felt that ocd patients were admirable, while none of those who had never known erp held this attitude . Likewise, all of erp - proficient psychiatrists felt that these patients were pitiful, but only 50% of the group who had never known erp felt in the same way . The proficiency in erp also related to feeling of tiredness (=17.591, df=9, p=0.04). Only 14.3% of erp - proficient psychiatrists felt tired toward ocd patients, whereas 75% of those who had never known erp felt tired . The other significant associations of this characteristic were the perception that ocd patients have poor compliance with medications (=12.874, df=6, p=0.045). Erp - proficient psychiatrists most agreed with this attitude, while none of those who had never known about erp agreed with it . This characteristic is also related to the perception that ocd patients need more time when compared with other psychiatric disorder sufferers (=20.758, df=9, p=0.014). The psychiatrists who never practiced or had a lack of proficiency in erp most agreed with this attitude, but none of erp - proficient psychiatrists agreed with this attitude . Psychiatrists confidence in treating ocd patients is significantly associated with several items of specific attitudes . The number of confident psychiatrists (22.9%) felt tired toward ocd patients, which is much less than the psychiatrists without adequate confidence (66.7%) (=16.41, df=3, p=0.001). A lower number of confident psychiatrists (12.9%) felt annoyed toward these patients than was the case for those who lacked confidence (19%) as well (p=0.015, fet). Most confident psychiatrists (72.9%) perceived that ocd patients were difficult to treat, while all of the psychiatrists who lacked confidence, held this attitude (=8.129, df=3, p=0.043). In a similar way, only 8.5% of confident psychiatrists agreed with the statement that i do nt want to treat ocd patients, when compared with other psychiatric disorder patients, whereas 33.3% of those psychiatrists who lacked confidence agreed (=13.698, df=3, p=0.003). Finally, only 4.3% of confident psychiatrists perceived that building therapeutic relationship with ocd patients is more difficult than with other psychiatric disorder patients (p=0.012, fet) compared with 19% of the psychiatrists who lacked confidence . Considering each treatment approach, the confidence in treating ocd with behavioral therapy is associated with several attitudes in a similar way with psychiatrists overall confidence, whereas the confidence in treating ocd with medications is significantly associated only with feelings of pity (=10.541, df=3, p=0.032) and tiredness (=8.384, df=3, p=0.039). Other attitudes that have significant associations with confidence in treating ocd with behavioral therapy were the perception that ocd patients have poor compliance with other psychotherapy (=18.692, df=3, p=0.00) and the notion that ocd patients need more patience than other psychiatric disorder sufferers (=10.369, df=3, p=0.016). The psychiatrists sex, age, and their preferred treatment approach for ocd had no significant association with the attitudes toward ocd patients . It was found that more than 80% of the participating psychiatrists had positive feelings toward ocd patients, such as pity, understanding, and empathy . These results correlated with previous studies which found that psychiatrists tend to have a positive attitude toward mentally ill patients.4,10,11 some of the psychiatrists in our focus group mentioned that ocd patients were admirable because they had been very patient and worked hard to alleviate their symptoms . However, the results found that only 18% of the participants agreed with this attitude . Therefore, the admiration may be a personal point of view, and not the common psychiatrists attitude toward ocd patients . One of the more noteworthy findings was that about one - third of the psychiatrists perceived that ocd patients talked and asked too much, needed more time and patience compared with other psychiatric disorder sufferers, and they felt tired while treating these patients . Although not the majority of participating psychiatrists held these negative attitudes, there was still a significant number of negative attitudes, which might have a negative impact on their interaction with ocd patients including treatment process . Moreover, almost 80% of the psychiatrists thought that ocd patients were difficult to treat . It might resulted from the nature of ocd which has a chronic, waxing, and waning course and rarely shows complete recovery for its patients . Regarding attitudes toward patients compliance to treatment, more than half of the psychiatrists perceived that ocd patients have poor compliance with behavioral therapy . As we found in our study, despite no statistically significant difference, 58.6% of psychiatrists who lack proficiency in erp reported compliance problem with behavioral therapy, compared with 28.6% of erp - proficient psychiatrists . The reason maybe because of the psychiatrists who lack proficiency in this kind of therapeutic method might not be able to adequately support the patients to cope with their difficulties, which in turn may lead to this attitude . On the contrary, only 7.7% of psychiatrists reported about the compliance problem with medications . There was no assessment of how they evaluate the patients compliance; as a result, it might not be possible to conclude that this attitude reflects the truth about ocd patients compliance . It was found that some of psychiatrists characteristics were significantly associated with particular attitudes, such as the workplace . Those psychiatrists in general / provincial hospitals, together with psychiatrists in mental hospitals, felt that ocd patients were more annoying than the perception of psychiatrists in medical university hospitals . This finding might result from the matter of workload, which was greater in general, provincial, and mental hospitals than in medical university hospitals . The estimated number of outpatients psychiatrists treated in one period (approximately 3 hours) reflected in a similar way . The psychiatrists who have the fewest patients felt most admired, whereas the group who has greatest number of outpatients most agreed with the perception that (a) ocd patients have poor compliance with behavioral therapy, and (b) these patients need more time when compared with other psychiatric disorder sufferers . These findings might reflect that the psychiatrist s burden of workload results in their negative attitudes . It correlates with previous study which found that high workload of health care organization lead to patient neglect.16 regarding the psychiatrists experience with ocd patients, there were several significant associations with the attitudes . The estimated time psychiatrists spent during the first visit with ocd patients was associated with feeling of pity and the perception about compliance problem with behavioral therapy . The psychiatrists who spent longest time felt that these patients were pitiful and disagreed with the compliance problem more than those who spent less time . It can be hypothesized that the psychiatrists who spend more time with the patients might be able to deeply understand them that results in the positive attitude . Furthermore, they might create better therapeutic relationship and/or provide the patients behavioral therapy including psycho - education about etiology, course and treatment options for ocd, which leads to better compliance . However, we still need further investigation to prove whether psychiatrists who spend more time with ocd patients, especially on the first visit, will lead patients more easily to comply with behavioral therapy, and bring about better treatment outcomes.1719 psychiatrists experience and proficiency with erp had significant associations with several items of attitudes . The psychiatrists who were proficient in erp most agreed that ocd patients were admirable and pitiful . They also felt less tired and less agreed that these patients need more time than other psychiatric disorder sufferers than those who never practiced erp or lack proficiency in this therapeutic intervention . These findings can be hypothesized that psychiatrist s proficiency in erp might lead to their positive attitudes toward ocd patients, which need to be further proved . The confidence of psychiatrists in treating ocd with various methods was significantly associated with several kinds of attitudes . All of the associations manifested in agreement, psychiatrists who have confidence held more positive attitudes toward ocd patients than those who lack confidence . Specifically, the confidence in treating ocd with behavioral therapy has shown more association with attitudes than other type of treatment approaches . The more they are confident in behavioral therapy, the more positive attitudes they have . So it can be suggested that more training in behavioral therapy for ocd may be needed to help psychiatrists to be more confident, which might improve not only the attitudes toward these patients but also the treatment outcomes . It was found that sex and age had no significant association with the attitudes toward ocd patients . This finding was correlated to a study by addison and thorpe,11 which found no difference about attitudes toward mentally ill patients between males and females . However, our finding differs from a study by arvaniti et al10 which reported that women and the older people had held negative attitudes toward mental illness, such as social discrimination . Firstly, the sample was not a true representation of all thai psychiatrists because there was no randomization in the sample selection, so we had more female and younger psychiatrists who participated . However, it was found that psychiatrists sex and age had no association with their attitudes toward ocd patients . Moreover, the distribution of their workplace was fairly consistent between the different types of hospitals, which is an important characteristic that might influence psychiatrists attitudes . Secondly, the questionnaire used to assess attitudes toward ocd patients has never been standardized and has not been previously studied in pilot study . However, we developed new questionnaire from the focus group interview, which provided deeper and more specific questions about attitudes toward ocd patients rather than those questions toward general mental illness as in some standardized questionnaires . Before distributing the questionnaire, thirdly, this study used questionnaire as a measure, so the results were subjective feelings of the psychiatrists, which might be different from the real situation . However, it still reflected the psychiatrists attitudes which usually have the impact on their patients . Finally, there were limited studies in the past we can compare to because most of them focus on attitudes toward general mental illness, not specific to ocd, and also used different methodologies and questionnaires . Even though the participating psychiatrists clearly held positive attitudes toward ocd patients more than negative attitudes, most of them reported that ocd patients were difficult to treat . The psychiatrists who have fewer workload and who spent more time with ocd patients during the first visit seemed to hold more positive attitudes . Although three - fourth of the psychiatrists reported confidence in treating ocd patients, their confidence in treating with medications was higher than in the case of behavioral therapy and other psychotherapy . Their confidence in treatment especially their proficiency in erp is significantly associated with more positive attitudes . Thus, it might be beneficial to improve the psychiatrists competence in treating ocd with behavioral therapy, which may lead to better attitudes toward patients and treatment outcomes . To our knowledge, this is the first study about psychiatrists attitudes toward ocd patients; further studies are needed to affirm our results . Abbreviations: bt, behavioral therapy; erp, exposure and response prevention; fet, fisher s exact test; ocd, obsessive compulsive disorder.
|
Segments of dna with near - identical sequence (segmental duplications or duplicons) in the human genome can be hot spots or predisposition sites for the occurrence of non - allelic homologous recombination or unequal crossing - over leading to genomic mutations such as deletion, duplication, inversion or translocation . These structural alterations, in turn, can cause dosage imbalance of genetic material or lead to the generation of new gene products resulting in diseases defined as genomic disorders . Previous studies to identify segmental duplications in the human genome have analyzed older versions of the genome assembly, which contained higher amounts of unfinished sequence and incorrectly mapped regions, and have used different computational approaches all performed by the same group [6 - 8]. With the human genome sequence now nearing completion, we have examined its content for segmental duplications using two distinct computational methods . In the first, we utilized the rapid blast2 algorithms that allow direct chromosomal - wide sequence comparisons to be made . All blast results reported in table formats can be subsequently grouped, parsed and analyzed for the detection of duplicated sequences . In addition, we have shown previously that there is a strong correlation between ambiguously mapped snps (ambsnps), as well as the density of snps, and segmental duplications . Ambsnps are snps that were annotated to map to two locations on a particular chromosome in the ncbi dbsnp . A subset of these ambsnps are not true snps but are likely to be computer - generated nucleotide mismatches from paralogous copies of duplicated sequences and should be more appropriately labeled as paralogous sequence variants (psvs). Another subset is likely to be false ambsnps of genomic sequences that have been misassigned in genome assemblies . Here, we report our analysis of all potential psvs in the human genome and their correlation with segmental duplications as detected by our blast analysis . Furthermore, we provide a critical assessment on the three latest human genome assemblies from our analysis of sequence misassignments as identified from this study . On the basis of the june 2002 (ncbi build 30) human genome assembly, a total of 107.4 mb (3.53%) of the human genome content (3,043.1 mb) were found to be involved in recent segmental duplications by our blast analysis criteria (table 1). This content is composed of more than 1,530 distinct intrachromosomal segmental duplications (80.3 mb or 2.64% of the total genome, figure 1) and 1,637 distinct interchromosomal duplications (43.8 mb or 1.44% of the total genome). In addition, 29% of all duplications are located in unfinished regions of the current genome assembly . We have also found that 38% of the duplications (52.3 mb) can be considered as tandem duplications - defined here as two related duplicons separated by less than 200 kb . In this study, we only analyzed large (size 5 kb) and recent (sequence identity 90%) duplications because we can achieve higher confidence and to prioritize those regions for their potential involvement in diseases . Previously, bailey and colleagues reported a total of 5.2% of the human genome involved in recent segmental duplications . The 1.6% discrepancy between our findings could be due to the difference in our detection criteria (size cutoff of 5 kb used in this study versus 1 kb used in bailey et al . ). Moreover, we have identified 38.9 mb of sequences (1.28% of the june 2002 genome assembly) likely to be artifactual duplications resulting from sequence misassignment errors present in the assembly . By comparing our results with those published previously, we found that 482/2579 clones that we identified to be involved in duplication were novel . The molecular mechanism by which segmental duplications are created is still unclear at the moment . A recent report has suggested that alu repeat clusters had a role as mediators of recurrent chromosomal rearrangements . We have examined whether elevated amounts of repetitive elements could be found in duplicon junctions . We inspected all duplication borders from our results and calculated the occurrence of different repeat types within the 500 bp window outside each duplicon junction . The whole - genome average frequencies were determined by sampling random 500 bp windows across the genome (excluding gap regions). Overall, we found that there are significant enrichment (or relative fold increase) for the presence of small ribonucleoprotein rna (srprna), satellite, long terminal (ltr) and sine / alu repeats (see additional data file). In addition, our data also showed that for some chromosomes the amount of duplicated sequence is higher in the pericentromeric and subtelomeric regions of chromosomes (figure 1), supporting the hypothesis that these repeat - dense regions have made an important contribution to the evolution of the human genome . Regions containing recently occurring segmental duplications can harbor rapidly evolving hominoid - specific genes, as well as novel gene families that are unique to primates . Using the national center for biotechnology information refseq annotation of these, 475 genes were fully contained within duplicated regions and were best candidates for recent whole - gene duplication . We have carried out functional analysis of these 475 genes using the gene ontology consortium database and found that there is a significant increase in gene duplications for genes involved in immune defense (antibodies, blood - group antigens) and reproduction (pregnancy, sex differentiation) (see additional data file). We were aware that in silico detection methods, such as the ones used in this study, would not allow us to distinguish completely true duplications from artifactual duplications arising from misassigned sequences, especially in cases where sequence identity between two detected duplications exceeded 99.5% over a substantial length (> 5 kb) in regions composed of draft sequences . Although a small proportion of such results (duplications with> 99.5% identity) might represent unfinished regions of the genome that contain true duplications that have arisen very recently in the evolution of the human genome (such as the large and nearly perfect palindromic repeats located in the azfc region on chromosome yq11.223 involved in male infertility), we suspect that most of the duplications (> 99.5% identity and contain draft sequences) are in fact sequence misassignment errors in the genome assembly . An explanation for such errors would be when two identical sequences belonging to the same genomic location were misassigned to distinct regions in the genome assembly . We have used the ncbi e - pcr to evaluate our results (potential sequence misassignment errors) from the june 2002 human genome assembly . Using some of the largest interchromosomal misassignment errors detected in our study, we found that none of the sts markers located within these misassigned sequences maps to their incorrectly assigned chromosomes . For example, ac121339 is incorrectly mapped to 3q13.13 in the june 2002 genome assembly, as supported by a consensus number of chromosome x sequence - tagged site (sts) markers (figure 2, table 2). From this genome assembly, we identified that a total of 38.9 mb of sequences, representing 1.28% of the total sequence content, are involved in such potential errors (a full list of potentially misassigned sequences can be obtained from) that would require additional effort and further sequencing to achieve resolutions . We also analyzed an additional two previous versions of the human genome assemblies, december 2001 and april 2002, and our results showed that there has been a dramatic reduction in potential errors in the latest human genome assembly compared to the two previous genome assemblies (table 3). Furthermore, we examined the distribution of the amount of duplications in five different categories on the basis of their level of sequence identity to each other (table 3). We observed a large reduction in duplications that fall within the 98 - 100% category, supporting the fact that the genome assemblies continue to improve and correct errors made . In addition, our data showed that there have been major improvements for chromosomes 5, 6, 7, 13, 14 and 19 over the last three genome assemblies . And for chromosomes that had reached finished status, such as chromosomes 20, 21 and 22 ambsnps are snps that were annotated to map to two locations on a particular chromosome in the ncbi dbsnp . Here we show on a genome scale that ambsnps most specifically correlate with intrachromosomal segmental duplications, suggesting they are paralogous sequence variants (psvs) (figure 1). These psvs were perhaps mistakenly introduced into dbsnp by automated in silico - generated analysis, arising from nucleotide mismatches in paralogous copies of duplicated sequences . Overall, a surprisingly high proportion, 8.6% (199,965 of 2,327,473), of the refsnps were annotated as ambsnps from dbsnp (build 108). A significant number of the ambsnps (139,974 of 199,965 or 70.0%) are located within duplicated regions as identified by blast and should be regarded as psvs (see additional data file). The non - identification by blast analysis of regions that contain ambsnps first, the duplicated copy(s) could have been removed from the sequence assembly or the two have been conflated, that is, mistakenly thought to be the same sequence owing to their high sequence similarity . A second possibility is that the duplication is smaller than 5 kb and was excluded in our blast analysis . A third possibility is that a collection of ambsnps could have been generated from misassigned sequences (identical sequences but misassigned to two difference locations in the genome) in older assembly builds due to sequencing errors or true snps (with high polymorphism rate) in the sequence . We also observed that the density of ambsnps generally correlates with the size of the putative duplication, although this might be affected by the level of sequence identity between duplications . For example, two duplicated sequences sharing 98% sequence identity compared to 95% over the same length might contain fewer psvs as the number of base - pair mismatches would be fewer in the former . In addition, we observed that regions identified by our blast method but that do not contain ambsnps often correspond to artifactual duplications generated from assembly errors . The size, orientation, and contents of segmental duplications are highly variable and most of them show great organizational complexity . This is perhaps due to successive transposition and rearrangement events leading to the creation of segmental duplications . In many cases, for example, one of the largest segmental duplicons detected in this study was 359 kb in size at the williams - beuren locus on 7q11.23 . In this case, the two duplicons are separated by 1.6 mb of intervening sequence with the telomeric duplicon comprising several separate smaller modules as compared to the primary duplicon . The results presented in our study (provided in tables available at) would also allow rapid identification of new duplicons that are potentially responsible for chromosome rearrangements and genomic disorders . For example, the location of the duplicons on chromosomes 9q34/22 q11 that have been suggested to mediate recombination leading to the philadelphia chromosome was identified in our analysis, as were other medically relevant chromosomal regions (table 4). The characterization of most large segmental duplications is complicated by the fact that many of them (29% of all duplications) are only represented as draft sequences from the current genome assembly . Despite the fact that both blast and psvs analyses allowed us to identify most segmental duplications involved in known genomic disorder mutations (table 4), estimations of the size of rearranged regions were different from those previously reported . In fact, with the exception of several small duplications and the segmental duplications on chromosome 22, other regions containing duplications involved in genomic disorders were often erroneously assembled and misplaced . Furthermore, we have searched the celera human genome c3 (publicly released version) and c4 (subscription - based version) sequence assemblies for large duplications found on chromosome 7 . We observed that most of them were not represented in large scaffolds, but instead were located in their sequence gaps, or only partially found at ends of scaffolds leading into gaps (see table 4). This suggests that the whole - genome assembly approach alone might not be able to finish such duplicated regions in mammalian genomes . On the basis of the june 2002 (ncbi build 30) human genome assembly, a total of 107.4 mb (3.53%) of the human genome content (3,043.1 mb) were found to be involved in recent segmental duplications by our blast analysis criteria (table 1). This content is composed of more than 1,530 distinct intrachromosomal segmental duplications (80.3 mb or 2.64% of the total genome, figure 1) and 1,637 distinct interchromosomal duplications (43.8 mb or 1.44% of the total genome). In addition, 29% of all duplications are located in unfinished regions of the current genome assembly . We have also found that 38% of the duplications (52.3 mb) can be considered as tandem duplications - defined here as two related duplicons separated by less than 200 kb . In this study, we only analyzed large (size 5 kb) and recent (sequence identity 90%) duplications because we can achieve higher confidence and to prioritize those regions for their potential involvement in diseases . Previously, bailey and colleagues reported a total of 5.2% of the human genome involved in recent segmental duplications . The 1.6% discrepancy between our findings could be due to the difference in our detection criteria (size cutoff of 5 kb used in this study versus 1 kb used in bailey et al . ). Moreover, we have identified 38.9 mb of sequences (1.28% of the june 2002 genome assembly) likely to be artifactual duplications resulting from sequence misassignment errors present in the assembly . By comparing our results with those published previously, we found that 482/2579 clones that we identified to be involved in duplication were novel . The molecular mechanism by which segmental duplications are created is still unclear at the moment . A recent report has suggested that alu repeat clusters had a role as mediators of recurrent chromosomal rearrangements . We have examined whether elevated amounts of repetitive elements could be found in duplicon junctions . We inspected all duplication borders from our results and calculated the occurrence of different repeat types within the 500 bp window outside each duplicon junction . The whole - genome average frequencies were determined by sampling random 500 bp windows across the genome (excluding gap regions). Overall, we found that there are significant enrichment (or relative fold increase) for the presence of small ribonucleoprotein rna (srprna), satellite, long terminal (ltr) and sine / alu repeats (see additional data file). In addition, our data also showed that for some chromosomes the amount of duplicated sequence is higher in the pericentromeric and subtelomeric regions of chromosomes (figure 1), supporting the hypothesis that these repeat - dense regions have made an important contribution to the evolution of the human genome . Regions containing recently occurring segmental duplications can harbor rapidly evolving hominoid - specific genes, as well as novel gene families that are unique to primates . Using the national center for biotechnology information refseq annotation of these, 475 genes were fully contained within duplicated regions and were best candidates for recent whole - gene duplication . We have carried out functional analysis of these 475 genes using the gene ontology consortium database and found that there is a significant increase in gene duplications for genes involved in immune defense (antibodies, blood - group antigens) and reproduction (pregnancy, sex differentiation) (see additional data file). We were aware that in silico detection methods, such as the ones used in this study, would not allow us to distinguish completely true duplications from artifactual duplications arising from misassigned sequences, especially in cases where sequence identity between two detected duplications exceeded 99.5% over a substantial length (> 5 kb) in regions composed of draft sequences . Although a small proportion of such results (duplications with> 99.5% identity) might represent unfinished regions of the genome that contain true duplications that have arisen very recently in the evolution of the human genome (such as the large and nearly perfect palindromic repeats located in the azfc region on chromosome yq11.223 involved in male infertility), we suspect that most of the duplications (> 99.5% identity and contain draft sequences) are in fact sequence misassignment errors in the genome assembly . An explanation for such errors would be when two identical sequences belonging to the same genomic location were misassigned to distinct regions in the genome assembly . We have used the ncbi e - pcr to evaluate our results (potential sequence misassignment errors) from the june 2002 human genome assembly . Using some of the largest interchromosomal misassignment errors detected in our study, we found that none of the sts markers located within these misassigned sequences maps to their incorrectly assigned chromosomes . For example, ac121339 is incorrectly mapped to 3q13.13 in the june 2002 genome assembly, as supported by a consensus number of chromosome x sequence - tagged site (sts) markers (figure 2, table 2). From this genome assembly, we identified that a total of 38.9 mb of sequences, representing 1.28% of the total sequence content, are involved in such potential errors (a full list of potentially misassigned sequences can be obtained from) that would require additional effort and further sequencing to achieve resolutions . We also analyzed an additional two previous versions of the human genome assemblies, december 2001 and april 2002, and our results showed that there has been a dramatic reduction in potential errors in the latest human genome assembly compared to the two previous genome assemblies (table 3). Furthermore, we examined the distribution of the amount of duplications in five different categories on the basis of their level of sequence identity to each other (table 3). We observed a large reduction in duplications that fall within the 98 - 100% category, supporting the fact that the genome assemblies continue to improve and correct errors made . In addition, our data showed that there have been major improvements for chromosomes 5, 6, 7, 13, 14 and 19 over the last three genome assemblies . And for chromosomes that had reached finished status, such as chromosomes 20, 21 and 22, the number of errors was negligible . Ambsnps are snps that were annotated to map to two locations on a particular chromosome in the ncbi dbsnp . Here we show on a genome scale that ambsnps most specifically correlate with intrachromosomal segmental duplications, suggesting they are paralogous sequence variants (psvs) (figure 1). These psvs were perhaps mistakenly introduced into dbsnp by automated in silico - generated analysis, arising from nucleotide mismatches in paralogous copies of duplicated sequences . Overall, a surprisingly high proportion, 8.6% (199,965 of 2,327,473), of the refsnps were annotated as ambsnps from dbsnp (build 108). A significant number of the ambsnps (139,974 of 199,965 or 70.0%) are located within duplicated regions as identified by blast and should be regarded as psvs (see additional data file). The non - identification by blast analysis of regions that contain ambsnps could be due to one of three possibilities . First, the duplicated copy(s) could have been removed from the sequence assembly or the two have been conflated, that is, mistakenly thought to be the same sequence owing to their high sequence similarity . A second possibility is that the duplication is smaller than 5 kb and was excluded in our blast analysis . A third possibility is that a collection of ambsnps could have been generated from misassigned sequences (identical sequences but misassigned to two difference locations in the genome) in older assembly builds due to sequencing errors or true snps (with high polymorphism rate) in the sequence . We also observed that the density of ambsnps generally correlates with the size of the putative duplication, although this might be affected by the level of sequence identity between duplications . For example, two duplicated sequences sharing 98% sequence identity compared to 95% over the same length might contain fewer psvs as the number of base - pair mismatches would be fewer in the former . In addition, we observed that regions identified by our blast method but that do not contain ambsnps often correspond to artifactual duplications generated from assembly errors . The size, orientation, and contents of segmental duplications are highly variable and most of them show great organizational complexity . This is perhaps due to successive transposition and rearrangement events leading to the creation of segmental duplications . In many cases, for example, one of the largest segmental duplicons detected in this study was 359 kb in size at the williams - beuren locus on 7q11.23 . In this case, the two duplicons are separated by 1.6 mb of intervening sequence with the telomeric duplicon comprising several separate smaller modules as compared to the primary duplicon . The results presented in our study (provided in tables available at) would also allow rapid identification of new duplicons that are potentially responsible for chromosome rearrangements and genomic disorders . For example, the location of the duplicons on chromosomes 9q34/22 q11 that have been suggested to mediate recombination leading to the philadelphia chromosome was identified in our analysis, as were other medically relevant chromosomal regions (table 4). The characterization of most large segmental duplications is complicated by the fact that many of them (29% of all duplications) are only represented as draft sequences from the current genome assembly . Despite the fact that both blast and psvs analyses allowed us to identify most segmental duplications involved in known genomic disorder mutations (table 4), estimations of the size of rearranged regions were different from those previously reported . In fact, with the exception of several small duplications and the segmental duplications on chromosome 22, other regions containing duplications involved in genomic disorders were often erroneously assembled and misplaced . Furthermore, we have searched the celera human genome c3 (publicly released version) and c4 (subscription - based version) sequence assemblies for large duplications found on chromosome 7 . We observed that most of them were not represented in large scaffolds, but instead were located in their sequence gaps, or only partially found at ends of scaffolds leading into gaps (see table 4). This suggests that the whole - genome assembly approach alone might not be able to finish such duplicated regions in mammalian genomes . We have used two different computational approaches to identify the locations of all recent segmental duplications in the current human genome draft sequence . The fidelity of the results reflects the quality of the assembly examined and the parameters used . In addition, our approach has detected numerous potential sequence misassignment errors in the current genome annotation, allowing rapid error detection in future sequence assemblies . The segmental duplication map of the human genome should serve as a guide for investigation of the role of duplications in genomic disorders, as well as their contributions to normal human genomic variability . It is clear that genomic regions containing segmental duplications present a major challenge to the completion of the human genome sequence by april 2003 . Focused efforts including targeted sequencing of allele - specific clones, high - resolution fluorescence in situ hybridization, and expert curation would be required to validate the actual (or proposed) organization of these complex regions as well as to complete the human genome reference sequence . We obtained the december 2001, april 2002, and june 2002 (ncbi build 28, 29 and 30 respectively) human genome assemblies through the university of california, santa cruz human genome browser . All chromosome sequences were lower - case masked for highly repetitive elements by repeatmasker (a.f.a . Each of the 25 masked chromosome sequences (including one unmapped chromosome sequence' chrun') was compared against itself by chromosome - wide blast2 to detect intrachromosomal segmental duplications (25 comparisons made), as well as pairwise comparisons to each of the other 24 chromosomes to detect interchromosomal segmental duplications (600 comparisons made). All blast results were subsequently parsed to eliminate low - quality and fragmented alignments under the following criteria: blast results having 90% sequence identity, 80 bp in length, and with expected value 10 . All identical hits (same coordinate alignments), including suboptimal blast alignments recognized by multiple, overlapping alignments, as well as mirror hits (reverse coordinate alignments) from the blast results of the intrachromosomal set were removed . Contiguous alignments separated by a distance of less than 3 kb, then 5 kb, and subsequently 9 kb were joined (stepwise) into modules in order to traverse masked repetitive sequences and to overcome breaks in the blast alignments caused by insertions / deletions and sequence gaps . Such contiguous sequence alignment modules represent sequence similarity between the subject and query chromosome sequence in question (at their respective positional coordinates). This pairwise sequence comparison procedure serves as a rapid and robust way to detect duplication relationships . However, because of the use of masked sequences, our method would only yield a poor (on average 0.1 - 0.5 kb) resolution for the determination of the precise duplication alignment boundaries . Results were classified as either duplications or' questionable' results based on sequencing status of the region and the percent sequence similarity between the detected alignments . Questionable duplications are results that fall within regions containing draft sequences with> 99.5% detected sequence identity with another region . We consider these questionable duplications to be involved in potential sequence misassignment errors in the human genome assembly and would require further effort to achieve resolution . Detailed information regarding segmental duplications as well as potential sequence misassignment errors identified by our analysis were presented using the generic genome browser . We have also summarized our results in table formats that include information on size of duplications, chromosomal band locations, level of identity between duplicated copies, sequenced clones (accession numbers) and their sequencing status, as well as genes mapped to these regions . In addition, we have plotted the size of each intrachromosomal duplication (y - axis) against its chromosome position (x - axis) along each chromosome to indicate the intrachromosomal segmental duplication content of each chromosome (figure 1) using the publicly available visualization tool genomepixelizer . Results generated from the detection of segmental duplications were subsequently converted into coordinate files as input for display using genomepixelizer . Each chromosome snp table, containing annotation regarding ambsnps that have appeared twice in a particular chromosome, were extracted and sorted along with their corresponding chromosomal positions . The number of ambsnps was tabulated along a 10-kb window to produce density plots of ambsnps along the length of each chromosome (figure 1). We obtained the december 2001, april 2002, and june 2002 (ncbi build 28, 29 and 30 respectively) human genome assemblies through the university of california, santa cruz human genome browser . All chromosome sequences were lower - case masked for highly repetitive elements by repeatmasker (a.f.a . Each of the 25 masked chromosome sequences (including one unmapped chromosome sequence' chrun') was compared against itself by chromosome - wide blast2 to detect intrachromosomal segmental duplications (25 comparisons made), as well as pairwise comparisons to each of the other 24 chromosomes to detect interchromosomal segmental duplications (600 comparisons made). All blast results were subsequently parsed to eliminate low - quality and fragmented alignments under the following criteria: blast results having 90% sequence identity, 80 bp in length, and with expected value 10 . Each blast report was sorted by chromosomal coordinates . All identical hits (same coordinate alignments), including suboptimal blast alignments recognized by multiple, overlapping alignments, as well as mirror hits (reverse coordinate alignments) from the blast results of the intrachromosomal set were removed . Contiguous alignments separated by a distance of less than 3 kb, then 5 kb, and subsequently 9 kb were joined (stepwise) into modules in order to traverse masked repetitive sequences and to overcome breaks in the blast alignments caused by insertions / deletions and sequence gaps . Such contiguous sequence alignment modules represent sequence similarity between the subject and query chromosome sequence in question (at their respective positional coordinates). This pairwise sequence comparison procedure serves as a rapid and robust way to detect duplication relationships . However, because of the use of masked sequences, our method would only yield a poor (on average 0.1 - 0.5 kb) resolution for the determination of the precise duplication alignment boundaries . Results were classified as either duplications or' questionable' results based on sequencing status of the region and the percent sequence similarity between the detected alignments . Questionable duplications are results that fall within regions containing draft sequences with> 99.5% detected sequence identity with another region . We consider these questionable duplications to be involved in potential sequence misassignment errors in the human genome assembly and would require further effort to achieve resolution . Detailed information regarding segmental duplications as well as potential sequence misassignment errors identified by our analysis were presented using the generic genome browser . We have also summarized our results in table formats that include information on size of duplications, chromosomal band locations, level of identity between duplicated copies, sequenced clones (accession numbers) and their sequencing status, as well as genes mapped to these regions . In addition, we have plotted the size of each intrachromosomal duplication (y - axis) against its chromosome position (x - axis) along each chromosome to indicate the intrachromosomal segmental duplication content of each chromosome (figure 1) using the publicly available visualization tool genomepixelizer . Results generated from the detection of segmental duplications were subsequently converted into coordinate files as input for display using genomepixelizer . Each chromosome snp table, containing annotation regarding ambsnps that have appeared twice in a particular chromosome, were extracted and sorted along with their corresponding chromosomal positions . The number of ambsnps was tabulated along a 10-kb window to produce density plots of ambsnps along the length of each chromosome (figure 1). The following additional data are availiable as a single file with this article: a table describing the relative frequency increase of repeat types at duplicon junctions (additional data file 1); a table giving the number of ambiguousgly mapped snps within segmental duplications (number of psvs) (additional data file 1); a figure (additional data file 1) showing functional profiling of genes involved in recent whole - gene duplication vs human genome average . This work was supported by the canadian institutes of health research (cihr) and genome canada to s.w.s . And x.e . Is a senior scientist at the centre de regulaci genmica (crg) and a visiting scientist of the hospital for sick children research institute . S.w.s . Is a scholar of cihr and international scholar of the howard hughes medical institute . Left, graphical views of the paralogous relationships between recent segmental duplications (graphics produced using genomepixelizer; each line represents a duplicated module; coloring scheme, red = 99% to 100% sequence identity, purple = 96% to 98%, green = 93% to 95%, and blue = 90% to 92%). Middle panel: segmental duplications as detected by blast analysis (size of duplication in kb plotted against the length of chromosome in mb). Right panel: ambsnps density plot (number of ambsnps plotted against the length of chromosome in mb). Ac121339 is incorrectly mapped to 3q13.13 in the june 2002 human genome assembly as shown by a consensus number of chromosome x sts markers . Segmental duplication content of the human genome * previous data on segmental duplications distributed by chromosomes as reported in . Comparison of duplications and potential sequence misassignment errors in genome assemblies * all numbers shown in the table are 100 kb . * segmental duplications involved in known genomic disorders and chromosome rearrangements identified by blast and ambsnp analyses this table represents a partial list of all known genomic disorders and chromosome rearrangements . * only the start coordinates (based on june 2002 assembly) for duplicons are shown . Results from blast analysis with chromosome coordinates and size of duplicon . For several genomic mutations (williams - beuren syndrome, prader - willi syndrome and angelman syndromes, and digeorge syndrome) the duplicons shown are incomplete, most of which are composed of several duplication modules . The' -' sign indicates that the second duplicon is in the inverse orientation . The number of ambsnps (ambiguously mapped single - nucleotide polymorphisms) found within the genomic segment . The ambsnp analysis defines regions containing high densities of contiguous ambsnps . For some of the segmental duplications involved in genomic disorders, the contiguous lengths of ambsnps are much larger than those detected by blast . The specific sizes of the segmental duplications have to be resolved by detailed characterization of the different modules . Celera representation: s, both copies found in large (> 500 kb) sequence scaffolds; p, partially hit, single copy found, or less than perfect alignments; m, missing from large sequence scaffolds, hitting numerous fragments.
|
Autonomic dysreflexia (ad) is a well known condition of an uncontrolled sympathetic output, that generally occurs in patients with spinal cord injury (sci) who have a lesion above t6 spinal level1). Ad is caused by spinal reflex mechanisms that remain intact despite the injury of the spinal cord . In sci patients, blood pressure levels in addition, the hypertensive attacts can be life - threatening by causing end organ damage14). Central nervous system complications are uncommon but it may be the most common reason of morbidity and mortality . Ad is an important clinical diagnosis that requires prompt recognition and treatment in order to avoid this devastating complications . Most important aspect of the management of ad is prevention, early recognition and removing of the triggering factors . In particular, the urinary tract obstruction and fecal impaction, which are the most common triggers of ad, must be checked out urgently and regularly . Here, we report a sci patient who had a rare hypertensive cerebral hemorrhage complication during an ad episode and we discuss the pathophysiology and the treatment methodes of the ad . The patient was a 43-year - old man who had a american spinal injury association impairment scale - b (asia - b) type incomplet sci at level c6 secondary to a traffic accident for three years (fig . He had been diagnosed with autonomic dysreflexia due to the hypertensive attacks which were followed with hypotension and bradicardia . His neurogenic bladder was initially managed with an indwelling foley catheter and then clean intermittent catheterisation for two years . Because of persistant attacks, suprapubic catheterization with cystofix has been performed one year ago . The patient admited to our emergency department with letargy, left sided facial paresis and worsening in his paresis in the left upper extremity . His family described the history of cystofix dysfunction with abdominal distention and increasing in blood pressure up to 220/100 mm hg right before these symptoms . His cranial ct revealed right thalamic and inraventricular hematoma with 21 mm in volume (fig . He has been followed - up with medical treatment and his cystofix catheter had been replaced with a wider one . Although it is common in sci, non - traumatic diseases such as multiple sclerosis and spinal cord tumor can also be the cause of ad2). Ad mainly occurs in chronic stage of disease both in the complete and the incomplete injury group1). The pathophysiology of ad is related with the disconnection of the spinal sympathetic centers from supraspinal control . Normal regulation of sympathetic output from the spinal cord is modulated by input from the higher centers . These changes are thought to occur because of the synaptic re - organisation and reduction in gliosis around the pre - synaptic sympathetic neurones2,5,14). As a result of this process, exaggerated reaction occurs within the sympathetic pre - ganglionic neurones as a response to the afferent stimulus . The reason that ad is a feature of lesions at or above the t6 level is related with splanchnic circulation response to this sympathetic overactivity . The excessive parasympathetic output (and lack of sympathetic tone) above the level of the lesion results with peripheral vasodilation . Hence, patients experience sweating, nasal congestion, flushing and bradicardia . In brief, ad result from the parasympathetic excitation above the level of injury, and sympathetic excitation below the level of injury and clinically it is characterized by an acute increase in blood pressure, headache, sweating, facial flushing and bradicardia1,2,5,11). We must always be aware of and search these features during the sci patients follow up . This ad crisis may lead to injuries in cardiac, pulmonary, retinal and renal tissues16). Uncommonly, this hypertansive crises may also effect central nervous system by causing cerebral hemorrhage10,12,13,14,15,16) and more rarely posterior reversible enchephalopathy syndrome (pres) or reversible cerebral vasoconstriction syndrome3,7,13). Central nervous system involvement is very rare and if occurs, it is most commonly asymptomatic . But, it can also result in altered mental status, local neurologic deficits and seizures4,16). Intracranial hemorraghe is an uncommon complication of ad but fatal cases with massive bleeding have also been reported6,8,10,13,17). Here, we report a rare sypmtomatic cerebral hemorrahge which is result from an ad attack . Physicians should repeatedly check and note the neurologic status of every sci patient even during chronic stage because it may be difficult to distinguish the new neurologic findings in this tetraparetic or tetraplegic high level sci patients . The main triggering factor of ad indwelling urinary catheters are one of the most common causes . Choosing the safest and appropriate method for the patients and family education for controlling the function of the catheter are the important issues . The goal in all bladder treatment is the creation of a balanced bladder, with low intravesical pressure that is drained totally at regular intervals and is free of urinary tract infections . In patients with sci, clean intermittent catheterization has been recommended rather than indwelling urinary catheters if the patient and family can adjust9). There are also many other urological causes for ad like bladder distension, urinary tract infection, bladder or kidney stones, urologic procedures, detrusor sphincter dysinergia, epididymitis or scrotal compression . The second most common causes of ad due to sci are gastrointestinal problems, including faecal impaction and rectal distension also anorectal conditions like haemorrhoids and fissures . Orthopedic conditions such as fractures, dislocation, heterotopic ossification and general surgical conditions of the abdominal organs, such as appendicitis, gastro - oesophageal reflux, and peptic ulceration may presipitate the ad . All of these triggering factors must be kept in mind during evaluation of a patient with ad . The first step of the treatment of ad, regardless of the cause, is to make patient sit in an upright position to maintain an orthostatic decrease in the blood pressure . If needed, the calcium antagonists or adrenoceptor blockers may be beneficial in the treatment of ad1,2,5). This life - threatening complication should be kept in mind in the patients, especially with upper sci . The medical team who are dealing with sci patients as well as the sci patients themselves and their relatives should be aware of this disorder and apropriate bladder care, bowel exercises and skin care should be provided . This case has been reported to emphasises the rare hypertensive cerebral hemorrhage complication during common ad episodes in sci . Clinicians should always closely monitore the patients with sci, especially those in the high spinal levels . These patients can easily develop ad which is triggered by the stimulation of lower parts of the body . Prompt removal of the triggers and choosing the safest urinary drainage method are very important to save the patients from the complications of ad.
|
Hundreds of genes have been implicated in alzheimer's disease, many of which can be grouped into discrete signalling networks and pathways relevant to the various subpathologies, risk factors, and biochemistry of alzheimer's disease . Many of the environmental risk factors associated with alzheimer's disease, including infectious agents (herpes simplex, chlamydia pneumonia, and borrelia burgdorferi) as well as vitamin a deficiency, hypercholesterolaemia, hyperhomocysteinaemia or folate deficiency, oestrogen depletion, cerebral nerve growth factor (ngf) deprivation, diabetes, cerebral hypoperfusion (leading to hypoxia and hypoglycaemia) or are able to promote cerebral beta - amyloid deposition (in the absence of any particular gene variant) in animal models . Kegg pathway and other analyses of the multiple genes implicated in alzheimer's disease have shown that subsets of susceptibility genes can be grouped into networks that are relevant to each of these amyloidogenic pathways (e.g., bacterial and viral entry pathways [1, 2], cholesterol / lipoprotein function [3, 4], growth factor signalling, folate and homocysteine pathways, insulin signalling, and steroid or vitamin a metabolism [8, 9]). A large number of genes are also related to the immune network (see http://www.polygenicpathways.co.uk/alzkegg.htm and a recent review for further details). These gene subsets are thus related to multiple external factors that are each able to promote beta - amyloid deposition, suggesting that certain genes are related to the causes of alzheimer's disease, (agents able to provoke beta - amyloid deposition) rather than (and as well as) to the underlying pathology of the disease itself . Several studies have implicated the herpes simplex virus in the aetiology of alzheimer's disease [1113]. Viral dna is found in amyloid plaques, which are also heavily enriched in proteins used by the virus during its life cycle, as well as in proteins related to the immune network, and immunoglobulin igm, but not igg seropositivity for herpes simplex is predictive of the subsequent development of alzheimer's disease . Igm seropositivity is indicative of viral reactivation which again can be induced by several of the risk factors relevant to alzheimer's disease and its underlying genetic pathways (e.g., ngf deprivation, 17-beta oestradiol, hypoxia, or fever and interleukin 6 activation, with the latter being common and general consequences of infection). Along with herpes simplex, a number of other pathogens have been implicated in alzheimer's disease and its associated pathologies . The viral, bacterial, spirochete, and fungal pathogens implicated in dementia or alzheimer's disease are referenced at (http://www.polygenicpathways.co.uk/alzenvrisk.htm) and include hhv-6, chlamydia pneumoniae, helicobacter pylori, periodontal pathogens involved in gum disease, borrelia burgdorferi, and cryptococcus neoformans . Of these, h. pylori eradication has been reported to improve performance and increase lifespan in alzheimer's disease patients, while two case reports indicated virtually complete recovery from long - term (3 years) misdiagnosed dementia / alzheimer's disease following antifungal treatment for c. neoformans infection [20, 21]. Many of these pathogens including herpes simplex, hhv-6, c. pneumoniae, h. pylori and the periodontal pathogen, p. gingivalis, have also been implicated in atherosclerosis [2225], while c. neoformans infection in rabbits induces an increase in neutrophil superoxide production, plasma lipid peroxidation, and an increase in inflammatory cells, forerunners of atherosclerosis . Atherosclerosis of the carotid arteries, or of the circle of willis and leptomeningeal arteries, is a significant predictor of risk in dementia or alzheimer's disease and correlates with alzheimer's disease pathology [27, 28]. Cerebral hypoperfusion (hypoglycaemia, hypoxia, ischaemia, or carotid occlusion) or other factors linked to atherosclerosis (e.g., high cholesterol or homocysteine levels) are also able, per se, to induce cerebral beta - amyloid deposition in animal models (see above). Genomewide association studies (gwas) have now identified a subset of genes which, along with apoe4, contribute a high proportion of genetic risk . These include clusterin (clu), phosphatidylinositol - binding clathrin assembly protein (picalm) and complement receptor 1 (cr1) as well as the atp cassette transporter abca7, bridging integrator bin1, a cd2-associated protein (cd2ap), cd33, ephrin a1 (epha1), and a membrane - spanning 4-domains, subfamily a (ms4a) cluster recently honed down to ms4a2, although other genes within this cluster may also be relevant [30, 31]. As discussed below, the major alzheimer's disease genes implicated by the recent gwas data, as well as app and gamma secretase, and previous gwas results are majoritarily involved in pathogen entry and defence, particularly in relation to herpes simplex, but also to other relevant pathogens, and in the immune network . This suggests that genes, pathogens, and the immune system act together to cause alzheimer's disease, and that a focus on pathogen detection and elimination should be a priority in the ageing at risk population . The genes identified in a number of recent genomewide association studies are available at the gwas repository at the national human genome research institute http://www.genome.gov/gwastudies/ and, along with pre - gwas genes and environmental risk factors, at http://www.polygenicpathways.co.uk/alzenvrisk.htm . The genes returned from very large sample sets (n> 10,000) include abca7, apoe, bin1, cd2ap, cd33, clu, cr1, epha1, ms4a2, ms4a4a, ms4a4e, ms4a6a, and picalm whose properties in relation to diverse pathogens were identified by literature survey . While it is recognised that such genes, particularly apoe, abca7, cr1, and clusterin, which are involved in lipoprotein function and/or amyloid processing (see below), may exert effects on other relevant branches of alzheimer's disease pathophysiology, the focus of this paper is on pathogens and the immune system, which appear to be the common factors integrating this network . Throughout the text, these and other genes implicated in alzheimer's disease from the gwas and pre - gwas era are highlighted in bold and appended to the various processes in which they are involved (derived from a kegg pathway analysis of these genes http://www.polygenicpathways.co.uk/alzkegg.htm) herpes simplex binding proteins, and key interactors, currently numbering over 450, are stocked and referenced at http://www.polygenicpathways.co.uk/herpeshost.html . Expression data are provided in figure 1 and are also hyperlinked to the biogps webserver http://www.biogps.gnf.org/, which provides general gene information and mrna expression profiles for most human genes, based on custom arrays from 79 human issues [33, 34]. Predicted b - cell epitopes from human beta - amyloid (142), nerve growth factor (np_002497.2), or the microtubule protein, tau (np_001116538.2) were identified using the bepipred server http://www.cbs.dtu.dk/services/bepipred/ and their sequences compared with pathogen proteomes (borrelia burgdorferi, c. neoformans, helicobacter pylori, herpes viruses hsv-1, hsv-2, hhv-6, and the cytomegalovirus (hhv-5)) using the ncbi blast server (protein versus protein: blastp). Complement receptor 1 (highly expressed in myeloid cd33 + cells (bone marrow) http://www.biogps.org/#goto=genereport&id=1378/) is a receptor for herpes simplex, adenovirus 5, the influenza virus and hiv-1, as well as for a number of other pathogens, including p. gingivalis, c. neoformans, streptococcus pneumoniae, staphylococcus aureus, and the malaria parasite, plasmodium falciparum [3743] and is a general clearance receptor for complement opsonised pathogens . Clusterin, predominantly expressed in brain, liver, and testis, (http://www.biogps.org/#goto=genereport&id=1191/) is a ligand for the lipoprotein receptor, megalin (lrp2) that is involved in beta - amyloid clearance, and also a complement inhibitor that prevents the formation of the membrane attack complex, a channel that is inserted into pathogen membranes, killing them by lysis . This complex is also seen in alzheimer's disease neurones [46, 47]. The herpes simplex virus interacts with other members of the complement cascade, by binding to the complement component and cr1 ligand, c3 and its derivatives and to cd59, a further inhibitor of the formation of the complement membrane attack complex (see review). C. pneumoniae interacts with this pathway by binding to properdin (cfp), a protein that stabilises the complement c3 and c5 convertase and contributes to the formation of the membrane attack complex . Complement component c3 binds to melanins derived from c. neoformans and cryptococcal capsules bind to c3 and activate the alternative complement pathway . Complement component c3 also binds to the bacterial surface of h. pylori, and the complement pathway is involved in bactericidal effects against this pathogen . P. gingivalis also uses complement receptor 3 (an integrin complex of integrin, alpha m / integrin, beta 2 (itgam / itgb2)) for entry, and herpes simplex glycoprotein c also binds to this complex as does c. neoformans, while itgb2 is involved in c. pneumoniae entry in human coronary artery endothelial cells . This macrophage complement receptor, also known as mac-1, generally mediates the phagocytosis of pathogens coated with complement c3 derivatives . T. c3 also binds to p. gingivalis although the pathogen has devised an elegant escape strategy involving digestion of complement components c3, c4, and c5 by bacterial secreted proteases, known as gingipains . The complement inhibitor cd59 is also a ligand for cd2, and cd59 activation of this receptor, presumably involving cd2ap, activates t cell receptor signalling resulting in the secretion of interleukins (il1a, il2 and il6) and granulocyte macrophage colony stimulating factor (csf2) [60, 61]. Complement component c1q, which binds to igm or igg complexed antigens (relevant to most pathogens), binds to macrophage calreticulin and lrp1 and c1q binding to macrophages markedly increased the expression of both lrp1 and abca7, effects which enhance the phagocytic abilities of macrophages . C1q also binds to complement receptor cr1, an effect involved in the immune clearance of opsonised pathogens . C1q also binds to beta - amyloid and is involved in amyloid - related complement activation . Mammalian surface receptors are endocytosed, via clathrin - dependent or independent processes (kegg: adrb1, adrb2, bin1, cav1, cd2ap, clu, dnm2, hla - a, hspa1b, ldlr, ntrk1, picalm) and either recycled or tagged for destruction by the ubiquitin / proteasome system (kegg: ubd, ube2i ubqln1, uchl1) or by lysosomes (kegg: abca2, arsa, arsb, ctsd, ctss, npc1, npc2, lipa). Early endosomes receive traffic from the cell surface, which is transferred to late endosomes for traffic to lysosomes . Late endosomes also receive traffic from the trans - golgi network used to synthesise proteins and from phagocytic pathways (kegg: ctss, dld, dlst, dnm2, gab2, hla - a, hla - drb1, mpo, nos1, olr1, pik3r1, psk1, tap2, tlr2, tlr4). Endosomal traffic moves along the microtubule (gsk3b, mapt, ttll7) or actin / myosin (myh8, myh13) networks via dynein / dynactin (dm2, dnmbp) or kinesin (kif18b, kif20b, kns2), related motors and rho gtpases, and vacuolar sorting proteins (sorcs1, sorcs2, sorcs3, sorl1) inter alia . These processes are usurped by many viruses and other pathogens to gain access to cells and to various intracellular compartments, while the lysosomal or proteasomal pathways may be used to destroy pathogen proteins . Clathrin - mediated endocytosis is one of several processes used by helicobacter pylori, herpes simplex, and many other viral, bacterial and fungal pathogens to gain entry to cells [6769]. Picalm, expressed primarily in myeloid and dendritic cells of the immune network http://www.biogps.org/#goto=genereport&id=8301/, plays a key role in clathrin - related endocytosis, binding to clathrin heavy chains (cltc and cltcl1), and recruiting the clathrin and adaptor protein 2 (ap-2) to the plasma membrane . The ap-2 complex is a heterotetramer consisting of permutations of two large adaptins (alpha (ap2a1, ap2a2)) or beta (ap2b1), a medium adaptin (ap1m1, ap1m2), and a small adaptin (sigma ap2s1). Picalm controls the endocytosis of the cation - independent mannose-6-phosphate igf2 receptor (igf2r), one used by herpes simplex for entry and cell - to - cell transmission and by c. pneumoniae for cellular entry . Igf2r is also a component of late endosomes disrupted by the helicobacter pylori vaca cytotoxin . Picalm also binds to a nuclear exportin crm-1 (xpo1) used by the herpes simplex virus during its life cycle . Gamma - adaptins (gga, gga2, gga3) bind to clathrins and mannose-6-phosphate receptors and regulate protein traffic between the golgi network and the lysosome and the sorting of mannose-6-phosphate receptors (igf2r and m6pr) at the trans - golgi network . This network is also related to important alzheimer's disease susceptibility genes as the interactions culled from ncbi gene show that gga1 binds to the sortilin - related receptor, sorl1, and the app cleaving beta - secretase bace2, while gga2 binds to the beta - secretases bace1 and bace2, sorl1 and the prolyl - isomerase pin1 . Cd2ap, primarily expressed in dendritic cells and b lymphoblasts http://www.biogps.org/#goto=genereport&id=23607/, is a scaffolding molecule that regulates the actin cytoskeleton and is primarily associated with the t - lymphocyte marker protein cd2 . Cd2 stimulates t cell activation and is involved in the creation of contacts between antigen presenting cells and t cells (the immunological synapse), effects mediated via cd2ap and clathrin . Cd2ap is also involved in the entry of the helicobacter vacuolating toxin vaca and connects the actin cytoskeleton to early endosomes containing vaca . Cd2ap also binds to the actin - bonding protein, cortactin (cttn), a protein that is exploited by several bacteria (escherichia coli, shigella, neisseria, rickettsia, chlamydia, staphylococcus, cryptosporidium, and helicobacter pylori), fungi (candida albicans), and viruses (vaccinia) enabling them to modify the actin cytoskeleton, which they use for transport [7779]. Cd2ap has not been specifically associated with herpes simplex, although the actin cytoskeleton is exploited by this and many other viruses . E - cadherin binds to the h. pylori toxin caga and is also cleaved by the helicobacter pylori protein htra allowing the pathogen to invade the intracellular compartment . Cdh1 and cdh5 expressions are increased by c. pneumoniae infection of human brain microvascular endothelial cells, contributing to vascular permeability changes and atherosclerosis . Bridging integrator 1 (bin1), also known as amphiphysin 2, is primarily expressed in the pineal and skeletal muscle, or otherwise ubiquitously http://www.biogps.org/#goto = genereport&id=274/. It is also involved in the clathrin - mediated endocytosis machinery and binds to dynamins that regulate the clathrin network including dnm1 and the herpes simplex binding partner dnm2 and to clathrins and the alpha adaptins, ap2a1 and ap2a2 . Bin1 also participates in phagocytosis in macrophages and is associated, but only transiently, with early phagosomes; however, it is retained on vacuoles containing chlamydia pneumoniae, an effect that reduces the ability of the macrophage system to kill the bacteria via nitric oxide generation . Macrophages expressing a dominant negative bin1 internalise c. pneumoniae, but do not allow their killing . Bin1 also binds to a number of alpha integrins (itga1, itga3, and itga6): integrins are used for attachment by many viruses, bacteria, and fungi and may serve as pattern recognition receptors regulating the immune response . Individual integrins bind to many others, forming heteromeric complexes; for example, itga1 binds to itga3 or itga6, while itga3 binds to itgb1 (a receptor for the h. pylori protein caga), itgb4, or itgb5, and itga6 binds to itgb1 and itgb4 (data from ncbi gene). Cd33, mainly expressed in myeloid cells, monocytes, and dendritic cells (http://www.biogps.org/#goto=genereport&id=945/), is a member of the sialic acid binding immunoglobulin g - like lectin (siglec) family . Cd33-related siglecs regulate adaptive immune responses and are also important as macrophage pattern recognition receptors for sialylated pathogens, including enveloped viruses . Cd33 binds to alpha2 - 3- or alpha2 - 6-linked sialic acids (n - acetyl neuraminic acid). These particular sialic acids are expressed on the surface envelope glycoproteins (b, d, and h) of the herpes simplex virion, and these residues are required for viral entry into cells . N - acetyl neuraminic acid is expressed by c. neoformans, is involved in fungal adhesion to macrophages, and is also a component of the cell wall of b. burgdorferi, while helicobacter pylori adhesins also bind to this particular form of sialic acid [99, 100] as does p. gingivalis . Bin1, as well as its relationship to the clathrin mediated endocytosis machinery, also regulates the expression of indoleamine 2,3-dioxygenase (ido1), an enzyme that catalyzes the first rate - limiting step in tryptophan metabolism to n - formyl - kynurenine . Ido1 upregulation is an important defence mechanism against pathogenic bacteria, many of which are unable to synthesise tryptophan . This ido1 response is also deleterious to other pathogens and parasites, including t. gondii, and to a number of viruses, including herpes simplex and other herpes viruses . Ido1 protein expression is localised to plaques and tangles in the alzheimer's disease brain . Ido1 activation can lead to the production of toxic tryptophan derivatives such as 3-hydroxyanthranilic acid or the n - methyl - d aspartate receptor agonist and excitatory neurotoxin, quinolinic acid (grin2b, grin3a). Plasma tryptophan levels are also lower in the ageing population and in alzheimer's disease, a pattern accompanied by immune activation, and by increased concentrations of quinolinic acid [106, 107]. Ms4a2, expressed mainly in the tonsils, lymph nodes, b cells, and dendritic cells http://www.biogps.org/#goto=genereport&id=931/, is a component of the immunoglobulin e (ige) receptor, which is involved in allergic responses in which allergens bound to receptor bound ige result in the activation of allergic mediators such as histamine . High levels of ige are also observed in man following recurrent herpes simplex infection and human ige antibodies are also known to interact with herpes family viruses including hsv-1 and 2 and the epstein - barr and cytomegalovirus and also to c. pneumoniae, h. pylori, and b. burgdorferi [112115]. Other members of this gene cluster (including ms4a4a, ms4a4e, and ms4a6a) are also structurally related to the immunoglobulin e receptor and to cd20 (ms4a1) and also regulate b cell and t cell proliferation and/or differentiation [117, 118]. Epha1 is an ephrin receptor, primarily expressed in the liver and otherwise ubiquitously (http://www.biogps.org/#goto=genereport&id=2041/). Only three protein / protein interactions for epha1 are reported in the ncbi gene interaction section, including its ligand efna1, the anaplastic lymphoma receptor tyrosine kinase (alk), and a smad - specific e3 ubiquitin protein ligase 2 (smurf2). Efna1 is one of several proteins identified as being important in the entry of c. pneumoniae into human coronary artery endothelial cells . Smurf2 is known to bind to the vp22 tegument protein of herpes simplex and plays a role in clathrin - mediated endocytosis and the subsequent ubiquitin - related proteasomal degradation of tgf beta receptors, to which it binds . Tgf beta signalling exerts immunosuppressive effects and inhibits host immunosurveillance and the recruitment of immunocompetent cells by chemokines . Alk is best characterised via its relationship with lymphomas, caused by alk gene fusion with any of several other housekeeping genes . Its key involvement in lymphoma suggests a role in the immune network although the function of the normal alk protein is poorly understood . Abca7 is an atp - binding cassette transporter, predominantly localised in the pineal gland and cells of the immune network (t cells, natural killer cells, and dendritic cells http://www.biogps.org/#goto=genereport&id=10347/). The lipoproteins apoa1 and apoe are substrates for abca7, and in cultured hek-293 cells, plasma membrane - situated abca7 increases the efflux of phosphatidylcholine and sphingomyelin efflux to apoa1 and apoe, with no effect on cholesterol efflux . However, cholesterol efflux to lipid - laden apoe, but not to lipid free apoe, is increased by abca7 expression in hek-293 cells . Sphingomyelin is enriched in extracellular herpes simplex viral membranes: this sphingomyelin, together with phosphatidylserine, is collected by the viral envelope during viral passage from the nuclear membrane to the exocytosis pathway . Herpes viral infection leads to an increased incorporation of phosphate into membrane sphingomyelin of the host . Inhibition of sphingomyelinase has also been shown to markedly reduce herpes simplex viral reproduction and also inhibits the antifungal effects of neutrophils against c. neoformans infection . Sphingomyelin is a receptor for the helicobacter toxin vaca and is also incorporated into inclusion bodies in c. pneumoniae - infected cells . Phosphatidylcholine plays an important role in the fusion of herpes simplex glycoproteins b and h with the host cell lipid membrane, a process used in viral entry . Ceramide, a potent activator of apoptosis, as well as its downstream target, caspase 3 (casp3) are both able to reactivate the herpes simplex virus from latency . Ceramide is also incorporated into c. pneumoniae inclusions, an effect that may play a role in the antiapoptotic effects of this bacterium . Apoa1 exerts antiviral effects against herpes simplex and inhibits viral entry into cells as well as viral - induced cell fusion and intercellular spread . In macrophages, abca7 is expressed intracellularly and does not participate in cholesterol or phospholipid efflux, instead playing a role in the phagocytosis of apoptotic cells, an important general defence mechanism against invading pathogens [62, 138]. Possession of the apoe4 allele facilitates the entry and transmission of herpes simplex in mice models . In man, apoe is also involved in hepatitis c, hiv-1, and herpes simplex infectivity [140143], and apoe4 facilitates the binding of c. pneumoniae elementary bodies to host cells . Apoe mrna is primarily expressed in the liver, adipocytes; kidney and brain, with very low expression in the peripheral immune network (http://www.biogps.org/#goto=genereport&id=348/) but nevertheless plays an important role in the immune system . For example, the presence of the apoe4 allele is associated with an enhanced macrophage inflammatory response, and cytokine responses to the intracerebral injection of lipopolysaccharide are increased in apoe4 transgenic mice, which also exhibit increased microglial activation . The anti - inflammatory effects of 17-beta - oeastradiol on microglia are also reduced in such animals [145, 146]. C - reactive protein (crp) levels are also decreased in apoe4 carriers [145147]. Crp is an acute phase protein that binds to phosphocholine on dead or dying cells and on bacteria, subsequently activating the complement pathway . Resistance to infection (klebsiella pneumoniae) or endotoxaemia is also decreased in apoe knockout mice . In addition, atherosclerosis is induced or worsened by infection with a number of relevant pathogens (cytomegalovirus, herpes simplex, helicobacter pylori, influenza, c. pneumoniae or p. gingivalis) in apoe knockout mice [150156]. Helicobacter pylori is able to promote atherosclerosis in heterozygous apoe (+ /) ldlr (+ /) mice, which is associated with an immune response to the bacterial heat shock protein hsp60 . Prior to the very large gwas collaboration, several other genes had been identified in smaller genomewide studies (apoc1, celf2, disc1, fam113b, gab2, mthfd1l, pax2, pcdh11x, pvrl2 rfc3, sash1, tomm40, ttll7, and znf224). Pvrl2 is a receptor for herpes simplex (hsv-1 and hsv-2), and the mitochondrial translocator, tomm40, a receptor for certain chlamydial species . The replication factor rfc3 is part of a complex necessary for human dna polymerase activity, a process exploited by many viruses including herpes simplex, whose virion component icp34.5 binds to proliferating cell nuclear antigen (pcna), an rfc3 binding partner and also a cofactor for dna polymerase . Protein arginine methylation is important in viral infection and replication, as well as in cytokine signalling, and a related arginine methyltransferase, prmt1, regulates herpes simplex replication via methylation of the icp27 viral gene . Disc1 is a component of the microtubule - associated dynein motor complex used in viral traffic; ttll7 (tubulin tyrosine ligase - like family, member 7) also regulates tubulin phosphorylation and can again be related to viral traffic along the microtubule network (see below). Celf2 (also known as cugbp2) is a member of the apobec1 cytidine deaminase mrna editing complex that also controls herpes simplex viral replication . Gab2 is a member of the grb2-associated binding protein family which act as adapter hubs transmitting signalling via cytokine and growth factor receptors, and t- and b - cell antigen receptors (definition from ncbi gene), while pax2 inhibits the expression of the antimicrobial peptide beta defensin (defb1), a gene associated with hsv-1 and cytomegalovirus seropositivity in children with acute lymphoblastic leukaemia, as well as with h. pylori or chlamydial infections [168, 169], also endowed with antimicrobial activity against c. neoformans and other pathogens . Mthd1l (methylenetetrahydrofolate dehydrogenase (nadp+ dependent) 1-like) is involved in the mitochondrial synthesis of tetrahydrofolate which in turn is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine (definition from ncbi gene). Many pathogens, including herpes simplex, express thymidylate kinases, which are important for viral replication and a target for acyclovir . Hyperhomocysteinaemia correlates with c. pneumoniae igg immunoreactivity in carotid artery atherosclerosis and is also associated with h. pylori infection in the context of atherosclerosis . The apolipoprotein apoc1 is a component of high - density lipoprotein: herpes simplex is present in all lipoprotein blood fractions in blood (vldl, ldl and hdl) and the lipid component of these lipoproteins binds to viral glycoprotein b (c.f . Apoa1, apoa4, apoa5, apoc1, apoc2, apoc3, apoc4, apod, and apoe). No immediately apparent pathogen - relevant interactions were found for fam113b (expressed exclusively in t cells, dendritic cells, and natural killer cells http://www.biogps.org/#goto=genereport&id=91523/), pcdh11x (which is ubiquitously expressed http://www.biogps.org/#goto=genereport&id=27328/), or sash1 (primarily expressed in the brain and lung although also in other tissues, including the immune network http://www.biogps.org/#goto=genereport&id=23328/) although the pathogen / immune theme is clearly carried through, particularly in relation to herpes simplex, in this second rank of alzheimer's disease susceptibility genes . Apoe, clusterin, and complement receptor 1 play key roles in beta amyloid clearance as do two further herpes simplex binding proteins apoa1, and alpha-2 macroglobulin (a2 m). A2 m, or apoe - bound a, is cleared by the lipoprotein receptor lrp1, while lrp2 (megalin) clears clusterin - bound a. lrp8 is a receptor for both apoe and clusterin . The role of abca7 has not been examined, although apoa1 is also a ligand for this transporter (see above). The varicella zoster and herpes simplex glycoprotein e binding protein, insulin - degrading enzyme, are also involved in beta - amyloid degradation, as is caspase-3 which is activated by the herpes simplex viral us3 kinase . The hsv-1 binding protein, complement c3 is also a ligand for lrp1 and lrp8, both of which play a role in c3 cellular uptake . Beta amyloid in the bloodstream is processed by its binding to complement c3, which subsequently binds to complement receptor 1 on erythrocytes . Clathrin - dependent endocytosis is also involved in the internalisation and recycling of neuronal app, a procedure necessary for the subsequent cleavage of app and the generation of beta - amyloid [175, 176], and in the neuronal, but not the microglial uptake of both soluble and aggregated beta - amyloids, the latter representing an important rout of disposal . However, while knockdown of the clathrin assembly protein ap180 in a neuronal cell line does reduce beta - amyloid generation, picalm knockdown does not . The accumulation of beta - amyloid in the brain interstitial space, related to the prior endocytosis of app, is clathrin dependent . Clathrin - mediated endocytosis is relevant to many receptors, including members of the lipoprotein family (lrp1, lrp2, lrp8, ldlr, vldlr), all of which are involved in beta - amyloid clearance, as well as in cholesterol and lipoprotein physiology . Abca7 plays a role in beta - amyloid secretion, which is increased in chinese hamster ovary cells expressing app and abca7 . This was related to an effect on app intracellular retention, rather than on secretase - mediated proteolysis of app . Gamma - secretase cleaves app, and other gamma - secretase substrates also play key roles in app processing (adam10), lipid and cholesterol function (lrp1, ldlr, vldlr), and other processes relevant to alzheimer's disease, for example, notch signalling . No other immediately apparent relationships with beta - amyloid could be found by literature survey for cd2ap, cd33, and epha1 or for ms4a - related proteins, although such are not precluded . Many pathogens, including herpes simplex, helicobacter, chlamydiae, p. gingivalis, and c. neoformans [185188], use the microtubule network that serves as a useful railway track between various cellular compartments, and may hijack dynein and kinesin motors for this purpose (see http://www.polygenicpathways.co.uk/herpeshost.html for herpes simplex). Tau hyperphosphorylation and neurofibrillary tangles are among the core pathologies of alzheimer's disease and can be promoted by herpes simplex infection . In relation to viral / human protein homology, herpes simplex proteins are homologous to a number of kinases known to phosphorylate tau (gsk3a, gsk3b, mapk1, and camk2b) suggesting that tau phosphorylation could be a direct result of a viral kinase . App plays a key role in the herpes simplex life cycle and is involved in its intracellular transport, an effect likely related to the ability of both app and the herpes simplex protein, us11, to bind to the app and kinesin binding protein appbp2 (also known as pat1) [194, 195]. The antimicrobial effects of beta - amyloidbeta - amyloid is an antimicrobial peptide with broad spectrum activity against a variety of yeasts and bacteria, effects that were attenuated by anti - a antibodies, beta - amyloid also has antiviral effects and, like acyclovir, attenuates the stimulatory effects of herpes simplex on mirna-146a levels in neuronal cells . Beta - amyloid also activates innate immune responses via the activation of pattern recognition receptors, such as toll receptors (tlr2, tlr4), which are also involved in beta - amyloid clearance [198, 199]. The antimicrobial, antiviral, and immunostimulant properties of beta amyloid are, however, likely to be abrogated by the presence of beta - amyloid autoantibodies in the sera of the ageing population and in alzheimer's disease . As immunogenic regions of beta - amyloid are homologous to similar regions within proteins expressed by all of the principal pathogens discussed in this paper, such antibodies are likely to be derived from antibodies raised to numerous pathogens (see below). Beta - amyloid is an antimicrobial peptide with broad spectrum activity against a variety of yeasts and bacteria, effects that were attenuated by anti - a antibodies, beta - amyloid also has antiviral effects and, like acyclovir, attenuates the stimulatory effects of herpes simplex on mirna-146a levels in neuronal cells . Beta - amyloid also activates innate immune responses via the activation of pattern recognition receptors, such as toll receptors (tlr2, tlr4), which are also involved in beta - amyloid clearance [198, 199]. The antimicrobial, antiviral, and immunostimulant properties of beta amyloid are, however, likely to be abrogated by the presence of beta - amyloid autoantibodies in the sera of the ageing population and in alzheimer's disease . As immunogenic regions of beta - amyloid are homologous to similar regions within proteins expressed by all of the principal pathogens discussed in this paper, such antibodies are likely to be derived from antibodies raised to numerous pathogens (see below). Gamma secretase: localisation to dendritic cells and cleavage of pathogen receptors gamma secretase is constituted of four components: the presenilins (psen1 or psen2), anterior pharynx - defective-1 (aph1a), the presenilin enhancer-2 (psenen), and nicastrin (ncstn). While all components are expressed in cerebral tissue, the major focus of distribution is within cells of the immune network; dendritic cells, myeloid cells, and monocytes for psen1 http://www.biogps.org/#goto=genereport&id=5663/; dendritic cells and natural killer cells for psenen http://www.biogps.org/#goto=genereport&id=55851/, dendritic cells and myeloid cells for nicastrin http://www.biogps.org/#goto=genereport&id=23385/ and b cells, dendritic cells, natural killer cells, and myeloid cells for aph1a . The substrate, app, is the only gene in this set that appears to be preferentially distributed in brain compartments, but, as with gamma - secretase components, it is also highly expressed in dendritic cells of the immune system (http://www.biogps.org/#goto=genereport&id=351/). The primary function of such cells is to process antigens and present them to b cells and t cells . They scout for and recognise pathogens via the agency of numerous pattern recognition receptors, for example, toll receptors (tlr2, tlr4), or viral dna sensors, expressed on their surface [202, 203].as well as cleaving app, gamma secretase is involved in the proteolysis of at least three herpes simplex receptors, nectin 1 alpha (pvrl1), and syndecans (sdc1, sdc2). Sdc1 is also a receptor for hiv-1, hepatitis e, and the human papillomavirus [206209], while sdc3, also a gamma secretase substrate, is an hiv-1 and papillomavirus receptor [210, 211].several other gamma secretase substrates (reviewed by lle and saura) also function as viral / pathogen receptors, including adam10, a receptor for the cytotoxin staphylococcus aureus alpha - haemolysin, cd44, an entry receptor for c. neoformans, cd46, a receptor for adenoviruses, measles virus, human herpes virus 6 (hhv-6), streptococci, and neisseria: cd46 is also cleaved by a protease secreted by p. gingivalis . Desmoglein-2 is an adenovirus receptor, while rhinovirus receptors include the lipoprotein receptors lrp1, ldlr, and vldlr [217, 218]. Notch1 and notch4 are activated by the epstein - barr virus [220, 221], while erbb4 is a receptor for vaccinia and other pox viruses . The low affinity nerve growth factor (ngfr) is a rabies virus receptor,, ephrin b2, (efnb2) a nipah virus and hendra virus receptor and sialophorin (spn), a receptor for the influenza a, and both human and simian immunodeficiency viruses [225, 226] and for the c. neoformans virulence factor, galactoxylomannan . Fractalkine (cx3cl1) binds to the cytomegalovirus chemokine receptor, us28, while the chemokine cxcl16 is a scavenger receptor for phosphatidylserine and oxidized low density lipoprotein: phosphatidylserine is the major lipid membrane component in most bacteria . Dystroglycan is a receptor for the lymphocytic choriomeningitis and lassa fever viruses [231, 232] and also for mycobacterium leprae (the leprosy pathogen). The antimicrobial and immunostimulant effects of beta - amyloid, the cleavage of a number of pathogen receptors by gamma secretase, and the concentration of both app and gamma - secretase components in dendritic cells suggest that a major function of this key group, implicated in both familial and late onset alzheimer's disease, is dedicated to pathogen defence, and that increased beta - amyloid generation is primarily a defence mechanism to rid the body (and brain) of invading pathogens: this scenario is supported by the ability of herpes simplex, c. pneumoniae, and b. burgdorferi to increase beta - amyloid deposition [234236]. One might expect many other pathogens to increase beta - amyloid deposition, and that, as has been noted in atherosclerosis, (a component of alzheimer's disease pathology), the final extent of risk may depend upon the overall pathogen burden, rather than upon any specific pathogen . Gamma secretase is constituted of four components: the presenilins (psen1 or psen2), anterior pharynx - defective-1 (aph1a), the presenilin enhancer-2 (psenen), and nicastrin (ncstn). While all components are expressed in cerebral tissue, the major focus of distribution is within cells of the immune network; dendritic cells, myeloid cells, and monocytes for psen1 http://www.biogps.org/#goto=genereport&id=5663/; dendritic cells and natural killer cells for psenen http://www.biogps.org/#goto=genereport&id=55851/, dendritic cells and myeloid cells for nicastrin http://www.biogps.org/#goto=genereport&id=23385/ and b cells, dendritic cells, natural killer cells, and myeloid cells for aph1a . The substrate, app, is the only gene in this set that appears to be preferentially distributed in brain compartments, but, as with gamma - secretase components, it is also highly expressed in dendritic cells of the immune system (http://www.biogps.org/#goto=genereport&id=351/). The primary function of such cells is to process antigens and present them to b cells and t cells . They scout for and recognise pathogens via the agency of numerous pattern recognition receptors, for example, toll receptors (tlr2, tlr4), or viral dna sensors, expressed on their surface [202, 203]. As well as cleaving app, gamma secretase is involved in the proteolysis of at least three herpes simplex receptors, nectin 1 alpha (pvrl1), and syndecans (sdc1, sdc2). Sdc1 is also a receptor for hiv-1, hepatitis e, and the human papillomavirus [206209], while sdc3, also a gamma secretase substrate, is an hiv-1 and papillomavirus receptor [210, 211]. Several other gamma secretase substrates (reviewed by lle and saura) also function as viral / pathogen receptors, including adam10, a receptor for the cytotoxin staphylococcus aureus alpha - haemolysin, cd44, an entry receptor for c. neoformans, cd46, a receptor for adenoviruses, measles virus, human herpes virus 6 (hhv-6), streptococci, and neisseria: cd46 is also cleaved by a protease secreted by p. gingivalis . Desmoglein-2 is an adenovirus receptor, while rhinovirus receptors include the lipoprotein receptors lrp1, ldlr, and vldlr [217, 218]. Notch1 and notch4 are activated by the epstein - barr virus [220, 221], while erbb4 is a receptor for vaccinia and other pox viruses . The low affinity nerve growth factor (ngfr) is a rabies virus receptor,, ephrin b2, (efnb2) a nipah virus and hendra virus receptor and sialophorin (spn), a receptor for the influenza a, and both human and simian immunodeficiency viruses [225, 226] and for the c. neoformans virulence factor, galactoxylomannan . Fractalkine (cx3cl1) binds to the cytomegalovirus chemokine receptor, us28, while the chemokine cxcl16 is a scavenger receptor for phosphatidylserine and oxidized low density lipoprotein: phosphatidylserine is the major lipid membrane component in most bacteria . Dystroglycan is a receptor for the lymphocytic choriomeningitis and lassa fever viruses [231, 232] and also for mycobacterium leprae (the leprosy pathogen). The antimicrobial and immunostimulant effects of beta - amyloid, the cleavage of a number of pathogen receptors by gamma secretase, and the concentration of both app and gamma - secretase components in dendritic cells suggest that a major function of this key group, implicated in both familial and late onset alzheimer's disease, is dedicated to pathogen defence, and that increased beta - amyloid generation is primarily a defence mechanism to rid the body (and brain) of invading pathogens: this scenario is supported by the ability of herpes simplex, c. pneumoniae, and b. burgdorferi to increase beta - amyloid deposition [234236]. One might expect many other pathogens to increase beta - amyloid deposition, and that, as has been noted in atherosclerosis, (a component of alzheimer's disease pathology), the final extent of risk may depend upon the overall pathogen burden, rather than upon any specific pathogen . Viruses and bacteria express proteins containing short contiguous amino acid stretches (pentapeptides or more, or longer gapped consensi) that are identical to those in human proteins: these pathogen / human consensi number in millions and concern all human proteins [238241]. Autoantibodies, which are observed in many, if not most human diseases, are often regarded as an epiphenomenon of little consequence . However, they can traverse the blood brain barrier (which is compromised in alzheimer's disease) and are also able to enter cells, essentially by hitching a ride on viruses, via high affinity igg receptors (fc gamma receptors) (fcer1 g) in the case of the rhinovirus, or the sars coronavirus, or via the tripartite motif protein, trim21, in the case of adenoviruses, where they are able to activate an intracellular immune attack . It would appear that the cellular entry of antibody laden viruses is diverted from their usually preferred receptors towards those used by antibodies [244246]. Fc gamma receptors are localised in microglia and astrocytes in the brain and their expression is upregulated by blood brain barrier disruption, while trim21 appears to be exclusively localised in peripheral immunocompetent cells (http://www.biogps.org/#goto=genereport&id=6737/). This ability places autoantibodies in a rather more sinister context, as their targeting of extracellular and intracellular human proteins would be expected to effect protein knockdown, a strictly immunopharmacological effect, as well as immune attack . In multiple sclerosis, schizophrenia, and cystic fibrosis, as well as in alzheimer's disease, numerous autoantigens targeted by the autoantibodies reported in these conditions, contain peptide sequences identical to those in the pathogens also implicated in the disease . Such regions of homology are focalised within epitope regions of the human autoantigen [192, 248250]. In parkinson's disease, antibodies to the epstein - barr virus, which has been implicated in postencephalitic adult and juvenile parkinsonism, are also known to cross - react with synuclein, a key protein involved in neurodegeneration in this disorder [251253]. In addition, 22 autoantigens reported in hiv-1/aids contain hiv-1/human matching sequences, supporting the contention that autoantibodies are in many cases antibodies initially raised to pathogens, which because of this homology, then target their human homologues . It has been argued that slightly dissimilar, rather than exact matches, are the more malignant in terms of autoimmunity, being less likely to be regarded as self, while the antibodies would retain low affinity for human counterparts [254, 255]. Autoantibody production would also be sustained, even after pathogen elimination, by continued encounter of the human homologue . The production of autoantibodies must be dependent upon the extent of pathogen / human matching, and thus by genes which determine human protein sequences . These pathogen / human matches are also highly and significantly enriched in the products of susceptibility genes implicated in alzheimer's disease, multiple sclerosis, and schizophrenia [192, 248, 250]. Many genes related to alzheimer's disease, including those described above, are involved in the immune network [10, 256], and the propensity for developing autoantibodies to particular proteins is also genetically determined and inherited . Thus, despite the fact that all human proteins likely possess pathogen homologues, whether or not autoantibodies will be produced will depend on the extent of human / pathogen matching (determined by human genes and the strain of pathogen encountered), on whether the pathogen protein is deemed as self or nonself (a factor determined soon after birth) and on other genetic factors related to the immune network, and autoimmunity . Somatic hypermutation, that drives the creation of multiple antibodies and which selects against those reacting to self, is disrupted in autoimmune disorders . These links suggest an interplay, applicable to many diseases, where susceptibility gene products, risk promoting pathogens and autoimmunity can all be related via protein sequence homology . It has also been noted that autoantigens have a tendency to relate to proteins known to bind to dermatan sulphate, a component of dead cells and a constituent of glycosaminoglycan receptors for many bacteria and viruses . All three of these proteins are autoantigens in alzheimer's disease and were chosen for analysis because of the ability of their antibodies to promote features of alzheimer's disease, in vivo . In mice, immunisation with neuronal tau produces neurofibrillary tangle - like structures, axonal damage, and gliosis, as in alzheimer's disease . In addition, in transgenic mice, initially expressing ngf antibodies only in lymphocytes, ngf antibodies subsequently enter the brain provoking extensive cortical degeneration, cholinergic neuronal loss, tau hyperphosphorylation, and beta - amyloid deposition . Beta - amyloid autoantibodies are also able to promote meningoencephalitis, both in laboratory models and in clinical trials [263, 264]. Beta - amyloid plaques contain numerous inflammatory proteins, and even without meningoencephalitis, these are commonly found within the walls of meningeal and medium - sized cortical arteries in alzheimer's disease . Almost the entire length of the tau protein (638/776 amino acids = 82.2%) was predicted as immunogenic (b cell epitope), as defined by the server set cutoff index of 0.35 . For the analysis in table 1, only regions of the tau protein with an immunogenicity index> 2.5 were examined for homology . For other proteins (ngf and beta - amyloid), the analysis concerned immunogenic regions above the cutoff value of 0.35 . All pathogens express proteins with homology to each autoantigen, specifically within predicted b - cell epitope regions of the human autoantigen (table 1), suggesting that antibodies raised to any could be responsible for targeting these human proteins, under the appropriate circumstances . Perversely, the successful elimination of the pathogen via antibody production could set in motion the very autoimmune responses that may be crucial to the development of alzheimer's disease, a pyrrhic victory, which would also be promulgated by any further encounter with these very common pathogens, or by structurally related proteins from other pathogens, as well as by continual encounter of the human autoantigen homologue (see section 3.6.5). As well as autoantibodies to these three proteins, a number of autoantibodies targeting highly relevant proteins have been reported in alzheimer's disease . These have functional effects on their target proteins and include antibodies that block the activity of atp synthase, induce apoptosis, and increase the cellular uptake of high density lipoprotein [266, 267], antibodies to cholinergic neurones that cause immunalysis of brain synaptosomes, antibrain antibodies that enhance intraneuronal beta - amyloid deposition as well as antibodies to the nicotinic receptor chrna7, that displace its ligand alpha - bungarotoxin: autoantibodies to the receptor for advanced glycation products (ager), to the antimicrobial peptide s100b, have also been reported . Using a classical example from the field of population genetics and darwinism, the light coloured genes of the peppered moth favour its selective predation by many different birds when it alights on dark trees covered with soot pollution, while darker melanised forms are selectively targeted on lighter coloured trees . The coloration susceptibility genes, or the variety of tree (risk factors), do not kill the moth but allow several causes to do so . The causes can hide in plain sight, as epidemiological studies, as applied to human diseases, could conclude that the birds are not killing the moths, as they are always present, on both sets of trees, in both genetic conditions, whether the moths are alive or dead (c.f . Many of the pathogens implicated in alzheimer's disease (herpes simplex, borrelia burgdorferi and c. pneumoniae), and several other risk factors (cholesterol, homocysteine, diabetes, or vitamin a or nerve growth factor deficiency) are able to promote cerebral beta - amyloid deposition in animal models, without the aid of any gene variant . Subsets of susceptibility genes can be related to each of these amyloidogenic pathways . In the case of genomewide association studies, the genes returned, as well as app, beta amyloid, and gamma secretase, seem intimately concerned with pathogen life cycles and defence and the immune network . This suggests that the diverse microbial risk factors as well as other dietary and environmental factors implicated in alzheimer's disease are in fact causative agents, whose deleterious effects are conditioned by susceptibility genes . As the environmental risk factors are amenable to therapy, while the susceptibility gene products have so far proved largely resistant, this suggests numerous ways with which to tackle the problem of alzheimer's disease . Herpes simplex reactivationalzheimer's disease plaques and tangles are highly enriched in human proteins used the herpes simplex during its life cycle, as well as in many immune - related proteins, suggesting that immune attack on a reactivated virus, diverted to neurones, which contain the complement membrane attack complex, may be ultimately responsible for the extensive neuronal destruction seen in alzheimer's disease . The herpes simplex virus establishes latency in neurones, existing as a dormant form where only the latency transcript is expressed . A number of factors again related to susceptibility genes and environmental risk factors in alzheimer's disease can be related to herpes simplex latency and reactivation . The cerebral herpes simplex viral load is decreased in apoe knockout mice, while the viral load is much increased in apoe4 transgenic mice, compared to apoe3 mice, suggesting that apoe4 favours the establishment of a greater number of latent viruses in cerebral tissue . In neuroblastoma cells, this latent form may even exert beneficial effects, blocking apoptosis and promoting neurite extension via akt1 upregulation . However, this latent form can be reactivated by ngf deprivation, and ngf promotes viral latency via the trka receptor ntrk1, the expression of which is reduced in the alzheimer's disease brain . (relevant pathways and genes: neurotrophin signalling (gsk3b, ntrk1, ntrk2, pik3r1, and sos2). Vitamin a supplementation in rats increases the cerebral levels of both ngf and bdnf, while oestrogen deficiency lowers cerebral ngf levels, an effect reversed by 17-beta oestradiol, which is, however, also able to reactivate the virus, via oestrogen receptor alpha (esr1). High levels of total oestradiol have been reported as a risk factor for alzheimer's disease in both women and men [282, 283]. Vitamin a related gens include apoe4, the isoform least able to transport the vitamin a precursor retinyl palmitate, a2 m abca1 alb aldh2 apoa1 chd4 clu cyp46a1 esr1 gstm1 gstp1 hspg2 klf5 lipa lpl lrat lrp2 lrpap1 mef2a npas2 nr1h2 parp1 pin1 pou2f1 ppara pparg rxra thra ttr ubqln1 vdr and many others controlled by retinoid receptor element (reviewed in).the virus can also be reactivated by heat, il6, or tnf . Il6 plasma and csf levels have been reported to be increased in alzheimer's disease and the secretion of il6 from monocytes is increased [287289]. Il6 plasma levels are raised by infection with c. pneumoniae or helicobacter pylori, and il6 production in monocytes is stimulated by c. neoformans . Stress - activated corticosterone is also able to reactivate the virus (pathway = steroid hormone biosynthesis: comt, cyp19a1, hsd11b1). Cortisol levels are increased in the ageing population and in alzheimer's disease [294, 295]. A number of related stressors including adrenaline, or downstream effectors such as cyclic amp, protein kinase a, or c activation are also able to reactivate the virus . Herpes simplex reactivation is blocked by beta - receptor antagonism (adrb1) [296, 298]. Glucocorticoids and prostaglandins are also able to reactivate the virus: cyclooxygenase inhibitors (ptgs2), celecoxib and indomethacin block viral reactivation and nonsteroidal anti - inflammatory use has been associated with a lower incidence of alzheimer's disease . Hypoxia also increases the replication of herpes simplex: transient cerebral ischaemia also lowers ngf levels, and these effects are relevant to the cerebral hypoperfusion seen in ageing and in alzheimer's disease . Vitamin a and the retinoic acid isomers all - trans-, 9-cis-, and 13-cis - retinoic acid are all able to reduce viral replication . Low vitamin a levels are a problem in the ageing population and even in successfully ageing persons can be observed in 50% of the population over the age of 8085 . Mice deficient in the nitric oxide synthase nos2 are also more susceptible to herpes virus infection, and reactivation occurs is stimulated by caspase 3 activation (casp3).thus, fever or cytokine release induced by diverse infections might be expected to reactivate herpes simplex as would several of the conditions associated with alzheimer's disease (cerebral hypoperfusion, low cerebral ngf levels, vitamin a deficiency, or high oestradiol levels). Alzheimer's disease plaques and tangles are highly enriched in human proteins used the herpes simplex during its life cycle, as well as in many immune - related proteins, suggesting that immune attack on a reactivated virus, diverted to neurones, which contain the complement membrane attack complex, may be ultimately responsible for the extensive neuronal destruction seen in alzheimer's disease . The herpes simplex virus establishes latency in neurones, existing as a dormant form where only the latency transcript is expressed . A number of factors again related to susceptibility genes and environmental risk factors in alzheimer's disease can be related to herpes simplex latency and reactivation . The cerebral herpes simplex viral load is decreased in apoe knockout mice, while the viral load is much increased in apoe4 transgenic mice, compared to apoe3 mice, suggesting that apoe4 favours the establishment of a greater number of latent viruses in cerebral tissue . In neuroblastoma cells, this latent form may even exert beneficial effects, blocking apoptosis and promoting neurite extension via akt1 upregulation . However, this latent form can be reactivated by ngf deprivation, and ngf promotes viral latency via the trka receptor ntrk1, the expression of which is reduced in the alzheimer's disease brain . (relevant pathways and genes: neurotrophin signalling (gsk3b, ntrk1, ntrk2, pik3r1, and sos2). Vitamin a supplementation in rats increases the cerebral levels of both ngf and bdnf, while oestrogen deficiency lowers cerebral ngf levels, an effect reversed by 17-beta oestradiol, which is, however, also able to reactivate the virus, via oestrogen receptor alpha (esr1). High levels of total oestradiol have been reported as a risk factor for alzheimer's disease in both women and men [282, 283]. Vitamin a related gens include apoe4, the isoform least able to transport the vitamin a precursor retinyl palmitate, a2 m abca1 alb aldh2 apoa1 chd4 clu cyp46a1 esr1 gstm1 gstp1 hspg2 klf5 lipa lpl lrat lrp2 lrpap1 mef2a npas2 nr1h2 parp1 pin1 pou2f1 ppara pparg rxra thra ttr ubqln1 vdr and many others controlled by retinoid receptor element (reviewed in). Il6 plasma and csf levels have been reported to be increased in alzheimer's disease and the secretion of il6 from monocytes is increased [287289]. Il6 plasma levels are raised by infection with c. pneumoniae or helicobacter pylori, and il6 production in monocytes is stimulated by c. neoformans . Stress - activated corticosterone is also able to reactivate the virus (pathway = steroid hormone biosynthesis: comt, cyp19a1, hsd11b1). Cortisol levels are increased in the ageing population and in alzheimer's disease [294, 295]. A number of related stressors including adrenaline, or downstream effectors such as cyclic amp, protein kinase a, or c activation are also able to reactivate the virus . Herpes simplex reactivation is blocked by beta - receptor antagonism (adrb1) [296, 298]. Glucocorticoids and prostaglandins are also able to reactivate the virus: cyclooxygenase inhibitors (ptgs2), celecoxib and indomethacin block viral reactivation and nonsteroidal anti - inflammatory use has been associated with a lower incidence of alzheimer's disease . Hypoxia also increases the replication of herpes simplex: transient cerebral ischaemia also lowers ngf levels, and these effects are relevant to the cerebral hypoperfusion seen in ageing and in alzheimer's disease . Vitamin a and the retinoic acid isomers all - trans-, 9-cis-, and 13-cis - retinoic acid are all able to reduce viral replication . Low vitamin a levels are a problem in the ageing population and even in successfully ageing persons can be observed in 50% of the population over the age of 8085 . Mice deficient in the nitric oxide synthase nos2 are also more susceptible to herpes virus infection, and reactivation occurs is stimulated by caspase 3 activation (casp3). Thus, fever or cytokine release induced by diverse infections might be expected to reactivate herpes simplex as would several of the conditions associated with alzheimer's disease (cerebral hypoperfusion, low cerebral ngf levels, vitamin a deficiency, or high oestradiol levels). These pathogens form a very small proportion of an extensive human microbiome comprising of trillions of bacteria, viruses, and other pathogens, whose influence on diseases is increasingly recognised . Individual species may exert benevolent or malevolent effects which may well be dictated by the very extensive sequence homology between human and pathogen proteins which enables pathogens to intercalate with numerous important signalling networks, via competition with their human counterparts [239, 241, 248, 250, 254]. These networks are implicated in diseases, and their efficiency, as well as pathogen / host homology, is dictated by susceptibility genes . This host / pathogen matching covers the entire human proteome and is represented by millions of short consensi of pentapeptides or more, not counting the longer gapped consensi . Clearly, powerful algorithms are needed to trawl human and pathogen proteomes and to link these homologies to susceptibility genes and to epitopes and autoantigens . The principles discussed here may apply to many other, if not most, human diseases . Protective agents in alzheimer's diseasestatins, fish consumption, omega-3 polyunsaturated fatty acids, the mediterranean diet, nonsteroidal anti - inflammatories, or the generally healthy life - style of nuns living in convents have all been associated with a reduced incidence or severity of alzheimer's disease, while homocysteine lowering b vitamins and folate have been shown to slow the rate of brain atrophy in cognitively impaired elderly patients . A rather pessimistic study recently stated that no firm conclusions could be drawn on the association of any modifiable factors with risk of alzheimer's disease . While this may be a justifiable statistical conclusion from meta - analysis, this is not to reckon with the diversity of the underlying genomic platform of each individual or with the profusion of diverse interacting risk and protective factors (epistasis, gene / environment, and environment / environment interactions).as with the risk factors, protective agents can be linked to genetic and pathological pathways involved in cholesterol and lipid function (statins, fish, and diet, e.g., abca1, abca2, abca7, abcg1, acads, aldh2, app, apoa1, apoa4, apoa5, apoc1 - 4, apoe, ch25h, cyp46a1, dhcr24, fdps, hmgcr, hmgcs2, hsd11b1, lipc, lrp1, lrp2, lrp8, ldlr, lipa, lpl, olr1, ppara, pparg, ptpla, vldlr, npc1, npc2, soat1, srebf1), homocysteine, methionine, and folate metabolism (folate and vitamins, e.g., blmh, cbs, comt, nat2, mthfd1l, mthfr, mtr, mtrr, pon1, pon2, pon3, vdr) and inflammatory pathways (nsaid's e.g., c4a, c4b, cd2ap, cd33, cfh, ccl2, ccl3, ccr2, csf1, clu, cr1, fas, gsk3b, il1a, il1b, il6, il8, il10, il18, plau, serpina1, serpine1, serpinf2, ptgs2, tgfb1, tnf). As with the risk factors, the success of such protective agents is likely to be determined by genes and other confounding factors . In this genomic era, affordable whole genome sequencing will soon be achieved, ushering in an age of more effective treatments tailored to individual genetic profiles . Alzheimer's disease is clearly multifactorial with many related genetic and environmental risk factors, several underlying pathologies, and several available protective strategies . A recent study has also shown that many other seemingly benign factors (eyesight, hearing, denture wearing, stomach, kidney, bladder or bowel problems, coughs, and colds) as well as high blood pressure and diabetes, constituting a frailty index, combine to markedly increase both the incidence and severity of alzheimer's disease . A further study, identifying physical inactivity, depression, smoking, mid - life hypertension or obesity, low education, and diabetes as key risk factors, has estimated that ~50% of alzheimer's disease cases may be preventable .elimination of the risk factors, including the regular detection and elimination of pathogens in the elderly, adherence to sensible dietary and vitamin supplement recommendations, and the genetically tailored use of certain drug regimens are together likely to be able to markedly reduce the incidence of alzheimer's disease . Using phage display, it is now possible to express peptide fragments of the entire human proteome in a phage library, and to use this to trap autoantibodies in blood or other bodily fluid samples . Such technology is likely to be extremely useful in characterising biomarkers and pathological immune processes as well as potential pathogen / human cross-reactivity.proteome-wide characterisation of the autoantibodies relevant to alzheimer's disease (a move from gwas to pwas) would also be very informative as selective autoantibody removal via affinity dialysis might well be expected to influence the severity and progression of alzheimer's disease.since the submission of this paper, miklossy has reported a highly significant association between spirochete infection and alzheimer's disease . As well as b. burgdorferi, several periodontal pathogen treponemas species were detected in brain samples and the pathological features of alzheimer's disease were reproduced by infection in vitro . In addition, two groups have reported a very extensive repertoire of autoantigens in alzheimer's disease, which can be characterised with a high degree of accuracy by a definitive immunosignature [320, 321]. The principles outlined above could thus be tested by analysis of pathogen / autoantigen cross - reactivity . Statins, fish consumption, omega-3 polyunsaturated fatty acids, the mediterranean diet, nonsteroidal anti - inflammatories, or the generally healthy life - style of nuns living in convents have all been associated with a reduced incidence or severity of alzheimer's disease, while homocysteine lowering b vitamins and folate have been shown to slow the rate of brain atrophy in cognitively impaired elderly patients . A rather pessimistic study recently stated that no firm conclusions could be drawn on the association of any modifiable factors with risk of alzheimer's disease . While this may be a justifiable statistical conclusion from meta - analysis, this is not to reckon with the diversity of the underlying genomic platform of each individual or with the profusion of diverse interacting risk and protective factors (epistasis, gene / environment, and environment / environment interactions). As with the risk factors, protective agents can be linked to genetic and pathological pathways involved in cholesterol and lipid function (statins, fish, and diet, e.g., abca1, abca2, abca7, abcg1, acads, aldh2, app, apoa1, apoa4, apoa5, apoc1 - 4, apoe, ch25h, cyp46a1, dhcr24, fdps, hmgcr, hmgcs2, hsd11b1, lipc, lrp1, lrp2, lrp8, ldlr, lipa, lpl, olr1, ppara, pparg, ptpla, vldlr, npc1, npc2, soat1, srebf1), homocysteine, methionine, and folate metabolism (folate and vitamins, e.g., blmh, cbs, comt, nat2, mthfd1l, mthfr, mtr, mtrr, pon1, pon2, pon3, vdr) and inflammatory pathways (nsaid's e.g., c4a, c4b, cd2ap, cd33, cfh, ccl2, ccl3, ccr2, csf1, clu, cr1, fas, gsk3b, il1a, il1b, il6, il8, il10, il18, plau, serpina1, serpine1, serpinf2, ptgs2, tgfb1, tnf). As with the risk factors, the success of such protective agents is likely to be determined by genes and other confounding factors . In this genomic era, affordable whole genome sequencing will soon be achieved, ushering in an age of more effective treatments tailored to individual genetic profiles . Alzheimer's disease is clearly multifactorial with many related genetic and environmental risk factors, several underlying pathologies, and several available protective strategies . A recent study has also shown that many other seemingly benign factors (eyesight, hearing, denture wearing, stomach, kidney, bladder or bowel problems, coughs, and colds) as well as high blood pressure and diabetes, constituting a frailty index, combine to markedly increase both the incidence and severity of alzheimer's disease . A further study, identifying physical inactivity, depression, smoking, mid - life hypertension or obesity, low education, and diabetes as key risk factors, has estimated that ~50% of alzheimer's disease cases may be preventable . Elimination of the risk factors, including the regular detection and elimination of pathogens in the elderly, adherence to sensible dietary and vitamin supplement recommendations, and the genetically tailored use of certain drug regimens are together likely to be able to markedly reduce the incidence of alzheimer's disease . Using phage display, it is now possible to express peptide fragments of the entire human proteome in a phage library, and to use this to trap autoantibodies in blood or other bodily fluid samples . Such technology is likely to be extremely useful in characterising biomarkers and pathological immune processes as well as potential pathogen / human cross - reactivity . Proteome - wide characterisation of the autoantibodies relevant to alzheimer's disease (a move from gwas to pwas) would also be very informative as selective autoantibody removal via affinity dialysis might well be expected to influence the severity and progression of alzheimer's disease . Since the submission of this paper, miklossy has reported a highly significant association between spirochete infection and alzheimer's disease . As well as b. burgdorferi, several periodontal pathogen treponemas species were detected in brain samples and the pathological features of alzheimer's disease were reproduced by infection in vitro . In addition, two groups have reported a very extensive repertoire of autoantigens in alzheimer's disease, which can be characterised with a high degree of accuracy by a definitive immunosignature [320, 321]. The principles outlined above could thus be tested by analysis of pathogen / autoantigen cross - reactivity.
|
Contacts between amino acid side chains are fundamental during protein folding, especially those contacts between pairs of residues that preserve the native state of the protein . These contacts are often well separated in the sequence but close in the protein 3d structure . New methods to predict contacts, based on different approaches, are continuously appearing (16). The importance of contact prediction has been pointed out in international experiments, such as the critical assessment of protein structure prediction [casp, (7)], where contact prediction is evaluated within the ab initio category, and the critical assessment of fully automated protein structure prediction [cafasp, (8)] where these kind of predictions are evaluated as well . These experiments revealed that contact prediction techniques are still not of sufficient quality to allow them to be used as the only source of information in protein structure prediction, even though, as demonstrated in the comparison carried out in the context of the cafasp3 challenge, they can predict contacts of a similar quality to other ab initio methods, i.e. Fragments - based methods, such as rosetta (9), threading methods, such as genthreader (10) and fugue (11), and comparative modelling servers, such as pcomb (12). The need to monitor progress in this field motivated us to develop an automatic contact prediction evaluation service that will allow the scientific community to compare results of these kind of predictions in a systematic way . In particular we are interested in establishing the limits reachable by contact prediction methods in comparison with other prediction approaches . Evacon evaluates raw contact predictions produced by the contact specialists and also evaluates, in terms of implicitly predicted 3d contacts, methods for the full reconstruction of protein models (i.e. Comparative modelling and threading / fold recognition servers). The results of evacon allow a direct comparison between contact predictions produced by the specialists and predictions extrapolated from the 3d models produced by protein structure prediction servers . Overall, the results are potentially informative about the ability of the contact specialists to produce 3d restraints, something that could be used by other ab initio methods to produce protein models, or that could be used as additional information to select models generated by other prediction methods (1315). Evacon realises the continuous evaluation of protein structure prediction servers, using the facilities of the eva system for assessing the servers, retrieving the new structures from pdb and building homogeneous datasets for testing the methods (16,17). A set of estimations are applied for the evaluation of the contact predictions following the standards commonly accepted in the field and used for the evaluations of casp and cafasp (see for the description of the evaluation). Two residues are considered to be in contact when the separation between their c - beta atoms (c - alpha for gly) is 8 . There is also the possibility of re - evaluating the predictions with a variable distance threshold (which can be chosen by the user) for the definition of contact . For 3d models without side chains, predictions from contact specialists are usually received as a list of predicted contacts sorted by a reliability value . We evaluate different levels of prediction, by selecting a number of predicted contact pairs proportional to the protein length . For 3d prediction servers that do not have values of reliability associated to each pairwise distance, we sample an equivalent number of predicted pairs . Evaluations are carried out for a number of pairs corresponding to: l/10, l/5, l/2, l and 2 times the protein length (l). The predictions are evaluated in terms of accuracy (acc), improvement over random (imp), coverage (cov) and xd . Acc = number of correctly predicted contactsall contacts predicted imp = accaccrand the accuracy of a random prediction (accrand) is obtained assuming that all the possible pairs of the experimental structure in the corresponding ranges of sequence distance separation are potential contacts (c). Accrand = number of observed contactsc cov = number of correctly predicted contactsnumber of observed contact xd=i=1i=15(pippia)(di15) xd is the weighted harmonic average difference between the distance distribution of the predicted contacts and the all - pairs distance distribution . Di is the distance representing each bin, the upper limit (normalized to 60). Pip is the percentage of predicted pairs whose distance is included in the i bin . Defined in this way, xd> 0 indicates the positive cases where the population of predicted contacts' distances is shifted to lower distances (19). For a random prediction the predictions are also evaluated for several values of sequence deviation from the predicted residue (delta, 14), giving the percentage of correctly predicted contacts within delta residues of the experimental contact . This means that a predicted contact between two residues i and j is considered correct if there is a contact observed between any (i delta, i + delta) and any (j delta, j + delta). All these measures are calculated for three different ranges of contacts: short range contacts (at least 6 residues of sequence separation between the residues of the pair), medium range contacts (at least 12 residues of sequence separation between the residues of the pair) and long range contacts (at least 24 residues of sequence separation between the residues of the pair). A set of prediction servers have been evaluated in evacon during the last 30 weeks (table 1). We would like to invite any other automated servers to join the eva evaluation system . The current interface provides an easy navigation for target structures and prediction methods (figure 1): evacon provides a fast graphical view with directly accessible results that give an overview of the performance of the servers . These pages include results (with graphs, tables and raw files for acc, imp, cov and xd) for each individual server, a summary of the mean accuracy over the weeks of the current year and also a comparison of the accuracies of the servers for the set of all the proteins during the current week.the dynamic section provides an in - depth view of the results, suitable for method developers . For example, it makes it possible to define subsets of proteins of interest common to all methods, and to visualize the comparative performances of the servers on these proteins . The results are presented as graphs, tables and raw files.evacon includes an additional facility for the direct evaluation of contact predictions that is intended for developers in order to evaluate the predictions of their methods according to the eva criteria . These can be submitted in contact prediction format or as pdb files together with the corresponding experimental structure . Evacon provides a fast graphical view with directly accessible results that give an overview of the performance of the servers . This initial view is composed of static pages that are regenerated every week . These pages include results (with graphs, tables and raw files for acc, imp, cov and xd) for each individual server, a summary of the mean accuracy over the weeks of the current year and also a comparison of the accuracies of the servers for the set of all the proteins during the current week . The dynamic section provides an in - depth view of the results, suitable for method developers . For example, it makes it possible to define subsets of proteins of interest common to all methods, and to visualize the comparative performances of the servers on these proteins . Evacon includes an additional facility for the direct evaluation of contact predictions that is intended for developers in order to evaluate the predictions of their methods according to the eva criteria . These can be submitted in contact prediction format or as pdb files together with the corresponding experimental structure . Another possibility of the system is to perform evaluations with a variable distance cutoff for the definition of contact which can be chosen by the user (apart from the default8 between c - beta atoms). This option can be accessed also from the main page of evacon, through the link choose a different contact distance and see results for the evaluated targets. This option is also available for the evaluation of predictions submited by the user [point (iii) above]. It is still too soon to establish a clear ranking of the performance of the servers, due to the small number of weeks that the evaluation has been active . Despite this, the assessment yields very similar results for the contact specialist methods and the 3d structure prediction servers . For some protein targets, contact specialists are performing much better than the 3d prediction methods evaluated by evacon . For instance, protein 1pxe chain a (zinc binding domain of the neural zinc finger transcription factor 1), where gpcpred (5) has an accuracy of 50% with a coverage of contacts predicted of 27.3%, twice the accuracy and coverage of fugue (11), the best performing threading server for this protein . Another interesting example is the case of the target 1xjh chain a (redox switch domain of the escherichia coli hsp33), where the best result is produced by cmappro_band (3), with a prediction accuracy of 66.7% and a coverage of 20%, and where the best threading prediction, in this case done by wurst (20), is only able to achieve an accuracy of 58.3% and a coverage of 17.5% . These results seem to confirm our initial observations (8), and if confirmed in the following weeks with additional proteins and methods, it will demonstrate the utility of adding contact prediction methods to the set of tools used in fold recognition approaches . A set of estimations are applied for the evaluation of the contact predictions following the standards commonly accepted in the field and used for the evaluations of casp and cafasp (see for the description of the evaluation). Two residues are considered to be in contact when the separation between their c - beta atoms (c - alpha for gly) is 8 . There is also the possibility of re - evaluating the predictions with a variable distance threshold (which can be chosen by the user) for the definition of contact . For 3d models without side chains, predictions from contact specialists are usually received as a list of predicted contacts sorted by a reliability value . We evaluate different levels of prediction, by selecting a number of predicted contact pairs proportional to the protein length . For 3d prediction servers that do not have values of reliability associated to each pairwise distance, we sample an equivalent number of predicted pairs . Evaluations are carried out for a number of pairs corresponding to: l/10, l/5, l/2, l and 2 times the protein length (l). The predictions are evaluated in terms of accuracy (acc), improvement over random (imp), coverage (cov) and xd . Acc = number of correctly predicted contactsall contacts predicted imp = accaccrand the accuracy of a random prediction (accrand) is obtained assuming that all the possible pairs of the experimental structure in the corresponding ranges of sequence distance separation are potential contacts (c). Accrand = number of observed contactsc cov = number of correctly predicted contactsnumber of observed contact xd=i=1i=15(pippia)(di15) xd is the weighted harmonic average difference between the distance distribution of the predicted contacts and the all - pairs distance distribution . Di is the distance representing each bin, the upper limit (normalized to 60). Pip is the percentage of predicted pairs whose distance is included in the i bin . Defined in this way, xd> 0 indicates the positive cases where the population of predicted contacts' distances is shifted to lower distances (19). For a random prediction the predictions are also evaluated for several values of sequence deviation from the predicted residue (delta, 14), giving the percentage of correctly predicted contacts within delta residues of the experimental contact . This means that a predicted contact between two residues i and j is considered correct if there is a contact observed between any (i delta, i + delta) and any (j delta, j + delta). All these measures are calculated for three different ranges of contacts: short range contacts (at least 6 residues of sequence separation between the residues of the pair), medium range contacts (at least 12 residues of sequence separation between the residues of the pair) and long range contacts (at least 24 residues of sequence separation between the residues of the pair). A set of prediction servers have been evaluated in evacon during the last 30 weeks (table 1). We would like to invite any other automated servers to join the eva evaluation system . The current interface provides an easy navigation for target structures and prediction methods (figure 1): evacon provides a fast graphical view with directly accessible results that give an overview of the performance of the servers . This initial view is composed of static pages that are regenerated every week . These pages include results (with graphs, tables and raw files for acc, imp, cov and xd) for each individual server, a summary of the mean accuracy over the weeks of the current year and also a comparison of the accuracies of the servers for the set of all the proteins during the current week.the dynamic section provides an in - depth view of the results, suitable for method developers . For example, it makes it possible to define subsets of proteins of interest common to all methods, and to visualize the comparative performances of the servers on these proteins . The results are presented as graphs, tables and raw files.evacon includes an additional facility for the direct evaluation of contact predictions that is intended for developers in order to evaluate the predictions of their methods according to the eva criteria . These can be submitted in contact prediction format or as pdb files together with the corresponding experimental structure . Evacon provides a fast graphical view with directly accessible results that give an overview of the performance of the servers . This initial view is composed of static pages that are regenerated every week . These pages include results (with graphs, tables and raw files for acc, imp, cov and xd) for each individual server, a summary of the mean accuracy over the weeks of the current year and also a comparison of the accuracies of the servers for the set of all the proteins during the current week . The dynamic section provides an in - depth view of the results, suitable for method developers . For example, it makes it possible to define subsets of proteins of interest common to all methods, and to visualize the comparative performances of the servers on these proteins . Evacon includes an additional facility for the direct evaluation of contact predictions that is intended for developers in order to evaluate the predictions of their methods according to the eva criteria . These can be submitted in contact prediction format or as pdb files together with the corresponding experimental structure . Another possibility of the system is to perform evaluations with a variable distance cutoff for the definition of contact which can be chosen by the user (apart from the default8 between c - beta atoms). This option can be accessed also from the main page of evacon, through the link choose a different contact distance and see results for the evaluated targets. This option is also available for the evaluation of predictions submited by the user [point (iii) above]. It is still too soon to establish a clear ranking of the performance of the servers, due to the small number of weeks that the evaluation has been active . Despite this, the assessment yields very similar results for the contact specialist methods and the 3d structure prediction servers . For some protein targets, contact specialists are performing much better than the 3d prediction methods evaluated by evacon . For instance, protein 1pxe chain a (zinc binding domain of the neural zinc finger transcription factor 1), where gpcpred (5) has an accuracy of 50% with a coverage of contacts predicted of 27.3%, twice the accuracy and coverage of fugue (11), the best performing threading server for this protein . Another interesting example is the case of the target 1xjh chain a (redox switch domain of the escherichia coli hsp33), where the best result is produced by cmappro_band (3), with a prediction accuracy of 66.7% and a coverage of 20%, and where the best threading prediction, in this case done by wurst (20), is only able to achieve an accuracy of 58.3% and a coverage of 17.5% . These results seem to confirm our initial observations (8), and if confirmed in the following weeks with additional proteins and methods, it will demonstrate the utility of adding contact prediction methods to the set of tools used in fold recognition approaches . The prediction of 3d contacts between amino acids is an active field of research, in which new methods are continually appearing . We introduce here evacon, an automatic system for the continuous evaluation of contact predictions . With the evacon evaluation, we want to help developers to test their new methods, and compare their results with others . The dynamic part of the system is particularly interesting for them, since it allows the production of common subsets of proteins adequate for the equilibrated evaluation of the methods . But above all, we think evacon can be very useful for biologists as a way to check which servers produce better predictions (or predictions with certain characteristics of coverage, accuracy,), based on an independent statistically reliable comparison . One of the reasons for that is that the comparison between methods based on the original publications is difficult since they are based on different datasets . Evacon can also be useful to test the potential use of contact prediction as additional restraints incorporated in other methods, for example, as assistance in the selection of correctly folded models . We also think that the system can be of interest for protein modellers searching for the best method from which to obtain additional structural information . It will allow a statistically valid comparison between contact prediction methods and general protein structure prediction methods . This continuous assessment produces rankings that are statistically more significant than those at casp, an experiment that takes place over just 23 months every 2 years, over a relatively small number of target sequences . Unlike casp we hope to be able to increase the number of servers evaluated by evacon and to produce an accurate evaluation of the current methods when the evaluation server has been running for a sufficient number of weeks . Furthermore, we foresee using the results of evacon to evaluate the relation between prediction methods and classes of proteins, under the assumption that some contact methods might lead to better predictions for some specific class of proteins or structural motifs . The system is composed of three different modules: one of them provides a fast view of the results through static pages that are regenerated every week . The second one is composed of a query - based system that allows a flexible display of the results . The third module is a service for the direct evaluation of contact predictions that can be submitted by users and method developers.
|
Laparotomy in goat is an invasive surgical procedure into the abdominal cavity that allows visual examination of abdominal organs and documentation and correction of certain pathologic abnormalities observed [1, 2]. Generally, it constitutes the single largest group of surgical operations carried out in ruminants [3, 4]. Laparotomy is indicated for exploration of abdominal and pelvic cavities and other surgical procedures involving abdominal and pelvic organs; other specific indications are caesarean section, embryo transfer to produce transgenic goats, ovariectomy, rumenotomy, abomasotomy, ventral abdominal herniorrhaphy, intestinal resection, anastomosis, and cystotomy [511]. Two approaches (flank and midventral) have been recognized and are currently in use in both small and large animals surgery; however in ruminants flank approach is the most widely and frequently practiced [1, 2]; due to the fact that surgical site can be visualized and observed from a distance and access healing, it was also reported to have reduced potential risk for evisceration if wound dehiscence is to occur, and the overlapping arrangement of the oblique muscles in the flank helps maintain the integrity of the abdominal wall if wound complication occurs . The flank laparotomy approach is the most widely used among small ruminants surgeons for accessing abdominal and pelvic organs . However, the approach is associated with some challenges: animals tend to rub the surgical site during healing against available solid objects leading to loosening of sutures and subsequently formation of wound dehiscence, prolonged lateral recumbency in goats under anaesthesia is associated with decrease in rumen stasis thereby predisposing the animal to bloat and toxemic lactic acidosis, and the accessibility to the distant organs (far proximal or distal to the point of incision) is also limited . We hypothesized that midventral laparotomy approach could be an alternative to flank laparotomy approach without much intra- and postsurgical complications . To test this hypothesis we compare the surgical wound assessment, intra- and postsurgical assessment, haematological profile, and subjective healing interval of the two laparotomy approaches . The aim of the study was to compare and evaluate flank and midventral laparotomy approaches in goats . Ten (n = 10) apparently healthy goats free of any dermatological lesions with average age of 12 2.1 months (mean sd), male and female of different breeds, and average weight of 13.4 2 kilograms (mean sd) were used for the investigation . The goats were kept at the usmanu danfodiyo university veterinary teaching hospital facilities and were conditioned for two weeks during which they were evaluated and stabilized for surgery . During evaluation serial blood sampling was done for comprehensive haematology to ascertain that the goats are fit for surgery and fecal sample was also collected to ascertain the intestinal worms burden . The goats were maintained on daily ration comprising wheat bran, bean husks, ground nut hay, and water ad libitum . The goats were randomly grouped into flank (fa) and midventral (mva) approaches . Feed and water were withdrawn from animals at least 12 hours prior to the surgery . The left flank region of each goat in the fa group was prepared for routine aseptic surgery by clipping the hairs around the proposed surgical site; the site was scrubbed with purit solution containing chlorhexidine gluconate b. p. 0.3% w / v (saro lifecare limited, lagos, nigeria) and rinsed with methylated spirit (binji pharmaceutical company, sokoto, nigeria). (sahib singh agencies, mumbai, india) at 4 mg kg through lumbosacral epidural anaesthesia as described by . The epidural space was identified by loss of resistance to injection of 1 ml of air after piercing the ligamentum flavum . Mild sedation was achieved using xylazine 20 (xylazine hcl 20 mg ml, kepro holland) at 0.025 mg kg intramuscular and atropine sulphate 0.6 mg ml (laborate pharmaceuticals india) at 0.05 mg kg intramuscular as vagolytic agent . Laparotomy was done according to standard procedure described by [1, 3, 14]. The laparotomy was routinely closed from within outward; muscle layers were closed using becton chromic catgut of the size of 1/0 and atraumatic 1/2 circle taper point needle (anhui kangning industrial groups, china) using interrupted horizontal mattress suture pattern with simple interrupted reinforcement . The subcutaneous layer was closed using becton chromic catgut of the size of 2/0 and atraumatic 1/2 circle taper point needle using simple continuous suture pattern . The skin was closed using ford interlocking pattern with agary nylon of the size of 0 and atraumatic 3/8 curved, cutting needle (agary pharmaceuticalsltd, xinghuai, china). In mva group, laparotomy was done through linea alba in all female goats with little paramedian incision at the level of prepuce in all the males according to standard procedure described by [1, 3, 4]. The incision was closed routinely in three layers from within outward (linea alba, subcutaneous layer, and skin) with the same suture materials as described in fa group . 5% acetaminophen injection 10 mg kg intramuscular (cadence pharmaceutical inc ., ireland) was administered for 3 days after surgery to take care of postoperative pain . Long acting 15% amoxicillin injection 20 the clinical appearance of the skin was assessed and scored twice: 1824 hours and 1014 days after surgery as described by using 4-point scoring scale, based on the following criteria: discharge, swelling, erythema, and dehiscence . Blood samples were collected from each animal in the two groups through the jugular vein after thorough disinfection of the area with methylated spirit; the sample was collected using 5 ml syringe and needle into edta bottles . The samples were collected before surgery as baseline, 1824 hours after surgery, and subsequently on weekly interval till complete healing when sutures were removed . The samples were analyzed using digital automated haemoanalyser (full automated blood cell counter pce-210, erma inc ., intra- and postsurgical complications were assessed using 3-point scoring system designed by ourselves; parameters considered were intraoperative haemorrhages, postsurgical seroma, incisional hernia, and wound fistula (table 1). Subjective healing interval was determined by visual observation and taking notes of days of apparent surgical site healing according to . Data generated from the four parameters (surgical wound scoring, haematology, surgical complications, and healing interval) were tabulated and mean and standard deviation were computed in each case . Student's t - test was used to compare statistical significant difference between the flank and midventral variables of each parameter at 95% confident interval using graphpad instat statistical software package 2010 . At 1824 hours after surgery, there was serous discharge in all groups; the mean discharge scores were (0.80 0.45 and 0.80 0.84) for flank and midventral approaches, respectively . There was no significant difference between the two groups when compared . At 1014 days after surgery midventral group had higher swelling score (2.00 00) in comparison with flank approach (1.8 0.45) and the overall swelling score was higher at 1824 hours after surgery compared to 1014 days after surgery (0.50 0.56 and 0.80 0.45) in flank and midventral, respectively (table 2). There was no significant difference between flank and midventral approach both at 1824 hrs and at 1014 days after surgery . The flank approach at 1824 hours had higher erythema score (1.40 0.55) when compared with midventral group (0.80 0.45) and there was significant difference (p <0.05) of erythema between the two approaches (table 2). At 1014 days after surgery, flank approach had higher erythema score (0.25 0.50) while midventral approach had no erythema record and there was significant difference (p <0.05) between the two approaches . Dehiscence was not recorded at 1824 hours after surgery in all the groups; however, at 1014 days after surgery dehiscence was observed in flank approach with significant difference (p <0.05) between the two groups (table 2). Intraoperative haemorrhage score was higher in flank approach (1.4 0.55) when compared with midventral approach (1.00 0.70); there was no significant difference (p> 0.05) between the two groups (table 3). There were no postoperative complications of incisional hernia, seroma, and wound fistula recorded . There were variations of total white blood cells (wbc) count of the two approaches before surgery, at 1824 hours, and at the first and second week after surgery; the midventral group had higher wbc value at all the intervals with significant differences (p <0.05) at first and second week after surgery (table 4). There were slight variations of total granulocytes between the two groups with the midventral group having the higher values at all the intervals, but there is no significant difference between the two groups (table 4). The lymphocytes values of the two groups also varied and the midventral approache had the highest value . There were significant differences (p <0.05) recorded between the two approaches at first and second week interval: 21.33 8.22 flank approach against 28.32 11.98 midventral approach and 15.20 3.52 flank approach against 25.48 6.00 midventral approach (table 4). There were also slight variations of monocytes values between the flank and midventral approaches at different timing interval; the midventral had higher values when compared with flank approach but there were no significant differences between the two approaches at any given time interval (table 4). The values of the platelets varied slightly between the two approaches, with the midventral approach having a higher value when compared with flank approach, and there was no significant difference between the two approaches at all the timing intervals (table 5). The platelets critical values varied between the two approaches with the midventral having the higher values; there was significant difference (p <0.05) at second week interval between the flank and midventral approach (0.15 0.04 against 0.25 0.08), respectively (table 5). The mean platelets volumes also showed slight variations between the two groups, but there was no significant difference between the groups at any of the timing intervals; the midventral approach had higher values when compared with the flank approach (table 5). The platelets dimension width values were slightly higher in midventral approach compared to flank approach and a significant difference (p <0.05) was recorded between the two approaches at 1824-hour interval (table 5). The packed cells volume of the two approaches showed slight variations with the midventral approach having the higher pcv values when compared with the flank approach . There was significant difference (p <0.05) recorded at one week interval between the two approaches (table 6). There were no significant differences (p> 0.05) between the two approaches in all other erythrocytic indices (red blood cells count, haemoglobin, mean corpuscular volume, mean corpuscular haemoglobin, mean corpuscular haemoglobin concentration, and red blood cells distribution width). However, the values of midventral approach are higher at different timing intervals in all other erythrocytic indices (table 6). The mean subjective healing intervals were 13.0 1.14 and 12.4 0.5 for flank and midventral approach . There was no significant difference (p = 0.643) between the two groups when compared (figure 1). Laparotomy is commonly indicated either for exploratory purposes when clinical diagnosis is uncertain or for therapeutic surgical intervention when specific diagnosis has been made . Flank approach is the most commonly practiced technique among large animal surgeons with the animal under local anaesthesia . Ventral paramedian or midventral laparotomy approach is an alternative practice by few large animal surgeons that necessitates the animal placement in dorsal recumbency . The two main indications in bovine are ventral abomasopexy and cesarean section, in which it offers advantages in the delivery of oversized or emphysematous fetuses and in complicated deliveries, including uterine tears [12, 19]. Surgical wound assessment showed significant difference of erythema both at 1824 and at 1014 days after surgery with flank approach having the highest erythema score and this could be due to surgical trauma elucidated by the traumatic surgical instruments on the soft tissue in the course of surgery; this is because the flank region has three layers of abdominal muscles that have to be passed through before getting access into the abdominal cavity in comparison with midventral approach through linea alba aponeurosis (ligament) which is passed through before gaining access to abdominal cavity; the ligament poorly responds to pressure of traumatic surgical instruments which brought about the less erythematous response . The high erythema score recorded in flank approach could also be a result of abdominal muscles tissue response to absorbable suture materials used for apposing the muscles mass which is more bulky than that of midventral approach . The overall scoring showed higher erythema earlier before surgery at 1824 hours and this finding is consistent with the studies conducted by [15, 17] where significant differences among the variables were observed . Dehiscence was also observed in the flank approach at 1014 days after surgery with significant difference when compared with midventral approach; this could be a result of scratching the surgical site (flank) with available objects in the pen as a result of tissue irritation in the course of healing process . It could also be due to self - mutation with horn of hind limbs in response to tissue irritation . Dehiscence score was by far less in midventral approach due to lesser chances of scratching and self - mutilation around the region . Our finding was contrary to that of, which recorded no dehiscence in a similar study using canine species, and that of, which recorded mild dehiscence both at 1824 hours and at 1014 day after surgery but without significant difference in a similar study using caprine species . The intraoperative hemorrhage score recorded was higher in the flank approach compared with the midventral approach, though without significant difference; this could be a result of high vascular channels available in the abdominal muscle mass when compared to poor vasculatures associated with tendons and ligament in the linea alba . This could serve as one of the advantages of midventral approach particularly when dealing with nonelective laparotomy in which the patient hematocrit reading is below normal range . The packed cell volume (pcv) of the flank approach decreased significantly one week after surgery when compared with midventral approach; this could be due to high intraoperative hemorrhage recorded . This finding was in line with the finding of [20, 21], both in a study involving laparotomy with goat; they noted that remarkable hematocrit decreased after surgery with significant difference . Higher values of total white blood cells count and lymphocytes count were recorded in midventral approach at the second week after surgery with significant difference when compared with the flank approach and this could be attributed to high persistent chronic inflammatory response in the course of tissue repair or it could be due to surgical stress because midventral approach is more stressful in relation to surgical positioning than lateral recumbency . Our finding is also in line with those of [20, 21] who also recoded elevated values leukocytes count . But noticed an average total leukocytes value within normal physiologic range after abdominal surgery in dairy cows . Percentage platelets critical value recorded was higher in midventral approach; this could be due to lesser whole blood loss observed intraoperatively as decrease in whole total blood volume leads to gross interference of the different components of the blood cells including platelets . This may also serve as an advantage in midventral approach because the higher the platelets critical values, the quicker the chances of blood clotting response . There were slight variations of means subjective healing interval of the two approaches but without significant difference (p = 0.643), with the flank approach having higher means number of days (13 1.14) to complete surgical wound healing when compared with 12.4 0.5 mean days for midventral approach . The slight variation of days of healing interval might be due to surgical site interference with the object coming contact with the surgical wound as reported by [22, 23], as the chance of surgical site contact with surrounding object is higher in flank laparotomy site compared to midventral site . The variation could also be a result of other local factors that affect wound healing like oxygenation, foreign body contact with the surgical wound, and venous insufficiency as reported by . It was concluded that the midventral laparotomy approach can be safely and conveniently performed without fear of clinical complications in goats . We recommend the use of midventral laparotomy approach for routine abdominal surgery in goats as an alternative to flank approach . Further study on pregnant goats to see whether midventral abdominal incisional closure can withstand pressure of gravid uterus also needs to be conducted.
|
Conventional purification of histone h1.4k26 methyltransferase activity hela nuclear pellet fraction was prepared following the protocol of dignam et al . Approximately 10 g of nuclear pellet fraction were subjected to 1000 ml of de52 resin (whatman) that was packed into a low - pressure chromatography column (15 cm diameter; spectrum) and equilibrated with bd buffer containing 100 mm ammonium sulfate (bd-100; 20 mm tris, ph 7.9, 0.2 mm edta, 2 mm dithiothreitol, 20% glycerol, 100 mm ammonium sulfate, 0.2 mm phenylmethylsulfonyl fluoride). Bound proteins were eluted by gravity flow using bd containing 350 mm ammonium sulfate (bd-350). The elution fraction was dialyzed against bd-100 and subjected to 100 ml of heparin - sepharose 6ff (ge healthcare) that was equilibrated with bd-100 . Bound proteins were eluted with a 10-cv linear gradient from 200 to 700 mm ammonium sulfate in bd . Fractions containing h1.4k26 hkmt activity were pooled, dialyzed, and subjected to a 54-ml deae 5pw column (tosoh) equilibrated with bd-100 . Subsequently, fractions containing the activity were pooled, dialyzed against bd-100, and subjected to a mono s hr10/10 (ge healthcare) column . The elution of bound proteins was carried out as described for the deae 5pw step . Fractions containing activity were pooled, dialyzed against bd-100, and subjected to a mono q hr5/5 column (ge healthcare). The elution of bound proteins was carried out as described for the deae 5pw step . Fractions containing activity were pooled and subjected to mass spectrometric analysis as well as to a superose 6 hr10/30 gel filtration column (ge healthcare). Fractions from the gel filtration chromatography were resolved by sds - page and visualized by silver staining or subjected to immunoblotting . Protein expression and purification, western blot, and silver staining recombinant histone h1.4 wild type or mutant (lysine 26 changed to alanine; h1.4 k26a) was produced in bacteria as an ha - tagged fusion protein using standard techniques . Affinity purified h1.4 protein exhibited multiple bands in sds - page likely due to truncated versions of the protein . Recombinant full - length g9a was obtained using a baculoviral expression system according to standard techniques . Baculovirally expressed gst - jmjd2a (residues 1506), gst - jmjd2b (residues 1424), gst - jmjd2c (residues 1372), and flag - jmjd2d (residues 1510) were purified using glutathione - sepharose 4b (ge healthcare) or anti - flag(m2) affinity gel (sigma). Western blotting was performed using standard techniques with antibodies against ha (sigma), flag(m2) (sigma), histone h1.4k26me2 (abcam; we find that the antibody showed a certain extent of cross - reactivity to h1.4k26me1 and -me3 in peptide dot blot experiments (supplemental fig . S2a)), mouse h1.4k26me1 (jenuwein lab; for details of antibody generation strategy see ref . 31), mouse h1.4k26me2/3 (7) (jenuwein lab) histone h1 (santa cruz), h3k9me1 (32) (jenuwein lab), h3k9me2 (millipore), h3k9me3 (32) (jenuwein lab), h3k27me3 (abcam), h3k27me2/3 (reinberg lab), h4k20me1 (millipore), h4k20me3 (millipore), h3 (cell signaling), gal4 (santa cruz), -actin (ambion), gst (ge healthcare), ezh2 (abcam), suz12 (abcam), eed (abcam), and g9a (yoshihiro nakatani). Silver staining was performed using standard molecular biology methods . In vitro hkmt assay briefly, the reaction was performed in a total volume of 30 l in hkmt buffer (20 mm tris, ph 8.0, 5 mm mgcl2) with 0.6 l of 0.2 m dithiothreitol, 1 l of [methyl - h]adomet (trk581 - 1mci, ge healthcare), 110 l of a source of enzymatic activity (either fractions of conventional purification or 50 nm recombinant g9a), and 8 l of substrate . The substrate consisted of 2 g of recombinant histone h1.4 (wild type or k26a mutant) or 5 g of synthetic peptides corresponding to either the n terminus of histone h3 (residues 415) or that of h1.4 (residues 1734). Hkmt assays were resolved by 15% sds - page, transferred to polyvinylidene difluoride membrane, and analyzed by fluorography using [h]enhance spray (perkinelmer life sciences). In vitro hkdm assay the demethylation reaction was carried out for 38 h at 37 c in the presence of 30200 ng/l of recombinant jmjd2 proteins, 2 m peptide substrate, 20 m fe(ii)-sulfate, 2 m zncl2, 500 m 2-oxoglutarate, 500 m ascorbic acid, 20 mm tris - hcl, ph 8.0, and 120150 mm kcl in a final volume of 8 l . To inhibit demethylation the iron chelating agent deferoxamine (sigma) was added to a final concentration of 0.2 mm . Seventy l of matrix solution (5 mg / ml -cyano-4-hydroxycinnamic acid, 37% (v / v) acetonitrile, 0.12% trifluoroacetic acid) were added to the reaction products, 1 l of the sample was spotted on a maldi sample plate, and spectra were acquired as described (34). The following peptides were used as substrates: h3k4me3, art[kme3]qtarkstggkaprkql - cys; h3k9me3, artkqtar[kme3]stggkaprkql - cys; h3k27me3, kaar[kme3] sapatggvkkphryrp - cys; h4k20me3, sgr gkgg[kme3]glgkggakrhrk - cys; h1.4k26me3, pvkkkar[kme3]saggakrk or pvkkkar[kme3]aaggakrk; h1.4k26me2, tpvkkkar[kme2]aaggakr - cys; and h1.4k26me1, pvkkkar[kme1]saggakrk . Histone samples were excised from sds - pa gels, in - gel digested with trypsin (at a w / w ratio of 1:200, trypsin: protein, estimated by the staining intensity of coomassie blue - stained histones) for 2 h before the reaction was stopped by addition of 5% formic acid and 60% acetonitrile . Dried digests were solubilized in 20 l of 50 mm ammonium hydrogen carbonate followed by addition of 50 l of a propionic anhydride solution (at a v / v ratio of 30:70, propionic anhydride: methanol) and adjustment of ph 7 with nh4oh . The samples were incubated at 50 c for 20 min and dried under vacuum before lc - ms / ms . All lc - ms / ms experiments were performed using a dionex ultimate nanoflow hplc system (sunnyvale ca) and a thermo ltq mass spectrometer (san jose, ca). Histone samples were first solubilized in 0.1% trifluoroacetic acid and loaded onto a trap column (dionex acclaim pepmap 100 c18, 5 m, 100, 300-m inner diameter 5 mm). After washing with 0.1% trifluoroacetic acid at 20 l / min for 2 min, the peptides were back - flashed onto a 75 m 12-cm emitter column packed with magic c18aq, 3-m 200 (michrom bioresources inc ., aubum, ca), and eluted with a linear gradient of 2 to 45% acetonitrile containing 0.1% formic acid in 30 min at a flow rate of 250 nl / min . Mass spectrometry data were acquired using a data - dependent acquisition procedure with each full ms followed by analysis of the five most intense ions by a zoom scan and a ms / ms scan . Data dependent analysis used a repeat count of two and a dynamic exclusion duration of 60 s. transfections, stable cell line3 10 293 t cells were transfected with 10 g of plasmid dna using fugene hd (roche) according to the manufacturer's instructions . Cells were incubated for 48 h post - infection, harvested, and whole cell extract prepared using ripa buffer (10 mm tris, ph 7.4, 150 mm nacl, 1% nonidet p-40, 0.5% deoxycholic acid, 0.1% sds, 1 mm edta). The generation of the nih3t3-tet off cells (clontech) with a stably integrated, inducible jmjd2b(1424)-green fluorescent protein expression construct was described previously (35). Induction was performed for 12 h and green fluorescent protein - positive cells were fluorescence - activated cell sorter - sorted and histones extracted . Histone extraction core and linker histones were extracted from 293, 293 ft, hela, 293trex - luciferase (see below), nih 3t3, and embryonic stem cells using 0.2 m sulfuric acid according to standard protocols . The acidic supernatant (containing histones) was neutralized by the addition of 0.75 volume of 1.5 m tris, ph 8.8 . Cells were either untreated or treated with the g9a small molecule inhibitor bix-01294 (kindly provided by boehringer ingelheim pharmaceuticals, inc .) Or the histone deacetylase inhibitor trichostatin a (sigma). Immunoprecipitation one mg of solubilized nuclear pellet was mixed with 1 volume of bd-200 plus 0.05% nonidet p-40 . Five g of antibody were added and the reaction mixture (200 l) incubated overnight at 4 c on a rotating wheel . Twenty l of pre - equilibrated protein g - agarose (roche) were added and incubation continued for 1 h at 4 c on a rotating wheel . Reactions were spun in a microcentrifuge at 400 g for 3 min, the supernatant was discarded, and beads washed two times with 400 l of bc-200 containing 0.05% nonidet p-40, one time with 400 l of bc-500, 0.05% nonidet p-40, followed by one time with 400 l of bc-100 . Reverse transcriptase - pcr hela cells were grown in the presence of 1% dmso or 2.5 m decitabine (5-aza-2-deoxycytidine) in dmso for 72 h. total rna was isolated using trizol (invitrogen) and cdna was produced using the superscript iii cdna synthesis kit according to the manufacturer's instructions . Real time pcr was performed using the brilliant ii sybr green qpcr master mix (stratagene). We previously generated a 293 trex cell line (invitrogen) that is stably transfected with a constitutively expressing luciferase transgene containing gal4 dna binding sites upstream of the transcriptional start site (293trex - luciferase (8)). This cell line was stably transfected with pcdna4to (invitrogen) containing the gal4-dbd and full - length cdna of human g9a (inserted between the hindiii and ecori sites). Gal4-tagged g9a was expressed upon addition of 2 g / ml tetracycline / doxycycline for 24 or 48 h. chip was performed in duplicate according to standard techniques and as previously described (36) using the following primer set: upper, 5-caccgagcgaccctgcataagc-3 and lower, 5-gcttctgccaaccgaacggac-3. Briefly, cells were treated with 1% formaldehyde in the growth medium for 10 min at room temperature . Cross - linking was quenched by the addition of glycine to a final concentration of 125 mm in growth medium . Cells were washed twice with phosphate - buffered saline and lysed in buffer a (25 mm tris, ph 8.0, 1% sds, 1 mm edta, 25 mm nacl). Cell lysate was sonicated using a bioruptor 200 (diagenode) with 200 watts ultrasonic wave output power . Sonication was carried out for 15 min with alternating 30-s on / off pulses . Sheared chromatin was used for immunoprecipitation using antibodies described above and antibodies against gal4 (millipore) and random igg (jackson). H1.4k26me2 antibody competition with histone peptides was carried out as follows: 5 g of antibody was mixed in a tube with 1 m h3k9me2, h1k26me0, and h1k26me2 peptides in a final volume of 40 l for 30 min on ice . Chip experiments on the endogenous mage - a1 promoter were carried out in triplicate as described above using hela cells grown in the presence or absence of 2.5 m decitabine for 72 h. the following primer set was used: oligo 1, 5-gtccaggctctgccagacatc-3 and oligo 2, 5-cgtccctcagaatggaaacctc-3. The gapdh chip primer set is located around the transcriptional start site and the sequence is available upon request . A, hkmt assays carried out with increasing amounts of nuclear extract (left) or nuclear pellet (right) using recombinant wild type histone h1.4 or a version with a lys to ala point mutation as substrate . C, mono q peak fraction of h1.4k26 hkmt activity was analyzed by sds - page and silver staining (left). Specificity is illustrated by hkmt assay using wild type or k26a mutant h1.4 as substrate (top). The fraction was subjected to mass spectrometric analysis and identified hkmts were confirmed by immunoblotting (right). D, h1.4k26 hkmt activity peak from the mono q step was pooled and subjected to a superose 6 gel filtration column . Fractions were either analyzed by hkmt assay or resolved by sds - page and analyzed by silver staining or immunoblotting . E, immunoprecipitation experiment from nuclear pellet fraction using igg, anti - g9a, and anti - ezh2 antibodies . A, hkmt assays carried out with increasing amounts of nuclear extract (left) or nuclear pellet (right) using recombinant wild type histone h1.4 or a version with a lys to ala point mutation as substrate . C, mono q peak fraction of h1.4k26 hkmt activity was analyzed by sds - page and silver staining (left). Specificity is illustrated by hkmt assay using wild type or k26a mutant h1.4 as substrate (top). The fraction was subjected to mass spectrometric analysis and identified hkmts were confirmed by immunoblotting (right). D, h1.4k26 hkmt activity peak from the mono q step was pooled and subjected to a superose 6 gel filtration column . Fractions were either analyzed by hkmt assay or resolved by sds - page and analyzed by silver staining or immunoblotting . E, immunoprecipitation experiment from nuclear pellet fraction using igg, anti - g9a, and anti - ezh2 antibodies . Precipitated material was analyzed by hkmt assays or immunoblotting . Purification of h1.4k26 methyltransferase activities we, and others previously reported that h1.4k26 is methylated in vivo (2, 5, 7). In an unbiased attempt to identify h1.4k26-specific methyltransferases we used recombinant bacterially expressed histone h1.4 as a substrate for in vitro hkmt assays and readily detected the h1-specific hkmt activity in both nuclear extract and pellet fractions . The target specificity of the hkmt activity assays was verified by comparing methylation of wild type h1.4 to that of a version in which the lys residue was mutated to alanine (h1.4k26a) (fig . Notably, methylation of the k26a mutant was strongly reduced but not completely abolished, suggesting that other residue(s) on histone h1.4 in addition to lys are methylated . The endogenous core histones h3 and h4 were methylated when the nuclear pellet fraction was used in hkmt assays . Surprisingly, the addition of recombinant h1.4k26a but not wild type h1.4 abolished the activity toward h4 . At present we do not know if this finding is relevant and did not pursue it further in this study . We next performed a conventional purification from the nuclear pellet following h1.4 hkmt activity (fig . 1b) and found that h1.4k26-specific and non - lys - specific activities co - eluted throughout the entire purification (supplemental fig . 1c) was subjected to mass spectrometric analysis . Among other polypeptides we identified three hkmts: g9a / kmt1c, glp / kmt1d, and ezh2/kmt6 and the presence of each was verified by western blot (fig . Analysis of the h1.4k26 hkmt activity by gel filtration chromatography revealed that the activity peak migrated at high molecular mass (400800 kda) and correlated well with both the g9a and ezh2 elution profiles as visualized by western blot (fig . Interestingly, a larger migrating h1.4 protein species was mainly methylated in fraction b14 and its radiolabel intensity did not correlate with the g9a and ezh2 elution profiles . Although fraction b14 contained g9a and ezh2, it is unclear why its substrate preference was different from that of fractions b8b12 . The methylation on this h1.4 protein was also lys specific because the radiolabel was lost when the fractions were assayed with an h1.4k26a mutant protein (fig . Therefore, it was possible that ezh2 is solely responsible for the h1.4 methylation observed . To clarify this we performed immunoprecipitations from nuclear pellet fractions and demonstrated that: 1) g9a and ezh2 do not interact; 2) both g9a and ezh2 immunoprecipitates contain h1.4 hkmt activity compared with an igg control (fig . 1e); and 3) the presence of histone octamers in the hkmt assay does not abolish g9a activity toward h1.4 (supplemental fig . Significantly less activity is precipitated with anti - ezh2 but this might be explained by the fairly stringent wash conditions that partially disrupted the ezh2 containing prc2 complex . G9a methylates h1.4 at lysine 26given that g9a was shown previously to methylate native histone h1 in vitro (37) we used recombinant full - length g9a to perform in vitro hkmt assays with either wild type h1.4 or its k26a mutant as substrate . We detected significant [h]ch3 incorporation on wild type h1.4 as evidenced by fluorography (fig . 2a) but a signal was not detected on h1.4k26a . However, longer exposure times gave evidence of minor [h]ch3 label (data not shown) suggesting that other lysines might be methylated with low efficiency . The reaction was carried out in substrate excess to attain the maximum amount of methylation under the given assay conditions to facilitate mass spectrometric analysis (see fig . We monitored the increase in lys methylation upon incubation of ha - tagged h1.4 with g9a and adomet using anti - h1.4k26me2-specific antibody (fig . Importantly, the antibody was methyl - specific because recombinant un - methylated h1.4 was not recognized despite being recognized by an anti - ha antibody (fig . The multiple bands are recognized by anti - ha and anti - h1.4k26me2 antibodies likely resulted from h1.4 truncations (see experimental procedures). Next, we used synthetic peptides corresponding to residues 1734 of h1.4 that were either unmethylated or harbored one, two, or three methyl groups at lys as substrates for g9a - dependent hkmt assays . G9a only utilized unmethylated and monomethylated peptides in a time - limiting reaction, similar to the result obtained when h3k9-peptides were used as substrate (fig . Therefore, g9a predominantly functions as an h3k9 and h1.4k26 mono- and dimethylase in vitro, although extended incubation times allowed g9a to perform trimethylation of the substrate (data not shown; previously discussed in ref . G9a - methylated h1.4 was subjected to mass spectrometry to unambiguously identify target sites . Due to the high lysine content of h1.4 the sample was propionylated before digestion to better distinguish mass differences in lc - ms / ms . The mass spectra of recombinant h1.4 incubated with g9a in the presence of adomet resulted in the detection of peptides with mono- and dimethylated h1.4k26 (fig . 2d, middle and bottom panels, spectra shown in black). In the absence of g9a or adomet, 2d, top panel, spectra shown in black and red, middle and bottom panels, spectra shown in red). In addition to h1k26 we found minor amounts of methyl groups incorporated on several other lysine residues (fig . G9a methylates h1.4 at lysine 26 in vivo we next tested if g9a impacted h1.4k26 methylation in cell - based assays . To this end overproduction of g9a significantly increased global h1.4k26 dimethylation and also moderately increased the level of h3k9me2 . Gal4-dbd alone or fused to the h4k20-specific hkmt pr - set7/kmt5a did not alter h1.4k26me2 or h3k9me2 levels (fig . Previous reports indicated that the lack of g9a substantially reduced h3k9me2 and -me1 in mouse embryonic stem cells (32, 39, 40). We extracted core and linker histones from these wild type and g9a stem cell lines (tt2 and 2210, respectively), and observed a global reduction in h1.4k26me2 in the case of g9a cells as visualized by western blot (fig . To demonstrate by alternative means that g9a is partially responsible for h1.4k26 methylation in vivo we took advantage of a recently identified, small molecule inhibitor of g9a . The compound termed bix-01294 is specific for g9a as even the highly homologous glp protein is far less effectively inhibited (41). Hela cells were treated for 48 h with bix-01294 at a final concentration of 9 m, histones were extracted and analyzed by western blot . Inhibition of g9a led to significant decreases in h1.4k26me2 and h3k9me2 levels (fig . 3c), whereas other histone lysine methylation marks were unaffected (fig . 3c and data not shown). Interestingly, trichostatin a - treated cells also showed a considerable reduction in global h1.4k26me2 levels . Previously, we demonstrated that h1.4k26 is acetylated in vivo and that the class iii histone deacetylase sirt1 targeted h1.4k26 (8). Now, our data suggest that lys is also targeted by class i and ii histone deacetylases and that acetylation of h1.4k26 might protect it from being methylated . G9a methylates h1.4k26 on chromatin in a gene - specific manner generally, histone h1 deposition condenses chromatin structure and negatively regulates gene expression, although various histone h1 isotypes seem to affect transcription differently (recently reviewed in ref . As histone h1.4 repressed transcription in reporter gene assays (7), we tested if g9a and h1.4 can co - occupy repressed genes . To this end a 293 cell line was stably transfected with a construct encoding gal4-dbd fused in - frame to g9a (gal4-g9a) under the control of a promoter that contains a tet - operator sequence . Upon addition of doxycycline (+ tet) gal4-g9a protein binds to gal4-specific dna binding sites integrated in the promoter of the luciferase reporter gene (fig . 4b) consistent with earlier reports that described g9a as a transcriptional co - repressor (3942). Induction of gal4-g9a expression for 48 h was monitored by a significant increase in gal4-g9a protein as well as by a global increase in h1.4k26me2 and h3k9me2 levels (fig . A, recombinant full - length g9a derived from a baculoviral expression system was used to methylate increasing amounts of recombinant wild type or k26a mutant ha - tagged h1.4 using h - labeled adomet as methyl donor . Shown is the fluorography after an exposure time of 12 h (top panel) and the coomassie blue - stained membrane to visualize the amount of h1.4 and h1.4k26a proteins (bottom panel). B, as in a but using unlabeled adomet as methyl donor . Detection of methyl groups incorporated at h1.4k26 was carried out by western blot using a specific anti - h1.4k26me2 antibody . C, as in a but using synthetic peptides corresponding to the sequence shown for h1.4 or h3 (top) as substrate . D, recombinant wild type h1.4 was incubated with g9a in the presence or absence of unlabeled adomet as methyl donor . The reactions were resolved by sds - page, stained with coomassie brillant blue, and the h1.4 bands then cut from the gel and subjected to mass spectrometry . Ion chromatograms of kksagaar peptides are shown with different modifications generated from lc - ms / ms data of propionylated partial tryptic digest of histone h1.4 . Only the sample incubated with g9a and adomet led to the detection of monomethylated ([m + 2h] = 578.1) and dimethylated lys ([m + 2h] = 557.2) (spectra shown in black). Only unmodified h1.4k26 peptides were detected in the absence of adomet (spectra shown in red). In the absence of g9a only unmodified ([m + 2h] = 570.8) lys peptides were detected . E, the table summarizes other potential h1.4 target sites and the percentage of methylation compared with an unmethylated h1.4 control . A, recombinant full - length g9a derived from a baculoviral expression system was used to methylate increasing amounts of recombinant wild type or k26a mutant ha - tagged h1.4 using h - labeled adomet as methyl donor . Shown is the fluorography after an exposure time of 12 h (top panel) and the coomassie blue - stained membrane to visualize the amount of h1.4 and h1.4k26a proteins (bottom panel). Detection of methyl groups incorporated at h1.4k26 was carried out by western blot using a specific anti - h1.4k26me2 antibody . C, as in a but using synthetic peptides corresponding to the sequence shown for h1.4 or h3 (top) as substrate . D, recombinant wild type h1.4 was incubated with g9a in the presence or absence of unlabeled adomet as methyl donor . The reactions were resolved by sds - page, stained with coomassie brillant blue, and the h1.4 bands then cut from the gel and subjected to mass spectrometry . Ion chromatograms of kksagaar peptides are shown with different modifications generated from lc - ms / ms data of propionylated partial tryptic digest of histone h1.4 . Only the sample incubated with g9a and adomet led to the detection of monomethylated ([m + 2h] = 578.1) and dimethylated lys ([m + 2h] = 557.2) (spectra shown in black). Only unmodified h1.4k26 peptides were detected in the absence of adomet (spectra shown in red). In the absence of g9a only unmodified ([m + 2h] = 570.8) lys peptides were detected . E, the table summarizes other potential h1.4 target sites and the percentage of methylation compared with an unmethylated h1.4 control . A, 293 t cells were transiently transfected with gal4, gal4-pr - set7, or gal4-g9a . Whole cell extract was prepared from transfected cells or acid extraction was performed to isolate core and linker histones and both fractions were analyzed by western blot using antibodies indicated on the right . B, acid extraction of histones was performed from wild type (tt2) or g9a (2210) embryonic stem cells and purified histones were analyzed by western blot using antibodies indicated on the right . C, 293 t cells were treated for 48 h with dmso, compound bix-01294 (a specific g9a inhibitor; final concentration 9 m), or trichostatin a (final concentration 300 nm). High salt nuclear extracts were prepared from treated cells and analyzed by western blot using the antibodies indicated on the right . A, 293 t cells were transiently transfected with gal4, gal4-pr - set7, or gal4-g9a . Whole cell extract was prepared from transfected cells or acid extraction was performed to isolate core and linker histones and both fractions were analyzed by western blot using antibodies indicated on the right . B, acid extraction of histones was performed from wild type (tt2) or g9a (2210) embryonic stem cells and purified histones were analyzed by western blot using antibodies indicated on the right . C, 293 t cells were treated for 48 h with dmso, compound bix-01294 (a specific g9a inhibitor; final concentration 9 m), or trichostatin a (final concentration 300 nm). High salt nuclear extracts were prepared from treated cells and analyzed by western blot using the antibodies indicated on the right . To determine whether g9a - mediated luciferase repression correlates with h1 deposition and h1.4k26 methylation we performed chip experiments . As expected, gal4-g9a was recruited to the promoter region of the luciferase gene in the presence of doxycycline . Interestingly, histone h1 occupancy was low on the luciferase gene but increased upon luciferase repression by gal4-g9a . Moreover, the levels of h3k9me2 and h1.4k26me2 increased in the presence of doxycycline, whereas those of h3k27me3 remained unchanged (fig . 4d). To rule out that the h1.4k26me2-specific antibody used for chip cross - reacted with h3k9me2 we performed peptide competition experiments . Dot blot analysis confirmed that the anti - h1.4k26me2 antibody specifically recognized h1.4 peptides but not h3k9, h3k27, or h4k20 peptides . Moreover, the recognition of h1.4k26me2 could be abolished only upon preincubating anti - h1.4k26me2 antibodies with h1.4k26me2 peptides, but not with h3k9me2 or h3k27me2 peptides (supplemental fig . We repeated the chip with h1.4k26me2 antibodies that were competed with various histone peptides prior to the immunoprecipitation step . Analysis of precipitated material by real time - quantitative pcr showed that h3k9me2 and h1.4k26me0 peptides did not significantly reduce the amount of precipitated material (p> 0.05). Of note, an h3k9me2-specific antibody was completely neutralized by the h3k9me2 peptide under identical conditions . Competition with h1.4k26me2 peptides reduced significantly the signal intensity as determined by paired t - tests (p <0.05; fig . The fact that the h1.4k26me2 peptide did not fully abolish the signal indicates that the antibody shows a low level of cross - reactivity . Results from the chip experiments on the luciferase transgene suggest that g9a alters the chromatin structure by promoting the recruitment of h1 . To test this hypothesis on an endogenous gene we focused on mage - a genes, previously shown as being occupied by g9a and with its presence mage - a gene silencing is also mediated by dna methylation in a number of tumor cell lines . It is well established that global and gene - specific dna methylation decreases upon addition of the cytosine analog decitabine . Treatment with decitabine was previously shown to reactivate tumor suppressor genes, with g9a occupancy at these genes being substantially reduced (44). We selected mage - a1 for a comparative chip analysis before and after addition of decitabine . In the absence of decitabine, g9a and histone h1 were present on the mage - a1 gene and h1.4 was methylated at lys (fig . That mage - a transcripts are detectable in hela cells (43) we found mage - a1 and -a3 gene expression to be induced upon treatment with decitabine (fig ., g9a was lost from the mage - a1 promoter region and importantly, the levels of h1k26 methylation were also reduced, presumably due to the decrease in total h1 protein . These results are in accord with those obtained using the luciferase reporter gene above, suggesting that g9a promotes spatially restricted h1 residency on chromatin . Figure 4.g9a methylates h1.4k26 on a specific genomic location and promotes h1 recruitment . A, illustration of the transgene system that allows tetracycline - induced expression of gal4-g9a and targeting to the luciferase promoter containing gal4 dna binding sites . B, induction of gal4-g9a effectively represses luciferase expression as demonstrated by luciferase assays of two independent clones . The experiments were carried out in duplicate and the result of one representative experiment is shown . C, whole cell extracts were prepared from two independent clones that were grown in the absence or presence of tetracycline for 24 h. extracts were analyzed by western blot using the antibodies indicated on the right . D, chip experiments from cells grown in the absence or presence of tetracycline for 24 h. antibodies used for the chips are indicated on the right . E, chips with anti - h1.4k26me2 antibodies either untreated or preincubated with synthetic peptides corresponding to various histone sequences and modification states . Quantitative real time pcr analysis for each sample was carried out in triplicate . Competition with h3k9me2 and h1.4k26me2 peptides did not result in statistically relevant (p> 0.05) reduction of pcr product . F, quantitative real time rt - pcr measuring mage - a1 and -a3 transcript levels from hela cells treated for 72 h with dmso or decitabine . G, chip experiments carried out from 293 cells analyzing the mage - a1 promoter in the absence or presence of decitabine . G9a methylates h1.4k26 on a specific genomic location and promotes h1 recruitment . A, illustration of the transgene system that allows tetracycline - induced expression of gal4-g9a and targeting to the luciferase promoter containing gal4 dna binding sites . B, induction of gal4-g9a effectively represses luciferase expression as demonstrated by luciferase assays of two independent clones . The experiments were carried out in duplicate and the result of one representative experiment is shown . C, whole cell extracts were prepared from two independent clones that were grown in the absence or presence of tetracycline for 24 h. extracts were analyzed by western blot using the antibodies indicated on the right . D, chip experiments from cells grown in the absence or presence of tetracycline for 24 h. antibodies used for the chips are indicated on the right . E, chips with anti - h1.4k26me2 antibodies either untreated or preincubated with synthetic peptides corresponding to various histone sequences and modification states . Competition with h3k9me2 and h1.4k26me2 peptides did not result in statistically relevant (p> 0.05) reduction of pcr product . F, quantitative real time rt - pcr measuring mage - a1 and -a3 transcript levels from hela cells treated for 72 h with dmso or decitabine . G, chip experiments carried out from 293 cells analyzing the mage - a1 promoter in the absence or presence of decitabine . Figure 5.g9a - methylated h1.4 is recognized by l3mbtl1 and hp1 in vitro . A, gst pull - down experiment with gst or gst fused to the three mbt domains of l3mbtl1 (gst-3mbt) and recombinant ha - tagged h1.4 either unmethylated or methylated by g9a . Notably, a point mutation in the second mbt domain (p2a) abolished binding but mutations in the first and third mbt domains (p1a and p3a) retained binding to g9a - methylated h1.4 . B, gst pull - down experiment with gst or gst - hp1 and recombinant ha - tagged h1.4 either unmethylated or methylated by g9a . Methylated h1.4 was visualized by western blot using anti - h1.4k26me2 antibodies . G9a - methylated h1.4 is recognized by l3mbtl1 and hp1 in vitro . A, gst pull - down experiment with gst or gst fused to the three mbt domains of l3mbtl1 (gst-3mbt) and recombinant ha - tagged h1.4 either unmethylated or methylated by g9a . Notably, a point mutation in the second mbt domain (p2a) abolished binding but mutations in the first and third mbt domains (p1a and p3a) retained binding to g9a - methylated h1.4 . B, gst pull - down experiment with gst or gst - hp1 and recombinant ha - tagged h1.4 either unmethylated or methylated by g9a . Methylated h1.4 was visualized by western blot using anti - h1.4k26me2 antibodies . Methylated at lys by g9a provides a binding surface for l3mbtl1 and hp1chromodomain - containing hp1 and mbt domain - containing l3mbtl1 proteins were previously shown to specifically recognize methylated h1.4 (36, 45). To examine if g9a is able to mediate this binding event we performed pull - down assays using recombinant h1.4 that was pre - methylated by g9a . A gst fusion protein comprising the three mbt domains of l3mbtl1 co - precipitated with methylated, but not unmethylated h1.4 . We previously showed that the second mbt domain was responsible for methyllysine binding (36) and indeed a point mutation in the second (p2a) but not in the first or third (p1a, p3a) mbt domains abolished the interaction with g9a - methylated h1.4 (fig . 5a). Similarly, gst - hp1 but not gst alone interacted with g9a - methylated h1.4 (fig . 5b). Importantly, unmethylated h1.4 was not precipitated when g9a was added to the pull - down assay, ruling out the possibility that g9a bridges the interaction between h1.4 and hp1. Figure 6.members of the jmjd2 subfamily of the jmjc domain - containing proteins demethylate h1.4k26 in vitro and in vivo . A, identification of mouse jmjd2d h1.4k26 demethylase activity by maldi - tof mass spectrometry . Each panel contains a spectrum for h3k4me3, h3k9me3, h3k27me3, h4k20me3, h1.4k26me3, h1.4k26me2, and h1.4k26me1 peptides incubated with or without mouse jmjd2d protein . The masses corresponding to unmodified (0), mono- (1), di- (2), or trimethylated (3) peptides are indicated in dotted lines . The appearance of a peak corresponding to the demethylated peptide is marked with an arrowhead . The shift corresponds to a loss of 14, 28, or 42 daltons due to the removal of methyl group(s). B, jmjd2a, jmjd2b, and jmjd2c were also identified as h1k26me3 demethylases . Addition of the iron chelator deferoxamine at the beginning of the reaction suppressed the formation of a demethylated peptide peak . C, nih3t3 cells stably expressing mouse jmjd2b display a reduction in h1.4k26me2/3 and h3k9me3 acid - extracted histones (1 or 2 g) were analyzed as indicated by triangles on the top . D, ectopic expression of human jmjd2d wild type but not its catalytic point mutant (h192a) in 293 t cells causes global reduction in h1.4k26me2/3 and h3k9me2 . Members of the jmjd2 subfamily of the jmjc domain - containing proteins demethylate h1.4k26 in vitro and in vivo . A, identification of mouse jmjd2d h1.4k26 demethylase activity by maldi - tof mass spectrometry . Each panel contains a spectrum for h3k4me3, h3k9me3, h3k27me3, h4k20me3, h1.4k26me3, h1.4k26me2, and h1.4k26me1 peptides incubated with or without mouse jmjd2d protein . The masses corresponding to unmodified (0), mono- (1), di- (2), or trimethylated (3) peptides are indicated in dotted lines . The appearance of a peak corresponding to the demethylated peptide is marked with an arrowhead . The shift corresponds to a loss of 14, 28, or 42 daltons due to the removal of methyl group(s). B, jmjd2a, jmjd2b, and jmjd2c were also identified as h1k26me3 demethylases . Addition of the iron chelator deferoxamine at the beginning of the reaction suppressed the formation of a demethylated peptide peak . C, nih3t3 cells stably expressing mouse jmjd2b display a reduction in h1.4k26me2/3 and h3k9me3 . Acid - extracted histones (1 or 2 g) were analyzed as indicated by triangles on the top . D, ectopic expression of human jmjd2d wild type but not its catalytic point mutant (h192a) in 293 t cells causes global reduction in h1.4k26me2/3 and h3k9me2 . Identification of h1.4k26 demethylases candidate approaches have been useful to identify the targets of the jmjc domain - containing histone lysine demethylases . We, and others previously identified jmjd2 proteins to specifically demethylate h3k9 and h3k36 (34, 35, 46, 47). Here, we tested a large panel of jmjc proteins among which jmjd2 proteins exhibited significant activity toward methylated h1.4k26 . We purified recombinant mouse jmjd2 proteins from baculovirus - infected sf9 cells (supplemental fig . S3) and examined demethylase activity toward methylated h1.4k26 peptides along with trimethylated h3k4, h3k9, h3k27, and h4k20 peptides . Recombinant jmjd2d efficiently converted h1.4k26me3 and h1.4k26me2 to the monomethyl state as detected by maldi - tof mass spectrometry, whereas conversion of an h1.4k26me1 peptide substrate to the unmethylated state was inefficient (fig . Conversion of h1.4k26me3 to the monomethylated state is consistent with the previous observation that human jmjd2d removes two methyl moieties from trimethylated h3k9 (35, 47). Under the assay conditions used in fig . 6a complete h3k9 demethylation was observed due to the relatively high enzyme concentration, whereas the use of lower amounts of enzyme or shorter incubation times predominantly resulted in accumulation of h3k9me1 (data not shown). There was no detectable activity toward h3k4me3 and h4k20me3, and only weak activity toward h3k27me3 . Under similar assay conditions, recombinant jmjd2a, jmjd2b, and jmjd2c removed only one methyl group from h1.4k26me3 peptides (fig . 6b), again consistent with their ability to convert h3k9me3 to the dimethyl state in vitro (47). The addition of the iron chelating agent deferoxamine abolished the production of h1.4k26me2 (fig . We also examined the enzymatic activity of recombinant mouse lsd1 and drosophila lid proteins, which were shown to demethylate h3k4me1, or -me2 and me3, respectively (34, 46). We did not detect h1k26 demethylation by these enzymes under conditions wherein h3k4 peptide demethylation was observed (data not shown). These results indicate that in addition to being h3k9me3-specific jmjd2 subfamily members are also h1.4k26-specific demethylases . To test if jmjd2 proteins demethylate h1.4k26 in a cellular context we took advantage of a previously generated nih3t3 cell line with stably integrated inducible jmjd2b (35). In contrast to the host cell line, induction of jmjd2b exhibited a 4-fold reduction in h3k9me3 levels concomitant with increased h3k9me1 levels (fig . Importantly, we also detected a reduction in h1.4k26me2/3 levels, but no significant increase in global h1.4k26me1 levels . This could be due to the high basal levels of h1.4k26me1 relative to those of h1.4k26me2/3 . Given that mouse and human jmjd2 members are highly conserved we next assessed the ability of ectopic jmjd2 proteins to target h1.4k26 in a human cell system . We transiently transfected 293 t cells with human jmjd2d, either the wild type or point mutant in its catalytic domain (h192a; described in ref . 48). Only functional jmjd2d reduced global h1.4k26me2/3 levels and, consistent with earlier studies (49, 50), those of h3k9me2 (fig ., we conclude that the mammalian family of jmjd2 proteins is responsible for the enzymatic turnover of h1.4k26 methylation in vivo . Our data show that h1.4k26 is subject to dynamic methylation and that g9a is partially responsible for this process . G9a is highly homologous to another hkmt termed glp / euhmtase1 (51) both of which were shown to exhibit specificity for h3k9 . For the purpose of this study we focused on g9a but indeed, we identified glp in our purification of h1.4k26 hkmt activity (supplemental table s1) and g9a and glp were shown previously to function in a heteromeric complex with both enzymes contributing to global h3k9me1 and -me2 (40). A recent report utilized spot array technology (described in refs . 52 and 53) to identify g9a substrates on the basis of a g9a - target consensus sequence . H1.4k26 was identified among potential g9a substrates in the context of synthetic peptides (54). We clarified that g9a specifically methylates h1.4k26 using peptides and full - length recombinant proteins with or without the presence of core histones . Importantly, we demonstrated methylation of h1.4k26 by g9a in vivo using cell biological, genetic, and pharmacological approaches . Recently, it was shown that the g9a and glp ankyrin repeats recognize h3k9me1/2 . It was speculated that one enzyme of the g9a - glp complex recognizes the modification, whereas the other places the mark (55). Given the similarity of the residues surrounding h3k9 and h1.4k26 we suspect that the ankyrin repeats also recognize h1.4k26me2 . Should this be the case, it is possible that the g9a - glp complex might recognize h1.4k26me2 and subsequently methylate h3k9 within the same chromatosome or recognize h3k9me1/2 to methylate h1.4k26 . Because g9a also methylates free h1.4 it is possible that binding of h1.4k26me2 to the ankyrin repeats provides a means by which g9a promotes its recruitment to chromatin . 4, d and e) and it will be interesting to investigate in future studies if a mutation in the ankyrin repeats that is deficient for histone methyl - lysine binding affects h1-recruitment to chromatin . The linker histone h1 was believed to constitute chromatin in a 1:1 ratio with core histone octamers . However, recent data demonstrated that h1 is not omnipresent but in certain instances subject to localized recruitment to establish facultative heterochromatin (recently discussed by ref . Moreover, genome - wide binding data illustrated that histone h1 is present predominantly over repressed genes and intergenic regions, whereas it is absent and replaced by parp-1 along active genes (56). Therefore, it is likely that mechanisms are in place to deposit h1 or to exchange other chromatin binding factors with h1 . Covalent modifications on core histones and the linker histone might affect such processes as recently demonstrated by studies showing that the presence or absence of h2a monoubiquitination affects h1 deposition (57, 58). 5, a and b) that might assist in its recruitment or increase its residence time on chromatin, thereby facilitating alterations of the chromatin structure . Members of the jmjd2 subfamily of h3k9/h3k36-specific demethylases have now been shown to target h1.4k26 as well . It was proposed that jmjd2 proteins regulate gene expression by locally altering histone methylation states . Demethylation of h1.4k26 would diminish the ability of repressive effector proteins like hp1 and l3mbtl1 to remain on chromatin and might also increase h1.4 mobility . We previously found that h1.4k26 is methylated by the h3k27-specific hkmt ezh2/prc2 and here we have shown that the h3k9-specific hkmt g9a methylates h1.4k26 in vitro and in vivo . Several h3k9-hkmts in addition to g9a are known in mammalian organisms and given the amino acid sequence similarity around h3k9, h3k27, and h1.4k26 it will be interesting to examine which of these histone methyltransferases, if any, have the potential to methylate h1.4k26 . Previous reports and this study revealed that jmjd2 proteins target multiple sites including h1.4k26 but the h3k9-specific jmjd1 proteins and h3k27-specific demethylases like utx did not demethylate h1.4k26 in our assays . This suggests that simple sequence similarity is not sufficient to define a recognition site . The crystal structural analysis of jmjd2a with methylated h3k9 and h3k36 peptides nicely illustrated distinct recognition mechanisms (59) and it would be interesting to see if a similar or distinct mechanism applies to h1.4k26 binding.
|
Fine - needle aspiration (fna) is the standard method used to determine treatment plans for thyroid nodules . Based on the bethesda system, the most generally accepted system for reporting thyroid cytology, the benign category implies a less than 3% risk of malignancy . Follow - up ultrasound (us) is recommended when the nodule has benign cytologic result . Repeat fna is recommended when a nodule shows significant growth or morphologic transformation with suspicious however, the practical risk of malignancy in nodules with benign cytology varies in each institute, ranging from 2% to 18%, and it has even been reported to have gone up to 62% . Therefore, some investigators recommend routine repeat fna for thyroid nodules with benign cytology [7, 8]. Considering cost - effectiveness and diagnostic value, repeat fna has been considered when the nodule shows any suspicious feature on the initial us [9, 10]. However, known us features associated with malignancy show an extremely variable probability of malignancy . Microcalcifications, marked hypoechogenicity, and irregular or spiculated margin show a high risk of malignancy, while solid composition and hypoechogenicity show a relatively low positive predictive value (ppv) [1113]. Based on these results, each suspicious us feature may not be considered as an equal risk factor for malignancy . Radiologists specialized in breast imaging have been confronted with the same problem in the core needle biopsy of a breast lesion . Correlation of pathologic results with sonographic findings has been used in some institutions to verify that the lesion was adequately sampled . This approach was suggested owing to the wide range of false negative rates of this category . Based on different malignancy rates of suspicious us features in thyroid nodules and considering approaching steps in management of breast lesions, we conjecture that an imaging - cytology correlation can be a better diagnostic approach for patient management than initial us features in a thyroid nodule with benign cytology . Therefore, we investigated the role of imaging - cytology correlation to reduce the false negative rates of cytology at thyroid nodules as compared with the use of initial us features . The institutional review board of the severance hospital approved of this retrospective study and required neither patient approval nor informed consent for our review of patients' images and records . However, written informed consents were obtained from all patients for us - guided fnas (us - fnas) prior to each procedure as a daily practice . Our institutional registry for the thyroid nodule was settled since 2006 including all patients with thyroid nodules who underwent us examinations and us - fnas at our institution . From march 2006 to december 2006, 3119 consecutive thyroid nodules in 2866 patients underwent us - fnas . Among them, we included 667 nodules in 649 patients (men, 83; women, 566), which fulfilled the following criteria: (a) they had no history of prior fna on the same nodule; (b) they were reported as benign (category ii) in the initial fna . Nondiagnostic, atypia or follicular lesions of undetermined significance, follicular neoplasm or suspicious for a follicular neoplasm, suspicious for malignancy, and malignant were excluded; (c) they were equal to or larger than 1 cm; (d) they underwent further evaluation such as follow - up us, follow - up fna, or thyroid surgery . In nodules which had not underwent operation, determinative cytologic reports (category ii or category vi) on follow - up us were used as standard reference . If a nodule decreased in size on follow - up us, the nodule was also included as a benign nodule; (e) there were available radiologic reports that included an additional radiologist's opinion about the concordance or discordance between imaging and cytologic results in postbiopsy correlation (figure 1). Mean lesion size of the thyroid nodules was 20.7 mm (range, 1070 mm). Median follow - up of 601 nodules in 584 patients which were included based on followup fna or us without surgical pathology was 1509 days from the date of initial fna to the last followup (iqr, 1522 days; range, 1722744 days). All us examinations were performed using a 7 to 15 mhz linear array transducer (hdi 5000; philips medical systems, bothell, wash) or a 5 to 12 mhz linear probe (iu22, philips medical systems) by 1 of 5 board - certified radiologists with 1 to 12 years of experience in thyroid imaging . All us - fnas were performed by the same radiologist who performed the us examinations . Us features of all thyroid nodules that underwent us - fnas were prospectively recorded by the previously described methods . Us features suspicious for malignancy were determined using previously published criteria from our institution: marked hypoechogenicity, microlobulated or irregular margin, microcalcifications, and taller than wider shape . When overall echogenicity of a nodule was darker than that of the surrounding strap muscle, it was defined as marked hypoechogenicity to differentiate it from hypoechogenicity based on the parenchymal echogenicity of the thyroid gland . Only calcifications equal to or less than 1 mm in diameter were indicated . If microcalcifications were detected with macrocalcifications, the lesion was considered to have microcalcifications as a worrisome finding . If hyperechoic foci accompanied comet - tail artifacts on conventional us, they were considered as colloids . An anteroposterior to transverse dimension ratio greater than 1 was defined as taller than wider shape . Us - fnas were performed on either thyroid nodules with suspicious assessment or the largest nodule among nodules with probably benign assessment on us . If there were multiple nodules with suspicious us findings in one patient or if the patient or physician requested a biopsy of a benign - looking nodule coexisting with a nodule showing suspicious us features, fnas were performed on multiple nodules in one patient . A free - hand biopsy technique was used with either a 23-gauge needle attached to a 20 ml disposable plastic syringe and an aspirator or a 23-gauge needle attached to a 2 ml disposable plastic syringe, depending on the performing radiologist's preference . Each lesion was aspirated at least twice, and the aspirated materials were expelled onto a slide and immediately placed in 95% alcohol for papanicolaou staining . An inadequate specimen was defined as less than 6 groups of cells containing more than 10 cells . Adequate specimens were categorized as benign, indeterminate, suspicious for malignancy, or malignant samples . The radiologist who performed fna routinely reviewed the initial us images within a week of the fna after the cytologic results were reported . For benign cytologic results, radiologists who performed the us - fnas decided and reported whether the cytology was concordant or discordant with the imaging findings . As researchers at our institution always try to assess lesions based on their most worrisome finding, the saved images should represent these worrisome us features . The final conclusion was not derived from the number of suspicious us features but from the subjective decision made by the radiologist who performed the us - fna . In our institution, concordant lesions included some nodules which had suspicious us features on the initial us but were acceptable for the benign cytology in postbiopsy image review as well as the nodules without features suspicious for malignancy on the initial us . Concordant benign thyroid nodules were recommended for follow - up by us after one year . In contrast, discordant lesions included nodules which were initially suspected for malignancy on us and were still thought to be suspicious for cancer even after obtaining benign cytology . Repeat fnas were usually recommended for discordant benign thyroid nodules after 612 months . Among the 667 nodules that met all the inclusion criteria, 586 nodules (87.9%, 586 of 667) were reviewed by radiologists who had more than three years of experience in thyroid imaging and fna whereas the remaining nodules were managed by less experienced radiologist . We compared the clinical characteristics of patients between benign and malignant nodules by using the test for categorical variables and independent t - test for continuous variables . We also compared the risk of malignancy as well as the clinical characteristics between concordant and discordant nodules by using or fisher's exact test for categorical variables and independent t - test for continuous variables . The baseline characteristics were also compared between patients with included and excluded nodules among thyroid nodules equal to or larger than 1 cm with the same methods . The risk of malignancy was calculated for several subgroups classified according to initial us features and imaging - cytology concordance . Using the generalized estimating equation, we compared the risk of malignancy in thyroid nodules with initially benign cytologic results with those of the remaining subgroups and also compared the risk of malignancy of thyroid nodules among subgroups . Logistic regression analysis was performed to assess the odds ratio for the risk of malignancy . Statistical analysis was performed using commercial statistical software (sas version 9.1, sas inc ., cary, nc, usa). Among 667 nodules with initially benign cytologic results, 656 nodules were benign (98.4%) and 11 nodules were malignant (1.6%) based on cytopathology (table 1). The mean age of patients with malignant nodules was not significantly different from that of patients with benign nodules (p = 0.277). The mean size of malignant nodules (17.6 12.5 mm) was not significantly different from that of benign nodules (20.7 10.1 mm, p = 0.315). There were 70 nodules with initial suspicious us features and 597 nodules without initial suspicious us features . The risk of malignancy was higher in nodules with initial suspicious us features (11.4%, 8 of 70) than in nodules without initial suspicious us features (0.5%, 3 of 597; p <0.001, table 1). When reviewing us images after initial fna results were reported, 40 out of 70 nodules which had suspicious features on initial us evaluation were finally concluded as concordant with benign cytology (figures 2 and 3). Therefore, in 667 nodules with benign cytology, 637 nodules were concordant with cytology, whereas 30 nodules were discordant with benign cytology . The reasons that 40 nodules with revised radiologic diagnosis after imaging - cytologic correlation were initially classified as suspicious nodules were microcalcifications (n = 16), microlobulated or irregular margin (n = 9), taller than wider shape (n = 3), or marked hypoechogenicity (n = 1) in order of frequency, respectively, and more than one characteristic of the above features in 11 nodules . Between the concordant and discordant group, gender of the patients was not significantly different (p = 0.159). The patients with discordant nodules were significantly older than other patients with concordant nodules (53.5 10.5 years versus 48.9 12.0 years; p = 0.038). The mean size of discordant nodules was significantly smaller than that of concordant nodules (16.0 6.6 mm versus 20.9 10.2 mm; p <0.001). 3%; 7 of 30) than in the concordant group (0.6%, 4 of 637; p about 44.5% (534 of 1201) of 1 cm or larger nodules with benign cytology in initial fna were excluded because they had neither standard reference, such as follow - up us, follow - up fna, or thyroid surgery, nor available radiologist's additional reports regarding imaging - cytologic correlation . The mean age of patients with included nodules was statistically different from the other patients (49.1 12.0 versus 50.7 13.1 years; p = 0.033). Patient gender (p = 0.392) and mean nodule size (p = 0.601) were not significantly different between included and excluded nodules . There were 60 nodules with suspicious findings in the initial us evaluation of excluded nodules (11.2%, 60 of 534), and the proportion was not significantly different from that of included nodules (10.5%, 70 of 667; table 2). When comparing the risk of malignancy between benign cytology alone and each subgroup by a combination of benign cytology with initial us findings or postbiopsy concordance, all combinations had significantly different risk values from cytology alone (table 3, figure 4). Also, when comparing the risk of malignancy between discordant lesions and lesions with suspicious features on initial us, the former (23.3%, 7 of 30) was significantly higher than the latter (11.4%, 8 of 70). However, there was no significant difference in the risk of malignancy between concordant lesions (0.6%, 4 of 637) and lesions without suspicious features on initial us (0.5%, 3 of 597; p = 0.438) (figure 4). Although fna is a widely used tool for the diagnosis of thyroid nodules, the most significant problem it has is false negative results which bring out misses and delays in treatment of the cancer . Errors in cytologic reports have arisen from the overinterpretation of nondiagnostic specimens as diagnostic ones [23, 24]. Therefore, many reports discussed the differentiation of a nondiagnostic specimen from a diagnostic one in the cytologic interpretation of thyroid fna [1, 3]. Diagnostic errors of thyroid fna can also be caused by the mistakes of cytopathologists and the inherent nature of thyroid nodules due to overlapping cytologic criteria among hyperplastic adenomatoid nodule in goiter, follicular adenoma, well - differentiated follicular carcinoma, and follicular variant of papillary carcinoma . Moreover, reported false negative rates are variable among institutions and operators due to variable sampling skills [5, 6]. Several guidelines recommend follow - up us in thyroid nodules with benign cytology unless the nodule shows significant growth or morphologic change in follow - up us [1, 3, 4]. However, it has been argued that follow - up might be not enough in some nodules because of the inevitable false negative diagnosis and the possible risk of delayed treatment [6, 22]. To reduce false negative results of thyroid fnas, there have been two suggested approaches; first, routine repeat fna in thyroid nodules with benign cytology [26, 27] and, second, selective repeat fna [8, 10, 28, 29]. In the aspect of cost - effectiveness, it is more rational to consider performing follow - up fna selectively for nodules with a high - risk of malignancy rather than performing a total inspection of cytologically benign nodules in initial fna . Based on several reports, the rate of malignancy in benign thyroid nodules with suspicious us features was 3.747.1% which was significantly higher than that of benign thyroid nodules without suspicious us features (table 4) [9, 1518]. Although the us criteria applied to each study had subtle differences, initial us features may be reliable factors in determining whether to repeat fna or not . Going one step further from simply matching cytologic results against imaging findings evaluated before biopsy, the postbiopsy correlation of us features with cytologic results could be an alternative in determining whether the nodule should be reaspirated to confirm its cytology or not . Imaging - pathologic correlation after biopsy has been found to be useful in validating biopsy results of breast lesions, and discordance has been suggested as an indication for excision because of its higher upgrade rate than that of concordant lesions [3032]. However, there has been no organized study that applies imaging - cytology correlation to patient management and considers how to accept results of postbiopsy correlation in regard to reducing false negative diagnosis in thyroid nodules . In this study, 1.6% of nodules with benign cytology in initial fna were finally proven to be malignant . As expected, the malignancy rate of thyroid nodules (11.4%) with suspicious features on initial us was significantly higher than that of nodules (0.5%) without suspicious features on initial us, and the malignancy rate of nodules (23.3%) with discordant imaging findings was also significantly higher compared to concordant nodules (0.6%) in postbiopsy imaging - cytologic correlations . Furthermore, the rate of malignancy was higher in the nodules showing imaging - cytology discordance compared to nodules showing suspicious feature on the initial us . However, there was no significant difference in the risk of malignancy between concordant nodules in postbiopsy correlation and nodules without suspicious features on initial us . This result lets us conclude that imaging - cytology correlation is a more effective approach than using initial us features alone when deciding follow - up management in patients with cytologically benign thyroid nodules without a statistical increase in missing malignancy . In this study, 40 of 70 nodules with suspicious features on initial us were determined as concordant with benign cytology after postbiopsy imaging - cytology correlation . Although many descriptions of each suspicious us feature are present, interobserver and intraobserver variability still exist for the us assessment of thyroid nodules . Among us characteristics, margin and calcification showed relatively less consistency between observers and nodules in most patients whose radiologic assessments were changed after obtaining benign cytology were initially assumed as suspicious nodule due to calcification (16 of 40), margin (9 of 40), or multiple features (11 of 40) including them in our study . Also, there have been difficulties in deciding whether a thyroid nodule shows echogenic spots on us . Echogenic spots can be due to microcalcifications related to cancer or crystals related to colloids . Therefore, postbiopsy imaging - cytology correlation can be a good diagnostic approach in deciding whether to repeat fna or not at a thyroid nodule with benign cytology . First, some nodules were excluded in analysis despite having benign cytologic results due to loss of follow - up and absence of additional reports . However, the initial us assessment was not significantly different between included nodules and excluded nodules which were 1 cm or larger with benign cytology in the initial fna . Second, interobserver and intraobserver variability among radiologists are possible in the interpretation of us images and among cytologists, especially when reviewing follicular lesions . Third, there might be a bias arising from the postbiopsy review process itself which was based on saved images instead of on a review in real - time us . Although we always tried to save any images showing worrisome us findings and the postbiopsy review was preferably done within a week of biopsy by the performer, an observer bias might not have been completely removed from the final results . Fourth, suspicious us features such as calcification, margin, vascularity, and echogenicity have been differently applied to thyroid nodules by various guidelines and different institutions . Fifth, most (87.9%) of the nodules in this study were reviewed by highly experienced radiologists in thyroid imaging . Repeat fna can be effectively limited to patients with cytologically benign thyroid nodules showing discordance in imaging - cytology correlation, which reduces unnecessary repeat aspirations as well as decreasing false negative results.
|
The patient was a healthy 29-year - old multigravida . In week 28, the fetus was found to have an anterior neck mass and polyhydramnios was also detected by prenatal ultrasound . During the last four weeks prior to delivery, the neck mass grew substantially, had a broad base, and was 7 cm in diameter . An exit procedure was performed at week 38 of gestation by a multidisciplinary team of experts including a pediatric otorhinolaryngologist, neonatologist, obstetrician, two anesthesiologists, and nurses . The patient was placed in a supine position with a left lateral tilt to avoid aortocaval compression . An arterial line for continuous arterial pressure monitoring and two peripheral intravenous lines (16-gauge) were placed before induction . Endotracheal intubation (6.5 cuffed) was done after thiopental sodium (3 mg / kg) and succinylcholine (1.5 mg / kg) administration by a rapid sequence induction . General anesthesia was maintained with sevoflurane 2 - 3 vol% and nitrous oxide in oxygen (50 - 50) combined with an additional dose of remifentanil (0.1 - 0.5 g / min / kg) and rocuronium (50 mg in total). An end - tidal (et) concentration of sevoflurane was maintained at 1 - 1.5 minimum alveolar concentration (mac) for proper uterine relaxation until the umbilical cord was clamped . Prior to uterine incision, the patient was given two boluses of intravenous nitroglycerine (30 g), followed by an infusion at 0.5 - 1 g / kg / min to ensure uterine relaxation . To maintain a maternal systolic blood pressure of 100 - 120 mmhg, the following treatments were required: four boluses of intravenous phenylephrine (50 g), followed by an infusion at 0.05 - 0.1 g / kg / min, an infusion of dopamine at 5 g / kg / min, and rapid infusion of volume expander (500 ml)., the obstetrician confirmed that the uterus was fully relaxed and inserted an angiocatheter (20-gauge) into the uterus under the guidance of ultrasound for decompression by slow reduction of the amniotic fluid volume . Then, the fetal head and the part of the torso just above the nipple were partially delivered . A sterile pulse oxymetry was applied at the left ear lobe of the fetus after removal of amniotic fluid, but reliable readings could not be obtained . Ultrasound - guided monitoring was done by an obstetrician for the early detection of placental detachment until the fetal airway was secured . The fetus was intubated with a 2.5 endotracheal tube by a pediatric anesthesiologist at the second attempt (fig . The stylet of the endotracheal tube was not removed by an assistant due to the slipperiness of the vernix caseosa . The position of the endotracheal tube was confirmed by a sterile end - tidal co2 monitor . Once the fetal airway was established and the positive - pressure ventilation was satisfactory, the umbilical cord was severed and the neonate was fully delivered from the uterus . The 1-min apgar score of the neonate was 7; the 5-min score was 9 . After delivery, the infusions of nitroglycerine, dopamine, and phenylephrine were all discontinued, and the et concentration of sevoflurane was also lowered to 0.8 - 1.0 vol% . Then, five units of oxytocin were injected intravenously by bolus, and 20 units / l was infused continuously . The estimated blood loss was 1,100 ml . The total intake of fluid during the operation was 1,800 ml . Three days later, the neck mass of the neonate was completely excised by a pediatric otorhinolaryngologist . The excised mass was confirmed to be a 5 5 5 cm benign teratoma (fig . The aim of the exit procedure is to manage life - threatening neonatal emergencies and thereby increase the survival rate at delivery . The exit procedure therefore requires a multidisciplinary team approach, including at least two anesthesiologists for both the mother and the fetus, a pediatric otorhinolaryngologist, an obstetric surgeon, a neonatologist, and a team of nurses . During the exit procedure, anesthesiologists have to maintain the uteroplacental circulation during cesarean section to increase the time available to secure a potentially obstructed fetal airway . In conventional cesarean section, the major goals are to minimize the time from anesthetic induction to umbilical cord clamping, thereby minimizing fetal exposure to inhalational anesthetics . In fact, during the exit procedure, even intramuscular administration of drug cocktails and/or inhalational anesthetics (1 - 1.5 mac) are recommended to ensure a motionless, well - anesthetized fetus . Furthermore, there is no need to limit the time of anesthesia induction or the skin incision to delivery time . The anesthetic goals and principles for an exit procedure differ markedly from those for a conventional cesarean section with respect to maintaining the uteroplacental circulation until the time of secured delivery . First, deep inhalational anesthetics (1.5 - 3 mac) are often used to relax the uterine muscles and to maintain the uteroplacental circulation . Inhalational anesthetic concentrations of at least 2 mac are usually recommended for proper relaxation of the uterine muscles and to prevent early placenta detachment . For rapid onset and offset of tocolytic action during the exit procedure, sevoflurane or desflurane are recommended . These drugs include nitroglycerine and magnesium sulfate . However, nitroglycerin is a better choice than magnesium sulfate because nitroglycerin is easily titratable and short acting . The onset of uterine relaxation using nitroglycerin is 30 - 60 s, and a loading bolus of 100 g with continuous dosing of 0.5 - 1 g / kg / min is recommended, as needed, to maintain effective uterine relaxation . Lastly, dopamine (5 g / kg / min), phenylephrine (0.05 - 0.1 g / kg / min), and ephedrine bolus (5 - 10 mg) can be utilized to maintain the maternal hemodynamics . Many of the suggested anesthetic maneuvers used during the exit procedure to enhance uterine relaxation, such as the use of higher mac inhalational anesthetics combined with short acting tocolytics, potentially decrease maternal blood pressure and uteroplacental perfusion before delivery, and may lead to uterine atony and continued hemorrhage post - delivery . Meticulous on- and off - techniques are critical to achieve full relaxation of the uterus before delivery and to ensure proper contraction to prevent uterine atony and massive hemorrhage post - delivery . Sevoflurane (1 - 1.5 mac) and remifentanil (0.1 - 0.5 g / kg / min) were used to maintain anesthesia . The et concentration of sevoflurane was less than 2 mac before the uterine incision, even though the concentration was set from the beginning of anesthetic induction . Therefore, an additional bolus of nitroglycerine (30 g) was given and infused continuously at 0.5 - 1 g / kg / min . The uteroplacental circulation was maintained for 7 min (from uterine incision to cord clamping) without maternal or fetal accident until the fetus was intubated and the endotracheal tube was confirmed to be in the correct position . Usually, during the exit procedure, the dose of nitroglycerine used in the combined spinal epidural anesthesia is more than 100 g in a bolus, and the et concentration of inhalational anesthetics used in general anesthesia is above 2 mac . In our case, we performed general anesthesia using a lower bolus dose (two consecutive doses of 30 g) of nitroglycerine and a lower et concentration of inhalational anesthetics (1 - 1.5 mac) to maintain maternal hemodynamic stability and ensure fetal airway safety . The exit procedure is a relatively new procedure and holds promise for newborns with airway obstruction . Anesthesia for the exit procedure can be performed in various ways, as long as uterine relaxation and uteroplacental circulation are maintained until the fetal airway is secured . Preoperative planning and communication with regard to anesthesia are the most important factors for success.
|
Leprosy is a chronic disease caused by mycobacterium leprae affecting the peripheral nervous system, the skin, and other tissues . Histoid leprosy (hl) is an uncommon variant of lepromatous leprosy (ll), first described by wade in 1960 . It is characterized by skin colored papules and/or subcutaneous nodules and plaques on apparently normal skin with distinct histopathology and characteristic bacterial morphology . It is usually seen in patients relapsing after dapsone monotherapy and also in the presence of dapsone resistance . A 27-year - old male presented with asymptomatic papules on the trunk and extremities of 5 months duration and not associated with epistaxis, ear lobe infiltration, glove and stocking anesthesia, or hoarseness of voice . He gives a history of the hypopigmented and hypoesthetic patch on the left leg 10-years ago, diagnosed as borderline tuberculoid (bt) leprosy and was advised for treatment . However, he developed severe drug reaction following intake of single tablet (most probably dapsone) which subsequently led to exfoliation of the skin . The episode of drug reaction desisted him from taking further treatment for leprosy . On examination, there was a single, ill - defined, dry, hypopigmented, and hypoesthetic patch on the medial aspect of the right knee [figure 1]. Multiple dome shaped skin colored papules and nodules (total of 129 in number) ranging from 0.5 to 1.5 cm were distributed on the back, upper, and lower limbs . Lesions were nontender, firm in consistency [figure 2], and with intact sensations . Left ulnar and right lateral popliteal nerves were thickened and not tender . With these clinical features, he was offered a clinical diagnosis of bt leprosy with hl . . Slit skin smears from representative nodule and both ear lobes were positive for lepra bacilli that were both solid and granular and were long and slender [figure 3]. Histopathological examination of biopsy from the patch (right knee) showed multiple epithelioid granulomas with few lymphocytes [figure 4]. Biopsy from the papule showed spindle cells and foam cells arranged in interlacing bundles around adnexal structures and nerve twigs in the dermis [figure 5], consistent with the diagnosis of bt leprosy with hl, respectively . He was started on antileprosy multidrug therapy consisting of rifampicin, ofloxacin, and clofazimine . Irregular, ill - defined, and hypopigmented patch on the right knee multiple dome - shaped papules and nodules on the side of the trunk and right arm ziehl neelsen's stain 100 slit skin smear from nodule showing long, slender solid, and granular lepra bacilli dermis showing epitheloid cell granulomas with few lymphocytes (h and e, 10) dermis showing grenz zone and spindle cells and foam cells arranged in interlacing bundles around adnexal structures and nerve twigs (h and e, 10) the term histoid is derived from the microscopic appearance of the nodule showing spindle - shaped cells resembling dermatofibroma . It is considered as a variant of ll by some researchers while others consider it as a distinct entity . The case under study is a young male aged 27 years, is in concert with reported male preponderance and the age group (2140 years) reported in the literature . Hl is known to be associated with dapsone resistance and also in relapse following dapsone monotherapy . However, it has also been reported with relapse in the presence of supervised monthly multidrug therapy and also in patients without any treatment . Histoid lesions rarely may occur along the course of peripheral nerve trunks and peripheral nerves . Morphology and distribution of skin lesions in the index case is in conformity with hl . There was no superciliary madarosis in the index case which is a notable feature in most of histoid patients and so is normal nasal mucosa . The cell - mediated immunity was found to be better in hl than in the active lepromatous patients as substantiated by increased cd36 expression by the keratinocytes, predominance of cd4 lymphocyte over cd8 lymphocytes, and increased number of activated lymphocytes and macrophages in the lesion . The humoral immunity was found to be enhanced as evidenced by increased absolute count of b lymphocytes and raised levels of immunoglobulins igg, igm, and iga . Bacteriologically, there is large bacillary load in histoid lesions, which is attributed to focal loss of immunity . Furthermore, the acid - fast bacilli in these cases are measurably longer than ordinary lepra bacilli, are arranged in groups or parallel bundles in spindle - shaped histiocytes, described as histoid habitus by wade . One of the significant electron microscopic features of histoid lesion is the absence of electron transparent zone or foam which is characteristically seen in lepromatous lesion . It is known that electron transparent zone (ets) interferes with bacterial metabolism leading to cell death . The absence of ets is said to be responsible for the preservation of bacilli within the cells in histoid lesions . The association of bt leprosy with hl in the index case is interesting as bt leprosy and hl belong to diverse immunological spectrum, former being unstable and latter being stable form . In addition, it is intriguing to note how bt leprosy moved to hl (polar form of leprosy) if downgrading theory is contemplated . Furthermore, if bt leprosy is downgraded, then it should have moved to subpolar ll rather than to hl which is a polar form of leprosy . However, it is not known whether such association occurs due to unexplored underlying immunological mechanisms . On the contrary, the single hypoesthetic patch on right knee in the index case could not be considered as single lesion bl / ll, as the patch was dry and did not show shininess or infiltration and the histopathology also did not substantiate . Nonetheless, there have been reports of single lesion bl and ll cases reported in the literature albeit not in association with histoid lesions . Review of literature could reveal only two case reports of association with hl; one with bt leprosy similar to the index case and the other with indeterminate leprosy.
|
This mini - review describes the toxic effects of vanadium pentoxide inhalation principally in the workplace and associated complications with breathing and respiration . Vanadium is a by - product of oil - burning furnaces when vanadium pentoxide (mr 181.88) is deposited in the flues . Inhalation is the principal route of entry into the body and may result acutely in severe pneumonitis with associated mucus membrane irritation and gastrointestinal disturbances . Ambient vanadium pentoxide dust produces irritation of the eyes, nose and throat . Over long periods, inhalation may potentiate chronic bronchitis, eczematous skin lesions, fine tremors of the extremities and greenish discoloration of the tongue . As it has a rapid renal clearance, it may be monitored in urine specimens to determine exposure to vanadium pentoxide (american conference of governmental industrial hygienists, acgih and british education index, bei) 50 g.g creatinine for an end - of - shift, end - of - workweek sample . Most absorbed vanadium is excreted in the urine within one day after a long - term moderate exposure to vanadium dust . During its measurement vanadium oxide is sampled onto a pvc filter in a higgins and dewell cyclone for subsequent analysis using x - ray powder diffraction . The workplace exposure limit for vanadium pentoxide is according to the health and safety executive (hse), 0.05 mg.m/8h . Msds details airborne exposure limits of 0.5 mg.m (ceiling) for vanadium respirable dust and 0.1 mg.m (ceiling) for vanadium fumes . Studies in laboratory rats have shown that one acute inhalation study available reported an lc67 of 1440 mg / m following a 1-h exposure of rats to vanadium pentoxide dust . Oral studies in rats and mice demonstrate greater toxicity of vanadium as oxidation state increases . The lungs are a significant site of entry of vanadium in the case of community exposure . The distribution pattern of particles and the solubility of vanadium compounds, as well as alveolar and mucociliar clearance, are important factors that determine the rate of absorption in the respiratory tract . Vanadium accumulates in the human lung with age, reaching approximately 6.5 g / g in the over-65 year's age group . Vanadium lung exposure studies in rats appear to reach a steady state in low exposure groups of 0.5 mg / m . The retention rate of vanadium in rats aged 18 months was 13 - 15% . Absorbed vanadium is transported mainly in the plasma, bound to transferrin . The average value for the distribution of blood vanadium between plasma and cells in rats after an intravenous injection of 0.9 - 30 g vanadium per kg was found to be 9: 1 . Vanadium is widely distributed in body tissues; principle organs of vanadium retention are kidneys, liver, testicles, spleen and bones . A major fraction of vanadium from cellular vanadium was found retained in nuclei . In pregnant rats bile is probably not an important pathway for excretion into the faces, but the existence of alternative routes for excretion into the gut (salivary excretion or direct transfer across the intestinal wall) has been suggested . When 4.5 - 9.0 mg vanadium as diammonium oxytetravanadate was fed daily to 16 elderly persons, urinary excretion, although quite variable, amounted to a mean of 5.2% of the amount ingested . A study of pre - incubation of renal brush border membrane vesicles with vanadium pentoxide demonstrated a time - dependent inhibition of citrate uptake thereof, contributing to the nephrotoxicity observed in vanadium exposure . Fuel - oil ash is a significant source of exposure to boilermakers . During coal combustion, flue gases may contain dangerous levels of vanadium pentoxide . In kilns, especially with inadequate ventilation, exposure to vanadium can be critical . In industrial concerns, airborne monitoring is principally designed to detect vanadium rather than vanadium pentoxide . The us national institute of occupational safety and health and the us occupational safety and health administration have published methods that are suitable for measuring vanadium and vanadium compounds in workplace air . Both are generic methods for metals and metalloids in which samples are collected by drawing air through a membrane filter mounted in a cassette - type filter holder, dissolved in acid on a hotplate and analyzed by inductively coupled plasma - atomic emission spectrometry . For both methods, the lower limit of the working range is approximately 0.005 mg / m for a 500 l air sample, although these methods are not widely available . Urine testing, in preference for plasma testing, assumes that vanadium is excreted with a half - life of 15 - 40h . Pre- and post - shift urine vanadium levels measured at the beginning and the end of a working week will, therefore, give a measure of daily absorption and accumulated dose from exposures over the preceding days . Environmental monitoring of vanadium employs various methods for the analysis of air samples of vanadium in air, surface waters and biota . For example, flameless aas gives a detection limit of 1 ng / ml in air, corresponding to an absolute sensitivity of 0.1 ng vanadium . Icp - aes has a working range of 5 - 2000 g / m for a 500-litre air sample . Although there are some material safety data sheets available detailing the handling, hazards and toxicity of vanadium pentoxide, there are only two reviews listed in pubmed detailing its toxicity . The aim of this article therefore was to collate information on the consequences of occupational inhalation exposure of vanadium pentoxide on physiological function and wellbeing . An attempt to classify the like according to functionality of certain selected organ systems was decided . The criteria used in the current mini - review for selecting articles to be included were both theoretically and practically motivated and adopted from proposed criteria in the international classification of functioning, disability and health - icf . These criteria were as follows: articles were chosen only with internationally recognized impact factors greater than 0.10.articles were chosen based upon the impact of lifestyle, stress and/or environmental factor / s predisposing vanadium pentoxide exposure.criteria for selection of literature used included yes - no responses to: the appropriateness of methodology; adequacy of subject numbers; specificity of sex and/or age of subjects; and statistically significant response rates to survey questionnaires . Due consideration was given to a comparative effect between acute and chronic exposure to vanadium pentoxide . Additionally, it was noted whether the studies occurred in laboratory animal or human subjects.the timeframe used was principally 1990 - 2007 inclusive, although articles of extreme importance from earlier decades were used where appropriate.a multi - factorial overview of the factors eschewed concerning vanadium pentoxide exposure was elucidated . It was presumed that collective articles detailing known factors of usage were not necessarily correlated with functionality and health.compilation of materials for the mini - review started with published literature or easily accessible academic research.the articles were accessible from on - line sources - pubmed and medline (abstracts of journal articles); cochrane (reviews of clinical evidence); clinical trials (reports); dissertation.com (summaries of journal articles); and occupational health and safety information services (full - text guidance material). Articles were chosen based upon the impact of lifestyle, stress and/or environmental factor / s predisposing vanadium pentoxide exposure . Criteria for selection of literature used included yes - no responses to: the appropriateness of methodology; adequacy of subject numbers; specificity of sex and/or age of subjects; and statistically significant response rates to survey questionnaires . Due consideration was given to a comparative effect between acute and chronic exposure to vanadium pentoxide . Additionally, it was noted whether the studies occurred in laboratory animal or human subjects . The timeframe used was principally 1990 - 2007 inclusive, although articles of extreme importance from earlier decades were used where appropriate . A multi - factorial overview of the factors eschewed concerning vanadium pentoxide exposure was elucidated . It was presumed that collective articles detailing known factors of usage were not necessarily correlated with functionality and health . Compilation of materials for the mini - review started with published literature or easily accessible academic research . The articles were accessible from on - line sources - pubmed and medline (abstracts of journal articles); cochrane (reviews of clinical evidence); clinical trials (reports); dissertation.com (summaries of journal articles); and occupational health and safety information services (full - text guidance material). Articles were categorized according to their focus on acute or chronic exposure and toxicity, respectively [table 1]. From the data elucidated in table 1, the differences between total articles chosen in the acute exposure versus other categories, was 42.9% (chronic exposure), 15.3% (acute toxicity) and 31.6% (chronic toxicity). Using similar determinations, included articles were 44.1, 13.1 and 41.7%, respectively . The excluded articles were judged via chronic toxicity comparison with the other categories giving differences of 22.2% (acute exposure), 50% (chronic exposure) and 44.4% (acute toxicity). Lungs: vanadium pentoxide is regarded as a less soluble form of vanadium and is therefore eliminated from the lungs at a slow rate . Inhalation of vanadium pentoxide can injure the lungs and bronchial airways, possibly involving acute chemical pneumonotis, pulmonary edema and/or acute tracheobronchitis . Clinical complications include a persistent cough, shortness of breath, bronchiolar constriction, tightness of the chest and a pseudo - asthmatic inflammation . In a study of 40 plant workers previously free of lung disease and exposed to vanadium pentoxide, 12 had bronchial hyper - reactivity and symptoms of asthma . Vanadate acts directly on human bronchial smooth muscle promoting the release of ca from intracellular store via the production of inositol phosphate second messengers and inhibition of ca - atpase and causing spasms . First aid measures following inhalation include removing the patient into fresh air and applying artificial respiration if breathing has expired . Oxygen is needed if breathing is labored and it is essential to seek medical attention . Vanadium pentoxide dust may be a potential mutagen via induced chromosomal aberrations in man and hamsters . Alveolar / bronchiolar neoplasms developed in male rats exposed to 0.5 and 2 mg.m vanadium pentoxide, with only a marginal increase thereof in female rats exposed to 0.5 mg.m . There were associated increase in inflammation, fibrosis and alveolar and bronchiolar hyperplasia / metaplasia and squamous metaplasia in both male and female rats . In an investigation of cynomolgus monkeys exposed to vanadium pentoxide dust for six hours per day, five days per week for 26 weeks, it demonstrated that airway obstruction accompanied a significant influx of inflammatory cells into alveolar tissue . In an earlier study, it was suggested that vanadium - induced pulmonary inflammatory changes involving polymorphonuclear leukocytes may play an important role in air - flow limitation . Exposure to vanadium may cause a metal fume fever - like syndrome associated with neutrophilic alveolitis associated with marked neutrophilia . Respiratory tract inflammation following inhalation of vanadium particles is characterized by abundant neurophilia initiated by alveolar macrophages and release of proinflammatory cytokines . Short - term, repeated inhalation of occupationally relevant levels of vanadium by rats results in pulmonary immunocompetence via cytokine production and pulmonary macrophage induction . Wang et al ., describes the mechanism of multiple reactive oxygen species induced by vanadium involves activation of an nadph oxidase complex and the mitochondrial electron transport chain, with hydrogen peroxide playing a major role in lung inflammation and apoptosis . There may be a pathological pattern within the lung which may be associated with the pattern and/or extent of vanadium deposition . Indeed, in lung tissue excised from post - mortem investigations, the mean vanadium concentrations of 1.36 0.08 (sd) (1990s) were higher than 1.04 0.05 in the 1960s . The free - radical redox cycling of vanadium in the rat lung involving vanadium (v) undergoing one - electron redox cycling in the rat lung biomembranes and re - oxidation of vanadium (iv) initiating lipid peroxidation, possibly contribute to pulmonary toxicity . Circulatory system: chronically, exposure to airborne metals including vanadium may result in alterations in cardiac autonomic function . Acute studies of vanadium pentoxide inhalation on the heart in experimental animals revealed that there was myocardial vascular congestion was observed, with focal perivascular haemorrhages . Studies in humans has revealed palpitation of the heart, high incidence of extrasystoles, changes in the blood picture (anemia, leukopenia, punctatebasophilia of the erythrocytes) and reduced levels of cholesterol in the blood . Limited studies have suggested a positive correlation between vanadium inhalation in urban air and mortality from cardiac failure, despite an absence of lifestyle determination . Liver: acutely, vanadium is a potent inhibitor of many enzymes, while it stimulates adenylate cyclase . Vanadium can also directly influence glucose metabolism in vitro and may play a role in its regulation . Lipid peroxidation of rat liver microsomes and mitochondria was induced by sulphite and accelerated by the presence of vanadium compounds . Severe acute exposure (tens of mg / m) is responsible for systemic effects . Most frequent findings in animal experiments were in the liver, kidneys, gonads and the nervous, hematological and cardiovascular systems . Chronically, histopathological changes observed in the liver following the higher level of inhalation exposure (27 g / m for 70 days) included central vein congestion with scattered small hemorrhages and granular degeneration of hepatocytes . Vanadium concentrations of 10 g / g dry weight (dw) in the liver is associated with mortality in ducks acutely exposed to sodium metavanadate . Chronic exposure to increasing dietary concentrations of sodium metavanadate (38.5 - 2651 ppm) over 67 days resulted in vanadium accumulation in the liver of 25.2 g / g dwt . Vanadium pentoxide exposure stimulates the secretion of cytokines and chemokines by hepatocytes and associated hepatotoxicity . Significant amounts of vanadate accumulate in the intermembrane space of the liver mitochondria and the detoxification mechanism of reduction of vanadate is inadequate enough to prevent damaging actions on hepatic mitochondria . In an old study, vanadium pentoxide retarded the development of vascular pathomorphology, supported cholesterol metabolism and activated oxidoreductive processes . Cns: severe acute exposure to vanadium pentoxide has major patho - physioloogical manifestations on the nervous system . Inhalation thereof produces a time - dependent loss of dendritic spines, necrotic - like cell death and considerable alterations of the hippocampus ca1 neurophile, all associated with spatial memory impairment . Additionally, there is a decrease in the number of tyrosine hydroxylase immunreactive neurones in the substatia nigra pars compacta . Within the ependymal epithelium, cilia loss, cell sloughing and cell layer detachment the damage results in disrupted permeability of the epithelium and promotes access of inflammatory mediators to the underlying neuronal tissue causing injury and neuronal death . In humans, severe chronic exposure results in general symptomatology including nervous disturbances, neurasthenic or vegetative symptoms . Kidneys: severe acute exposure (tens of mg / m) is responsible for aberrations in renal function . Vanadium concentrations of 25 g / g dwt . In the kidneys are associated with mortality in ducks acutely exposed to sodium metavanadate . Chronic exposure to increasing dietary concentrations of sodium metavanadate (38.5 - 2651 ppm) over 67 days resulted in vanadium accumulation in the kidneys of 13.6 g / g dw . When renal brush border membrane vesicles are exposed to vanadium pentoxide, there is a time - dependent inhibition of citrate uptake in the membrane possibly contributing to nephrotoxicity . In studies on dog and human kidney enzymes, the authors suggested that vanadium inhibits the atpase at the site activated by na and atp protects the enzyme by either binding vanadium or by competing for a mutual receptor on the enzyme . Chronically in experimental animals, histopathological changes observed in the kidneys following the higher level of inhalation exposure (27 g / m for 70 days) included marked granular degeneration of the epithelium of the convoluted tubules . Chronically, absorbed vanadium in either pentavalent or tetravalent states is distributed mainly to the bone (around 10 - 25% of the administered dose three days after administration) and to a lesser extent to the kidney (about 4%). Distribution studies in which rats received a total of approximately 224 and 415 mg vanadium pentoxide / kg in drinking - water over a period of 1 and 2 months indicated that the vanadium content (assessed in 13 specific tissues) was greatest in the kidneys, spleen, tibia and testes . Testicles: chronic ingestion of vanadium may have significant consequences for infertility by damaging spermatogenesis . Studies in mice have demonstrated that inhalation of vanadium pentoxide results in necrosis of spermatogonium, spermatocytes and sertoli cells . Vanadium accumulates in the testes and attenuates the percentage of gamma - tubulin in all analysed testicular cells, suggesting changes in microtubules used in cell division . This mini - review has contributed to a brief synthesis of the literature which is currently rather scattered in nature into a compact format . Vanadium pentoxide has adverse effects on health and well - being and measures need to be taken to prevent hazardous exposure of the like . Medical monitoring of workers exposed to the dust or fumes; workplace monitoring and measurement of ambient concentrations; dealing with contaminated attire and establishing personal hygienic procedures; dealing with emergency spills of dust; enforcing protocols for emergencies and hazardous waste management; and the use of inspected respiratory and personal protective equipment, are all essential in reducing toxic exposure . Vanadium pentoxide exposure (acutely and chronically) in both experimental animal and human studies indicates a systemic patho - physiological and pathological influence on cell metabolism and tissue function . Therefore procedures need to be implemented in environments which potentially expose workers to vanadium pentoxide including influences on respiratory function and appropriate quality guidelines enforced . The lungs are likely to accumulate more vanadium particles than elsewhere particularly from polluted air . The lowest observed - adverse - effect level for acute exposure can be considered to be 60 g vanadium per m. indeed, chronic exposure emanates as slight changes in the upper respiratory tract, with irritation, coughing and injection of pharynx, to more serious effects such as chronic bronchitis and pneumonitis . Persons suffering from lung problems including asthma and cystic fibrosis would need to ensure that they take adequate measures to prevent vanadium irritation of the mucosae . Obviously, however, a systemic assessment via renal and liver function tests needs to be completed in order to make an accurate clinical assessment of the influence of vanadium on body function and ultimately the efficient maintenance of homeostasis . More research is required to establish and add to the limited existing knowledge on the toxicokinetic and toxicological database on vanadium pentoxide . Indeed, there is limited understanding of the potential for dermal absorption and the potential long term effects as a result of sequestration in body tissues such as bone.
|
The family reoviridae accommodates a wide range of members that infect protists, fungi, plants, invertebrates, and vertebrates, and are characterized by 912 segmented double - stranded rna (dsrna) genomes, multi - layered virion structures, and particle - associated enzymes for rna synthesis . The family now consists of 15 genera divided into two subfamilies spinareovirinae (turreted or spiked reoviruses) and sedoreovirinae (non - spiked reoviruses) (attoui et al ., 2012). Among the 15 genera is a relatively recently established genus mycoreovirus containing three members (mycoreovirus 13, myrv1 - 3) that were isolated in two phytopathogenic fungi, specifically, the chestnut blight fungus (myrv1 and myrv2) and the white root rot fungus (myrv3) by the groups of drs . Bradley i. hillman, william macdonald, and naoyuki matsumoto (enebak et al ., 1994; hillman and suzuki, 2004; hillman et al ., 2004 myrv1 and myrv2 have 11-segmented genomes (figure 1; s1s11, termed with an increasing order of mobility in sds - polyacrylamide gel electrophoresis), while myrv3 has a 12-segmented genome (s1s12). The mycoreovirus belongs to the spinareovirinae subfamily and its members retain conserved ntp binding motif and di - histidine motif specifically conserved in the subfamily (suzuki et al ., 2004; supyani et al ., 2007; spear et al ., 2012). Each segment has a large single orf corresponding between 42 and 98% of its entire size . Light gray boxes refer to orfs and the sizes of their protein products are shown . The locations and rdrp, guanylyltransferase, and ntp binding protein are assigned to s1, s3, and s6 . Vp4 and the plus - sense strand of each dsrna segment possesses the strictly conserved 5 pentanucleotide (5-gauca), single orf and 3 heptanucleotide (gcaguca-3). Myrv1 has a double - shelled particle structure of approximately 80 nm in diameter . . Both could involve large extents of genome segment alterations, but they are different in the generation mechanism . Reassortment events, involving exchange of genome segments between two viruses, occur at varying rates during genome packaging in coinfected cells . Genome rearrangements, defined as alterations of considerable tracts of sequence within single genome segments often in the form of deletions and extensions (taniguchi and urasawa, 1995), are a common phenomenon in all major genera of the family reoviridae (table 1). They occur under natural conditions (murao et al ., 1996; schnepf et al ., 2008) and laboratory conditions, for example, by serial passage of rotaviruses at high multiplicities of infection (mois; hundley et al, 1985; kojima et al ., 2000) and exclusive maintenance in one of their two hosts (plant, vector insect) in the case of plant reoviruses (nuss, 1984). Rearrangements can be regarded as non - homologous, intramolecular rna recombination and exclude intermolecular rna recombinations that are documented frequently in plus - sense (+), single - stranded rna (ssrna) viruses but are infrequently reported for reoviruses (taniguchi and urasawa, 1995; desselberger, 1996). Rearrangements are hypothesized to happen by copy choice (template switch) mechanism during rna synthesis mediated by the rna - dependent rna polymerase (rdrp) complex, as is rna recombination in ssrna viruses . Nsp, non - structural protein; del, deletion; dup+, duplication with the original orf extended; dup, duplication with the original orf unaltered; inter, intergenic recombination; wt, wild - type virus; lab, laboratory; nat, natural . * we overview genome alterations, with a focus on unusual genome rearrangements observed in mycoreoviruses and discuss differences between other reovirus rearrangements in type of genome segment alterations and possible mechanisms underlying their occurrence . Readers are referred to excellent review articles on rna recombination (lai, 1992; nagy and simon, 1997; simon - loriere and holmes, 2011; sztuba - solinska et al ., 2011). Three types of very unusual genome alterations were reported to occur in mycoreoviruses that differ from those reported for other reoviruses . The first example is complete loss of one of the segment s8 reported for myrv3, a very rare event for a reovirus . An entire set of genome segments are believed to be incorporated and packaged into single core particles during replication (plus - sense strand synthesis). Therefore, all reovirus strains with rearranged segments still contain a set of all genome segments whether intact or altered . To our knowledge, (2004) is the only example of reovirus that lacks a genome segment and is still viable . These observations allowed the authors to conclude that myrv3 s8 is dispensable for maintenance under laboratory conditions . The second type of mutations found in myrv1 is unique among reovirus examples in their dependence on a distinct virus or a viral protein . Specifically, myrv1 rearrangements are observed at extremely high rates in the fungal host either coinfected with the prototype hypovirus cryphonectria hypovirus 1/ep713 (chv1-ep713) or expressing a multifunctional protein p29 encoded by chv1-ep713 (sun and suzuki, 2008). After repeated subculturing of those fungal strains for one to two months, several dozen percent of resulting myrv1 isolates carry genome rearrangements . From doubly infected fungal mycelia, a myrv1 variant, myrv1/s10ss is isolated from 22.4% of subcultures, which harbors an altered segment s10ss, a deleted form of s10, in place of an intact s10 . S10ss lacks approximately 75% of the internal orf region while retaining the 5 and 3 terminal regions (sun and suzuki, 2008). In transformant fungal strains with the chv1 p29 coding domain, a variety of rearrangements are generated in addition to s10ss that include s1l, s2l, s3l, and s6l (figure 2). In contrast to s10ss, these rearranged segments involve orf extensions, but are distinct from many previously reported animal reovirus examples . Extensions have been reported mostly from rotaviruses and those entail all head - to - tail tandem partial duplication occurring downstream of the termination codon of the authentic orf . Thus, unaltered protein products are being synthesized from their cognate transcripts in infected cells . However, altered myrv1 genome segments, i.e., s1l, s2l, s3l, and s6l are all with duplicated orfs in - frame with their preceding orfs, resulting in extension of orfs by 1.41.9 fold . Importantly, the products of the expected sizes are detectable in mycelia infected with myrv1 variants although s1l - encoded product remains to be detected (sun and suzuki, 2008; tanaka et al ., 2011). These extended segments s1l, s2l, s3l, and s6l are frequently concomitant with s10ss although its significance is unclear . S1, s3, and s6-encoded proteins carry sequence motifs characteristic of rdrp (hillman et al ., 2004), guanylyltransferase (supyani et al ., 2007), and ntp binding proteins (suzuki et al ., 2004). It should be noted that these sequence motifs are duplicated in the expected protein products . The maximum size expansion of an orthoreovirus was predicted to be 10% of the entire size (approximately 2.0 kb) (roner and steele, 2007). Congruent with this notion, myrv1/s1l + s10ss variant, with the largest extension per segment (approximately 2.3 kb), has a genome - based extension of 1.8 kb after deduction of the deleted s10 sequence in s10ss . These extensions correspond to approximately an 8% increase on a genome - size (23,433 bp) basis . There are two types of myrv1 rearrangements reported: extensions (s1l, s2l, s3l, and s6l) and deletions (s4ss and s10ss) that could happen by single events . S1l, s2l, and s3l result from in - frame orf fusion but s4ss and s10ss do not always involve in - frame orf deletions . Genetic organizations of the normal (top) and rearranged forms (bottom) of genome segments is shown . For extended segments s1l (a), s2l (b), s3l (c), and s6l (d), three fragments colored differently (blue, red, and green) are separated by break points . The red portions refer to duplicated sequence while red color gradation is to indicate orientation (head - to - tail for all rearrangements). In internal deletion mutations s4ss and s10ss (e, f), only 1122% (for s4ss) and 1043% (for s10ss) of the intact orfs are retained . Note that s4ss and s10ss each have at least 4 (s4ss1s4ss4) and 2 variants (s10ss1 and 2) and one each of them (s4ss1 and s10ss1) are shown in (e) and (f), respectively . Solid lines denote the 5 and 3 utrs, while blue and green boxes refer to the n and c terminal portions of orf retained after each rearrangement event . Nucleotide positions for the start and stop codons, and rearrangement breakpoints are shown above the diagrams of each normal segments . Nucleotide and aa sequences adjacent to the altered sites on normal and rearranged segments are also shown below the diagrams of each altered segment . Neither sequence heterogeneity nor mismatch was detected at the junction sites for s1l, s2l, and s3l, while mismatches are found at or close to breakpoints of s4ss and s10ss (sun and suzuki, 2008; eusebio - cope et al . Myrv1 s4 (eusebio - cope et al ., 2010) and s10 (suzuki, unpublished results), albeit very infrequently, are rearranged in a chv1 p29 independent fashion . Myrv1/s4ss variants carry deletion mutations on s4 (s4ss1, s4ss2, s4ss3, and s4ss4) lacking approximately 80% of the s4 orf but retaining its ability to be transcribed and replicated . The genome segments including s4ss, s4ss1s4ss4 are different from each other in deletion endpoint . A reassortant variant of myrv1 that contains substantial deletions in both s4 and s10 (myrv1/s4ss1 + s10ss2) was generated in fungal colonies coinfected with myrv1/s4ss1 and myrv1/s10ss2 . Surprisingly, myrv1/s4ss + s10ss shows comparable replication levels to the wild - type myrv1 . This is the first example of a reovirus that is replication - competent without two viral proteins . Unlike members of the genera orthoreovirus (kobayashi et al ., 2007), orbivirus (boyce et al ., 2008; matsuo et al ., 2010), and rotavirus (komoto et al ., 2006), no reverse genetics system has been developed for mycoreoviruses . However, the myrv1 rearrangements (shown in figure 2) provide insights into the functional roles of the genome segments and their protein products . Common to all these altered rearrangements, they are competent to be packaged and transcribed given the comparable accumulation levels of their transcripts in infected cells . These results show that signals for packaging, transcription, and replication reside within the remaining genome sequence . The viability of myrv1/s4ss + s10ss indicates that neither myrv1 non - structural protein encoded by s4 (vp4) nor s10 (vp10) is required for virus replication . 2010) reported that vp4 contributes to mycelial growth and efficient vertical transmission through conidia . Vp10 contributes inversely to the reduction of aerial mycelial growth induced by the virus (sun and suzuki, 2008). Recombination events altering protein sequences are often deleterious to its function and purified from the population (simon - loriere and holmes, 2011; sztuba - solinska et al ., 2011). In fact, most extensions reported previously for reoviruses occur downstream of the termination codon and thus result in no change of protein sequences (kojima et al ., 1996). In this sense, the fact that several myrv1 variants with extension rearrangements are viable is surprising . Interpretation of functional roles for extended segments (s1l, s2l, s3l, and s6l) in virus replication is complex due to coexistence of the extended and normal unaltered genome segments in fungal colonies infected by myrv1 variants . Therefore, heterocomplementation of rearranged segments by the normal segments cannot be ruled out . In this regard (2011), that fungal colonies infected with myrv1/s1l + s10ss2, myrv1/s2l + s10ss2, and myrv1/s3l + s10ss2 are similarly restored in aerial mycelial growth to some extent (figure 3). The restoration levels of aerial mycelial growth increase as the ratio of transcript levels of rearranged s1l to normal segment s1 rises (tanaka et al ., 2011) fungal colonies were grown on pda for 8 days under the bench top conditions approximately 24c . C. parasitica strain ep155 was infected with wild - type myrv1 (myrv1), myrv1/s10ss2 (myrv1/s10ss), myrv1/s1l + s10ss2 (myrv1/s1l + s10ss), myrv1/s2l + s10ss2 (myrv1/s2l + s10ss), or myrv1/s3l + s10ss2 (myrv1/s3l + s10ss). As in other reoviruses, rearrangements are considered to contribute to evolution and molecular diversity of mycoreoviruses, while mycoreoviruses with such rearrangements including the myrv3 s8 loss are found under laboratory conditions, but not in the natural environment . Myrv1 variants with large deletions may have selective advantages in replication or packaging over wild - type myrv1 . Myrv1 variants with large extensions require chv1 p29 for their maintenance, suggesting no selective advantage of these variants in the absence of p29 . Maintenance of animal viruses in cultured host cells frequently induces mutations that confer selective advantages under laboratory conditions and lead to virulence attenuation in host animals . In this regard, myrv1 with genome rearrangements are different because they retain the ability to induce symptoms, while distinct from those induced by wild - type myrv1 (figure 3), including the reduction of host virulence to plants . Rather, myrv1 is reminiscent of plant reoviruses which undergo various mutations when they are maintained exclusively in one of their hosts, plant and insect vectors in laboratory conditions . Examples include those of would tumor virus (wtv) and rice dwarf virus (rdv) that are vectored by different species of leafhoppers (table 1). In fact, transmission defective isolates of wtv emerge after being maintained for a long period of time in cultured insect cells that carry internal deletions on segments encoding structural and non - structural proteins (nuss, 1984; anzola et al ., 1987). In the case of rdv maintained only in plants, point mutations rather than internal deletions accumulate resulting in little expression of protein products encoded by the mutated segments . . However, one single passage in cultured insect vector cell lines resulted in inverse population structures (pu et al ., 2011). Two major mechanisms are proposed for it, specifically, replication independent breakage - rejoining recombination, and replication dependent rdrp - mediated recombination (template switch or copy choice). The non - replicative, breaking - joining mechanism entails dsrna or ssrna fragmentation and re - ligation for which several variations are proposed such as self - recombination requiring no proteins, and rnase - catalyzed cleavage and ligation (chetverin, 1999). The second model, replicase - mediated mechanism is more widely accepted (lai, 1992; nagy and simon, 1997; sztuba - solinska et al ., 2011). In this model, the nascent rna and rdrp complex jumps after proceeding to a certain point from one template to another (intergenic or intermolecular recombination) or to another point of the same template (intragenic or intramolecular recombination). Template switches could occur in homologous and non - homologous (illegitimate) manners such that their crossover regions are of similar and unrelated sequences respectively . Non - homologous recombination is sometimes considered to be facilitated by sequences features of template and acceptor strands, such as direct, inverted repeats and/or secondary structures . A number of viral rna and protein elements as well as host factors are involved in rna recombinations in different single - stranded, plus - sense rna plant virus / host systems (serviene et al ., 2005; sztuba - solinska et al ., recently, rna silencing was shown to contribute to the generation of defective - interfering (di) rnas of the prototype hypovirus (chv1; zhang and nuss, 2008), associated with the picornavirus superfamily (koonin et al ., 1991), that infects the chestnut blight fungus and confers hypovirulence . Rearrangements reported for members of the family reoviridae could be accounted for by an intramolecular template switch, in which the replicase complex jumps backward (for extension) or forward (for deletions) on the same template molecule . For example, intragenic rearrangements of human rotavirus segment s11 are hypothesized to be generated in the process of plus - sense strand synthesis (transcription) mediated by short direct repeats of 46 nucleotides (kojima et al . (2001) inferred that duplications of human rotavirus genes 7 and 11 were presumed to occur by template switch mediated by an inverted repeat - involving secondary structure during the replication step (gault et al . A rare example is intergenic recombination with a crossover of two rotavirus segments encoding nsp2 and nsp5,6 (cao et al ., 2008; recent structural studies led to 3d modeling of rdrps from two reoviruses, human orthoreovirus and rotavirus . They are commonly characterized by 4-window structures which allow entry of substrates (rear window) and templates (left window), and exit of template rna (front window) and nascent rna (bottom window; tao et al ., 2002; lu et al ., 2008 based on this rdrp structural prediction, a loop model was proposed to explain how reovirus extension rearrangements occur (matthijnssens et al ., 2006). According to this model, extension rearrangements occur during the transcription step via intramolecular template switch from the transcribed region of the minus - strand to upstream regions of the same molecule re - entering from the left channel . It remains unknown how the mechanism of intergenic recombination or large deletion rearrangements fits into the rdrp 3d model . Addressing how p29 is involved in the enhanced emergence of myrv1 rearrangements is an interesting challenge . Hypovirus rna are replicated in golgi - derived vesicles of 80 nm whose production is enhanced in the cytoplasm upon viral infection (fahima et al ., 1994; hillman and suzuki, 2004; jacob - wilk et al ., 2006). Reovirus rnas are synthesized in viroplasms or virus factories formed in the cytoplasm of infected cells by viral and host components (patton et al ., 2006; cheung et al ., 2010). Chv1 p29 is a multifunctional protein acting as a symptom determinant (choi and nuss, 1992; craven et al ., 1993; suzuki et al ., 1999, 2003), protease (choi et al, 1991a, b), an rna silencing suppressor (segers et al ., 2006), and an enhancer of heterologous and homologous viruses (suzuki et al ., 2003; sun et al ., 2006). Some functional domains of p29 are mapped such as the n terminal aa 124 essential for virus viability, adjacent 2574 for the symptom determinant and the c terminal half for the proteolytic catalytic domain (suzuki and nuss, 2002; hillman et al ., 2004). Firstly, p29 may interact the rna synthesis machinery to perturb transcription (plus - sense rna synthesis) and/or replication (minus - sense rna synthesis), leading to enhanced rate of template switch of rdrp - mediated via rna sequence features such as inverted or direct repeats . Another possibility is that p29 alters the physiological state of infected cells, which enhances selection of pre - existing mutant viruses with rearranged segments by unknown means ., it remains unknown whether chv1 p29 reside in myrv1 core particles viewed as a nano - scale rna synthesis factory (guglielmi et al ., 2010) to perturb myrv1 rna synthesis . Sun and suzuki (2008) showed that chv1 p29 interacts with myrv1 vp9, considered to be a non - structural protein, in vitro and in vivo, providing a clue to the mechanism . As in cells infected with other reoviruses, viroplasm is produced in myrv1-infected cells (sun and suzuki, unpublished data). One or two viral non - structural proteins are required as matrix proteins for production of reoviral viroplasms which are believed to be the site of virus replication where core particle assembly and rna synthesis occur . Consistent with this notion, knocking - down of the genes responsible for functional viroplasm formation is detrimental for virus replication (campagna et al . As discussed above, a myrv1 variant shows comparable replication competency without vp4 and vp10 . Therefore, vp4 and vp10 are unlikely to be matrix proteins of viroplasms given the essentiality of viroplasm . One of key points to be addressed is what the possible role of vp9 in myrv1 replication is . It is of interest to infer that vp9 is a viroplasm matrix protein that is remodeled upon interaction with p29 . Moreover, to explore whether chv1 p29 is incorporated into myrv1 core particles is a prerequisite . The other possibility may be associated with the reason why almost a half of the myrv1 segments, whether encoding structural or non - structural proteins, are generated at high rates . Chv1 p29, as a symptom determinant, slightly enhances mycelial growth and suppresses asexual sporulation and orange pigmentation, which involve complex regulatory pathways . Additionally, p29 is an rna silencing suppressor which may potentially be able to perturb the cellular physiological state . The p29 protein might be involved in selection and maintenance of myrv1 variants with rearrangements . Apparent reversion of s1l, s2l, s3l, and s6l to respective normal segments (sun and suzuki, 2008; tanaka et al ., 2011) in the absence of p29 suggests a role for the protein in the maintenance of the extended segments . Three unusual types of genome alterations are found in the genus mycoreovirus; a s8-deficient myrv3 mutant, a myrv1 variant with two rearranged segments (s4ss and s10ss) each lacking three fourths of the orf, and myrv1 variants with genome rearrangements (s1l, s2l, s3l, s6l, and s10ss) induced by a multifunctional protein p29 of an unrelated virus, chv1 . While s8-lacking myrv3 strains have properties indistinguishable from wild - type myrv3, most myrv1 variants with rearranged segments induced different symptoms in the chestnut blight fungus than the wild - type virus . Therefore, these genome segment alterations are useful for gaining insights into functional roles of genome segments of mycoreoviruses for which a reverse genetics system is unavailable like many other reoviridae members . The chv1 p29-dependent rearrangements of myrv1 are a novel type of intriguing virus / virus interactions, and accordingly there are a few important unanswered questions . What is the biological significance of the interactions between the two viruses? What function of chv1 p29 is related to rearrangements? Does p29 contribute to generate de novo genome rearrangements or to select pre - existing rearrangements by altering the cellular state, while it is poorly defined at present? Does chv1 p29 induce genome rearrangements on other reoviruses such as myrv2 and myrv3? Experiments to address these issues are underway . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Metastatic lesions comprise approximately 1% of the tumors in the sellar / parasellar (sps) area for which patients undergo transsphenoidal surgery (tss) [1, 2]; however, it has been reported in autopsy series that the rate of metastasis to these areas could be as high as 28% . Breast and lung cancer are the two most common types of malignant tumors that metastasize to the sps region, with respective rates of 40% and 33% . Metastases of prostate, renal cell, gastrointestinal, thyroid [8, 9], and pancreatic cancers, and lymphoma, leukemia, melanoma, and plasmocytoma have also been reported . Despite the advancement in the imaging modalities, tumors that have metastasized to the sps areas may still be difficult to differentiate from pituitary adenoma on radiographic studies [2, 14, 15]. Thickening of the pituitary stalk and invasion of the cavernous sinus may be suggestive of such lesions, but invasion of the cavernous sinus may commonly occur with pituitary adenomas . This distinction is also clinically challenging, although there are very few symptoms that suggest a metastatic lesion . Management options are multimodal and vary depending on whether a primary source is known or on the likely differential diagnoses based on the clinical and radiological findings . Multimodal options include radiation therapy, chemotherapy, and/or surgery [16, 17], although the tumor invasiveness renders surgical resection limited . Although surgical series have not shown any survival benefits, the patient's quality of life may be improved [10, 14]. In this paper, we review the clinical, endocrine, and radiological features of the metastatic sps tumors with currently accepted therapeutic options based on the pertinent literature . In addition, we report six cases from our institution and discuss their management with long - term clinical outcome . A systematic review of the literature was performed using pubmed and the bibliographies of reviewed articles . The medical records of six patients admitted to the university of utah health sciences center between 2001 and 2011 were reviewed retrospectively . Clinical presentation, radiographic studies, treatment, histopathological confirmation, outcome, and prognosis were recorded (table 1). A 77-year - old man with known prostate cancer presented with a four - month history of left retro - orbital pain followed by left eye ptosis . At presentation, he had complete left third nerve palsy . His visual acuity was intact in both eyes, with full visual fields to confrontation . Brain magnetic resonance (mr) imaging (figure 1) showed a heterogeneously enhancing mass lesion that measured 29 17 29 mm involving the sella, with invasion of the left cavernous sinus and the upper clivus . The lesion extended to the inferior orbital fissure and was centered in the sella turcica and the cavernous sinus . He subsequently underwent chemotherapy and focused radiation to the sellar region and was noted to have stable neurological examination findings two months after surgery, with no change in his ophthalmoplegia . An 82-year - old woman with known history of breast cancer presented with several weeks' complaint of progressive left - sided hearing loss as well as facial pain and numbness in the first and the second divisions of the trigeminal nerve, respectively . On neurological examination, left - sided hearing loss and facial numbness along the v1 and v2 distributions were confirmed . Mr imaging showed evidence of a heterogeneously enhancing mass in the left petrous apex that extended to involve meckel's cave, the lateral cavernous sinus, and the internal auditory canal (figure 2). She was discharged home on postoperative day three in stable condition for followup with oncology . A 79-year - old man with known history of prostate cancer presented with several weeks' history of progressively worsening double vision and eventual right eye ptosis . Mr imaging disclosed an enhancing soft tissue mass involving the clivus, pituitary fossa, cavernous sinus, and posterior nasal cavity (figure 3) that surrounded both internal carotid arteries in the cavernous sinuses . An endonasal transsphenoidal approach to the sphenoid sinus was carried out to obtain a biopsy of the lesion . A histopathological diagnosis of metastatic melanoma was made, and evaluation was undertaken by the oncology team .) A 21-year - old man with a remote history of osteosarcoma and newly diagnosed metastatic renal cell carcinoma had complaints of worsening vision and facial pain . Because there was a discrepancy in the pupillary size between his eyes, he underwent a computed tomography (ct) scan of the head, followed by craniofacial mr imaging, which revealed an enhancing mass in the right sphenoid sinus with adjacent extension . On neurological examination, he was noted to have complete hemifacial numbness and horner's syndrome on the right side . Mr imaging of the face demonstrated a homogeneously contrast - enhancing lesion centered within the right sphenoid sinus measuring 33 20 27 mm (figure 4). The lesion extended into the carotid canal, pterygopalatine fossa, and optic nerve canal with destruction of the vidian canal and foramen rotundum on the right . A 42-year - old woman with several weeks of frontal headaches initially presumed to be secondary to a sinus infection underwent mr imaging after antibiotic medications failed to alleviate her symptoms . Brain mr imaging demonstrated a lobulated, 25 20-mm sellar and suprasellar lesion with extension into the right cavernous sinus and encasement of the right internal carotid artery . This lesion was isointense on t1- and t2-weighted images and heterogeneously enhancing with gadolinium administration . A ct scan was consistent with a lytic lesion involving the central skull base extending laterally and posteriorly to involve the bilateral medial sphenoid wings and the clivus, respectively . Histopathologic evaluation was consistent with a diagnosis of diffuse large b - cell lymphoma (figure 5). A 53-year - old woman presented with a known diagnosis of breast cancer and a one - year history of worsening left eye vision with a more precipitous decline in the last month . Mr imaging of the brain demonstrated a skull base lesion involving the left sphenoid bone, the anterior clinoidal process, and the cavernous sinus . On neurological assessment, the patient was noted to have an acutely diminished visual acuity in her left eye to a level of finger counting with left temporal visual field cut . Mr imaging (not shown) showed a homogenously contrast - enhancing lesion of the skull base involving the greater sphenoid wing and the anterior clinoidal process with encasement of the optic nerve on the left . A left frontotemporal craniotomy was performed for biopsy of the lesion and to decompress the optic nerve and the cavernous sinus with a subtotal resection . One year after surgery, her neurological findings were unchanged, and her systemic disease was under control . Neoplasms originating from a multitude of sites have been reported to metastasize to the sps region . Breast and lung cancer account for approximately two - thirds of sps metastases, being the most common sources in women and men, respectively, [11, 1821]. Histological examinations of the tissue samples obtained during palliative hypophysectomy performed in patients with end - stage breast cancer and from autopsy series have documented metastasis to the sps region in 6% to 29% of cases [3, 2225]. One hypothesis put forth to explain this prevalence is that the prolactin - rich environment of the pituitary enhances the proliferation of breast tumor cells . After carcinoma of breast and lung, lymphoma and prostate cancer have been reported to be the most common sources of metastasis to sps region . Liver, renal cell, colon, and thyroid cancers and melanoma are rare sources of distant metastases to this region . The relatively rarer occurrence of our other cases, prostate, melanoma, renal cell, and lymphoma, is consistent with the literature . Most cases are found in the sixth or the seventh decade of life as a part of a generalized metastatic spread, commonly associated with multiple, particularly osseous metastases [18, 20]; however, metastases can occur in young patients . The age of presentation ranged from 21 to 82 years in our small series, with an average age of 60 years . Very occasionally, these lesions are the first manifestation of an occult cancer or the only site of metastasis [14, 20]. Thus, in a patient without any prior history of cancer, an sps lesion cannot be assumed to be an adenoma, just as in a patient with a known primary cancer, it is not always metastatic . Clinically, metastasis is generally suspected in patients with rapid onset and progressive symptoms, irrespective of a history of malignancy . The possible metastatic pathways to the pituitary and parasellar region include direct blood - borne metastasis to the posterior pituitary lobe, pituitary stalk, clivus, dorsum sellae, or cavernous sinus or leptomeningeal spread with involvement of the pituitary capsule [10, 26, 27]. There has been some controversy regarding the most common location of metastasis within the pituitary gland . Authors of early series have reported that the majority of pituitary metastasis occurs in the posterior pituitary, but some dispute this claim . Teears and silverman reported that 57% of the lesions localized to the posterior pituitary alone, 13% to the anterior pituitary alone, 12% to both lobes, and the remaining 18% to the capsule or stalk . They hypothesized that the posterior pituitary, by receiving direct arterial supply, is more likely to develop metastases than the adenohypophysis, which receives its blood supply from the hypophyseal portal system . The posterior lobe has a larger area of contact with the adjacent dura, which may be another contributing factor [4, 18]. Metastatic inoculation in the anterior lobe is usually the result of contiguous spread from the posterior lobe . These may be isolated, such as diplopia or ptosis, with the third (oculomotor) and the sixth (abducens) nerves being the most commonly involved, followed by the fourth (trochlear) nerve [14, 2931], or they may appear in a constellation of symptoms characterized by unilateral, rapidly progressive ophthalmoplegia with retroorbital pain . This latter presentation is the usual presentation of the cavernous sinus syndrome, also known as parasellar syndrome . If the branches of the trigeminal nerve are affected, alteration in the facial sensation, facial pain, or dysesthesia occurs . Headache has been reported as a rather common symptom, with an incidence as high as 70% [14, 34, 35]; however, the majority of pituitary metastases are clinically silent . In the autopsy study by teears and silverman, these metastases are often seen in patients with terminal malignancy who present with malaise, generalized pain, central nervous system involvement, or treatment - associated symptoms, although symptoms of pituitary insufficiency may be masked . Several studies have indicated that diabetes insipidus (di) was the most common symptom [10, 20, 24, 36, 37]. In the series of mccormick et al ., di developed in 70% of patients; however, if the anterior pituitary function is compromised, di may be concealed by reduced mineralocorticoid function . In some recent series, di has not been reported, which is likely because modern imaging techniques are able to detect abnormalities earlier than the timeframe required for di development . Other rarer hormonal findings may be hypothyroidism and hypoadrenalism, hypogonadism, or overproduction of adrenocorticotropic hormone (acth), growth hormone (gh), or prolactin [10, 3840]. Because of their invasiveness, pituitary metastatic lesions have a high potential to cause visual deficits from suprasellar extension, with an incidence as high as 50% reported by branch jr . And laws jr . And others [10, 34, 41]. In both the series by chiang et al . And that of sioutos et al cranial nerve palsies involving the third and the sixth nerves and facial pain with numbness (trigeminal origin) were the most common presentation (33%) in our cases with cavernous sinus involvement . Retro - orbital pain, vision compromise, gait instability, horner's syndrome, and hearing loss were infrequent and associated with petroclival and sphenoorbital extension of the lesions . All these symptoms were experienced with a relatively rapid onset from a few weeks to a few months that suggested the aggressive character of the lesions . Symptoms strongly suggesting metastasis in the parasellar or sellar space include painful ophthalmoplegia in association with the sudden onset of di [10, 26, 34, 42]. The pain may be retro - orbital or may be due to trigeminal dysfunction [4345]. In our series, 5 of the 6 (83%) patients had a previous history of malignant disease . One of the patients that had prior history developed a malignancy (melanoma) other than the original one . Only one patient without a prior history of malignancy first presented with lymphoma metastasis to the sps region . Because pituitary adenomas also present with invasion of the sellar floor, cavernous sinus, or clivus, no specific neuroimaging criteria to define metastatic lesions in sps region have been reported . The diagnostic imaging tools for sps metastasis mainly include high - resolution ct and mr imaging . Although ct is superior to mr imaging in detecting the bone involvement, the latter is preferable to determine the relationship of the lesion to the surrounding neurovascular structures . Although nonspecific, the characteristics of these lesions on mr imaging are an iso- or hypointense mass on t1-weighted imaging with a usually hyperintense signal on t2-weighted imaging, and homogeneously enhancing mass in images obtained after the administration of contrast agent . Invasion of the cavernous sinus, sclerotic changes around the sella turcica and clivus, isointense signal on both t1- and t2-weighted imaging, and loss of high - intensity signal in the posterior pituitary have been reported to be helpful in differentiating metastatic lesions from benign ones [15, 30, 48]. . Found that thickening or enhancement of the infundibulum was the most characteristic ct or mr imaging feature . Schubiger and halter reported that the invasion of the infundibular recess by a suprasellar mass is suggestive of metastasis . Because of the rapid growth of metastatic lesions, a dumbbell - shaped intra- and suprasellar tumor with indentation at the diaphragm level is generally indicative for these cases [20, 37, 49]. The radiodiagnostic findings that suggested a malignant / metastatic process in our cases were the involvement of multiple compartments in the anterior, middle, posterior cranial fossae, extension to the infratemporal and pterygopalatine fossae, sphenoid sinus, and nasal cavity with bony destruction in the cranial base and asymmetric or bilateral invasion into the cavernous sinus . The management of sps metastases is multimodal, including surgical resection, radiation therapy, and chemotherapy . Treatment is mainly palliative and depends on the symptoms and the extent of systemic disease [10, 51]. Because of the invasiveness and the high vascularity of the tumor, total surgical resection is generally not undertaken [1, 20]. Therefore, surgical treatment should aim for symptomatic relief and the preservation of visual function, even in patients with widespread primary disease, and should be followed by local radiation treatment and/or chemotherapy [10, 51]. The body of evidence is inconclusive on the effect of the latter two modalities on survival [14, 52]. Laws jr . Reported improvement in symptoms, especially in pain and visual field defects, with no difference in survival after complete resection compared with subtotal or partial resection [10, 14]. On the other hand, others have supported the concept of improvement in survival after surgical resection of the lesion [5355]. Surgical exploration is also essential if tissue diagnosis is likely to affect therapy in patients with no known primary malignancy . Resection is most commonly done via transsphenoidal route, although subfrontal or pterional approaches are also options depending on the location and the extension of the lesion . Four out of six patients in our series underwent surgical biopsy through either transsphenoidal or transcranial route and then underwent subsequent radiation / chemotherapy . One patient who had visual compromise had subtotal resection for palliation followed by radiation / chemotherapy . One patient who had renal cell carcinoma was directly referred to radiation oncology for immediate radiation and subsequent chemotherapy . Besides its role as an adjunct after surgery [14, 42, 56], radiosurgery or conventional radiation is recommended as the initial course of treatment in patients with systemic disease out of control, recurrence in the systemic disease with concomitant sps metastasis, or medical comorbidities that put the patient at risk for a surgical intervention [2, 7, 18, 41, 5762]. Radiosurgery, which is considered less invasive than conventional radiation, has been reported to achieve good tumor control [63, 64]. In a series of 23 patients by iwai et al ., the rates of tumor control and symptom improvement were 67% and 53%, respectively; however, radiosurgery to the sps region is limited by its potential to cause radiation injury to the surrounding neurovascular structures such as optic apparatus, pituitary gland, or cranial nerves coursing in cavernous sinus . Doses reported in the literature for these structures range from 8 to 40 gy [63, 6568], and the optimal dose may be quite variable depending on the proximity of the lesion . Furthermore, the debate about whether the radiation should be directed to the sps region alone or to the entire brain continues . Chemotherapy is commonly used alone or along with radiation therapy mostly for palliation in the treatment of metastatic disease in sps region . Its value has not been adequately studied and reported in the literature . The prognosis of patients with metastases to the sps region is grim in a majority of cases because of the aggressive character of the primary disease . Even in patients with no other metastasis at the initial evaluation, the prognosis remains poor because of radiologically undetectable microscopic metastases; however, it has been suggested that the extent of systemic disease affects survival in these patients . Patients with a single sps region metastasis may have a better outcome [10, 20]. Median survival is less than 2 years independent of the management strategy [10, 14, 70]. The records on the long - term follow - up of the majority of our patients are lacking because the patients were not monitored for surgical outcome, or the follow - up periods were too short . The only patient that had palliative surgery for vision compromise was seen at one year after the surgery with stable neurological findings . Suggestive symptoms include rapid onset of progressive ophthalmoplegia with retro - orbital or facial pain, visual impairment, and/or di . Management varies depending on whether a primary source is identified, the symptomatology, the location and extent of the lesion, the stage of the primary disease, and the medical comorbidities . Subtotal or partial surgical resection is aimed mainly for symptom relief . A multimodal approach involving subtotal resection of the lesion followed by radiation and/or chemotherapy is widely accepted, especially in symptomatic patients whose primary disease is under control . Radiation with or without chemotherapy is generally recommended as first - line treatment in patients with advanced primary disease or in those with high - risk medical comorbidities . A biopsy usually precedes radiation therapy if the primary source of the metastasis is unknown . The prognosis for patients is generally poor, independent of the therapeutic modality, and the overall survival is less than two years.
|
Brain - derived neurotrophic factor (bdnf) is a member of the nerve growth factor family and it exerts its effects by binding to the tropomyosin kinase b receptor . Among the neurotrophins bdnf is a basic dimeric protein, and its subunit is a 13.5 kda (119 amino acids) molecule . It is an essential mediator of neuronal activity and synaptic plasticity in both the central and peripheral nervous systems, and it enhances the growth and maintenance of several neuronal systems by serving as a neurotransmitter modulator 1 . It is well known that the bdnf expression increases following an insult to the central nervous system (cns). Although many studies have demonstrated a relevant role of bdnf for regulating neuroprotection, recent findings have suggested that changes of plasma bdnf level, regardless of nervous system, are also associated with several inflammatory or metabolic derangement conditions 2 - 4 . Decrease of renal function induces accumulations of circulating cytokines, advanced glycation end product and pro - oxidants, which contributes to the pro - inflammatory milieu in patients with chronic kidney disease . Uremic inflammation is associated with various adverse outcomes in hemodialysis (hd) patients, such as cardiovascular disease, malnutrition and neurological disorders . While many studies have investigated inflammatory cytokines as a reflection of uremic condition in hd patients, there is no information about the peripheral changes of bdnf in patients undergoing hd as far as we are aware . In this cross - sectional study, we investigated the changes of the plasma bdnf levels in hd patients and evaluated the potential correlations between this peptide and selected parameters of uremic inflammation . Using a cross - sectional design, we studied 60 randomly selected, stable uremic patients who were undergoing hd for more than 6 months and 30 healthy control subjects who were matched for age and sex . Patients with known hypersensitivity to the dialysis membrane, signs of infection, malignancy, severe liver disease, autoimmune disease, previous history of renal transplantation, treatment with drugs known to interfere with the immune system were excluded . Following an overnight fast, blood samples were collected from both hd patients and control subjects . For the hd patients, the samples were obtained from the arterial side at the time of needling before the dialysis session . Fasting blood was withdrawn into a lithium heparin vacuum tube and immediately centrifuged at 3,800 rpm for 10 minutes . Human plasma bdnf was assayed using the duoset elisa development system (catalog number: dy248, r&d systems, uk). All the assays were performed in duplicate using the manufacturer's recommended buffers, diluents and substrates . The intra - assay and inter - assay coefficients of variation were 5.4% and 9.8%, respectively . The concentrations of the samples in each plate were calculated according to each standard curve and the dilution factor . The cytokine assays for human serum il-2, il-4, tumor necrosis factor- (tnf-) and interferon- (ifn-) were performed using the highly sensitive hs - elisa development system from r&d systems, abingdon, uk . The intra- and inter - assay coefficients of variation were 5.6 and 7.08%, respectively, for il-2, il-4, and tnf-. The intra- and inter - assay coefficients of variation were 6.7 and 9.2% for ifn- 5 . The presence of diabetes, body mass index (bmi), dialysis duration and dialysis adequacy (kt / vurea) were assessed in the hd patients . We also measured hemoglobin, hematocrit, platelet count, blood urea nitrogen, creatinine, serum albumin, lipid profiles, calcium, phosphorus, intact parathyroid hormone (ipth), high sensitivity c - reactive protein (hs - crp, normal value <3.0 mg / l), ferritin and fibrinogen in these patients . The data with continuous variables and a normal distribution were presented as means standard error, and those without a normal distribution were presented as the median with ranges . The kolmogorov - smirnov test showed that the bdnf values did not fit a standard distribution curve . Therefore, statistical analyses were performed using an appropriate non - parametric test, the mann - whitney u - test . The relationship between bdnf levels and other clinical or biochemical parameters was also analyzed by multiple regression analysis . Using a cross - sectional design, we studied 60 randomly selected, stable uremic patients who were undergoing hd for more than 6 months and 30 healthy control subjects who were matched for age and sex . Patients with known hypersensitivity to the dialysis membrane, signs of infection, malignancy, severe liver disease, autoimmune disease, previous history of renal transplantation, treatment with drugs known to interfere with the immune system were excluded . Following an overnight fast, blood samples were collected from both hd patients and control subjects . For the hd patients, the samples were obtained from the arterial side at the time of needling before the dialysis session . Fasting blood was withdrawn into a lithium heparin vacuum tube and immediately centrifuged at 3,800 rpm for 10 minutes . Human plasma bdnf was assayed using the duoset elisa development system (catalog number: dy248, r&d systems, uk). All the assays were performed in duplicate using the manufacturer's recommended buffers, diluents and substrates . The intra - assay and inter - assay coefficients of variation were 5.4% and 9.8%, respectively . The concentrations of the samples in each plate were calculated according to each standard curve and the dilution factor . The cytokine assays for human serum il-2, il-4, tumor necrosis factor- (tnf-) and interferon- (ifn-) were performed using the highly sensitive hs - elisa development system from r&d systems, abingdon, uk . All the assays were performed according to the manufacturer's instruction . The intra- and inter - assay coefficients of variation were 5.6 and 7.08%, respectively, for il-2, il-4, and tnf-. The intra- and inter - assay coefficients of variation were 6.7 and 9.2% for ifn- 5 . The presence of diabetes, body mass index (bmi), dialysis duration and dialysis adequacy (kt / vurea) were assessed in the hd patients . We also measured hemoglobin, hematocrit, platelet count, blood urea nitrogen, creatinine, serum albumin, lipid profiles, calcium, phosphorus, intact parathyroid hormone (ipth), high sensitivity c - reactive protein (hs - crp, normal value <3.0 mg / l), ferritin and fibrinogen in these patients . The data with continuous variables and a normal distribution were presented as means standard error, and those without a normal distribution were presented as the median with ranges . The kolmogorov - smirnov test showed that the bdnf values did not fit a standard distribution curve . Therefore, statistical analyses were performed using an appropriate non - parametric test, the mann - whitney u - test . The relationship between bdnf levels and other clinical or biochemical parameters was also analyzed by multiple regression analysis . The plasma bdnf level was significantly higher in hd patients than in control subjects (median 630.3, range 76.4 - 1435.0 vs. 312.4, 78.7 - 969.9 pg / ml, respectively, p <0.05) (figure 1). Serum il-2, il-4, tnf- and ifn- also showed higher values in the hd group than in the control group (p <0.05). There were no significant differences in age, gender and bmi between the hd group and the control group (table 1). The baseline characteristics of the hd patients are summarized in table 2 . Among the 60 hd patients, 26 (43.3%) had diabetes . The median duration of dialysis was 43.5 months (range, 7 - 240 months). We classified hd patients into subgroups according to age, gender and the presence of diabetes, and compared the plasma bdnf levels between subgroups . There were no significant differences in the plasma bdnf level in subgroup analysis according to age (60 years, median 592.7, range 90.5 - 1380.0 pg / ml; 60 years, median 635.7, range 76.4 - 1435.0 pg / ml; p = 0.83) and gender (male, median 512.0, range 76.4 - 1435.0 pg / ml; female, median 625.3, range 90.5 - 1412.6 pg / ml; p = 0.40). However, the plasma bdnf level of diabetic hd patients showed higher value compared to those of non - diabetic hd patients and control subjects (diabetic hd patients, median 822.4, range 90.5 - 1435.0 pg / ml; non - diabetic patients, median 418.7, range 102.4 - 835.0 pg / ml; control subjects, median, 312.4, range 78.7 - 969.9 pg / ml; p <0.01). Furthermore, non - diabetic hd patients showed slightly, but significantly higher plasma bdnf value than control subjects (p = 0.022; figure 2). Correlation analysis was performed to examine the relationships between logbdnf and the clinical or biochemical parameters in the hd group . The logbdnf was positively correlated with hs - crp (r = 0.409, p <0.01) and ifn- (r = 0.551, p <0.01), and it was negatively correlated with serum albumin (r = -0.408, p <0.01). In multivariate regression analysis, logbdnf was independently related to the presence of diabetes (-coefficient = 0.399, p = 0.041) and ifn- (-coefficient = 0.538, p = 0.003) after adjustment for age, sex, bmi, dialysis duration, serum albumin, crp and cytokines (table 3). According to many other studies, bdnf has been shown to protect the cns under a variety of conditions . Previous work demonstrated that patients with fibromyalgia and depression have increased serum bdnf concentrations 6 . It has also been shown that plasma bdnf concentrations were elevated in drug users or in patients with chronic stress 7,8 . Recently, apart from nervous systems, there are several reports showing the associations of plasma bdnf with systemic or peripheral inflammatory conditions, such as diabetes, acute coronary syndrome, atherosclerosis or rheumatoid arthritis 2 - 4 . In this study, we investigated for the first time the changes of the plasma bdnf level in uremic condition and the correlations between bdnf and clinical or biochemical parameters in hd patients . We found that the plasma bdnf level was significantly elevated in patients who were undergoing hd compared to the control subjects . The plasma bdnf was removed during dialysis session . In our study, the average plasma bdnf clearance of a single hd session, which is defined as the pre - hd blood levels minus the post - hd blood levels divided by the pre - hd blood levels, was ~ 19.4%, and the median post - hd plasma bdnf level was 508.1 pg / ml (range, 25.1 - 1327.0 pg / ml). The post - hd plasma bdnf level was significantly higher than that of the controls (p <0.05). However, there was no correlation between the post - hd plasma bdnf and the clinical or biochemical parameters including cytokines (data not shown). In the present study, the increase of the bdnf to be more marked in the hd patients with diabetes . Previous animal research demonstrated that subcutaneous administration of bdnf reduced food intake and ameliorated impaired glucose tolerance in diet - induced obesity mice 9 . Furthermore, systemic bdnf treatment normalized fasting blood glucose, hemoglobin a1c and lipid profiles 10,11 . Therefore, in the present study, it is possible that plasma bdnf may increase in hd patients with diabetes to compensate hyperinsulinemia and insulin resistance . However, there is a controversy as to whether the serum bdnf level is higher in diabetics than in non - diabetics who are not undergoing dialysis treatment . A previous study showed that serum bdnf level was higher in newly diagnosed type 2 diabetic patients than in normal controls 2 . On the other hand, fujinami et al . Reported that serum bdnf levels were significantly lower in patients with advanced type 2 diabetes compared to control subjects 13 . In our results, most of diabetes in dialysis group were not newly diagnosed, and might be more complicated diabetes . Therefore, the presence of diabetes alone could not explain the elevated level of the plasma bdnf in the present study . Our results also showed that the plasma bdnf level in non - diabetic hd patients was higher than that of control subjects . There may be many other factors including uremic inflammation to increase the plasma bdnf level in diabetes of the hd patients . There were no differences of plasma bdnf level according to age or gender subgroups in our hd patients . Conflicting results exist as regards the changes of bdnf associated with age or gender differences . A recent report showed that a significant age - related increase of the plasma bdnf level in down's syndrome patients 14 . However, there are also reports showing age - related decrease of the serum bdnf level or no significant difference of the serum bdnf in age 6,13 . In the gender aspect, a previous report showed that bdnf levels were significantly higher in females than in males with type 2 diabetes 2 . In contrast, laske et al . Revealed no significant gender difference of the serum bdnf in fibromyalgia patients 6 . It seems that gender or age - related serum bdnf results could differ according to underlying disease and study population . Recent studies demonstrated that pro - inflammatory cytokines, such as il-1, il-6, tnf- and ifn- showed higher value . Anti - inflammatory cytokine levels including il-2, il-4, il-5 and il-12 were decreased in dialysis patients 15 . In the present study, in addition, the hd patients showed a significantly positive relationship between the plasma bdnf and the serum ifn- in multivariate regression analysis . Increases of bdnf expression in inflamed bladder tissues and in airway epithelium during allergic airway inflammation have been demonstrated 16,17 . Furthermore, grimsholm et al reported that plasma bdnf level in rheumatoid arthritis patients showed higher values than in healthy controls, and anti - tnf treatment lead to a decrease in the plasma bdnf level 4 . It is unclear that higher plasma bdnf in the hd patients was associated with uremic inflammation . It has been shown that activated antigen - specific t cells, b cells, and monocytes produced bdnf 18 . Uremic inflammatory state is characterized by enhanced immune system which involves both t lymphocytes and monocytes 19 . Therefore, it is postulated that chronic inflammatory condition and enhanced immune system is associated with the production of bdnf, which may explain the reason that the plasma bdnf level in non - diabetic hd patients was higher compared to that of control subjects in this study . Serum contains platelets, and it has been well established that large amount of bdnf is stored in platelets 20 . It was previously reported that serum bdnf level was found to be 200-fold higher than plasma level 21 . Thrombin, collagen, the ca ionophore a23187 and shear stress stimulated a rapid release of bdnf from platelets 20 . Thus, the difference between serum and plasma levels of bdnf could explain the amount of bdnf stored in platelets, and plasma bdnf may reflect circulating levels rather than the levels stored in platelets 22 . Only a few data are available on plasma bdnf levels and it is difficult to determine the significance of bdnf of plasma according to disease state . Nofuji et al . Recently reported that the serum bdnf concentration was found to significantly change according to exercise, however, the plasma bdnf level was not 23 . On the other hand, piccinni et al . Showed in their study with depressed patients that while the plasma bdnf levels increased in parallel with the clinical improvement after one month antidepressant treatment, they could not detect any significant change in serum bdnf levels in spite of the treatment 24 . In the future, studies will be required to determine the action and regulation of plasma bdnf in peripheral blood according to disease state . First, this is a cross sectional study, therefore, longitudinal observation is needed to assess the relationship between this peptide with uremic inflammatory conditions and clinical outcomes . Second, this study is limited by its small sample size . Further study with a large dialysis population would add further information about the role of bdnf as markers of inflammation and malnutrition including hs - crp and serum albumin . Third, in this study, we measured only the plasma levels of bdnf, and this was the major limitation of the study . The source of plasma bdnf and its biological activity were not investigated in the present study . Future studies are needed to determine which source of bdnf - platelets, plasma, serum, or whole blood - provides the most reliable biological marker of patients with hd . Finally, we did not provide data on the assessment of nervous system functions in the patients and the other neurotrophins such as nerve growth factor or neurotrophin-3 . The evaluation of these parameters in the hd patients may help to explain the change of the plasma bdnf level in uremic condition . In conclusion, the plasma bdnf level showed higher values in the hd patients, and the presence of diabetes seemed to be associated with the higher value of the plasma bdnf in the patients . In addition, the plasma bdnf level was found to be positively correlated with inflammatory cytokine in these patients, which suggests that plasma bdnf might reflect the uremic inflammatory condition in the patients undergoing hd.
|
Understanding information transmission within neuronal circuits, and the factors underlying long - range axonal signaling malfunction, relies on identifying the axonal ion channels that are key regulators of node of ranvier (nor) excitability . Nors are highly specialized zones in myelinated axons containing high densities of voltage - gated sodium channels (navs) and associated cytoskeletal complexes, creating active zones essential for saltatory conduction of action potentials (aps) (debanne et al ., 2011). The repolarizing currents required to sustain nav availability at nors for reliable ap transmission is less clear cut, particularly in the mammalian brain . Both low- and high - voltage - activated potassium (k) channel subunits (kv7 and kv3.1/3) have been anatomically localized to nors (devaux et al ., 2003, 2004; pan et al ., 2006), and although their presence can vary between brain regions and axon types (debanne et al . 2003, 2004), recent experiments provide direct evidence that kv7 channels stabilize nor membrane potential (vm) in cortical l5 pyramidal cells (battefeld et al ., 2014) consistent with findings in peripheral nerve (schwarz et al ., 2006). The influence of delayed rectifier (dr) k channels (kv1.1 and kv1.2), which are widely observed in the juxtaparanodal (jp) zone (devaux et al ., 2003; ogawa et al ., 2010; rasband, 2010; zhou et al ., 1998), has, however, been difficult to assess without demyelination (rper and schwarz, 1989; wilson and chiu, 1990), and whether local vm becomes sufficiently depolarized to recruit jp kv1 channels during saltatory conduction is disputed (arancibia - carcamo and attwell, 2014). Voltage - gated ca channels (cavs), which could provide an additional source of depolarization as well as gating ca - dependent processes including recruitment of ca - dependent k channels (kca), have been described in central myelinated axons and shown to influence excitability at the axon initial segment (ais) (bender and trussell, 2009; bender et al ., 2010; yu et al ., 2010). However, although cavs have been proposed to influence nor formation during development (alix et al ., 2008), their presence at mature nors in the brain is not established (zhang et al ., 2006). Purkinje cells (pcs) in the cerebellum fire at high rates, both spontaneously and in response to synaptic input, and thus require fast recovery of sodium channels at their nors . We have obtained direct evidence that, rather than solely relying on voltage - gated potassium channels, activity - dependent, spatially localized ca influx at nors of pc axons recruits an intermediate - type kca (ik, or kca3.1) to provide a node - specific repolarizing conductance crucial for axonal spike propagation . Using simultaneous somatic and axonal patch - clamp recordings, local pharmacology, and two - photon ca imaging of cerebellar pc axons, we directly investigated which ion channels are engaged at nors during ap propagation . We visualized pc axons in cerebellar slices by dye filling via the somatic recording pipette and recorded axonal aps downstream of nors (see the experimental procedures; figure 1a) identified by virtue of their presence at axonal branchpoints (clark et al ., aps are securely transmitted by pc axons at high firing rates, with failures occurring above 250 hz (khaliq and raman, 2005; monsivais et al ., 2005). This propagation reliability is retained across axonal branchpoints, with equal limiting frequency in both the main projection axon (257 17 hz; also monsivais et al ., 2005) and in recurrent axon collaterals (figures 1b and 1c, 253 14 hz, 0.05% differentially propagated spikes, n = 6 cells, see also foust et al ., 2010). We used local application (figure s2a) of various ion channel antagonists to test their impact on ap propagation at nors in spontaneously firing pcs (firing rates 2080 hz). Ttx (10 m) completely blocked ap propagation, confirming the presence of a nor at branchpoints (figure s1d; see also khaliq and raman, 2005). In contrast, application of tea at a concentration (10 mm) that should block a wide variety of k channels including kv1, kv3, and kv7 types (grissmer et al ., 1994;, 2000) did not affect ap propagation, having no impact on axonal capacitive current amplitude, firing rate, or conduction velocity (figures s1b and s1c). This lack of effect was similar at high firing rates, and the limiting frequency for spike propagation was unchanged (figure s1d). These results are unexpected given that tea - sensitive k - channels are thought to contribute to axonal ap repolarization (devaux et al ., 2003; hille, 1967; rper and schwarz, 1989), to stabilize nodal vm as well as preventing antidromic spike reflection (goldstein and rall, 1974), and kv3.3 subunits have been localized to pc axons (chang et al ., 2007). Potential explanations for these results might be that first, tea - sensitive k channels are absent from pc axons and/or their nors and repolarization is mediated by an alternative mechanism . Second, they may be present but at insufficient density to be primary regulators of node excitability . Third, tea - sensitive k channels might be located behind tight myelin junctions in the juxtaparanodes (jps) (wang et al ., 1993) and contribute to repolarization of the axonal membrane while being inaccessible to tea, as observed in peripheral nerve (chiu and ritchie 1980; kocsis and waxman 1980) (however, see mierzwa et al ., 2010). Fourth, these channels may be present in the jps but weakly activated by the limited vm changes that are calculated to occur in healthy myelinated axon segments (arancibia - carcamo and attwell, 2014). Recently, an intermediate - type kca conductance (ik, kca3.1), not previously observed in the cns and with a lower sensitivity to tea (ic50 = 24 mm) (wei et al ., 2005), was described in cerebellar pcs and shown to contribute to postsynaptic integration (engbers et al ., 2012). We examined whether ik might provide an alternative mechanism for regulating excitability at nors and found that local application of the selective ik channel antagonist tram-34 (engbers et al ., 2012; wulff et al ., 2000) to axonal branchpoints led to a concentration - dependent block of axonal spike propagation during spontaneous firing (2080 hz; figures 1d1 g), with no observed dependence on firing rate (r = 0.1). Clotrimazole (1 m), another ik - selective blocker, had similar effects (figure 1 g), while apamin (1 m) and iberiotoxin (1 m), which block small (sk) and large (bk) kca channels, respectively, had no impact (98% 0.44% [n = 5] and 97.3% 1.2% [n = 4] of control axonal spike amplitude). Ik gating depends solely on intracellular [ca] (kd: 0.10.3 m) (wei et al ., 2005; 1997), and, since both local removal of extracellular ca and application of ni (100 m) similarly suppressed action potential propagation (figures 1d1 g), the activation of ik is likely initiated by ca influx via cavs . We confirmed that pc axons are immunopositive for the kca3.1 subunit, the sole molecular entity that constitutes the ik channel, but found, surprisingly, that no hotspots were seen at nors and that kca3.1 labeling was instead relatively uniform along the axon (figure 2). Activity - dependent ca influx has been observed in optic nerve (lev - ram and grinvald, 1987; zhang et al ., 2006), but the resulting ca transients are spatially uniform along both nors and internodes (zhang et al ., 2006), and the route of ca entry is uncertain . As yet, there is no direct evidence for ca influx localized to nors in the brain . Using two - photon ca - imaging, we investigated whether the spatial distribution of calcium signals in pc axons might confer nor specificity of ik recruitment . We detected prominent activity - dependent increases in intracellular ca concentration ([ca]i) at nors (identified by their location at branchpoints) and at the ais (see bender and trussell, 2009) during trains of evoked aps (figures 3a3c; 204 21 hz). Ca signals were restricted to approximately 5 m from the center of nors (figures 3c and 3d), and there were no detectable changes in internodal [ca]i (figure 3b), consistent with the lack of effect on spike propagation of 0 mm ca, 10 mm bapta application to the internodes (figure s2b). [ca]i at nors required axonal aps, were suppressed when spontaneous firing was arrested by somatic hyperpolarization (figure 3 g), and could not be driven by somatic depolarization when spikes were blocked with bath - applied ttx (figures 3e and 3f). Increases in [ca]i were spike rate dependent (figure s3), slow, and cumulative and lead to sustained [ca]i during continuous activity (figures 3 g and 3h). [ca]i increase was also suppressed by removal of extracellular ca (16% 6% of control n = 4; figure 3i) and bath application of mibefradil (figures 3i and 5 m, 43% 14% of control, p = 0.013) but was not sensitive to agatoxin iva, which blocked ca transients in pc synaptic boutons as expected (hillman et al ., 1991) (figures 3i; 9% 3% of control, p <0.0001). This implies that t - type and not p - type cavs are the primary source of ca entry at nors . Additionally, although prior depolarization of the soma reduced [ca]i at the ais, ap - triggered nodal ca signals were unaffected (figures s3c and s3d), demonstrating that, in pcs, nodal [ca]i is independent of somatic vm . To understand the major impact of ik block on axonal ap propagation, we used a multicompartmental model of a pc (clark et al ., 2005) and tested whether ik, as the sole repolarizing conductance at the nors, can support reliable propagation of aps in a continuously firing axon (see the experimental procedures for details). At a minimum ik density of 0.05 s / cm, with an associated t - type cav with a maximum permeability of 0.002 cm / s (anwar et al ., 2012) and an accompanying, low - density, juxtaparanodal dr k conductance (0.002 s / cm, clark et al ., 2005) to mimic the kv1.1/kv1.2 channels commonly observed in immunohistochemical studies (rasband 2010), ap propagation along the model axon was highly reliable . Complete removal of the ik conductance alone caused nor depolarization, trapping of sodium channels in inactivated and blocked (khaliq et al ., 2003) states, and ap propagation block (figure 4a). Ik may therefore act to stabilize the nor vm during continuous firing and application of the ik channel inhibitor tram-34 (figure 1) could cause depolarization block . Our observed lack of effect of tea application to nors (figure s1) implies that other k channel types previously shown to be present in pc axons (kv3.1, chang et al ., 2007) and nors (kv7.3, pan et al ., 2006) may not, in the absence of ik, be sufficient to support ap propagation . A direct test of the hypothesis that ik stabilizes nodal vm requires quantitative measurements of axonal vm during ik block . Since pc nors are too small for patch - clamp recording and voltage - sensitive dye methods cannot be used to detect absolute changes in vm, we used the ais as a proxy for nors while recording spontaneous firing at the soma, presuming that some ik might be present there, as suggested by our immunohistochemistry data (figure 2). During tram-34 application to the ais, we observed a reduction in somatic firing rate of 25% 5.2% (p <0.001, n = 15 cells, figure 4c), accompanied by a small somatic depolarization (1.5 0.2 mv, p <0.0001) and an increase in ap threshold (1.8 0.16 mv, p <0.0001). In a minority of cells (4 / 15), tram-34 application to the ais caused sufficient depolarization (vm = 2.56 1.28 mv, mean vm = 48.4 1.9 mv) to reversibly but completely block firing in some trials . Reduction of firing rate correlated with initial firing rate (r = 0.53, p <0.05) so that cells with higher baseline rates showed a smaller reduction in spike rate on tram-34 application . This may reflect the presence of rate - dependent recruitment of bk and sk currents shown to regulate pc somatic vm during spontaneous firing (raman and bean, 1999). Analysis of the second derivative of the somatic ap revealed a reduction in the component driven by current flow from the ais (figure 4d) as well as the local somatic component of the action potential during tram-34 application, indicating a reduced recruitment of sodium current at both locations . Kca channels have been implicated in control of excitability in both unmyelinated (lscher et al ., 1996) and myelinated (lev - ram and grinvald, 1987) mammalian axons, although the evidence for the latter is indirect and the physiological impact unknown . Our results provide the first direct evidence for local, activity - dependent cav - mediated ca influx at nors and for the recruitment of an intermediate kca current (ik, kca3.1) that is an essential component for spike propagation . Our model indicates that ik alone can sustain the nav availability required for propagation security, although it is conceivable that other conductances might also play a role, for example, in setting the nodal vm in the absence of firing . The sensitivity of ap conduction to low concentrations of ni and the suppression of the ca transients by mibefradil is consistent with the involvement of a t - type cav, as seen in association with dendritic ik in pcs (engbers et al ., 2012). During sustained firing, this channel type is expected to be largely inactivated but could provide a small window current for ca entry . This might be of advantage since, due to the higher affinity of ik for ca (wei et al ., 2005), a small ca influx can be effective but less expensive for an energetically demanding cellular compartment . Ik may provide advantages over other k channel types in axons that continuously transmit aps, often at high rates . Ik lacks intrinsic voltage dependence and does not inactivate, but, by virtue of the activity dependence of ca influx, it could be recruited and sustained at levels controlled by mean spike rate . Its localized recruitment by ca may also be amplified by ca - induced ca release (llano et al . It has recently been shown that pcs also express bk channels under the myelin in the paranode region (hirono et al ., 2015). These channels appear to become functionally relevant at firing frequencies above 100 hz, suggesting that they may act as a complementary partner to ik under conditions when [ca]i is sufficient for their activation . In the absence of fast voltage - gated k currents, aps at nors may also be broader, as generated by the model, than the exceptionally narrow somatic aps in pcs, potentially further facilitating ca entry at these sites . Besides its role in axonal electrogenesis, nodal ca influx could also be important in regulating nor structure and functional properties . For example, activity - dependent local ca levels might be crucial to target and maintain cavs (forti et al ., 2000) and navs (hund et al ., 2010) at nors (wang et al ., 2007) and to preserve or modify nodal architecture and myelin distribution (alix et al ., 2008; einheber et al ., 1997). Ca signaling is thought to underlie the activity - dependent changes in mitochondrial motility observed in mammalian axons (chiu, 2011), notably in pcs (ohno et al ., 2011). Importantly, given their spike frequency dependence, nor ca signals could provide a readout of neuronal circuit activity, which could result in ca - dependent axonal plasticity beyond the ais (grubb and burrone, 2010; grndemann and husser, 2010; kole, 2011; kuba et al ., 2010). In providing direct evidence for activity - dependent ca entry at nors and its recruitment of ik, our findings show that ca may play both short- and long - term roles in regulating axonal excitability, crucial for long - range signaling in neuronal circuits . Methods used for preparing and recording from pcs and pc axons in cerebellar slices (200250 m) from p18p43 c57bl/6 mice were as previously described (monsivais et al ., 2005) and carried out under institutional and national approval . Pc axons visualized by dye - filling and ap - associated cell - attached axonal capacitive currents were recorded in voltage clamp mode at 34c 1c . Amplitude of capacitive currents reflects the rate of rise of the axonal action potential and therefore pharmacological reduction in the amplitude reflects reduced sodium channel availability . Drugs were diluted in acsf and bath applied or diluted in hepes - buffered or standard acsf and pressure - applied locally via patch electrodes using a picospritzer (0.510 psi, parker). 30 m alexa fluor 488 or 594 was included in the solution to help adjust pressure and pulse duration to target localized drug ejection . Two - photon ca imaging and simultaneous electrophysiological recordings were performed using a custom - built dual galvanometer - based laser - scanning microscope (prairie technologies). A ti: sapphire pulsed laser (maitai, spectra physics) tuned to 810 nm was used for two - photon excitation . 200 m oregon green 488 bapta-1 (ogb-1, invitrogen) replaced egta in the pipette solution, which also contained 50 m alexa fluor 594 hydrazide (sigma - aldrich) to visualize morphology . Pcs were dialyzed for at least 15 min after establishing whole - cell mode before imaging . Data were digitized (itc-18, instrutech, heka) at 50100 khz and acquired using axograph x (http://www.axographx.com/). Analysis was performed using custom - written routines in matlab (mathworks) or igor pro 6 (wavemetrics) in combination with neuromatic (http://www.thinkrandom.com/). Two - photon imaging data were acquired with custom - written matlab software either as line scans (2 ms / line, 500 hz) or as xyt frame scans for a chosen region of interest (520 frames / s), digitized with a bnc-2090 board (national instruments), and analyzed with custom - written scripts in matlab, imagej, and igor pro 6 . Line scan and xyt frame - scan data were filtered using a boxcar running average or 2d - averaging filter, respectively . Relative changes in ca - sensitive fluorescence (ogb-1, f / f) were calculated as raw fluorescence fraw minus baseline fluorescence f0 normalized to the background (fb) subtracted baseline fluorescence (yasuda et al ., 2004): data are displayed as raw ogb-1 fluorescence values or relative changes in ogb-1 fluorescence normalized to the alexa fluor 594 red fluorescence (f / r, figure s3). Significance is tested using student s t test unless otherwise stated, and a p value <0.05 is regarded as significantly different (instat, graphpad software). Mice were perfused with ice - cold pbs for 1 min and then with 4% paraformaldehyde (pfa) in pbs (10 min). Brains were dissected and 80 m slices of cerebellar vermis were cut using a vibratome (leica). Slices were washed in pbs and blocked in 10% goat serum for 2 hr before 48 hr antibody incubation in 2% goat serum (kca3.1, mouse monoclonal, santa cruz biotechnology, calbindin d-28k, rabbit, swant) followed by second antibody incubation for 24 hr (633 goat anti - rabbit, 488 as well as 633 goat anti - mouse, invitrogen). Confocal image stacks were acquired using a 63 objective (na 1.4, z - step: 130 nm, lsm700, zeiss). Ap propagation along pc axons was simulated in neuron using a previously published multicompartmental pc model (clark et al ., 2005), which included a resurgent sodium conductance typical of pcs (khaliq et al ., 2003) additionally, at nors the model included a low - threshold ca conductance (cavt, 0.002 cm / s) (anwar et al ., 2012) as well as an intermediate type kca (ik, kca3.1). Nodal kca3.1 was based on a previously published bk conductance (solinas et al ., 2007), and its kinetics were adjusted to a four - state model to match previously published experimental recordings of ik (bailey et al ., 2010; hirschberg et al ., 1998). The simulations were run for 500 ms, and values shown in figure 4 were measured at the center of the compartment.
|
Cirrhosis is a global public health concern that results from chronic liver damage due to viral infection, alcohol abuse, autoimmune disease, and non - alcoholic steatohepatitis . In cirrhotic patients, the mortality rate of patients with initial episodes of variceal hemorrhage is up to 20%, and the recurrence rate of bleeding in survivors is high . Therefore, screening endoscopy for ev in all patients with cirrhosis is recommended in the current guidelines to identify patients who need prophylactic treatment . However, at any given point in time, approximately 75% to 85% of cirrhotic patients undergoing endoscopy have no ev or only have mild ev, which do not need medical intervention . Therefore, all patients with cirrhosis undergoing periodic endoscopy might unnecessarily increase the burden for both the medical service and patients . Nevertheless, endoscopy is invasive, uncomfortable, and requires anesthesia . Accordingly, in recent years, alternative ways to predict ev, such as those that use spleen length, child - pugh class, platelet count, portal vein diameter, elastography, or a combination of these indices, have been developed to reduce unnecessary endoscopy [814]. However, these reported indices were various and the cut - off values of the same index were different; therefore, the previous results are unreliable and further validation is necessary . Recently, contrast - enhanced ultrasonography (ceus) has been widely used in liver imaging, such as characterizing focal lesions . Compared with contrast - enhanced ct and contrast - enhanced mri, ceus is low cost, repeatable, safer, and can be controlled by operators in real - time during the measurements . Moreover, previous studies have demonstrated that hepatic dynamic ceus features are correlated with severity of chronic liver diseases (cld), degree of liver fibrosis, and portal pressure . In patients with cirrhosis, however, the usefulness of liver dynamic ceus features for assessing the ev has not been evaluated . The present study aimed to investigate the usefulness of ceus in predicting esophageal varices (ev) and assessing high - risk ev in patients with hbv - related cirrhosis . Between oct 2014 and dec 2016, consecutive patients with hbv - related cirrhosis who had undergone endoscopy and agreed to participate in this study were recruited . The diagnosis of liver cirrhosis was based on liver biopsy according to the metavir scoring system . Patients had to meet the following inclusion criteria: (1) more than 18 years old; (2) the interval between endoscopy and ceus imaging was less than 60 days; and (3) hbsag - positive . Exclusion criteria were: (1) focal liver lesions; (2) a history of ev ligation or endoscopic injection sclerotherapy; (3) a use of vasoactive drugs within 2 weeks before the ceus measurements; (4) portal vein thrombosis; (5) cavernous transformation of portal vein; (6) co - infection with hcv or hiv; and (7) a history of severe heart disease . This study was approved by the institutional review board of the first affiliated hospital of shihezi university school of medicine . Hi vision ascendus (hitachi aloka medical, tokyo, japan) with a c715 convex probe (15 mhz) was used in this study . A sonologist (jun li) with more than 10 years of experience in abdominal ultrasonography performed the ceus . All of the participants fasted more than 8 h and were placed in the supine position with the right arm extended above the head . Conventional b - mode ultrasonography and doppler ultrasonography were performed on the right lobe of the liver before the ceus imaging in order to choose an appropriate cross - section that contained the hepatic artery, hepatic vein, and portal vein simultaneously . Injection of contrast agent was administered by a single researcher (ting - ting du). A bolus injection of 2.4 ml contrast agent (sonovue; bracco s.p.a ., milan, italy) was administered through a 20-gauge catheter at the left antecubital fossa, followed by a rapid injection of 5 ml of normal saline . Dynamic contrast harmonic imaging was recorded from 10 s before sonovue injection to 2 min after injection . Regions of interest (rois) were drawn on the hepatic artery, hepatic vein, portal vein, and liver parenchyma . For the vessels, the rois were kept within the vascular structures, for the liver parenchyma, a roi of 200 mm was set approximately 5 cm to 8 cm in depth under the transducer and more than 3 cm under the capsule, as well as to avoid including any large vascular structures . The motions in the video caused by breaths during the measurements were corrected by the motion - correction algorithms of the analysis software . All the rois which been drawn in the videos were checked by 2 of the authors to ensure that a time - intensity curve could be computed accurately . In the analysis software, the intensity of the ceus image was expressed as grey - scale (range, 0 to 255). The time - intensity curve can be also quantified and outputted in microsoft excel for ease of interpretation and further analysis . The interface of the analysis software and corresponding time - intensity curves are shown in figure 2 . The mean value of the first 10 s of the video (before the contrast agent injection) was defined as the baseline intensity . Hepatic artery arrival time (haat), hepatic vein arrival time (hvat), and portal vein arrival time (pvat) were defined as the interval between sonovue injection and when the signal intensity exceeded 10% of the baseline in the corresponding roi . Psi was the difference between the peak signal intensity in the liver parenchyma and baseline intensity; moreover, ttp was defined as the time interval between injection and liver parenchyma peak time . To lessen the impact of variations in the blood circulation time, hv ha (hvat minus haat) and pv ha (pvat minus haat) were calculated . The time from 10% to 90% of liver parenchyma peak signal intensity was expressed as the rise time . Ev was diagnosed according to the published criteria: grade 0, no varices; 1, straight small varices; 2, beaded medium - sized varices; and 3, nodular, tortuous, and tumor - like large varices . The grades 0 and 1 ev patients were defined as a low - bleeding - risk group and grades 2 and 3 patients were considered at a high - risk of ev bleeding . Data were presented as mean standard deviation if they were normally distributed, or expressed as median (interquartile range). Data were compared between groups using student t - test or test, as appropriate . The area under the receiver operating characteristic curve (auroc) was computed to explore the diagnostic performance of ceus features . Spss 17.0 software (chicago, il) and medcalc 12.7.0.0 software (mariakerke, belgium) were used in this study . Between oct 2014 and dec 2016, consecutive patients with hbv - related cirrhosis who had undergone endoscopy and agreed to participate in this study were recruited . The diagnosis of liver cirrhosis was based on liver biopsy according to the metavir scoring system . Patients had to meet the following inclusion criteria: (1) more than 18 years old; (2) the interval between endoscopy and ceus imaging was less than 60 days; and (3) hbsag - positive . Exclusion criteria were: (1) focal liver lesions; (2) a history of ev ligation or endoscopic injection sclerotherapy; (3) a use of vasoactive drugs within 2 weeks before the ceus measurements; (4) portal vein thrombosis; (5) cavernous transformation of portal vein; (6) co - infection with hcv or hiv; and (7) a history of severe heart disease . This study was approved by the institutional review board of the first affiliated hospital of shihezi university school of medicine . Hi vision ascendus (hitachi aloka medical, tokyo, japan) with a c715 convex probe (15 mhz) was used in this study . A sonologist (jun li) with more than 10 years of experience in abdominal ultrasonography performed the ceus . All of the participants fasted more than 8 h and were placed in the supine position with the right arm extended above the head . Conventional b - mode ultrasonography and doppler ultrasonography were performed on the right lobe of the liver before the ceus imaging in order to choose an appropriate cross - section that contained the hepatic artery, hepatic vein, and portal vein simultaneously . Injection of contrast agent was administered by a single researcher (ting - ting du). A bolus injection of 2.4 ml contrast agent (sonovue; bracco s.p.a ., milan, italy) was administered through a 20-gauge catheter at the left antecubital fossa, followed by a rapid injection of 5 ml of normal saline . Dynamic contrast harmonic imaging was recorded from 10 s before sonovue injection to 2 min after injection . Regions of interest (rois) were drawn on the hepatic artery, hepatic vein, portal vein, and liver parenchyma . For the vessels, the rois were kept within the vascular structures, for the liver parenchyma, a roi of 200 mm was set approximately 5 cm to 8 cm in depth under the transducer and more than 3 cm under the capsule, as well as to avoid including any large vascular structures . The motions in the video caused by breaths during the measurements were corrected by the motion - correction algorithms of the analysis software . All the rois which been drawn in the videos were checked by 2 of the authors to ensure that a time - intensity curve could be computed accurately . In the analysis software, the intensity of the ceus image was expressed as grey - scale (range, 0 to 255). The time - intensity curve can be also quantified and outputted in microsoft excel for ease of interpretation and further analysis . The interface of the analysis software and corresponding time - intensity curves are shown in figure 2 . The mean value of the first 10 s of the video (before the contrast agent injection) was defined as the baseline intensity . Hepatic artery arrival time (haat), hepatic vein arrival time (hvat), and portal vein arrival time (pvat) were defined as the interval between sonovue injection and when the signal intensity exceeded 10% of the baseline in the corresponding roi . Psi was the difference between the peak signal intensity in the liver parenchyma and baseline intensity; moreover, ttp was defined as the time interval between injection and liver parenchyma peak time . To lessen the impact of variations in the blood circulation time, hv ha (hvat minus haat) and pv ha (pvat minus haat) were calculated . The time from 10% to 90% of liver parenchyma peak signal intensity was expressed as the rise time . Ev was diagnosed according to the published criteria: grade 0, no varices; 1, straight small varices; 2, beaded medium - sized varices; and 3, nodular, tortuous, and tumor - like large varices . The grades 0 and 1 ev patients were defined as a low - bleeding - risk group and grades 2 and 3 patients were considered at a high - risk of ev bleeding . Data were presented as mean standard deviation if they were normally distributed, or expressed as median (interquartile range). Data were compared between groups using student t - test or test, as appropriate . The area under the receiver operating characteristic curve (auroc) was computed to explore the diagnostic performance of ceus features . Spss 17.0 software (chicago, il) and medcalc 12.7.0.0 software (mariakerke, belgium) were used in this study . In this prospective study, ceus was performed on 63 eligible patients; of them, 5 (7.9%) participants were excluded because of poor respiratory cooperation (n=3, 4.8%), rib shadow (n=1, 1.6%), and a severely atrophic liver (n=1, 1.6%). Finally, 58 patients were included in the data analysis and their characteristics are shown in table 1 . Of the 58 patients, 18 patients (31.0%) had no ev, and 12 (20.7%), 11 (19.0%), and 17 (29.3%) patients had grade 1, 2, and 3 ev, respectively . Compared with the non - ev group, the hvat, hv ha, and psi were significantly decreased in the ev groups (p<0.001, p<0.001, p=0.010, respectively), and pv ha increased significantly (p=0.024). Similar results were observed in the high - risk group compared with the low - risk group (p<0.001 for hvat, p<0.001 for hv ha, p=0.013 for psi, respectively). Furthermore, pvat increased significantly in the high - risk group compared with the low - risk group (p=0.019). Ha, and psi were negatively correlated with the grade of ev . On the contrary, roc curves were computed to evaluate the diagnostic performance of features with significant correlation with the grade of ev (table 4, figure 3). For the assessment of the presence of ev and high - risk ev, for the diagnosis of the presence of ev, the auroc was 0.883, and the optimal cut - off value of hv ha was 8.2 seconds with a sensitivity of 85% and a specificity of 78% . For the diagnosis of high - risk ev, the auroc was 0.915, and the optimal cut - off value of hv ha was 7.0 s with a sensitivity of 82% and a specificity of 90% . In this case, the false - positive and false - negative rates of hv ha were relatively low (table 5). In pairwise comparison of the aurocs, for evaluating the presence of ev, the differences between features were not significant; for the evaluation of high - risk ev, hv ha allowed better assessment of high - risk ev compared with hvat, pv ha, and psi (p=0.006, p=0.009, p=0.006, respectively). Ceus is widely used in cld patients, such as in assessing the severity of liver fibrosis and ph, and theoretically, ceus features may correlate with ev . Under this assumption, we conducted a pilot study utilizing ceus to predict the presence of ev and high - risk ev to relieve the burden on patients and medical service providers by reducing unnecessary endoscopy . This study focused on cirrhotic patients with hbv and showed that several ceus features were closely correlated with the grade of ev; moreover, the hv hvat has been reported in previous studies to be useful for evaluating portal pressure and staging liver fibrosis, because the structure of intrahepatic vasculature is changed by fibrous tissue, leading to arteriovenous shunting, and to some extent, arteriovenous shunting and arterialization of the sinusoidal bed, which may elevate the portal pressure . Ev as a result of ph was developed to relieve the high portal pressure and help the obstructed portal venous system to bypass the liver and flow into the systemic circulation . This study showed that the hvat was closely negatively correlated with the grade of ev (r=0.589, p<0.001); therefore, hvat can be a good indicator for predicting the presence of ev and assessing high - risk ev (auroc: 0.838 and 0.840), with the cut - off values of 22 s and 20.8 s, respectively . However, hvat is vulnerable to patient individual circulation time, how the contrast agent is injected, and when the timer is started . In clinical practice, hvat is easy to perform but is less reliable than hv ha . Ha index had been used in many studies to correct the differences of participants blood circulation time . As expected, the aurocs of hv ha was larger than that of hvat (0.883 vs. 0.838 for assessing presence of ev and 0.915 vs. 0.840 for assessing high - risk ev). In addition, this index seems to be more reliable than hvat and is also feasible as a clinical tool . Ha was significantly correlated with ev grade (r=0.296, p=0.024), its performance was insufficient for assessing the presence of ev and high - risk ev (auroc, 0.726 and 0.714, respectively). We hypothesized that this ceus feature would tend to reflect the blood content of the liver in the different stages of cld . The liver is rich in blood, like a blood - pool; however, fibrosis and regenerative nodules increase with the progression of cld; therefore, the blood - pool space is reduced . In the ceus images, reduced content of microbubble - filled blood - pool produces a reduction in signal intensity . On the other hand, although not conclusive, hepatic arterial buffer response may decrease when the compensation of collateral circulation reaches a peak . The aurocs of psi were 0.710 for assessing the presence of ev and 0.672 for evaluating the high - risk ev . Compared with hv ha, the diagnostic accuracy of pis was significantly lower (p=0.006). Ttp has been used to evaluate the severity of ph in cirrhosis, but its performance was unsatisfactory . In addition, another study reported a disappointing result of rise time for assessing ph in patients with cirrhosis . Although spleen length and portal vein diameter are easy to measure, a systematic review showed that they are not accurate enough to predict ev . Serum tests are popular to use in diagnosing ev of liver cirrhosis, but the indexes, including apri, aar, fib-4, lok, and forns scores, had low - to - moderate diagnostic accuracy in predicting ev in liver cirrhosis . On the other hand, ct was reported to diagnose ev in liver cirrhosis with high accuracy, but ct cannot be used for patients with renal failure due to the adverse effect of radiocontrast agent . In addition, ct has high cost, static imaging (non - dynamitic), and radioactive by - effects . In addition, mri is not a dynamic imaging system, which was reported as the robustness of pv flow measurement on only 1 slice at a specific time point . Doppler indexes have been used to diagnose ev for many years, but the results are unsatisfactory even today . Liver stiffness measured by transient elastography showed a good correlation with the severity of ev, and this approach is simple and reproducible . However, the cut - off values vary between studies (range, 13.9 kpa to 21.5 kpa for predicting the presence of ev); thus, it has not been used in clinical practice . Examined the lower esophagus by ceus directly and found the thickness of mucosa and submucosa was strongly correlated with the grade of ev, with an auroc of 0.987 for detecting large ev (the criteria for ev grade were not provided). This approach is direct and interesting, but has a few disadvantages: it cannot detect the middle and upper esophagus, and it is vulnerable to overlying gastrointestinal gas; in addition, the contraction of the lower esophageal sphincter in the resting state may squash the varicose esophageal veins . Included 25 control participants, and 9, 13, and 34 patients with small, medium, and large ev, respectively, but did not include cirrhotic patients without ev . To some extent, this proportion of patients may increase the diagnostic performance . In addition, the number of participants was small and further studies are needed to confirm this approach . Compared with the above - mentioned techniques, intrahepatic transit time (i.e., hv ha) was accurate, easy to detect, widely studied, and directly and closely correlated with the distortion of hepatic vascular architecture that may lead to ph and ev . In this study, the interval between endoscopy and ceus imaging was limited to within 60 days . According to previous studies on noninvasive assessment of ev, a 180-day interval is considered acceptable . Good respiratory cooperation was needed in this ceus imaging process in order to avoid losing the target vessel, especially near the arrival time . Although participants had been briefly trained before the measurement, a 4.8% failure rate was still obtained . To the best to our knowledge, manual injection of the contrast agent was the common method in ceus imaging; however, a mechanical device may be more accurate and feasible in clinical work . Second, all the ceus imaging data were analyzed by 1 researcher; thus, reader variability may be a drawback of this study . However, the process for ceus imaging analysis in this study was standardized and the results were computed automatically, thereby minimizing variability between different readers . In conclusion, dynamic ceus may be used for the assessment of ev, and hv ha is the best index in predicting ev . Considering the results of previous studies, hv ha may provide a comprehensive assessment for patients with cld in many aspects, such as the degree of fibrosis, the severity of ph, and the grade of ev . Although dynamic ceus imaging may not replace endoscopy completely, this technique is helpful in evaluating whether patients with hbv - related cirrhosis, particularly those who present a high risk of ev, should undergo endoscopy.
|
Despite many years of research efforts and impressive progress in knowledge of mechanisms of endometriosis development, the etiopathogenesis of the disease and exact cause of infertility in patients suffering from endometriosis still remain poorly understood . None of the theories and models of endometriosis pathogenesis provide definitive explanation of the disease development, considering its different manifestations and various localizations . Recently published studies present new data on potential role of free radicals in endometriosis pathophysiology . Although the origin of the oxidative stress occurring in the peritoneal cavity in endometriotic patients is unknown, accumulating data suggest that increased iron levels, together with apoptotic endometrial fragments and activated macrophages, may promote prooxidant environment . In addition, oxidative stress in endometriotic patients may potentially be induced by environmental factors, including dioxins or heavy metals [1, 2]. In our preliminary work we found significantly increased levels of ox - ldl in peritoneal fluid of women with stage iii / iv endometriosis compared to patients with follicle ovarian cysts . However, peritoneal fluid oxldl concentrations did not differ significantly between patients with minimal / mild endometriosis and women from the reference group . Murphy et al . Showed increased low - density lipoprotein (ldl) oxidation in peritoneal fluid of patients with endometriosis, which may be a result of peritoneal cavity macrophages hyperactivity . It was also proved that oxidized ldls stimulate monocyte chemotactic protein-1 (mcp-1) expression in mesothelial and endometrial cells which provides direct evidence of oxidative stress role in etiopathogenesis of the disease . Increased concentrations of lipid peroxidation end products, malondialdehyde (mda), 8-isoprostane, and 25-hydroxycholesterol, were found in peritoneal fluid of infertile women with endometriosis [610]. Serum of patients with endometriosis, compared to healthy women, contains also significantly higher 8-isoprostane levels . Murphy et al . Showed that peritoneal fluid of patients with endometriosis contains increased concentration of lysophosphatidylcholine, another lipid peroxidation product with confirmed chemotactic properties for monocytes . Mda and 7-hydroxynonenal (hne-7) expression were increased in endometriosis implants tissue; however, both lipid proteins are also expressed in eutopic endometrium . Concentrations of antibodies against lipid peroxidation products were found to be increased in serum of women with endometriosis, with no immunoglobulins detected in their peritoneal fluid . Serum of women with endometriosis contains also elevated concentration of lipid hydroperoxide (looh), and its levels correlate positively with the stage of the disease according to revised american fertility society classification . Peritoneal fluid of endometriotic patients contains oxidatively modified protein - lipid complexes, showing both chemotactic properties and ability to stimulate selected cytokines production . However, there are relevant data published in the literature according to which the concentrations of mda and mda - cu complexes demonstrate no significant differences, being comparable in peritoneal fluid of patients with and without endometriosis, showing also no significant correlation with the stage of the disease [1618]. No differences were also found in peritoneal fluid concentration of another lipid peroxidation product, cholest-3,5-dien-7-one . The objective of the study was to assess concentrations of oxidized low - density lipoproteins (oxldl) in peritoneal fluid (pf) of women with endometriosis . Clinically and histologically confirmed diagnosis established the following groups: women with endometriosis (e, n = 110) and as the reference groups: patients with simple serous (r1, n = 78) and dermoid (r2, n = 41) ovarian cysts . In each case the disease was found to be minimal (e1) in 23 cases, mild (e2) in 25 patients, moderate (e3) in 39 women, and severe (e4) in 23 cases . Subjects were not given hormonal therapy and/or anti - inflammatory medications for at least 3 months before laparoscopy . Medical history of the patients and basic clinical examination showed no general chronic diseases, except for the condition, which was the indication for laparoscopy . Similarly, no significant difference was found in the phase of menstrual cycle of the time of laparoscopic procedures between women in all study groups . All patients signed an informed consent, and the lublin medical university ethics committee approval was obtained for the study . All visible pfs were aspirated during laparoscopy from the anterior and posterior cul - de - sacs, under direct vision to avoid blood contamination . Samples were immediately centrifuged at 500 g for 5 minutes, and the supernatants were aspirated and stored at 70c until analysis . Oxldl concentration in the pf was measured in duplicate using a commercially available enzyme - linked immunoassay kit (immundiagnostik ag, cat . All data were tested with the shapiro - wilk test for normality . Because data were not normally distributed, statistical significance between e and r groups was determined with the mann - whitney u test . Data are presented as medians (me), minima (min), maxima (max), and lower and upper quartiles . Concentrations of oxldl in pf of patients with endometriosis were significantly higher compared to women with serous ovarian cysts (p = 0.03). However, no significant difference in the pf oxldl levels was found between patients with endometriosis and women with dermoid ovarian cysts (p = 0.4). Levels of oxldl in pf of women with serous ovarian cysts were similar to those noted in patients with dermoid cysts (figure 1, table 1). By analyzing concentrations of oxldl in pf of women with different stages of the disease, it was noted that they were higher only in the subgroup of patients with stage iv endometriosis as compared to women with ovarian serous cysts . No significant differences were found between concentrations of oxldl in pf of women with different stages of the disease (table 2). Pf oxldl concentration did not differ significantly between the subgroups of women in the follicular and the luteal phase of the menstrual cycle (me, range: 71.5, 1.21470 ng / ml versus 80.3, 16.71870 ng / ml, p = 0.5). In our work, we demonstrated that peritoneal fluid oxldl concentration was significantly higher in patients with endometriosis than in women with serous ovarian cysts; however, it did not differ significantly as compared to subjects with dermoid cysts . After analysis of data obtained in women with different stages of the disease, it was noted that these results are found only in patients with severe endometriosis . In case of minimal, mild, and moderate disease, to our knowledge, only murphy and colleagues investigated the possible role of oxldl in the pathogenesis of endometriosis . Based on a small number of cases, they found increased oxidation of low - density lipoprotein in women with pelvic endometriosis and increased levels of oxldl in the pf of patients with this disease . Our results agree with these findings . However, our data suggest that only the severe stage of endometriosis is associated with increased oxidation of low - density lipoprotein in the peritoneal cavity, probably as the result of an imbalance in prooxidant / antioxidant pf systems . Shanti et al . Demonstrated that women with endometriosis had increased serum concentrations of autoantibodies to markers of oxidative stress including oxldl . Data from our work indirectly confirm these results . Based on many findings, there is an emerging concept of treating endometriosis as an autoimmune disease . An increased incidence of endometriosis was observed in the group of women with autoimmune diseases such as multiple sclerosis, lupus erythematosus, psoriasis, crohn's disease, hypothyroidism, hyperthyroidism, and rheumatoid arthritis . Endometriosis shares many similarities with other autoimmune diseases including elevated levels of cytokines, decreased cell apoptosis, and t- and b - cell abnormalities . A variety of autoantibodies have been detected in patients with endometriosis patients, which suggests a polyclonal activation of b cells . The most commonly reported types are antiendometrial, antiovarian antibodies, and autoantibodies against phospholipids, histones, and nucleotides . Other similarities between endometriosis and autoimmune diseases include familial occurrence, tissue damage, preponderance of females, and multiorgan involvement [21, 22]. Lipid peroxidation processes are closely associated with the pathophysiology of autoimmune diseases . Therefore, increased levels of oxidized ldl in pf of women with endometriosis support the theory of treating endometriosis as an autoimmune disease . Oxidized ldl induces secretion of numerous proinflammatory cytokines including macrophage colony - stimulating factor (m - csf), interleukin-6 (il-6), and tumor necrosis factor (tnf-). Concentrations of these cytokines were found to be elevated in the pf of patients with endometriosis . We can speculate that increased levels of oxidized ldl in the peritoneal cavity of women with severe endometriosis may be one of the factors responsible for increased levels of m - csf, il-6, and tnf- in pf . Elevated pf concentrations of these cytokines promote adhesion, invasion, proliferation, and angiogenesis of ectopic endometrium and create an inflammatory environment in the peritoneal cavity in women with endometriosis . . Demonstrated that oxldl caused an increase in accumulation of monocyte chemotactic factor-1 (mcp-1) in the medium of cultured mesothelial and endometrial cells . They also found that cells cultured in the presence of pf from endometriosis patients secreted more mcp-1 than those cultured with pf from subjects without the disease . Therefore, we hypothesize that increased concentration of oxldl may be responsible for, as demonstrated in other studies, higher concentrations of mcp-1 in the pf of women with endometriosis . Stimulation of mcp-1 production by increased pf levels of oxidized ldl may hypothetically be another factor responsible for the creation of proinflammatory environment in the peritoneal cavity of patients with endometriosis . Unfavorable changes in lipid profile are present not only in the pf of women with endometriosis . It has been recently shown that plasma of patients with this disease contains higher concentrations of total cholesterol, low - density lipoproteins, high - density lipoproteins (hdl) and triglycerides as compared to healthy women . Although all lipoproteins were significantly elevated in endometriosis patients, the difference was most substantial for ldl levels, which were 38% higher in women with endometriosis . Verit et al . Found that patients with endometriosis displayed significantly lower serum levels of hdl and higher levels of triglycerides, total cholesterol, and ldl than women without the disease . They also demonstrated that serum of women with endometriosis is characterized by significantly lower activity of paraoxonase-1 (pon-1), which negatively correlated with the progression of the disease . This hdl - associated antioxidant enzyme with paraoxonase activity prevents ldl and hdl oxidation and is also responsible for the antioxidant effect of hdl . Therefore, authors speculated that unfavorable lipid profile combined with lower pon-1 activity in women with endometriosis may contribute to the increased susceptibility for the development of atherosclerosis . In conclusion, oxldl levels were significantly higher in the peritoneal fluid of patients with severe endometriosis than in women with serous ovarian cysts . This suggests that disrupted oxidative status in the peritoneal cavity of women with endometriosis may play a role in the etiopathogenesis of the more advanced stages of the disease . However, it cannot be excluded that high oxldl levels are the result of more oxidant environment in the peritoneal cavity of patients with severe endometriosis than with less advanced disease.
|
Idiopathic demyelinating polyneuropathies are not common in the context of acute kidney injury (aki). Poems syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes) is a rare disease characterized by the presence of proliferation of plasma cells with mainly lambda - chain restriction and diverse systemic symptoms occurring over several years, meaning that patients typically visit several clinical departments before obtaining the final diagnosis1). Kidney dysfunction is not included in the diagnostic criteria of poems syndrome, but aki can be present with other systemic symptoms2). A 52-year - old korean man was admitted to this hospital because of abdominal distension and diarrhea . He had been well until 4 years ago, when he was diagnosed with cerebral infarct at another hospital . He was a businessman who rarely drank alcohol and had no previous history of medication . When he was transferred to our hospital 2 years ago, he had the symptom of mild tingling sensation in the left hand . One and a half years ago, paresthesia of right arm and intermittent difficulties with handwriting developed . Brain magnetic resonance imaging (mri) with mr angiography showed neither infarct nor vascular stenosis . Nine months ago, after undergoing health checkups, he was referred to the nephrology, endocrinology, and ophthalmology clinics because of high scr (1.52mg / dl), elevated thyroid stimulating hormone, and papilledema in both eyes, respectively . Since then, he suffered from gradually increasing paresthesia of both feet, progressing to both ankles and to both lower legs . He did not feel muscle weakness, but had some difficulties maintaining balance while walking as well as morning stiffness of both arms . Nerve conduction studies showed absent bilateral tibial nerve responses, slow motor responses on bilateral peroneal nerves, decreased sensory responses on bilateral sural nerves on the lower extremities, and slow motor and sensory nerve conduction velocities over the right median nerve . On cutaneous examination, red papules with diameters of 2 to 6 mm, which developed in the previous year, were scattered on the truncal areas . Hypertrichosis with hyperpigmentation was observed in both hands and lower arms and finger clubbing was present . The pathologic diagnosis of the papules was glomerular hemangioma . Computed tomography (ct) of the chest and abdomen ct of abdomen showed multiple small lymph node enlargements around the aorta as well as a small amount of ascites . A diagnosis of chronic inflammatory demyelinating polyneuropathy was made and therapy with oral prednisolone was initiated . During the next 2 months, weakness in the patient's legs increased and he developed a limping gait . He could not walk on his toes and heels and his perception of vibration decreased in both knees . The test results for syphilis, hepatitis b and c, and hiv were negative . Tests for autoantibodies such as rheumatoid factor, anti - nuclear antibody, anti - ganglioside antibody, and anti - myelin - associated glycoprotein antibody, were all negative . Tests for vasculitis and anti - phospholipid syndrome were also negative . The levels of serum complements c3, c4 and immunoglobulins ig g, a, and m were within normal limits . A small m - peak was noted (0.1 g / dl) in serum protein electrophoresis (pep) and no light chain was detected in urine pep . Six months before admission, he was referred to the oncologist for this finding and monoclonal gammopathy of undetermined significance (mgus) was a plausible diagnosis . Three months after steroid pulse therapy, his muscle weakness and gait improved, but burning paresthesia persisted . After 4 months, the steroid dose had been tapered and stopped . After stopping steroid treatment, he noted rapid progression of muscle weakness (he could not stand from the floor) and difficulties with walking and balancing . Although his appetite markedly decreased, his body weight increased by 5 kg and leg edema and abdominal girth increased . He had not taken any nephrotoxic agents including nonsteroidal anti - inflammatory drugs (nsaids). Laboratory results showed an increase in scr to 3.21mg / dl and fena and feurea was 0.24% and 12.3%, respectively . As abdominal distension increased with ascites he needed therapeutic paracentesis every 4 to 5 days . Light microscopic examination revealed renal cortex and medulla containing about 33 glomeruli, one of which was globally sclerotic . Most glomeruli showed increase in size and cellularity with mild to moderate endocapillary proliferations with diffuse double contours of capillary walls . There were diffuse interstitial edema and mild interstitial lymphocytes infiltrations with focal tubular atrophy containing hyaline casts destructing of tubular cells . Immunofluorescence study did not show any immunoglobulin or complement deposition or staining for kappa and lambda light chain . Electron microscopic examination revealed that most glomerular capillary lumina were compromised with diffuse duplications of capillary walls and subendothelial widenings with flocculent materials and mesangial interposition . Visceral epithelial cells showed hyperplasia and focal effacement of foot process about 20% of external capillary surfaces . Bone marrow biopsy showed normal bone marrow cellularity (60%) and a normal ratio of the plasma cells (2.3%). Megakaryocyte hyperplasia was observed and a lymphoid follicle was seen in the bone marrow biopsy . Immunohistochemical staining showed that the majority of plasma cells were positive for lambda light chain (fig . The patient's diagnosis was almost certainly poems syndrome accompanied by recurrent aki; however, an additional major criterion was required . Upon retrospective review of his previous chest and abdomen ct, we found osteosclerotic bone lesions in thoracic vertebral bones in the chest ct scan (fig . 3). Therefore, poems syndrome was diagnosed based on polyneuropathy, monoclonal plasma cell disorder with iga lambda, sclerotic bone lesion, extravascular volume overload, endocrinopathy, hepatomegaly and skin changes, consistent with proposed diagnostic criteria . Once the diagnosis of poems had been established, the patient was treated with a 28 days cycle of bortezomib and dexamethasone combination followed by autologous hematopoietic stem cell transplantation (hsct) at another hospital . Two months after the procedure, the patient showed a notable clinical improvement including polyneuropathy, normal scr (0.80mg / dl) and mobilization was possible with the aid of a walker . Poems syndrome is a rare paraneoplastic syndrome resulting from a proliferative monoclonal plasma cell disorder1). The diagnosis of poems syndrome must include two mandatory major criteria of (1) demyelinating polyneuropathy and (2) monoclonal plasma cell - proliferation (almost always type). In addition, one other major criterion must be present (any one of the following three features: osteosclerotic bone lesions [almost always present], elevated levels of vascular endothelial growth factor [vegf], or castleman disease). In addition, at least one of the following seven minor criteria should be met: organomegaly, extravascular volume overload, endocrinopathy (excluding diabetes mellitus or hypothyroidism), typical skin changes, papilledema, or thrombocytosis, polycythemia1). Making a diagnosis can be a challenge as the syndrome is rare and can be mistaken for other neurologic disorders . The most prominent symptom of this patient was his progressive sensory neuropathy, followed by the development of motor weakness over a period of 4 years . Possible differential diagnoses of polyneuropathy and kidney injury include nutritional deficiency such as pyridoxine or thiamine, human immunodeficiency virus - related neuropathy, amyloid, vasculitis, and paraneoplastic syndrome3). His laboratory results for viruses and vasculitis revealed no positive findings and his aki had no definite cause . During the clinical course of this patient, there was no event of renal ischemia caused by nephrotoxic drugs or other systemic hemodynamic change . In the kidney, continuous endothelial injury caused mesangial interposition, mesangial proliferation and finally mesangial sclerosis . In addition to the glomerular change, ischemic damage caused by obliteration of arterioles and small arteries was proposed to induce recurrent acute kidney injury2). Vegf is a potent microvascular permeability - enhancing mediator and a selective mitogen for vascular endothelial cell8). Therefore, the vegf produced by plasma cells leads to a decrease in intravascular volume by increasing vascular permeability, which may contribute to prerenal aki5). We might discern from this case that serum and urine pep should be obtained in patients with polyneuropathy and unexplained kidney injury to detect monoclonal gammopathy . However, serum and urine pep of this patient were normal 8 and 6 months ago (table 1). In poems syndrome, the median percent of plasma cells in the bone marrow is less than 5%, which is reflected by the small amount of m - protein, and serum pep often cannot detect the m - peak1). Instead, serum and urine ife should be performed to identify the isotype, as these techniques are three times more sensitive in detecting monoclonal immunoglobulin than serum pep4). In kidney biopsy, immunofluorescence staining showed no deposition of -light chain and electron microscopy showed no electron - dense deposits . These are quite different findings from other plasma cell disorders that showed kidney damage with deposition of a monoclonal immunoglobulin4). Instead, renal pathology of this patient showed extensive endothelial cell injury and evidence of increased extravascular permeability . Secretion of vegf from the monoclonal plasma cells in patients with poems syndrome has been suspected to trigger these changes25), but the mechanism remains unknown and must be investigated6). In contrast to the pathologic lesions, proteinuria was absent and microscopic hematuria was minimal in this patient, which may reflect a relatively intact glomerular basement membrane structure and podocyte functions . Treatment of poems syndrome is directed to target the underlying monoclonal plasma cell disease7) and therapeutic strategies for the treatment of multiple myeloma have been reported to show successful patient and renal outcomes and an improvement in morbidities related to treatment67). As this patient showed bone marrow involvement, he received systemic chemotherapy and had autologous blood stem cell transplantation.
|
Kits for cd34 and cd31 cells were, respectively, from stemcell technologies (grenoble, france) and dynal - biotech (invitrogen, cergy - pontoise, france). Culture media, including endothelial cell basal medium (ecbm), were from promocell (heidelberg, germany). Antibodies for flow cytometry were from bd biosciences (le pont - de - claix, france) or caltag (invitrogen, cergy - pontoise, france). Antibodies for immunofluorescence were from dakocytomation (denmark, cd31), epitomics (cd34), zymed (invitrogen, france, icam1), santa - cruz (cliniscience, france, gpihbp1), upstate (millipore, france, phospho - histone--h2ax), and molecular probes (invitrogen; secondary antibodies coupled to alexafluor-488 or alexafluor-546). Paired biopsies from abdominal sat (periumbilical) or vat (greater omental) were obtained from subjects undergoing bariatric surgery for obesity . Subjects had been weight stable for at least 3 months before surgery, and they included 29 women and 1 man (mean bmi sem = 43.35 1.05 kg / m, range 34.559.1; mean age sem = 40.4 1.93 years, range 2661 years). Five subjects were hypertensive, 6 had hypercholesterolemia, and 3 had type 2 diabetes . The mean time since obesity sem had been diagnosed was 18.2 1.4 years . Abdominal sat were obtained from 51 nonobese healthy women undergoing plastic surgery for cosmetic purposes (mean bmi sem = 23.11 0.221, range 19.527.2; mean age sem = 43.57 1.753, range 2474). Fat collection protocols were approved by the institutional research board of inserm and the toulouse university hospital ethics committee . At (210 g) was processed immediately after removal . Adipocytes and stromal - vascular fraction (svf) were obtained by collagenase digestion as previously described (10). After digestion and filtration of the adipocyte suspension (250-m mesh nylon sieves), adipocytes were washed three times with krebs - ringer bicarbonate buffer supplemented with 10 mmol / l hepes (krbh) and 0.1% fatty acid - free bsa (ph = 7.4). Mature adipocytes were suspended in ecbm supplemented with 0.1% bsa (1/10, vol / vol). Three different calibrated fields were examined to measure adipocyte diameters using nis software (nikon, champigny - sur - marne, france). Svf cells were counted and analyzed by flow cytometry to determine the number of ecs . [pbs]/0.5% bsa, 2 mmol / l edta) were incubated (for 20 min, at 4c) with fitc - cd31 and percp - cd34 antibodies or the appropriate isotype controls . After washing, the labeled cells were analyzed by flow cytometry using a fluorescence - activated cell sorter calibur flow cytometer and diva software (bd - biosciences). When the quantity of svf cells was sufficient (11 subjects, paired sat and vat), native cd34/cd31 cells (ec) were isolated by immunoselection / depletion as previously described (10). Mature adipocytes and ec were either lysed and stored at 20c for mrna extraction or further processed . Sat and vat mature adipocytes were placed in fibrin gels (1.5 mg fibrinogen / ml ecbm supplemented with 25 units / ml thrombin; 1/3, vol / vol) and cultured in ecbm/0.1% bsa supplemented with 100 units / ml penicillin and 100 g / ml streptomycin . After 24 h, the adipocyte - conditioned media were collected and frozen at 80c . Sat mature adipocytes were cultured in ecbm supplemented with 0.1% bsa, 100 units / ml penicillin, and 100 g / ml streptomycin in clinicell 25-culture cassettes (1/3, vol / vol) in normoxia or hypoxia chambers (1% o2; sanyo, avon, france). After 24 h, mature adipocytes were lysed and stored at 20c for rna extraction . Tissue immunofluorescent staining of human sat and vat cut into small pieces (0.51 mm) was performed . After fixation in paraformaldehyde 4% for 1 h and subsequent washing in pbs, at pieces were incubated for 30 min in pbs/2% bsa in the presence of 0.1% triton . For -h2ax staining, at pieces were permeabilized for 5 min in 95% ethanol and 5% acetic acid, and then incubated for 30 min in tris - buffered saline (tbs)/3% bsa . At pieces were incubated for 1 h with primary antibody (cd31 [1/50], cd34 [1/200], icam1 [1/50], gpihbp1 [1/40], -h2ax [1/200]). After several washings (pbs/0.2% tween or tbs), at pieces were incubated for 30 min in pbs/2% bsa/0.1% triton or tbs/3% bsa and then incubated with the corresponding fluorescently - labeled secondary antibodies (alexafluor-488 or alexafluor-546, 1/200). After washing, at pieces were incubated for 10 min with 10 g / ml hoescht 33342 to stain nuclei . They were placed between two mounting slides and examined with a fluorescence (nikon) or confocal (zeiss 510) microscope . Quantification of phospho--h2ax positive nuclei in human sat and vat was performed on three calibrated fields using nis software (nikon, champigny - sur - marne, france) and normalized to the total number of nuclei (hoescht 33342 staining). Total rna was extracted from ec and mature adipocytes and real - time pcr analyses were performed as previously described (10). Primers (taqman gene expression assays from applied biosystems, lifetechnologies, france) are listed in the supplemental table in the online appendix available at http://diabetes.diabetesjournals.org . Senescence - associated--galactosidase (sa--gal) activity was determined in human sat - ec isolated from nonobese healthy women (mean bmi sem = 25.34 1.033, range 22.028.5; mean age sem = 48.5 3.074, range 3557) and treated or not with adipocyte - conditioned media from sat and vat (pretreated or not for 1 h with 1 g / ml vegfa neutralizing antibody [r&d systems, lille, france], or with vegfa [10 ng / ml; peprotech, levallois - perret, france]). Cells were fixed (5 min, room temperature) in 0.5% glutaraldehyde, washed with pbs, and incubated at 37c for 16 h with fresh sa--gal staining solution (1 mg / ml of 5-bromo-4-chloro-3-indolyl galactopyranoside in dimethylformamide) supplemented with 0.12 mmol / l potassium ferricyanide, and 1 mmol / l mgcl2 (ph 6). Cells positive for sa--gal activity were counted by phase contrast microscopy through scanning the whole well and normalized to the total number of cells determined in four different fields with hoescht 33342 nuclear staining using nis software . Comparisons between the two groups (paired biopsies from sat and vat) were analyzed by paired student t tests . Comparisons among groups were made by one - way anova followed by a dunnett post hoc test . Kits for cd34 and cd31 cells were, respectively, from stemcell technologies (grenoble, france) and dynal - biotech (invitrogen, cergy - pontoise, france). Culture media, including endothelial cell basal medium (ecbm), were from promocell (heidelberg, germany). Antibodies for flow cytometry were from bd biosciences (le pont - de - claix, france) or caltag (invitrogen, cergy - pontoise, france). Antibodies for immunofluorescence were from dakocytomation (denmark, cd31), epitomics (cd34), zymed (invitrogen, france, icam1), santa - cruz (cliniscience, france, gpihbp1), upstate (millipore, france, phospho - histone--h2ax), and molecular probes (invitrogen; secondary antibodies coupled to alexafluor-488 or alexafluor-546). Paired biopsies from abdominal sat (periumbilical) or vat (greater omental) were obtained from subjects undergoing bariatric surgery for obesity . Subjects had been weight stable for at least 3 months before surgery, and they included 29 women and 1 man (mean bmi sem = 43.35 1.05 kg / m, range 34.559.1; mean age sem = 40.4 1.93 years, range 2661 years). Five subjects were hypertensive, 6 had hypercholesterolemia, and 3 had type 2 diabetes . The mean time since abdominal sat were obtained from 51 nonobese healthy women undergoing plastic surgery for cosmetic purposes (mean bmi sem = 23.11 0.221, range 19.527.2; mean age sem = 43.57 1.753, range 2474). Fat collection protocols were approved by the institutional research board of inserm and the toulouse university hospital ethics committee . At (210 g) was processed immediately after removal . Adipocytes and stromal - vascular fraction (svf) were obtained by collagenase digestion as previously described (10). After digestion and filtration of the adipocyte suspension (250-m mesh nylon sieves), adipocytes were washed three times with krebs - ringer bicarbonate buffer supplemented with 10 mmol / l hepes (krbh) and 0.1% fatty acid - free bsa (ph = 7.4). Mature adipocytes were suspended in ecbm supplemented with 0.1% bsa (1/10, vol / vol). Three different calibrated fields were examined to measure adipocyte diameters using nis software (nikon, champigny - sur - marne, france). Svf cells were counted and analyzed by flow cytometry to determine the number of ecs . At least 100,000 cells (in 100-l phosphate buffer saline [pbs]/0.5% bsa, 2 mmol / l edta) were incubated (for 20 min, at 4c) with fitc - cd31 and percp - cd34 antibodies or the appropriate isotype controls . After washing, the labeled cells were analyzed by flow cytometry using a fluorescence - activated cell sorter calibur flow cytometer and diva software (bd - biosciences). When the quantity of svf cells was sufficient (11 subjects, paired sat and vat), native cd34/cd31 cells (ec) were isolated by immunoselection / depletion as previously described (10). Mature adipocytes and ec were either lysed and stored at 20c for mrna extraction or further processed . Sat and vat mature adipocytes were placed in fibrin gels (1.5 mg fibrinogen / ml ecbm supplemented with 25 units / ml thrombin; 1/3, vol / vol) and cultured in ecbm/0.1% bsa supplemented with 100 units / ml penicillin and 100 g / ml streptomycin . After 24 h, the adipocyte - conditioned media were collected and frozen at 80c . Sat mature adipocytes were cultured in ecbm supplemented with 0.1% bsa, 100 units / ml penicillin, and 100 g / ml streptomycin in clinicell 25-culture cassettes (1/3, vol / vol) in normoxia or hypoxia chambers (1% o2; sanyo, avon, france). After 24 h, mature adipocytes were lysed and stored at 20c for rna extraction . Tissue immunofluorescent staining of human sat and vat cut into small pieces (0.51 mm) was performed . After fixation in paraformaldehyde 4% for 1 h and subsequent washing in pbs, at pieces were incubated for 30 min in pbs/2% bsa in the presence of 0.1% triton . For -h2ax staining, at pieces were permeabilized for 5 min in 95% ethanol and 5% acetic acid, and then incubated for 30 min in tris - buffered saline (tbs)/3% bsa . At pieces were incubated for 1 h with primary antibody (cd31 [1/50], cd34 [1/200], icam1 [1/50], gpihbp1 [1/40], -h2ax [1/200]). After several washings (pbs/0.2% tween or tbs), at pieces were incubated for 30 min in pbs/2% bsa/0.1% triton or tbs/3% bsa and then incubated with the corresponding fluorescently - labeled secondary antibodies (alexafluor-488 or alexafluor-546, 1/200). After washing, at pieces were incubated for 10 min with 10 g / ml hoescht 33342 to stain nuclei . They were placed between two mounting slides and examined with a fluorescence (nikon) or confocal (zeiss 510) microscope . Quantification of phospho--h2ax positive nuclei in human sat and vat was performed on three calibrated fields using nis software (nikon, champigny - sur - marne, france) and normalized to the total number of nuclei (hoescht 33342 staining). Total rna was extracted from ec and mature adipocytes and real - time pcr analyses were performed as previously described (10). Primers (taqman gene expression assays from applied biosystems, lifetechnologies, france) are listed in the supplemental table in the online appendix available at http://diabetes.diabetesjournals.org . Senescence - associated--galactosidase (sa--gal) activity was determined in human sat - ec isolated from nonobese healthy women (mean bmi sem = 25.34 1.033, range 22.028.5; mean age sem = 48.5 3.074, range 3557) and treated or not with adipocyte - conditioned media from sat and vat (pretreated or not for 1 h with 1 g / ml vegfa neutralizing antibody [r&d systems, lille, france], or with vegfa [10 ng / ml; peprotech, levallois - perret, france]). Cells were fixed (5 min, room temperature) in 0.5% glutaraldehyde, washed with pbs, and incubated at 37c for 16 h with fresh sa--gal staining solution (1 mg / ml of 5-bromo-4-chloro-3-indolyl galactopyranoside in dimethylformamide) supplemented with 0.12 mmol / l potassium ferrocyanide, 0.12 mmol / l potassium ferricyanide, and 1 mmol / l mgcl2 (ph 6). The enzymatic reaction was stopped with water . Cells positive for sa--gal activity were counted by phase contrast microscopy through scanning the whole well and normalized to the total number of cells determined in four different fields with hoescht 33342 nuclear staining using nis software . Comparisons between the two groups (paired biopsies from sat and vat) were analyzed by paired student t tests . Comparisons among groups were made by one - way anova followed by a dunnett post hoc test . Human mature adipocytes were isolated from paired biopsies of sat and vat from obese subjects . Adipocytes were classified according to their diameter (i.e., small, with a diameter less than 60 m; and large, with a diameter more than 100 m) and the expression of genes was analyzed by real - time pcr . The proportion of large adipocytes was higher in sat than vat (table 1). Expression of hypoxia - related genes, such as hypoxia - inducible factor (hif)-1, and certain hif1-responsive genes (vascular endothelial growth factor a [vegfa] and glut1, was higher in vat than sat adipocytes (fig . In contrast, other genes regulated by hypoxic conditions and induced by hif-1, including leptin and the fasting - induced adipose factor (fiaf), exhibited the inverse profile (fig . 1a). To further define the impact of hypoxia and adipocyte size on adipocyte gene expression, correlations among transcript levels and percentages of large adipocytes were calculated . Adipocyte transcript levels of vegfa and glut1 were positively correlated with hif1- mrna, irrespective of fat depot origin (* p = 0.03; spearman r = 0.2425, n = 60 [sat and vat]; and * * p <0.0001; spearman r = 0.4744, n = 60 [sat and vat], respectively). However, leptin and fiaf mrnas were positively correlated with the percentage of large adipocytes (* p = 0.012; spearman r = 0.3302, n = 60 [sat and vat]; and * p = 0.014; spearman r = 0.3231, n = 60 [sat and vat], respectively). No correlation was found between the percentage of large adipocytes and transcript levels of hif-1, glut1, or vegfa . Finally, the specific impact of low oxygen tension on adipocyte vegfa and glut1 expression was confirmed by real - time pcr analysis of mature sat adipocytes maintained in culture for 24 h under normoxic or hypoxic (1% o2) conditions . Vegfa and glut1 transcript levels were increased under hypoxic culture conditions, whereas leptin and fiaf were not altered substantially (fig . Thus, human vat adipocytes exhibit hypoxia - related characteristics, with increased hif-1, vegfa, and glut1 expression, independently of fat cell size . Human sat and vat adipocyte sizes data are percentages se of small (<60 m) and large adipocytes (100 m) in paired samples of sat and vat from n = 30 subjects; * * p <0.01; paired t test between sat and vat; ns, not significant . A: comparison of mature adipocyte gene expression in sat and vat (n = 30). Hypoxia inducible factor 1 or 2, subunit (hif-1, hif-2), glut1, vascular endothelial growth factor a (vegfa), and fasting - induced adipose factor (fiaf). Open bars: genes upregulated, and solid bars: genes downregulated in vat compared with sat . Results are expressed as fold differences between vat and sat as means sem . * p <0.05, * * p <0.01; paired t tests between sat and vat . B: sat adipocyte gene expression under normoxic (nx) and hypoxic conditions (1% o2) (n = 6). Open bars: gene expression under normoxic conditions, and solid bars: gene expression under hypoxic conditions . Results are expressed as means sem * * p <0.01; paired t tests between normoxic and hypoxic conditions . To test whether a less extensive vascular network in vat contributes to higher hypoxia - related gene expression in vat than sat in obese subjects, sat and vat were analyzed using three - dimensional confocal immunofluorescence microscopy for the ec markers cd34 and cd31 . The apparent density of the vascular network, determined from colocalized cd34 and cd31 positive signals, was greater in vat than sat (fig . The number of cd34/cd31 cells, normalized for tissue weight, was significantly higher in vat than sat (fig . 2c). To note, the ec number in sat of lean (n = 42) subjects was similar to that of obese subjects (20,378 2,554 vs. 25,476 3,211 cells / g at, respectively; p = 0.1), indicating that growth of sat is associated with concomitant expansion of its capillary network . Vascular network and ec number in human sat and vat . A and b: representative photomicrographs of three - dimensional confocal immunofluorescence analyses of human (a) sat and (b) vat using antibodies directed against cd34 (green) and cd31 (red) (n = 5). Original magnification 10 . C: flow cytometry analyses were performed on freshly harvested svf using fluorescently - labeled antibodies directed against cd34 and cd31 (n = 30). Results are means sem of the number of cd34/cd31 cells per gram of at * p <0.05; paired t tests between the two at depots . (a high - quality digital representation of this figure is available in the online issue .) To determine whether hypoxia - related gene expression in vat adipocytes is related to endothelial dysfunction, native human cd34/cd31 cells were isolated by immunoselection / depletion from sat and vat from obese subjects in biopsies that were of sufficient size . Genes involved in inflammation (chemokines and adhesion molecules), angiogenesis, metabolism, and cellular senescence were analyzed by real - time pcr . Many of the genes encoding proinflammatory and angiogenic factor receptors were upregulated in vat compared with sat - ec, including cc motif ligand 20 (ccl20), chemokine cxc motif ligand 8 (cxcl8), intercellular adhesion molecule-1 (icam1), vascular endothelial growth factor receptor 2 (vegfr2), leptin receptor (leptin r), and neuropilin 1 and neuropilin 2 (nrp1 and nrp2; fig . 3a and b, respectively). Expression of genes involved in metabolism, such as endothelial lipase (el), lpl, ppar, and gpihbp1, tended to be higher in sat than vat - ec, although differences for el and lpl did not reach statistical significance (fig . Immunohistochemical analyses confirmed the increased expression of icam1 and decreased expression of gpihbp1 in ec from vat compared with sat in obese subjects (fig ., both proteins were expressed at similar levels in sat from lean and obese subjects (fig . Moreover, real - time pcr analyses performed on isolated sat - ec from lean subjects (n = 6) did not differ substantially in ccl20, cxcl8, icam1, leptin r, nrp2, and el compared with obese sat - ec (data not shown). Finally, expression of the deacetylase, sirt1, was decreased, whereas insulin - like growth factor binding protein 3 (igfbp3), a gene upregulated in senescent ec, was increased in vat - ec from obese subjects compared with sat - ec (fig . No differences in sirt1 and igfbp3 expression were detected in sat - ec from lean and obese subjects (data not shown). To test whether cellular senescence is more extensive in vat than sat - ec, immunofluorescence analyses were performed using an antibody directed against -h2ax, a marker of senescent nuclei . 5c and d, respectively), but at a higher density in vat - ec (3.3-fold increase in vat vs. sat, p = 0.0004, * * n = 10). Expression of inflammatory, angiogenic, and metabolic genes in human sat and vat ec . Cc motif ligand 20 (ccl20), cc motif ligand 2 (ccl2), chemokine cxc motif ligand 8 (cxcl8), platelet endothelial cell adhesion molecule-1 (pecam1), intercellular adhesion molecule-1 (icam1), vascular endothelial growth factor receptor 1 and vascular endothelial growth factor receptor 2 (vegfr1 and vegfr2), leptin receptor (leptin r), neuropilin 1 and neuropilin 2 (nrp1 and nrp2), endothelial lipase (el), lipoprotein lipase (lpl), peroxisome proliferator - activated receptor gamma (ppar), and gpi - anchored hdl - binding protein 1 (gpihbp1). Open bars: genes upregulated, and solid bars: genes downregulated in vat compared with sat . Results are expressed as fold differences between vat ec and sat ec as means sem (n = 7 to 11) * p <0.05, * * p <0.01; paired t tests between sat ec and vat ec . Representative photomicrographs of immunofluorescence analyses of human sat from lean subjects (n = 4, 5) (a and d), obese subjects (n = 6, 9) (b and e) and vat from obese subjects (n = 6, 9) (c, f) using antibodies directed against icam1 (green) and cd34 (red) (a c) gpihbp1 (green) (d f) with nuclear staining with hoescht 33342 (blue). (a high - quality digital representation of this figure is available in the online issue .) Markers of senescence in native ec in sat and vat . B: expression of (a) sirtuin 1 (sirt1, n = 9) and (b) insulin - like growth factor binding protein 3 (igfbp3, n = 11) in sat ec and vat ec . Results are expressed as means sem; * p <0.05, * * p <0.01; paired t tests between sat ec and vat ec . D: representative photomicrographs of immunohistofluorescence analyses of human (c) sat and (d) vat using antibody directed against phospho--h2ax (red) and nuclear staining (blue) with hoescht 33342 (n = 10). (a high - quality digital representation of this figure is available in the online issue .) To define effects of the sat and vat microenvironments on ec, native sat - ec from nonobese women were treated with sat and vat adipocyte - conditioned media . Adipocyte - conditioned media clearly increased the number of sa--gal positive ec compared with control basal medium (fig . 6b and a, respectively). Moreover, native sat - ec treated with vat conditioned medium developed a significantly higher percentage of senescent cells than the same native sat - ec cells treated with sat - derived conditioned medium (fig . Ec proliferation was significantly increased by both sat and vat adipocyte - conditioned media, but to a greater extent in vat than sat - ec (fig . Finally, to analyze the potential factor(s) involved in such a senescence - promoting effect of adipocyte - conditioned media, sat - ec were treated with vegfa alone or with sat- and vat - derived conditioned media in the presence of neutralizing vegfa antibody . Although vegfa increased the number of sa--gal positive ec, the presence of a neutralizing vegfa antibody significantly reduced the effects of sat- and vat - conditioned media (fig . A and b: representative photomicrographs of native sat - ec cultured in the presence (b) or absence (a) of adipocyte - conditioned media (n = 6). Results are expressed as means sem as percentages of control in the presence of vegfa (n = 3) (dotted) or adipocyte - conditioned media from sat (open) or vat (solid) treated (hatched) or not with vegfa neutralizing antibody (n = 3), * p <0.05, * * p <0.01 vs. control; $p <0.05, $$p <0.01, adipocyte - conditioned media alone versus containing vegfa neutralizing ab . Hatched bar: control, open bar: sat, and solid bar: vat . Results are expressed as means sem as a percentage of control * p <0.05, * * p <0.01, n = 3 . (a high - quality digital representation of this figure is available in the online issue .) Human mature adipocytes were isolated from paired biopsies of sat and vat from obese subjects . Adipocytes were classified according to their diameter (i.e., small, with a diameter less than 60 m; and large, with a diameter more than 100 m) and the expression of genes was analyzed by real - time pcr . The proportion of large adipocytes was higher in sat than vat (table 1). Expression of hypoxia - related genes, such as hypoxia - inducible factor (hif)-1, and certain hif1-responsive genes (vascular endothelial growth factor a [vegfa] and glut1, was higher in vat than sat adipocytes (fig . In contrast, other genes regulated by hypoxic conditions and induced by hif-1, including leptin and the fasting - induced adipose factor (fiaf), exhibited the inverse profile (fig . 1a). To further define the impact of hypoxia and adipocyte size on adipocyte gene expression, correlations among transcript levels and percentages of large adipocytes were calculated . Adipocyte transcript levels of vegfa and glut1 were positively correlated with hif1- mrna, irrespective of fat depot origin (* p = 0.03; spearman r = 0.2425, n = 60 [sat and vat]; and * * p <0.0001; spearman r = 0.4744, n = 60 [sat and vat], respectively). However, leptin and fiaf mrnas were positively correlated with the percentage of large adipocytes (* p = 0.012; spearman r = 0.3302, n = 60 [sat and vat]; and * p = 0.014; spearman r = 0.3231, n = 60 [sat and vat], respectively). No correlation was found between the percentage of large adipocytes and transcript levels of hif-1, glut1, or vegfa . Finally, the specific impact of low oxygen tension on adipocyte vegfa and glut1 expression was confirmed by real - time pcr analysis of mature sat adipocytes maintained in culture for 24 h under normoxic or hypoxic (1% o2) conditions . Vegfa and glut1 transcript levels were increased under hypoxic culture conditions, whereas leptin and fiaf were not altered substantially (fig . Thus, human vat adipocytes exhibit hypoxia - related characteristics, with increased hif-1, vegfa, and glut1 expression, independently of fat cell size . Human sat and vat adipocyte sizes data are percentages se of small (<60 m) and large adipocytes (100 m) in paired samples of sat and vat from n = 30 subjects; * * p <0.01; paired t test between sat and vat; ns, not significant . A: comparison of mature adipocyte gene expression in sat and vat (n = 30). Hypoxia inducible factor 1 or 2, subunit (hif-1, hif-2), glut1, vascular endothelial growth factor a (vegfa), and fasting - induced adipose factor (fiaf). Open bars: genes upregulated, and solid bars: genes downregulated in vat compared with sat . Results are expressed as fold differences between vat and sat as means sem . * p <0.05, * * p <0.01; paired t tests between sat and vat . B: sat adipocyte gene expression under normoxic (nx) and hypoxic conditions (1% o2) (n = 6). Open bars: gene expression under normoxic conditions, and solid bars: gene expression under hypoxic conditions . Results are expressed as means sem * * p <0.01; paired t tests between normoxic and hypoxic conditions . To test whether a less extensive vascular network in vat contributes to higher hypoxia - related gene expression in vat than sat in obese subjects, sat and vat were analyzed using three - dimensional confocal immunofluorescence microscopy for the ec markers cd34 and cd31 . The apparent density of the vascular network, determined from colocalized cd34 and cd31 positive signals, was greater in vat than sat (fig . The number of cd34/cd31 cells, normalized for tissue weight, was significantly higher in vat than sat (fig . 2c). To note, the ec number in sat of lean (n = 42) subjects was similar to that of obese subjects (20,378 2,554 vs. 25,476 3,211 cells / g at, respectively; p = 0.1), indicating that growth of sat is associated with concomitant expansion of its capillary network . A and b: representative photomicrographs of three - dimensional confocal immunofluorescence analyses of human (a) sat and (b) vat using antibodies directed against cd34 (green) and cd31 (red) (n = 5). Original magnification 10 . C: flow cytometry analyses were performed on freshly harvested svf using fluorescently - labeled antibodies directed against cd34 and cd31 (n = 30). Results are means sem of the number of cd34/cd31 cells per gram of at * p <0.05; paired t tests between the two at depots . (a high - quality digital representation of this figure is available in the online issue .) To determine whether hypoxia - related gene expression in vat adipocytes is related to endothelial dysfunction, native human cd34/cd31 cells were isolated by immunoselection / depletion from sat and vat from obese subjects in biopsies that were of sufficient size . Genes involved in inflammation (chemokines and adhesion molecules), angiogenesis, metabolism, and cellular senescence were analyzed by real - time pcr . Many of the genes encoding proinflammatory and angiogenic factor receptors were upregulated in vat compared with sat - ec, including cc motif ligand 20 (ccl20), chemokine cxc motif ligand 8 (cxcl8), intercellular adhesion molecule-1 (icam1), vascular endothelial growth factor receptor 2 (vegfr2), leptin receptor (leptin r), and neuropilin 1 and neuropilin 2 (nrp1 and nrp2; fig . 3a and b, respectively). Expression of genes involved in metabolism, such as endothelial lipase (el), lpl, ppar, and gpihbp1, tended to be higher in sat than vat - ec, although differences for el and lpl did not reach statistical significance (fig . Immunohistochemical analyses confirmed the increased expression of icam1 and decreased expression of gpihbp1 in ec from vat compared with sat in obese subjects (fig ., both proteins were expressed at similar levels in sat from lean and obese subjects (fig . Moreover, real - time pcr analyses performed on isolated sat - ec from lean subjects (n = 6) did not differ substantially in ccl20, cxcl8, icam1, leptin r, nrp2, and el compared with obese sat - ec (data not shown). Finally, expression of the deacetylase, sirt1, was decreased, whereas insulin - like growth factor binding protein 3 (igfbp3), a gene upregulated in senescent ec, was increased in vat - ec from obese subjects compared with sat - ec (fig . No differences in sirt1 and igfbp3 expression were detected in sat - ec from lean and obese subjects (data not shown). To test whether cellular senescence is more extensive in vat than sat - ec, immunofluorescence analyses were performed using an antibody directed against -h2ax, a marker of senescent nuclei . 5c and d, respectively), but at a higher density in vat - ec (3.3-fold increase in vat vs. sat, p = 0.0004, * * n = 10). Expression of inflammatory, angiogenic, and metabolic genes in human sat and vat ec . Cc motif ligand 20 (ccl20), cc motif ligand 2 (ccl2), chemokine cxc motif ligand 8 (cxcl8), platelet endothelial cell adhesion molecule-1 (pecam1), intercellular adhesion molecule-1 (icam1), vascular endothelial growth factor receptor 1 and vascular endothelial growth factor receptor 2 (vegfr1 and vegfr2), leptin receptor (leptin r), neuropilin 1 and neuropilin 2 (nrp1 and nrp2), endothelial lipase (el), lipoprotein lipase (lpl), peroxisome proliferator - activated receptor gamma (ppar), and gpi - anchored hdl - binding protein 1 (gpihbp1). Open bars: genes upregulated, and solid bars: genes downregulated in vat compared with sat . Results are expressed as fold differences between vat ec and sat ec as means sem (n = 7 to 11) * p <0.05, * * p <0.01; paired t tests between sat ec and vat ec . Representative photomicrographs of immunofluorescence analyses of human sat from lean subjects (n = 4, 5) (a and d), obese subjects (n = 6, 9) (b and e) and vat from obese subjects (n = 6, 9) (c, f) using antibodies directed against icam1 (green) and cd34 (red) (a c) gpihbp1 (green) (d f) with nuclear staining with hoescht 33342 (blue). Original magnification 40 . (a high - quality digital representation of this figure is available in the online issue . B: expression of (a) sirtuin 1 (sirt1, n = 9) and (b) insulin - like growth factor binding protein 3 (igfbp3, results are expressed as means sem; * p <0.05, * * p <0.01; paired t tests between sat ec and vat ec . D: representative photomicrographs of immunohistofluorescence analyses of human (c) sat and (d) vat using antibody directed against phospho--h2ax (red) and nuclear staining (blue) with hoescht 33342 (n = 10). (a high - quality digital representation of this figure is available in the online issue .) To define effects of the sat and vat microenvironments on ec, native sat - ec from nonobese women were treated with sat and vat adipocyte - conditioned media . Adipocyte - conditioned media clearly increased the number of sa--gal positive ec compared with control basal medium (fig . 6b and a, respectively). Moreover, native sat - ec treated with vat conditioned medium developed a significantly higher percentage of senescent cells than the same native sat - ec cells treated with sat - derived conditioned medium (fig . Ec proliferation was significantly increased by both sat and vat adipocyte - conditioned media, but to a greater extent in vat than sat - ec (fig . Finally, to analyze the potential factor(s) involved in such a senescence - promoting effect of adipocyte - conditioned media, sat - ec were treated with vegfa alone or with sat- and vat - derived conditioned media in the presence of neutralizing vegfa antibody . Although vegfa increased the number of sa--gal positive ec, the presence of a neutralizing vegfa antibody significantly reduced the effects of sat- and vat - conditioned media (fig . A and b: representative photomicrographs of native sat - ec cultured in the presence (b) or absence (a) of adipocyte - conditioned media (n = 6). Results are expressed as means sem as percentages of control in the presence of vegfa (n = 3) (dotted) or adipocyte - conditioned media from sat (open) or vat (solid) treated (hatched) or not with vegfa neutralizing antibody (n = 3), * p <0.05, * * p <0.01 vs. control; $p <0.05, $$p <0.01, adipocyte - conditioned media alone versus containing vegfa neutralizing ab . Hatched bar: control, open bar: sat, and solid bar: vat . Results are expressed as means sem as a percentage of control * p <0.05, * * p <0.01, n = 3 . (a high - quality digital representation of this figure is available in the online issue .) We found greater expression of hypoxia - related genes and smaller sizes of vat than sat adipocytes in obese subjects . The increased hypoxia in vat is not likely to be a consequence of capillary rarefaction since vascular density, as well as ec number, were higher in vat than sat . However, the vat - ec phenotype in obese subjects was markedly proangiogenic and inflammatory, with decreased expression of metabolism - related genes, including el, gpihbp1, and ppar. This phenotype of vat - ec in obese subjects could be related to premature ec senescence, as suggested by expression of the senescence markers, igfbp3 and -h2ax, as well as decreased expression of sirt1 . Adipocytes from vat appear to have reduced capacity for lipogenesis (17) and greater capacity for lipolysis than sat cells (15), with vat containing more proinflammatory immune cells than sat (12). In the present study and consistent with other reports (18,19), marked hypertrophy of sat compared with vat adipocytes was observed in obese subjects . Increased expression of the hypoxia - related genes, hif-1, vegfa, and glut1 was found in vat compared with sat adipocytes . Despite previous studies reporting that leptin and fiaf are induced under hypoxic conditions (20,21), we found they were lower in vat than sat . Irrespective of at location, both leptin and fiaf transcript levels correlated with adipocyte size, as noted by others for leptin (22). Expression of vegfa and glut1 was tightly linked with that of hif-1. Moreover, sat adipocytes maintained under low oxygen conditions had higher vegfa and glut1 expresssion than vat, whereas the expression of both leptin and fiaf was not affected substantially . Together, the present results indicate that hypoxia - related processes are more highly activated in vat than sat and are not related to the extent of adipocyte hypertrophy in obese subjects . Moreover, qualitative analyses by confocal microscopy and flow cytometry, using both the ec markers cd34 and cd31 simultaneously, reveal that capillary network density was higher in vat than in sat . Treatment of native sat - ec originating from normal nonobese women with conditioned media originating from vat adipocytes from obese subjects led to marked proliferation compared with conditioned media from sat adipocytes from the same subjects . This suggests that the microenvironment of vat is more proangiogenic than sat and is consistent with the greater capillary density in vat than sat . Whether increased proangiogenic induction by vat adipocytes is related to hypoxia- and inflammation - related events remains to be determined . Our results indicate that vat - ec from obese subjects exhibited a markedly proinflammatory and angiogenic activated state, with increased expression of chemokines, adhesion molecules, and angiogenic factor receptors . This phenotype could contribute to the greater abundance of proinflammatory immune cells in vat than sat (12). El and gpihbp1 are ec - specific metabolic genes, at least in murine models (23). Together with ppar (the main regulator of gpihbp1), these genes were downregulated in vat compared with sat . A recent study in murine models of diet - induced obesity highlighted the key role of ppar in the modulation of ec function and metabolic alterations associated with obesity (7). Together our results show that although the capillary density of vat is higher than that of sat, vat - ec exhibit a phenotype characterized by marked activation of inflammatory and angiogenic pathways associated with altered metabolic function in obese subjects . This proangiogenic, proinflammatory phenotype might be related to premature endothelial cellular senescence . Indeed, senescent ec exhibit an activated state that may by induced either by extensive cell replication, leading to premature irreversible cell growth arrest, or by various stresses, including oxidative stress (24). Decreased expression of sirt1, together with increased expression of igfbp3 and -h2ax, have been noted in senescent, replicatively exhausted human ec (2528), and we found indications of cellular senescence found in vat - ec from obese subjects . Moreover, since conditioned media originating from vat adipocytes increased the number of sa--gal positive ec, it is tempting to speculate that the chronic proangiogenic microenvironment of vat promotes premature ec senescence, leading to endothelial dysfunction . Interestingly, vegfa alone enhanced the number of sa--gal positive ec, although to a lesser extent than adipocyte - conditioned media . Moreover, neutralization of vegfa reduced the senescence - promoting effect of the sat and vat adipocyte - conditioned media, suggesting that vegfa might be an adipocyte - derived factor involved in premature adipose tissue ec senescence, consistent with its effects on ec senescence in other systems (29,30). Cellular senescence in other cell types is associated with a senescent secretory phenotype, with increased production of proinflammatory cytokines, chemokines, and extracellular matrix - modifying proteins, as well as angiogenic factors (3135). It will be important to define the secreted protein profile of senescent vat - ec and sat - ec and to determine whether such a phenotype is involved in the accumulation of immuno - inflammatory cells . Consistent with this possibility, we previously showed that treatment of sat - ec with sat adipocyte - conditioned media led to increased diapedesis of blood - derived monocytes (10). The subjects in our study were obese . Whether regional variation in fat tissue ec properties are already present in lean subjects or arise as a consequence of obesity needs to be determined . Since cellular senescence is increased in obesity (36) and since obesity is associated with aortic endothelial cell senescence (37), it is tempting to speculate that obesity could induce senescence in vat - ec to a greater extent than in sat - ec . Consistent with this speculation, our study shows that sat - ec from lean and obese subjects did not exhibit marked phenotypic differences or numbers relative to at weight . If comparative studies of vat - ec from lean and obese subjects validate our speculation, interventions that limit the accumulation of senescent ec or their proinflammatory state could improve the approaches to limit inflammation attributable to obesity and its complications.
|
The main goal of endodontic treatment is the complete apical and coronal seal of root canal system to prevent the bacterial leakage and percolation many studies have confirmed the importance of coronal leakage as a possible cause of failure of root canal treatment (rct). Malone and donelly considered coronal restoration as it replaces missing tooth structure, protects remaining tooth from fracture, and prevents canals recontamination as the first protective barrier for the periapical tissues after rct . Torabinejad et al ., confirmed the results of swanson and madison 1978 that root canal treatment failure could be assumed to the delayed final restoration placement or when the temporary filling partially or completely lost . Hence, a great attention should be paid for the immediate placement of coronal restoration . Some studies suggested the placement of a barrier made of different materials on the root canal orifices for complete coronal seal . This barrier is indicated even in cases with post retained restorations . In 1995, ray & trope published a radiographic study about the correlation between the periapical pathosis and endodontically treated teeth . Their results indicated that the adequacy of the coronal restoration is more important than the quality of the root canal filling . They also showed that the periapical pathosis related clearly to the quality of coronal restoration and not to the root canal filling . Kirkevang et al . Gained similar results . On the contrary, many studies, showed the adequacy of root canal filling is the most important preventive measure for the periapical tissues (although there was no negligence on the coronal restoration importance). Moreover, ricucci and bergenholtz reported that exposure of root canal fillings to the saliva (teeth with missing coronal restorations) was not necessarily associated with apical pathosis in cases with adequate endodontic treatment . Many epidemiological studies from different countries: brazil, france, turkey, belgium and australia gave conflicting results about the impact of the final coronal restoration on the status of periapical tissues . 2012 made a comprehensive review to studies related to this subject and could nt resolve this controversy . The aim of this study was to assess the influence of the quality of coronal restorations and root canal treatment (separately and in concomitant) on the periapical status of endodontically treated teeth from an adult syrian subpopulation . We randomly selected panoramic x - rays for patients attended dental school of damascus university who fulfill the selection criteria: patient's age was set to be minimum of 19 years old, they had neither received any dental treatment for more than one year, nor had previously visited dental school clinics (selected patients are private clinic patients). Our sample contained 200 high qualities panoramic x - rays which had been examined under good illumination and magnification by two endodontists with minimum 5 years experience individually . In cases when disagreement occurred, the number of examines teeth in panoramic x - rays (except third molars) were 5331 teeth, 784 teeth (361 teeth for males and 423 teeth for females) received endodontic treatments (there was a radioopaque material in the root canals or pulp chambers). We recorded the type of the final fillings as following: type of coronal restoration no filling in 39 teeth (5%)filling in 320 teeth (42.1%)prefabricated post & filling in 26 teeth (3.3%)crown in 304 teeth (38.8%)post & crown in 85 teeth (10.8%). No filling in 39 teeth (5%) filling in 320 teeth (42.1%) prefabricated post & filling in 26 teeth (3.3%) crown in 304 teeth (38.8%) post & crown in 85 teeth (10.8%). The quality of the final restorations and root canal fillings had been classified as: adequate or inadequate according to tronstad et al . Inadequate coronal restoration: final restoration appears radiographically with overhang, open margin, recurrent caries, temporary filling or no filling . Adequate root canal filling: all canals obturated with dense fillings ending about 2 mm shorter than the radiographic apex . Inadequate root canal filling: root canal fillings end more than 2 mm shorter than the radiographic apex or grossly overfilled . Periapical status was assessed by periapical index (pai) proposed by rstavik et al . 1986, who scored the periapical area of the radiographic images as follows: normal periapical structures.small changes in bone structure.changes in the bone structure with little mineral loss.periodontitis with well - defined radiolucent area.severe periodontitis with exacerbating features . Normal periapical structures . According to this index we classified periapical tissue as: normal or healthy periapex: absence of radiographic evidence of diseased periapical tissues . The worst score of all canals was taken to represent the pai score for multicanal teeth . Spss software was used for statistical analysis (spss inc, chicago, il). Out of 784 endodontically treated teeth, the mandibular molars were the most frequent treated teeth . 459 cases (58.54%) had been classified as having adequate coronal restoration, and 325 (41.46%) cases as having inadequate one [table 1]. Illustrate the type of the teeth in the study and the adequacy of the final coronal restoration in the 459 teeth with adequate final restoration, the status of periapical tissues was healthy in 353 teeth (76.9%) and diseased in 106 teeth (23.1%). In the 325 teeth with inadequate coronal restoration, the status of periapical tissues was healthy in 169 teeth (52%) and diseased in 156 teeth (48%) [table 2]. Illustrate the status of periapical tissues according to the adequacy of final coronal restoration chi - squared test was used to evaluate the major differences in the status of periapical tissues according to the adequacy of final coronal restoration as illustrated in table 3 . Evaluation of the major differences between studied groups statistical analysis revealed that the healthiness of periapical tissues affected by quality of coronal p <0.01 [table 4]. The effect of coronal restoration type on the status of periapical tissues the study showed that 72% of the cases with final restoration absence accompanied with a clear radiographic radiolucency . Teeth with prefabricated post and filling or cast post and crown accompanied with periapical pathosis (38.5% and 31.8%) respectively . Overall, the post presented in 111 cases (14.1%), 74 cases accompanied with healthy periapical tissues and 37 cases with diseased tissues . Endodontic treatments had been evaluated as adequate in 145 teeth (18.5%), and inadequate in 639 teeth (81.5%). When we compared the status of periapical tissues according to the adequacy of root canals fillings we noticed that 95.2% of the teeth were with adequate root canal fillings, and about 60.1% of the inadequate endodontically treated teeth were with healthy periapical tissues (score one and two rstavik et al . Periradicualr disease (pai> 2) had been found in 262 teeth (33.4%). 7 cases of there were with adequate treatment and 255 cases were inadequate [table 5]. The status of periapical tissues according to the adequacy of the root canal filling the difference in the number of teeth with healthy periapical tissues and adequate root canal filling were significant when compared to teeth with inadequate root canal filling . (p <0.001). The impact of the adequacy of the coronal restoration and root canal filling on the status of periapical tissues had been studied (separately and in concomitant). Classification of teeth according to the adequacy of the final restoration and root canal filling in this study the status of periapical tissue were healthy in 96.6% of cases when both final coronal restoration and root canal filling were adequate . But the status of periapical tissues was healthy in 88.5% when only the root canal fillings were adequate and 70% when only the coronal restoration was adequate . The status of periapical tissue was healthy in only 48.8% of cases when both the endodontic treatment and the final restoration were inadequate [table 7]. The effect of endodontic treatment and the final coronal restoration on the status of periapex for cases with both adequate restorations and adequate root canal filling, the success rate was 96.6% . Healthy periapex was observed in 88.5% of the teeth with adequate root canal filling and inadequate restoration . When only the final restoration was adequate (root canal treatment inadequate) the success rate was 70% (p = 0.04). The difference when both the final restoration and the root canal filling were inadequate was significant when compared to the other three groups . This epidemiological study used x - rays to evaluate the presence of periapical radiolucencies, the quality of the root canal fillings and restorations with all limits of the 2 dimensional images . One of this study disadvantages is the inability to collect detailed information about the endodontic treatment: when it was done? If the periapical pathosis is pre or post treatment disease? Whether the periapical periodontitis is healing or expanding? In fact, radiographic image represents a snapshot of a continuous process of a dynamic disease . According to the study of petersson et al . The number of healed lesions equals the number of developed ones after 10 years of follow up, indicating the reliability of epidemological studies for recording the long - term success of endodontic treatments . This type of studies gave us valuable information about the level and development of dental practice in different periods, the common endodontic errors and the prevalence of periapical pathosis in subpopulations . To overcome the disadvantages of this type of studies, the sample was expanded and radiographs had been evaluated by using good illumination and magnification . All panoramic x - rays in this study were taken in dental school clinics of damascus university . Many studies did not find significant differences between periapical and panoramic x - rays in evaluation of periapical pathosis . One of the most important questions is whether the study represents the syrian subpopulation? To come up to an answer we should mention that dental school clinics of damascus university is one of the biggest dental clinics in damascus that offers consultations and treatments to so many people from damascus and its province . The criteria of sample selection was: the patient should have received his previous treatment outside dental school clinics (by general practice dentists), did not receive any dental treatment for at least one year of attendance to give a chance for any radiographic radiolucency to be healed by that time . According to rstavik d (1996) 89% of lesions would heal after one year of endodontic therapy . The number of endodontically treated teeth was 784 teeth (half of them were upper and lower molars). The prevalence of periapical lesions was about 33.42%, 58.5% of the coronal restorations were evaluated as adequate with different type of restorations, while 5% of the sample lost its restorations . The incidence of apical periodontitis associated with adequate coronal restorations was lower with significant difference than inadequate ones . The effect of the type of the coronal restorations on the status of periapical tissues was not crucial . In 111 cases out of 784 cases, some studies indicated that the presence of canal posts accompanied with higher percentage of periapical pathosis due to leakage during post space preparation or infrequent irrigation or weakening the remaining gutta percha . Root canal filling was adequate in 18.5% of cases which is so low when compared to other studies that consider root canal therapy as predictable treatment . In this study, the correlation between periapical pathosis and inadequate root canal treatment was highly significant, other studies confirmed these results . When each factor (root canal filling or coronal restoration) was evaluated separately, it had a significant influence on periapical health; in fact, these two factors are un separated . To evaluate which factor had the greater impact on outcome, we statistically analyzed the results of combination of these two factors . Success rate (the presence of healthy periapex) scored in 96.6% of cases with adequacy of both factors and decreased to 88.5% in cases with adequate root canal fillings and inadequate coronal restorations but with non - significant difference (it means that root canal treatment exert greater impact on outcome). In cases with adequate coronal restorations and inadequate root canal fillings success rate was recorded in 70%, which again indicates the importance of root canal filling in the success of the endodontic treatment . The worst results were obtained when both factors are inadequate which accompanied with lower successful results and high significant difference compared to all studied groups . That indicates the importance of a complete treatment (adequate root canal filling and placement of adequate final coronal restoration). Overall results indicate that the factor that plays the key role in the success of a treatment is the quality of root canal filling without neglecting the effect of the coronal restoration . The prevalence of periapical lesion in syrian subpopulation is high which indicate poor dental practice . Thus, considerable efforts should be spent to improve the level of endodontic treatment and promote periradicular health.
|
To make adaptive choices, people should sometimes exhibit patience, forgoing immediate benefits to acquiring more valuable future rewards . Humans account for future consequences when making temporal decisions, whereas many animal species wait only a few seconds for delayed benefits . The extreme differences between humans and nonhumans seem to provide powerful evidence that patience is uniquely a human trait (1). A major focus of attention in psychology is on the determinants and consequences of well - being . Personality traits and character strengths are the strongest and most consistent predictors of well - being (2). There is also evidence of a genetic link between personality and well - being (3). While the role of some personality traits such as gratitude, are comprehensively explored, scientific study of others such as patience are neglected . Patience is commonly said to be a virtue, but not commonly included in the contemporary discussions of the good life . Psychologists pay scant attention to this virtue, although they study it under related guises such as gratification delay (4). In recent years, a 3-factor patience scale (3-fps) was designed to measure three types of patience: interpersonal, life hardship and daily hassles patience (5, 6). Life hardship represents patience toward long - term goals or hardships (e.g., chronic illness) while daily hassles represents patience toward frustrating situations in daily life (e.g., traffic jams). Interpersonal patience, for example, has a strong correlation with agreeableness, but life hardship and daily hassles patience have moderate correlations . However, it is not clear whether these relationships would hold across cultures in the same way . To establish the generalizability of patience as a unique predicator of mental well - being, it is important to show its cross - cultural consistency the current study aimed to examine the relationship between patience and mental health, subjective well - being and personality factors, in an iranian population . Although all three types of patience are expected to correlate with higher levels of mental health and well - being, no hypothesis was made regarding the strength of these relationships . The age range of these 123 female and 129 male subjects was from 19 to 45, with a mean of 23.43 and a standard deviation of 3.45 . The persian versions of the following measures were administered; they have been previously used in the iranian samples (except the patience scale) and had proven to be valid . This 11 item scale is designed to measure three types of patience: interpersonal (i am patient with other people), life hardship (i am able to wait - out tough times), and daily hassles patience (in general waiting in lines does not bother me). The 3-fps has internal consistency reliability, convergent validity and high test - retest reliability (5, 6). In the current study, items were translated into persian and the adequacy of translations was confirmed by having the persian version of questionnaire items translated back into english . Similar to the original 3-fps (6) the persian scale, in the current study, had a three - factor structure, consisting of interpersonal patience (= 0.74, m = 3.55, sd = 0.75), long - term life hardships patience (= 0.81, m = 3.37, sd = 0.93), and short - term daily hassles patience (= 0.64, m = 3.19, sd = 0.91). Cronbach s alpha was 0.82 for the 3-fps (m = 3.39; sd = 0.67). This five - item widely used measure of life satisfaction was used to measure the cognitive aspect of subjective well - being (7). The persian version of this scale has convergent validity and test - retest and internal reliability, with coefficient alpha at 0.83 (8). Evidence of relative psychological dysfunction was obtained with the widely - used ghq-12 . This well - validated scale is a self - report instrument of psychological components of ill - health . The ghq-12 focuses on breaks in the normal function, rather than upon lifelong traits (9). The persian version of the ghq-12 has high level of internal reliability (with coefficient alpha at 0.87) and convergent validity with global quality of life scores (10). The costello and comrey s (11) scales assess depression (14 items) and anxiety (9 items) as traits rather than states . Cronbach s alphas for the persian versions of depression and anxiety scales are 0.90 and 0.84, respectively (12). The big - five factors of personality (openness, conscientiousness, extraversion, agreeableness, and emotional stability) were measured using the 20-item, self - report mini international personality item pool - big five (13). Coefficient alphas of the persian versions of these five factors ranged from 0.59 to 0.73 (14). The current study used a cross - sectional design and a convenience non - random sampling method . Data were collected using self - administered questionnaires delivered to the students in person during the 2011 - 2012 academic year . The data were analyzed using descriptive and inferential statistics including correlation, regression, and factor analyses by the spss software, version . This 11 item scale is designed to measure three types of patience: interpersonal (i am patient with other people), life hardship (i am able to wait - out tough times), and daily hassles patience (in general waiting in lines does not bother me). The 3-fps has internal consistency reliability, convergent validity and high test - retest reliability (5, 6). In the current study, items were translated into persian and the adequacy of translations was confirmed by having the persian version of questionnaire items translated back into english . Similar to the original 3-fps (6) the persian scale, in the current study, had a three - factor structure, consisting of interpersonal patience (= 0.74, m = 3.55, sd = 0.75), long - term life hardships patience (= 0.81, m = 3.37, sd = 0.93), and short - term daily hassles patience (= 0.64, m = 3.19, sd = 0.91). Cronbach s alpha was 0.82 for the 3-fps (m = 3.39; sd = 0.67). This five - item widely used measure of life satisfaction was used to measure the cognitive aspect of subjective well - being (7). The persian version of this scale has convergent validity and test - retest and internal reliability, with coefficient alpha at 0.83 (8). Evidence of relative psychological dysfunction was obtained with the widely - used ghq-12 . This well - validated scale is a self - report instrument of psychological components of ill - health . The ghq-12 focuses on breaks in the normal function, rather than upon lifelong traits (9). The persian version of the ghq-12 has high level of internal reliability (with coefficient alpha at 0.87) and convergent validity with global quality of life scores (10). The costello and comrey s (11) scales assess depression (14 items) and anxiety (9 items) as traits rather than states . Cronbach s alphas for the persian versions of depression and anxiety scales are 0.90 and 0.84, respectively (12). The big - five factors of personality (openness, conscientiousness, extraversion, agreeableness, and emotional stability) were measured using the 20-item, self - report mini international personality item pool - big five (13). Coefficient alphas of the persian versions of these five factors ranged from 0.59 to 0.73 (14). The current study used a cross - sectional design and a convenience non - random sampling method . Data were collected using self - administered questionnaires delivered to the students in person during the 2011 - 2012 academic year . The data were analyzed using descriptive and inferential statistics including correlation, regression, and factor analyses by the spss software, version . This 11 item scale is designed to measure three types of patience: interpersonal (i am patient with other people), life hardship (i am able to wait - out tough times), and daily hassles patience (in general waiting in lines does not bother me). The 3-fps has internal consistency reliability, convergent validity and high test - retest reliability (5, 6). In the current study, items were translated into persian and the adequacy of translations was confirmed by having the persian version of questionnaire items translated back into english . Similar to the original 3-fps (6) the persian scale, in the current study, had a three - factor structure, consisting of interpersonal patience (= 0.74, m = 3.55, sd = 0.75), long - term life hardships patience (= 0.81, m = 3.37, sd = 0.93), and short - term daily hassles patience (= 0.64, m = 3.19, sd = 0.91). Cronbach s alpha was 0.82 for the 3-fps (m = 3.39; sd = 0.67). This five - item widely used measure of life satisfaction was used to measure the cognitive aspect of subjective well - being (7). The persian version of this scale has convergent validity and test - retest and internal reliability, with coefficient alpha at 0.83 (8). This well - validated scale is a self - report instrument of psychological components of ill - health . The ghq-12 focuses on breaks in the normal function, rather than upon lifelong traits (9). The persian version of the ghq-12 has high level of internal reliability (with coefficient alpha at 0.87) and convergent validity with global quality of life scores (10). The costello and comrey s (11) scales assess depression (14 items) and anxiety (9 items) as traits rather than states . Illustrating depression is the self - report, cronbach s alphas for the persian versions of depression and anxiety scales are 0.90 and 0.84, respectively (12). The big - five factors of personality (openness, conscientiousness, extraversion, agreeableness, and emotional stability) were measured using the 20-item, self - report mini international personality item pool - big five (13). Coefficient alphas of the persian versions of these five factors ranged from 0.59 to 0.73 (14). The current study used a cross - sectional design and a convenience non - random sampling method . Data were collected using self - administered questionnaires delivered to the students in person during the 2011 - 2012 academic year . The data were analyzed using descriptive and inferential statistics including correlation, regression, and factor analyses by the spss software, version . Patience was positively correlated with the big - five and life satisfaction, and negatively correlated with depression, anxiety, and the ghq . There were no gender differences in patience . With the effects of the big five controlled, the 3 fps still significantly predicted life satisfaction (= 0.22, p <0.01), depression (= -0.29, p <0.01), anxiety (= -0.38, p <0.01), and general health (= -0.16, p <0.01). Gender coded 0 = female, 1 = male a series of regression were applied to assess discriminant validity of the three factors of patience (table 2). Daily hassles was the strongest predictor of life satisfaction, closely followed by life hardship . The results of the current study, as predicted, showed that patience is associated with higher levels of mental health and subjective well - being, which is consistent with what had been found previously (6). The present study, therefore, provided a cross - cultural confirmation to conclude that patience can predict mental health and positive functioning . Life hardship patience was a better predictor of depression and ghq, showing that long - term patience may affect depression and general health . Daily hassles patience was a better predictor of life satisfaction, suggesting that short - term patience is more beneficial for hedonic well - being and interpersonal patience can predict anxiety better . The three - dimension factor structure of the patience scale also appears to exhibit external validity, where interpersonal patience was more strongly related to the interpersonal factor from the big - five, agreeableness . To help people overcome life hardship or daily hassles, they should be equipped with mechanisms designed to promote, for example, avoidance of forgoing immediate benefits to acquiring more valuable future rewards where there is a choice . Individuals who are approach motivated have higher baseline activation of the left prefrontal cortex than the right prefrontal cortex, whereas persons who are avoidance motivated have higher baseline activation of the right prefrontal cortex than the left prefrontal cortex (15 - 17). Moreover, not achieving or delay of a goal can be threatening one s self - esteem . It is possible to ignore, or utilize attentional shifting away from the cause of the stress (avoidance). Thus, while delayed in traffic one may simply think about last night s volleyball game (18). Another way is emotion reappraisal (5) and such ability, among others, is linked to right hemisphere dominance (19). Given these findings, prefrontal asymmetries might be considered as a possible neurological substrate of patience . Future research should examine greater diversity among individuals, as well as studying other cultures.
|
Three series have reported the prevalence of autoimmune pancreatitis as between 5% and 6% of all patients with chronic pancreatitis . It is very important to distinguish between these two entities regarding to differences in treatment and prognosis . Aip appears to be a disease of the elderly, but vary widely in age, as most patients are more than 50 years old at diagnosis . It is reported to be at least twice as common in men as in women . Although diffuse swelling of the pancreatic parenchyma can be morphologically characteristic of aip, a focal type of this clinical entity has been recently recognized and is still difficult to establish . However, in this day and age, even with heightened awareness of aip and appropriate preoperative workup (including serum immunoglobulin g fraction 4 (igg4) measurement and, in very select cases, a short steroid trial), some patients with aip are likely to be resected for the suspicion of malignancy . A 56-year - old patient was referred to our unit for upper abdominal pain since two week and lost of 6 kg in two months . In his past medical history the serum carcinoembyonic antigen and cancer antigen 19 - 9 (ca) level was normal . Transabdominal ultrasonography showed a hepatic steatosis and 5 angiomas . Magnetic resonance imaging (mri) showed the angiomas and a lesion of 2020 mm of the pancreatic tail with decreased signal intensity on t1-weighted mr images, increased signal intensity on t2-weighted mr images, and discreetly hypovascularized (figure 1). Due to concerns of pancreatic malignancy (pancreatic adenocarcinoma), we found a tumor about 5 cm in diameter lacking clear margins in the tail of the pancreas, which was removed via an open distal splenopancreatectomy . Histological analysis of the resected specimen revealed no malignancy, but dense fibrosis with lymphoplasmositic infiltration and acinar atrophy (figure 2). Postoperatively, autoantibodies and immunoglobulin were normal but igg4 was slightly above of the upper limit of the normal range . Patient was treated by 40 mg / j of corticotherapy with a remarkable improvement . In the follow up, because of the past medical history of mellitus diabetes, the young age of the patient, the normalization of the serum igg4 level, the absence of malignancy in histology, and the clinical improvement after corticoid therapy, the diagnosis of aip was made . Figure 1magnetic resonance imaging shows the affected pancreatic lesion involving tail with decreased intensity on the t1-weighted image (a) and increased intensity on the t2-weighted image (b) compared with the signal intensity in the liver . Magnetic resonance imaging shows the affected pancreatic lesion involving tail with decreased intensity on the t1-weighted image (a) and increased intensity on the t2-weighted image (b) compared with the signal intensity in the liver . Figure 2the histologic findings of the resected specimen of the pancreas include: dense fibrosis (black arrow), lymphoplasmacytic infiltration, and acinar atrophy (white arrow). Hematoxylin and eosin (he, 250). The histologic findings of the resected specimen of the pancreas include: dense fibrosis (black arrow), lymphoplasmacytic infiltration, and acinar atrophy (white arrow). Although diagnostic criteria were established for aip, there remains no practical strategy to differentiate pc from aip . Making a correct differential diagnosis between the two conditions is of paramount importance as the treatment approaches are different . The common presenting symptoms of the pseudo tumoral autoimmune pancreatitis are mild abdominal pain, jaundice, and weight loss . Cholestatis was seen in 75100% of a japanese series, mild pancreatitis, acute recurrent pancreatitis, biliary duct strictures are a various clinical forms of aip . It is made by radiologic computed tomography scan finding of a narrowing of the pancreatic duct and parenchymal edema of the pancreas (a sausage shape). Isolated focal pancreatic mass is difficult to be diagnosing without doubt as a focal aip . It can show focal aip as a low - attenuation or an iso - attenuation mass . On the other hand, features highly suggestive of pancreatic cancer were a pancreatic low density mass, main pancreatic duct obstruction, distal pancreatic atrophy, and metastases . Endoscopic ultrasonography provides the opportunity for fine needle aspiration, but does not have pathognomonic findings on its own . Immunological abnormalities include hypergammaglobulinaemia, elevated serum igg4 levels and the presence of autoantibodies including antinuclear antibody, anti smooth muscle antibody, rheumatoid factor, antilactoferrin antibody and anticarbonic anhydrase antibody ii . The specificity and sensitivity of a high serum igg4 level in the diagnosis of aip are> 90% . After resection, histological changes in aip show predominantly periductal inflammation consisting of a dense interstitial lymphoplasmacytic infiltrate, thus causing duct obstruction with acinar tissue fibrosis . In addition, aip has been seen in association with retroperitoneal fibrosis, kidney involvement and lung nodules . These features are considered as extrapancreatic signs of aip and might be helpful to diagnose especially in focal form . Our patient had no extrapancreatics features . Because of the difficulty of the diagnosis, several types of diagnosis criteria have been proposed . Since there is currently no diagnostic serological marker for aip, and approach to the pancreas of histological examination is generally difficult, aip is currently diagnosed on the basis of presence of a combination of abnormalities unique to aip . For practical purposes, the revise japanese clinical diagnostic criteria (2006) and hisort criteria from the mayo clinic and in 2011 international consensus diagnostic criteria for aip were proposed . In this set of diagnostic criteria, the diagnosis of aip is made using one or more positive criteria on: i) imaging criteria: diffuse enlargement of the pancreas and diffuse or segmental irregular narrowing of the main pancreatic duct; ii) laboratory criteria: elevated levels of igg and/or igg4 or the presence of autoantibodies; iii) histopathologic criteria: fibrosis and lymphoplasmocytic infiltration; iv) association with other autoimmune diseases; and v) response to steroid therapy . Despite all these investigations procedures and the existence of these criteria, 35% of patients undergoing pancreatic resection for presumed pc in fact has aip, as was the case of our patient . Reported that 7 of 37 (18.9%) aip patients had surgery because they were misdiagnosed as having pc or bile duct cancer . This treatment may represent a diagnosis test, considered as one of the main diagnosis criteria . Extrapancreatic features, igg4 level, endoscopic ultrasound guided fine needle aspiration and corticotherapy are helpful to evoke aip . The preoperative diagnosis should prevent unnecessary surgery causing a high morbidity comparing to medical treatment (corticosteroid) of aip.
|
Diabetes prevalence in persons over 65 years old is rapidly increasing, with current estimates varying between 15 and 25% (1). During the next decade, the greatest increase in diabetes is anticipated to be among persons aged 75 and older (2). Compared with older adults without diabetes, those with diabetes have life expectancy that is reduced by 10 years and double the mortality (3,4). Reasons for increased mortality and morbidity include cardiovascular, cerebrovascular, and renal diseases and geriatric conditions such as cognitive impairment, physical function decline, disability, depression, incontinence, falls, and the syndrome of frailty (i.e., fatigue, weight loss, muscle weakness, and decreased overall physical function) (5,6). Despite this increase of diabetes and its complications in older adults, until recently, older adults were poorly represented in most large diabetes trials . This scenario is similar for many prevalent chronic diseases such as hypertension and cancer trials, where older adults have until recently been traditionally excluded (7,8). The under - representation of older adults from initial trials showing the benefits of tight glycemic control led to uncertainty regarding the applicability and safety of the intervention in older persons (9). More recent glucose - lowering trials such as the action to control cardiovascular risk in diabetes (accord) (10), action in diabetes and vascular disease (advance) (11), and the veterans affairs diabetes trial (12) included older adults; however, they have not reported the effects of the glycemic interventions according to age . Although the overall benefits were modest and, in some cases, were outweighed by the harms (13), these trials can provide valuable insights into whether older adults can safely tolerate intensive therapy for diabetes . Although it has been suggested that treatment targets for older persons with long - standing type 2 diabetes may need to be different (1416), there is little empiric evidence for such a position . Recommendations for individualization of treatment in older persons with type 2 diabetes have been based on multiple considerations, including comorbidities, polypharmacy, and patient preferences (17). However, as a group, little is known regarding the ability of older versus younger individuals to achieve glycemic targets and the effect of glycemic control on clinically important outcomes . The purpose of the glycemic portion of the accord study was to determine whether randomization to an intensive therapeutic strategy targeting normal glycated hemoglobin levels (i.e., below 6.0%, 42 mmol / mol) would reduce the rate of cardiovascular events, as compared with a standard strategy targeting glycated hemoglobin levels from 7.0 to 7.9% (5363 mmol / mol) in people with type 2 diabetes . The accord study previously reported that there were no age - related differences in the effect of the glycemia intervention on cognition (18), but that the intensive intervention reduced the risk of falls in older individuals and increased it in younger individuals (rr = 0.75 and 1.27, respectively; p interaction = 0.018) (19). The impact and tolerability of intensive management in older adults (65 years old; specifically, 6589 years old; n = 3,996) versus younger adults (<65 years old; specifically, 4064 years old; n = 6,255) on glucose control, severe hypoglycemia, severe adverse effects, the accord primary / secondary outcomes, and physical function (activities of daily living and mobility) are addressed herein . Also addressed is the potentially modifying effect of age on the previously reported findings that 1) the highest risk in mortality among intensive participants occurred for participants with average postrandomization a1c> 7.0% (53 mmol / mol) and 2) the increased mortality in the intensive arm was most apparent in those participants whose a1c levels fell less rapidly in the initial year of follow - up (20). The accord design, consort (consolidated standards of reporting trials) chart, and major results have been previously published (10,2123). The accord trial was a randomized, multicenter, double 2 2 factorial trial designed to test the effects on major cardiovascular disease (cvd) events of intensive versus standard glycemia control (plus either antihypertensive or lipid - lowering intervention components, which are not addressed in this article). Men and women (n = 10,251) with type 2 diabetes aged 40 to 79 years whose a1c was 7.5% (58 mmol / mol) and who had prior evidence of cvd or additional cardiovascular risk factors were recruited at 77 north american sites . Briefly, participants had to have type 2 diabetes with a glycated hemoglobin level of 7.5% or more, be aged 40 to 79 years with a history of prior cvd, or be aged 55 to 79 years with either anatomical evidence of significant atherosclerosis, albuminuria, left ventricular hypertrophy, or at least two additional risk factors . Participants with frequent or recent serious hypoglycemic events, unwillingness to do home glucose monitoring or inject insulin, a bmi of more than 45 kg / m, a serum creatinine level of more than 1.5 mg / dl (133 mmol / l), or other serious illness were excluded . Participants were initially recruited into a vanguard phase of accord (n = 1,184 from january to june 2001), with the subsequent randomization of 9,067 participants taking place from february 2003 to october 2005 . In february 2008, the glycemia trial was terminated early due to higher mortality in the intensive compared with the standard glycemia strategies (10), while the antihypertensive and lipid - lowering components (not discussed here) were continued until spring 2009 . The primary accord outcome was a composite representing the first occurrence of either nonfatal myocardial infarction (mi) or nonfatal stroke or cardiovascular death . This outcome, as well as secondary outcomes, including all cause mortality, an expanded composite comprising the primary outcome plus revascularization or hospitalization for heart failure (congestive heart failure [chf]), total (i.e., fatal or nonfatal) mi, total stroke, and fatal or nonfatal chf (21), were included in the current analysis . Also included were adverse events such as severe hypoglycemia (i.e., requiring assistance) or an adverse experience that was life threatening and/or resulted in death, permanent disability, hospitalization, or prolongation of hospitalization . Two physical function limitations were assessed based on responses to the health utilities index questionnaire (25), which contains a question that addresses mobility limitations (walking) and another that addresses limitations in the ability to perform basic activities of daily living . These data were obtained at baseline and 12, 36, and 48 months of follow - up and coded in terms of having no difficulty versus any difficulty . A1c was collected in each arm at visits scheduled at 4-month intervals, and the updated average a1c was computed by calculating a weighted average of the cumulative a1c values, with weights defined by the length of intervals between blood draws (20). Means and percentages were used to compare baseline characteristics for those <65 versus 65 years old at enrollment . The percentage of participants experiencing hypoglycemia and other serious adverse events was calculated by glycemia intervention arm . Events per 100 person - years were calculated by dividing the total number of initial events by the total person - years accrued until either the time of the event or censoring . Time until the initial occurrence of each of the clinical outcomes was analyzed using cox proportional hazard (ph) regression analyses according to the principle of intention to treat . Hazard ratios (hrs) and 95% cis were derived from these models within subgroups defined by <65 versus 65 years old at enrollment . Analyses were performed for events occurring from randomization until the date of transition (glycemia substudy: 5 february 2008). Cox ph regression models contained a term representing glycemia arm allocation plus the following terms accounting for subgroups of participants that were prespecified in the protocol for analysis of the primary outcome: 1) additional assignment to the blood pressure (bp) or lipid trial, 2) randomization to the intensive bp intervention within the blood pressure trial, 3) randomization to fibrate within the lipid trial, and 4) participants with prior evidence of cvd versus those with no prior cvd . In addition, as done for the accord primary analysis, a term representing the clinical center network was included for analysis of the primary outcome . For each outcome, the consistency of the intervention effects within those <65 versus 65 years old was assessed within the cox models using statistical tests of interactions between the variables representing age and the glycemia intervention . Within those <65 years old and those 65 years old, previously described cox regression models (using penalized b - splines) and poisson regression models (20), were used to explore the relationship between updated average a1c and mortality risk and to estimate mortality rates in relation to the magnitude of the 1-year change of a1c within each treatment arm, respectively . For both models, likelihood ratio tests were used to test for between - subgroup heterogeneity in both the location and shape of lines fitted within glycemia arms . A comparison between glycemia arms on the proportion of participants that reported any difficulty in the two functional activities at each follow - up time was performed using logistic regression and generalized estimating equations, controlling for baseline difficulty, assignment to the bp or lipid trial, randomization to the intensive bp intervention within the bp trial, and randomization to fibrate within the lipid trial . The primary accord outcome was a composite representing the first occurrence of either nonfatal myocardial infarction (mi) or nonfatal stroke or cardiovascular death . This outcome, as well as secondary outcomes, including all cause mortality, an expanded composite comprising the primary outcome plus revascularization or hospitalization for heart failure (congestive heart failure [chf]), total (i.e., fatal or nonfatal) mi, total stroke, and fatal or nonfatal chf (21), were included in the current analysis . Also included were adverse events such as severe hypoglycemia (i.e., requiring assistance) or an adverse experience that was life threatening and/or resulted in death, permanent disability, hospitalization, or prolongation of hospitalization . Two physical function limitations were assessed based on responses to the health utilities index questionnaire (25), which contains a question that addresses mobility limitations (walking) and another that addresses limitations in the ability to perform basic activities of daily living . These data were obtained at baseline and 12, 36, and 48 months of follow - up and coded in terms of having no difficulty versus any difficulty . A1c was collected in each arm at visits scheduled at 4-month intervals, and the updated average a1c was computed by calculating a weighted average of the cumulative a1c values, with weights defined by the length of intervals between blood draws (20). Means and percentages were used to compare baseline characteristics for those <65 versus 65 years old at enrollment . The percentage of participants experiencing hypoglycemia and other serious adverse events was calculated by glycemia intervention arm . Events per 100 person - years were calculated by dividing the total number of initial events by the total person - years accrued until either the time of the event or censoring . Time until the initial occurrence of each of the clinical outcomes was analyzed using cox proportional hazard (ph) regression analyses according to the principle of intention to treat . Hazard ratios (hrs) and 95% cis were derived from these models within subgroups defined by <65 versus 65 years old at enrollment . Analyses were performed for events occurring from randomization until the date of transition (glycemia substudy: 5 february 2008). Cox ph regression models contained a term representing glycemia arm allocation plus the following terms accounting for subgroups of participants that were prespecified in the protocol for analysis of the primary outcome: 1) additional assignment to the blood pressure (bp) or lipid trial, 2) randomization to the intensive bp intervention within the blood pressure trial, 3) randomization to fibrate within the lipid trial, and 4) participants with prior evidence of cvd versus those with no prior cvd . In addition, as done for the accord primary analysis, a term representing the clinical center network was included for analysis of the primary outcome . For each outcome, the consistency of the intervention effects within those <65 versus 65 years old was assessed within the cox models using statistical tests of interactions between the variables representing age and the glycemia intervention . Within those <65 years old and those 65 years old, previously described cox regression models (using penalized b - splines) and poisson regression models (20), were used to explore the relationship between updated average a1c and mortality risk and to estimate mortality rates in relation to the magnitude of the 1-year change of a1c within each treatment arm, respectively . For both models, likelihood ratio tests were used to test for between - subgroup heterogeneity in both the location and shape of lines fitted within glycemia arms . A comparison between glycemia arms on the proportion of participants that reported any difficulty in the two functional activities at each follow - up time was performed using logistic regression and generalized estimating equations, controlling for baseline difficulty, assignment to the bp or lipid trial, randomization to the intensive bp intervention within the bp trial, and randomization to fibrate within the lipid trial . At the time of randomization, the younger subgroup comprised 6,776 participants and the older subgroup comprised 3,475 participants (1,888 aged 6569 years, 1,054 aged 7074 years, 486 aged 7579 years, and 47 aged 80 + years). As noted in supplementary table 1, compared with the younger subgroup, the older subgroup had a longer duration of diabetes (median of 10 vs. 9 years); fewer women (25 vs. 40%) and minorities (34 vs. 39%); and lower body weight, bmi, waist circumference, a1c, diastolic bp, fasting glucose, ldl, total cholesterol, and triglycerides . Baseline mean systolic bp levels were somewhat higher in the older subgroup, and mean levels of hdl and serum creatinine were also higher in this subgroup . 1 shows the median a1c levels achieved over follow - up through month 80 in the older and younger intensive and standard therapy glycemia arms . The levels achieved were equivalent for intensive therapy for the older and younger subgroups (median 6.4 from months 1248), but for standard therapy, the median a1c was modestly lower in the older subgroup (median 7.5 from months 1248) compared with the younger subgroup (median 7.6 from months 1248). An age subgroup comparison of medication used to achieve these levels prior to the transition of intensive participants to standard therapy identified that a lower percentage of older versus younger intensive glycemia participants were prescribed metformin (66.6% older, 79.3% younger), any secretagogue (57.7% older, 63.9% younger), and any thiazolidinedione (49% older, 57% younger). Similar percentages of older and younger intensive glycemia participants were placed on any insulin and prandial insulin . The total dose of insulin was slightly lower in the older versus younger intensive glycemia participants (mean = 0.63 vs. 0.74 units / kg, respectively) and 18.1% of older versus 28.2% of younger intensive glycemia participants were on three or more classes of medication plus insulin (see supplementary table 2). Of final note, older adults had higher rates than younger adults for discontinuation of active management of glycemia medication regimens by accord physicians at some point during follow - up (11.3 vs. 8.9%, respectively; p = 0.0001). Among older participants, 12.4% in intensive glycemia versus 10.1% in standard glycemia discontinued accord medication management at least once during follow - up (9.6 vs. 8.2%, respectively, in the younger group). As noted in table 1, participants allocated to intensive glycemic therapy had approximately three times the rate of severe hypoglycemia as those allocated to standard therapy . This increased risk of hypoglycemia attributable to intensive therapy was similar for the two age subgroups . However, the absolute annual incidence of severe hypoglycemia was greater for older individuals allocated to both treatment arms (4.45 and 1.36% in intensive and standard glycemia, respectively) than in younger individuals (2.45 and 0.80% for intensive and standard glycemia, respectively). Over a mean follow - up of 3.7 years, these rates translated into 15.1 and 8.7% of intensively treated older and younger participants, respectively, reporting severe hypoglycemia (5.1 versus 3.0% of older and younger standard glycemia participants, respectively). Adverse events by glycemia and age subgroup for events occurring before the transition (5 february 2008) as presented in fig . 1, the effect of the intervention on the primary and all but one of the secondary outcomes was similar across age subgroups . There was no intervention effect on cardiovascular mortality in the older subgroup (hr = 0.97; 95% ci 0.701.36), but an increased risk in the intensive arm for younger (hr = 1.71; 95% ci 1.172.50) versus older participants (p interaction = 0.03). As expected, the older subgroup had higher absolute event rates for all outcomes considered within both treatment arms . The percentage of participants who were lost to follow - up for outcomes was 3.7% for older adults and 4.1% for younger adults for self - reported difficulty with walking, the percentage of participants reporting difficulty ranged from 3040% for the older subgroup and from 2733% for the younger subgroup, and for difficulty with activity, the percentages ranged from 3.27.6% and 5.9 - 6.9% within the same age groups, respectively (fig . The differences between glycemia arms (for either age group) in percentage reporting either difficulty (walking or activity) were clinically minimal (<2% on an absolute scale). Plots represent the proportion of participants reporting difficulty with either walking or activities at each follow - up visit . In the table below the figure, the number of participants providing data at each time point is presented in parentheses, after the percentage of participants reporting difficulty . M12, month 12; m24, month 24; m36, month 36; m48, month 48; int, intensive; std, standard; gly, glycemia . For the walking outcome, we found greater limitations in the intensive arm averaged across time points (p = 0.024) and at the 36-month visit (p = 0.014) for older participants and no differences at 12 months (p = 0.09) or 48 months (p = 0.33). Among younger participants, there were no differences between the glycemia arms across time points (p = 0.06) or at any visit (p = 0.06 for month 12; p = 0.38 at month 36; p = 0.13 at month 48). For activity limitations, slightly higher levels of limitations existed in the intensive arm within the older subgroup across time points (p = 0.012) and at the 12-month (p = 0.027) and 48-month (p = 0.042) visits, and no differences were found in activity for younger participants (p = 0.72 overall; p = 0.61 at month 12; p = 0.60 at month 36; p = 0.47 at month 48). Figure 3 contains plots of the relationships between all - cause mortality and both the updated average a1c (fig . 3c and d) by age subgroup and intervention arm . Comparing the relationships between fig . 3a and b, we note that there is no difference between age subgroups in the shape (slope of lines at each updated, average a1c value) for the intensive (p = 0.38) or standard (p = 0.52) arms; however, the vertical positioning of the lines for the older subgroup are significantly higher within both intensive (p = 0.01) and standard (p <0.01) arms . There is a significant difference between the shapes of the intensive and standard lines within fig . 3a and b, the confidence intervals for the standard lines for a1c <6.8 completely cover the intensive line, thus limiting conclusions about differences in this tail of the distribution . The increase in mortality risk within intensively treated participants was primarily among those with updated average a1c> 7.0 (53 mmol / mol), regardless of age subgroup . Spline curves of the risk of all - cause mortality with the two treatment strategies . A and b: the linear part of the ph model for average a1c from 6.0 to 9.0% (42 to 75 mmol / mol) for participants aged <65 and 65 years at randomization, respectively . For clarity, the figure omits values <6 (42 mmol / mol) and> 9% (75 mmol / mol); approximately 5% of deaths are excluded from the plot at the lower and also at the higher end of the a1c range, but these data are included in the models . The plotted values are relative to a standard participant, aged <65 years at randomization and at an a1c of 6% . The dashed lines represent estimates and cis for standard participants, solid lines are for intensive participants . C and d: the results from a poisson regression model of all - cause mortality rates by treatment and age subgroup for the whole period of follow - up, over a range of decreases in a1c from baseline in the first year of treatment (as% a1c). The full range of values was from 6.8% (51 mmol / mol; an increase) to 7.4% (57 mmol / mol; a decrease) from baseline . The calculations used a poisson regression model with data from model 3 of riddle et al . (20). When relating mortality risk to the initial 12-month fall in a1c (fig . 3c and d), we could not conclude that the shape of the lines between the two age subgroups were different within intensive (p = 0.24) or standard (p = 0.23) arms; however, the location of the lines were higher for older participants in both intensive (p = 0.03) and standard (p <0.01) arms . Within age groups, while the older subgroup that was treated intensively displays a large elevation in the mortality rate for those with little reduction in a1c levels (fig . 3d), this elevation must be considered within the context of the variability in estimates; only 6 deaths and 219 person - years of follow - up occurred among intensive participants with an increase in a1c during the initial 12 months . At the time of randomization, the younger subgroup comprised 6,776 participants and the older subgroup comprised 3,475 participants (1,888 aged 6569 years, 1,054 aged 7074 years, 486 aged 7579 years, and 47 aged 80 + years). As noted in supplementary table 1, compared with the younger subgroup, the older subgroup had a longer duration of diabetes (median of 10 vs. 9 years); fewer women (25 vs. 40%) and minorities (34 vs. 39%); and lower body weight, bmi, waist circumference, a1c, diastolic bp, fasting glucose, ldl, total cholesterol, and triglycerides . Baseline mean systolic bp levels were somewhat higher in the older subgroup, and mean levels of hdl and serum creatinine were also higher in this subgroup . 1 shows the median a1c levels achieved over follow - up through month 80 in the older and younger intensive and standard therapy glycemia arms . The levels achieved were equivalent for intensive therapy for the older and younger subgroups (median 6.4 from months 1248), but for standard therapy, the median a1c was modestly lower in the older subgroup (median 7.5 from months 1248) compared with the younger subgroup (median 7.6 from months 1248). An age subgroup comparison of medication used to achieve these levels prior to the transition of intensive participants to standard therapy identified that a lower percentage of older versus younger intensive glycemia participants were prescribed metformin (66.6% older, 79.3% younger), any secretagogue (57.7% older, 63.9% younger), and any thiazolidinedione (49% older, 57% younger). Similar percentages of older and younger intensive glycemia participants were placed on any insulin and prandial insulin . The total dose of insulin was slightly lower in the older versus younger intensive glycemia participants (mean = 0.63 vs. 0.74 units / kg, respectively) and 18.1% of older versus 28.2% of younger intensive glycemia participants were on three or more classes of medication plus insulin (see supplementary table 2). Of final note, older adults had higher rates than younger adults for discontinuation of active management of glycemia medication regimens by accord physicians at some point during follow - up (11.3 vs. 8.9%, respectively; p = 0.0001). Among older participants, 12.4% in intensive glycemia versus 10.1% in standard glycemia discontinued accord medication management at least once during follow - up (9.6 vs. 8.2%, respectively, in the younger group). As noted in table 1, participants allocated to intensive glycemic therapy had approximately three times the rate of severe hypoglycemia as those allocated to standard therapy . This increased risk of hypoglycemia attributable to intensive therapy was similar for the two age subgroups . However, the absolute annual incidence of severe hypoglycemia was greater for older individuals allocated to both treatment arms (4.45 and 1.36% in intensive and standard glycemia, respectively) than in younger individuals (2.45 and 0.80% for intensive and standard glycemia, respectively). Over a mean follow - up of 3.7 years, these rates translated into 15.1 and 8.7% of intensively treated older and younger participants, respectively, reporting severe hypoglycemia (5.1 versus 3.0% of older and younger standard glycemia participants, respectively). Adverse events by glycemia and age subgroup for events occurring before the transition (5 february 2008) 1, the effect of the intervention on the primary and all but one of the secondary outcomes was similar across age subgroups . There was no intervention effect on cardiovascular mortality in the older subgroup (hr = 0.97; 95% ci 0.701.36), but an increased risk in the intensive arm for younger (hr = 1.71; 95% ci 1.172.50) versus older participants (p interaction = 0.03). As expected, the older subgroup had higher absolute event rates for all outcomes considered within both treatment arms . The percentage of participants who were lost to follow - up for outcomes was 3.7% for older adults and 4.1% for younger adults for self - reported difficulty with walking, the percentage of participants reporting difficulty ranged from 3040% for the older subgroup and from 2733% for the younger subgroup, and for difficulty with activity, the percentages ranged from 3.27.6% and 5.9 - 6.9% within the same age groups, respectively (fig . The differences between glycemia arms (for either age group) in percentage reporting either difficulty (walking or activity) were clinically minimal (<2% on an absolute scale). Plots represent the proportion of participants reporting difficulty with either walking or activities at each follow - up visit . In the table below the figure, the number of participants providing data at each time point is presented in parentheses, after the percentage of participants reporting difficulty . M12, month 12; m24, month 24; m36, month 36; m48, month 48; int, intensive; std, standard; gly, glycemia . For the walking outcome, we found greater limitations in the intensive arm averaged across time points (p = 0.024) and at the 36-month visit (p = 0.014) for older participants and no differences at 12 months (p = 0.09) or 48 months (p = 0.33). Among younger participants, there were no differences between the glycemia arms across time points (p = 0.06) or at any visit (p = 0.06 for month 12; p = 0.38 at month 36; p = 0.13 at month 48). For activity limitations, slightly higher levels of limitations existed in the intensive arm within the older subgroup across time points (p = 0.012) and at the 12-month (p = 0.027) and 48-month (p = 0.042) visits, and no differences were found in activity for younger participants (p = 0.72 overall; p = 0.61 at month 12; p = 0.60 at month 36; p = 0.47 at month 48). Figure 3 contains plots of the relationships between all - cause mortality and both the updated average a1c (fig . 3c and d) by age subgroup and intervention arm . Comparing the relationships between fig . 3a and b, we note that there is no difference between age subgroups in the shape (slope of lines at each updated, average a1c value) for the intensive (p = 0.38) or standard (p = 0.52) arms; however, the vertical positioning of the lines for the older subgroup are significantly higher within both intensive (p = 0.01) and standard (p <0.01) arms . There is a significant difference between the shapes of the intensive and standard lines within fig . 3a and b, the confidence intervals for the standard lines for a1c <6.8 completely cover the intensive line, thus limiting conclusions about differences in this tail of the distribution . The increase in mortality risk within intensively treated participants was primarily among those with updated average a1c> 7.0 (53 mmol / mol), regardless of age subgroup . Spline curves of the risk of all - cause mortality with the two treatment strategies . A and b: the linear part of the ph model for average a1c from 6.0 to 9.0% (42 to 75 mmol / mol) for participants aged <65 and 65 years at randomization, respectively . For clarity, the figure omits values <6 (42 mmol / mol) and> 9% (75 mmol / mol); approximately 5% of deaths are excluded from the plot at the lower and also at the higher end of the a1c range, but these data are included in the models . The plotted values are relative to a standard participant, aged <65 years at randomization and at an a1c of 6% . The dashed lines represent estimates and cis for standard participants, solid lines are for intensive participants . C and d: the results from a poisson regression model of all - cause mortality rates by treatment and age subgroup for the whole period of follow - up, over a range of decreases in a1c from baseline in the first year of treatment (as% a1c). The full range of values was from 6.8% (51 mmol / mol; an increase) to 7.4% (57 mmol / mol; a decrease) from baseline . The calculations used a poisson regression model with data from model 3 of riddle et al . (20). When relating mortality risk to the initial 12-month fall in a1c (fig . 3c and d), we could not conclude that the shape of the lines between the two age subgroups were different within intensive (p = 0.24) or standard (p = 0.23) arms; however, the location of the lines were higher for older participants in both intensive (p = 0.03) and standard (p <0.01) arms . Within age groups, 3d (p = 0.003). While the older subgroup that was treated intensively displays a large elevation in the mortality rate for those with little reduction in a1c levels (fig . 3d), this elevation must be considered within the context of the variability in estimates; only 6 deaths and 219 person - years of follow - up occurred among intensive participants with an increase in a1c during the initial 12 months . Overall, our analysis of the impact of baseline age on the effect of more intensive blood glucose lowering in the accord trial indicates that, relative to standard glycemic treatment, intensive treatment resulted in similar metabolic (e.g., attained a1c targets) and primary and secondary end point effects in older and younger participants . These results illustrate that age is not a primary factor in success of achieving glycemia treatment targets within the age range included in accord . Similarly, the advance study found that the effect of intensive glycemic control on the primary outcome of major cardiovascular events was comparable within younger and older age subgroups (11). These results are analogous to findings such as those of the shep (systolic hypertension in the elderly program) study that contradicted commonly held beliefs that older adults would not tolerate targeted bp reduction as well as younger patients with hypertension (26). Compared with standard therapy, accord s intensive glycemia strategy resulted in a higher incidence of cardiovascular mortality in the younger participants but not in older participants (p = 0.03 for interaction). A similar trend between younger and older participants was seen for total mortality (p = 0.10). As might be expected, the absolute incidence of outcome and adverse events was generally greater in the older compared with the younger subgroup . It has been previously suggested that older adults may be more susceptible to hypoglycemic episodes (2729). Accord investigators and others have shown that that there are definable subgroups of older adults, such as those persons with evidence of early cognitive impairment (30) or dementia (31), who are at greatest risk for serious treatment side effects such as hypoglycemia . Our results now amplify prior findings in older patients . In accord, older adults were at higher risk of hypoglycemia than younger adults, and intensive glycemic therapy appeared to triple the risk in both older (4.45% intensive and 1.36% standard annualized risk) and younger (2.45% intensive and 0.80% standard annualized risk) adults . In the older group, over a mean follow - up of 3.7 years, these rates translated into a total of 15.1% intensive and 5.1% standard arm participants reporting severe hypoglycemia . The trend for increased hypoglycemia risk among older participants was identified early during accord follow - up in those 80 years old at randomization, where early monitoring of hypoglycemia rates by the external data and safety monitoring board (dsmb) identified elevated rates of hypoglycemia in participants who were 80 years old at randomization . The accord dsmb recommended at their may 2003 meeting that no additional participants over 80 years old be recruited into the main accord trial, and this recommendation was quickly implemented . At that time, among the 1,184 vanguard participants followed for an average of 1.8 years (1,150 were <80 years old, 34 were 80 + years old), 20.5% of those 80 years old and 4.7% of those <80 years old had reported hypoglycemia requiring emergency medical assistance . Two hypotheses set forth for the increased mortality in participants treated intensively for glycemia have involved the speed of decline in a1c (20) and the increase in hypoglycemia rates (32). In epidemiologic analyses, (20) have shown that the highest rates of mortality in the intensive arm was in the subgroup of participants with the least rapid drop in a1c levels during the initial 12-months of follow - up . The elevated mortality risk associated with less a1c decline in the initial 12 months was most prominent in those in the older subgroup (see fig . However, any inference regarding glycemia treatment differences in these figures should be severely restricted due to the variability in estimates at the tails of the distributions . (32) were unable to directly link higher rates of severe hypoglycemia in the intensive arm to the overall increased risk of mortality in intensively treated participants . Notably, our analyses identified no increase in total mortality risk associated with intensive therapy compared with standard therapy among older participants (hr = 1.06) but a similar relative increase in risk of hypoglycemia for intensive versus standard treated participants for older and younger participants (approximately 3.0 in both subgroups). In addition, the neutral effect of allocation to the intensive treatment on mortality in older participants did not appear to be due to the slightly higher rate of discontinuation of accord medication management in this group (unreported analyses). Finally, because a wide range of glycemic approaches were used and individually tailored to participant characteristics, epidemiologic analyses of accord medications data may be unable to detect small but important relationships within subgroups . These results should be viewed as hypothesis generating and interpreted with caution since they are tertiary analyses for the accord trial involving subgroups, some of which may be quite small (33). Specifically, the demographic differences between the two age groups relative to gender, racial composition, and other characteristics should also be noted relative to the patient populations for whom these subgroup analyses apply . Finally, accord was designed to include only community - dwelling ambulatory participants; thus these results cannot be applied to more frail and disabled or institutionalized groups of older adults . In summary, while we have shown that similar glycemic levels can be reached in ambulatory, community - dwelling older and younger adults, the frequency of serious adverse events associated with intensive targets was consistently higher within the older subgroup . The increased risk of hypoglycemia in older versus younger adults, regardless of whether they were in intensive or standard therapy, also suggests the need to individualize therapy in older adults with type 2 diabetes, as suggested by others (15,34,35). The recent 2012 american diabetes association consensus report emphasizes a need to stratify targets based on comorbid illness and functional status, among other factors, rather than on age alone (17). Where the accord results do not indicate that significant excess mortality occurred among intensively versus standard treatment older adults, there is little evidence to suggest that older adults received a cvd benefit . Importantly, the accord glycemia experience supports the concept that older adults should be included in clinical trials along with careful monitoring of adverse effects . Exploratory analyses of the type we have performed can help to inform the design, implementation, and monitoring of future clinical trials that include older patients with type 2 diabetes and other chronic diseases.
|
In most cells, proteostasis involves continuous regulation of protein synthesis and degradation, but the eye lens is a notable exception . During the final stages of maturation, lens cells eject all organelles, preventing normal protein turnover . The lens therefore provides a unique opportunity to observe the effects of aging in relation to damage accumulation in long - lived proteins, which are increasingly a subject of interest . They constitute approximately 3540% of the total soluble mass of the lens and are composed of a 3:1 ratio of a to b . While a is found almost exclusively in the lens, b has been found throughout the body including heart, glia, muscle, kidney, lung, and skin cells . Gene knockout studies revealed that a mouse lens can develop normally without b but not without a, which led to prompt cataract formation . Nevertheless, the chaperone activity of heteropolymers formed from a 3:1 ratio of a to b is higher than either homopolymer, suggesting that the combination of both proteins is optimal . Beta and gamma crystallins are the two other major subgroups of crystallins in the lens . They act in conjunction with the -crystallins to maintain lens structure and transparency and to achieve a suitable refractive index . To behave properly as chaperones, -crystallin monomers must interact with each other to form polydisperse oligomers . A and b form dimers that then assemble into larger complexes ranging from 15 to 50 monomers, with the subunits dynamically intermixing and exchanging . Removing the n- and c - terminal extensions allows for determination of partial crystal structures . When crystallins do not interact with each other properly, they become water - insoluble and begin to aggregate . The influence of many post - translational modifications (ptms) on this process has been investigated, including deamidation, oxidation, disulfide formation, and truncation . Importantly, all of these ptms lead to mass shifts that are easily detectable by mass spectrometry (ms). More subtle modifications that also increase with age, such as isomerization and epimerization, do not lead to easily detectable mass shifts and have been significantly less studied . Methods for detecting isomerization in peptides (meaning either inversion of the chiral center of an amino acid to produce an epimer or conversion of aspartic acid to isoaspartic acid) include stereoselective enzymatic digestion, ion mobility, and ms . Previous studies have shown that aspartic acid and serine are the two amino acids most susceptible to spontaneous isomerization . Deamidation of asparagine residues generates aspartic acid, and this transformation can also be accompanied by isomerization . The mechanism by which l - asp converts into l - isoasp, d - isoasp, and d - asp has been studied previously and is known to proceed via nonenzymatic formation of a succinimide ring, which can yield four isomers, as shown in scheme 1 . Enol tautomerism and then hydrolyzed to form d - asp or d - isoasp . The mechanism by which l - ser epimerizes to d - ser in proteins is not well - established, although proposals have been made . Alpha and beta carbons are labeled to highlight the difference between l - asp and l - isoasp, respectively . Although isomerization might appear to be a ptm, studies have shown it can cause major perturbations in protein structure . Noguchi and coworkers successfully crystallized hen egg - white lysozyme with an isoaspartic acid substitution at asp101 that caused backbone deflection of nearly 90 relative to the native structure . Crystal structures of a modified ribonuclease revealed that isoasp-32 induces conversion of an -helix to a u - shaped loop . Isomerization not only perturbs 3d structure but also can affect physical properties such as solubility and bioactivity . For example, isomerization of asp92 in immunoglobulin 2 (igg2) leads to deactivation of the antigen - binding region . Large - scale (i.e., proteomic) identification of single amino acid isomerism within peptides is challenging because there is no change in mass . However, differences in fragment intensities following ms / ms analysis can be used to detect isomers . This method was first applied to stereoisomers by tao and coworkers, who reported differences as a ratio of relative abundances of a pair of fragment ions differing most between l- and d- enantiomers (rchiral = rd / rl). It has been shown that radical - directed dissociation (rdd) yields the best chiral discrimination for analysis of peptide epimers . Previous work on the detection of isomerization and epimerization in the sheep lens using tandem lc ms revealed novel sites of isomerization in the crystallins . The present study focuses on changes in isomerization and epimerization for a, b, and b3 crystallin between water - soluble (ws) and water - insoluble (wi) protein fractions from cow, sheep, and pig eye lenses . To determine which regions of these proteins are most susceptible to isomerization, enzymatic digestion into peptides ms / ms analysis using both collision - induced dissociation (cid) and rdd . Importantly, we found several regions in the well - ordered crystallin domain that are disproportionately isomerized in the wi fractions . Specific isomerization hotspots were identified and correspond to regions with serine or aspartic acid repeats . Potential explanations for the isomerization of these sites are offered, and comparison with other long - lived and problematic proteins reveals that these sequence motifs are common . Cow, pig, and sheep eye lenses were acquired as discarded tissue from corona cattle, inc . The approximate ages for each of the animals were 1218 months for the cow, 56 months for the pig, and 68 months for the sheep . The supernatant was separated from the precipitate following centrifugation at 15,100 g for 20 min at 4 c . The precipitate (wi) was solubilized in 6 m urea and purified by dialysis against 6 m urea . For ws digestion, the protein was dissolved in 50 mm nh4hco3 buffer, ph 7.8; disulfide bonds were then reduced with 100 mm dithiothreitol (dtt) at 95 c for 5 min . After returning to room temperature, reduced cysteine residues were capped using 100 mm iodoacetamide in the dark for 20 min . Finally, the proteins were digested with trypsin overnight at 37 c using a 50:1 protein to enzyme ratio . For the wi digestion, the proteins were dissolved using 6 m 50 mm tris - hcl, ph 8.0 . Disulfide bonds were cleaved using 200 mm dtt in tris - hcl, ph 8.0 at 37 c for 20 min . Following this, 200 mm iodoacetamide in tris - hcl, ph 8.0 was added and the mixture was incubated in the dark for 1 h. to consume unreacted iodoacetamide, 200 mm dtt was added and incubated for 1 h in the dark . Next, the urea concentration was diluted to <0.6 m using 50 mm tris - hcl, 1 mm cacl2, ph 7.6 . The proteins were digested using trypsin with a 50:1 protein to enzyme ratio for 16 h at 37 c . For the iodobenzoic acid modification, the digested peptides were desalted and cleaned using a peptide trap (michrom bioresource). Approximately 5 nmoles of the digestion mixture, 15 l of 15 mm 4-iodobenzoic acid nhs - activated ester in dioxane, and 5 l of borate buffer (ph 8.6) were combined and incubated for 1 h at 37 c . Important: dimethyl sulfoxide should not be substituted for dioxane in this step because it can cause aspartic acid isomerization . The modification side products at arginine and tyrosine side chains were removed by incubating the reaction mixture in 1 m hydroxylamine, ph 8.5 . These procedures have been previously determined not to yield any detectable isomerization / epimerization in control experiments . To quantify isomer identification, an rchiral value approach,, risomer represents the ratios of the relative intensities of a pair of fragments that varies the most between two isomers (ra / rb). If risomer = 1, then there the two tandem ms spectra are indistinguishable and the species are likely not isomers . If risomer> 1, then a larger number indicates a higher probability that two unique molecules are represented . To confidently identify each of these isomers by ms / ms, we use a threshold that was determined by performing a t test on the risomer values obtained by performing cid and rdd on a mixture of synthetic peptides separated by lc ms . Using 99% confidence intervals, the risomer threshold for cid is> 1.9 and for rdd it is> 2.4 . We have previously described a modified bottom - up strategy for detecting sites of isomerization, including epimerization, in proteins . In brief, proteolytically digested peptides are separated by reverse - phase column chromatography and analyzed by ms with minimal time exclusion windows to favor repeated analysis of the same m / z . For example, the n - terminal fragment of a crystallin from the wi protein fraction of sheep lens, acetyl - mdiaiqhpwfk, elutes at four different times, each separated by 2 min, as shown in figure 1a . To establish that these peaks represent isomers, repeated ms / ms analysis of each eluting peak is required (both cid and rdd are used in separate runs).figure 1b shows cid spectra from each of the lc peaks in figure 1a . Although the spectra are similar, suggesting that they originate from the same peptide sequence, the relative intensities of certain peaks change noticeably . For example, the intensities of y9, b7, and y10 ions vary considerably between lc peaks 1 and 2 . These differences can be quantified into risomer values, which are provided in figure 1c . For cid analysis, risomer values above 1.9 represent statistically significant differences, meaning that all four peaks in figure 1a are different isomers of acetyl - mdiaiqhpwfk . Mass spectra alone do not provide information about which isomer corresponds to the native l - asp peptide, but in this case, the largest peak constitutes> 90% of the total relative abundance and likely represents the unmodified l - asp isomer . If the wi fraction is highly isomerized, in which case identification of the l - asp isomer becomes ambiguous, then comparison with the less isomerized ws digest or an authentic standard is used to identify the l - asp isomer . (a) lc chromatogram for the separation of the four isomers of ac - mdiaiqhpwfk in the wi sheep lens digest . (b) cid spectra from each of the lc peaks . Labeled fragments are those used to determine risomer values . The degree of peptide isomerization from the ws and wi protein fractions of sheep a crystallin is summarized in figure 2 . All isomers were confirmed by comparison of either cid or rdd ms / ms spectra, as described above . For example, the two isomers of aipvsr were indistinguishable by cid but could be confidently detected using rdd (see si figure s1). Additionally, some isomers coelute, preventing quantitation of the relative abundance of each form . The first downward bar on the left side of figure 2a (111) represents the data from figure 1 . This peptide, acetyl - mdiaiqhpwk, was found to be 9% isomerized, with error bars representing standard deviations from three technical replicates . The color coding of the bars corresponds to the three distinct structural regions present in -crystallins, the n - terminal disordered region, the crystallin - ordered region, and the disordered c - terminal extension . These regions are illustrated relative to a partial crystal structure on the right side of figure 2 . The full protein sequence is provided at the bottom of figure 2, color coded and with residues of interest marked for easy location . The trends in figure 2 illustrate that the average amount of isomerization is significantly higher in the n and c termini than in the well - ordered crystallin domain for both the ws and wi fractions . These dynamic regions play important roles in the assembly of -crystallins into higher - order structures, but this flexibility may also enable isomerization by facilitating more frequent access to the pathways outlined in scheme 1 . Percent isomerization of water - soluble (ws) a sheep versus water - insoluble (wi) a sheep . Orange, disordered n - terminus; blue, structured -crystallin domain; purple, disordered c - terminus . Peptide 164173 does not contain error bars because it only appeared baseline - resolved in one digest . The full protein sequence is given below the plot, with aspartic acid residues in bolded / black and serine residues in underlined / black . Asp105 and asp106 are in bold red text in the amino acid sequence and are shown explicitly in the crystal structure (pdb 3l1f) to highlight an important region of isomerization . Stars indicate isomerized regions where isomerization was identified, but quantitation was not possible due to incomplete chromatographic separation . Interestingly, the degree of isomerization in the disordered regions, although slightly more abundant in the wi fraction, is similar in both the ws and wi fractions . This suggests that these modifications do not significantly drive aggregation and loss of solubility, as previously reported . Differences in degree of isomerization are more notable within the crystallin region, where isomerization is significantly more abundant in the wi fraction (except for the dramatically modified peptide 104112 that will be discussed further below). Cumulatively, these results imply that modifications to flexible regions may be more facile but also less consequential in terms of altered functionality . Fewer peptides are isomerized in b, and the average degree of isomerization is less in both the ws and wi fractions compared with a . The flexible n - terminal domain is highly isomerized, similar to a . Interestingly, the c - terminal extension is not isomerized, which contrasts with a and is largely due to the fact that the c - terminal extension of b lacks any aspartic acid residues and contains only a single serine . The degree of isomerization observed in the ws versus wi fractions also varies more dramatically compared with a, with greater isomerization being observed in the wi fraction for all peptides . A and b share similar functionality and freely intermix to form higher order structures, yet comparison of figures 2 and 3 illustrates significant differences in propensity and effects of isomerization . The sequence alignment of the two proteins is <60% (figure s2), but the tertiary structures of a and b are very similar, as illustrated by the crystal structure of truncated bovine b on the right side of figure 3 . Despite the similarity, sequence variation appears to have a significant effect on the ability of b to accommodate isomerization and retain solubility, in agreement with previous observations . Another interesting difference between the two -crystallins is the overall abundance of acidic amino acids . Aspartic acid in a comprises 8.8% of residues and glutamic acid contributes another 5.8%, whereas b contains 6.3% aspartic acid and 8.0% glutamic acid . Although isomerization of glutamic acid is possible, the formation of the glutarimide intermediate is much slower compared with the succinimide equivalent in aspartic acid . Therefore, even though both proteins contain a similar percentage of acidic residues, a contains more residues prone to isomerization, and these residues often reside in regions where isomerization is facile . Isomerization of b from sheep, which differs significantly from what was observed for a (see figure 2a, formatting is identical). Asp109 in the amino acid sequence is in red bold text and shown explicitly in the crystal structure (pdb 3l1 g) to highlight an important site of isomerization . The same analysis that was performed on the crystallins was also conducted on one of the crystallins . B3 is composed of 211 amino acids, with two large structured domains connected by a flexible linker . The disordered n - terminal and c - terminal regions are much smaller than those observed in the -crystallins . The total amount of isomerization detected in the ws and wi fractions of b3 is lower than that in a and b, which is likely due to the greater fraction of highly structured regions . Similar to b, b3 is characterized by significant disparity between the degree of isomerization in the ws versus wi fractions, with greater isomerization being observed in the latter . This suggests again that structural perturbations in b3 are consequential and lead to rapid loss of solubility . The isomerized versions of several peptides, including slrplhidgpdhk and kmeivdddvpslw, are only detectable in the wi fractions (see figure s3). Slrplhidgpdhk is part of the structurally critical connecting peptide that joins the two domains of the monomer, denoted by the green bar in figure 4 . Kmeivdddvpslw contains aspartic acid residues that form ion pairs during assembly into higher order oligomers . Sequence alignment for human, pig, cow, and sheep b3 shows that each contains this aspartic acid repeat motif (figure s4). The results in figure 4 suggest that isomerization of either of these peptides leads to dramatic loss of solubility and, by extension, function . Formatting is identical to figure 2, except for the linker of the structured domains, shown in green . Asp110, asp113, asp133, asp134, and asp135 are all in red bold text in the amino acid sequence and are shown explicitly in the human crystal structure (pdb 3qk3) to highlight important regions of isomerization . His113 from human b3 was mutated to asp113*. The same analysis was carried out on pig and cow lenses, and the results are summarized with the sheep results in figure 5 . The percent isomerization per protein was determined by taking the sum of the percent of isomerization per peptide and dividing it by the total number of peptides, including a value of zero for those that were not isomerized . Peptides where the degree of isomerization could not be determined were omitted for all samples of the same protein . For example, tryptic digestion of 173 residue a yielded 12 peptides that cover 92% of the sequence . Contributions from these same peptides were used to calculate the numbers for each of the ws and wi a digests for each animal . The data were then normalized to the a digest that was most isomerized, which was the wi sheep digest . The same approach was applied to b and b3 . Although there is some variation between species, in general, the degree of isomerization is, on average, significantly greater in the wi fractions for all species . Several of the peptides in figures 24 appear to exhibit an unusual degree of isomerization relative to their peers . For example, qddhgyisr from a is not only is the most isomerized site in the protein but also is significantly more isomerized than any other peptide in the structured -crystallin domain . Quantitatively, the average amount of isomerization per peptide in the structured domain of a is 17.9% for the ws digest and 27.3% in the wi digest . At 76.7 and 89.3% isomerization in the ws and wi fractions, qddhgyisr is isomerized 4 the average rate in the ordered crystallin region . The analogous sequence in b, qdehgfisr, is also the most isomerized peptide extracted from the wi fraction, although full quantitative comparisons cannot be made due to lack of separation of some isomers for other peptides in the ordered region (see figure s5 for details). Finally, kmeivdddvpslw is the most isomerized peptide in the wi fraction from b3 . Each of these peptides shares a common feature, sequential repeats of acidic residues . In two cases, these observations suggest that sequential acidic residues represent sites of greater propensity for isomerization . There are at least two possible explanations that could account for increased isomerization at acid residue repeats . First, if there are multiple aspartic acid residues, then isomerization at multiple sites is possible . Structural perturbation engendered by the first modification could easily lead to increased local backbone flexibility, facilitating isomerization at additional sites . Indeed, examination of the elution profiles for these peptides reveals an abundance of isomers, indicating modification at more than one residue . For example, the elution profiles for the ws and wi fractions from pig for pqddhgysir reveal the presence of seven isomers; see figure 6 . The lowercase p at the n - terminus of the sequence denotes pyroglutamate, which is a common product during trypsin digestion . Comparison with synthetically prepared all l - asp isomer was used to confirm the peak corresponding to the canonical peptide . Risomer values (4.8, 5.5, 3.7, 4.6, 4.5, 1.2, and 3.4) relative to the synthetic version confirm that the sixth peak in the digest is the all l - asp isomer (see figure s6 for details). The ws / wi degree of isomerization for pqddhgysir from sheep is shown in figure 6c, d . A similar elution profile is seen between wi pig and sheep; however, the amount of l - asp in the ws pig lens is nearly twice as great as it is in ws sheep . (a) ws chromatogram and (b) wi chromatogram for pqddhgysir from pig . (d) wi sheep . Lower case p indicates the pyroglutamate that forms during tryptic digestion of n - terminal glutamine residues . Isomers were confirmed by ms / ms analysis and are labeled with percent abundance . Another factor contributing to isomerization at sites with multiple acidic residues, which may be more important than increased backbone flexibility, is inhibited repair by protein isoaspartyl methyltransferase (pimt). Pimt is the only known repair enzyme that targets protein damage caused by aging . It is present and active in bovine lenses and reverts l - isoasp back to l - asp.d - asp is also repaired, although much less efficiently, but d - isoasp is not a substrate . Importantly, sequence effects for substrate recognition have been identified and revealed that pimt has substantially lower affinity for isoasp if the n+1, n+2, or n+3 residues are negatively charged or if the n+1 site is proline . Therefore, the sequence regions with multiple acidic residues that we have observed to be highly modified are unlikely to be repaired by pimt, and our results confirm the importance of this enzyme in the repair of long - lived proteins . Acidic residue repeat sites may therefore be prone to sequential isomerization and difficult to repair, a potent combination with important consequences for protein aging . Indeed, examination of other long - lived proteins associated with age - related diseases reveals the presence of numerous acidic acid repeat sites that would similarly be susceptible to isomerization . For example, amyloid precursor protein associated with alzheimer s disease contains 27 acidic residue repeat sites that would be poor substrates for pimt . Table 1 lists long - lived proteins that contain aspartic acid repeats, are aggregation - prone, and are associated with diseases . It is clear that the results obtained here may be relevant on a much broader scale for any system composed of long - lived proteins . Number of asp residues with an acidic residue in the n+1, n+2, or n+3 position . We have also identified isomerized regions with multiple serine residues, such as eekpssapss . In the ws and wi fraction of the sheep lens this peptide elutes in six different peaks (figure s7), and comparison of resulting cid spectra confirms that they represent different isomers . It is interesting to note that the total amount of isomerization in the wi sheep fraction for eekpssapss is much lower than what was observed for qddhgyisr, 27.3% compared with 90.4%, respectively . It is possible that isomerization of aspartic acid may have a larger influence on local structure than epimerization of serine, inducing isomerization of nearby residues more efficiently . Alternatively, there is no known repair enzyme for epimerization of serine, which may suggest that the failure of pimt to repair isomerization may be the most important factor influencing isomerization at acidic residue repeats . However, the number of peptides with unambiguous epimerization at serine, that is, peptides that are isomerized and do not contain aspartic acid, is relatively small . Therefore, more data will need to be acquired before strong conclusions about serine epimerization can be drawn . Peptide epimerization and isomerization are difficult to detect and remain among the least studied ptms despite their potentially important role in numerous diseases . We have evaluated these modifications in crystallin proteins from the eye lenses of several organisms, and our results suggest that isomerization and epimerization lead to reduced protein solubility in many cases . Although there is variation between species, several common themes emerge from analysis of the data . For example this finding suggests that many other long - lived proteins with known disordered regions, such as -synuclein, tau, and -amyloid, may also exhibit pathology related to isomerization or epimerization . Although less prone to modification, isomerization within well - structured regions of proteins leads to more drastic changes in behavior, including unchecked aggregation . It was previously known that serine and aspartic acid are the most easily isomerized among the natural amino acids, but we have further demonstrated that when multiple acidic residues are close in sequence, the propensity for modification is enhanced further . We postulate that increased flexibility following an initial modification and failure of pimt to repair damaged residues contribute to the dramatic isomerization of sites with multiple acidic residues . The degree of isomerization at these sites also confirms the importance of pimt for long - term maintenance of protein structure . Proteins associated with parkinson s disease, alzheimer s disease, amyotrophic lateral sclerosis, and huntington s disease all contain regions with multiple aspartic acid or serine residues in close proximity, suggesting that these proteins may also exhibit hotspots of isomerization . Both a and b exhibit similar structural and functional behavior, yet a is found only in the eye lens . The isomerization behavior of a and b are quite distinct, with a being more prone to isomerization, but with b suffering greater loss of solubility following isomerization . The ability of a to sustain isomerization without loss of solubility may make it uniquely suited to the zero - turnover environment of the eye lens . It is clear that further, detailed examination of isomerization and epimerization in other tissues is needed and will expand our understanding of the role of long - lived proteins in aging - related diseases.
|
Since prostate - specific antigen (psa) was demonstrated in prostatic tissue in 1970, measurement of the serum psa level has become widely used for the early diagnosis and management of prostate cancer . However, it is well known that an increased serum psa level does not always indicate the existence of prostate cancer . The serum psa level can also be increased in patients with benign prostatic hyperplasia (bph), in patients with prostatitis, and after interventions such as prostate biopsy and transurethral resection of the prostate (turp). Especially in patients with mildly increased serum psa (4 - 10 ng / ml), the single most common cause of serum psa elevation is known to be bph, rather than prostate cancer . Other benign prostatic diseases that can cause elevation of the serum psa level include acute urinary retention, acute prostatitis, and prostatic ischemia . Moreover, it has been reported that the serum psa level has a tendency to increase temporarily for 20 days after turp and will decrease afterwards . Therefore, it is difficult to distinguish prostate cancer from benign prostatic conditions in patients who have undergone interventions on the prostate . One report on this issue suggested that 3% of patients who have undergone surgeries for bph will actually develop prostate cancer during the follow - up period; thus, establishment of clinical guidelines for follow - up strategies for such patients is necessary . It is now well understood from several reports on changes in the serum psa level after turp that the serum psa level decreases after turp . By contrast, reports on changes in the serum psa level after potassium - titanyl - phosphate (ktp) laser vaporization of the prostate based on the analysis of large populations are rare . Treatment of patients with bph by 80 w high - power ktp laser vaporization was first introduced in clinical practice in 2000 and is now accepted as an effective minimally invasive treatment modality . This method eliminates prostatic tissues that cause obstruction through vaporization, which occurs when hemoglobin selectively absorbs the ktp laser that generates heat energy . Ktp laser vaporization has gained considerable attention among many urologists recently because this treatment modality is less invasive while offering treatment results similar to those of conventional turp . Hwang et al reported that patients who underwent ktp laser vaporization demonstrated significant improvements in international prostate symptom score (ipss), maximal flow rate (qmax), quality of life (qol), and residual urine 3 months after the operation . Because the use of ktp laser vaporization is expected to increase, a need exists for establishing patterns in changes in the serum psa level after the operation . The elucidation of such patterns might offer useful clinical information on appropriate management and follow - up strategies . A total of 662 patients underwent ktp laser vaporization of the prostate for bph between october 2004 and august 2008 . Among these patients, those with prostate cancer, prostatitis, a history of urinary retention, or use of antiandrogen medication, all of which can influence serum psa levels, also excluded were patients for whom insufficient data were available or who were lost to follow - up . Therefore, 278 patients were included in the prospective analysis of serial serum psa levels . Careful history taking, digital rectal examination (dre), ipss, urinalysis / urine culture, transrectal ultrasound (trus), qmax, postvoiding residual urine (pvr), and serum psa levels were checked in every enrolled patient and evaluated to determine whether to perform ktp laser vaporization . Patients with abnormal dre findings or a serum psa value of 4.0 ng / ml or higher underwent trus - guided 12-core prostate biopsy to detect and exclude prostate cancer . Prostate volume was estimated by trus, first by measuring length (l), width (w), and height (h) and then by calculating volume by use of a prolate ellipsoid formula (lwh/6). Either epidural or subarachnoid anesthesia was used for the operations, and the vaporization was carried out by use of an 80 w ktp laser system (greenlight pvtm; laserscope, san jose, ca) that uses a 6 fr side - deflecting optical fiber emitting laser at a wavelength of 532 nm, which is delivered through a 23 fr, 30 continuous flow cystoscope connected to videoendoscopy . The distance from the probe to the prostatic tissue was kept closer than 2 mm, and normal saline was used as the irrigation fluid . The vaporization was performed until the tissues that caused the obstruction were completely removed, resulting in the formation of an appropriately sized cavity . A foley catheter (16 or 18 fr) was inserted right after the procedure and was removed one day later . Serum psa levels were measured in every patient before the operation and 1, 3, 6, and 12 months after the operation to analyze patterns of change . In addition, serum psa levels at 24 months after the operation were also checked in 183 patients . The mixed linear model in spss (version 12.0, spss inc) was used for statistical analysis of the changes in the serum psa level, and statistical significance was defined as a p - value of less than 0.05 . The mean age of the patients was 69.0 years (range, 50 - 91 years). The mean serum psa value was 2.722.93 ng / ml, and mean prostate volume estimated by trus was 35.715.5 cc (table 1). The serum psa level temporarily increased and reached 3.183.23 ng / ml at 1 month after the operation (p=0.032). However, levels began to decrease continuously afterward and decreased to 1.922.26 ng / ml in 3 months (p<0.001) and 1.791.82 ng / ml in 6 months (p<0.001). Within 12 months, the serum psa level was 1.702.25 ng / ml (p<0.001), thus demonstrating a decreasing pattern of stabilization (table 2, fig . The decreasing pattern showed its greatest value between 1 month and 6 months (fig . 1). The serum psa level at 24 months after the operation was not checked in all patients, but it also was shown to decrease and stabilize (table 2). As a result, the serum psa level had decreased by 37.5% by 12 months after the operation compared with the preoperative level . Bph is a common disease in older men; 40% to 70% of men over the age of 60 years are suspected of having bph, and it is still on the rise along with increasing life expectancy and westernized diets . Turp is accepted as the standard surgical method for treating the lower urinary tract symptoms of bph, although several other treatment options have been developed to date . However, complications of turp such as bleeding, tur syndrome, urethral stricture, retrograde ejaculation, and urinary incontinence are still among the side effects of this procedure and have not decreased significantly despite developments in techniques and instruments . Ktp laser vaporization of the prostate was introduced in the 1990s but was not widely accepted as an effective treatment option because it was performed with a low - power (20 w, 34 w) ktp laser in the early years and required a relatively longer surgical time than conventional turp . More recently, however, the 80 w high - power ktp laser was developed to improve vaporization speed, and as a result, ktp laser vaporization has become an effective treatment modality . Malek et al proved its efficacy by reporting that patients with prostates over 45 cc who underwent 80 w ktp laser vaporization showed significant improvements in ipss, qol, qmax, and pvr within 5 years of follow - up . Therefore, ktp vaporization is now widely practiced in many institutes because of its efficacy and reduced invasiveness, even though some controversy remains concerning its complication rates compared with conventional turp [13 - 15]. Ktp laser vaporization cannot eradicate prostate cancer that originates in the peripheral zone, however, because it only eliminates tissues at the transitional zone of the prostate . Marks et al reported that among 82 patients who underwent turp to treat lower urinary tract symptoms, prostate cancer had developed in 6 patients within 5 years of follow - up . With ktp laser vaporization in particular, possible pathologic diagnosis of prostate cancer could be missed because it is impossible to obtain a prostate specimen from the operation, which is possible in conventional turp . Therefore, it would be useful to establish clinical guidelines by serum psa follow - up after the operation to detect coexisting prostate malignancy with bph . To date, however, only limited reports on serum psa changes after ktp laser vaporization of the prostate were available . It is widely known that serum psa levels generally increase after interventions on the prostate for a certain period of time and decrease afterward . Temporary elevation of the serum psa level occurs as a result of psa leakage to the systemic circulation due to damage to the blood - prostate barrier during manipulations . In addition, prostatic inflammation after the manipulation can also facilitate increases in the serum psa level . There are several different reports on the length of time it takes for the serum psa level to decrease after a procedure . Volkan et al reported that the serum psa level increased immediately after ktp laser vaporization, but eventually decreased and returned to its preoperative level within 15 days after the operation . In our series, the serum psa level increased for up to 1 month and then decreased significantly over the next 3 months . It is not possible to clearly explain this variability in the length of time for which the serum psa level is increased . Further investigation of the probable responsible factors, such as differences in prostate volume, the preoperative serum psa level, operating time, and devices, are necessary to clarify this matter . Aus et al analyzed the serum psa level of 190 patients who underwent turp and reported that the serum psa level was reduced by 70% compared with its preoperative level . They also reported that the serum psa level became lower than 4 ng / ml in 90% of those patients . Wolff et al also reported that the serum psa level became stabilized at 2 ng / ml or higher in patients who were diagnosed with prostate cancer after turp . Therefore, similar to patients who undergo turp, the possible existence of prostate cancer should also be considered in patients who demonstrate a serum psa level that remains high or increases constantly after ktp laser vaporization . In our study, the serum psa level decreased significantly within 3 months after the operation and showed only a slight decrease from 6 to 12 months, which might mean that the levels stabilize after 6 months . In the present study, we were able to accurately analyze the changes in the serum psa level after ktp laser vaporization by frequently checking the postoperative serum psa level in a relatively large population for more than 1 year . The serum psa level may be temporarily increased after ktp laser vaporization for a certain period of time, but values will show a decreasing pattern within 3 months and will eventually become stabilized between 6 and 12 months . Therefore, it may be appropriate to wait for 3 months if the serum psa level rises after the procedure . However, if the serum psa level remains high even after 6 months, close follow - up or further investigation should be considered.
|
Somatization is a condition in which the patient experiences unexplained medical symptoms, and is sometimes called functional somatic complaint.1,2 the condition is particularly hard to detect in the elderly and its effects should not be underestimated as it can become a serious medical condition.3 high comorbidity between medically unexplained physical symptoms and other psychiatric disorders has been found among elderly patients.4 one survey revealed that general practitioners believe somatization to be an important cause of physical complaints among the elderly,5 and some investigators found that it is difficult to differentiate between the functional somatic and psychiatric origins of somatic complaints, in particular if they are overlapping.6 somatic symptoms may be related to depression, as depressed elderly people commonly manifest their suffering through physical symptoms.7,8 in previous studies, we showed that depressed elderly people tend to express their frustrations more as physical symptoms than nondepressed individuals, and that this was more the case in elderly depressed than younger depressed people.9,10 in addition, other factors such as culture, education, social values, or even ageism make it difficult for elderly people to be open or assertive, and as a result, physical complaints would seem to be a coping mechanism that they use to deal with this inner conflict.11 somatic symptoms may present themselves differently due to the influence of ethnic factors . For example, south americans have been found to have the highest rates of somatization11,12 and the condition is also common in asian people, especially among those who are experiencing depression, regardless of their age.13 an ethnic difference has also been found in terms of the types of symptoms reported . For instance, one symptom described as a heavy head is significantly more common among asians than among americans, caucasians, and africans.11 it may be that culture and ethnic background frame how individuals express themselves, whether they benefit or look bad when coping with types of stress or conflict, and in certain situations . For example, in thai society, elderly people are expected to have higher moral standards than younger people, so it may be unacceptable to express feelings such as sexual desire, even with a doctor, even if they still have them . Somatic symptoms, on some levels, may also be related to personality traits such as neuroticism . Neuroticism is the actual inclination to see distressing thoughts easily, such as frustration, anxiety, depressive disorder, or susceptibility . It is also at times referred to as emotional instability, inverse emotional stability, or neuroticism has been found to be one of the strongest predictors of somatism,14 and alexithymia is another personality trait that is found to have an influence on the condition.15,16 based on these results, somatization is viewed psychoanalytically as a defense mechanism against internal conflict whereby an individual finds it difficult to express himself or herself directly.17,18 it is also influenced by age and culture, and as mentioned before, can be viewed as a repository for frustration . Moreover, hypothetically, somatization should be prominent in individuals who display social inhibition, meaning it is difficult for them to effectively access help from others or express themselves directly.19 social inhibition is thought to reflect complex interpersonal behavior that is related to social withdrawal, regardless of whether it is related to anxiety, depression, or even apathy.2022 social inhibition, however, as measured by the interpersonal inventory of interpersonal problems, tends to be viewed as a trait rather than as a symptom.23 therefore, with regard to the role of social inhibition, in theory it is believed to act as a link or mediator between personality traits and somatization, and previous studies have found a correlation between it and somatization, although mostly accompanied by the presence of negative affectivity (or neuroticism).19,2426 however, little is known about the relationship between somatization and social inhibition in the elderly, in whom somatization is a common condition . We were interested in studying the relationship between these variables, as well as personality traits in addition to neuroticism . This study, therefore, aimed to explore the effects of personality traits on somatization and social inhibition as well as some sociodemographic data, based on the hypothesis that personality traits have either a direct effect on somatization, or indirectly via social inhibition (figure 1). These have not previously been investigated . This study was part of a wider study conducted in 200927 which was approved by the ethics committee at the faculty of medicine, chiang mai university . The authors analyzed the data of 126 elderly participants who provided demographic data and who completed the inventory of interpersonal problems (iip-64),27,28 the sixteen personal ity factor (16 pf), and symptom checklist (scl)-9029,30 questionnaires . Demographic data concerning the sex, age, income, and education of the participants were obtained . Participants aged 60 years or more were recruited (in thailand, people over 60 years old are defined as elderly). Income was assessed based on the gross monthly household incomes of the participants (<1 unit to 9 units, 1 unit equals 5,000 baht or 167 us dollars). The iip-6428 is a self - reporting questionnaire which measures interpersonal difficulties across eight subscales as follows: domineering, vindictive, nonassertive, socially inhibited, overly accommodating, self - sacrificing, and intrusive / needy . The scale consists of 64 items which are rated on a 5-point scale, ranging from 0 (not at all) to 4 (extremely), and the subscales can be modeled geometrically, as with a circumplex model . Each subscale signifies an octant in this model . The thai version has demonstrated a good overall internal consistency of =0.95.27 the test retest reliability of the iip-64 subscale using intraclass correlation coefficient (icc) ranged from 0.68 to 0.76 and 0.81 for the total score, although only the subscale socially inhibited (=0.79) was used for the analysis . The scl-9029,30 is a 90 item self - reporting questionnaire used to assess psychological problems and symptom distress . Each item assesses symptom severity on a 5-likert scale, where 0 represents not at all and 4 represents extremely . There are nine symptoms included in the instrument: somatization, obsessive compulsive, interpersonal sensitivity, hostility, depression, anxiety, paranoid ideation, phobic anxiety, and psychoticism . The thai version of scl-90 was developed by chooprayoon30 and has been used on both a clinical and nonclinical population . In this study, only somatization was used . For the somatization subscale, a cronbach s alpha of 0.85 has been generated using this instrument.10 the 16 pf, as developed by cattell et al,31 is a tool used for assessing personality based on eight dimensions or 16 characteristics: warmth, intellect, emotional stability, dominance, liveliness, rule - consciousness, social boldness, sensitivity, vigilance, abstractedness, privateness, apprehensiveness, openness to change, self - reliance, perfectionism, and tension . The results are rated by giving a score of 1 or 2, then comparing the results with a standard score . It has been shown to have adequate reliability: cronbach 0.80 over a 2-week period and 0.70 over a 2-month period.32 the thai version of 16 pf was developed by cheuaphakdi and phornphatkul,33 and has been widely used to assess personality and its relationship to clinical samples . The cronbach s alpha found when using the tool in this study ranged between 0.61 and 0.88.33 in this study, descriptive statistics were examined across all variables . Path analysis using amos 18 (ibm corporation, armonk, ny, usa) was applied to establish the effects of the personality trait predictors as well as the outcomes (somatization and social inhibition). A graphical illustration of path analysis is an easy, convenient, and effective way to present the complicated relationships among variables that exist as it allows one to see the influence of personality traits on somatization and social inhibition at the same time, and also the indirect effect of personality traits or social inhibition on somatization . In the first step, we analyzed the direct effects of the significant, correlated demographic variables, plus each personality trait variable, on somatization and social inhibition, after which we introduced mediator variables and estimated the direct and indirect effects . Path analysis was undertaken using the maximum - likelihood estimation method with all single indicators allowed to be correlated . Two fit indices commonly used in the confirmatory factor analysis literature were used to evaluate the model fit, these being the goodness of fit index (gfi)34 and the comparative fit index (cfi).35 the root mean square error of approximation (rmsea) and standardized root - mean - square residual (srmr) methods were also used as this is an evaluation statistic that is relatively unaffected by sample size and is suitable for assessing models of differing complexity.35,36 modification indices were also applied . The authors analyzed the data of 126 elderly participants who provided demographic data and who completed the inventory of interpersonal problems (iip-64),27,28 the sixteen personal ity factor (16 pf), and symptom checklist (scl)-9029,30 questionnaires . Demographic data concerning the sex, age, income, and education of the participants were obtained . Participants aged 60 years or more were recruited (in thailand, people over 60 years old are defined as elderly). Income was assessed based on the gross monthly household incomes of the participants (<1 unit to 9 units, 1 unit equals 5,000 baht or 167 us dollars). The iip-6428 is a self - reporting questionnaire which measures interpersonal difficulties across eight subscales as follows: domineering, vindictive, nonassertive, socially inhibited, overly accommodating, self - sacrificing, and intrusive / needy . The scale consists of 64 items which are rated on a 5-point scale, ranging from 0 (not at all) to 4 (extremely), and the subscales can be modeled geometrically, as with a circumplex model . Each subscale signifies an octant in this model . The thai version has demonstrated a good overall internal consistency of =0.95.27 the test retest reliability of the iip-64 subscale using intraclass correlation coefficient (icc) ranged from 0.68 to 0.76 and 0.81 for the total score, although only the subscale socially inhibited (=0.79) the scl-9029,30 is a 90 item self - reporting questionnaire used to assess psychological problems and symptom distress . Each item assesses symptom severity on a 5-likert scale, where 0 represents not at all and 4 represents extremely . There are nine symptoms included in the instrument: somatization, obsessive compulsive, interpersonal sensitivity, hostility, depression, anxiety, paranoid ideation, phobic anxiety, and psychoticism . The thai version of scl-90 was developed by chooprayoon30 and has been used on both a clinical and nonclinical population . In this study, only somatization was used . For the somatization subscale, a cronbach s alpha of 0.85 has been generated using this instrument.10 the 16 pf, as developed by cattell et al,31 is a tool used for assessing personality based on eight dimensions or 16 characteristics: warmth, intellect, emotional stability, dominance, liveliness, rule - consciousness, social boldness, sensitivity, vigilance, abstractedness, privateness, apprehensiveness, openness to change, self - reliance, perfectionism, and tension . The results are rated by giving a score of 1 or 2, then comparing the results with a standard score . It has been shown to have adequate reliability: cronbach 0.80 over a 2-week period and 0.70 over a 2-month period.32 the thai version of 16 pf was developed by cheuaphakdi and phornphatkul,33 and has been widely used to assess personality and its relationship to clinical samples . The cronbach s alpha found when using the tool in this study ranged between 0.61 and 0.88.33 the continuous scores of each variable were used for analysis . Path analysis using amos 18 (ibm corporation, armonk, ny, usa) was applied to establish the effects of the personality trait predictors as well as the outcomes (somatization and social inhibition). A graphical illustration of path analysis is an easy, convenient, and effective way to present the complicated relationships among variables that exist as it allows one to see the influence of personality traits on somatization and social inhibition at the same time, and also the indirect effect of personality traits or social inhibition on somatization . In the first step, we analyzed the direct effects of the significant, correlated demographic variables, plus each personality trait variable, on somatization and social inhibition, after which we introduced mediator variables and estimated the direct and indirect effects . Path analysis was undertaken using the maximum - likelihood estimation method with all single indicators allowed to be correlated . Two fit indices commonly used in the confirmatory factor analysis literature were used to evaluate the model fit, these being the goodness of fit index (gfi)34 and the comparative fit index (cfi).35 the root mean square error of approximation (rmsea) and standardized root - mean - square residual (srmr) methods were also used as this is an evaluation statistic that is relatively unaffected by sample size and is suitable for assessing models of differing complexity.35,36 modification indices were also applied . The age of the participants ranged from 60 to 93 years (mean = 71.7; standard deviation [sd] = 6.7); 50.8% of the group were male and 54.8% were married . The average number of years spent in education among the participants was 7.6 (sd = 5.2). Out of the 16 personality factors, only seven personality traits significantly related to either social inhibition or somatization were selected: emotional stability, dominance, reasoning, vigilance, apprehension, self - reliance, and tension (table 1). Vigilance was found to correlate with both social inhibition and somatization (r=0.229, p<0.001 and r=0.192, p<0.05, respectively). The other personality traits correlated in the range of 0.185 to 0.267 . Personality traits revealing significant correlations with social inhibition and somatization were included in the hypothesized model . Sex, reasoning, apprehension, and self - reliance were excluded from the model as they yielded low estimates in terms of regression weighting (p0.05). As a result, only emotional stability, dominance, and vigilance were retained . However, the direct effect of age on social inhibition, dominance on social inhibition, and social inhibition on somatization was not significant (p>0.05), so these three paths were deleted from the model . Age was found to have a direct impact only on somatization (=0.25, z=3.20, p=0.001), and then indirectly on social inhibition via the education level as they were significantly correlated (r=0.37). A lower education level was shown to have a direct association with high levels of somatization (=0.37, z=4.80, p<0.001) as well as social inhibition (=0.19, z=2.17, p=0.03). Emotional stability had a direct effect on both somatization (=0.19, z=2.58, p=0.01) and social inhibition (=0.19, z=2.27, p=0.023). Dominance had an effect on somatization (=0.18, z=2.45, p = 0.014) and a direct effect on vigilance (=0.33, z=3.86, p<0.001), and vigilance had an effect on social inhibition (=0.19, z=2.50, p=0.024). More importantly, modification indices did not suggest a link between social inhibition and somatization, as had been speculated beforehand.18,25 the r for somatization was 0.35, whereas for social inhibition it was 0.10 . The model showed a very good fit to the data, with =3.55, df=6, p=0.738, cfi = 1.00, tli = 1.097, nfi = 0.968, gfi = 0.992, rmsea = 0.00, and srmr = 0.031, and all paths were significant (p<0.05). To our knowledge, this is the first study investigating the link between personality traits and both somatization and social inhibition at the same time . Above all, age and education were found to have an effect on both symptoms, with education found to have the strongest influence when compared to personality traits . This result may have been due to the level of intelligence of the individuals involved, as found in previous studies.3739 age was found to have both a direct and indirect impact on these symptoms when combined with personality traits . As mentioned earlier, here our model showed that it had an impact on both outcomes, meaning that elderly people in the study who had a low emotional stability score tended to have both symptoms . Dominance, meanwhile, was found to have a direct effect on somatization and an indirect effect on social inhibition . It is important to note that without the presence of the dominance trait and other factors in the model, emotional stability had no significant effect on somatization . This may be explained by the fact that somatization is related to depression, that is, it may be influenced by depression, which in turn is related to neuroticism (or inverse emotional stability).4046 neitzert et al compared the relationships between neuroticism, depression, and somatic symptoms in a healthy student sample, finding that neuroticism and depression are significantly and positively related to somatic symptoms reporting, even after controlling for the effects of neuroticism.47 however, our study focused exclusively on the importance of personality traits with regard to social inhibition and somatization when depression is not involved, which is why the effect of emotional stability was not dramatic . It is interesting to note that somatization is related to dominance, which is defined by the presence of characteristics such as assertiveness, forcefulness, aggressiveness, and competiveness . What can be understood from this relationship between dominance and somatization? Some assumptions we would like to make here are that since the dominance personality trait is forceful an assertive personality akin to a type a it has been found to be related to a narcissistic personality.48 it may therefore be speculated that sociocultural influences have a role to play, particularly among the thai elderly, with regard to the dominance personality trait . In thai society, older people tend to feel powerless and that they lack authority.49 they tend to submit and expect not be independent, and this undermines their pride and self - esteem . When compared to younger people with these personality types, it may be rather difficult for dominant elderly people to assert themselves, or to express their frustrations, meaning that somatic complaints may reflect an idiom of distress . Dominance indirectly endorses social inhibition through the suspicion trait, while skepticism (vigilance) may make an older person socially withdraw rather than step forward for help in a time of need, as the elderly are expected by thai society to be knowledgeable and self - fulfilled . As for social inhibition, there is evidence that it has a relationship with emotional stability,23 in contrast to the findings of kingma et al who found that neuroticism had no effect on social inhibition.50 this can be attributed to the fact that there were differences in terms of the neuroticism - related outcomes measured and instruments used in these studies . It is interesting to note that the results here showed no direct effect of social inhibition on somatization, as had been hypothesized in the model, even though both social inhibition and somatization are significantly correlated . In fact, social inhibition did have a significant effect on somatization, but this was reduced to a nonsignificant level when other personality traits were included . This suggests that these personality traits outweigh the effect social inhibition has on somatization . To summarize, somatization symptoms, without depression, were related to (instead of being influenced by) social inhibition and both were influenced by age, education level, as well as inverse emotional stability, dominance, and vigilance personality traits . What outcomes here are of use when dealing with elderly people experiencing somatization and social inhibition, but without depression? The model used here suggests we should consider an individual s level of education (or intelligence), his or her age, and also look out for the personality traits of emotional stability (or neuroticism), dominance, and vigilance . To help patients feel safe, therapists should reduce the level of fear and anxiety patients experience, while creating a way for them to express their self - esteem and pride . Approaching the problems in this way should help them to cope with stress or frustrations better rather than avoiding their problems and using somatic complaints as a way to cope with stress or frustration . In addition, building trust should help improve their socialization levels, which in turn may prevent them experiencing somatic preoccupation . First, the sample size used in this study was rather small, and this will have had an impact on the statistical analyses . Second, this study investigated a nonclinically diagnosed sample of somatization sufferers using the scl-90 self - reporting tool, whereas ideally, clinician rated structured interviews should have been used to assess the presence or otherwise of the condition . Third, this study was cross - sectional in nature, therefore it was not possible to evaluate causality . Our study identified personality traits and sociodemographic variables that have an effect on somatization and social inhibition . Emotional stability, dominance, and vigilance, as well as age and level of education were found to have an effect on these symptoms . Therefore, primary care workers should perhaps pay more attention to these factors when dealing with elderly with somatization . However, further studies with larger sample size and longitudinal design is encouraged to warrant the likelihood of the model . In addition, the authors encourage investigating how depression has its effect on these variables in any further study.
|
Typically, we study experience with health care conditions, including health care costs and quality, as if these conditions occur in isolation, one at a time . The vast majority of extant clinical guidelines and disease management programs focus on a single condition, although the experience of multiple chronic illnesses is the reality for many patients particularly among the elderly and near elderly . The institute of medicine s report crossing the quality chasm highlights the problem with health system fragmentation and stresses the need for health care systems that promote continuity of care and integration of services.1 realigning the focus of health services research to be more in line with the complex experience of patients is central to developing solutions that work . This paper provides information on what we know about multiple chronic conditions, specifically the prevalence and health challenges of multiple chronic conditions, and the ramifications of specific combinations of chronic conditions on quality, patient management, and costs . We performed a semistructured literature review to identify relevant articles . Specifically, we queried medline for peer - reviewed publications that examined the prevalence, outcomes, costs, and patient management challenges associated with multiple chronic conditions . Chronic disease and comorbidity, and limited our search to articles on adults published in english between january 2000 and march 2007 (n=643). The first strategy used a set of specific mesh terms related to prevalence, quality, access, delivery of care, patterns of care, morbidity, mortality, and expenditures . To ensure that we did not overlook any important articles in the original set the final set of 123 articles was the union of abstracts gained from these 2 approaches . The remaining abstracts were reviewed by the first author and abstracts that did not mention at least 1 specific somatic chronic illness, abstracts that did not examine specific comorbidities, and articles that focused on an acute illness or procedure were removed . Information summarized in this review stem from the remaining articles and prior publications cited by these articles . The number of persons in the united states who have not just a single chronic condition, but multiple co - occurring chronic conditions is large and growing . In 2005, 21% or roughly 63 million americans had more than 1 chronic condition, or multiple illnesses or impairments expected to last a year or longer . A persons risk of having more than 1 chronic condition, henceforth referred to as multiple chronic conditions or mcc, increases with age: 62% of americans over 65 have mcc . With the aging of the us population, the number of americans with mcc is projected to be 81 million by 2020.2 the institute of medicine s seminal report crossing the quality chasm noted that 23% of medicare beneficiaries have 5 or more chronic conditions.1 prior research has documented the prevalence of individual conditions in the u.s . For example, based on data from the medicare current beneficiary survey (mcbs), the most prevalent individual conditions among the over-65 population include: arthritis (57%), hypertension (55%), pulmonary disease (38%), diabetes (17%), cancer (17%) and osteoporosis (16%).2 however, there has been very little research to date exploring the prevalence of particular combinations or clusters of chronic conditions, and almost all studies examining specific comorbidities do so from the perspective of a specific index disease rather than examining all co - occurring chronic conditions.3 only a fragmentary portrait of the prevalence of mcc emerges from studies examining comorbidities among patients with specific index conditions . A case - control study of asthmatics found that diabetes was more common in concert with asthma, but obesity was more common in patients without asthma4 of patients with alzheimer s disease, 28% also have congestive heart failure, 27% chronic obstructive pulmonary disease, 22% diabetes mellitus, and 20% cancer.2 in comparison to the general population, persons receiving care for schizophrenia or affective disorders in community - based treatment centers were more likely to suffer from asthma, chronic bronchitis, diabetes, and liver problems.5 finally, persons suffering from epilepsy have higher rates of a host of chronic conditions, including bowel disorders, bronchitis / emphysema, heart disease, and stroke in comparison to the general population.6 fewer studies have explored the natural clustering of chronic conditions . Using cross - sectional medicare claims data, wolff and colleagues grouped a national sample of medicare patients into major diagnostic categories (mdc) based on a well - validated grouping algorithm . They found that the tendency of patients to have comorbid conditions varied from 80% among individuals in the mdc myeloproliferative disorders to 32% in the circulatory disorders mdc . These investigators found that specific combinations of chronic conditions occurred more frequently than expected, and proposed that perhaps underlying biological vulnerabilities may help explain the clustering of diseases within individuals.7 a subsequent more limited study used cluster analysis to identify conditions that tend to co - occur among elderly american indians . The specific conditions in this group include heart disease, stroke, hypertension, diabetes, urinary or bladder conditions, and tuberculosis . Interestingly, although arthritis is 1 of the 2 most common chronic conditions in this population, it does not commonly occur in concert with other conditions.8 perhaps the most widely known example of the clustering of chronic conditions in a biologically and clinically meaningful way is the so - called metabolic syndrome . Population,9 the metabolic syndrome is present when patients have at least 3 of 5 chronic conditions: obesity, hypertriglyceridemia, low - serum high - density lipoprotein (hdl), hypertension, and glucose intolerance.10,11 the metabolic syndrome is associated with increased risk of cardiovascular disease and all cause mortality12,13 and may reflect underlying genetic predispositions to this combination of chronic conditions.14,15 overall, specific chronic conditions have a stronger relationship with functional impairment than others, and persons with more chronic conditions become more functionally impaired sooner than persons with fewer chronic conditions.16 the picture, however, appears to be more complex . One of the most revealing studies to date found that after controlling for the presence of individual conditions, specific mcc were associated with disability far greater than expected based on the disability observed for each disease in isolation . The authors suggested that some diseases may be associated with disability only in the presence of other specific diseases, and that a new, potentially effective strategy for prevention or amelioration of disability would be to decrease targeted disease - disease interactions.17 fultz et al.18 also found synergistic interactions between some pairings of mental and physical conditions, but not others . For example, persons with stroke and cognitive impairment had a higher level of impairment in activities of daily living than predicted by the presence of stroke and cognitive impairment alone . Other combinations, such as stroke and depression, did not have the same synergistic effect on activities of daily living impairments.18 a recent analysis of near - elderly veterans found that in general the risk of 5-year mortality increased with the number of co - occurring chronic conditions; however, osteoarthritis in combination with any other chronic condition actually lowered the risk of 5-year mortality.19 persons with multiple chronic conditions are particularly vulnerable to suboptimal quality care.2 they tend to use services more frequently and to use a greater array of services than other consumers of care . This makes coordination of care more difficult for individuals with multiple chronic conditions . The number of different physicians seen annually by the average medicare patient with a chronic condition ranges from 4 with 1 condition to 14 with 5 or more . As the number of providers involved in patients care increases, patients are likely to find it increasingly challenging to understand, remember, and reconcile the instructions of those providers.20 because patients with more than 1 chronic condition take on average more medications, they are more likely to suffer adverse drug events (ades), including ades that result from drug - drug interactions,2124 or in the specific case of heart failure coupled with chronic obstructive pulmonary disease, present challenges to appropriate pharmacological management.25 having multiple chronic conditions also makes it more challenging for patients to participate effectively in their own care.26 surveys of physicians confirm that they believe quality problems are increased among their patients with multiple chronic conditions.27 however, the link between co - occurring chronic conditions and poor quality is far from clear . An assessment of quality among canadians over 65 with specific combinations of chronic conditions found deficiencies in care associated with some combinations of conditions, but not all . For example, patients with hyperlipidemia and chronic obstructive pulmonary disease were less likely than patients with hyperlipidemia alone to receive lipid - lowering medications . Individuals with psychoses and arthritis were less likely to receive arthritis medications than individuals with arthritis alone . However, glaucoma patients with breast cancer are no less likely to receive glaucoma medications than those without breast cancer.28 a well - known study of the predictors of initiating psychiatric treatment found that competing demands from physical problems hindered the initiation of psychiatric care.29 however, other studies have found that co - occurring chronic conditions are actually associated with more appropriate care . Contrary to prior expectations, researchers examining a cohort of diabetic patients enrolled in a heart failure disease management program found that despite their targeted heart failure care, these patients also received comprehensive diabetes care.30 patients with somatic chronic conditions may actually receive more appropriate care for depression or other psychiatric disorders . Among elderly persons, depression care was more likely to be adequate among elderly persons with co - occurring diabetes than without,31 and neither the number nor specific comorbid conditions were found to impact the effectiveness of interventions aimed at improving depression care.32 more general measures of quality also yielded mixed results . Braunstein et al.33 found that the occurrence of hospitalizations for ambulatory care sensitive conditions increased among elderly heart failure patients when they suffered from other comorbidities . Hospitalizations for ambulatory care sensitive conditions are considered preventable by good primary care.34 the odds of experiencing these so - called preventable hospitalizations were largest when heart failure occurred in combination with hypertension or chronic renal insufficiency . However, for unknown reasons, certain comorbidities, such as hypercholesterolemia or dementia, seemed to protect heart failure patients against hospitalization for ambulatory care sensitive conditions.33 among vulnerable persons age 65 and over, min et al.35 found that overall, persons with more chronic conditions had higher (better) risk - adjusted quality scores . However, specific combinations such as diabetes and cardiovascular disease were associated with worse quality of care as measured by a composite of up to 207 quality indicators . It is reasonable to hypothesize that clinicians systematically vary in the provision of indicated services when caring for patients with particular combinations of conditions, just as they systematically overlook certain issues in caring for single illnesses.36 for example, systematic differences in colon cancer screening rates among elderly persons with chronic conditions may reflect conscious decisions to concentrate screening on patients whose life expectancy can be improved through cancer treatment.37 several observers have argued that current strategies including disease - specific health guidelines may not be suitable in many cases to optimizing care of individuals with mcc.21,24 instead, it is argued, guidelines need to be tailored to clusters of illnesses in ways that acknowledge not only the biology of those clusters, but also the special challenges and threats to quality of care associated with mcc in general and specific clusters in particular . Moreover, single - disease - oriented disease management programs, which frequently offer services provided outside traditional health care facilities (call centers and coaches, for example), have the potential to further fragment care . Even wagner s chronic care model, which emphasizes coordination of care around chronic illness, focuses primarily on single illnesses, not multiple chronic conditions,38 so that its relevance and effects on multiple chronic conditions remain to be explored . The intrinsic challenges to optimizing quality and value of care among individuals with multiple chronic conditions, the evidence that quality may be suboptimal for some individuals with multiple chronic conditions, and indications that quality may vary with the specific clusters of chronic conditions, all suggest the need to explore more systematically the relationship between quality of care and clusters of chronic conditions . In a country with health care expenditures exceeding $1.7 trillion and 15% of gross domestic product,39 controlling costs of care has become an overwhelming concern among public and private policy makers and managers . From this perspective the care of individuals with chronic conditions is estimated to account for 78% of health expenditures in the united states . Patients with more than 1 chronic condition are estimated to account for 95% of all medicare spending; those with more than 5 account for two thirds.2 the congressional budget office reports that among high - cost medicare beneficiaries (e.g., the 25% of beneficiaries accounting for 85% of programmatic costs), about 30% had 4 co - occurring chronic illnesses: coronary artery disease, diabetes, congestive heart failure, and chronic obstructive pulmonary disease.40 the likelihood that patients with a particular condition such as heart failure or diabetes will use expensive health care resources such as hospital care increases substantially with the presence of other comorbidities.33,41 for example, the likelihood that a medicare patient with a chronic medical condition will use emergency department services doubles when depression is present as a comorbidity.42 medicare beneficiaries with heart failure who have comorbidities are more likely to be readmitted for heart failure than patients without comorbidities.43 the concentration of health care expenditures in subpopulations with chronic conditions has led to the widespread proliferation of disease management programs . In 2004, 97% of private health plans had disease management programs for diabetes, 86% for asthma, 83% for heart failure, and 70% for ischemic heart disease.44 state medicaid programs have also begun implementing similar disease management programs.45,46 under provisions of the medicare modernization act, congress instructed the centers for medicare and medicaid services to undertake a variety of initiatives to improve care for high - cost, chronically ill patients, including the chronic care improvement program (ccip), a large national experiment with applying disease management programs to patients in the traditional medicare program.47,48 the ccip will target more than 30,000 beneficiaries with 3 conditions (diabetes, heart failure, and chronic obstructive pulmonary disease) in 10 regions of the country . Despite the conceptual attractiveness of the disease management approach, evidence of clinical and cost - effectiveness remain limited.49,50 recent analyses have found that cost savings and return on investments varied by diagnosis.51,52 most disease management programs focus on management of a single chronic condition . This raises concerns about whether they may undermine coordination of care for patients with mcc,53 thereby introducing new inefficiencies and potential threats to quality of care.21,24,54 furthermore, by focusing on a single illness, programs fail to account for the synergistic impact of chronic conditions occurring in combination . The medicare program has begun experimenting with improving management of patients with mcc under other demonstrations including its medicare coordinated care demonstration and its care management for high - cost beneficiaries demonstration . More recently, some private health plans have also shifted toward intensive case management programs aimed at high - risk patients with multiple complex conditions,50 often using predictive modeling applications to identify members whose past utilization suggests they are likely to generate high health care costs in the future.55 however, even these initiatives may suffer from the fact that they lack information necessary to take into account the potential variation in costs and quality associated with particular mcc and information on the most efficacious treatments for specific disease combinations . Understanding how to care effectively for persons with multiple chronic conditions is among the most important challenges our health care system faces . Despite the depth of research into specific chronic conditions, there is little information about the prevalence of mcc, and the health and cost impacts of specific combinations of chronic conditions . The small amount we do know suggests that specific chronic conditions combine and impact health and costs in unpredictable ways, and that specific combinations have particularly large impacts of health or costs of care . Currently, there are a number of methodological challenges to research on mcc, including, fundamentally, the need for large and preferably longitudinal, clinically meaningful data that can be used to identify the natural history of disease, and control for the severity of individual conditions when assessing outcomes for mcc . The increasing adoption of health information technology has the potential to greatly improve the level of clinical detail of widely available data,56 and may help accelerate clinically meaningful research . Such research should help illuminate why certain clusters of comorbid illness may be more prone to quality lapses or be associated with significant but unexpected clinical outcomes, and lead to the development of targeted strategies, including tailored mcc - specific clinical guidelines, to improve the management of patients with key mcc . Similarly, research on more clinically detailed data may be used to develop computerized decision support that incorporates new knowledge regarding the additive clinical impact of specific comorbidities co - occurring within a patient and anticipate the tendency of clinicians to overlook or overprescribe certain elements in the process of care . Although payers have begun to target high cost combinations, far more research is needed to understand the clinical impact of the clustering of chronic illness and to incorporate this more refined understanding into targeted quality improvement and clinical management strategies . With the aging of population,
|
Hwa byung (hb,) is a disease caused by continuous stress and the inhibition of bad emotions such as depression, anger, and so on . Hb produces various psychological and somatic symptoms, including depressed mood, anxiety, pushing up in the chest, chest tightness, fatigue, headaches, dizziness, mouth dryness, insomnia, palpitation, indigestion, and so on . Hb literally means anger disorder or fire disease because hwa means anger or fire and hb is a korean culture related syndrome related to a deep expression of feeling, i.e., deep sorrow (), and is included in the diagnostic and statistical manual of mental disorders, 4 edition (dsm - iv) [1, 2]. Sa - am acupuncture (saa) is a unique korean acupuncture method that was developed by a korean hermit, master sa - am, in the sixteenth or seventeenth century a.d . And is now one of the popular acupuncture techniques used in korean traditional medicine [3, 4]. The pericardium is known to control blood circulation in the entire body indirectly and to assist and protect the heart by defending it against the invasion of pathogens (). The pericardium is involved in the action of the mind and regulates emotion . In saa methods, the pericardium meridian, which is connected to the pericardium, is used to treat heart diseases, circulation disorders, and neuropsychiatry diseases [5, 6]. Simpo - jeongkyeok (spjk,) is a saa method that tonifies lr1 and pc9, and sedates ki10 and pc3, and that is used to tonify a deficient pericardium meridian and a deficient function of the pericardium [3, 4]. Spjk treats the deficiency syndromes of mental disease, such as non stopping of joy and laughter, delirious speech, anxiety, nervousness, and so on . Several randomized controlled trials (rcts) have been conducted to prove the effects of saa a for treating hypertension, chronic tension type headaches, dysmenorrhea, simple obesity, and hb [12 - 14]. We already reported that spjk, from among saa methods, was effective for treating hb . However, we also theorize that saa may have an effect on the blood pressure (bp), pulse rate (pr), and body temperature (bt) because saa has been shown to have positive effects when is used to treat hb, as well as hypertension . Thus, the purpose of the present study was to examine additionally in a rct the effects of saa spjk treatment on the bp, pr and bt in patients with hb . The study was a patient assessor blind, randomized, placebo, controlled trial and included 50 women aged 20 65 years who visited sangji korean medicine hospital from may 2010 to october 2010 and were diagnosed as having hb by using the hwa byung diagnostic interview schedule (hbdis). After the study protocol had been approved by institutional review board of sang - ji university korean medicine hospital (no . Sj irb 100512), informed consents were obtained from the subjects . Patients with hb for less than a 6 month duration, with a psychosis such as delusion, hallucination and mania, or with a history of alcohol and drug abuse were excluded . Because disorders such as liver, heart, endocrine, and kidney disorders may occur with hb, patients who had those disorders or who were taking medications for those disorders were also excluded . Patients who drank alcohol or beverages containing caffeine, who overworked the day before the experiment, or who had undergone acupuncture treatment or had participated in other clinical experiments during the previous one month were excluded . The number of women in one group was arbitrarily decided as 20 women without analyzing the sample size because the study was a pilot study . The target sample sizes for the treatment and the control groups were 25 women each, considering a dropout rate (20%). The subjects were randomly assigned by using statistical analysis system (sas) program (ver . 9.1.3) into those who would receive real acupuncture (treatment group) and those who would receive minimal sham acupuncture treatment (sham or control group) in a 1: 1 ratio . The subjects were numbered and listed at random . The random code list was sealed in a double non penetrable envelope, and the envelope was opened just before the experiment . The volunteers, data collector and analyst were unaware of the individuals who would be receiving the treatment . The procedure in both the treatment and the control groups was done by one korean doctor for consistency . Only one analyst, who did not know the assignment of subjects, analyzed the data taken before and after treatment . For the treatment group, sterilized, single use needles (0.25 mm 30 mm, stainless steel, dongbang, korea) were used for the intervention . Totally, four treatments over 2 weeks were done at the same time of the day . 1) needle insertion was done at pc9, lr1, pc3, and ki10 on the right side . Insertions of 2 3 mm at pc9 and lr1 and of 10 mm at pc3 and ki10 were used . Directional supplementation and draining (dsd,) and de- qi were performed (fig . Needle insertions with depths of less than 3 mm depth were done at 6 cm superior and 3 cm lateral of pc3, 6 cm superior and 3 cm medial of pc3, 6 cm inferior and 3 cm posterior of ki10, and 6 cm inferior and 3 cm posterior of gb34 . Demographic information such as the medical history, age, height, weight, drinking and smoking habits, and medications being taken was checked at the first visit . The bp and the pr were measured before and after treatment at visits 1, 2, 3, and 4 and before treatment at the follow - up (f / u) visit (visit 5). Bt at (ex) yintang, cv17, cv12, and cv6 were measured before and after treatment at visits 1 and 4 and before treatment at the f / u visit . The hem-7200 unit (omron, japan) we analyzed the data by using the mann - whitney u, wilcoxon signed rank, and repeated measured analysis of variance (rm anova) tests and considered statistical significance at p <0.05 . Two participants who did not meet the inclusion criteria and one participant with endocrine disorder from among the 53 participants at the screening step were excluded . Fifty participants were finally enrolled and finished the trials; there were no drop outs . Twenty five participants each were randomly place into the spjk treatment group and the control group (fig . 2) on the baseline characteristics, no significant differences in age, weight, drinking and smoking habits, marriage, medication, pr, both side systolic and diastolic bp, and bt were noted between the treatment and the control groups . The average height in the control group was 2.36 cm larger than that in the treatment group (156.48 3.91 vs. 158.84 3.68, p = 0.0328) (table 1). The right (rt .) And the left (lt .) Side systolic blood pressure (sbp) of the treatment group showed 4.2% and 4% decreases, respectively . The decrease in the both side sbp continued until visit 4 . Until the f / u visit, the decrease in the lt . However, no significant differences in the sbp and the diastolic blood pressure (dbp) in between the control and the treatment groups were observed at each visit (rm anova, sbp within group p = 0.357, between groups p = 0.706; dbp within group p = 0.244, between groups p = 0.561) (figs . The differences in the sbp between before and after treatment at each visit between the treatment and the control groups were significant (table 3) the bp differences between before and after treatment were higher in the treatment group than in the control group except for left arm systolic pressure at the third visit of the control group (figs . Side at visit 2, but that drop in the bp steadily declined at each later visit . The dbp before and after treatment in the treatment group showed no difference compared to the control group (figs . The sbp of both arms in the treatment group showed decreases between visits 1 and 2, 1 and 3, 1 and 4 and 1 and the f / u visit . The both arm dbp between visit 1 and visit 3 and the right arm dbp showed decreases (table 2). The differences in the pr between before and after treatment at each visit between the treatment and the control group were significant (table 4), but that decrease in the pr did not continue until the f / u visit . The prs of the treatment and the control groups showed no significant differences at each visit (rm anova, within group p = 0.138, between groups p = 0.857). However, the pr from visit 1 to visit 4 decreased more in the treatment group . Compared to visit 1, the pr reduction in the treatment group was significantly higher until visit 4 than it was in the control group, but the difference on the pr between the f / u visit and visit 1 showed no significance (table 3). The bts at (ex) yintang, cv17, cv12, and cv06 at each visit showed significant differences within groups (rm anova, p <0.001). The minimal temperature increase was found at cv06 and cv12 in the treatment group whereas the minimal decrease was observed at (ex) yintang and cv17 in the treatment group . Spjk not only caused the temperature at the upper regions of the body to be lower, but also that at the lower regions to be warmer . The patterns of temperature change in the two groups between the 1 treatment and the 4 treatment were similar (table 4). Several rcts studying the effects of acupuncture in lowering the bp have been reported [8, 15 - 18]. Some studies suggested that acupuncture might have reduced the bp in patients with hypertension [8, 15 - 17] whereas others reported contradictory results . However, acupuncture has been reported to lower the bp significantly in patients taking antihypertensive medications . Many studies have indicated that acupuncture might be a good adjunctive therapy for treating hypertension [19, 20]. Our study s conditions were not similar to those of other studies [8, 15 - 20] because the patients in our study were patients with hb, but not with hypertension . This study showed that immediately after treatment acupuncture without an antihypertensive drug had decreased bp compared to the normal range of bps, but that effect was not maintained . Our study s results were similar to those of chen et al, which showed no statistical differences because of small sample size and short treatment duration . However, we hypothesize that the reduced bp and heart rate should be maintained if the duration and the frequency of acupuncture treatment were to be increased to three months or more . However, electroacupuncture has been reported to activate neurons in the hypothalamic arcuate nucleus, the ventrolateral periaqueductal gray matter (vlpag) in the midbrain, and the nucleus raphe in the medulla to inhibit the neural activity in the rostral ventrolateral medulla (rvlm) and to inhibit the reflex hypertension through opioid mediated inhibition of glutamate in the rvlm [22, 23]. Another report suggested that acupuncture might regulate the cardiovascular system through a complicated brain network from the brainstem, the hypothalamus, and the cortical level . Some evidence suggests that acupuncture lowers the bp by modulating the activity of cardiovascular pre - sympathetic neurons in the rvlm and can improve the circadian rhythm of the bp in patients with hypertension by normalizing the decreased parasympathetic nerve activity [15, 25, 26] or by regulating the autonomic nervous system (ans) [27 - 29]. Sympathetic nerve stimulation (sns) increases the heart rate (hr) and the pr, and constricts both the heart and all the blood vessels of the systemic circulatory system . Conversely, parasympathetic nerve stimulation (pns) or the inhibition of sns causes the opposite effects . We speculate that the bp and the pr decrease because the hyperactivity of sns caused by hb is inhibited or because pns is activated by saa spjk . A report that the saa method of supplementing lr1 and draining ki11 significantly decreased the mean artery pressure in normal rats supports our study s results . The bt is regulated by nervous feedback mechanisms operating through temperature regulating centers in the ans of the hypothalamus . Pns or the inhibition of sns increases blood flow to abdominal organs such as the gastrointestinal tract and the kidneys . We postulate that the abdominal temperature (cv12 and cv06) increases whereas the face and the chest temperatures ((ex) yintang and cv17) decrease because spjk activates pns, which induces an increase in the blood flow at abdominal organs . Second, the acupuncture treatment and the follow - up duration were each two weeks . The duration of our study was shorter than that of clinical experience and a large clinical trial . Nevertheless, the present study demonstrated that spjk could lower the bp, decrease the pr, and maintain homeostasis of the bt soon after treatment . Third, the subjects of this study were patients with hb and normal bp (not with hypertension). Thus, we were unable to ascertain whether the spjk treatment had a real effect in lowering the bp or the lowering of the bp was an effect accompanying the treatment of hb . However, we were able to determine that spjk had an immediate effect on the bp, pr, and bt in the normal range and that the effect could not be maintained, although a precise conclusion could not be drawn from this study . Future rigorous rcts with larger sample sizes and long durations are recommended to identify the effect of saa spjk treatment in lowering the bp in patients with hypertension . The results of this study suggest that saa spjk treatment has instant positive effects on the bp, pr, and bt in patients with hb, but the effects on the bp and pr are not maintained . Values were means sds: sds, standard deviations; pr, pulse rate; bp, blood pressure; bt, body temperature . Values were means sds: sds, standard deviations; at1, first treatment; at2, second treatment; at3, third treatment; at4, fourth treatment; f / u5, follow- up visit 2 weeks after the end of treatment . At1, first treatment; at2, second treatment; at3, third treatment; at4, fourth treatment; f / u5, follow up visit 2 weeks after the end of treatment . At1, first treatment; at4, fourth treatment; f / u5, follow - up visit 2 weeks after the end of treatment.
|
It is a consequence of chronic inflammation and infections leading to anatomic distortion and dilation of the bronchi . As a result, many insults have to be considered in its pathogenesis, and the condition is typically considered irreversible . However, studies have shown potential reversibility with early treatment.1 the description of bronchiectasis dates back to early 19th century in the writings of rene theophile hyacinthe laennec . In 1992, with the introduction of bronchography by jean athnanse, images of lung destruction were obtained, and nowadays the gold standard for diagnosis is high - resolution computed tomography scan.1 the clinical presentation is chronic cough (ie, daily for four or more weeks) with purulent sputum and frequent exacerbations, recurrent chest infections, dyspnea, wheeze, hemoptysis, clubbing, failure to thrive, and growth retardation . The patient was a 29-year - old male from tehran, with a history of multiple hospitalizations for lung infection who presented to the pulmonary clinic with a complaint of chronic productive cough which had worsened in the previous year . He had been hospitalized two to three times for his respiratory condition and once in childhood when he was 10 or 11 years old . The hospitalizations helped him a little, but his sputum production had gradually increased . Since his last hospitalization, which had been 2 years earlier, he had had persistent sputum production with expectoration two or three times an hour . He was up to date on his vaccinations, was not on any medications, and denied any drug allergies . He denied any medical illnesses in his family, including lung disease . On physical examination, he was in no acute distress, with a blood pressure of 110/70 mmhg, a pulse rate of 72 beats per minute, a respiratory rate of 20 per minute, and an oral temperature of 37c . Heart sounds s1 and s2 were heard, with no murmurs, rubs, or gallops . On pulmonary examination, chest x - ray showed extensive pulmonary cysts on the left side, with mediastinal shift to the left . Computed tomography scan of the thorax without contrast showed a normal heart, mediastinum, and pleura, with shift to the left side and hyperaeration of the right lung . There were multiple medium - sized, thick - walled cystic lesions, some containing fluid, in the left lung (mostly in the upper lobe), with volume loss in favor of bronchiectasis . Laboratory investigations showed a white cell count of 10 10 cells/l and an erythrocyte sedimentation rate of 17 mm / hour . In view of illness since childhood, investigations were undertaken to exclude congenital causes of bronchiectasis . Body plethysmography was ordered with culture of sputum for bacteria, fungi, and mycobacteria . Electronic medical records from masih daneshvari hospital, a tertiary referral center, were searched to identify all cases of bronchiectasis and associated conditions from january 2007 until july 2008 . In total, 291 cases of bronchiectasis were identified, age range 583 years, with 24 cases being younger than 18 years . Fifty cases of old tuberculosis were found, as well as 22 cases of cystic fibrosis, 21 of congenital immune deficiency, and five cases of kartagener s syndrome . The age range for patients with primary ciliary dyskinesia was 925 years and that for immune deficiency was 243 years . The charts of the last ten patients admitted with a final diagnosis of bronchiectasis were reviewed . Infection is the most common etiology of bronchiectasis in developing countries . Vaccinations and use of antibiotics pulmonary changes can be focal or diffuse, and most commonly involve the lower lobes . Increased concentrations of inflammatory elements, including neutrophil elastase, interleukin 8 (a potent chemokine for neutrophils), tumor necrosis factor alpha, and prostanoids have been shown . Increased numbers of neutrophils, neutrophil elastase, myeloperoxidase, tumor necrosis factor alpha, and interleukin 6 have been found in the bronchioalveolar lavage fluid of patients with stable disease compared with controls.1 long term - mortality is associated with advancing age, lower body mass index, dyspnea, lack of vaccination, hypoxemia, hypercapnia, and other functional parameters.4 the differential diagnosis for this condition is extensive . Childhood conditions associated with bronchiectasis include bacterial, viral, mycobacterial, and fungal infections, immune deficiency (eg, hypogammaglobulinemia), secondary immune deficiency (eg, acquired immunodeficiency syndrome, immunosuppressant therapy), allergic bronchopulmonary aspergillosis, cystic fibrosis, primary ciliary dyskinesia, pulmonary sequestration, alpha-1 antitrypsin deficiency, williams - campbell syndrome, other congenital syndromes, marfan syndrome, aspiration, gastroesophageal reflux, endobronchial tumor or extrinsic narrowing, toxic inhalation, rheumatic and autoimmune disease, and arsenic exposure.1 the main causes of bronchiectasis identified in studies of children have been immune deficiency, congenital abnormalities, aspiration, asthma, toxic inhalation, and idiopathic . For evaluation of immune deficiency, an antibody response to hemophilus influenzae type b capsular polysaccharide vaccine of four times or greater has been suggested . Humoral immunity should be evaluated promptly in patients with chronic sinopulmonary infection for early therapeutic considerations . Malabsorption syndrome is also seen in these patients.19 cystic fibrosis is a common cause of bronchiectasis, diagnosed by elevated sodium and chloride concentrations on sweat chloride testing in a child with recurrent respiratory infections . It is an autosomal recessive disease involving the cystic fibrosis transmembrane conductance regulator, with delta - f508 being the most common mutation.1 alpha-1 antitrypsin deficiency is also seen in older patients with more severe lower zone emphysema.8 computed tomography scoring systems have been devised, and are used every two years as follow - up for the disease . Scores are based on bronchiectasis, airway wall thickening due to inflammation, and mucus plugs.6 cystic fibrosis is diffuse and has a predilection for the upper lobe on computed tomography of the chest.10 consolidation, pulmonary nodules, peribronchial thickening, bronchiectasis / bronchial dilation, and air trapping may be seen.11 multidetector computed tomography allows diagnosis and monitoring of cystic fibrosis at substantially lower radiation doses.12 primary ciliary dyskinesia is also an autosomal recessive disorder with variable penetrance . Mean age at diagnosis is 4.4 years, and the disease affects 1/15,000 to 1/40,000 births . It is classically described as showing mirror image arrangement, bronchiectasis, and sinusitis.13 foreign body aspiration presents with dyspnea, wheezing, coughing, and atelectasis or hyperinflation on chest x - ray.1 addressing recurrent cough, sinusitis, potential foreign body aspiration, and gastroesophageal reflux are cornerstones of prevention . Antibiotics and bronchodilators have traditionally been used as treatment modalities . The most common organisms involved are h. influenzae, pseudomonas spp, and streptococcus pneumoniae . The risk of pseudomonas infection increases as time passes and is a marker of disease severity.4 general measures include avoiding smoking or secondhand smoke, adequate nutrition, and immunizations, including yearly influenza vaccines, mobilization of secretions with acetylcysteine, hypertonic saline (shown to be beneficial in cystic fibrosis) or mannitol nebulization (shown to be useful in patients with bronchiectasis, cystic fibrosis, and asthma). Inhaled or systemic corticosteroids can be considered if hyperreactivity exists . Aerosolized recombinant dnase is used in cystic fibrosis.14 chest physiotherapy, including postural drainage, chest wall percussion, and forced expiration techniques, are traditionally utilized . In advanced disease or lack of response to appropriate therapy, surgery is an option to decrease infective episodes and for hemoptysis . Following surgery, patients experience a 42.5%75% improvement in symptoms.1 in one study, macrolides reduced sputum volume, improved lung function, and achieved better control of symptoms, with improved survival.4 in cases of inadequate humoral immunity, morbidity and infection rates can be reduced by intravenous or subcutaneous immunoglobulin and aggressive antibiotics and pulmonary hygiene measures.1 live vaccines may be harmful.13 patients with primary ciliary dyskinesia or cystic fibrosis may need specialized treatment . Addressing recurrent cough, sinusitis, potential foreign body aspiration, and gastroesophageal reflux are cornerstones of prevention . Antibiotics and bronchodilators have traditionally been used as treatment modalities . The most common organisms involved are h. influenzae, pseudomonas spp, and streptococcus pneumoniae . The risk of pseudomonas infection increases as time passes and is a marker of disease severity.4 general measures include avoiding smoking or secondhand smoke, adequate nutrition, and immunizations, including yearly influenza vaccines, mobilization of secretions with acetylcysteine, hypertonic saline (shown to be beneficial in cystic fibrosis) or mannitol nebulization (shown to be useful in patients with bronchiectasis, cystic fibrosis, and asthma). Aerosolized recombinant dnase is used in cystic fibrosis.14 chest physiotherapy, including postural drainage, chest wall percussion, and forced expiration techniques, are traditionally utilized . In advanced disease or lack of response to appropriate therapy, surgery is an option to decrease infective episodes and for hemoptysis . Following surgery, patients experience a 42.5%75% improvement in symptoms.1 in one study, macrolides reduced sputum volume, improved lung function, and achieved better control of symptoms, with improved survival.4 in cases of inadequate humoral immunity, morbidity and infection rates can be reduced by intravenous or subcutaneous immunoglobulin and aggressive antibiotics and pulmonary hygiene measures.1 live vaccines may be harmful.13 patients with primary ciliary dyskinesia or cystic fibrosis may need specialized treatment.
|
Parathyroid hormone (pth) is a linear peptide consisting of 84 amino acids and produced by the parathyroid cells . It plays a critical role in the calcium metabolism, and its receptor (pth1r) is present in several tissues, with special importance in renal tubules and bone cells . The classical biological activity of pth, mediated by pthr1 activation, is dependent on the presence of an intact amino terminal sequence, mainly the first amino acids . Yet pth present in circulation is very heterogeneous, and this heterogeneity is the consequence of a complex metabolism that starts in the parathyroid cells and continues in other tissues, mainly in the kidneys and liver [1, 2]. The result of this complex metabolism is the presence of a circulation pool of pth peptides, not only in pathological conditions, but also in normal individuals . This phenomenon is particularly important in patients with end - stage renal disease, where pth fragments, with marked predominance of the carboxyl terminal ones, are present in great quantities in comparison to the intact 184 form (figure 1). One important point is the fact that the biologically active forms have very short half - lives, compared to the carboxyl terminal fragments (devoid of the amino terminal amino acids) that have longer half - lives and accumulate in circulation as glomerular filtration declines . The recent demonstration of functional carboxyl - terminal receptors for pth, and of their potential physiological importance, brought a new challenge in the interpretation of pth results [46]. The correct definition of the form recognized by the assay employed for serum pth measurement becomes very important . Pth measurement has evolved alongside immunoassay methods for almost 50 years, since the first practical method was published in 1963 . It is a long story, and the accumulated knowledge about physiology and metabolism of the molecule provided new tools for the development of new assays in a continuous feedback process . We can divide, for the sake of simplicity, the evolution of pth assays in three groups of methods: the competitive immunoassays (1st generation), the immunometric assays (2nd generation), and the new assays recently described using mass spectrometry (3rd generation). In the first case a single polyclonal antibody competes for labeled pth and the serum forms . In the 2nd - generation assays, two distinct antibodies (usually monoclonal), directed against different epitopes, one of the antibodies is bound to a solid phase, and the other is labeled . In the third type of assays, the recognition is based on other principles (mass spectrometry) in serum samples previously purified . The first description of a radioimmunoassay for pth, by berson et al . In 1963 was a tremendous breakthrough and initiated a revolution in the diagnosis of parathyroid conditions . Several other radioimmunoassays were described in sequence, all based on antibodies raised against pth extracted form bovine or porcine parathyroid glands . These heterogeneous 1st - generation assays had important limitations, including the difficulty of producing antibodies with sufficient affinity and defined specificity . These difficulties derived from the fact that bioactive pth circulates in concentrations that in normal individuals are below 10 the specificity of these first antibodies was directed mainly against carboxyl fragments, the pth form predominant in the gland extracts used for immunization, for standard preparation and for labeling . Nevertheless, immunoassays with reasonable characteristics and clinical correlation were described [8, 9]. These carboxyl terminal assays had a major limitation that was related to the retention of these fragments with decrease in glomerular filtration, rendering their use in chronic renal disease patients almost invalid [10, 11]. With the description, by potts et al ., that a synthetic peptide comprising the 134 sequence of pth was biologically active and equipotent to the complete 184 peptide, an effort to develop amino - terminal - specific assays ensued . We had an extensive experience with the development and use of an amino - terminal - specific radioimmunoassay for pth . The assay was based on egg - yolk - extracted antibodies, and despite problems in sensitivity, the assay was diagnostically superior to the most available carboxyl terminal radioimmunoassay [1618]. The description of the first immunometric assay for pth (noncompetitive, sandwich type assay) by nussbaum et al . In 1987 was a major breakthrough, and the sensitivity and specificity problems were considered overcome . Immunometric assays (2nd generation) are based on the recognition of pth by two different antibodies, one carboxyl terminal and the other amino terminal specific . Initially these assays were considered to recognize only intact pth (184) and considered to be the gold standard for the definition of parathyroid dysfunctions . Nevertheless, publications by the group of d'amour et al . Showed that it could not be exactly the case [21, 22]. These authors showed that pth forms with deletion of the first amino terminal amino acids (mainly 784) are present in significant concentration, particular in patients with renal insufficiency . We confirmed these observation using an in - house immunofluorometric assay and hplc separation for the pth forms in circulation . Since the biological activity of pth, via pthr1 binding, depends on the presence of these first amino acids, these 784 forms have no classical pth biological activity . The reason why the intact assays measured also these deleted forms relates to the specificity of the amino terminal antibody used, since most of them are directed to an antigenic site located around amino acids 20 to 25 (amino terminal antibody type 1 in figure 2). This region of the molecule is more antigenic, and a successful immunization (mice or other animal) usually produces antibodies with that specificity . In order to have an assay recognizing only the biologically active 184 pth form, the amino terminal antibody used should recognize the first amino acids (amino terminal antibody type 2 in figure 2). Assays with this specificity were described, are available commercially, and were extensively studied against the standard immunometric assays [24, 25]. The conclusion of all these studies was that besides having a lower reference range, these biologically active 184 pth assays showed no clear advantage over the more available, less expensive, and extensively validated intact immunometric assays for measurement of intact serum pth are widely available in clinical laboratories, have good sensitivity and reproducibility, and well - defined normal reference values [27, 28]. One point is still debatable and relates to the use of these assays in patients with hyperparathyroidism secondary to renal insufficiency, since as described by quarles et al . In 1994, dissociation between serum pth levels and bone abnormality exists in these patients . One logical solution, the use of the immunometric assays that measures only the biologically active the conclusion is that some form of skeletal resistance exists in this condition, and it may be in part explained by the interaction of pth molecules that bind to pthr1 but do not activate it . These somewhat unexpected observations may be related to the notion that pth should be viewed as a polyhormone, a concept first raised by mallette in 1991 . The wide range of circulating forms of pth may include forms with biological activity different from those expected by the activation of pthr1 [36]. This observation can be further stressed by the recent description, in some parathyroid carcinoma patients, of circulating forms of pth that are able to activate pthr1 but are not recognized by the current intact assays . The additional information potentially provided by the measurement of the various forms of circulating pth peptides is very attractive, but attaining this goal using immunometric assays would require several different assays . The use of liquid chromatography coupled to tandem mass spectrometry in the clinical laboratory is rapidly maturing and is already in routine in diagnostic laboratories for steroid hormones . The enormous potential of these techniques already led to the development of methods that associate immunoaffinity, in situ digestion, and mass spectrometry for the discrimination and quantification of the pool of circulating pth forms [34, 35]. We foresee these techniques (3rd generation) as the next step in pth quantification, with broad new clinical applications.
|
The prevalence of newborns with hyperthyrotropinemia was 1 in 8,000 live births at the beginning of neonatal screening in 1979 (1), and it is now 1 in 2,500 births (2) in japan . Due to the increase in the prevalence of screening - positive newborns, the number of newborns diagnosed as having transient hypothyroidism or transient hyperthyrotropinemia has increased . It has been reported that about 30% of screening - positive newborns with anatomically normal thyroids have transient forms of the disorder (3). The causes of transient hypothyroidism or transient hyperthyrotropinemia include prematurity, maternal thyroid disease and excess or lack of maternal iodine intake (4). On the other hand, it has been reported that subclinical hypothyroidism persists in late childhood in about 30% of children found to be false - positive during neonatal screening (5). It is unclear whether transient thyroid dysfunction and subclinical hypothyroidism represent true clinical conditions . The aim of this study was to determine whether transient thyroid dysfunction and subclinical hypothyroidism detected during neonatal screening are influenced by genetic background . The tsh receptor (tshr), thyroid peroxidase (tpo) and dual oxidase 2 (duox2) genes, for which it has been reported heterozygous defects cause neonatal transient thyroid dysfunction, were analyzed in children with transient thyroid dysfunction or subclinical hypothyroidism detected during neonatal screening . We recruited nine screening - positive children who had not received levothyroxine (l - t4) replacement or had been able to stop l - t4 replacement after re - evaluation of thyroid function . Subjects with known underlying causes of transient thyroid dysfunction, such as prematurity, down syndrome, maternal thyroid disease and excessive maternal iodine intake, were excluded . They were continuously observed at toho university omori medical center or ibaraki children s hospital . The study was performed with the approval of the institutional review boards of the toho university school of medicine and ibaraki children s hospital, and informed consent for participation in this study was obtained from all the subjects parents . All exons of the tshr gene, tpo gene and duox2 gene were amplified by polymerase chain reaction (pcr) using primers described in previous reports (6,7,8,9). The purified pcr products were sequenced directly by an automated dna sequence analyzer (abi 310 autosequencer, applied biosystems, foster city, ca, usa). Basal tsh levels above 5 u / ml were considered elevated (5), and peak tsh levels after trh stimulation above 35 u / ml in infants and above 2530 u / ml in children were considered exaggerated responses (10, 11). The serum tsh level was 24.3 11.2 u / ml (n=8) during neonatal screening . The serum tsh and free t4 levels during the first visit to the hospital at 27 16 d of life were 14.3 8.0 u / ml (n=9) and 1.52 0.25 ng / dl (n=8), respectively (table 1). Four children had not received l - t4 replacement, but their thyroid functions had been evaluated every 6 to 12 mo . Although subject 8 showed normal serum tsh and t4 levels (4.19 u / ml and 10.9 g / dl, respectively) during her first visit to the hospital at 56 d of life, her serum thyroglobulin (tg) level (120 ng / ml) was slightly high . The remaining five children started l - t4 replacement during the neonatal period and stopped it after re - evaluation of thyroid function at the age of 5.5 2.2 yr . After the cessation of l - t4 replacement, their thyroid functions were evaluated every 6 mo . The initial dose of l - t4 replacement was 3.2 0.5 g / kg / d, and the dose of l - t4 replacement at cessation was 1.0 0.2 g / kg / d (table 2). No patients had a family history of thyroid diseases.table 1 subjects initial thyroid function resultssubjectsexserum tsh level at screening (u / ml)at first visit to the hospitalinitial dose of levothyroxine (l - t4) (g / kg / d)age (d)basal tsh level (u / ml)ft4 (ng / ml)tsh peak after trh stimulation (u / ml)1f42.01217.961.7190.713.42f15.41711.881.5948.762.63f14.5545.51.2nano treatment4f26.11832.781.75na3.05m14.51214.321.0952.913.86m43.41119.051.8546.623.07m20.33811.581.42nano treatment8fna564.19nanano treatment9m17.92011.81.2nano treatmentna: not available . Table 2 subjects follow - up thyroid function resultssubjectagegenetic defectbasal tsh level under no treatment (u / ml)at re - evaluationagetsh peak after trh (u / ml)dose of l - t4 (g / kg / d)16yr, 5moa single tshr mutation (r450h)3.206.004yr, 0mo43.71.028yr, 4mond1.402.806yr, 6mo21.70.938yr, 4mond2.98nano treatment48yr, 6mond2.502.607yr, 2mo18.41.359yr, 3mond2.106.605yr, 6mo29.10.8610yr, 4mond1.401.909yr, 0mo20.71.0714yr, 1mond1.206.550yr, 8mo26.9no treatment814yr, 3moa single tpo mutation (p883s)3.016.1110yr, 8mo30.2no treatment915yr, 0mond1.305.001yr, 5mo22.5no treatmentnd: not detected, na: not available . Nd: not detected, na: not available . Ultimately, subjects 1, 5, 7 and 8 were diagnosed as having subclinical hypothyroidism because of fluctuating basal tsh levels during the no treatment period and/or exaggerated tsh responses to trh simulation at re - evaluation . All subjects with subclinical hypothyroidism were negative for anti - tpo and anti - tg antibodies . Subjects 2, 4 and 6 were diagnosed as having neonatal transient hypothyroidism because they showed normal tsh responses to trh stimulation at re - evaluation and their basal tsh levels had been normal after cessation of l - t4 replacement . Subjects 3 and 9 were diagnosed as having transient hyperthyrotropinemia because they had not received l - t4 replacement and their basal tsh levels had been normal since the early infantile period . Subject 1 was heterozygous for a tshr gene mutation (r450h), and subject 8 was heterozygous for a tpo gene mutation (p883s; fig . 1 sequence analysis of a tshr gene in subject 1 (a) and a tpo gene in subject 8 (b). (a) the mutant site (g to a) is indicated by the arrow . (b) the mutant site (c to t) is indicated by the arrow . Sequence analysis of a tshr gene in subject 1 (a) and a tpo gene in subject 8 (b). (a) the mutant site (g to a) is indicated by the arrow . (b) the mutant site (c to t) is indicated by the arrow . One group consists of genes causing thyroid dysgenesis, and the other group consists of genes causing thyroid dyshormonogenesis (12). Among them, tshr, sodium iodine symporter (nis), tg, tpo and duox2 gene defects have been occasionally reported to cause mild hypothyroidism . Subjects who are heterozygous for tshr gene mutations have been reported to show various phenotypes, from euthyroid to mild hypothyroidism (13,14,15,16). Some subjects with heterozygous tshr gene mutations were identified during neonatal screening, and the others were identified in the course of evaluation for common nonspecific symptoms . Subjects with biallelic inactivating mutations of the nis gene and tg gene have also been reported to show various phenotypes, from euthyroid to severe hypothyroidism (17,18,19,20). Reported that the heterozygous carrier rate for tpo gene mutations is significantly higher in babies with neonatal transient hypothyroidism than in normal babies and suggested that the presence of heterozygous tpo gene mutations contributes to development of neonatal transient hypothyroidism (21). Several reports suggest that biallelic inactivating mutations in the duox2 gene are associated with severe and permanent congenital hypothyroidism and that heterozygous mutations of duox2 gene are associated with neonatal transient hypothyroidism (9, 22). However, maruo et al . Reported that subjects with compound heterozygous duox2 mutations detected during neonatal screening also showed transient hypothyroidism (23). In the present study, the tshr, tpo and duox2 genes were analyzed because monoallelic mutations of these genes might cause transient neonatal thyroid dysfunction . Two of nine children with transient thyroid dysfunction or subclinical hypothyroidism detected during neonatal screening had heterozygous gene mutations, one for a tshr gene (r450h) and one for a tpo gene (p883s). The r450h mutation of the tshr gene is common in japan (15), and the p883s mutation of the tpo gene has been reported in japanese patients (24). Since nis and tg genes were not analyzed in the present study, some of the remaining seven children may have had mutations of these two genes . Although further examinations are necessary, genetic background may contribute to development of the transient thyroid dysfunction and subclinical hypothyroidism detected during neonatal screening . Thyroid function is influenced by several factors, such as general condition, age and amount of iodine intake . It is well known that patients with subclinical hypothyroidism can develop overt hypothyroidism during puberty and pregnancy due to the increase in thyroid hormone requirement . However, large amounts of iodine intake have been reported to cover the development of hypothyroidism in patients with biallelic inactivating mutations of the nis and duox2 genes (17, 25). Moreover, it has been reported that, if left untreated, goiters caused by elevated tsh stimulation in patients with defects of the tpo gene and tg gene are prone to development into thyroid cancer (26, 27). Therefore, it is important to continue long - term follow - up of children with transient thyroid dysfunction and subclinical hypothyroidism detected during neonatal screening to avoid missing the development of overt hypothyroidism and goiters, given that they may have background gene defects . In conclusion, two of the nine screening - positive children who had not received l - t4 replacement or had been able to stop the treatment had genetic mutations . It is possible that genetic background contributes to the development of transient thyroid dysfunction and subclinical hypothyroidism detected during neonatal screening . Therefore, long - term follow - up of screening - positive children is required.
|
Forward head posture (fhp) is a commonly noted abnormal neck posture in students who carry heavy loads or maintain a sitting posture for long periods1,2,3 . Fhp is defined as the hyperextension of the upper cervical and a forward translation of the cervical vertebrae4 . Fhp increases the compressive loading on tissues in the cervical spine, particularly the facet joints, and stress on the ligaments4, 5 . Also, fhp can induce neck pain and increase electromyographic activity in the neck muscles4, 6 . For these reasons, fhp is known to lead not only to neck pain but also to changes in cervical movement patterns7, 8 . Alterations in cervical spine movement can provide clinicians with information that assists assessment and treatment and in monitoring the efficacy of rehabilitation programs in fhp populations1, 9, 10 . In particular, the neck rotation test is often performed for evaluation of cervical spine dysfunction7 . For the neck rotation test, the subject is asked to maximally rotate the head by turning to one side, left or right, in a sitting position11 . Comerford and mottram11 stated that generating lateral flexion motion during neck rotation can cause dysfunction and pain in the cervical spine . Thus, to prevent unwanted cervical lateral flexion during cervical rotation, many clinicians and researchers emphasize cervical axial rotation so as not to complicate rotation with other neck motions, such as flexion, extension, and lateral flexion12, 13 . Cervical axial rotation along the longitudinal axis is considered clinically important for painless neck motion14 . For precise cervical axial rotation, it is necessary to properly control the activation of the neck muscles11, 15, 16 . However, precise neck movements in fhp populations are typically difficult because they have problems with alterations in the length and activation of the neck muscles8, 17 . The primary problems in fhp are shortening and hyperactivation of the sternocleidomastoid (scm) muscle7, 8, 18 . The scm muscle acts in neck rotation and lateral flexion as well as in neck flexion . However, many previous studies of fhp and scm muscles have focused largely on movements in the sagittal plane, such as flexion and extension1, 5, 10 . Also, movements in the frontal plane, which involve hyperactivation of the scm muscles, have been overlooked in patients with fhp . Although patients with fhp may be exposed to neck pain caused by hyperactivation of the scm muscles, to our knowledge, kinematic analysis of lateral flexion movement patterns of subjects with fhp during neck rotation has not been reported . Repeated cervical lateral flexion and translation motions due to fhp posture that occur during cervical rotation in a sitting position or in activities of daily life may cause tissue microtrauma, overuse syndrome, mechanical dysfunction, and development of pain in the cervical spine12, 19 . For this reason, it is important to understand the kinematics of lateral flexion movement patterns and scm muscle activation during neck rotation in subjects with fhp . Furthermore, although the neck rotation test is commonly used to evaluate cervical motion in the sagittal plane, there is potential for using this test for evaluating motion in the frontal plane as part of a clinical evaluation for neck problems in subjects with fhp . Thus, the aims of this study were to compare 1) the rotation - lateral flexion ratio, 2) the lateral flexion movement onset time, 3) the rotation and lateral flexion angles, and 4) the muscle activation of scm between individuals with fhp and controls during neck rotation . We hypothesized that 1) the rotation - lateral flexion ratios would be higher, 2) the lateral flexion movement onset time would be earlier, and 3) the rotation and lateral flexion angle values would be higher during neck rotation in the fhp group; we also hypothesized that 4) the scm muscles would be more highly activated during maintenance of end - range neck rotation in both directions in the fhp group than in control subjects . In total, 28 subjects were recruited from university students in korea (14 control students, 14 fhp students). Subjects were recruited into the fhp group if they had a forward translated neck alignment; the fhp group was selected by evaluating the horizontal distance from a vertical line through the lobe of the ear and the acromion process in the sagittal plane (fhp 5 cm)20 . Additionally, to classify the groups, the cranio - vertebral angle (cva) was measured in all subjects . The intra - class correlation coefficient (icc) of the cva measurement method has been reported to be high (icc = 0.88)21 . Exclusion criteria included past or present spinal canal stenosis, rheumatoid arthritis, and vestibulobasilar insufficiency . Before the experiment, we explained all procedures and the purpose of the study to the subjects in detail . All subjects signed an informed consent form, which was approved by the inje university college of health science human studies committee . In all sessions, the kinematics were recorded using a three - dimensional ultrasound - based motion analysis system and muscle activity was measured using electromyography . Data collection using the two systems occurred simultaneously so that data were synchronized for a more complete and valid analysis . A three - dimensional ultrasound - based motion analysis system (zebris cms20, zebris meditechnic gmbh, isny, germany) was used to collect kinematic data . Two components of ultrasound triple markers, one installed on the apex of the head and another attached to the right lateral shoulder, were fixed to accept real time neck motion data via a transducer sensor, which consisted of three microphones . The transducer sensor was placed perpendicular and to the right of the subject at a distance of 1 m. the preferred neck position was set at zero based on the starting position before each test . The kinematic data - sampling rate was 20 hz . For measurement of neck movements, the icc for intra - session test - retest reliability had been previously established as 0.730.90, as well as inter - session reliability of 0.430.6822 . Rotation and the lateral flexion angle of the neck were recorded in real time during neck rotation to identify the ratio of rotation to lateral flexion movements to the ipsilateral or contralateral side . The collected kinematic raw data were converted to ascii files for analysis . The movement onset time and the motion of the neck the point exceeding a threshold angle of 1 was defined as the onset time of neck movement23 . The mean value of three trials was analyzed to determine onset time and rotation - lateral flexion movement patterns during neck rotation . Finally, the rotation - lateral flexion ratio was calculated as the lateral flexion angle divided by the rotation angle, multiplied by 100 . Electromyographic (emg) signals from the scm muscles were recorded and analyzed using a surface electromyography system (mp150, biopac systems, inc ., santa barbara, ca, usa). Skin preparation at the attachment sites consisted of shaving and cleaning the skin with an alcohol swab . Emg data were recorded from the scm muscle (1/3 of the distance from the sternal notch to the mastoid process, parallel and over the muscle belly)24 . (20450 hz) and a band - stop filter (60 hz) were used . Raw data were transformed into the root mean square with a window of 50 ms . For normalization, muscle contraction reference data were collected while the subject performed two maximal voluntary isometric contraction (mvic) trials over a 5-s period in a manual scm muscle testing position4 . The average value of the middle 3 s of the 5-s trial was used, and the average of two trials was calculated for normalization . During the maintenance phase, the average emg data from the middle 3 s of the 5-s measurement were used to compare the fhp and control groups . Neck and trunk postures were not adjusted, and the usual posture of each subject was maintained throughout the experiment . Subjects were strapped to the chair to minimize compensation by trunk motion during the test . Before the test, each subject was instructed to perform neck rotation in the preferred rotation range in two directions (left and right) randomly to identify end range of motion . Neck rotation end range was defined as maximum range through which each subject could actively rotate his / her cervical spine in each direction . Once end range of motion was established, the neck rotation test was repeated three times in each direction . The initial direction of neck rotation test was randomized, and a 1-min rest was allowed between trials . To minimize differences in vestibular function during the neck rotation, each subject conducted the neck rotation for 6 s (rotation phase) at a speed of <15/s25 and maintained the end - range position for 5 s (maintenance phase), all timed using a metronome . Differences in the rotation - lateral flexion ratio, rotation angle, lateral flexion angle, scm activation, and subject demographic in each direction between subjects with and without fhp was evaluated using independent t - tests . The spss statistical package (ver . 18.0, spss, chicago, il, usa) was used for all statistical analyses and a p - value 0.05 was considered to indicate statistical significance . Subjects in the two groups were of similar age, height, and weight (p> 0.05). The forward head distance was significantly increased in the fhp group compared with the control group (p <0.05). The results of the kinematic analyses are presented in table 1table 1.rotation-lateral flexion movement patterns, mean (sd), during neck rotation to the left and right between two groupsdirectioncontrol group(n = 14)fhp groupn = 14)rotation - lateral flexion ratio (%) left10.01 (5.11)13.46 (10.92)right6.43 (3.58)6.81 (4.80)rotation angle ()left52.15 (7.12)62.72 (6.94)right51.58 (7.90)59.45 (7.35)lateral flexion angle ()left3.39 (1.95)6.22 (3.01)right3.46 (2.55)7.97 (6.21)lateral flexion onset time (s)left1.68 (0.79)1.04 (0.45)right1.54 (0.75)0.88 (0.39)fhp: forward head posture; sd: standard deviation . * p <0.05, all of which were significantly different between the fhp and control groups (p <0.05). The rotation - lateral flexion ratio was higher in both directions in the fhp group than that in the control group . At end range neck rotation, the fhp group showed rotation angle was greater by approximately 810 degrees than the control group, respectively . Also, lateral flexion angle in fhp group was greater by 34 degrees than in control group . In addition, the onset of lateral flexion movement during neck rotation of all directions in the fhp group occurred up to about one second earlier than in control group (p <0.05). Fhp: forward head posture; sd: standard deviation . * p <0.05 with regard to electromyography of the scm muscles during neck rotation in both directions, the activity in the contralateral scm muscles was greater in subjects with than in those without fhp (p <0.05) (table 2table 2.muscle activation as a percentage of the maximum voluntary isometric contraction (% mvic) during neck rotation to the left and right between the two groups (n = 28)directionmusclemuscle activation (% mvic)control group mean (sd)fhp group mean (sd)left rotationleft scm2.88 (1.35)3.52 (2.08)right scm16.90 (7.74)29.21 (14.69)right rotationleft scm18.29 (6.38)34.78 (21.48)right scm4.39 (2.17)3.32 (1.69)fhp: forward head posture; sd: standard deviation . * many researchers emphasize correct neck motion to minimize dysfunction in the adjacent structures of the cervical spine17, 26 . Although fhp is a common physical finding in persons with malalignment of the neck, to our knowledge, there have not been any publications investigating variations in neck kinematics in fhp during neck rotation3, 27, 28 . Here, we investigated rotation - lateral flexion movement patterns and scm activation during neck rotation in fhp and control subjects . Our data suggest differences in the rotation - lateral flexion movement patterns and activation of scm muscles between the fhp and control groups during neck rotation . The data showed relatively less axial neck rotation in the fhp group than in the control group . This may be because long - duration fhp maintenance induces alterations in cervical motor control and muscle imbalance of the neck muscles, such as the scm . Faulty alignment, neck muscle imbalances, and alteration of motor control of the cervical spine have been reported to contribute to neck movements5, 6, 8, 18 . Also, no other axial neck rotation could induce repetitive translation motion in the transverse plane in the cervical spine as often as neck rotation, and translation motion can induce cervical instability12 and spinal disorders31 . The scm muscles of subjects with fhp showed greater imbalance between the left and right muscles compared with the control group . This may be because the scm muscles in the fhp group are hyperactive during neck motion due to changes in the condition of the neck muscles caused by maintaining a faulty posture such as fhp . The muscle imbalance induced by fhp can result in decreased muscular efficiency and increased activation of the additional muscles needed to maintain neck and head posture29 . As a result, subjects with fhp used contralateral scm muscles to a greater extent during neck rotation than did the control subjects . These kinematics and emg data show that subjects with fhp have different pattern of neck movement and scm activation than those without fhp . These aspects may indicate that global muscles, such as the scm, are being used instead of local muscles during neck rotation . Global muscles are known to function as musculature for multi - segmental joints, and they generate large movements rather than precise movements7, 8, 17 . Thus, excessive activation of scm - controlled lateral flexion during neck rotation occurred significantly more in people with fhp than in control subjects . Although statistical significance does not necessarily imply clinical significance, clinicians may recognize the clinical implications of these findings for preventing neck problems in fhp patients . Neck rotation tests can be used to assess movement of the cervical spine7, 11 . However, many clinicians overlook motion in the frontal plane and examine only movement in the sagittal plane in fhp1, 32, 33 . Thus, it should be recommended that clinicians examine lateral flexion in the frontal plane when assessing and treating patients with fhp . In this study, the angle of rotation in the fhp group was significantly higher than that in the control group . However, a previous study demonstrated that subjects with fhp had a decreased range of motion of neck rotation compared with the control group30; this differs from our findings . It is possible that the subjects with fhp in this study may have compensated for the decreased range of neck motion by lateral flexion the neck . This may have resulted in our overlooking differences in the direction of lateral flexion movements during preferred neck rotation . In future research, the direction of lateral flexion movement generated during neck rotation should be identified and considered within the interpretation of the results . Second, our results cannot be generalized to other age groups because all subjects were university students . Finally, we did not measure emg activity in the intrinsic neck rotator muscles . Our results demonstrate that neck rotation in subjects with fhp is characterized by lateral flexion in addition to axial rotation compared with subjects without fhp . The clinical importance of this study lies in its confirmation of often - overlooked neck movement in the frontal plane and the provision of baseline data for future clinical interventions concerning lateral flexion in subjects with fhp . Additionally, significant differences in activation patterns of the scm muscles were noted in individuals with fhp, specifically with increased recruitment on the contralateral side during movement . Assessment of neck rotation movement in patients with fhp should take into consideration lateral flexion in the frontal plane and contralateral scm activation.
|
Cysteine point mutations for residues were introduced via the quikchange mutagenesis kit (stratagene) using a human p2x2 receptor or rat p2x4-myc (y378a) plasmid as the template . Human p2x2 receptor plasmid (gift of dr . Andrew powell, glaxosmithkline, united kingdom) contained the sequence of the p2x2a isoform (q9ubl9) with the nh2-terminal variant maaaqpkypagata mv as described.4 for the rat p2x4-myc (gift of dr . Francois rassendren, cnrs, montpellier, france), the mutant y378a was created and used as the template for more stable currents (21). Production of the correct mutations and absence of coding errors in the p2x2 and p2x4 mutant constructs was verified by dna sequencing (automated abi sequencing service, university of leicester). Expression in xenopus laevis oocytes wild type and mutant constructs were transcribed to produce sense strand crna (mmessage mmachine, ambion, tx) as described previously (22). Manually defoliculated stage v x. laevis oocytes were injected with 50 nl (50 ng) of crna using an inject+matic microinjector (j. alejandro gaby, genva, switzerland) and stored at 18 c in nd96 buffer (96 mm nacl, 2 mm kcl, 1.8 mm cacl2, 1 mm mgcl2, 5 mm sodium pyruvate, 5 mm hepes, ph 7.6). Electrophysiological recordings two - electrode voltage clamp recordings (at a holding potential of 60 mv) were carried out on crna - injected oocytes using a geneclamp 500b amplifier with a digidata 1322 analog to digital converter and pclamp 8.2 acquisition software (axon instruments) as previously described (22). Native oocyte calcium - activated chloride currents in response to p2x receptor stimulation were reduced by replacing 1.8 mm cacl2 with 1.8 mm bacl2 in the nd96 bath solution . Atp (magnesium salt, sigma) was applied via a u - tube perfusion system . Atp (0.1 m to 10 mm) was applied at 5-min intervals, using this regime reproducible atp - evoked responses were recorded . Individual concentration - response curves were fitted with the hill equation: y = [(x) m]/[(x) + (ec50)], where y is response, x is agonist concentration, h is the hill coefficient, m is maximum response, and ec50 is the concentration of agonist evoking 50% of the maximum response . Mutants that had considerably shifted atp potency were tested with atp concentrations up to 10 mm . For the calculation of ec50 values individual concentration - response curves were generated for each experiment and statistical analysis carried out on the pec50 data generated . In the figures, characterization of the effects of methanethiosulfonate compounds to study the effect of mts compounds on atp activation at wild type and cysteine mutants, atp (ec50 concentration) was applied and either mtsea or sodium (2-sulfonatoethyl)methanethiosulfonate (mtses) (toronto research chemicals, toronto, canada) were bath - perfused (for at least 5 min; the recovery time required between application to see reproducible responses) prior to coapplication with atp via the u - tube as described previously (15, 16). Mts reagents (1 mm) were made in nd96 solution immediately prior to use . Mts reagents were applied for 10 min with the maximal, or near maximal response seen after 5 min . The effects of the mts reagents on the p2x2 receptor mutants were the same following washout of the compounds showing that they irreversibly modified the receptors . The effects of the mts compounds on the mutant p2x4 receptors were reversible following a 510 min washout . The p2x4 receptor has been shown to be subject to extensive constitutive and agonist induced trafficking (23) even for the y378a mutant used in this study (21, 24). To determine whether longer incubations could be used to irreversibly modify p2x4 mutant receptors we treated the oocytes for 3 h in the presence of mtses (1 mm) and 3.2 units / ml of apyrase to break down any endogenous atp, or just apyrase . This was followed by washing and subsequent testing of responses to an ec50 concentration of atp (in the absence of mtses). This treatment had no effect on the amplitude of wt p2x4 receptor currents, however, reductions of the mutants were equivalent to those where mtses was present during the recordings demonstrating that any changes in properties for the mutant receptors result from irreversible modification of introduced cysteine residues and that cysteine residues were available in the resting un - liganded state of the receptor . Mts reagents have a reasonably short half - life and this suggests that the 1 mm concentration used is supramaximal and there was still sufficient reagent present during the 3-h incubation to irreversibly modify the receptors . These results suggest that the reversal of mts effects following washout of short applications is likely to result from trafficking of un - modified receptors to the cell surface and longer incubations are required to irreversibly modify the whole pool of p2x4 mutant receptors . We have therefore presented data for effects on an ec50 concentration of atp during the presence of the mts reagents as this allows us to analyze data from the same oocyte before and during application of the reagents . The effects of mts reagents on the concentration responses to atp for p2x2 receptors were investigated following washout of mtsea (applied at 1 mm for 10 min in the absence of agonist), there was no effect on wt responses . For p2x4 receptors the effects of mtsea on concentration responses were investigated by application of atp following incubating the oocytes for 1 h in mtsea (1 mm) and washout of mtsea . Atp concentrations were applied via the u - tube with nd96 bathing solution (no mts reagents present). Western blotting expression levels of wild type and mutant receptors were estimated by western blot analysis of total cellular protein and cell surface proteins . Total cellular protein samples were prepared from oocytes injected with wild type or mutant receptor crna homogenized in buffer h (100 mm nacl, 20 mm tris - cl, ph 7.4, 1% triton x-100, and 10 l / ml protease inhibitor mixture) at 20 l / oocyte . Sulfo - nhs - lc - biotin (pierce) labels cell surface proteins by reacting with primary amines and was used to estimate the level of wild type or mutant receptor trafficked to the cell surface membrane . Sulfo - nhs - lc - biotin is impermeable to the cell membrane and can only biotinylate proteins available at the cell surface . Oocytes injected with wild type or mutant receptor crna were treated with sulfo - nhs - lc - biotin (0.5 mg / ml) in nd96 for 30 min and washed with nd96 . Oocytes were homogenized in buffer h, and the spin - cleared supernatant was mixed with streptavidin - agarose beads (sigma) treated as described previously (25). All samples were mixed with sds sample buffer and heated to 95 c for 5 min prior to loading . Samples were run on a 10% sds - page gel, transferred to nitrocellulose, and screened for immunoreactivity for the anti - p2x2 or p2x4 antibody (1:500) (alomone, israel) significant differences between wt and mutant maximum current amplitudes, agonist potency, and mts reagent modification were calculated by one - way analysis of variance followed by dunnett's test for comparisons of individual mutants against control using the graphpad prism package . Differences in mutant concentration response curves for individual mutants, on treatment with mtsea, were tested with student's t test . Effects of cysteine mutants on atp responses at p2x2 receptors at wt human p2x2 receptors atp evoked concentration - dependent inward currents with an ec50 of 13 m (fig . 2 and table 1) similar to that reported previously for this receptor (14, 15, 26). Robust currents were also recorded for f183c, t184c, and f289c mutants, however, they showed a modest 410-fold decrease in atp potency (fig . The peak amplitude of currents to a maximal concentration of atp (10 mm) were reduced by 90% for the mutant r290c and for this receptor the amplitude of responses continued to increase between 3 and 10 mm indicating the ec50 is> 3 mm atp . At mutants n288c and k307c 10 mm atp evoked very small currents suggesting that the ec50 for these receptors is> 3 mm . No currents were recorded in response to 10 mm atp for mutants k69c and k71c . Analysis of the expression of both total and surface levels of p2x2 wt and mutant receptors with reduced peak current amplitudes showed that there was at most an 50% reduction in surface expression (k307c), predicting a halving in peak current amplitude, however, there was a> 97% reduction in amplitudes for k69c, k71c, and n288c . This indicates that any reductions in current amplitude compared with wt were predominantly due to an effect on channel properties and not trafficking to the cell surface . Overall these results are consistent with those from similar mutants for the p2x1 receptor (12). Table 1summary of the effects of cysteine substitution on p2x2 and p2x4peak current values taken on 1st application of a maximal concentration of atp (a saturating concentration 300 m to 10 mm). Mts data (effect of atp applied in the presence of mts reagent) calculated as a percentage of the control (effect of atp applied in the absence of mts reagent) which was set as 100%.na (max)ec50pec50mtseamtseshuman p2x2 wt 4465 477 13 m 4.89 0.1 127 2% 101 3% k69c nfa nf nf no effect no effect k71c nf nf nf no effect no effect f183c 4661 1209 40 m 4.40 0.1b 128 2% 96 1% t184c 4515 1402 117 m 3.93 0.1c 195 11%d 20 3%c n288c 13 2b> 3 mm <2.52 22 5%b 21 3%c f289c 2279 583 64 m 4.19 0.1c 123 11% 78 11%d r290c 525 70d> 3 mm <2.52 1237 249%c 27 7%c k307c 49 20c> 3 mm <2.52 27500 6660%c 15 1%crat p2x4-myc (y378a) wt 2513 187 13 m 4.89 0.02 103 11% 108 6% k67c 66 21d nde nd 2076 485%c 15 4%c k69c 821 146> 3 mm <2.52 350 50%c 1 1%c f185c 587 224 265 m 3.58 0.07c 93 7% 95 2% t186c 1706 425 650 m 3.19 0.04c 35 6%d 8 3%c n293c 521 164> 3 mm <2.52 6 1%c 2 1canf, nonfunctional.bp <0.01, n = 3-18.cp <0.001, n = 3-18.dp <0.05, n = 3-18.end, not determined . Summary of the effects of cysteine substitution on p2x2 and p2x4 peak current values taken on 1st application of a maximal concentration of atp (a saturating concentration 300 m to 10 mm). Mts data (effect of atp applied in the presence of mts reagent) calculated as a percentage of the control (effect of atp applied in the absence of mts reagent) which was set as 100% . Atp potency was tested on wt and p2x2 receptor mutants expressed in oocytes by two - electrode voltage clamp (holding potential = 60 mv). A, trace data representative of currents observed for wild type and mutant receptors in response to atp applications (indicated by the bar, concentrations in micromolar) at 5-min intervals . B, concentration - response curves to atp for wt and mutants k69c, k71c, f183c, t184c, n288c, f289c, r290c, and k307c . K69c, k71c, n288c, and k307c with reduced peak currents in response to a maximal concentration of atp, are expressed as a percentage of the amplitude of the wt maximum response, whereas all others are expressed as a percentage of their own maximum response (n = 310). C, western blots of total and surface expression levels of wt and mutant p2x2 receptors with reduced peak current amplitudes . Lower panel shows densitometric analysis of the blots expressed as% of wt levels . Atp potency was tested on wt and p2x2 receptor mutants expressed in oocytes by two - electrode voltage clamp (holding potential = 60 mv). A, trace data representative of currents observed for wild type and mutant receptors in response to atp applications (indicated by the bar, concentrations in micromolar) at 5-min intervals . B, concentration - response curves to atp for wt and mutants k69c, k71c, f183c, t184c, n288c, f289c, r290c, and k307c . K69c, k71c, n288c, and k307c with reduced peak currents in response to a maximal concentration of atp, are expressed as a percentage of the amplitude of the wt maximum response, whereas all others are expressed as a percentage of their own maximum response (n = 310). C, western blots of total and surface expression levels of wt and mutant p2x2 receptors with reduced peak current amplitudes . Effects of mts reagents on cysteine mutant p2x2 receptors at p2x receptors the 10 conserved cysteine residues in the extracellular domain are thought to form five intrasubunit disulfide bonds (25, 27). The substituted cysteine accessibility method has been used to look at the contribution of introduced cysteine mutants to receptor function, where modification of properties following application of mts reagents indicates that the introduced cysteine residue is accessible in the aqueous environment and may play an important role in receptor function (28). Previously, charged mts reagents (positively charged mtsea and negatively charged sodium mtses), have been used to probe residues involved in atp action at p2x receptors (15, 16) as they may interact with the negative charge of the phosphate tail of atp or magnesium complexed with atp in physiological solutions giving rise to localized positive charge . At wt p2x2 receptors mtsea (1 mm) produced a small increase (128 3% of control) in the response to an ec50 concentration of atp (table 1, fig . Mtsea had no effect on the potency of atp and current amplitudes returned to control levels on washout . Mtsea had a similar effect at f183c and f289c mutant p2x2 receptors (table 1, fig . There was an increase in potentiation to 195 11% of control, however, on washout this was reduced to 141 11% of control indicating that it results from a combination of the reversible effect seen for wt and an additional irreversible modification . R290c and k307c mtsea produced a significantly larger increase in the response to an ec50 concentration of atp (table 1, fig . 3) that was sustained on washout indicating that it results from irreversible modification of the introduced cysteine . At r290c the amplitude of responses was still rising in response to increases from 3 to 10 mm atp, indicating a large decrease in atp sensitivity at this mutant . Mtsea application for 10 min in the absence of agonist resulted in a large increase in amplitude of responses and a leftward shift in the concentration response to atp and now a fully saturating concentration response was generated following mtsea treatment (pec50 values 2.8 0.1, estimated from a free fit as responses did not saturate for control, to 3.3 0.2, p <0.01, for mtsea, n = 34) (fig . Responses to a high concentration of atp (10 mm) were small (50 na) for the k307c mutant and responses were below the limit of detection for 1 mm atp, however, following a 10-min mtsea treatment (and washout) there was a very large increase in the amplitude of responses and the pec50 for atp in the presence of mtsea was 3.5 0.1 (n = 7). As mtsea was able to rescue the responses to mutants with small amplitude currents we tested whether mtsea had any effect on mutants where receptor protein could be detected at the cell surface but little or no current was detected in response to high concentrations of atp . At n288c the responses to atp (3 mm) were reduced to 22 5% of control following mtsea treatment, this effect was sustained on mtsea washout . For mutants k69c and k71c, atp - evoked currents were still not detected following mtsea treatment . The negatively charged mts reagent mtses (1 mm) had no effect on currents at wt p2x2 receptors (table 1, fig . Similarly mtses had no effect on atp responses at f183c mutant p2x2 receptors (table 1, fig . Mtses, however, reduced the amplitude of response to an ec50 concentration of atp by 80% for mutants t184c, n288c, r290c, and k307c, a more modest 20% decrease was recorded at f289c (table 1, fig . These effects were maintained following washout of mtses indicating that the reagent was acting irreversibly to modify the introduced cysteine residues . For non - functional mutants k69c and k71c in the presence of mtses, 3 mm atp still did not evoke a response . Effects of cysteine mutants on atp responses at p2x4 receptors the myc - tagged rat p2x4 receptor with the y378a mutation was used as the background for these studies . The y378a mutation was introduced to improve surface expression of the receptor (21) and increased the peak amplitude of atp currents by> 2050-fold in the present study . Atp evoked concentration - dependent responses at the rat p2x4-myc y378c receptor with an ec50 of 13 m (table 1, fig . 5) similar to that reported previously for rat p2x4 receptors (2931) and this construct will be referred to as p2x4 wt . For f185c, t186c, and f294c mutants full concentration - response curves were generated and the ec50 for atp was increased by 20-, 50-, and 4-fold, respectively (table 1, fig . 5). For the remaining mutants (k67c, k69c, n293c, r295c, and k313c) atp - evoked responses did not saturate at the maximum concentration tested (10 mm) and for these mutants the atp ec50 is reported as> 3 mm (table 1, fig . Mutants k67c, r295c, and k313c had reduced maximal current amplitudes compared with wt, however, this was not reflected by a marked reduction in either total or surface expression of the receptors (fig . 4c). For the mutant n293c the smaller peak current amplitudes may result in part from a reduction in trafficking of the receptor to the cell surface (fig . Effects of mts reagents on cysteine mutant p2x4 receptors positively charged mtsea (1 mm) had no effect on atp - evoked currents at wt p2x4 receptors (table 1, fig . Atp - evoked responses were also unaffected by mtsea for the mutants of the conserved aromatic phenylalanine residues f185c and f294c (table 1, fig . 6). At t186c and r295c, responses evoked by an ec50 concentration of atp were reduced to 40% of control levels and at mutant n293c responses were reduced by 95% (table 1, fig . In contrast, at mutants where a positively charged lysine residue was mutated to cysteine (lys, lys, and lys) application of mtsea potentiated the amplitude of the atp response (table 1, fig . . A, trace data representative of currents observed before and during the addition of mtsea (1 mm). Mtsea reagent was bath applied 5 min prior to u - tube atp coapplication with mtsea . B, graph representing the effect of mtsea on the p2x2 wt and mutant receptors (n = 36). C, trace data representative of currents observed with the addition of mtses (1 mm). Mtses reagent applied in a similar manner to mtsea traces are shown for a given oocyte before and during mtses application . D, graph representing the effect of mtses on the p2x2 wt and mutant receptors (n = 36). *, p <0.05; * *, p <0.01; * * *, p <. A, trace data representative of currents observed before and during the addition of mtsea (1 mm). Mtsea reagent was bath applied 5 min prior to u - tube atp coapplication with mtsea . B, graph representing the effect of mtsea on the p2x2 wt and mutant receptors (n = 36). C, trace data representative of currents observed with the addition of mtses (1 mm). Atp application (ec50 concentration) is indicated by the bar . Mtses reagent applied in a similar manner to mtsea traces are shown for a given oocyte before and during mtses application . D, graph representing the effect of mtses on the p2x2 wt and mutant receptors (n = 36). *, p <0.05; * *, p <0.01; * * *, p <0.001 . A, atp concentration - response curve for r290c under control conditions or following washout of mtsea after a 10-min incubation with mtsea (1 mm)(n = 34). B, atp concentration - response curve for k307c under control conditions or following washout of mtsea after a 10-min incubation with mtsea (1 mm)(n = 36). The data are expressed as a percentage of the amplitude of the response to 3 mm atp under control conditions . A, atp concentration - response curve for r290c under control conditions or following washout of mtsea after a 10-min incubation with mtsea (1 mm)(n = 34). B, atp concentration - response curve for k307c under control conditions or following washout of mtsea after a 10-min incubation with mtsea (1 mm)(n = 36). The data are expressed as a percentage of the amplitude of the response to 3 mm atp under control conditions . The application of negatively charged mtses (1 mm) had no effect on the amplitude of atp evoked responses at wt or f185c and f294c mutant p2x4 receptors (table 1, fig . 6). At the remainder of the mutants (k67c, k69c, t186c, n293c, r295c, and k313c) mtses reduced the amplitude of atp evoked responses by 8095% . These results suggest that the negative charge at this position interferes with the action of atp possibly by repelling the negatively charged phosphate tail . These effects of mtsea and mtses are broadly consistent for both the p2x2 and p2x4 receptors . However, in contrast to the p2x2 receptor the effects of mts reagents were reversible on washout (showing 50100% recovery following 5 min washout) indicating that either the reagent was not irreversibly modifying the receptor or that un - modified receptors were being trafficked to the cell surface during the washout period . It is known that p2x4 receptors undergo cyclical trafficking to the cell surface (21, 23, 24) so we decided to see whether longer incubation with the mts reagents had an irreversible effect . In addition, as the mts reagents were applied before and during atp application the question arises as to whether the introduced cysteines are accessible in the un - liganded or ligand bound state . To address these questions we incubated mutant p2x4 receptors in membrane impermeant mtses (1 mm) in the presence of apyrase (3.2 units / ml to break down any endogenous atp in the solutions) for 3 h followed by washing . This treatment had no effect on the amplitude of wt p2x4 receptors compared with oocytes treated with just apyrase . For the mutants, however, there was a significant reduction in the amplitude of responses for the mutants k67c, k69c, t186c, n293c, r295c, and k313c (8 1, 10 3, 10 3, 35 8, 25 6, and 17 4.7% of atp responses following apyrase treatment only and washing, with p <0.01, 0.001, 0.005, 0.005, 0.005, 0.01, respectively, n = 47). These results show that longer incubations with mts reagents are required to irreversibly modify the receptors, give equivalent results to bath - applied mtses, and suggest that washout following short applications of mts reagents (510 min) results from trafficking of un - modified mutant p2x4 receptors to the cell surface . These results also demonstrate that these introduced cysteine residues are accessible in the absence of agonist . This is consistent with previous studies on the p2x2 receptor indicating that mts effects at the region around lys and lys are blocked by atp (15) and mtsea biotinylation studies on the p2x1 receptor showing that mutants n290c, f291c, r292c, and k309c are mtsea biotinylated in the absence of atp and this is reduced following application of atp (16). Taken together these results show that the mts reagents are acting at introduced cysteine residues that are accessible in the absence of ligand . Atp potency was tested on wt and p2x4 receptor mutants expressed in oocytes by two - electrode voltage clamp (holding potential = 60 mv). A, trace data representative of currents observed for wild type and mutant receptors in response to atp applications (indicated by bar, concentration in micromolar) at 5-min intervals . B, concentration - response curves to atp for wt and mutants k67c, k69c, f185c, t186c, n293c, f294c, r295c, and k313c . K67c, k69c, n293c, r295c, and k313c, with reduced peak currents in response to a maximal concentration of atp, are all expressed as a percentage of peak wt maximum response whereas, all others are expressed as a percentage of their own maximum response (n = 34). C, western blots of total and surface expression levels of wt and mutant p2x4 receptors with reduced peak current amplitudes . Lower panel shows densitometric analysis of the blots expressed as% of wt levels . Atp potency was tested on wt and p2x4 receptor mutants expressed in oocytes by two - electrode voltage clamp (holding potential = 60 mv). A, trace data representative of currents observed for wild type and mutant receptors in response to atp applications (indicated by bar, concentration in micromolar) at 5-min intervals . B, concentration - response curves to atp for wt and mutants k67c, k69c, f185c, t186c, n293c, f294c, r295c, and k313c . K67c, k69c, n293c, r295c, and k313c, with reduced peak currents in response to a maximal concentration of atp, are all expressed as a percentage of peak wt maximum response whereas, all others are expressed as a percentage of their own maximum response (n = 34). C, western blots of total and surface expression levels of wt and mutant p2x4 receptors with reduced peak current amplitudes . Lower panel shows densitometric analysis of the blots expressed as% of wt levels . For mutants k67c, k69c, and k313, where mtsea resulted in an increase in the amplitude of the response to atp we constructed concentration - response curves following application of mtsea . We found that incubation with membrane - permeant mtsea for 1 h (in the absence of agonist) followed by washout and testing of atp sensitivity in the absence of mtsea resulted in an increase in atp potency at the receptors with pec50 values of 3.61 0.24, 3.95 0.09, and 3.63 0.16 for k67c, k69c, and k313c, respectively (n = 4, 3, and 3) (fig . 7). These results suggest that positive charge at these positions plays an important role in determining atp potency . The aim of this study was to determine whether a model of the atp binding site based on systematic mutagenesis studies on the p2x1 receptor could be applied, using cysteine - based mutagenesis, to other p2x receptor family members, and to extend this to see if the actions of atp could be modified in a similar way by mts reagents . The data for the effects of cysteine mutants on atp potency at p2x2 and p2x4 receptors support previous work about residues involved in atp action . . A, trace data representative of currents observed on the addition of mtsea (1 mm). Mtsea reagent was bath applied 5 min prior to u - tube atp coapplication with mtsea . Traces are shown in response to atp for a given oocyte before and during the application of mtsea . B, graph representing the effect of mtsea on the p2x4 wt and mutant receptors (n = 38). C, trace data representative of currents observed on the addition of mtses (1 mm). Traces are shown in response to atp for a given oocyte before and during the application of mtses . D, graph representing the effect of mtses on the p2x4 wt and mutant receptors (n = 36). *, p <0.05; * *, p <0.01; * * *, p <. A, trace data representative of currents observed on the addition of mtsea (1 mm). Mtsea reagent was bath applied 5 min prior to u - tube atp coapplication with mtsea . Traces are shown in response to atp for a given oocyte before and during the application of mtsea . B, graph representing the effect of mtsea on the p2x4 wt and mutant receptors (n = 38). C, trace data representative of currents observed on the addition of mtses (1 mm). Traces are shown in response to atp for a given oocyte before and during the application of mtses . D, graph representing the effect of mtses on the p2x4 wt and mutant receptors (n = 36). *, p <0.05; * *, p <0.01; * * *, p <0.001 . There are three conserved lysine residues in the extracellular domain that have been suggested to be involved in atp binding at p2x receptors . Mutagenesis of these residues has shown a marked decrease in agonist potency at a variety of receptors with the majority of the mutations resulting in a shift in ec50 to> 3 mm and in some cases, e.g. P2x2 receptors, currents are below the limit of detection even at high agonist concentrations (15). At p2x4 receptors atp sensitivity at k67c, k69c, and k313c was increased on treatment with mtsea, consistent with the fact that the incorporation of mtsea at cysteine produces a side chain of similar size and charge to lysine (17). This clearly indicates that the localized charge at these three positions plays an important role in regulating atp action at the receptor . For p2x2 receptors a response to atp one feature that is common to the p2x1,2,4 receptors is that the decrease in atp potency at the cysteine mutant of the residue equivalent to lys in the p2x1 receptor can be rescued by treatment with mtsea, consistent with an important role of positive charge at this position . A recent study on the p2x2 receptor using single channel analysis has suggested the lysine residue 308 can play a role in regulation of gating of the channel . This was based on the fact that mutation of this residue could abolish spontaneous gating of the t339s mutant p2x2 channel and that mutation k308r reduced atp potency by 200-fold and decreased the amplitude of the maximal response compared with control (32). In the current study the concentration responses to p2x2 k307c and p2x4 k313c did not saturate so it is not possible to determine whether there was a reduction in the amplitude of the maximal response . At the p2x1 receptor the 200-fold reduction in atp potency at k309r and k309c mutants did not result in a decrease in the amplitude of the maximal response (16, 22) as would have been expected if an effect on gating of the receptor has been primarily responsible for the reduction in potency (33). These results suggest that the effects of mutation of this conserved residue can be manifest as a principal effect on atp binding at the p2x1 receptor (16) and an additional effect on gating at the p2x2 receptor (32). This may indicate that in the p2x2 receptor the lysine residue interacts with another amino acid that is not conserved at the p2x1 receptor to regulate gating . Taken together these results support that the three positively charged lysine residues play an important role in atp action most likely contributing to the atp binding site . Indeed it would be unusual to have an atp - binding protein without positive charge being important in coordinating agonist binding . A, mtsea significantly increased the potency of atp and amplitude of responses at k67c mutants . B, mtsea significantly increased the potency of atp and amplitude of responses at k69c mutants . C, mtsea significantly increased atp potency and peak response at k313c mutants (n = 34). The data are expressed as a percentage of the amplitude of the response to 3 mm atp . For mtsea treatment (1 mm, 1 h incubation, followed by washout and construction of the concentration response in the absence of mtsea) these have been corrected with a scaling factor corresponding to the mean -fold increase, at 3 mm atp, in currents compared with untreated oocytes . A, mtsea significantly increased the potency of atp and amplitude of responses at k67c mutants . B, mtsea significantly increased the potency of atp and amplitude of responses at k69c mutants . C, mtsea significantly increased atp potency and peak response at k313c mutants (n = 34). The data are expressed as a percentage of the amplitude of the response to 3 mm atp . For mtsea treatment (1 mm, 1 h incubation, followed by washout and construction of the concentration response in the absence of mtsea) these have been corrected with a scaling factor corresponding to the mean -fold increase, at 3 mm atp, in currents compared with untreated oocytes . The mutations of conserved aromatics f183c in p2x2 and f185c in the p2x4 receptor gave rise to a modest 3- and 20-fold decrease in atp potency at the receptors . This is consistent with previous studies on p2x1 and p2x4 receptors (34, 35) and indicates that this conserved residue contributes to atp action . The mts reagents used are of similar size (or smaller) than atp and can gain access to the atp binding pocket . The effects of the mts compounds at cysteine mutants of the adjacent threonine residue (t184c and t186c for p2x2 and p2x4, respectively) suggest that this region of the receptor is accessible to these reagents and the lack of effect at the cysteine - substituted phenylalanine residues is likely to reflect that this residue is either not very close to the atp binding pocket or is involved in interaction with other residues that could regulate gating . The former interpretation suggests that the phenylalanine may not play a direct role in binding of the adenine ring of atp as we have suggested previously for the p2x1 receptor (34). However, cysteine substitution does give rise to changes in agonist action at the receptor . The introduction of a polar side chain (cysteine) to replace the non - polar phenylalanine could have an effect on bonding / electrostatic interactions or a structural change to the receptor . Mutation of threonine in the conserved ft motif to cysteine resulted in a 10- and 40-fold decrease in atp potency at p2x2 and p2x4 receptors . Previous studies on the p2x2 receptor have shown that alanine substitution at this residue deceases atp potency by 100-fold (15). This is the first time a mutation has been made at this position for the p2x4 receptors and it supports a similar mode of agonist action as p2x1 and p2x2 receptors . At p2x2 and p2x4 receptors the response was inhibited by mtses . These results clearly indicate that modification of the side chain at this conserved threonine residue can regulate channel function . Close to the ft motif is a nearby conserved lysine residue that has been shown to be involved in regulating atp potency (lys in p2x1 and lys in p2x2 that when mutated to alanine resulted in 10- (22) and 100-fold decreases in atp potency (36)). Thus this region in the middle of the extracellular loop of the channel plays a role in regulation of atp potency, however, whether this results from an effect on agonist binding and/or gating remains to be determined . What is clear is that residues involved in agonist action at p2x receptors are not just focused around regions close to the transmembrane segments and the pore of the channel . At the conserved nfr motif cysteine substitution at asn and arg reduced atp potency by> 300-fold and gave marked reductions in peak current amplitudes (> 80%) at p2x2 and p2x4 receptors . The asparagine to cysteine mutation had the same effect at p2x2 (n288c) and p2x4 (n293c) receptors with inhibition of currents by either mts reagent as reported previously for p2x1 receptors (16). The reduction of atp responses at the mutants of the conserved arginine by mtses is the same for p2x1,2,4 receptors, however, mtsea inhibited p2x1 and p2x4 receptors, but potentiated the p2x2 receptor (ref . 16 and this shows that the p2x1 and p2x4 receptors are similar in that the mts reagents interfere with the action of atp in a way that is charge independent . However, for p2x2 the results are consistent with the polarity of charge at this position being important . When the phenylalanine of the nfr motif was replaced with cysteine there was only a modest 4-fold reduction in atp potency, no effect on peak current amplitude, and mts reagents were ineffective . This suggests that at p2x2 and p2x4 receptors the conservation of the asparagine and arginine residues is more important in regulating the actions of atp than the phenylalanine of which they are adjacent . At p2x1 receptors and a non - desensitizing chimeric p2x1/2 receptor, marked effects of> 100-fold decrease in atp potency with no effect on the peak response were recorded with the equivalent mutations (16, 18). Taken together these results show that whereas there are marked similarities between the receptors, there are also differences in regulation of atp potency between the p2x receptor subunits (e.g. The effects of mtsea on cysteine substitution of the arginine of the nfr motif). This is consistent with variations in the pharmacological properties of p2x receptors and suggests that non - conserved amino acids are associated with agonist action . Table 2summary of data for the effects of mts reagents at p2x receptor cysteine mutantsarrows correspond to significant effects of mts reagents on atp responses . Shaded areas correspond to similar effects of the mts reagents at different p2x receptor subtype mutants . Summary of data for the effects of mts reagents at p2x receptor cysteine mutants arrows correspond to significant effects of mts reagents on atp responses . Shaded areas correspond to similar effects of the mts reagents at different p2x receptor subtype mutants . The present study shows that the nfr region plays an important role in regulation of atp action at p2x2 and p2x4 receptors . We have previously shown, for p2x1 receptors, that reductions in atp potency at cysteine mutants of the nfr motif are likely to result from effects on agonist binding at arg and effects on both binding and gating for asn and phe (16). The contribution of this region to the agonist binding site is supported by a recent paper (18) showing that the phenylalanine is close to the conserved lys residue in the p2x1 receptor and cysteine mutants k68c and f291c can form an inter - subunit disulfide bond and this is inhibited by atp, suggesting that both residues are close to the atp binding site . Similarly a recent single channel study on p2x2 receptors reported that the reduction of atp potency for the k69a mutant of the p2x2 receptor results predominantly from an effect on agonist binding (32). Previously we had suggested that the phenylalanine residues in the nfr motif were involved in binding of the adenine ring of atp . However, the present results from p2x2 and p2x4 receptors with modest changes in atp for cysteine mutants of these phenylalanines and the lack of effect of mts reagents on atp responses suggests that the conserved aromatic residue may not contribute directly to agonist recognition . The inhibition of cysteine - substituted mutants of the arginine of the nfr motif for p2x1 and p2x4 receptors by both positive and negatively charged mts reagents suggests that arginine is not directly involved in binding of the phosphate tail of atp . This suggests that asparagine and arginine are most likely involved in binding of the ribose and/or adenine ring of atp . Portions of the extracellular loop adjacent to either the first (in gray) or second (in black) transmembrane domain are shown for two adjacent p2x receptor subunits (numbering for the p2x4 receptor). The gray arrow represents the disulfide bond that can be formed between cysteine mutations of these residues at the p2x1 receptor (18). Residues that showed a decrease in atp potency when mutated to cysteine are shown, those in black correspond to those that were modified by mts reagents, whereas those in gray were unaffected by either mtsea or mtses . Positively charged mtsea increased the amplitude and potency of responses at cysteine mutants of the p2x4 receptor at positions lys, lys and lys, this suggests a role of these residues in coordinating the binding of the negatively charged phosphate of atp, however, it is possible that they also contribute to the gating of the channel as has been suggested for the residue equivalent to lys at the p2x2 receptor (32). The conserved ft region is shown as a dotted line as it has been shown to be involved in agonist potency and is unclear whether the effects result from changes in agonist binding and/or gating . Portions of the extracellular loop adjacent to either the first (in gray) or second (in black) transmembrane domain are shown for two adjacent p2x receptor subunits (numbering for the p2x4 receptor). The gray arrow represents the disulfide bond that can be formed between cysteine mutations of these residues at the p2x1 receptor (18). Residues that showed a decrease in atp potency when mutated to cysteine are shown, those in black correspond to those that were modified by mts reagents, whereas those in gray were unaffected by either mtsea or mtses . Positively charged mtsea increased the amplitude and potency of responses at cysteine mutants of the p2x4 receptor at positions lys, lys and lys, this suggests a role of these residues in coordinating the binding of the negatively charged phosphate of atp, however, it is possible that they also contribute to the gating of the channel as has been suggested for the residue equivalent to lys at the p2x2 receptor (32). The conserved ft region is shown as a dotted line as it has been shown to be involved in agonist potency and is unclear whether the effects result from changes in agonist binding and/or gating . Our results support the idea that mammalian p2x receptors share a common agonist binding site with the negative charge of atp coordinated by positively charged lysine residues and the nfr motif involved in binding of the adenine / ribose component (fig . The conserved ft motif also contributes to agonist action, however, whether this results from an effect on agonist binding and/or gating remains to be determined.
|
The first important discussion regarding sialosis in dental reports was mentioned 35 years ago and since then little has been published . Sailadenosis refers to noninflammatory, often recurrent enlargement of the salivary glands, most frequently, the parotids . It is usually associated with various underlying disorders that include diabetes, alcoholism, malnutrition, anorexia nervosa, bulimia, etc ., the management of sialadenosis depends upon identification of the underlying cause that must then be corrected . A 45-year - old female came with a swelling at the left preauricular region measuring 3 cm 3 cm . Ultrasonography showed single, well - circumscribed swelling measuring 3 cm 3 cm in the left preauricular region which was suggestive of benign salivary gland lesion . Fine needle aspiration cytology showed moderately cellular smears having acinar epithelial cells arranged in clusters, papillae, and glandular pattern as well as scattered singly [figure 1a]. Individual cells were round, having round uniform nuclei and a moderate amount of cytoplasm [figure 1b]. In areas (a) photomicrograph showing moderately cellular smears having acinar epithelial cells arranged in clusters, papillae, glandular pattern, and scattered singly (b) individual cells were round, having round uniform nuclei, and a moderate amount of cytoplasm (c) in areas mild cellular enlargement, nucleomegaly, and hyperchromasia were noted . Sialadenosis is a recurrent, noninflammatory, nonneoplastic enlargement of salivary glands usually associated with an underlying systemic disorder . Pape et al . Reported in his series of cases, four cases of unilateral sialadenosis . Sialadenosis usually occurs in association with a variety of conditions including diabetes mellitus, alcoholism, endocrine disorders, pregnancy, drugs, bulimia, eating disorders, idiopathic, ect . Clinically, it presents as soft, often bilateral, usually painless, and recurrent swelling of the parotid gland . Fine needle aspiration yields cellular smears having acinar epithelial cells adherent to thin fibrovascular stroma . Mainly large numbers of naked nuclei of epithelial cell origin were seen in the background . A similar condition that can mimic sialadenosis is low grade acinic cell tumor particularly on cytology . Atypical nuclear features were more prominent in acinic cell tumors as compared to sialadenosis . In our case, the distinguishing cellular feature for acinic cell carcinoma includes large nuclei, grainy eosinophilic cytoplasm, and neoplastic cells are arranged singly or in small clusters . In addition, usually there is an absence of other normal salivary gland structures such as duct epithelium and interstitial adipose tissue . These are important features useful for differentiating acinic cell carcinoma from sialadenosis and normal salivary gland enlargement . The diagnosis of silaladenosis must exclude inflammatory causes of salivary gland swelling, particularly sjogren's syndrome, human immunodeficiency virus (hiv) infection, sarcoidosis, and lymphoepithelial diseases by relevant investigations . Other condition of sialadenitis will be excluded as it contains inflammatory cells on the background . The treatment of sialadenosis is unsatisfactory but it should be aimed at the correction of the underlying disorder . We are presenting this case for its rarity and its important differentiation on cytology smears from other parotid lesions . In the work - up of salivary gland swelling, it is important to recognize on cytological evaluation of these underestimated entities which do not necessarily require surgical treatment and can be treated with an underlying systemic cause.
|
The institutional review board approved this case report prior to any review of medical records . An 80-year - old man was transferred to our institute because of an incidentally detected renal tumor . The patient underwent a right partial nephrectomy due to a previously diagnosed rcc eight years prior . Recent routine follow - up ct images, which covered the lung and abdomen, revealed a right renal mass, a right adrenal mass, and three pulmonary nodules; all of which were not seen on prior ct images (figs . 1a - c). The right renal tumor and adrenal tumor had maximum diameters measuring 2.0 cm and 1.8 cm, respectively . In addition, the pulmonary nodules, with maximum diameters ranging from 8 to 10 mm, were seen in the right upper lobe, left upper lobe, and left lower lobe . The treatment modality decided upon was an rf ablation for the cytoreductive removal of the right renal tumor . However, the histological results were not confirmed before the ablation as these lesions were clinically considered to be recurrent or as metastatic lesions from the previously removed rcc . An internally - cooled rf system (radionics, burlington, ma) was used for the ablation of the right renal tumor, along with an electrode (cool - tip, valleylab, boulder, co) that was kept below 20 by means of chilled water supplied by a peristaltic pump . We selected an rf electrode with a 2 cm active tip, which corresponded to the size of the right renal tumor . The electrode was appropriately targeted in the center of the renal tumor under ultrasound (us) guidance and performed two cycles of rf ablation . For the first ablation cycle, for the second rf cycle, reduced electrical power (80 w) was delivered for 3 minutes due to severe pain . For pain relief, a total of 50 mg of penthidine hci (hana pharmacy corporation, hwasung, korea) was intravenously infused during the rf ablation . A post - ablation ct performed 10 months after the ablation showed a lack of tumor enhancement within the right renal tumor (fig . The size of the recurrent renal tumor decreased to a maximum diameter of 1.4 cm . All of the metastatic pulmonary nodules became too small to be measured on ct images (fig . In addition, the right adrenal tumor decreased in size to a maximum diameter of 1.4 cm (fig . Chemotherapy and immunotherapy was not performed due to the poor general condition and old age of the patient . Spontaneous tumor regression has been reported to occur for some types of malignant tumors, although the incidence is rare . This phenomenon may be defined when the tumors partially decrease or totally disappear without any treatment . An rcc can be a spontaneously regressing tumor and is in fact known to develop in less than 1% of rcc cases (1 - 5). Spontaneous regression of metastatic lesions from an rcc have occurred frequently following a nephrectomy, radiotherapy, or embolization (1 - 4, 6). As with our case, metastatic pulmonary lesions were reported to spontaneously regress following an rf ablation of a tumor (7). These cytoreductive treatments seemed to play a major role in the spontaneous regression; however, the role of nephrectomy accounted for only less than 50% of all reported cases with spontaneous regression (4). Immunological responses to an rcc are also quite controversial, but the use of interferon to strengthen the hosts immunity, which may ultimately improve the survival of patients with advanced stage rcc should be performed (8). In general, here has been a consensus that an rf ablation can be used in treating patients with a localized rcc, which is difficult to remove surgically . Recently, this treatment modality has been considered as a good alternative treatment option because of its minimally invasive nature and excellent clinical outcome . For this reason, an rf ablation might be as beneficial as a nephrectomy at inducing the spontaneous regression of rcc, although their mechanisms are unknown . Both the rf ablation and a nephrectomy may be involved in stimulating the host's immune system as if these treatments naturally kill the cells of rcc as with the use of immnunotherapy using interferon . A literature search revealed that our case was found to be the second case report on the spontaneous regression of pulmonary metastases following an rf ablation of the recurrent rcc (7). However, we could not find any cases with spontaneous regression of adrenal metastasis from the rcc following ablation . The rf ablation might be recommended as a good alternative treatment when a cytoreductive nephrectomy is required in patients with metastatic lesions, but are in poor general physical condition . In conclusion, spontaneous regression of metastatic lesions from an rcc is extremely rare, but can result following the rf ablation of the tumor.
|
Autophagy, literally meaning self (auto) eating (phagy), is an evolutionarily conserved and highly regulated catabolic process that leads to the degradation of cellular components using lysosomal / vacuolar degradation machinery of the same cell . Depending on the mechanism of transport to lysososome / vacuole, at least three forms of autophagy have been described: macroautophagy is characterized by the engulfment of long - lived proteins and organelles in de novo formed double-/multimembrane vesicles called autophagosomes or autophagic vesicles . These vesicles subsequently deliver their cargo to the lysosome or vacuole for degradation . In another form of autophagy, called lysosome / vacuole directly engulfs cytosolic components through an invagination of its membrane [1, 2]. A third common form of autophagy cma is a very selective process during which proteins with a kferq consensus peptide sequence are recognized by a chaperone / cochaperone complex and delivered to the lytic compartment in an unfolded state [3, 4]. Macroautophagy (autophagy hereafter) occurs at basal levels in growing cells, allowing them to recycle long - lived proteins and organelles . The cargo is degraded into its building blocks (i.e., proteins to amino acids), helping the cell to economize its resources, eliminate old / damaged organelles, and survive nutrient and other types of stress . For example, in plants under conditions causing cellular and organismal stress such as starvation, drought, and other abiotic stress, autophagy is upregulated [58]. Autophagy is also involved in physiological phenomena including plant development, senescence, and immune response [911]. In some cases, autophagy can function as a nonapoptotic and alternative programmed cell death mechanism, and its role in plant cell death was explored [1215]. As a consequence of its involvement in several important physiological and pathological phenomena, autophagy became one of the fastest expanding fields of molecular biology in recent years . In this review, we will briefly summarize the mechanisms of autophagy in general and particularly plant autophagy, list commonly used techniques to detect and quantify autophagy, and finally discuss their utility in plant autophagy detection . The readers may find an in - depth discussion of the mechanistic aspects of autophagy in recently published reviews [5, 9, 16]. So far, nearly 30 autophagy - related genes (depicted by the acronym atg) were identified using yeast mutants . Data obtained from these studies underline the fact that the basic machinery of autophagy is preserved from yeast to higher eukaryotes . Autophagy proceeds through five distinct phases: namely, induction, nucleation, vesicle expansion and completion, autophagosome / lysosome fusion, and cargo degradation [9, 18] (figure 1(a)). This is the phase where upstream signaling mechanisms leading to autophagy activation are turned on . Many of these pathways are integrated by the target of rapamycin (tor) protein [1921]. Tor is a serine / threonine kinase regulated in response to variation in amino acids, atp, and growth factors . Tor pathway and its effect on autophagy were preserved in plants . Yet, structural differences exist between tor proteins in plants and other eukaryotes, therefore, rapamycin, a widely used specific inhibitor of tor, cannot be used to study autophagy in plants [23, 24]. The first involves activation of transcription factors called gln13 (nitrogen regulatory protein) and gcn4 (general control nondepressible), leading to transcriptional upregulation of some of the atg genes (e.g., atg1 and atg13) [25, 26]. Second mechanism is related to the modification by tor of an autophagy protein complex containing atg1 and atg13 . Active tor induces hyperphosphorylation of atg13 inhibiting its association with atg1 (atatg1 in a. thaliana and ulk1 (unc-51-like kinase1) in mammals), a serine / threonine kinase required for autophagy . Tor inactivation leads to rapid dephosphorylation of atg13 and an increase in the affinity of this protein for atg1 . Recent evidences indicate that atg1 - 13 complex regulates recycling of atg proteins such as atg9 and atg23 functioning at the autophagy organization site called pas (for the preautophagosomal structure). While the origin of the lipid donor membranes in autophagy is still obscure, endoplasmic reticulum, golgi, and a so far undetermined organelle called the phagophore were suggested as lipid providers to autophagosomes . Whatever is the origin, autophagosomal membranes, pas is a prominent structure next to the vacuole, but in higher eukaryotes, several sites are involved . Nucleation of autophagosomes is initiated by a protein complex including vps34, a class iii phosphatidylinositol 3-oh kinase (pi3k), and atg6/vps30 (beclin1 in mammals). Together with other regulatory proteins such as uvrag (uv radiation resistance associated gene), bif-1, and ambra, atg6-containing complex plays a role in the regulation of vps34 activity . Pi3p produced by vps34 serves as a landing pad on pas for proteins involved in autophagosome formation such as atg18 and atg2 [16, 32, 33]. Two ubiquitination - like conjugation systems play a role in autophagosome biogenesis . In the first reaction, atg12 is conjugated to atg5 in a covalent manner . The conjugation reaction starts with the activation of atg12 by an ubiquitin - activating enzyme (e1)-like protein atg7 . Atg12 is then transferred to atg10, an ubiquitin - conjugating - like enzyme (e2)-like protein [35, 36]. Finally, atg12 is covalently conjugated to atg5 . The conjugation allows the formation and stabilization of a larger complex containing atg12, atg5, and atg16 . This protein complex is necessary for the second ubiquitination - like reaction to occur and to allow autophagosome membrane elongation . Complex localizes to the outer membrane of the forming autophagosome, and, dissociates from it as soon as the vesicle is completed, underlining the fact that its role is regulatory rather than structural . The second ubiquitination - like reaction involves atg8 protein (microtubule - associated protein light chain-3 or shortly lc3 in mammals). While atg7 is common to both conjugation reactions, e2-like protein atg3 is specific for atg8 conjugation to a lipid molecule (phosphatidylethanolamine, pe). Prior to conjugation, atg8 has to be cleaved at its carboxy - terminus by atg4, allowing the access of the lipid molecule to a glycine residue on atg8 . Lipidation reaction is reversible since atg4 can also cleave the conjugated lipid, enabling recycling of atg8 . Recent data provide evidence that together with atg3, atg12/5 complex is directly responsible for atg8-pe conjugation . The yeast atg8 has several orthologues and isoforms in plants [4143]. In the model plant arabidopsis thaliana, at least 9 atg8 proteins were described . A vps complex and rab gtpases proteins are involved in the organization of the fusion site . Then, snares proteins (snap as soluble nsf attachment protein receptor) form a complex which serves as a bridge between the two organelles [46, 47]. In the lumen of lysosome / vacuole, lipases such as atg15 first degrade the remaining autophagic membrane and the cargo is then catabolized by lysosomal lytic enzymes . Following the degradation of the vesicle, specialized lysosome membrane proteins play a role in this process including lysosomal - associated membrane proteins lamp-1 and lamp-2 . Both microautophagy and macroautophagy are functional in plants . Mechanisms of these pathways are similar to those described in other model organisms . In plant cargo - containing vesicle pinches off to be released inside the vacuole and degraded within the lumen . Microautophagy was involved in accumulation of storage proteins, lipids, and degradation of starch granules in developing plants [49, 50]. As in other organisms, the macroautophagy (hereafter autophagy) in plants is a process that starts with the formation of cup - shaped membranes in the cytoplasm . They may fuse with the tonoplast and be directly delivered to the lumen of the vacuole as seen in arabidopsis . Alternatively, autophagosomes may first transform into lysosome - like acidic and lytic structures and, fusion with the central vacuole may occur as a secondary event (figures 1(b) and 1(c)) [51, 52]. In the model plant arabidopsis thaliana, some exist as a single copy (i.e., atg3 and atg5) and others as multiple copies (i.e., atg1 and atg8). Functional domains of these arabidopsis proteins were well conserved during evolution, indicating preservation of basic autophagy mechanisms in plants . Indeed, complementation tests in atg mutant yeast strains using some of the plant atg proteins confirmed the preservation of their function . Moreover, gene targeting studies in whole plants demonstrated that plant genes of all tested autophagy proteins (i.e., for atg7, atg9 and atg5-atg12) were necessary for autophagosome formation following various types of stress [44, 53, 55]. Furthermore, some atg genes were upregulated under stress conditions stimulating autophagy [7, 5661]. A list of atg genes identified in arabidopsis and the phenotypes caused by their modification are depicted in table 1 . Incubation of root tips with vacuolar enzyme inhibitors led to the accumulation of autophagic vesicles as autolysosome - like structures and in the vacuole . When cysteine protease inhibitor, e64d, was used to inhibit autophagy, autophagic vesicles accumulated inside vacuoles in arabidopsis cells . Similarly, growth of tobacco cells in the presence of e64d led to the accumulation of autolysosome - like structures outside the vacuole . Autophagy - specific inhibitor 3-ma blocked the accumulation of autophagosomes and autolysosomes, demonstrating that autophagy is responsible for vesicle accumulation [52, 62]. Expression of a gfp fusion construct of atg8f (an autophagy marker in arabidopsis) resulted in the accumulation of this marker protein in the vacuole lumen . Atg8f accumulation was also detected in the presence of concanamycin a (a vacuolar h(+)-atpase inhibitor blocking vacuolar degradation). The role of constitutive autophagy in the degradation of damaged or oxidized molecules was confirmed using mutants of atatg18a . These mutants produced greater amounts of oxidized proteins and lipids in comparison to wild - type plants . Increased amount of oxidized protein and lipid generation in atg18a - silenced plants underlined importance of autophagy for the degradation of oxidized molecules in plant cells [8, 63]. Therefore, as in other organisms, plant basal autophagy seems to function to eliminate damaged organelles (e.g., chloroplast, a source of reactive oxygen species in plants) and to clear damaged / abnormal proteins that accumulate in the cytoplasm . The role of autophagy for plant development was studied using several autophagy gene mutants . Under nutrient - rich conditions, autophagy - defective plants achieve normal embryonic development, germination, shoot and root growth, flower development, and seed generation [44, 53, 54]. When these plants are grown under carbon- or nitrogen - deficient conditions, accelerated bolting, increased chlorosis, dark - induced senescence, and a decrease in seed yield were observed . Therefore, autophagy seems to be a major mechanism of nutrient mobilization under starvation conditions in plants . Autophagy plays a role during vacuole biogenesis as well . In a recent study, yano et al . Proposed that formation of vacuoles from tobacco by-2 protoplasts involved an autophagy - like process . However, this process could not be inhibited by classical autophagy inhibitors such as 3-ma and wortmannin, suggesting that autophagy during vacuole formation differs from constitutive autophagy taking place under normal conditions or autophagy induced by stress . When organisms including plants are exposed to adverse environmental conditions, they develop responses to cope with stress and to survive . Stress conditions inducing autophagy include sucrose, nitrogen, and carbon starvation, as well as oxidative stress and pathogen infection [8, 62, 66, 67]. For example, sucrose starvation has been reported to induce autophagy in rice, sycamore, and tobacco - cultured cells, and carbon starvation induced autophagy in maize plants . Furthermore, autophagy participates in the formation of protein storage vacuoles in seeds and cereal grains [71, 72], prolamin internalization to vacuole in wheat, biogenesis of vegetative vacuoles in mature meristematic cells [74, 75], and degradation of proteins in protein storage vacuoles in mung bean [49, 76]. Since plants have a rigid cell wall and they lack typical caspase proteases, apoptosis is not the mechanism utilized by plants to degrade cellular components before cell death . During programmed cell death (pcd) in plants, vacuole and cell size increase, organelles are taken up by vacuole and subsequently degraded, and finally vacuole lyses resulting in cell death . These events overlap with the major characteristics of autophagy in plants [15, 77]. In the light of these observations, the role of autophagy in plant programmed cell death needs to be further investigated . To avoid spread of infection, plants developed an innate immune response, called the hypersensitive response programmed cell death (hr - pcd). The innate immunity is achieved through limitation of the infection with the death of cells surrounding the infected area . Studies using autophagy gene mutant plants showed that an autophagy defect is associated with a failure to contain cell death at the infection site, leading to its spread into uninfected tissue [7981]. Therefore, paradoxically, autophagy also plays a role in limiting cell death initiated during plant innate immune responses . Indeed, as seen in plants, autophagy is involved both in cell survival and cell death in various other organisms . Various techniques and tools were used to monitor and evaluate autophagy . While transmission electron microscopy (tem) analysis remains the golden standard, with the recent advances in the field, transmission electron microscopy (tem) is one of the earliest tools used to characterize autophagy, and it is still one of the most reliable methods to monitor autophagy in cells and tissues . Yet, interpretation of the tem data requires special expertise and there are several criteria to describe autophagosomes and autolysosomes with precision . The hallmark of autophagosomes is their double or multimembrane structures containing electron dense material with a density similar to that of the cytoplasm . Presence in autophagosomes of organelles such as mitochondria, chloroplasts, and endoplasmic reticulum (er) strengthens the conclusion (figure 2(b)). Autolysosomes contain darker, degenerated, or degraded material and some of them are reminiscent of lysosomes / vacuole . Degenerated mitochondria, folds of er, or nuclear membrane may be mistaken for autophagosomes [8385]. Sometimes the typical double membrane structure of autophagosomes may be disrupted (e.g., following infection with some pathogens). Combination of electron microscopy with immunogold - labelling of autophagosome - specific markers such as atg8/lc3 may allow a more objective and reliable interpretation depending on the experimental needs . Transmission electron microscopy was successfully used to detect autophagy in plants [61, 79]. Proteins that are involved in the autophagy process or that are degraded specifically through autophagy have been used to monitor autophagic activity . Plants knock - out and transgenic for these markers are useful tools to study autophagy - related phenotypes under different experimental conditions (see table 1). Molecular techniques, such as atg8/lc3 dot formation, were successfully used for high - throughput screens of autophagy in various systems . Atg8/lc3 is covalently conjugated to a lipid molecule as a result of an ubiquitination - like reaction and, its lipidation is required for autophagic membrane elongation (see section 2.3). In plants, several isoforms of atg8/lc3 seem to be functional during autophagy mechanisms . During autophagy, atg8/lc3 lipidation and recruitment to autophagic membranes changes its localization from diffuse cytosolic to punctuate (figure 2) [51, 54, 89, 90]. Moreover, in sds - page protein gels, the molecular weight of atg8/lc3 changes from 18kda (free cytosolic form, free atg8, or lc3-i) to 16kda (lipidated form, atg8-pe (or lc3-ii)) [41, 54, 57]. Soon after the discovery of its autophagy - related lipidation, atg8/lc3 had become one of the main tools to monitor autophagy . The localization change of an atg8/lc3-fluorescent protein fusion construct (such as gfp - atg8/lc3) is commonly used to detect autophagy in cells (figure 2(a)) and in whole organisms including transgenic arabidopsis and tobacco plants [38, 51, 54, 55, 57]. When working with isolated cells, quantification of gfp - atg8/lc3 signal using facscan / flow cytometer may be used as an autophagy evaluation tool . In this system, this method is a good quantitative tool to monitor activity in living cells by facscan / flow cytometer [9294], especially using cells derived from atg8 transgenic plants . Free atg8 (or lc3-i) to atg8-pe (or lc3-ii) ratio differ among tissues, depending on stimuli and antibodies that are used, therefore, reliable controls must be added . To avoid misinterpretations due to kinetics of autophagy, it is highly advised to check atg8/lc3 lipidation at several time points after signal application rather than using only one point in time . The use of vacuolar / lysosomal degradation inhibitors will help to confirm that accumulation of the lipidated form is indeed due to the canonical autophagy pathway . It has been reported that high level gfp - atg8/lc3 expression may also lead to dot formation even in nonautophagic cells and in autophagy mutants . Furthermore, atg8/lc3 was found to associate with protein aggregates marked with p62/sqstm1 (see section 4.2.7) in an autophagy - independent manner . Importantly, atg8/lc3 lipidation reflects an early stage in autophagosome formation and it cannot be interpreted as autophagic activity per se [99, 100]. Hence, this method should not be used as the only technique to monitor autophagy and it has to be complemented with other autophagy detection techniques including tem analysis ., atg6 regulates vps34 class iii phosphoinositide-3 kinase (pi3k) complex producing pi3p that is involved in autophagic vesicle nucleation . Similar to atg8/lc3, intracellular localization change of a fluorescent protein fusion of atg6 (and leading to its colocalization with pi3p) was observed upon autophagy induction [101, 102]. Pi3p may be labelled in cells using a pi3p - binding peptide, fyve fused to gfp . Quantification of the accumulation of gfp - fyve - labelled dots may also be used as a tool to quantify autophagy activation upon starvation in mammalian cells (yamaner y. and gozuacik d. unpublished data). Adaptations to the plant system may be possible since orthologues of atg6 and vps34 are present in plants including arabidopsis . Atg5 as well as atg16 was used as a selective marker to recognize autophagosome organization centers (pas). Since atg5 dissociates after vesicle completion the signal could be detected as fluorescent dots under microscope [38, 97]. Like atg5, atg16l transiently associates with the surface of autophagosomes during their formation and forms punctate structures . Therefore, as atg8/lc3, atg5 and atg16l, coupled with a fluorophore or detected by immunofluorescence using specific antibodies, can be used to monitor autophagosome formation . As homologues of atg5 and atg16 exist in plants (e.g., arabidopsis, z. mays) this technique might be useful in plants studies as well . A mammalian orthologue of the yeast atg18, wipi-1, was proposed as a marker for autophagy as well . Wipi-1 is a wd (tryptophan and aspartic acid) repeat protein and as such, it may interact with pi3p and accumulate in dot - like structures (upon autophagy induction by amino acid starvation other stimuli). Wipi-1 dots were shown to colocalize with atg8/lc3 [107, 109] in human cells lines . Whether plant atg18 protein might be used as an autophagy marker has to be tested as homologues are found in plants such as arabidopsis . Recently, monitoring atg8/lc3 cleavage by atg4 was proposed as a technique to detect autophagy . The assay is based on the cleavage by atg4 of a luciferase protein fused to atg8/lc3 which, itself, is fixed on actin cytoskeleton . In this system, actin - associated luciferase has a secretion signal and, upon cleavage of atg8/lc3 by atg4, it is released from the cell . Homologues of atg4 are present in plants including arabidopsis and rice; therefore, this technique could be adapted to monitor atg4 protease activity in plants . Its activity correlated with autophagy induction [22, 27, 111113]. In s. cerevisiae, atg1 autophosphorylation is dramatically reduced upon starvation leading to autophagy . In mammals, the function of atg1 orthologues ulk1 and ulk2 seems to be controlled by autophosphorylation as well [113, 114]. Hence, atg1 kinase activity and phosphorylation status could be used as a new test of the autophagic activity in cells, tissues, and extracts . In arabidopsis thaliana genome, orthologues of the yeast genes coding for atg1 kinase and atg13 have been identified [53, 115]. Therefore, measuring atg1 activity could serve as a tool to monitor autophagy in plants . Sequestosome 1 (sqstm1), also named ubiquitin - binding protein p62 (shortly p62), is a stress - induced adaptor / marker protein that is a common component of protein aggregates . P62/atg8 interaction triggered degradation of protein aggregates by autophagy during which p62 itself was also degraded [118, 119]. This observation led to the use of p62 degradation as a molecular tool to detect autophagic activity [119121]. As lc3 lipidation appears prior to p62 degradation, existence of a lag phase should be considered during the design of the experiments . Of note, it is still not known whether p62 is a general marker for autophagy and caution should be taken when using this technique with new autophagy - inducing stimuli . Weakly basic amines selectively accumulate in cellular compartments with low internal ph and can be used to visualize acidic compartments such as lysosomes / vacuoles . Labelling of acidic compartments by lysotracker is likely due to its protonation and retention in the membranes of these organelles . Lytic compartment labelling methods such as lysotracker staining must be used in combination with more specific markers of autophagy in order to discriminate autophagic activity from other events increasing lysosome / vacuole activity . Lysotracker staining method has been used to monitor autophagy in various organisms including arabidopsis, tobacco, and barley [79, 80, 122]. Ao accumulates in acidic compartments, such as lysosomes and vacuole, and becomes protonated and sequestered in their lumen . In acridine orange - stained cells, cytoplasm and nucleolus therefore, quantification of the red fluorescence reflects the degree of acidity and the volume of the cellular acidic compartments . Comparison of the ratio of green / red fluorescence in cells, using fluorescent microscopy or flow cytometry, enables quantification of the extent of autophagic degradation [123, 124]. So far, to our knowledge, no study used ao as a plant autophagy marker . The autofluorescent substance monodansylcadaverine is commonly used to detect autophagy in plants and in other organisms [67, 125127]. Mdc is a weak base that is capable of crossing biological membranes and concentrating in acidic compartments . Although mdc was originally proposed to label autophagosomes and autolysosomes, recent studies on mammalian autophagy brought out that it is not an autophagy - specific marker . These publications revealed that mdc - positive structures colocalized only partially with autophagosome markers in cells . Furthermore, in autophagy - defective atg5 knockout cells, mdc - positive dots were still observed . The figures labelled by mdc seem to be endosomes, lysosomes, and lamellar bodies . Therefore, mdc associates with acidic and lipid - rich compartments and it does not discriminate between autophagosomes / autolysosomes and the aforementioned vesicular organelles . Since autophagy is involved in the degradation of long - lived proteins, determination of their turnover appears to be an efficient method to monitor autophagy levels in cells . In the commonly used technique, following metabolic labelling, degradation of all long - lived proteins a radioactively labelled amino acid such as valine or leucine can be used to label newly synthesized proteins . Then cells are incubated with cold amino acids to allow short - lived proteins to be degraded . Finally, release of labelled amino acids resulting from the degradation of long - lived proteins is monitored . One major weakness of this technique is that autophagy is not the only mechanism of long - lived proteins degradation . Autophagic and nonautophagic degradation of long - lived proteins should be distinguished by the use of autophagy inhibitors such as 3-mehyladenine (3-ma). An alternative nonradioactive method uses chromatography to monitor the amount of released unlabeled amino acids . Usage of metabolic labelling in plants was hindered by high compartmentalization of protein substrates and by the fact that metabolite pools in plant cells are generally highly dynamic . Recently developed techniques allowing metabolic labeling of whole plants and plant cell cultures may overcome these difficulties and allow quantification of autophagy by long - lived protein degradation in plants [135137]. Radio - labelled sucrose or raffinose, delivered to cytosol through electropermeabilization, is sequestered in autophagic vesicles together with engulfed cytosolic fragments . Accumulation of radioactivity in autophagic membrane fractions was used to measure autophagic activity [138, 139]. Furthermore, injection of the labelled molecule can disturb cellular homeostasis, therefore, precautions and extracontrols including determination of the metabolic equilibrium of the cell prior to the measurement are required . Sugar sequestration technique might be useful in plant cell cultures studies and it needs to be tested . An assay to monitor autophagy in plants carbon starvation - activated degradation of membrane lipids led to the accumulation of phosphorylcholine in the cytoplasm . Phosphorylcholine accumulation correlated well with autophagy - induction and its quantification by 31p - nmr spectroscopy was proposed as a novel way of autophagy detection in plant cells . One of the yeast techniques developed to monitor autophagy makes use of an n - terminal truncated mutant of the yeast alkaline phosphatase pho8 . In contrast to the er - localized wild - type enzyme, the mutant form of pho8 lacking the n - terminal signal sequence (pho860), is delivered to the vacuole by way of autophagy . Following entry to the vacuole, pho860 is cleaved at its c - terminus to produce the active alkaline phosphatase . Measurement of alkaline phosphatase activity and/or protein immunoblotting to check the shift between precursor and mature enzyme allows the detection of autophagic activity in yeast cells . Nonselective degradation of marker proteins (especially those with an enzymatic activity) might also be used in plants as autophagy detection methods . Although autophagy is generally considered as a nonselective phenomenon, some proteins appear to be selectively degraded by autophagy . A gfp or dsred construct, targeted to the chloroplast, and a gfp fusion of rubisco were transported to the vacuole through autophagy [90, 142]. Rubisco is allocated most of the plant nitrogen and functions in carbon - fixation in chloroplasts . It is released from the chloroplasts in structures called rubisco - containing bodies (rcbs) in order to provide nitrogen from the leaves to others organs . Rcb seem to overlap with autophagic vesicles, indicating that rubisco is engulfed in autophagosomes and eventually delivered to the vacuole . The process was dependent on atg genes underlining the autophagic character of the transport . Therefore, targeted gfp - dsred constructs or gfp - rubisco may be used as tools to study selective autophagy in plants . Another study proposed measurement of neomycin phosphotransferase ii accumulation by flow cytometry as an autophagy detection method [144, 145]. Whether the plant orthologue betaine homocysteine methyltransferase shares the same faith and whether neomycin phosphotransferase follows the same path in plants has to be determined . Since autophagy is a general process for the quality control of organelles, mitochondria are common targets of autophagic degradation . The term mitophagy was coined to describe the selective degradation of mitochondria by autophagy . In yeast, a technique of mitophagy detection was recently developed . This method is based on the use of a gfp - tagged mitochondrial protein and monitorization of the vacuolar release of green fluorescent protein after the degradation of chimera . Similarly, during autophagy activated by sucrose starvation in plants, a gradual decrease in the number of mitochondria per cell was observed, indicating that techniques based on mitochondrial degradation may be developed to study autophagy in plants . Due to its role in fundamental biological phenomena in various organisms including humans and plants, interest in autophagy field is growing exponentially . Accumulation of the knowledge on autophagy molecular mechanisms stimulated the discovery of more efficient and reliable molecular tools to study autophagy . Despite the fact that some of these methods and tools seem to be more suitable for use in specific model organisms plant autophagy studies already benefit from the adaptation of various general autophagy detection techniques used in other model organisms, such as atg8/lc3 localization tests . Main disadvantages or difficulties of available tools to study autophagy . A better understanding of the biological phenomena involving autophagy in plants and its molecular mechanisms and targets will lead to the development of novel and more precise techniques that will allow the measurement of autophagy in plants with increasing precision and will further accelerate studies in this field.
|
Stroke patients suffer neurotransmission problems, decreases in cognitive and visual perceptions, damage to the sensitivity of sight, decrease in peripheral sensory sensitivity, and disorders in the vestibular system . Stroke can result in various problems when performing activities of daily life, such as eating, clothing, bathing and moving, eventually leading to partial or complete dependency2, 3 . Stroke limits body function, and its effects vary depending on the location of the affected area and the level of injury sustained, and it often induces other disorders involving cognition, visual perception, sensation, and linguistic abilities4 . Cognitive impairment often accompanies various neurological disorders such as stroke . Mobility is also affected when stroke patients experience cognitive disorders over a long period . As cognitive impairment increases the difficulty of rehabilitation, a therapeutic approach involving cognitive impairment is vital for rehabilitation training, and cognitive rehabilitation using an integrated treatment method is essential . There are many methods of treatment for increase of cognitive functions, such as music therapy, reminiscence therapy, methods for compensating cognitive functions such as memory assistants, methods for improving memory capability using picture cards or family photos, methods for inducing improvement in learning ability through virtual reality for people with memory damage, and computer assisted cognitive rehabilitation (cacr)2 . It provides objective evaluation and instant feedback on the patients task performance, and also gives cognitive training based on the neuropsychological patterns of patients to stimulate the damaged location2, 6 . Clinical use of cacr has increased in the treatment of neurological patients, since its level of difficulty can be adjusted to suit an individual s cognitive level, which reduces treatment time and costs7, 8 . In order to eliminate problems arising from cultural and linguistic differences, cacr has been translated into the korean language and is being used in clinics, and investigations on the effectiveness of cacr for brain - damaged patients are continuing9, 10 . Recent developments in medical engineering have led to increased clinical use of cacr in the cognitive rehabilitation field . However, only a limited number of studies have investigated the effectiveness of brain wave changes and cognitive improvements using this training method to treat stroke patients . This study aimed to determine the most effective treatment method for clinicians in the cognitive rehabilitation field by investigating the changes in stroke patients brain waves, memory and attention elicited by cacr, and the manner in which these changes affect daily life . The study participants were chosen from among thirty stroke patients who were hospitalized and receiving occupational therapy and physical therapy at a general hospital in kyeongki province between december 2013 and january 2014 . The general characteristics of the participants are shown in the table 1table 1.general characteristicscacrcongender (male / female)7/59/4age (years)60.04.763.76.3lesion side (right / left)9/38/5duration (month)5.32.36.02.2mmse (score)18.84.120.53.2education (years)11.01.610.71.8all variables are the meanstandard deviation (sd). Cacr: computer assisted cognitive rehabilitation training group; con: control group; mmse: mini mental state examination . Participant selection criteria were: hemiparetic stroke patients with stroke onset within 3 months to 1 year, who were able to follow verbal instructions, and communicate to a certain level . In addition, participants were chosen from among patients who were able to perform all tests and had experienced light cognitive function failures that scored between 18 and 23 on the mini mental state examination (mmse). Subjects were excluded if they had diplegia, had never attended a school, were biased, or had received cacr within the past year . All the patients who participated in this study signed a written consent form after receiving a full explanation of the expected result and side effects of the study . Cacr training was conducted over a period of 6 weeks, in consideration of the hospitalization period . As the participants were recruited successively, the training was conducted over 8 weeks . The control group received occupational therapy and physical therapy, for half an hour 5 times a week for 6 weeks . The cacr group received the same rehabilitation as the control group with extra cacr training for half an hour 5 times a week for 6 weeks . All of the protocols used in this study were approved by gachon university . Before beginning the study, the procedures, risks and benefits the cacr program used in the present study, rehacom (hospi, seoul, korea), was developed in 1989, and has been used for clinical purposes and in previous research11 . It provides cognitive rehabilitation treatment for patients with cognitive disorders or deficiency with the help of a computer . Feedback on the result during and after the treatment is provided, which is helpful for completing the training and developing the right learning strategies for the patient . A joystick and touch screen can be used as the input device in rehacom, and the patients could complete the training using a reaction board while seated and watching the screen . The attention and concentration programs were chosen from the various cacr programs of rehacom and performed for 30 minutes each time according to each patient s functional ability; the awakening, reactivity, attention and concentration, simultaneous attention, and selective attention programs were used . Cacr: computer assisted cognitive rehabilitation training group; con: control group; mmse: mini mental state examination qeeg-8 (laxtha inc ., the participants were seated in a comfortable chair, and the method of the trial was explained before brain wave measurements were performed . The poles were checked after being attached to the participant s scalp to determine if they were functioning properly . After a 3-minute break, brain waves were measured for 3 minutes while the participants stared at a designated spot to the front in a fixed posture . The brain wave poles were attached to 8 regions of the scalp, and brain waves were measured using the monopolar derivation method . Eight poles were attached in the following order: left frontopolar lobe (fp1), right frontopolar lobe (fp2), left frontal lobe (f3), right frontal lobe (f4), left temporal lobe (t3), right temporal lobe (t4), left parietal lobe (p3), and right parietal lobe (p4). The reference electrode was attached behind the right earlobe, and the ground electrode was attached to the left earlobe . A computerized neurocognitive function test (cnt) was used to assess memory and attention . It is comprised of 5 main categories and 17 sub - test for brain disorders . Among these sub - tests, the digit span test (dst) and visual span test (vst), which test memory, and the visual continuous performance test (vcpt) and auditory controlled continuous performance test (accpt), which test attention, were used . These four tests, dst, vst, vcpt, and accpt were performed in order from the easiest to the hardest, and they were performed by everyone in the same order . When the patients used the touch screen, we let the patients use their non - paralyzed arms12 . 12.0 was used to calculate the averages and standard deviations . The significance of brain wave, memory and attention differences within a group, before and after the treatment, was tested using the paired t - test, and the significance of differences between the groups was tested using the independent t - test . Change of brain waves at the eight channels and cnt with respect to cacr training are shown in tables 2table 2.comparison of relative beta waveseegchannelcacrconprepostprepostrelative beta wave (hz)fp10.090.050.150.080.090.060.100.06fp20.080.040.130.080.080.060.090.06f30.100.040.150.070.090.020.090.03f40.100.030.160.080.100.050.100.05t30.160.070.180.080.140.050.160.05t40.140.050.180.070.140.050.140.05p30.100.020.140.070.090.01470.090.01p40.090.020.130.070.090.010.090.02all variables are the meanstandard deviation (sd); p<0.05; p<0.01; cacr: computer assisted cognitive rehabilitation training group; con: control group; fp1: left frontopolar; fp2: right frontopolar; f3: left frontal; f4: right frontal; t3: left temporal; t4: right temporal; p3: left parietal; p4: right parietal and 3table 3.comparison of memory and attentioncntsubtestcacrconprepostprepostmemory (digit)dstforward test3.430.534.590.774.091.204.101.22backward test2.270.683.281.042.551.182.791.44vstforward test3.980.925.171.443.960.754.070.96backward test2.931.093.721.603.211.153.301.13attention (digit)vcptcorrect response119.834.26123.001.70121.071.49122.003.48reaction time (sec)0.780.070.610.150.680.130.590.09accptcorrect response57.411.8856.911.1657.841.5757.762.31reaction time (sec)0.650.140.620.140.620.170.610.18all variables are the meanstandard deviation (sd); p<0.05; p<0.01; cnt: computerized neurocognitive function test; cacr: computer assisted cognitive rehabilitation training group; con: control group; dst: digit span test; vst: visual span test; vcpt: visual continuous performance test; accpt: auditory controlled continuous performance test . The cacr group showed before and after test changes (p<0.05) in the frontal lobe (fp1, fp2 and f4) and the parietal lobe (p3 and p4), but no notable changes were observed in control group . The cacr group showed a statistically significant difference in cnt memory (dst & vst forward / backward test) (p<0.01) and attention (vcpt correct response) (p<0.05), but no notable changes were observed in the control group . All variables are the meanstandard deviation (sd); p<0.05; p<0.01; cacr: computer assisted cognitive rehabilitation training group; con: control group; fp1: left frontopolar; fp2: right frontopolar; f3: left frontal; f4: right frontal; t3: left temporal; t4: right temporal; p3: left parietal; p4: right parietal all variables are the meanstandard deviation (sd); p<0.05; p<0.01; cnt: computerized neurocognitive function test; cacr: computer assisted cognitive rehabilitation training group; con: control group; dst: digit span test; vst: visual span test; vcpt: visual continuous performance test; accpt: auditory controlled continuous performance test this study investigated the beta wave, memory and attention changes in stroke subjects after cacr training . The activities that affect brain activation in each part of the brain include attention and judgement related which are processed in assignments for the frontal lobe and assignments that require perception for spatial and temporal information and which are processed in language for the parietal lobe13, 14 . The main role of the prefrontal cortex includes cognitive activities such as dealing with new situations, whereas the frontoparietal cortex is concerned with space and controlling intended motions15, 16 . The relative beta waves of each channel following training showed that the frontal lobe (fp1, fp2, f4) and the parietal lobe (p3, p4) had higher brain activity in the cacr group . Moreover, the relative beta wave exhibited increased activation in the frontal lobe (f3) and the parietal lobe (p4) in the cacr group compared to the control group . In a study by kim et al.17, brain injury patients and healthy individuals performed 10 attention assignments of comcog cacr training . Functional mri showed that the frontal and temporoparietal lobes were more activated than the temporooccipital lobe, supplementary motor area, and anterior cingulate gyrus before the intervention than in healthy controls . However, after the cognitive training the frontal lobe activation had decreased and the anterior cingulate gyrus and right parietal lobe were more activated . This result reflects the improvement in the patients cognition elicited by cacr, and continuing the cacr may have spread the activation to other parts of the brain . Moreover, a difference in the level of brain activation could be predicted based on the extent of injury that had been sustained by the patient, indicating the necessity of more subdivided and specialized research into the differences in brain activation depending on which area of the brain is injured . Cacr can be performed by patients with a wide range of cognitive function . However, for a more effective treatment, it will be necessary to select different treatments for different diagnoses, inhibitory vs. reward brain waves as appropriate for the diagnosis . To obtain better evidence of the effects of cacr training, standardized and accurate eeg measurement and analysis of more than 8 channels will be necessary . Cnt concentration assessments can check the attention deficit of brain damaged patients, and it can also be used as an indicator of the degree of brain damage or recovery of a patient12 . Shim et al.9 conducted comcog cacr, with traditional rehabilitation therapy for stroke hemiplegic patients, and the results of cognitive function assessments with cnt showed that the cacr group showed significant improvements in memory and attention compared to the group that only received traditional rehabilitation therapy . In our study, the cacr group showed a significant difference in cnt memory (dst and vst forward / back ward test) (p<0.05) attention (vcpt correct response) (p<0.05), but no notable changes were observed in the control group . Cacr practice based on cognitive rehabilitation therapy usually focuses on memory and attention, and kim et al.10 reported significant improvements in long - term and short - term memory after cacr memory training, and gilsky18 showed that even though brain - damaged patients are slower than normal people, they can still acquire a great deal of knowledge and skills related to everyday life . The results cited above indicate that cacr is more helpful at improving the cognitive function of stroke patients than the use of traditional rehabilitation alone . Besides these effects, cacr, which use computer games, is a helpful therapeutic mediation method, considering the convenience and appeal of games . The recovery depends on the injured area and the injury period; however, intensive rehabilitation, duration, and the patients will to recover also play important roles19 . A rehabilitation method, which is performed over a long period, should be easy and interesting to maintain the active participation of the patient . The average age of the participants in this study was 60.0 years, and thus, most patients were unfamiliar with computers and electronic devices . However, the patients were familiar with program selection and the assignment after the second run, and most of the participants actively participated in the cacr . Standardized and more accurate brain wave measurement and analysis are required to provide sufficient evidence of the benefits of cacr training . In addition, if cognitive function recovery can be expedited by conducting cacr for stroke patients with cognitive injury, the patients would be expected to have a quicker rehabilitation . Thus, cacr program development and activation are required, and more specialized research based on the location of the brain lesion in patients with cognitive injury would be beneficial.
|
Appropriate management of moderate postoperative pain is well achieved associating several analgesic drugs with adjuvant agents through synergistic interaction . The potential advantage of this combined therapy is related to the minimization of the incidences of adverse effects of each drug and to the improvement of the outcome . Postoperative clinical situations, such as difficult patient extubation, respiratory depression due to opioids, and cardiovascular side effects, require a combined therapy to improve analgesia quality and decrease adverse effects of each drug when used alone . This has led to administering pain drugs in continuous intravenous (iv) infusion with different mechanisms and sites of action, together with adjuvant agents . Tramadol hydrochloride (hcl) and ketorolac tromethamine are analgesic drugs commonly used in combination in postoperative pain management . Tramadol hcl is a synthetic, centrally acting analgesic with no anti - inflammatory activity and one of the most interesting and useful weak opioids for treatment of moderate to moderately severe pain with weak -receptor agonist properties and noradrenergic and serotonergic neurotransmission effects. [39] ketorolac tromethamine is a potent nonsteroidal anti - inflammatory drug (nsaid) with analgesic efficacy similar to opioids. [289] this drug is administered to treat moderate pain or, combined with reduced opioid doses, for severe pain . According to some studies, metoclopramide hcl as an adjuvant agent can improve analgesia and decrease the need for other pain drugs; it is a dopamine and 5-ht receptor antagonist, commonly used as a prokinetic and antiemetic . Also, this has been recently investigated as an agent that can enhance the efficacy of analgesic drugs. [91113] some studies have also suggested a role of magnesium sulfate (mgso4) as an adjuvant agent, an n - methyl - d - aspartate receptor antagonist, in the management of postoperative pain . The perioperative administration of iv mgso 4 is associated with smaller analgesic requirements, and magnesium sulfate could be of interest as an adjuvant to postoperative analgesia. [1416] the aim of this study was to investigate the chemical stability of tramadol hcl combined with ketorolac tromethamine and metoclopramide hcl in solution for 48 h (25c) and 5 days (5c), with the presence of mgso4 . Milan, italy) 2 mg / ml, tramadol hcl (contramal; grnenthal, gmbh, stolberg, germany) 20 mg / ml, and ketorolac tromethamine (lixidol; roche s.p.a ., milan, italy) 6 mg / ml stock solutions were prepared in high - performance liquid chromatographic (hplc)-grade deionized water and stored at 4c during experimental assay . Well - defined volume samples were drawn from each stock solution, joined, and diluted in deionized water to produce 5 working standard solutions, with concentrations in the range of 0.51.5 g / ml for metoclopramide hcl, 2060 g / ml for tramadol hcl, and 39 g / ml for ketorolac tromethamine . Every 48 h the working standard solutions were prepared from stock solutions and stored at 4c . Limit of quantitation (loq) values were found to be 1, 0.5, and 0.1 g / ml for tramadol, ketorolac, and metoclopramide, respectively . Limit of detection (lod) values were 0.05, 0.2, and 0.1 g / ml for tramadol, ketorolac, and metoclopramide . Precision and accuracy were determined on spiked samples at 4 concentrations with respect to a calibration graph prepared every day (n = 3). The precision of the method was evaluated as the intra- and interday relative standard deviation (rsd) of the measured peak areas by assaying spiked samples at 4 different concentrations . All samples for these purposes were freshly prepared, including preparing the standard solution from the same stock solution . Six drug admixtures were prepared by transferring the contents of one ampule of metoclopramide hcl, 4 ampules of tramadol hcl, 2 ampules of ketorolac tromethamine, and 4 ampules of mgso4 (1 g/10 ml ampule, magnesio solfato monico; monico s.p.a ., venezia mestre, italy) to give each a final volume of 52 ml . All the solutions were prepared on different days, stored at 25c and assessed over a period of 48 h. solutions were stored in amber colored glass bottles with air - tight caps to protect them from direct light exposure . The nominal concentration of each drug in all prepared solutions was 0.19 mg / ml for metoclopramide hcl, 7.69 mg / ml for tramadol hcl, and 1.15 mg / ml for ketorolac tromethamine . All the drug admixtures were visually inspected immediately after preparation (0 h) and at 24 and 48 h against a black and white background to ensure any physical changes (eg, color, phase separation, precipitation). A 100 l sample was drawn from each solution at intervals of 0 (initial), 24, and 48 h and diluted to 20 ml with deionized water; we prepared solutions in triplicate at each time interval to have 54 samples . Twenty microliters of each sample was injected into the hplc system to determine concentration of each drug . As previously described, 6 drug admixtures were prepared on different days, stored at 5c (refrigerated), assessed, and visually inspected at intervals of 0 (initial), 1, 3, and 5 days . A 100 l of sample was drawn from each solution and diluted to 20 ml with deionized water; we prepared solutions in triplicate at each time interval to have 72 samples . Twenty microliters of each sample was injected into the hplc system to determine concentration of each drug . The hplc method developed by kk et al was modified for use in this study. [1718] the instrumentation included a binary pump (model g1312a; agilent technologies; hewlett - packard, waldbronn, germany) and an ultraviolet (uv)variable wavelength detector (model g1314a; agilent). At the beginning of our study, we looked for the maximum uv absorption wavelength for each drug solution on the basis of uv spectra for each solution . As we used uv variable wavelength detector, and metoclopramide and tramadol retention times were very close reciprocally, we found that 271 nm was the best wavelength for both drugs to have good sensitivity and maximum signal / noise ratio . For ketorolac drug solutions separation was achieved using a reversed - phase c18 5 m particle size column (luna c18 (2) 100a, 150 4.6 mm; chemtek analytica srl, anzola emilia (bo), italy), equipped with a 2-cm precolumn, which was maintained at 25c with a column temperature controller (thermosphere ts-130; phenomenex, torrance, california). Hplc - gradient analysis were performed using the following mobile phase: 0.01 m phosphate buffer, potassium dihydrogen phosphate [kh2po4] ultra for molecular biology (fluka and riedel - de han, buchs sg, switzerland) and acetonitrile (sigma - aldrich supelco, bellefonte, pennsylvania) (75:25, v / v) with the addition of 0.1% triethylamine, adjusted to ph 3 with phosphoric acid (solvent a) and h2o acetonitrile (50:50, v / v, solvent b). 0% b, 610 min 80% b, 1015 min 0% b [table 1]. The elution - gradient program each mobile phase was prepared fresh daily, filtered through a 0.45 m 47 mm nylon membrane filter (supelco, bellefonte, pennsylvania nylon 66 filter membranes pore size 0.20 m, diameter 47 mm), and degassed ultrasonically for 20 min before use . The flow rate was 1 ml / min, and the injected volume was 20 l . The run time was 15 min and the approximate retention times for metoclopramide, tramadol, and ketorolac were 2.8, 3.4, and 13.4 min, respectively [figure 1]. Uv chromatogram of metoclopramide hydrochloride (a), tramadol hydrochloride (b), and ketorolac tromethamine (c), eluted at 2.8, 3.4, and 13.4 min, respectively . Calibration curves were produced using linear regression of the peak area against concentration of each drug [table 2]. We obtained 5 calibration curves for each drug and all the curves were linear over the concentration ranges considered for each drug: metoclopramide hcl r = 0.991; tramadol hcl r = 0.995; ketorolac tromethamine r = 0.961 . The results were averaged and analyzed by linear simple regression model of y = mx + q by the least - squares method . The t test was used to examine the concentration difference at each time, and the significance level of error was less than 0.001 . Linear simple regression model (y = mx + q) by the least - squares method all the data reported in tables 3 and 4 were submitted to anova and differences analyzed by tukey's honestly significant differences test . No significant admixture and time - dependent effect interactions were observed (p 0.05). Percentage% sd of metoclopramide hydrochloride, tramadol hydrochloride, and ketorolac tromethamine remaining in the admixtures with magnesium sulfate after storage at 25c for 48 h percentage% sd of metoclopramide hydrochloride, tramadol hydrochloride, and ketorolac tromethamine remaining in the admixtures with magnesium sulfate stored at 5c for 5 days milan, italy) 2 mg / ml, tramadol hcl (contramal; grnenthal, gmbh, stolberg, germany) 20 mg / ml, and ketorolac tromethamine (lixidol; roche s.p.a ., milan, italy) 6 mg / ml stock solutions were prepared in high - performance liquid chromatographic (hplc)-grade deionized water and stored at 4c during experimental assay . Well - defined volume samples were drawn from each stock solution, joined, and diluted in deionized water to produce 5 working standard solutions, with concentrations in the range of 0.51.5 g / ml for metoclopramide hcl, 2060 g / ml for tramadol hcl, and 39 g / ml for ketorolac tromethamine . Every 48 h the working standard solutions were prepared from stock solutions and stored at 4c . Limit of quantitation (loq) values were found to be 1, 0.5, and 0.1 g / ml for tramadol, ketorolac, and metoclopramide, respectively . Limit of detection (lod) values were 0.05, 0.2, and 0.1 g / ml for tramadol, ketorolac, and metoclopramide . Precision and accuracy were determined on spiked samples at 4 concentrations with respect to a calibration graph prepared every day (n = 3). The precision of the method was evaluated as the intra- and interday relative standard deviation (rsd) of the measured peak areas by assaying spiked samples at 4 different concentrations . All samples for these purposes were freshly prepared, including preparing the standard solution from the same stock solution . Six drug admixtures were prepared by transferring the contents of one ampule of metoclopramide hcl, 4 ampules of tramadol hcl, 2 ampules of ketorolac tromethamine, and 4 ampules of mgso4 (1 g/10 ml ampule, magnesio solfato monico; monico s.p.a ., venezia mestre, italy) to give each a final volume of 52 ml . All the solutions were prepared on different days, stored at 25c and assessed over a period of 48 h. solutions were stored in amber colored glass bottles with air - tight caps to protect them from direct light exposure . The nominal concentration of each drug in all prepared solutions was 0.19 mg / ml for metoclopramide hcl, 7.69 mg / ml for tramadol hcl, and 1.15 mg / ml for ketorolac tromethamine . All the drug admixtures were visually inspected immediately after preparation (0 h) and at 24 and 48 h against a black and white background to ensure any physical changes (eg, color, phase separation, precipitation). A 100 l sample was drawn from each solution at intervals of 0 (initial), 24, and 48 h and diluted to 20 ml with deionized water; we prepared solutions in triplicate at each time interval to have 54 samples . Twenty microliters of each sample was injected into the hplc system to determine concentration of each drug . As previously described, 6 drug admixtures were prepared on different days, stored at 5c (refrigerated), assessed, and visually inspected at intervals of 0 (initial), 1, 3, and 5 days . A 100 l of sample was drawn from each solution and diluted to 20 ml with deionized water; we prepared solutions in triplicate at each time interval to have 72 samples . Twenty microliters of each sample was injected into the hplc system to determine concentration of each drug . The hplc method developed by kk et al was modified for use in this study. [1718] the instrumentation included a binary pump (model g1312a; agilent technologies; hewlett - packard, waldbronn, germany) and an ultraviolet (uv)variable wavelength detector (model g1314a; agilent). At the beginning of our study, we looked for the maximum uv absorption wavelength for each drug solution on the basis of uv spectra for each solution . As we used uv variable wavelength detector, and metoclopramide and tramadol retention times were very close reciprocally, we found that 271 nm was the best wavelength for both drugs to have good sensitivity and maximum signal / noise ratio . For ketorolac drug solutions, we found that 323 nm was the best absorption wavelength . Separation was achieved using a reversed - phase c18 5 m particle size column (luna c18 (2) 100a, 150 4.6 mm; chemtek analytica srl, anzola emilia (bo), italy), equipped with a 2-cm precolumn, which was maintained at 25c with a column temperature controller (thermosphere ts-130; phenomenex, torrance, california). Hplc - gradient analysis were performed using the following mobile phase: 0.01 m phosphate buffer, potassium dihydrogen phosphate [kh2po4] ultra for molecular biology (fluka and riedel - de han, buchs sg, switzerland) and acetonitrile (sigma - aldrich supelco, bellefonte, pennsylvania) (75:25, v / v) with the addition of 0.1% triethylamine, adjusted to ph 3 with phosphoric acid (solvent a) and h2o acetonitrile (50:50, v / v, solvent b). The elution - gradient program was 06 min 0% b, 610 min 80% b, 1015 min 0% b [table 1]. The elution - gradient program each mobile phase was prepared fresh daily, filtered through a 0.45 m 47 mm nylon membrane filter (supelco, bellefonte, pennsylvania nylon 66 filter membranes pore size 0.20 m, diameter 47 mm), and degassed ultrasonically for 20 min before use . The flow rate was 1 ml / min, and the injected volume was 20 l . The run time was 15 min and the approximate retention times for metoclopramide, tramadol, and ketorolac were 2.8, 3.4, and 13.4 min, respectively [figure 1]. Uv chromatogram of metoclopramide hydrochloride (a), tramadol hydrochloride (b), and ketorolac tromethamine (c), eluted at 2.8, 3.4, and 13.4 min, respectively . Calibration curves were produced using linear regression of the peak area against concentration of each drug [table 2]. We obtained 5 calibration curves for each drug and all the curves were linear over the concentration ranges considered for each drug: metoclopramide hcl r = 0.991; tramadol hcl r = 0.995; ketorolac tromethamine r = 0.961 . The results were averaged and analyzed by linear simple regression model of y = mx + q by the least - squares method . The t test was used to examine the concentration difference at each time, and the significance level of error was less than 0.001 . Linear simple regression model (y = mx + q) by the least - squares method all the data reported in tables 3 and 4 no significant admixture and time - dependent effect interactions were observed (p 0.05). Percentage% sd of metoclopramide hydrochloride, tramadol hydrochloride, and ketorolac tromethamine remaining in the admixtures with magnesium sulfate after storage at 25c for 48 h percentage% sd of metoclopramide hydrochloride, tramadol hydrochloride, and ketorolac tromethamine remaining in the admixtures with magnesium sulfate stored at 5c for 5 days at the mediterranean institute for transplantation and highly specialized therapies (ismett, palermo, italy) is already using an experimental protocol for the treatment of moderate to severe pain, which involves the administration of intravenous mixture of tramadol (7.69 mg / ml), metoclopramide (0.19 mg / ml), ketorolac (1.15 mg / ml), and magnesium sulfate (77 mg / ml). To use this drug combination is necessary that the drugs are compatible with each other and the mixture is stable over time . Table 3 shows drugs solution concentration after storage period up to 48 h. the data obtained are in agreement with data reported in the literature regarding a mixture of tramadol, ketorolac, metoclopramide, and ranitidine in a solution for intravenous perfusion . Data reported in table 4 show the remaining percentage of drug concentrations in all admixtures prepared and assessed over a period of 5 days . It is possible to observe constant percentage concentrations remaining for all the 3 drugs at 1, 3, and 5 days when stored at 5c . We believe that the information has clinical utility in facilitating the preparation and dispensing of the tramadol, metoclopramide, ketorolac, and magnesium sulfate mixture in postoperative pain management . On the basis of our results, the mixture may be considered for a possible commercial formulation, at the concentrations listed . In this study, precise and accurate hplc method suitable for stability evaluation of tramadol hcl combined with ketorolac tromethamine and metoclopramide hcl is described . The physical appearance of the solutions remained constant during the study period, without the formation of any visible discoloration, cloudiness, or precipitation . In admixtures containing mgso4 and stored at 25c, each drug, at the same time, reached at least 98% of the initial concentration during 48 h. solutions prepared adding mgso4 assessed over a period of 5 days at 5c show the lower confidence limit of the estimated regression line of the concentration at 98% of the initial concentration . Within these limits, for the purpose of pre - preparing drug admixtures to use with confidence, tramadol hcl infusions may be prepared in advance and then thawed before use in clinical units . Moreover, information about the chemical stability of the drugs could be utilized in further investigations focused on iv infusion solutions.
|
When a septal deviation (sd) is present during the endoscopy performed before a transcanalicular diode laser - assisted dacryocystorhinostomy (tcl dcr), one tends to think that this anatomical alteration could influence the final result, due to technical difficulties and alterations in osteotomy healing . Dacryocystorhinostomy (dcr) is the surgical treatment for opening up lacrimal pathways [1, 2]. There are three types of dcrs: external, endoscopic, and transcanalicular approach [36]. We use the transcanalicular approach (tcl dcr) for all patients, except recurrences, which we treat externally . Endoscopically nasosinusal anatomical variations may appear, such as septal deviation (sd), inferior turbinate hypertrophy, and concha bullosa [79]. We designed the present study in order to investigate the influence of nasal septal deviation on the surgery of lacrimal pathways . If significant influence cannot be proved, then previous or concomitant septoplasty could be avoided in candidates for surgery of the lacrimal pathways (lp). From january 1, 2008, until december 31, 2010, one hundred and twenty - four patients were considered candidates for tcl dcr surgery, so they were included in this study . A protocol was designed, including personal data, medical history, and degree of epiphora . In order to quantify and standardize the degree of epiphora candidates for tcl dcr surgery had to meet the following conditions: need to dry tears more than 5 times a day (munk score: 35), blockage of the vertical part of the lacrimal pathways, presence of lacrimal sac proved by dacryocystography, symptoms (epiphora), chronic dacryocystitis, and/or a history of acute episodes . The patients were seen by the otorhinolaryngologist and the ophthalmologist in the same follow - up visit, in order to assess the feasibility of tcl dcr; septal deviations were noted . During this multidisciplinary consultation, we chose a classification based on the distance separating septum from lateral nasal wall: mild (less than 50% the distance from septum to nasal wall); moderate (greater than 50% the said distance); and severe (septum touched the lateral nasal wall). Patients younger than eighteen, with previous dcr (whatever the technique), with other disorders of ocular annexes, or lacking in motivation (they interfere with the munk score) were excluded on this study . All patients signed the consent form for tcl dcr to participate in this clinical trial and were operated on without taking into consideration the presence of sd or the lack of it . This device uses an ingaasp diode laser generator and a semiconductor with a wavelength of 980 nm (5) with a maximum input power of 20 w. the corresponding silica optical fiber was sterile and disposable, measuring 600 microns . The ent used a karl storz tube with an optical angle of 0 degrees . During the postoperative period topical treatment twenty - four hours after surgery nasal irrigation with saline water and topical nasal applications of fluticasone furoate were prescribed . During the follow - up revisions endoscopies (one month, three months, and six months) were performed and traces of fibrin were removed; an assessment was also carried out, taking into account presence of epiphora (munk scale), positive or negative nasal syringing with fluids, and endoscopic appearance of the osteotomy site . Surgery was deemed success when the patients scored 0 or 1 on the munk scale, in which they had to dry tears twice or less than twice a day, six months after the operation . Therefore, we considered failure when they scored 2 to 5 on the munk scale . We divided the patients who had undergone tcl dcr into two groups: one group included lp with no anatomical nasosinusal variants and the other lp group was with sd or other nasosinusal alterations . This prospective, nonexperimental clinical study was carried out correlating clinical features with a longitudinal analysis . Dichotomous variable presence or absence of sd has been studied and compared in both groups . Contrasts referred to equality of means of anova like duration of procedure, age, and duration of epiphora in years, pearson's correlation coefficient like age and duration of epiphora, or modeling explanatory ability of those predictor variables acting on probability of success, using the logistic regression model like successful syringing at 3 and 6 months after operation, presence of granulomas, presence of synechiae, presence of postoperative granulomas, and presence of sd, have been used . The study included 124 patients, in which 159 lp operations were performed, 102 lp (64.15%) did not have any anatomical variants, and 57 lp (35.84%) had anatomical variants . Out of these 57 lp with anatomical variants, 39 had sd (68.42%): in 21 of them it was mild (53.84%), in 15 it was moderate sd (38.46%), and in 3 it was severe sd (7.6%). Other anatomical alterations were found in the remaining 18 lp (31.57%): one lp with concha bullosa (0%) and 17 lp with hypertrophic inferior turbinate (51%). In the group with no anatomical alterations, 69 lp had a successful postoperative outcome (67.6%). In the sd group, 26 lp had a successful postoperative outcome (66.7%). According to the logit method, the difference between both groups in postoperative outcome was not significant (p> 0.05). If we compare the success rate of the sd group (66.7%) and other anatomical alterations (44.1%) in our study, the difference is statistically significant (p <0.05). We also compared success rates in each sd group (mild, moderate, and severe). The success rate for each group was as follows: 66.67% for mild sd; 66.60% for moderate sd; and 66.66% for severe sd . In patients with severe sd (3), a previous septoplasty was necessary in order to make a correct tcl dcr possible later on, as a part of the same surgical procedure . There were no complications during or after these procedures, no intraoperative bleeding, and no postoperative infection and all patients were discharged 4 - 5 hours after the operation . The demographic data collected for our sample agree with that found in worldwide medical literature, as far as sex [1315], age [1316], and race are concerned . There was a higher success rate in the sd group (66.7%) compared to the rest of anatomical alterations (success in this latter group amounted to 44.1%), but the former had a lower success rate when compared to the group with no anatomical alterations (67.6%). Most of septal deviations (69.6%) are inferior ridges or posterior deviations, so they did not need surgery . There is no need for previous or concomitant septoplasty in some cases like mild and moderate sd, because the success rate was similar . All severe sd were operated on during the same procedure; therefore, access to the middle meatus in the nasal fossa presented no difficulties . One month and three months later, most patients scored 0 to 1 on the munk scale . It could change the scores from 0 to 2 over the course of the 6 months following surgery, so the success rate would decrease . We have not found articles referring to surgical success in patients with sd in scientific literature . In our study, we found no significant statistical differences between the success rate in the two groups . Furthermore, we could avoid previous or concomitant septoplasty in some cases like mild and moderate sd because the success rate was similar to nonseptal deviation group.
|
An estimated 9 million people contracted mycobacterium tuberculosis in 2013, with a further 1.5 million deaths attributed to tuberculosis (tb) infection and coinfection with hiv (1). Vaccination is widely accepted to be the most effective method for control of an infectious disease . The current tb vaccine, mycobacterium bovis bcg, is most commonly delivered as an intradermal (i.d .) It is known to reduce the occurrence of disseminated forms of childhood tb (2) but displays variable efficacy against the infectious forms of adult pulmonary disease, suggesting that bcg - induced immunity may decline over time (3, 4). While several novel vaccines have progressed to clinical trials (5), none has yet improved upon the limited protection afforded by intradermal bcg vaccination . Typically, novel vaccines are delivered via a parenteral route, and, consequently, attention is now refocused on alternative routes for vaccine delivery, specifically aligning the route of vaccination with the natural route of tb infection using aerosol delivery methods (69). Bcg has been shown to enhance protection against experimental m. tuberculosis infection when delivered intranasally or by aerosol to mice (10, 11) and as an aerosol to guinea pigs (12, 13) or rhesus macaques (14). However, the previous aerosol bcg immunization studies did not investigate in detail the immunological mechanisms underlying this protection . There is an established division of labor between effector t cells (tem) able to migrate to peripheral tissues through the expression of tissue - specific homing markers to execute inflammatory functions and central memory t cells (tcm) that reside within secondary lymphoid tissues ready to proliferate and replenish the tem pool (15). The t - cell response to active tb infection has been shown to favor the tem phenotype, with tcm more prevalent in latently infected individuals (16). Vaccine - induced tem responses have been associated with protection against viral pathogens (17), and tem populations have been investigated and detected following systemic bcg vaccination (18). Hence, it has been hypothesized that the current bcg vaccination induces tem populations capable of the short - term control of m. tuberculosis infection but poorly induces the tcm populations required for long - term protection (19). Currently there is no validated correlate of protection against m. tuberculosis infection, but a cell - mediated t - helper 1 (th1) response from cd4 t cells (20) and probably a major histocompatability class (mhc) i restricted cd8 response (21) are known to be important for successful control of the disease . In the absence of a true correlate, functional markers such as gamma interferon (ifn-), the quality of the t - cell response has been highlighted as important to the induction of memory t cells (22), and multifunctional cd4 cells expressing combinations of the cytokines ifn-, tumor necrosis factor alpha (tnf-), and interleukin-2 (il-2) have been implicated both in the active phase of the disease (23) and as correlates of vaccine - induced protection (2426). However, there is also evidence contradicting the legitimacy of these multifunctional cells as markers of anti - tb protective immunity (27), which highlights the likely complexity of the immune response required for tuberculosis immunity . Indeed, it is now clear that the cd4 t - helper response is diverse and includes cells of the th17 lineage . Il-17 production has been implicated in the induction and maintenance of the th1 response following bcg vaccination and recruitment of cells to the lung following infection with m. tuberculosis (28, 29) and correlates with improved outcome following m. tuberculosis exposure in nonhuman primates (nhp) (30). The nhp model has many advantages over other species for the study of potential tb vaccines . These include the similarity of primate anatomy, physiology, susceptibility to low - dose aerosol infection, and, crucially, immune response to those of humans (31, 32). In this study, we used the rhesus macaque model to investigate mucosal and systemic immune responses induced following aerosol bcg vaccination . In doing so, we reveal features of the aerosol - induced immune response that may contribute to the enhanced protection reported in the literature and inform future vaccination strategies and the search for correlates of protection . Bcg was aerosolized by nebulization with the omron microair device, and the effect of this on vaccine viability was investigated . Serum institut [ssi], copenhagen, denmark) reconstituted in phosphate - buffered saline (pbs) were aerosolized through a sealed system to prevent loss of aerosol to the atmosphere, and cells were passively collected by condensation into sterile deionized water . The condensate was plated onto middlebrook 7h11 selective agar containing oleic acid, bovine albumin, dextrose, and catalase (oadc) (biomrieux, basingstoke, united kingdom) for enumeration of viable cfu . In parallel, cfu were measured in a nonaerosolized aliquot of identical bcg solution to enable quantification of any change in bacterial viability associated with the aerosolization process . To estimate the aerosol vaccination dose, losses associated with the nebulization apparatus and procedure were measured . Bcg vaccine solution was nebulized through the omron microair device with an unsealed pediatric face mask, and the aerosol was collected in an all - glass impinger (agi) (ace glass inc ., viable cfu in collected aerosols were determined alongside those in nonaerosolized bcg solution as described above . Eight rhesus macaques (macaca mulatta) of indian origin aged between 4.6 and 5.2 years of age were obtained from an established united kingdom breeding colony . The absence of a previous exposure to mycobacterial antigens was confirmed by tuberculin skin tests as part of the colony management procedures and by screening for ifn- enzyme - linked immunosorbent spot (elispot) assay (mabtech, nacka, sweden) responses to purified protein derivative (ppd) (ssi, copenhagen, denmark) and pooled 15-mer peptides of early secreted antigen target 6 (esat-6) and 10-kda culture filtrate antigen (cfp-10) (peptide protein research ltd ., animals were housed in compatible social groups, in accordance with the home office (united kingdom) code of practice for the housing and care of animals used in scientific procedures (1989) and the national committee for refinement, reduction and replacement (nc3rs) guidelines on primate accommodation, care and use, august 2006 . For each procedure, sedation was applied by intramuscular injection with 10 mg ketamine hydrochloride (ketaset; fort dodge animal health ltd ., all animal procedures were approved by the public health england ethical review committee, porton down, united kingdom, and authorized under an appropriate united kingdom home office project license . Sedated animals were exposed to aerosolized bcg danish strain 1331 (ssi, copenhagen, denmark) using an omron microair mesh nebulizer (omron healthcare united kingdom ltd . Vaccine doses were selected to be equivalent to or 1/10 of a standard adult intradermal dose after the expected losses in bcg titer associated with the aerosol delivery process were taken into account . Bcg vaccine was prepared by adding 1 ml of pbs to each vaccine vial to give an estimated concentration of 2 10 to 8 10 cfu / ml . Multiple vials were pooled to ensure standardization between vaccinations, and 1/10 dose solutions were created by diluting this stock 1:10 with pbs before delivering 1 ml of the appropriate preparation to each animal . Animals were sedated at two weekly intervals for blood sample collection and measurement of body weight and body temperature, red blood cell (rbc) hemoglobin levels, and erythrocyte sedimentation rates (esr). Rbc hemoglobin was measured using a hemocue hemoglobinometer (hemocue ltd ., dronfield, united kingdom), and the esr was measured using the sediplast system (guest medical, edenbridge, united kingdom). Animal behavior was observed throughout the study for contraindicators, including depression, withdrawal from the group, aggression, changes in feeding patterns, respiration rate, or coughing . Bronchoalveolar lavage (bal) fluid was collected at 4-week intervals, as described previously (6). Gamma interferon (ifn-) elispot assays were performed on peripheral blood mononuclear cells isolated from heparin anticoagulated blood using standard methods, as previously described (6). Intracellular cytokine staining (ics) was performed on 1 10 bal fluid cells or peripheral blood mononuclear cells (pbmcs) in medium (r10) consisting of rpmi 1640 supplemented with l - glutamine (2 mm), penicillin (50 u / ml), streptomycin (50 g / ml), and 10% heat - inactivated fetal bovine serum . These cells were stimulated with a 10 g / ml solution of cd28 and cd49d costimulatory antibodies (both from bd biosciences, oxford, united kingdom) and 10 g / ml ppd (ssi, copenhagen, denmark), 5 g / ml staphylococcal enterotoxin b (seb) (sigma - aldrich, gillingham, united kingdom), or r10 medium alone as a negative control . Intracellular cytokine staining to evaluate antigen - specific production of the cytokines ifn-, tnf-, il-2, and il-17 was performed as previously described (6). Immunophenotyping was performed using 1 10 freshly isolated pbmcs or bal fluid cells incubated for 30 min at room temperature with optimal dilutions of the following fluorescent antibodies: cd3-af700, cd4-allophycocyanin (apc)-h7, cd8-fluorescein isothiocyanate (fitc), cd95 pecy7, ccr7-phycoerythrin (pe), cd29-apc, and cd49d - bv711 (all from bd biosciences, oxford, united kingdom), cd28-bv421 (biolegend, london, united kingdom), and cd14-ecd and cd20-ecd (beckman coulter, high wycombe, united kingdom). The amine - reactive live / dead fixable red dead cell stain kit was from life technologies (renfrew, united kingdom). Bd compbeads (bd biosciences) were labeled with the above fluorochromes and used as compensation controls . Following antibody labeling, cells and beads were washed by centrifugation and fixed in 4% paraformaldehyde solution (sigma - aldrich, gillingham, united kingdom) prior to flow cytometric acquisition . Cells were analyzed using a four - laser lsr ii flow cytometer (bd biosciences, oxford, united kingdom). Cytokine - secreting t cells were identified using a forward scatter height (fsc - h) versus side scatter area (ssc - a) dot plot to identify the lymphocyte population, to which appropriate gating strategies were applied to exclude doublet events, nonviable cells, monocytes (cd14), and b cells (cd20). For ics analysis, sequential gating through cd3, cd4, and cd8 or cd3, cd8, and cd4 cells was used before individual cytokine gates to identify ifn--, il-2-, tnf--, and il-17-producing subsets . For phenotyping analysis, cd4 and cd8 populations were identified using bivariate dot plots before assessment of homing marker expression using cd29 (1 integrin chain) versus cd49d (4 integrin chain) bivariate plots (see fig . T - cell memory profiles were identified by gating on cd4 or cd8 populations with high surface staining for cd95, before differentiation of cd28 and ccr7 expression (see fig . 6 and 7e to h). All data were analyzed using flowjo (version 9.7.6; tree star, ashland, or, usa). Polyfunctional cells were identified using boolean gating combinations of individual cytokine - producing cd4 or cd8 t cells . The software package pestle (version 1.7) was used for background subtraction to obtain antigen - specific ics assay responses, and spice (version 5.35) was used to generate graphical representations of flow cytometry data (mario roederer, vaccine research center, niaid, nih). Levels of anti - tuberculin ppd igg in serum samples were measured by enzyme - linked immunosorbent assays (elisas). High protein binding capacity polystyrene plates (fisher scientific, loughborough, united kingdom) were coated with a 1 g / ml solution of tuberculin ppd (ssi, copenhagen, denmark) suspended in ph 9.5 carbonate - bicarbonate buffer (scientific laboratory supplies, hessle, united kingdom). Plates were washed and blocked using pbs plus 5% dried milk powder (bd biosciences, oxford, united kingdom) before addition of 2-fold serial dilutions of serum samples . Following incubation, the plates were washed and incubated with 0.3 g / ml goat anti - monkey igg - horseradish peroxidase (hrp) (insight biotechnology ltd ., wembley, united kingdom)., eden prairie, mn, usa) was added to the wells, and the wells were incubated at room temperature for 10 min . The reaction was stopped by the addition of 2 m sulfuric acid (fisher scientific, loughborough, united kingdom), and the absorbance at 450 nm was measured immediately . Antibody titers were determined by linear regression of the sample dilution series and are expressed as arbitrary units relative to the mean prevaccination levels . Before necropsy, animals were anesthetized with ketamine (15 mg / ml intramuscularly [i.m . ]), weighed, and photographed, clinical data were collected, and exsanguination was performed via the heart, before termination by injection of a lethal dose of anesthetic (140 mg / kg dolethal; vtoquinol, ltd ., united kingdom). Samples of spleen, liver, kidneys, lymph nodes (hilar, inguinal, mesenteric, axillary, and colonic), tonsil, brain, olfactory bulb, heart and pericardium, small intestine (ileum, jejunum, and duodenum), transverse colon, eye, and the upper left lung lobe were removed, dissected on sterile trays, and placed into formalin - buffered saline for gross pathology and histopathology analysis . Representative sections from the tissues described above were processed to paraffin wax, cut at 5 m, and stained with hematoxylin and eosin (h&e) for microscopic examination . Comparisons of ex vivo elispot assay responses and serum igg titers were completed using the area under the curve (auc) of each animal's response calculated using sigmaplot version 10 (systat software inc ., auc values were compared between test groups using the nonparametric mann - whitney u test, minitab version 15 (minitab ltd ., coventry, united kingdom). To compare t - cell functional profiles measured by polyfunctional flow cytometry and t - cell homing and memory marker expression between vaccination groups, t - cell subset frequencies were compared using a wilcoxon rank test at each analysis time point (spice version 5.35). Similarly, vaccine - induced changes in t - cell functional profiles and memory or homing marker expression within each vaccination group were assessed by comparing frequencies at each analysis time point with mean baseline values . Negative values in antigen - specific ics data generated by background subtraction were replaced by a minimum threshold value (33). The viability of bcg following aerosolization through a sealed system was confirmed by bacterial culture and comparison to nonaerosolized vaccine stock preparations . Stock solutions had viable counts of 4.4 10 cfu / ml, compared to mean counts of 3.15 10 cfu / ml 6.4 10 cfu / ml from passively collected aerosols . To estimate the aerosol vaccine dose, bcg was aerosolized through the unsealed nebulizer with a pediatric face mask and actively collected under conditions mimicking macaque respiration . Stock solutions of bcg had viable cfu counts of 5.35 10 cfu / ml, whereas the mean cfu collected from four repeat nebulizations of bcg solution was 4.49 10 cfu / ml 2.37 10 cfu / ml . This represented a 1.08-log10 reduction in viable bcg cfu / ml, implying that the aerosol bcg dose would be approximately 10-fold less than the titer of the nebulized bcg solution . There were no observed perturbations beyond the normal ranges in body weight, temperature, peripheral lymph node size, red cell hemoglobin concentration, or erythrocyte sedimentation rate following aerosol bcg vaccinations . Histopathology analysis by h&e staining of secondary lymphoid tissues did not reveal any adverse findings attributable to the bcg vaccination or route of administration . Systemic immune responses induced by aerosol bcg vaccination were profiled using an ex vivo ifn- elispot assay . Increases in ppd - specific ifn- spot - forming unit (sfu) frequencies were observed from 8 weeks after aerosol vaccination and reached significance at weeks 10 and 13 in both vaccination groups (p = 0.03) (fig . Significant differences were not detected between i.d .- equivalent and lower - dose aerosol vaccination groups when elispot assay aucs measured across the study time course were compared by the mann - whitney u test (p = 0.34). Frequencies of systemic ppd - specific ifn- spot - forming units (sfu) measured by elispot assay . The frequencies of ppd - specific ifn- sfu were measured in pbmcs following vaccination with aerosol - delivered bcg equivalent to a standard i.d . Dose (aero 1) (a) and 10-fold less than a standard i.d . Dose (aero 1/10) (b). Panels a and b show sfu frequencies in individual animals, whereas panel c depicts vaccination group median sfu standard deviations . Antigen - specific production of the cytokines ifn-, tnf-, il-2, and il-17 by cd4 and cd8 t cells was measured throughout the study by multiparameter ics (fig . 2 and 3). Cytokine production by cd4 and cd8 t cells in bal fluid and pbmcs was characteristic of a th1- and th17-type response . A clear dose response was evident in both the mucosal and systemic t - cell populations, with significantly greater frequencies of ifn--, il-2-, and tnf--producing cd4 cells (p = 0.02) and ifn--producing cd8 t cells (p = 0.02) detected in bal fluid 13 weeks after aerosol bcg vaccination equivalent to a standard i.d . Dose . Aerosol bcg vaccination induces both th1 and th17 type cytokines in cd4 t cells isolated from bal fluid (a, b) and peripheral blood (c, d). The bar charts display median values of the individual cytokines ifn-, tnf-, il-2, and il-17 produced prior to vaccination (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with a dose equivalent to (a, c) or 1/10 of (b, d) a standard i.d . Dose . Cytokine frequencies in individual animals are represented by dots (n = 4 per vaccination group). Cd8 t - cell cytokine production in bal fluid (a, b) and pbmcs (c, d) is indicative of an effector phenotype lacking il-2 production . The bar charts display median values of the individual cytokines ifn-, tnf-, il-2, and il-17 produced prior to vaccination (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with a dose equivalent to (a, c) or 1/10 of (b, d) a standard i.d . Dose . Cytokine frequencies in individual animals are represented by dots (n = 4 per vaccination group). Mucosal and systemic polyfunctional profiles of cd4 and cd8 t cells producing combinations of the cytokines ifn-, il-2, and tnf- following aerosol bcg vaccination were measured throughout the study . Cd4 responses induced by aerosol vaccination in bal fluid cells were significantly above the prevaccination levels in four distinct profiles: ifn-, il-2, and tnf- triple - positive cells (p = 0.02), ifn- and tnf- dual - positive cells (p = 0.02), and ifn-- or tnf--producing single - positive cells (p = 0.02) (fig . 4a and b). A clear dose response was apparent between the vaccination groups in terms of mucosal cd4 t cells, with the frequency of triple - positive cells (p = 0.02), ifn- and tnf- dual - positive cells (p = 0.02), and ifn- only - producing cells (p = 0.02) significantly greater following vaccination via the aerosol route with a dose equivalent to a standard i.d . Vaccination . Cd8 t cells in bal fluid and pbmcs were found to produce ifn- or tnf- or both cytokines simultaneously (fig . Cd8 t cells producing tnf- increased significantly in bal fluid and were detected in pbmc samples following aerosol bcg vaccination . Ppd - specific polyfunctional cd4 t - cell profiles measured in bal fluid and pbmcs . The bar charts represent vaccination group median values for cytokine frequencies in bal fluid (a, b) and pbmcs (c, d) prior to vaccination (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with 1/10 of (a, c) or the equivalent of (b, d) a standard adult i.d . Dose . Cytokine frequencies in individual animals are represented by dots (n = 4 per vaccination group). Ppd - specific polyfunctional cd8 t - cell profiles measured in bal fluid and pbmcs . The bar charts represent vaccination group median values for cytokine frequencies in bal fluid (a, b) and pbmcs (c, d) prior to vaccination (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with 1/10 of (a, c) or the equivalent of (b, d) a standard adult i.d . Dose . Cytokine frequencies in individual animals are represented by dots (n = 4 per vaccination group). Central and effector memory t - cell populations are identified in the rhesus macaque by expression of cell activation markers such as cd95, followed by differential expression patterns of the costimulatory receptor cd28 and lymph node homing marker ccr7 . Therefore, the central - to - effector memory axis was determined as cd28 ccr7 (tcm), cd28 ccr7 (transitional effector memory cells [transem]), and fully differentiated cd28 ccr7 (tem) (fig . 6e to h and 7e to h) (34, 35). Using this classification, t - cell memory profiles were assessed on cells isolated from bal fluid and pbmcs at regular intervals throughout the study . Cd4 and cd8 t cells from bal fluid remained polarized in an effector t - cell phenotype throughout the study . Cd4 t cells primarily occupied a transem profile; cd8 restricted cells were approximately evenly split between the transem and the fully differentiated tem phenotype (fig . 6a and b and 7a and b). A similar pattern was observed in cd4 and cd8 effector memory subsets isolated from peripheral blood but was accompanied by significant increases in tcm frequency . This tcm expansion was most pronounced in the cd4 subset and was seen in both aerosol vaccination groups . Expanded tcm populations remained elevated following aerosol bcg vaccination with a dose equivalent to the standard i.d . Bcg vaccination, whereas the population had contracted and was significantly lower in the 1/10 dose group 13 weeks after vaccination (p = 0.02) (fig . Cd4 t cells isolated from bal fluid samples remain polarized in an effector phenotype, whereas pbmc tcm populations expand following aerosol bcg vaccination . Cd4 memory phenotype analysis of bal fluid cells (a, b) and pbmcs (c, d) collected at baseline (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with 1/10 of (a, c) or the equivalent of (b, d) a standard adult i.d . The box plots show interquartile ranges (iqr) with medians represented as horizontal bars . Representative bivariate flow cytometry plots showing sequential gating of cd95-stained populations and definition of central to effector memory t - cell populations by patterns of cd28 and ccr7 expression in cells isolated from bal fluid (e, f) and pbmcs (g, h). Cd8 memory t - cell populations display a predominately effector memory phenotype split between the transem and tem subsets . Memory phenotype analysis applied to bal fluid mononuclear cells (a, b) and pbmcs (c, d) collected at baseline (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination with 1/10 of (a, c) or the equivalent of (b, d) a standard adult i.d . Dose . Representative bivariate flow cytometry plots showing sequential gating of cd95-stained populations and definition of central to effector memory t - cell populations by patterns of cd28 and ccr7 expression in cells isolated from bal fluid (e, f) and pbmcs (g, h). T - cell expression patterns of the 4 and 1 integrin chains were investigated as putative t - cell lung homing markers (fig . Dose - related differences in expression profiles were not observed following aerosol vaccination; therefore, data from the high- and lower - dose vaccination groups were combined for analysis purposes . The 41 integrin chains were highly expressed on cd4 and cd8 t cells isolated from bal fluid prior to vaccination and remained consistently high throughout the study, with a significant increase in 41 coexpression on cd4 t cells 13 weeks following vaccination (fig . The expression patterns on pbmcs were more varied and generally remained consistent throughout the study, although a trend for reduced 41 detection in the cd8 subset was noted 4 weeks after vaccination and was accompanied by a significant increase in the proportion of 41 double - negative cells at this time point (fig . 41 integrins are expressed at high frequency by bal fluid cd4 and cd8 t cells, whereas more varied expression is observed in pbmcs . Expression of the 41 integrin lung homing markers on cd4 and cd8 t cells was measured in cells isolated from bal fluid (a, c) and pbmcs (b, d). The box plots show vaccination group medians and iqr of 41 integrin expression prior to vaccination (pb) and at weeks 4, 8, and 13 after aerosol bcg vaccination (standard i.d . Dose equivalent and 1/10 dose vaccination groups combined). Patterns of homing marker expression on cd4 t cells isolated from bal fluid are displayed in panel a and from pbmcs in panel b. equivalent cd8 t - cell profiles are shown in panels c and d. representative bivariate flow cytometry plots of 4 integrin (cd49d) and 1 integrin (cd29) chain staining on cd4 t cells isolated from bal fluid (e) and pbmcs (f). Levels of tuberculin ppd - specific igg were measured in serum samples at selected time points throughout the study using a ppd elisa . Median anti - ppd igg titers increased in both vaccination groups relative to the prevaccination levels but had subsided 10 weeks later in the lower - dose vaccination group . Anti - tuberculin ppd igg titers measured in serum samples following vaccination with aerosol - delivered bcg equivalent to a standard adult i.d . Dose (aero 1) (a) and 10-fold less than a standard adult i.d . Dose (aero 1/10) (b). Igg titers were established relative to the mean prevaccination levels (arbitrary units). Panels a and b show igg titers measured in individual animals, whereas panel c depicts vaccination group median titers standard deviations . Despite a concerted global effort, tb remains a leading cause of mortality from an infectious agent . In recent years, the search for novel vaccines to improve upon the protection afforded by conventionally delivered bcg has begun to focus on alternative routes for vaccine delivery . Aerosol delivery of tb vaccines to the mucosal surface of the lung is a rational approach for localizing a vaccine - induced response at the primary site of infection . Such an approach has proven practical and effective in the context of measles vaccination (36) and has recently proven safe and immunogenic in clinical trials of the novel tb vaccine mva85a (7). Aerosol - delivered bcg vaccination has previously been shown to afford enhanced protection against inhaled m. tuberculosis infection in the rhesus macaque (14). However, these studies did not describe the host response underpinning this protection . With this assessment of the immunogenicity of aerosol bcg vaccination, we highlight features of the mycobacterium - specific t - cell response induced via the mucosal vaccination route that may contribute to the enhanced protection observed in previous studies . Moreover, in comparison with recently published studies describing equivalent immunogenicity measures applied following i.d . Bcg vaccination in age - matched rhesus macaques, a comparison can be drawn between the immune responses induced by each vaccination route (6). Multifunctional t - cell responses are thought to be an important component of a protective immune response against intracellular pathogens, including m. tuberculosis (2426), and have been shown to be involved during the active phase of tuberculosis infection (23). Our results show that polyfunctional cd4 t cells are detected in the lung following aerosol vaccination and that the functional repertoire of cd4 and cd8 t cells induced by aerosol bcg was consistent with that reported in our prior studies of i.d . However, the frequency of antigen - specific cells was observed to increase at later time points following aerosol vaccination (6, 32). In addition, aerosol vaccination also induced tnf--secreting cd8 populations detectable at the mucosal surfaces or in the periphery . As antigen - specific tnf- production has been implicated as a protective factor in the control of tuberculosis (37, 38) and anti - tnf- therapy has been demonstrated to induce reactivation of latent infection (39, 40), this could prove to be an important factor in the protection imparted by aerosol bcg vaccination . Delayed t - cell activation is an established phenomenon associated with m. tuberculosis infection and is often in contrast with the kinetics observed following infection with comparable intracellular pathogens and viruses (4145). Our study suggests that the route of bcg vaccination has a significant impact on the kinetics of the cell - mediated response . This was seen as a delay in the peripheral response measured by the ifn- elispot assay, which was detected approximately 8 weeks following aerosol vaccination, whereas intradermally delivered bcg responses typically occur by week 4 (6, 32). Moreover, a similar trend was observed in cd4 t - cell cytokine production, including that of polyfunctional t cells, measured in bal fluid and pbmcs, which was delayed relative to the cytokine production observed in prior i.d . This is also a notable retarding of t - cell induction relative to that observed following m. tuberculosis infection via the respiratory route, where ppd - specific ifn- sfu are usually detected within 4 weeks of infection in immunologically naive animals (32). Furthermore, such delayed activation of the mycobacterium - specific response may explain the protection observed in prior studies by barclay et al . (14), as their study design delivered the m. tuberculosis challenge 8 weeks following vaccination, which would be during the peak of the primary aerosol bcg - induced vaccine response . Bcg is primarily administered to infants or adolescents and confers protection against disseminated childhood forms of tuberculosis (2). However, the longevity of this protection is thought to wane beyond the adolescent years, suggesting that intradermally delivered bcg weakly induces long - lived memory t - cell responses (3, 4). Our t - cell memory phenotyping analysis shows that aerosol - delivered bcg leads to significant expansion of circulating cd4 central memory populations . This expansion persisted for at least 3 months following vaccination, after which point there was evidence for contraction of the tcm population in the lower - dose vaccination group . While different models exist to describe the development pathway of memory t - cell populations (46, 47), most agree that induction of the tcm subset leads to long - lived populations residing within secondary lymphoid tissues . However, we recognize that ours is a relatively short - term study and that longer time scales are required to assess the longevity of these cells beyond the primary phase of the vaccine response . Furthermore, measurement of functional markers such as cytokine production, cytotoxicity, and proliferation within the memory t - cell subsets is required to assess the antigen - specific recall capacity of these cells . In agreement with previous observations, our data confirm that the t - cell repertoire within the lung is biased toward an effector phenotype (35, 48). This is further supported by the high levels of th1 and th17 effector cytokines we detected in cells isolated from bal fluid . The homing capacity to peripheral organs is a key feature of tem (47), and expression of the 41 integrin cell surface adhesion markers has been linked with t - cell enrichment in the lung (49) and lung localization of ppd - specific ifn--producing cd4 cells in m. tuberculosis - infected patients (50). To investigate whether these markers could be used as correlates of mucosal immunity, we followed the surface expression dynamics of the 41 integrin chains following aerosol bcg vaccination . Our data confirm that cd4 and cd8 t cells isolated from bal wash fluid coexpress 41 at a high level, supporting the use of these markers as a measure of lung homing capacity . However, expression frequencies remained unchanged in both bal fluid and pbmc samples following vaccination . We believe this highlights the limitation of measuring global frequencies of these markers, which inevitably reduces an assay's sensitivity to detect small changes within the total t - cell pool . Therefore, characterization of homing marker expression on cells executing antigen - specific functions should be a priority for future studies . Aerosol delivery of vaccines is a practical proposition in the clinical setting, holding many advantages over conventional needle - based approaches . The safety of delivering novel tb vaccines to rhesus macaques and healthy human volunteers has recently been established (69). However, despite the excellent safety record of bcg, particular caution is warranted in the context of delivering live, attenuated bacilli to the lung and nasopharyngeal surfaces . The primary objective of this study was to characterize the immunological profiles induced by aerosol bcg and contrast these with existing i.d . In addition, we are able to report that aerosol bcg was well tolerated, with no contraindications observed in the clinical parameters measured . Moreover, histopathology analysis of secondary lymphoid tissues did not reveal any adverse findings attributable to the bcg vaccination or route of administration . However, further studies are required to demonstrate the safety of this approach before trials in human volunteers and immunocompromised individuals . Consequently, we intend to further investigate the efficacy of aerosol bcg vaccination and characterize the events following low - dose experimental m. tuberculosis infection to confirm the protection reported in the literature and further interrogate correlates of mucosal immunity and protection.
|
Various etiologies of cutaneous horn reported in literature till date111213 though cutaneous horns have been described in the literature for many years, they still remain novel to many clinicians especially when located in unusual areas like the genitalia . They usually appear in uncovered areas and/or from constant irritation over the scalp or face . It resembles the horn of an animal but has no bony structure inside . Despite the typical appearance of cutaneous horn, there can be a wide range of pathology at the base ranging from benign, premalignant to malignant changes . A 47-year - old man presented with a raised painless growth over the prepuce for the last 4 months . Twelve years ago, he was diagnosed with testicular seminoma of the right side . The tumor was excised, and six cycles of cisplatin - based chemotherapy were given . Physical examination revealed a solitary, firm, nontender and well - circumscribed horn - like projection over the prepuce at 2 o clock position [figure 1]. A clinical diagnosis of the penile cutaneous horn was considered, and a punch biopsy was performed . Clinical image of cutaneous horn over the prepuce histopathological examination showed a raised lesion in the epidermis with hyperkeratosis, mounds of parakeratosis, focal hypergranulosis and marked irregular acanthosis with elongated [figure 2] and inwardly curving rete pegs that enclosed several cavernously dilated thin - walled blood vessels within the papillary dermis [figure 3]. A few of these blood vessels toward the base of the lesion showed fibrin thrombi . Photomicrograph showing hyperkeratosis, papillomatosis, acanthosis and blood filled cavernous vessels in the papillary dermis (h and e, 4) photomicrograph showing hyperkeratosis, papillomatosis and marked acanthosis with inwardly bending broad rete pegs enclosing cavernous blood vessels with fibrin thrombi (h and e, 4) a diagnosis of solitary angiokeratoma presenting as the cutaneous horn was established based on the clinical presentation and histopathological findings . Cutaneous horn (cornu cutaneum) is a clinical entity that appears as a conical protuberance over the skin surface and resembles a minuscule animal horn . They are of different shapes and sizes and can have satellite horns . By definition, it is a circumscribed conical markedly hyperkeratotic lesion in which the height of the keratotic mass amounts to at least half of its largest diameter . On the other hand, angiokeratoma has a pleomorphic appearance varying from papules, nodules, plaques which may be single or multiple . Of the many clinical variants, solitary angiokeratoma represents an acquired disorder presenting as single warty papule . Solitary angiokeratoma presenting as the cutaneous horn is a rarity, scarcely described in the literature . Cutaneous horn could develop on a variety of skin conditions which can be benign, premalignant or malignant [table 1]. A study analyzing 643 cases histopathologically had reported the most common causes for cutaneous horns to be benign (61.1%), followed by premalignant (23.2%) and malignant (15.7%) in that order . It was based on clinical appearance, apparent causation and histology [table 2]. Montgomery's classification as of today, there is no precise clinical information to make a distinction of benign or malignant etiology for a cutaneous horn . In general, clinical pointers toward malignancy they are usually larger and harder at their base due to inflammation and are present at unusual sites such as genitalia . The presence of a malignancy elsewhere in the body supports the probability of cutaneous horn to be malignant . It is important to know the primary pathology which has led to the cutaneous horn to rule out malignancy and to direct prospective further therapy . The present case report highlights the presence of a solitary angiokeratoma as cutaneous horn over the prepuce, which has not been reported before . The present case report highlights the presence of a solitary angiokeratoma as cutaneous horn over the prepuce, which has not been reported before . The present case report highlights the presence of a solitary angiokeratoma as cutaneous horn over the prepuce, which has not been reported before.
|
In most classifications of tibial plateau fractures, including one used most widely - schatzker classification, fractures are described as a combination of medial and lateral condyle, primarily in the sagittal plane . Coronal component of these fractures, affecting the posterior tibial condyle is now well recognized . What is not described is anterior coronal component of the fracture, what we are calling anterior tibial condyle fracture . These fractures are often missed on routine antero - posterior and lateral knee x - rays due to an overlap between the fracture and the normal bone . Eight cases of anterior tibial condyle fractures with posterior subluxation of the tibia, six of which were missed by the initial surgeon and two referred to us early, are described . Primary outcome measures such as union of the fracture, residual flexion deformity, range of motion and stability were studied at the end of 6 months . All operated fractures united . There was no posterior sag in any . In those presenting late and were operated, the flexion deformity got corrected in all (average from 15 to 0) and mean flexion achieved was 100 (range: 80 - 120). In those presenting early and were operated, there was no flexion deformity at 6 months and a mean flexion achieved was 115 (range: 100 - 130). They should be suspected, diagnosed early and treated by reconstruction of anterior condyle, posterior cruciate ligament reconstruction . Tibial plateau fractures are commonly described as a combination of fractures affecting medial, lateral or both condyles in the sagittal plane.1 fractures of the posterior condyle of the tibia have been described in the literature,23 but we did not come across a description of anterior tibial condyle fracture on an extensive search of english literature . We define anterior tibial condyle fractures as those affecting anterior one - third of the medial condyle, extending to a variable degree to the lateral side [figure 1]. The importance of reporting this injury lies in the fact that it is likely to be missed by the initial treating doctor, as has happened in six out of eight cases in this series . Delay in treatment results in fixed posterior subluxation of the knee, making it technically difficult to treat at a later date . We have described our technique of treating this injury . A line diagram showing anterior tibial condyle fracture we are reporting a total of eight cases, six presenting late (between 3 and 7 months) and two referred to us early (within 1 week, range: 2 - 6 days). They were in the age group of 21 - 45 years (mean 35 years). All patients had sustained the injury in road traffic accidents, the exact mechanism of injury could not be ascertained . In all the cases presenting late, the fracture was missed by the initial treating doctor and they were treated as soft - tissue injury . All patients were treated for 3 - 6 weeks with immobilization in a plaster of paris cast, followed by physiotherapy . A detailed clinical evaluation was done to record range of motion (rom), deformity and stability . Posterior subluxation was passively completely correctable in one and to a variable extent in others . They all had a flexion deformity in the range of 10 - 30, with terminal loss of flexion of 30 - 40. two of the patients had common peroneal nerve palsy . The x - ray showed fracture of the anterior condyle of tibia with subtle posterior subluxation . X - rays and clinical picture of a representative case is as shown in figure 2 . Only 2 of the 6 patients in this late group accepted surgery . In one, the posterior subluxation was correctable whereas in the other, initial surgical mobilization of the tibial plateau was done from posteromedial approach to correct fixed posterior subluxation . Once the posterior subluxation was corrected, it was held in place with pcl reconstruction using hamstring graft . It was observed that with pcl reconstruction alone, the femoral condyle had a tendency to slide into the depressed malunited anterior tibial condyle . Hence, anterior tibial condyle was lifted by an open wedge osteotomy from front, stabilized by an osteochondral graft and a radius t - buttress plate anteriorly [figure 3]. The patients were kept nonweight bearing for 4 weeks, with rom exercises commencing on day 1 . After 4 weeks, the patients were allowed to partially weight bear and full weight bear at the end of 12 weeks . Clinical photographs (a and b) showing posterior subluxation of tibia and x - rays knee joint anteroposterior and lateral views (c) showing anterior tibial plateau fracture of a typical case, presenting late intraoperative photographs showing (a) depression of anterior condyle (b) osteotomy to elevate the depressed condyle (c) insertion of cortico cancellous graft (d) buttressing the graft with plate two other cases who presented early (within the 1 week of injury) had hemarthrosis and the tibia was subluxated posteriorly . On opening the joint, we noticed that the femoral condyle was dipping into the depression caused by the depressed anterior tibial condyle . We did reconstruction of the anterior tibial condyle from front using the technique described above and pcl reconstruction . The primary outcome measures of union of the fracture, deformity, rom and stability were studied at the end of 6 months . Secondarily the complications were studied as well as the presence or absence of posterior step off . We also made note of any operative / nonoperative procedures such as manipulation under anesthesia, that were done on the patients . The four patients who did not get operated (late un - operated group) continued to have flexion deformity of 20 (range 15 - 25) and range of flexion of average 69 (range 60 - 80). The common peroneal nerve injury in one of these four cases had not improved at the end of 6 months . All the fractures united with a posterior step off . In the group that presented late and were operated upon (late operated group), the flexion deformity got corrected in all of the cases (from an average of 15 - 0). Mean flexion achieved was 100 (range 80 - 120) and there was no posterior sag . The common peroneal nerve palsy in one of the case in this group recovered partially in 6 months . Both cases showed union at the fracture site at the end of 6 months [figure 4]. (a) clinical photographs of a patient presented late showing posterior sagging of tibia (b) x - rays of knee joint anteroposterior and lateral views showing tibial plateau injury (c) sagittal mri of same patient showing anterior tibial plateau injury (d) immediate postoperative x - ray of knee joint anteroposterior and lateral views showing implant in situ with reduction achieved in the group that presented early, there was no flexion deformity at the end of 6 months, the mean flexion achieved was of 115 (range: 100 - 130). The knee was stable with no posterior sag and there was union at the fracture site at the end of 6 months . The purpose of this paper is to report a hitherto not described injury - anterior tibial condyle fracture with posterior subluxation of tibia . We did not come across any reference to such an injury on extensive search of english literature . It seems that this fracture is missed often as is clear from our series where six out of eight cases were missed by the treating doctors . This also raises a question on relevance of commonly used schatzker's classification, which is based on considering the tibial plateau fracture a combination of medial and lateral pillars.1 not much attention has been paid to the coronal component of these injuries . Moore identified that the medial condyle fracture is often posteromedial and not purely medial, for which they recommended posteromedial plating.4 there have been reports where the fracture is in the coronal plane alone, involving only the posterior part of the medial condyle.3 in such cases, the fractured condyle is displaced posteriorly, carrying with it the medial femoral condyle . Such fractures can be missed on ap x - ray, but can be diagnosed in lateral x - rays . Coronal bicondylar tibial plateau fracture involving the posterior condyles have also been reported.3 the relevance of recognizing the coronal component of these fractures lies in the fact that the buttress plate has to be put from behind.5 lately, luo et al . Proposed, based on computed tomography (ct) evaluation, the concept of three - column in the treatment of tibial condyle fractures, where three columns were medial, lateral and posterior.6 it seems that inspite of such extensive work on tibial plateau fractures, the anterior condyle fractures have escaped attention . An anterior rim fracture detected on magnetic resonance imaging has been reported in radiology literature.78 this was only thought to be a useful indicator of associated pcl and posterolateral corner injuries . The anterior tibial plateau fractures reported by us are not merely that of the rim, but involve the anterior third of the tibial condyle . Whereas reconstruction of pcl would be required to keep the knee aligned in the sagittal plane, reconstruction of the anterior depressed tibial plateau fracture is mandatory not to let the femoral condyle slide into it . In our opinion, unless anterior bony stability is restored, an attempt at standalone pcl reconstruction may fail . We suspect that this fracture may be responsible for failure of pcl reconstruction in some cases where this fracture is co - existent and is not addressed too . We highlight the importance of early diagnosis of these fractures as they were missed in six out of eight cases in this series . This happened apparently as these are difficult to see on ap and lateral x - rays due to overlap . In the absence of routine use of ct scan in treatment of these fractures, the only clue in plain x - rays is subtle posterior subluxation of the tibia . Early diagnosis and early surgery is critical in these cases as delay in treatment results in the tibia remaining in a posteriorly subluxated position . There are long term implications of leaving the knee subluxated as it will cause abnormal loading on the tibiofemoral and patella - femoral joint resulting in early degeneration . Attempt at late surgery is technically more demanding as one has to dissect behind the tibial condyles to mobilize the tibia . It is required to stabilize the anterior coronal fracture with an anterior plate, similar to posterior fixation of coronal fractures in the posterior plane . We conclude that recognition of coronal component of the tibial condyle fracture, commonly posterior, but sometimes anterior, is important . Awareness that such an injury exists and suspecting it in a case with posterior subluxation of tibia, is the key to early diagnosis . Once diagnosed, an evaluation by ct scan and reconstruction of the depressed anterior condyle from front, in addition to pcl reconstruction is required.
|
Dexmedetomidine, the pharmacologically active d - isomer of medetomidine, is a highly selective and specific 2-adrenoceptor agonist . Dexmedetomidine, by its central sympatholytic action, promotes haemodynamic stability when used as an adjuvant during general anaesthesia . However, because of its sedative property, it is unknown if the recovery from anaesthesia would be delayed when used as continuous infusion . The aim of this study was to assess the effect of intravenous dexmedetomidine on perioperative haemodynamics and also postoperative recovery in elective surgical procedures with continuous monitoring of depth of anaesthesia by entropy analysis . After obtaining the approval from institutional ethical committee and written informed consent from patients, 60 patients with asa status i and ii, aged 1855 years, and undergoing elective surgical procedures were randomly allocated into two groups: group a (control group): sevoflurane fentanyl and group b (test group): sevoflurane dexmedetomidine . Patients older than 55 years, those with a history of psychiatric / neurological illness, hypertensive patients, morbidly obese patients, pregnant and nursing women, patients with known allergic reaction to any of the study medications, patients on recent use of sedatives or analgesics, and patients with significant laboratory abnormalities were excluded . On arrival in the operating room, patient's heart rate, blood pressure and oxygen saturation were monitored by continuous electrocardiogram (ecg), noninvasive blood pressure (nibp) monitor and pulse oximetry (spo2) monitor, respectively . Depth of anaesthesia was evaluated by entropy (state entropy, response entropy) analysis (datex - ohmeda s/5 avance workstation, ge healthcare, helsinki, finland). Glycopyrrolate 4 g / kg and ondansetron 0.15 mg/ kg intravenous were given as premedication in both the groups . Dexmedetomidine (2 ml diluted in 48 ml of saline) in a dose of 1 g / kg over 10 min through infusion pump . Ten minutes after the administration of the study drug, anaesthesia was induced with thiopentone sodium 5 mg / kg intravenous slowly . Anaesthesia was maintained with sevoflurane to a maximum of 2.5% end tidal to maintain the heart rate and blood pressure within 20% of the baseline value and entropy value between 40 and 60 . Patients in the test group received dexmedetomidine continuous infusion between 0.2 and 0.8 g/ kg / h . The anaesthesiologist was permitted to treat haemodynamic events, defined as heart rate and/or blood pressure more than 20% of baseline, in spite of increasing sevoflurane concentration to 2,5% and dexmedetomidine infusion to 0.8 g / kg, with incremental doses of metoprolol 25 mg, or fall in heart rate and blood pressure by more than 20% of baseline with ephedrine 5 mg intravenously . In group b, dexmedetomidine diclofenac sodium 1 mg / kg (max dose of 75 mg) was given intravenously in both groups at the time of skin closure . Immediately after extubation, sedation was assessed with sedation score as follows: 1, awake; 2, sleepy but arousable; and 3, sleepy difficulty to awake . In the postoperative period, if visual analogue score (vas) was> 6, inj . Heart rate, blood pressure, spo2 and entropy were recorded continuously at predetermined time intervals as per the protocol . Recovery was assessed by modified aldrete's and sedation score as follows: score 1, awake; score 2, sleepy but arousable; score 3, sleepy difficult to arouse . Statistical analysis was conducted with epi info software (version 3.5.3, 2011) for windows statistical package using unpaired t - test for continuous variables with normal distribution . The nonparametric kruskal wallis test was used for variables not normally distributed . For categorical variables, chi - square test and a sample size of 30 patients per group was needed to detect an intergroup difference of at least 10% in blood pressure and heart rate with a power of 0.80 and of 0.05 . The two groups were comparable regarding age, sex, weight and asa physical status . The type of surgery and duration of anaesthesia (p=0.27) were comparable between both groups . Pre - induction heart rate, systolic and diastolic blood pressure (sbp and dbp, respectively) were comparable between the two groups (p>0.05). At intubation, there was 10% rise in pulse rate from baseline in the test group as compared to 17% rise in the control group (p=0.01). Intraoperatively, the test group showed significant fall in mean heart rate from baseline as compared to the control group at all time points . The mean heart rate in the test group showed a 6% fall as compared to 3.7% rise in the control group from baseline . Post extubation, the test group showed significant fall in average pulse rate of 22.5% from baseline as compared to the control group which showed average 1% rise [figure 1]. Changes in heart rate (meanse): 5 and 10 min after the start of dexmedetomidine; at induction; at intubation; at 5, 10, 15, 30, 45 and 60 min post intubation; at extubation; at 5, 10, 15 and 30 min post extubation (da - dexmedetomidine administration; pi - post intubation; e - post extubation) ten minutes after administration of the test drug, significant fall in sbp and dbp of 6% and 9%, respectively, from baseline as compared to the control group was observed (p<0.05). At intubation, both the groups showed rise in sbp and dbp . The test group showed a rise of 6% versus 23% in sbp and 7% versus 20% in dbp as compared to the control group (p<0.05). Intraoperatively, a significant difference in the change of sbp and dbp from baseline was observed between the two groups at all time points till 60 min (p<0.05). The test group showed an average of 8% fall in sbp and dbp as compared to 3.6% rise in the control group [figure 2]. Post extubation at 30 min, a 12% fall in sbp was seen in the test group as compared to 0% in the control group (p<0.05), while change in diastolic pressure was not significantly different between the two groups . Changes in systolic and diastolic blood pressure (meanse): 5 and 10 min after the start of dexmedetomidine; at induction; at intubation; at 5, 10, 15, 30, 45 and 60 min post intubation; at extubation; at 5, 10, 15 and 30 min post extubation (da - dexmedetomidine administration; pi - post intubation; e - post extubation; sbp - systolic blood pressure; dbp - diastolic blood pressure) postoperatively, the test group showed significant sedation with a mean score of 1.430.50 at 2 h as compared to 1.00.0 of the control group (p=0.00). The recovery as assessed by modified aldrete's score was significantly better in the control group (10.000.0) as compared to the test group (8.060.64) at 30 min post extubation (p=0.00). However, modified aldrete's score significantly improved in the test group at the end of 2 h and was similar to that of control group . Postoperative analgesia as assessed by vas, showed significant analgesic effect of dexmedetomidine with a mean score of 5.700.60 as compared to 8.130.70 of the control group (p=0.00) [table 1]. Analgesia, sedation and recovery score post extubation bradycardia was observed in two patients in the dexmedetomidine group within 10 min post extubation, which promptly responded to inj . After operation, none of the patients in either of the groups complained of any discomfort or of intraoperative awareness . This prospective randomised study demonstrated that intraoperative infusion of dexmedetomidine attenuates stress responses to various noxious stimuli during surgery and maintains haemodynamic stability without the requirement of opioids with prolongation of recovery . Dexmedetomidine, a highly selective 2 agonist, has significant sympatholytic and haemodynamic stability property . Earlier studies have shown that dexmedetomidine attenuates stress response to intubation by decreasing central sympathetic outflow, thereby decreasing serum epinephrine and norepinephrine levels . These findings are consistent with our study results which showed a significant decrease in change in heart rate, systolic blood pressure and diastolic blood pressure . Tanskanen et al . In their study showed that intraoperative infusion of dexmedetomidine at a rate of 0.4 g / kg / h maintains heart rate and blood pressure in acceptable range for a longer duration as compared to placebo group . The decrease in heart rate and blood pressure is similar to the findings by feld et al . Who compared dexmedetomidine with fentanyl in bariatric surgery . Thus, showing that dexmedetomidine by its sympatholytic activity attenuates various stress responses during surgery and maintains haemodynamic stability . Our study showed a significant attenuation of heart rate at the time of extubation in dexmedetomidine group . Use of haemodynamic end points for assessing the depth of anaesthesia in a study on sympatholytic drugs such as dexmedetomidine would be unreliable as there may be compromise in the depth of anaesthesia . Thus, use of electroencephalogram - dependent indices such as bispectral index and entropy to measure the depth of anaesthesia would be appropriate . In our study, adequate depth of anaesthesia was maintained throughout surgery with response and state entropy being maintained between 40 and 60 . One of the most commonly encountered problems in postoperative anaesthetic care unit (pacu) is delayed recovery and longer discharge time of patients receiving perioperative dexmedetomidine infusion. [1315] similar findings were observed in our study . However, there was no difference between two groups at the end of 2 h. the delayed recovery might be due to the sedative property of dexmedetomidine . However, unlike opioids, sedation with dexmedetomidine is not associated with respiratory depression . In our study, dexmedetomidine was discontinued 20 min prior to extubation, thus we could not establish the potential benefit of dexmedetomidine in attenuating haemodynamic response at the time of extubation and during postoperative period . Also, recording the time taken to extubate after the completion of surgery would have established objectively the effect of dexmedetomidine on immediate recovery . Dexmedetomidine, when administered as a pre - anaesthetic medication and intraoperative infusion, attenuates stress response to various noxious stimuli and maintains haemodynamic stability . Dexmedetomidine's sedative property delays postoperative recovery, thus continuous monitoring is essential during the first few hours of postoperative period.
|
Paget's disease is a chronic bone disorder characterized by focal areas of excessive osteoclastic resorption accompanied by a secondary increase in osteoblastic activity, resulting in abnormal bone structure, bone expansion, and deformity . Scintigraphy using either tc99m - methylene diphosphonate or fluorine-18 (f-18) fluoride is the most useful method of detecting pagetic lesions . We report the imaging findings of a patient with paget's disease in carcinoma lung who underwent during staging and follow - up imaging using f-18-fluorodeoxyglucose (fdg) positron emission tomography / computed tomography (pet / ct). A 65-year - old male patient diagnosed to have right lower lobe lung adenocarcinoma was referred for fdg pet / ct for staging evaluation . Fdg pet - ct showed intense tracer uptake in the right lower lobe lung lesion along with multiple mediastinal and right supraclavicular lymph nodes [figure 1]. Furthermore, increased tracer uptake noted in the entire left hemipelvis with a maximum standardized uptake value (suvmax) of 5.3 . Ct showed cortical thickening, intra trabeculation with course thick trabeculae, bone expansion, and multiple areas of sclerosis, consistent with paget's disease [figure 2]. He underwent follow - up fdg pet - ct after three cycles of chemotherapy showed intense fdg uptake with decrease in size and metabolism of the lung primary and mediastinal nodes with complete response in supraclavicular and some mediastinal nodes . But left hemipelvis uptake remains same, and he was asymptomatic for paget's disease [figure 3]. Whole body fluorodeoxyglucose - positron emission tomography/ computed tomography (fdg pet / ct) maximum intensity projection image showing primary right lower lobe lung mass and mediastinal, right supraclavicular nodes . Furthermore, diffuse increased uptake in left hemipelvis noted (paget's disease) axial computed tomography of the pelvis showing left ilium cortical thickening, intra trabeculation with course thick trabeculae, bone expansion, and multiple areas of sclerosis, consistent with paget's disease whole body fluorodeoxyglucose - positron emission tomography/ computed tomography (fdg pet / ct) maximum intensity projection image showing decrease in primary right lower lobe lung mass and mediastinal nodes . Paget's disease is a disorder of unknown etiology with unevenly increased osteoclastic and osteoblastic skeletal remodeling . Bone involvement may be monostotic or polyostotic with characteristic radiographic features of osseous enlargement, deformity, and trabecular thickening . There is a rise in serum alp and abnormal remodeling of bone, leading to characteristic radiograph appearances of cotton wool appearance of the skull, ivory vertebra, and blade of grass shape in long bones . Fdg - pet is a tomographic technique, with superior spatial resolution compared with a bone scan, with the added ability to quantitatively measure (suvmax) disease activity, and monitor the response to treatment . The role of fdg - pet in paget's disease is not as yet well - elucidated . It is unclear whether paget's disease may lead to false - positive findings in oncological patients, or if fdg - pet can reliably differentiate benign pagetoid changes from metastatic and sarcomatous changes of bone . Some studies have concluded that paget's disease is not associated with fdg uptake in most of the cases, but fdg uptake may be seen in patients with more active disease . Previous reports of increased tracer uptake in paget's disease mimicking metastasis ina case of malignant mesothelioma and rectal cancer have been reported . We describe a case of increased fdg activity in pagetoid pelvis in lung cancer patient detected incidentally using pet / ct . The intense fdg focal uptake in the left hemipelvis lesion on fdg - pet in our case is a possibility of false positive findings in patients with cancer . Fused pet / ct images can add increased specificity in the characterization of an osseous lesion when compared with stand - alone pet by differentiating between the exact location of fdg uptake in these lesions . In general, cortical distribution of fdg uptake is more frequently seen in paget's disease, and a medullary distribution of fdg uptake is more often associated with osseous metastases . Computed tomography correlation may often improve the diagnostic accuracy of nonspecific fdg uptake in some patients, with the potential for discriminating between benign paget's disease and associated sarcomas . Coregistered pet / ct data may obviate the need for further evaluation or biopsy, as in our case, especially when ct scan findings are characteristic for paget's disease . Follow - up imaging was helpful as lung primary and nodes were responding to the chemotherapy but the pelvic lesion remains same confirming unrelated to lung cancer as paget's disease of pelvis.
|
Forty - eight patients diagnosed with pdd at the movement disorder outpatient clinic of the university hospitals based on the uk parkinson s disease society brain bank clinical diagnostic criteria and the clinical diagnostic criteria for probable pdd were enrolled . Clinical information included age, gender, disease duration, history of hypertension, diabetes mellitus, heart disease, dyslipidemia, and current medication . Data from complete physical and neurological examinations, laboratory tests, and brain magnetic resonance imaging were obtained . Patients 1) with a previous stroke or other neurological and psychiatric disorders, 2) atypical pd or secondary parkinsonism or 3) secondary causes of dementia were excluded . The levodopa equivalent daily dose was calculated as follows: dose of levodopa plus dose of dopamine agonists multiplied by equivalents (= 1 levodopa dose + 0.75 controlled release dose + 0.33 entacapone + 20 ropinirole dose + 100 pramipexole + 10 selegiline + 1 amantadine). When enrolled in this study, all patients had been diagnosed for the first time with dementia . No pd patient had ever taken anti - dementia drugs, antipsychotics, antidepressants or anxiolytics prior to this study . Information on memory problems and other subjective cognitive deficits was obtained from caregiver interviews . To assess neuropsychiatric symptoms, the npi comprises sub - questions in 12 different categories covering four major neuropsychiatric symptom domains: mood, apathy, agitation, and psychosis . Symptom frequency was rated on a scale of 1 to 4, and severity was rated on a scale of 1 to 3 . A composite score ranging from 1 to 12, defined as the product of frequency and severity, was calculated . In addition, npi sub - scores for each patient were analyzed using five different clusters of neuropsychiatric symptoms: 1) few and mild neuropsychiatric symptoms (n = 19), 2) high scores on depression, anxiety, apathy and low scores on the other items (mood group, n = 9), 3) high scores on apathy and low scores on the remaining items including depression (apathy group, n = 7), 4) moderate or severe sub - scores on the majority of items including irritability and agitation items (agitation group, n = 11), and 5) high scores on hallucinations and delusions together with low scores on the majority of other items (psychosis group, n = 2). The general cognitive status and dementia severity were evaluated using the korean version of the mini - mental state examination (mmse) and the clinical dementia rating (cdr) scale and global deterioration scale . Parkinsonian motor symptoms were evaluated using the unified parkinson s disease rating scale (updrs) part iii and the modified hoehn and yahr (h&y) scale when patients were on medications . All patients were divided into tremor - dominant and akinetic rigid - dominant groups based on previous methods . Total score is calculated as the sum of all scores and ranges from 0 to 88 . Cbi is a 24-item multidimensional questionnaire comprised of 5 different subscales [1820] that quantify caregiver burden: 1) time - dependence burden: time spent on caregiving (items 15), 2) developmental burden: caregiver feelings during care (items 610), 3) physical burden: status of general health problems (items 1114), 4) social burden: problems in the family and social life (items 1519), and 5) emotional burden: negative feelings about the patient (items 2024). Each individual item is scored from 0 to 4, the total score is the sum of all sub - scores and ranges from 0 to 96 . The responder for these questionnaires was selected from one of the family members using the following criteria: 1) being a relative of the patient and older than 18 years; and 2) serving as the primary caregiver and with an intimate knowledge of the patient that developed over time . Demographics were described using the mean, standard deviation (sd), number, and percentage . Correlation analyses were conducted to evaluate the relationship between neuropsychiatric symptoms, other motor and cognitive features, and caregiver burdens . Independent - sample t - tests were used to compare caregiver burdens and neuropsychiatric symptoms between tremor- and akinetic rigid - dominant groups . Burden differences among npi clusters were also compared using a one - way analysis of variance . Multiple linear regression analyses were performed to evaluate the effect of associated variables on caregiver burden . Forty - eight patients diagnosed with pdd at the movement disorder outpatient clinic of the university hospitals based on the uk parkinson s disease society brain bank clinical diagnostic criteria and the clinical diagnostic criteria for probable pdd were enrolled . Clinical information included age, gender, disease duration, history of hypertension, diabetes mellitus, heart disease, dyslipidemia, and current medication . Data from complete physical and neurological examinations, laboratory tests, and brain magnetic resonance imaging were obtained . Patients 1) with a previous stroke or other neurological and psychiatric disorders, 2) atypical pd or secondary parkinsonism or 3) secondary causes of dementia were excluded . The levodopa equivalent daily dose was calculated as follows: dose of levodopa plus dose of dopamine agonists multiplied by equivalents (= 1 levodopa dose + 0.75 controlled release dose + 0.33 entacapone + 20 ropinirole dose + 100 pramipexole + 10 selegiline + 1 amantadine). When enrolled in this study, all patients had been diagnosed for the first time with dementia . No pd patient had ever taken anti - dementia drugs, antipsychotics, antidepressants or anxiolytics prior to this study . Information on memory problems and other subjective cognitive deficits was obtained from caregiver interviews . To assess neuropsychiatric symptoms, the npi comprises sub - questions in 12 different categories covering four major neuropsychiatric symptom domains: mood, apathy, agitation, and psychosis . Symptom frequency was rated on a scale of 1 to 4, and severity was rated on a scale of 1 to 3 . A composite score ranging from 1 to 12, defined as the product of frequency and severity, was calculated . In addition, npi sub - scores for each patient were analyzed using five different clusters of neuropsychiatric symptoms: 1) few and mild neuropsychiatric symptoms (n = 19), 2) high scores on depression, anxiety, apathy and low scores on the other items (mood group, n = 9), 3) high scores on apathy and low scores on the remaining items including depression (apathy group, n = 7), 4) moderate or severe sub - scores on the majority of items including irritability and agitation items (agitation group, n = 11), and 5) high scores on hallucinations and delusions together with low scores on the majority of other items (psychosis group, n = 2). The general cognitive status and dementia severity were evaluated using the korean version of the mini - mental state examination (mmse) and the clinical dementia rating (cdr) scale and global deterioration scale . Parkinsonian motor symptoms were evaluated using the unified parkinson s disease rating scale (updrs) part iii and the modified hoehn and yahr (h&y) scale when patients were on medications . All patients were divided into tremor - dominant and akinetic rigid - dominant groups based on previous methods . Total score is calculated as the sum of all scores and ranges from 0 to 88 . Cbi is a 24-item multidimensional questionnaire comprised of 5 different subscales [1820] that quantify caregiver burden: 1) time - dependence burden: time spent on caregiving (items 15), 2) developmental burden: caregiver feelings during care (items 610), 3) physical burden: status of general health problems (items 1114), 4) social burden: problems in the family and social life (items 1519), and 5) emotional burden: negative feelings about the patient (items 2024). Each individual item is scored from 0 to 4, the total score is the sum of all sub - scores and ranges from 0 to 96 . The responder for these questionnaires was selected from one of the family members using the following criteria: 1) being a relative of the patient and older than 18 years; and 2) serving as the primary caregiver and with an intimate knowledge of the patient that developed over time . Demographics were described using the mean, standard deviation (sd), number, and percentage . Correlation analyses were conducted to evaluate the relationship between neuropsychiatric symptoms, other motor and cognitive features, and caregiver burdens . Independent - sample t - tests were used to compare caregiver burdens and neuropsychiatric symptoms between tremor- and akinetic rigid - dominant groups . Burden differences among npi clusters were also compared using a one - way analysis of variance . Multiple linear regression analyses were performed to evaluate the effect of associated variables on caregiver burden . Their mean age (sd) was 74.7 6.6 years and the mean duration of pd was 3.9 4.4 years . Fourteen patients (29.2%) had diabetes, 21 (43.8%) had hypertension, 7 (14.6%) had heart disease, and 2 (4.2%) had an abnormal lipid profile . Eight patients were current smokers, 3 were ex - smokers, and 37 were non - smokers . The severity of parkinsonian motor and cognitive symptoms was as follows: mean updrs part iii score, 28.1 12.4; mean h&y stage score, 2.4 0.8; mean mmse score, 19.8 4.0; and mean cdr score, 1.1 0.7 (table 1). All patients were on anti - parkinsonian medications with levodopa only or with dopamine agonists, amantadine, entacapone or selegiline . The mean levodopa equivalent daily dose was 490.3 318.6 mg . With the exception of 1 patient, the most frequent neuropsychiatric symptoms were anxiety and apathy (70.8%), followed by depression (68.7%), nighttime behavior disorder (58.3%), and appetite change (47.9%). Delusion, hallucination, agitation and aggression, disinhibition, irritability and lability, and aberrant motor behavior were present in 2040% of patients . The total npi score did not differ between male and female patients (male vs. female = 24.4 24.2 vs. 22.6 24.3, p = 0.729), and we observed no associations with age (r = 0.004, p = 0.980), disease duration (r = 0.062, p = 0.678), levodopa equivalent daily dose (r = 0.032, p = 0.827) or mmse score (r = 0.090, p = 0.542). However, the total npi score did correlate with cdr (r = 0.444, p = 0.002), h&y stage score (r = 0.326, p = 0.024), and updrs part iii (r = 0.312, p = 0.031). All caregivers reported mild to moderate burdens, ranging from 0 to 79 using bi (mean; 37.8 22.2) and 3 to 87 using cbi scores (mean; 35.7 23.0). The mean cbi sub - scale scores were: time - dependence burden, 13.0 6.2; developmental burden, 7.6 6.4; physical burden, 6.2 5.1; social burden, 4.4 4.0; and emotional burden, 4.5 4.7 . Delusion, hallucination, agitation and aggression, anxiety, irritability and lability, and aberrant motor behavior were associated with greater caregiver stress (table 2 and 3). For the npi clusters, caregivers of groups with irritability, agitation and psychotic symptoms (clusters 4 and 5), reported more severe stress or burden (table 4). Increasing age, longer disease duration, and lower mmse scores did not affect caregiver burden . Burden correlated with more severe motor symptoms and cognitive dysfunction quantified using updrs part iii and h&y stage scores and cdr . Caregiver burden tended to be greater for the akinetic rigid - dominant group, although there were no differences in neuropsychiatric symptoms between tremor - dominant and akinetic rigid - dominant groups with the exception of the apathy domain (table 5). Linear regression analyses revealed that npi score associated independently with caregiver burden in patients with pdd, as measured using bi and cbi, regardless of age, gender, vascular risk factors, and motor and cognitive status (table 6). Parkinson s disease dementia patients included in this study presented with frequently occurring neuropsychiatric symptoms . The frequency and severity of neuropsychiatric symptoms were similar to previous studies; the most frequent and severe symptoms were apathy, anxiety, and depression . Parkinsonian motor - symptom status or dementia severity in patients was associated with greater caregiver distress . This finding may be because the patients in this study had relatively short durations of pd: (3.9 4.4 years) compared with a previous study (10.9 7.7 years);14 the shorter disease duration may cause selection bias, and it is therefore possible that the longer disease duration group was underrepresented . Severe neuropsychiatric symptoms correlated with caregiver distress; caregivers reported greater burden as neuropsychiatric symptoms became more frequent and severe . Only euphoria, which was the most rare and mildest symptom, was not associated with caregiver burden . Both sub - items and scales for depression and anxiety (beck depression inventory and beck anxiety inventory) showed a borderline association between mood and caregiver burden . Psychotic symptoms, such as hallucination, delusion, and agitation or irritability, correlated with more - severe caregiver distress . After controlling for age and other potential confounding factors, total npi score associated significantly with pdd caregiver burden . This finding is consistent with recent studies showing neuropsychiatric symptoms were associated with increased caregiver stress or nursing home placement [2732]. These data suggest that caregiving for pdd patients may impair psychological health due to fatigue and also deprive the caregiver of time to do activities that are desired and expected at that moment in life . Thus, the caregiver role may be characterized by perceived disruption - of - life expectations . Neuropsychiatric symptoms were similar between parkinsonian motor phenotype groups; however, the akinetic - rigid group showed higher npi scores and more apathy . Caregiver burdens were marginally influenced by motor phenotype suggesting bradykinesia and rigidity were more stressful to caregivers than tremor symptoms . The major strength was that both bi and cbi were used to estimate caregiver or family distress, which provided more precise and detailed results from a total of 46 items between these two assessments . In addition, pd patients diagnosed with dementia for the first time at enrollment were included . They had not taken any anxiolytics, antipsychotics, antidepressants, or anti - dementia drugs . Because these drugs improve symptoms, the total npi score may have been reduced in patients using these medications . However, a recent study showed that hallucination may correlate with cognitive decline rather than adverse dopaminergic events . Other studies suggest that psychosis in pd patients results from multiple etiologies . Moreover, the mean score and frequency of delusion and hallucination in this study were not very different from those of a previous study . The frequency and severity of neuropsychiatric symptoms may not generalize to other populations; however, many cross - sectional studies have been performed and their outcomes accepted [24]. In conclusion, the results from this study confirm neuropsychiatric symptoms are frequent and severe in patients with pdd and that they are associated with increased caregiver distress . These data suggest that the detailed evaluation and management of neuropsychiatric symptoms in pdd patients may improve patient quality of life and reduced caregiver burden.
|
Natural killer (nk) cells represent a highly specialized lymphoid population initially identified by a potent cytolytic activity against tumor or virus infected cells . Different from t or b lymphocytes, they do not express clonally distributed receptors for antigen [1, 2], while their function is finely regulated by a balance of inhibitory and activating receptors . Nk cell inhibitory receptors, recognizing mostly hla class i molecules on self cells (notable exceptions to this concept are represented, among others, by siglec7 and irp60 recognizing non - hla - related structures), turn nk cells off and represent the major failsafe device to prevent nk - mediated attack of normal hla class i autologous cells . On the other hand, the on signal is delivered when nk cells interact with target cells that lack mhc class i molecules and at the same time are triggered through activating molecules expressed by these cells (figure 1). Activating stimuli may be delivered to nk cells through triggering via toll - like receptors (tlrs) including tlr2, tlr3, tlr7/8, tlr9, interleukin receptors (il-2, il-12, il-15, il-18), and combinations thereof (e.g., il-2 + il-15, il-2 + il12, il-12 + il-18), or activatory receptors representing an array of different molecules expressed on their surface including natural cytotoxicity receptors (ncrs), nkg2d, nkg2c (a lectin - type triggering receptor which dimerizes with cd94), 2b4 (cd244), nkp80, dnam-1, ntb - a, and the receptor for igfc (cd16). The receptors responsible for nk cell activation in the process of natural cytotoxicity are collectively termed natural cytoxicity receptors (ncrs): nkp46 [4, 5], nkp44 [6, 7], and nkp30 . Their expression is mostly restricted to nk cells, and particularly in the case of nkp46, they represent the most accurate surface markers for human nk cell identification . Nkp44 may be detected on the surface of a minority of peripheral plasmacytoid dendritic cells but on a relevant fraction of tissue - resident pdc and nkp30 may be expressed by umbilical cord t - lymphocytes upon activation . While nkp30 and nkp46 enable a precise identification of nk cells, regardless of whether these cells are resting or activated, nkp44 is selectively expressed only by activated nk cells [6, 7, 12] and should be differentiated from nkp44 which is constitutively expressed on pdcs in tissues . Ncrs play a major role in nk - mediated killing of most tumor cell lines, as revealed by monoclonal antibody - mediated receptor - masking experiments [3, 12]. Moreover, their surface density on nk cells correlates with the magnitude of cytolytic activity against nk - susceptible target cells . The ligands recognized by ncrs are still incompletely molecularly defined and may have variable expression on different cells . However, as revealed by cytolytic assays, they are expressed by cells belonging to different histotypes [2, 1517] and, in some cases, may be associated to neoplastic cells (e.g., b7-h6) or to rna viruses including influenza, dengue, or west nile virus [19, 20]. Nkg2d is another major nk - cell - triggering receptor belonging to the nkg2 family (type ii membrane proteins characterized by a lectin - like domain) [2123]. Contrary to the ncr, nkg2d is not restricted to nk cells but may be also expressed by cytolytic t lymphocytes . Nkg2d is specific for stress - inducible polymorphic mhc - class - i - related chain (mic), mic - a and mic - b or ulbp proteins, which may be expressed upon cell infection or transformation . Other triggering surface molecules expressed by nk cells are shared by other leucocyte types and appear to function primarily as coreceptors . Two such coreceptors, 2b4 and ntb - a, appear to serve a dual and opposite function, depending of availability of downstream regulating elements on their signaling pathways . A triggering surface molecule termed nkp80 has been identified by the generation of specific mab (ma152 and lap171). Nkp80 is expressed by virtually all fresh nk cells derived from peripheral blood as well as by a minor t - cell subset characterized by the cd3cd56 surface phenotype and binds to aicl on target cells . Another molecule behaving as triggering coreceptor in nk cells was described following attempts to identify the cellular ligands of triggering receptors . In addition to nk cells, it is expressed also on t cells, monocytes, and a small subset of b lymphocytes . The role of dnam-1 in nk - mediated killing varies with the different target cells analyzed thus far, suggesting differences in the expression of dnam-1 ligands . Indeed, carcinomas and hematopoietic cell lines express pvr and nectin-2, and their lysis involves dnam-1 . On the other hand, most ebv - transformed b cell lines analyzed do not express pvr nor nectin-2, and their lysis does not involve dnam-1 . Thus, pvr and nectin-2 represent the major (if not only) ligands of dnam-1 . As in the case of the other triggering receptors, the nk cell activation via dnam-1 is controlled by hla - class - i - specific inhibitory receptors . As a consequence other triggering receptors including cd27, crtam, cd96, cd100(sema4d), psgl1, and cd319 (slamf7) may be expressed by nk cells and have known ligands . Nk cells are a central component of innate immune response, comprising the first line of defense against a variety of tumors and microbial pathogens, including viruses, bacterial, fungal, and other intracellular parasites [3336]. The lytic activity of nk cells is controlled by complex interactions of inhibitory and activating receptors with specialized signalling machinery, and at times, the possibility to directly detect pathogen - derived molecules, independent of toll - like receptors [2, 37, 38]. In addition to possible direct activation of nk cells via tlr by pathogen - derived molecular structures (pamp, e.g., lps, rna, dna), accumulating evidences over recent years have linked ncrs on nk cells with direct or indirect recognition of pathogen - associated structures . Given their role for sensing intracellular pathogen - infected cells, under particular conditions, these observations may bear relevant importance in the outcome of an immune response . One should also consider that, even in the presence of weak inhibitory activity by kir or other inhibitory receptors (e.g., kir3dl2-hla - c1 homozygosity), defects in ncr expression could lead to failure in recognizing pathogen - associated molecules acting as ncr ligands on infected cells, leading to variable degrees of derangement in nk cell function (figure 2). The balance of kir carriage: hla class i expression and nkg2a / cd94:hla - e or cd85j(lir1/ilt2):/hla class i expression needs also to be considered in these cases . In other terms, although kir: hla carriage is known to influence nk cell activation, this pathway alone is not exhaustively representing overall nk cell function, for example in kir - negative cd56 nk cells, in nk cell precursors (which are kir - nkg2a+ and kir - nkg2a, resp . ), or in cd56dull nk cells carrying kir2dl3 on an hla - c1 homozygous background but in addition express high levels of cd85j (lir1/ilt2). Ncrs have been found to interact with infected cells through recognition of virus - encoded molecules . Sendai virus (sv) haemagglutinin - neuraminidase (hn) and influenza virus (iv) haemagglutinin (ha) both recognize terminal n - acetylneuraminic acid residues (sialic acids) attached to gal . Iv ha and sv hn, bind to sialic acid residues on nkp46 and nkp44 [19, 40], enabling ncr - mediated lysis of iv or sv - infected cells . Subsequent clinical observations corroborated these findings and showed that lethal iv infection in humans may be associated to absence of nkp46 on nk cells . Nkp46 is also involved in the detection and lysis of vaccinia - virus - infected cells, together with nkp30 and nkp44 although viral ligands have not been characterized . Nkp44 has been reported to interact directly to cell - free mycobacteria or other bacteria and to play a role in the recognition of virus - infected cells . In fact, following the original description of a putative interaction of nkp46 with influenza virus haemagglutinin and sendai virus hemagglutinin - neuraminidase, also nkp44 was found to interact with these proteins . Direct interaction of nkp44 with virus - infected cells and with virus or virus - like particles, has been recently shown also with regard to the envelope protein of flavivirus (west nile virus, dengue virus). This leaves open the question of the potential relationship of hcv (another member of the flaviviridae family) and ncr expression with regard to disease course . Hiv-1-infected cd4 cells are reported to be targeted by nk cells via a nkp44l that is induced by an hivgp41 peptide . The presence of antibodies to this peptide in vivo would prevent nk cell recognition and disposal of infected cells . In hiv - infected patients, . There has been so far no nearer characterization of this ligand, although it has been recently shown that the 3s motif of gp41 binds to gc1qr (a receptor for the globular domain of c1q) on cd4 t cells and induces activation of a signalling cascade that leads to nkp44l expression also on uninfected cd4 t cells . Thus, nkp44 may be involved not only in protection from overwhelming infection by direct interaction with cells infected by viruses belonging to different virus families (orthomyxo-, paramyxo-, flavi-, and lentiviridae) but may also play a role in the pathogenesis of hyperactivation syndromes (as with influenza or dengue) or in immune depletion (e.g., hiv-1). Several aspects remain be further clarified in this area, as direct nk - pathogen interaction via an activating receptor that is only expressed upon nk cell activation (nkp44), entails recognition only after full nk cell activation and not upon initial events following virus entry . In line with what has been recently shown for nkp44, also nkg2d interacts with multiple cellular- or pathogen - derived ligands that trigger nk cell cytotoxicity . Nkg2d binds to the polymorphic mhc - class - i - related chain (mic), mic - a and mic - b, and also binds to ul-16-binding proteins (ulbps), which are mhc class - i - like molecules that are expressed by tumor cell lines . Ulbps enhance the capacity of nk cells to lyse tumors and to produce cytokines such as ifn and tnf [48, 49] and are upregulated during heat shock or during infection with cmv [50, 51]. Opposite to nkp44 and nkp46, there is little evidence for direct interaction of nkg2d with pathogen(s); however, its ligands may be either induced or downmodulated upon infection by several pathogens . In the case of rodent poxviruses such as ectromelia virus (mousepox virus), nkg2d ligands are upregulated on infected cells [52, 53], while it appears that human poxviruses such as vaccinia virus do not affect nkg2d expression in their host but rather affect nkp46, nkp44, and nkp30 through ifn--mediated increased expression [42, 54]. Nkg2d appears to play a relevant role in killing hiv-1-infected cd4 cells, as its ligands are still expressed in infected cells in vitro . However, hiv nef is specifically downmodulating ulbp2, thus, preventing nkg2d - mediated cytotoxicity . Downregulation of nkg2d ligands mic - a and mic - b is also induced by the k5 immune evasion gene of kshv (hhv-8). The same gene product also determines downregulation of the ligand of nkp80 (i.e., aicl), thus, simultaneously maiming both nk- and t - cell responses against hhv-8 at multiple levels . Human cmv has developed a similar protective system against both nkg2d - expressing t cells and nk cells, as its ul16 protein binds to 3 or the main nhg2d ligands (i.e., micb, ulbp1, ulbp2), thus, preventing them from being expressed by infected cells, thereby, avoiding cell killing by nkg2d - expressing nk cells . A less extensive nkg2d - ligand targeting (i.e., mica alone) has been reported also for hcv via its ns3/4a serine protease . Overall, there are still conflicting views in this area that could need additional attention to improve our understanding of the role played by nkg2d and nkg2d - interference during infection by intracellular pathogens comparing human and animal models . Since nkg2d is also expressed by a relevant proportion of cd8 ctls, additional aspects need do be addressed comprehensively to improve our understanding of the relative role of nk cells and cd8 ctls in disease pathogenesis to help advise possible interventions . There are few if any reports suggesting a direct interaction of other triggering coreceptors 2b4 (cd224) or dnam-1 or their ligands (i.e., cd48 and poliovirus receptor (cd155) and nectin-2 (cd112) with viral products) [32, 59, 60]. One possible exception is represented by nkp80, as mentioned above, which is targeted by hhv-8 proteins which induce downmodulation of its ligand in infected cells . The strongest evidence for a role of the immune system in controlling hiv-1 disease comes from a number of epidemiological studies demonstrating a strong influence of individual hla class i alleles on determining the rate of hiv-1 disease progression . Several subsets of cells belonging to the hematopoietic lineage express receptors that bind to hla class i molecules, including cd8 t cells, monocytes, dendritic cells, and nk cells . A number of observations strongly suggest that cd8 t cells play an important role in the containment of hiv infection . For example, exposed - uninfected seronegative subjects lack specific humoral responses to hiv-1 but have detectable cd8ctl responses and mucosal iga immunity [6265]. However, hiv-1-specific cd8 t - cell immunity alone is not sufficient to explain the large heterogeneity observed in the clinical manifestation of hiv-1 disease . More recent advances in the understanding of the immune response to viral infections support the involvement of additional components of the innate immune system in the control of hiv-1 disease and might help to identify the mechanism underlying protective immunity in hiv-1 infection . Hiv-1 infection is associated with significant changes in nk cell subset distributions and function in the peripheral circulation which were detected already at the beginning of the epidemic and were subsequently systematically evaluated and reviewed [6668]. Several reports have shown a dramatic reduction in the proportion of cd3 cd56 nk cells [69, 70], and particularly cd56 cd16 . This reduction appears to be partially attributable to the emergence of a novel subset of nk cells that is rare in healthy individuals, cd3 cd56 cd16 nk cells [68, 72]. Earlier work showed that nk cells in hiv - viremic patients displayed a functionally relevant and dramatic reduction in ncrs, which is accompanied by relevant activation, as determined by hla - dr and cd69 expression . A consistent fraction of these cells fall also in the subsequently identified cd56 cd16 cd3 exausted nk cell subset . Since this subset becomes prominent in individuals with active viral replication at the expense of the two other subsets of cells (i.e., cd56 and cd56 nk cells), it needs to be accounted for to evaluate the overall number of nk cells in patients with hiv-1 infection . Nk cells with defective ncr expression in hiv patients, among these also cd3 cd56 cd16 nk cells, have strongly reduced nk cell effector functions, including killing, cytokine secretion, and antibody - dependent cellular cytotoxicity (adcc), and exhibit aberrant dc - editing activity [67, 73, 74]. Dc - editing by nk cells may take place whenever dcs and nk cells interact in secondary lymphoid organs . Dcs that do not express functionally relevant hla class i molecule densities are subject to nk cell killing (e.g., idcs and incompletely mature dcs). Nk cells in turn induce dc maturation through ifn- and tnf- production [7579]. Since incompletely mature dcs produce higher levels of il-10 and lower quantities of il-12 and show less efficient antigen presentation, the efficiency of nk - dc interactions crosstalk including cytokine production and nkp30/dnam-1 expression may variably shape subsequent downstream t - cell and b - cell adaptive responses . In addition to changes in nk subpopulations associated with hiv infection, there are also marked changes in nk surface receptor expression that are related to loss of function . With hiv viremia, there is an overall decrease in surface receptor density of nkp46 and nkp30 found on freshly drawn nk cells and dysfunction in nkp44 de novo expression upon stimulation in vitro resulting in what has been termed an ncr phenotype . In the cd56 subset, the proportion of cells expressing nkp46 and nkp30 and their cytolytic activity decrease with disease progression . Moreover, a concomitant increase of kir density is also observed not only on cd8 ctl, but also on nk cells, thus, setting the basis for an increased inhibitory potential of cytolytic cells [8284]. The downmodulation of activating receptors and upregulation of kirs result in measurable functional defects in nk - cell - mediated cytotoxicity regardless of the nk cell subpopulation . The induction of nkp44l by hivgp41 on infected and uninfected cd4 cells and the as yet poorly characterized downmodulation of activatory receptor and coreceptor ligands are likely to be involved [26, 46]. Despite isolated reports on the possibility of infection of cd4 expressing or activated nk cells [85, 86], this phenomenon may be rather attributed to cells different from nk cells and is currently not regarded as a major mechanism leading to nk cell dysfunction . Antiretroviral treatment (art) does not significantly affect nk cell function recovery, as ifn production, and ncr expression may be persistently impaired even after successful art and virus control in patients with cd4 cell numbers> 500/l . Variable ncr expression during art, thus, appears to contribute to clinical disease course upon treatment interruption . Thus, differences in innate immune balance during art may be associated to differential control of hiv . Their understanding could explain clinical differences in individual patients that are not reflected by cd4 cell counts alone . Overall, therefore, although kir: hla carriage may significantly affect the course of hiv infection [61, 90, 91], direct or indirect disruption of ncr / ncr - ligand expression by hiv represents a significant event that needs to be considered in parallel when evaluating nk cell activating / inhibiting balance . Disruption of nk - dc interaction and dc editing by nk cells via nkp30 [76, 78, 79] and dnam-1 is likely to lead to inefficient selection of dc maturation with inefficient downstream antigen - specific t- and b - cell responses [74, 92]. Studies describing nkp46, nkp30, nkg2d, and nkp80 in animal models of hiv infection revealed that ncr expression in shiv - infected macaques does not reflect the downmodulation observed in hiv - infected humans [93, 94]. Importantly, defective transcription of nkp44 has been observed in macaques and this explains why no surface expression of this ncr is detected in macaques (macaca mulatta and macaca fascicularis) [9395], thus, raising questions on the interpretation of some experiments in this animal model with regard to nk cell regulation . On the contrary, although nkp44 transcription and induction appears to be differently regulated in chimpanzees compared to humans, this primate species has a full set of ncrs . A relevant difference with homo sapiens relies in nkp30 expression and regulation and may impact on the relative resistance to progressive hiv infection in this species . Indeed, in both uninfected and hiv - infected chimpanzees nkp30 is not- or poorly expressed but is de novo expressed at levels comparable to human nk cells upon cell activation . Thus, even during hiv replication, nk: dc crosstalk via nkp30 is likely to be dampened and may explain the low level of immune activation even in the presence of active replication of a virus that in humans thrives on cell activation . Nk cells have been implicated in all stages of hcv infection in both genetic and functional studies . This role may be either direct, by targeting hepatocytes, or indirect by influencing other key immunocytes such as dcs or t cells . Nk cells comprise 520% of peripheral blood mononuclear cells but make up a substantially greater proportion (3050%) of lymphocytes in the liver . Intrahepatic nk cells in murine models may behave differently (i.e., hyporesponsiveness) compared to nk cells in other districts, due to a presumed tolerogenic environment in the liver . They are less cytotoxic and have an altered cytokine profile producing lower level of ifn and greater levels of immunomodulatory cytokines, such as il-10, compared to peripheral blood and splenic nk cells . Human peripheral blood nk cells are involved in the acute phase of hcv infection, with an increase in cd56 nk cells and associated reduction in cd56 subset . A decline in the cd56 population is observed in patients spontaneously clearing the virus and reaching levels comparable to healthy control individuals within 13 months . This return to baseline is not observed in those that proceed to chronic hcv infection . In the acute phase of infection, expression of nkg2d in addition, peak nk cell activation and degranulation precedes or coincides with peak t - cell responses, and a correlation was observed between nk cell degranulation and the magnitude of hcv - specific t - cell responses . Thus, recent evidences agree with a direct involvement of nk cell responses during acute hcv infection favoring induction and priming of downstream t - cell responses leading to virus clearance . During chronic hcv infection, peripheral blood nk cell frequency (both absolute number and percentage of total lymphocytes) a reduction in peripheral blood nk cell frequency in patients with chronic hcv as compared to spontaneous resolvers has also been noted [106, 107]. These observations may be at least in part explained by a significant reduction of il-15 (a pivotal cytokine for nk cell development, proliferation, and function) concentrations / levels which is observed in hcv patients as compared to healthy controls . Several studies in chronic hcv patients have documented a relative increase in circulating cd56 (but not cd56 nk cells) compared to healthy individuals and spontaneous resolvers [102, 106, 108]. Demonstrated that the relative proportions of cd56 and cd56 nk cells in the liver are altered in chronic hcv observing that 80.5% of intrahepatic nk cells were cd56 as compared to 94% in peripheral blood, and 19.5% intrahepatic nk cells were cd56 as compared to 6.0% in peripheral blood . This implies that the decreased frequency of cd56 in the periphery is not related to their sequestration in the liver, although there are no nearer data on the relative proportion of cd56 and cd56 nk cells in the healthy liver . Cd56 nk cells are kir - negative and nkg2a - positive, and one of the most consistent findings so far has been an increase in nkg2a expression in chronic hcv infection [108110]. This occurs on both intrahepatic and peripheral blood nk populations and also involves cd56 nk cells . Contrary to hiv infection, there has been so far less consensus on ncr expression during chronic hcv infection . Increased proportions and density of ncrs, including nkg2c, nkp44, nkp30, and nkp46 have been reported [108, 111, 112]. Similarly, there is conflicting evidence with respect to nkg2d expression which has been reported as being upregulated, downregulated, and also unchanged during chronic hcv infection [108, 109, 112]. However, these apparently opposite findings could be reconciled by different treatment responses in different cohorts . Thus, the interaction of hcv with ncrs on nk cells is less direct compared to hiv, as direct virus challenge does not impair nk cell function, and may be mediated by other as yet poorly understood viral factors or by possible immunogenetic traits that would parallel those observed for the other side of the (nk cell) coin (i.e., kir: hla interactions). Different sets of observations support the notion that nk cells may be involved in the control of mycobacterial infections, with particular emphasis on mycobacterium tuberculosis hominis (mth). First, nk cells from healthy donors (hds) can directly respond to products via tlr-2 . A direct link between nk cells and mth - infected cells has been shown to be mediated by the interaction of nkp46- and nkg2d - activating receptors on nk cells with infected monocytes . Evidences indicating a relevant role for nk - mediated control of mth replication are provided by experiments using cells from hds showing their promotion of intracellular killing of mycobacteria [120, 121] and by their ability to lyse monocytes infected with mth, mycobacterium tuberculosis bovis bacille calmette - guerin or mycobacterium avium intracellulare . In addition, the recent description of reduced mdc and pdc numbers and function in patients with tb suggests that this, in turn, may impair nk cell function (e.g., through impaired production of cytokines promoting nk cell activation such as il-12 and il-15) contributing to reduce lysis of mth - infected macrophages which are, in turn, subjected to the activation of antiapoptotic pathways by mth [119, 124]. Nk cells have been shown to play a fundamental role in the maintenance of efficient ag - specific cd8 ctl responses in healthy humans with latent mth infection . In line with these observations, patients with recent onset of pulmonary tb have low - level expression of both nkp46 and nkp30, suggesting that nk - cell - driven downstream adaptive responses may also be defective . In addition, patients successfully recovering from pulmonary tb with standard treatment (rifampicin, isoniazid, ethambutol, and pyrazinamide for 2 months followed by 24 months of rifampicin and isoniazid) do recover ifn production by nk cells but fail to recover nkp30 and nkp46 expression and in some cases do so even after 35 years from end of treatment (a. de maria, personal observation). These observations could be explained by the hypothetical scenario of immunogenetically determined regulation on ncr expression that may influence different interindividual susceptibility to latent mth reactivation with onset of disease . So far, the role of ncrs in the interaction of pathogens with nk cells has been largely considered ancillary to cytokine- or tlr - mediated activation and to kir: hla modulation of nk cell function . Over the last 10 years accumulating evidences point to the possibility of viruses to directly interact with ncrs to tamper with their expression and to interfere with ncr ligand expression on target cells, thus, indirectly reducing nk cell function irrespective of the kir: hla haplotype (figure 2). Improving our knowledge of the mechanism(s) and of the regulation of ncr expression and function and integrating this information with inhibitory receptor expression and function will improve the prospective management of patients with potentially lethal or invalidating acute infections including influenza, dengue, or hcv and optimize treatment strategies of chronic invalidating persistent infections such as hiv, tb, and hcv.
|
One of those subtypes is immunoglobulin d multiple myeloma which can have different clinical presentations . Advancement in the treatment of immunoglobulin d multiple myeloma is promising and should lead clinicians to earlier diagnosis for better outcomes . A 53-year - old caucasian male patient with previous medical history of anaplastic oligodendroglioma status post - surgical removal and temozolomide therapy for 1 year in 2006 presented to the outpatient clinic on september 2013 complaining of back pain while mowing the lawn . Pain was described as severe and sudden and limiting the ability of regular daily activity . His family history is significant for ovarian cancer in his mother and coronary artery disease in his father . Physical examination showed tenderness over the lower thoracic vertebrae with no sensory or motor impairment . His neurological examination including gait assessment was normal . Initial lab investigations showed low hemoglobin of 12.5 g / dl (reference range 13.217.1 g / dl), normal vitamin d 25-oh of 47 ng / ml (reference range 30100 ng / ml), high calcium level of 10.5 mg / dl (reference range 8.610.3 mg / dl), and low parathyroid hormone of 5 pg / ml (reference range 1065 pg / ml) his creatinine was normal at 1.08 mg / dl (reference range 0.701.33 mg / dl), and he had mildly elevated alkaline phosphatase of 128 u / l (reference range 40115 u / l). Aspartate aminotransferase and alanine aminotransferase were both within normal limits . Serum protein electrophoresis showed total protein was normal at 6.9 g / dl (reference range 6.18.1 g / dl), normal albumin at 4.0 (reference range 3.54.7 g / dl), normal alpha 1 globulins, alpha 2 globulins, beta globulins, and gamma globulins, and showed an abnormal protein band in the gamma globulin region . Urine electrophoresis showed normal 24-hour creatinine of 2.37 g (reference range 0.632.50 g/24 h) elevated total 24-hour protein of 3,050 mg (reference range <150 mg/24 h), elevated protein - to - creatinine ratio, and two abnormal protein bands detected in the gamma globulin region . Free light chain assay showed serum free kappa elevated at 3,090.0 mg / l (reference range 3.319.4 mg / l) and low free lambda of 1.8 mg / l (reference range 5.726.3 mg / l), and free kappa / lambda ratio was elevated at> 1,000.00 (reference range 0.261.65). Immunoglobulin d was elevated at 566.0 mg / dl (reference range <15.3 mg / dl). Magnetic resonance imaging (mri) of thoracic spine with and without contrast showed acute pathological fracture of the t12 vertebral body with enhancing soft tissue which extends into the left ventral epidural space and left t11t12 neural foramen . Bone marrow biopsy was obtained and showed 60% cellularity with about 54% cellularity consistent with atypical plasma cells with normal male karyotype . Fluorescent in situ hybridization was positive for gain of 11q; however, there was normal appearance of 11;14 . Mri of thoracic spine with and without contrast because of worsening back pain 2 weeks later showed a new t8 fracture (fig . He received a total of 6 cycles and his kappa light chain was down to 3.96 mg / l (reference range 3.319.4 mg / l) and his immunoglobulin d level was 0.7 mg / dl (reference range <15.3 mg / dl). He also received 9 treatments of high - dose radiation therapy to his thoracic spine for pain control . After his fifth cycle, he was referred to a tertiary center for assessment of autologous peripheral blood stem cell transplant, which he underwent 6 months after the initial diagnosis . Follow - up after 6 months of the transplantation showed complete remission, and the patient agreed to continue on lenalidomide maintenance therapy for a total of 3 years or as long as he is in remission . Immunoglobulin d multiple myeloma is a rare disease with an incidence of 2% in all myelomas . The main presenting features of immunoglobulin d myeloma were bone pain, fatigue, and weight loss . A previous review of 77 cases reported bone pain as the most common presenting symptom, which happened in 77% of the cases with 89% lambda light chain predominance . Median age of presentation was 57 years . Though previously immunoglobulin d multiple myeloma was thought to have poor prognosis overall, a recent study reported median survival of 51.5 versus 50.7 months for patients with other subtypes . Our case is peculiar as it represents a rare disease presenting in a young male patient with no identifiable risk factor . Indeed, it shows excellent response to the standard chemotherapy used in multiple myeloma and to autologous peripheral blood stem cell transplant, which was done after complete remission . Previous reports of combining chemotherapy and autologous peripheral blood stem cell transplant showed improvement in prognosis in this rare disease . Immunoglobulin d multiple myeloma can present as spontaneous fracture as initial presentation and it usually happens in young males . Advancement in the treatment of immunoglobulin d multiple myeloma urges clinicians to offer their patients new treatment options . The authors declare that there is no conflict of interest regarding the publication of this paper.
|
In recent years, a significant increase in the prevalence of obesity has been observed in many countries and across different age groups, including children.1,2 the increase in the prevalence of childhood obesity is worrying because of obese children s higher risk of becoming obese adults and because of the various morbid conditions associated with obesity.3 because obesity is a difficult - to - treat chronic disease that is associated with a variety of adverse consequences relating to morbidity and mortality, special emphasis should be given to preventive measures . Simple, low - cost measures without potential adverse effects are particularly attractive . Within this context, several authors have raised the hypothesis that breastfeeding might have a protective effect against obesity.414 epidemiological studies and experimental studies on animals have suggested that individuals first nutritional experiences may affect their susceptibility to chronic diseases in adulthood, such as obesity, hypertension, cardiovascular disease and type 2 diabetes . Metabolic imprinting.15 this term describes a phenomenon through which an early nutritional experience during a critical and specific period of development might cause an enduring effect that continues throughout an individual s life, thereby predisposing him or her to certain diseases.15 breastfeeding represents newborns first nutritional experience and provides continuity with the nutrition provided during intrauterine development . Many bioactive factors are present in human milk, including hormones and growth factors, which affect the growth, differentiation and functional maturation of specific organs, thus affecting various aspects of development.16 therefore, the unique composition of maternal milk might be implicated in the process of metabolic imprinting, for example, by changing the number and/or size of adipocytes or by inducing the phenomenon of metabolic differentiation . A tendency for obesity to run in families can be seen such that children of obese parents have a higher risk of being obese themselves . In addition to genetic factors, parents and children usually share dietary habits and have similar physical activity levels, thus contributing towards the greater risk of obesity in certain families.17 high energy intake and low energy expenditure are among the main causal factors of obesity.18 in addition to total caloric intake, the composition of one s diet is also important: diets rich in simple carbohydrates and lipids are a risk factor for obesity.18 therefore, in analyzing a possible protective role for breastfeeding against overweight and obesity, it becomes necessary to take into consideration other variables that could be involved in this association . The aim of the present study was to investigate whether early weaning constitutes a risk factor for overweight at preschool age and to determine whether children s current diet, physical activity level and birth weight and their mothers body mass index (bmi) are associated with overweight . A case - control study was carried out among children of both sexes aged two to six years who attended private schools in 2003 and 2004 . The sample size of 144 cases and 144 controls was calculated with the aid of the statcalc program in the epi - info software, version 6.0, using a confidence interval of 95%, a power of 80%, a ratio of 1:1 between the numbers of cases and controls, an expected frequency of the principal exposure in the control group (early weaning) of 40% and an odds ratio of 2.0, in accordance with data in the literature.10 assuming the prevalence of overweight to be 11%,2 around 1,309 children would need to be evaluated in order to identify 144 cases . A free and informed consent form was sent to all parents or guardians responsible for the children within the desired age group . All children whose parents authorized their participation were included in the study (1,610 children). The case group was formed by the children who were overweight, which was defined as bmi greater than or equal to the 85 percentile for their age group . The curves and tables of bmi percentiles of the centers for disease control and prevention (cdc, united states), 2000 version (revised version of the nchs 1977 tables), for individuals aged two to twenty years according to sex and age were used as the reference standard (www.cdc.org/growthcharts; accessed on aug 12, 2002). The control group was formed by children whose bmis were lower than the 85 percentile . Children presenting diseases or using medications capable of interfering with their weights and/or heights were not included in the study . Among the 1,610 preschool children assessed, 183 children were randomly drawn from among the pupils attending the same schools as the cases . Children were considered to present this exposure if they had received exclusive breastfeeding or predominant breastfeeding (i.e., maternal milk accompanied by water and/or tea) for a period of less than four months . Other variables were also evaluated, such as birth weight, maternal bmi, variables relating to the children s current diet and variables relating to the children s level of physical activity . The children s current frequencies of intake of the following were analyzed: fruits and greens / vegetables (variables used as markers for a healthier diet). Bread (representing the intake of dough from grain), soft drinks and biscuits (representing the intake of carbohydrates and sweets / candies) and chips / french fries (representing the intake of fatty and fried foods). The following variables related to the children s physical activity levels were analyzed: average number of hours per day (on weekdays) of watching television, average number of hours per day (on weekdays) of playing outside and their most frequent means of locomotion (walking, car, motorcycle or bus). The weights and heights of the children and their mothers were measured by a team of trained research assistants in accordance with standardized methods.19 each measurement was taken twice, and the mean was used . The bmi was calculated using the formula of weight (in kilograms) divided by the square of the height (in meters). Data relating to breastfeeding and the other variables were gathered by the same team by means of interviews with the children s mothers . This information was stored in a database using double data entry and correction of inconsistencies . The data were analyzed using epi - info version 6.0 and spss version 8.0 software . First, each variable was evaluated separately to determine whether it was a risk factor for overweight, with calculation of odds ratios and their 95% confidence intervals . Following this, multivariate analysis was performed using the standard multiple regression method, in which all variables are simultaneously entered into the model . Among the 366 children studied, 176 were male (48.2%) and 190 were female (51.9%). There was no statistically significant association between sex and overweight (or = 1.36; 95% ci: 0.882.10; p = 0.17). The mothers mean schooling level was 12.5 years, and the fathers was 11.6 years . Most of the families had one or more cars (67.8%), were homeowners (73.2%) and had health insurance for their children (51.9%). There was no statistically significant association between overweight and any of these socioeconomic variables (table 1). The percentage of the children who had received exclusive or predominant breastfeeding for less than four months was 36.2% (132/366). In univariate analysis, the children who had received exclusive or predominant breastfeeding for less than four months presented a greater risk of overweight than did those who had received exclusive or predominant breastfeeding for four months or more (or = 1.69; 95% ci: 1.102.60; p = 0.02). Maternal overweight (bmi 25 kg / m), birth weight greater than or equal to 3,500 g, fruit intake less than twice a day, greens and/or vegetable intake less than three times a week, consumption of one or more bread rolls per day, consumption of soft drinks every day and consumption of biscuits every day constituted risk factors for overweight in the univariate analysis . Furthermore, in the univariate analysis, it was observed that the children who played outside for an average of two or more hours a day on weekdays and those whose most frequent means of locomotion was walking presented lower risks of overweight . It was also observed that the children who consumed chips / french fries every day and those who watched television for an average of five or more hours a day on weekdays presented higher risks of overweight . However, these associations were not statistically significant . In the multivariate analysis, only maternal overweight, birth weight greater than or equal to 3,500 g, playing outside for less than two hours a day and main means of locomotion other than walking remained as risk factors for overweight . The association between early weaning (receiving exclusive or predominant breastfeeding for less than four months) and overweight did not reach statistical significance in the multivariate analysis . Table 2 presents the unadjusted and adjusted odds ratios with their respective 95% confidence intervals . In the present study, the protective effect of breastfeeding against overweight was only shown in univariate analysis; it did not persist after controlling for other variables . It is possible that breastfeeding has only a small protective role against overweight in comparison to other variables of greater importance.11,18 different definitions of both the exposure and the outcome make it difficult to compare this study with similar studies in the literature . The time that elapses between the exposure and the outcome also causes difficulty in analyzing this possible association . It may give rise to recall bias, or, in the case of longitudinal studies, it may impose high costs, long study durations and operational difficulties . Furthermore, the extended time that elapses between the exposure and the outcome may make it difficult to take all the confounding variables into consideration.720;2632 dewey,26 in a review article, also reported that the protective effect of breastfeeding seemed to be small compared with the effects of other factors, particularly having overweight parents . Even so, the effect of breastfeeding could be important from a public health point of view considering the present epidemic of obesity seen in many countries . Wadsworth et al.13 did not find a significant association between breastfeeding and the prevalence of overweight at 6 years of age in an analysis of 3,731 children in the united kingdom . In a cross - sectional study of 9,357 (15) found that the prevalence of obesity was 4.5% among children who had never been breastfed and 2.8% among those who had breastfed . A dose - dependent effect of the duration of breastfeeding was observed . After adjusting for potential confounding factors, obesity was defined as bmi greater than the 97 percentile, whereas overweight was defined as bmi greater than the 90 percentile . In the recent review by owen et al.,30 the authors concluded that breastfeeding has a protective effect against obesity, but that the magnitude of this effect is still poorly defined . These authors found 61 articles analyzing the possible relationship between breastfeeding and the risk of obesity and concentrated their attention on the 28 studies that reported odds ratios that supported a protective effect of breastfeeding . They observed that, in several studies, controlling for confounding variables led to a reduction of the protective effect of breastfeeding but did not eliminate it, and they emphasized the need to carry out other studies to determine the roles of the confounding factors . In a wide - ranging meta - analysis, harder et al.31 included 17 studies that reported odds ratios and 95% confidence intervals or sufficient data to calculate them; reported the duration of breastfeeding; and included children fed exclusively with infant formula for comparison . Based on these data, these authors reported that the duration of breastfeeding was inversely associated with the risk of overweight, independent of the definition of overweight used and the age of the participants in the studies . One month of breastfeeding was associated with a 4% decrease in the risk of obesity . Evaluation of food intake is a complex task, which may at least partially explain the divergences in the literature . Several methods have been used for such evaluations, for example, 24-hour recall, food diaries, direct weighing of foods, home consumption of foods, the food frequency questionnaire and dietary history . Each of these has its advantages and limitations.33 evaluation of food intake among preschool children is an even more difficult task because there is little data on this age group . Older age groups have been investigated much more thoroughly.34, 35 it is possible that information given by individuals about their own energy intake is not a valid measurement.23 moreover, there is evidence that genetic factors are capable of modulating an organism s response to variations in environmental factors such as diet and physical activity.36 in the same way as for energy intake, measurement of physical activity is also a complex task . Several methods can be used, such as calorimetry, systematic observation, movement sensors, heart rate monitors and questionnaires.37 questionnaires present several advantages, such as low cost, practicality, lack of changes to individuals behavior and possibility of adaptation of the questionnaire to the population in question . However, the literature is sparse regarding questionnaires for evaluating physical activity among preschool children . Even the extensive collection of questionnaires presented by kriska et al.37 does not privilege this age group . The mechanisms through which maternal milk may play a protective role against obesity have not yet been determined . In a review article, singhal & lanigan38 grouped potential protection mechanisms into two major groups: those that were associated with behavioral factors and those related to the composition of maternal milk . Waterland & garza21 put forward some potential mechanisms through which the phenomenon of metabolic imprinting could occur . Among these are induction of variations in the structures of some organs, changes in the number of cells, and metabolic differentiation (changes in the expression of certain genes causing variations in the production of enzymes, hormones, hormonal receptors, transmembrane transporters, etc). In terms of nutrients, . Moreover, several bioactive factors are present in human milk, including hormones like insulin, adrenal steroids, t3 and t4.22 casabiell et al.39 identified the presence of leptin in human milk, which could play a regulatory role in the newborn s metabolism, given that the hormone acts to inhibit appetite and anabolic pathways and to stimulate catabolic pathways.40 miralles et al.41 analyzed the concentrations of leptin in samples of blood and maternal milk from 28 non - obese women and assessed the growth of their children, who were breastfed for at least 6 months, over their first years of life . These authors observed a negative correlation between the concentration of leptin in maternal milk after one month of lactation and the children s bmis at the ages of 18 and 24 months . Lucas et al.42 reported differences in endocrine responses with regard to the release of pancreatic and intestinal hormones between newborns breastfed with maternal milk and those fed with infant formula . It is also possible that the newborns who were breastfed developed more effective mechanisms for regulating their energy intake.43 evidently, even though no significant protective effect of maternal milk against overweight and obesity has been proven, breastfeeding should continue to be strongly recommended because of its unquestionable nutritional, immunological and psychological advantages . In summary, the results of our study suggest that the possible protective effect of breastfeeding against overweight among preschool children is of a lower magnitude than the effects of genetic factors and other environmental factors . Maternal overweight, birth weight and sedentarism are important risk factors for overweight in this age group.
|
Methylmercury (mehg) is an environmental contaminant produced from natural or anthropogenic sources of mercury by methylation in widespread sulphate reducing bacteria . Mehg enters the aquatic food chain and accumulates to become a threat for higher - order aquatic mammals and fish, but also to human health through consumption of contaminated fish . Mehg has been shown to be detrimental for human health, with many studies emphasizing its neurological toxicity [4, 5]. The molecular pathway by which mehg exerts its toxicity has been the issue for extensive research . Although mehg seems to induce specific cytotoxic symptoms, one main route for mehg molecular toxicity has yet to be elucidated [6, 7]. However, mehg has a strong affinity for thiol groups, making every cysteine - containing protein a potential target for mehg - binding and disruption, meaning that there may not exist one specific route of toxicity . In the search for a specific molecular mechanism of mehg - cytotoxicity, several mechanisms have been suggested for example, oxidative stress [9, 10], excito - toxicological effects, microtubule and cell - structural damage, genotoxic effects, and elevated intracellular ca leading to apoptosis [11, 13]. The occurrence of mehg in seafood has led to a debate regarding health promoting nutrients through fish consumption, versus the risk for contaminant exposure [1416]. Fish serve as an important source of nutrients, vitamins, and minerals and constitute an important part of a balanced diet . Some of the beneficial nutrients in fish are the long chained marine n-3 fatty acids eicosapentaenoic acid (epa, 20:5n-3) and docosahexaenoic acid (dha, 22:6n-3), which has shown to be important for optimal cognitive health and neuronal development . But in addition to its nutritional benefits, fish may also accumulate heavy metals and other environmental contaminants in edible parts, posing an exposure risk for higher - order mammals . Many epidemiological studies have investigated the effects of chronic low - dose fetal exposure of mehg in different geographical locations . Some of these studies report no adverse effects [18, 19], while other studies have reported adverse effects . . Suggest that dietary effects may be responsible for the discrepancies in mehg toxicity between different geographical localities . They argue that a study [18, 19], performed at the seychelles which showed no adverse effects, is based on a mainly fish consuming population, while another, performed at the pharoe island which shows adverse effects, was based on populations consuming mainly whale meat . Following this argumentation, a fish - based diet may contain certain ameliorating nutrients that will reduce the toxicity of mehg . Recently there has been increasing focus on interactions between nutrients and toxicants and how nutrients and the nutrient composition of organisms may affect the toxicity of different environmental contaminants . Reviews have pointed to the lack of research on nutrient - mehg interactions and suggest that an increased focus on nutrient - mehg interaction may increase understanding of mehg toxicological mechanisms . Nutrients can affect mehg toxicity and retention in fish, as shown by bjerregaard et al . Who demonstrated that dietary selenite decreased mehg retention in rainbow trout (oncorhynchus mykiss). Marine n-3 fatty acids, in particular dha, have also been shown to modulate mehg - toxicity in rats, and to possibly modulate mehg neurotoxicity, as demonstrated by in vitro studies . The aim of this study was to elucidate possible intervening effects of n-3 marine pufa (dha and epa) compared to the n-6 fatty acid arachidonic acid (ara, 20:4n-6) on mehg cytotoxicity in atlantic salmon kidney (ask) cells . Human embryonic kidney (hek293) cells were included in certain aspects of the study, and mehg - induced toxicity was compared between the two cell types by assessing effects on cell proliferation and death using the xcelligence system . Interaction effects caused by fatty acids on mehg toxicity were screened by investigating known mechanistic effects of mehg, such as uptake of mehg in both cell lines, apoptosis in ask cells, and oxidation of rogfp in hek293 cells . Additionally, we investigated the regulation of transcriptional markers for mehg toxicity and fatty acids metabolism and how dha, epa, and mehg affected these in ask cells . The cells were grown in leibowitz l15 media with 20% fbs and 1 penicillin / streptavidin / amphotericin (all from sigma, st . Hek293 cells were a gift from marc niere (university of bergen, norway). Louis, mo, usa) supplemented with 10% fbs, 1 l - glutamine, and 1 penicillin / streptavidin / amphotericin at 37c with 5% co2 . Fatty acids were coupled to fatty - acid - free bsa (faf - bsa) (paa, pasching, austria) as described by . Briefly, the fatty acids were weighed and 0.04 ml chloroform per mg fa was added . Furthermore, potassium hydroxide (koh) was added in a 1: 3 relationship and the vial shaken in a whirl mixer for ten minutes . Faf - bsa was added in a 2.5: 1 ratio to fa . The solution was then shaken 45 minutes, sterile - filtered, and stored anoxic at 80c until use . Ask cells were seeded in concentrations of 24 000 cells per cm . After 24 hours the cells were preincubated with 300 m dha, 300 m epa, or 300 m ara, all purchased from sigma, st . Louis, mo, usa . The controls were preincubated with equivalent amounts of bsa as would be found together with fatty acids at concentrations of 300 m . The cells were preincubated with fatty acids or bsa for 72 hours, and the media were removed before mehg, diluted in media, or control, just fresh media, was added . Hek293 cells were seeded, and similar to ask they were preincubated with the same fatty acids; however, the incubation time was reduced to 24 hours due to a more rapid cell growth of hek293 compared to ask . Mehg, or control, was added and endpoint measurements were performed within a time frame of 48 hours . 48 hours after mehg addition, the cells were scraped off using a rubber policeman and washed 3 times in 1 pbs . The cells were further divided into two aliquots, where one was added to a dma 80 mercury analyzer . The other half of the cells were lyzed, and total protein was measured using the bca protein assay (thermo scientific pierce, rockford, il, usa) on a labsystems iems reader (thermo fisher scientific inc ., 24 hours after mehg addition, cells were harvested and analyzed as described previously for ask cells . In order to investigate the effect of mehg on cell viability and proliferation, we implemented the xcelligence rtca sp impedance assay from roche diagnostics (mannerheim, germany) where cell adherence is measured in real time . The base of the xcelligence technology is the disposable e - plates, which are similar to normal 96-well microtiter plates . These plates are connected to an rtca analyzer and computer with rtca - associated software . The e - plates contain gold - plated sensor electrodes in the bottom of each well, which enables impedance readings from a small current emitted into the system . The distance from one electrode to the next in the xcelligence system is possibly obstructed by cell media and cells adhering to the electrodes . Cells will act as insulators at the electrodes and will alter impedance measurement based on cell density and cell adherence . Hence, this impedance measurement will correspond to cell growth, cell toxicity, and adherence qualities (morphology) of the cells . A broader introduction of the xcelligence system and software has previously been presented in [27, 28]. Ask cells were seeded at a concentration of 24 000 cells per cm in a 96-well e - plate . Fresh media containing bsa were added 24 hours after seeding, at a concentration of 150 m (equivalent to the amount incorporated in fa). The cells were incubated another 72 hours, before they were washed twice in fresh media and mehg was added in concentrations from 1 to 4 m mehg dispersed in fresh media . Impedance measurement was recorded every 30 minutes throughout the analysis and up to 48 hours after addition of mehg . Hek293 cells were seeded at a concentration of 15 000 cells per cm in a 96-well e - plate . The cells were incubated for another 24 hours, before they were washed twice in media, and mehg dispersed in media was added in concentrations of 17 m . Impedance measurement was recorded every 30 minutes, with the exception of the first hour after any modification to the cells, where it was measured every 15 minutes . Impedance measurements were performed throughout the analysis and up to 48 hours after addition of mehg . After addition of mehg to both ask and hek293, the xcelligence plot showed a pronounced increase in cell adherence . Since this also occurred in the control, it was deemed likely that this specific effect was due to the washing of the cells with the resulting loss of cell adherence and increase in floating cells . When these cells adhered during the next couple of hours, a pseudoincrease in growth curve would be expected . Moreover, the renewal of the media with fresh nutrient was also likely to impose a sudden increase in growth of the cells . In order to focus on the more long - term effects of mehg, it was chosen to normalize cells when the growth curve stabilized . In order to standardize this normalization, growth curve of control cells in both ask and hek cells was smoothed using the prism 5.04 (graphpad software inc ., san diego, ca, usa), to get more continuous curves . After smoothing, the first derivate of the curve was calculated in order to investigate the slope of the curve . At the time point where the first - derivative first approached zero (where cell growth stabilized), the curve was normalized in all treatments for the respective cell type . Ask cells were seeded at a concentration of 24 000 cells per cm in 24-well culture plates and further treated as described in basic experimental design . After 48-hour exposure to mehg, the cells were fixed with 4% para formaldehyde (chemi teknik, oslo, norway) and stained with 4 g ml bisbenzimide h 33342 (sigma, st . The fluorescent imaging was performed at the molecular imaging center (fuge, norwegian research council), university of bergen . Ask cells were preincubated with the different fa and exposed to mehg in 6-well plates at a cell density of 24 000 cells / cm, as previously described . After exposure to mehg for 48 hours, the cells were harvested using a rubber policeman . Cells were lysed, and total rna was extracted using rneasy columns (qiagen, oslo, norway). The quantity and quality of the rna were assessed with the nanodrop nd-1000 uv - vis spectrophotometer (nanodrop technologies, wilmington, de, usa). The concentration of rna in one well of a 6-well plate containing 24 000 cells per cm was approximately 50 ng l . The expression of 11 target genes and two reference genes in ask cells after fa and mehg exposure (table 1), was analyzed using a two - step real - time rt - pcr protocol . The rt reactions were run in triplicates in a 96-well plate, with 250 ng rna in each sample . For pcr efficiency calculations a 6-fold serial dilution (1000 - 31 ng) in triplicates template controls (ntc) and rt enzyme control (nac) were included in each 96-well plate . The rt reaction was performed according to manufacturer's instructions using taqman reverse transcription reagents (applied biosystems, foster city, ca, usa) on a geneamp pcr 9700 machine (applied biosystems, foster city, ca, usa). Reverse transcription was performed at 48c for 60 min by using oligo dt primers (2.5 m) for all genes in 30 l total volume . The final concentration of the other chemicals in each rt reaction was mgcl2 (5.5 mm), dntp (500 mm of each), 10x taqman rt buffer (1x), rnase inhibitor (0.4 u/l), and multiscribe reverse transcriptase (1.67 u/l) (applied biosystems). Diluted cdna (1: 2) (2.0 l cdna from each rt reaction) was transferred to a new 96-well reaction plate and the qpcr run in 10 l reactions on the lightcycler 480 real - time pcr system (roche applied sciences, basel, switzerland). Real - time pcr was performed by using sybr green master mix (lightcycler 480 sybr green master mix kit, roche applied sciences,), which contains faststart dna polymerase and gene - specific primers (500 nm). Pcr was achieved with a 5 min activation and denaturizing step at 95c, followed by 45 cycles of a 15 s denaturing step at 95c, a 60 s annealing step and a 30 s synthesis step, at 72c . Target gene mean - normalized expression (mne) was determined using a normalization factor calculated by the genorm software based on two selected reference genes, ef1ab and arp . Genorm determines the individual stability of a gene within a pool of genes and calculates the stability according to the similarity of their expression profile by pairwise comparison, using the geometric mean as a normalizing factor . The gene with the highest m, that is, the least stabile gene, is then excluded in a stepwise fashion until the most stabile genes are determined . Here, a normalizing factor based on two examined reference genes was used to calculate the mne . In the fluorescent vector pegfp - n, already containing a c48s mutation, serine and glutamine at positions 147 and 204 have been replaced by two cysteines to create the rogfp2 c48s / s147c / q204c . The thiol group in these cysteines reacts to changes in the red - ox environment of the cell, altering the conformation of the rogfp - protein, and subsequently its conformation and fluorescent properties . The rogfp has two emission peaks (figure 1(a)), which vary in intensity according to red - ox status in the cell . By measuring the emission of the rogfp at these two different excitation wavelengths, a ratiometric value representing the red - ox status in the cell can be obtained . The plasmid pegfp - n1/rogfp was purchased from university of oregon . A stable cell line expressing rogfp (figure 1(b)) was made by transfecting hek293 using fugene hd transfection reagent (roche diagnostics, mannheim, germany) according to manufacturer instructions, and then the cells were selected using 400 g ml geneticin (g418) (invitrogen, by land). After selection, the cells were grown in media containing 200 g ml geneticin . Cells containing rogfp were excited at 400 and 488 nm, and emission at the two different excitation points was measured at 510 nm using a optima fluostar plate reader (bmg labtech, offenburg, germany). A ratiometric value from the emission at the two excitation points was obtained by (1)emission at excitation point 488 nm emission at excitation point 405 nm = red / ox ratio . When rogfp positive cells grow, the total signal will increase, and since the two peaks measured have different emission maxima, a general increase in signal leads to a small change in the ratio . In order to adjust for this every treated sample was normalized to control at each time point: (2) red ox ratioaverage control red ox ratio = relative red / ox ratio . In order to reduce systematic errors in the assay, the relative red - ox ratios were also normalized to their relative red - ox ratio at the start of the experiment (t0): (3)relative red ox ratiored ox ratio at t0=normalized red ox ratio . To compare red - ox ratio of fatty acids and mehg to a known oxidative inducer, a titration curve using h2o2 was run and a standard curve was calculated using linear curve fitting (figure 1(c)) of the log - transformed h2o2 concentration . Oxidative effects of fatty acids and mehg were then calculated into corresponding concentrations of h2o2, to visualize oxidative effect . All statistic analysis was performed using statistica 9 (statsoft inc ., tulsa, usa) and graphpad prism 5.04 (graphpad software inc . Uptake data, apoptosis count, and red - ox measurement were processed using one - way anova followed by post hoc dunnett's test . Real - time rt - pcr data were processed using the nonparametric kruskal - willis with post hoc paired comparisons . Cells were preincubated with the marine fatty acids: dha or epa, the n-6 polyunsaturated fatty acid ara, or bsa as control, before addition of mehg . Ask cells preincubated with dha, epa, or ara showed no difference in uptake of mehg compared to mehg - control (figure 2(a)). In hek293 cells, however, dha significantly decreased the uptake of mehg (figure 2(b)). Cell toxicity of mehg in both ask and hek293 cells was investigated using xcelligence impedance measurement . Both cell lines showed a clear dose - response curve after titration versus mehg (figure 3). In hek293, impedance measurements were stabilized at a concentration of 5 m mehg, where no further decrease was measured . Therefore, concentrations above 5 m were considered as too high to be statistically relevant, and only data from 05 m mehg were used in regression analysis of dose response . Impedance measurement of ask cells also seemed to reach a plateau as the mehg concentration increased similar to hek293, but more noticeable was the early onset of toxicity from control to 1 m mehg (figure 3). Area under curve (auc) was calculated in ask cells from time point 102 h144 h after seeding, as a measurement of cell toxicity, and used in regression analysis . This dose - response curve of ask auc followed a nonlinear regression curve with r = 0.9824 (figure 3(c)). Auc was also calculated from hek cells from time point 5396 h. the dose - response curve of hek auc followed a linear curve fitting with r = 0.9491 (figure 3(d)). Apoptosis was measured using morphological analysis of ask cells after fatty acid preincubation and mehg exposure . A dose - response curve of mehg was investigated by preincubating cells with bsa, instead of fatty acids, followed by a titration to different mehg concentrations . Apoptosis count was plotted, and curve fitting was performed (figure 4(a)). The dose response followed a nonlinear regression curve (r = 0.9564). From the dose response curve we chose a concentration of 2.5 m mehg to test the effect of fatty acid preincubation on mehg - induced apoptosis, since this particular concentration of mehg induced a level of apoptosis which can be remedied by molecular intervention . Cells preincubated with different fatty acids were compared to control cells preincubated with bsa and exposed to mehg using one - way anova and post hoc dunnett's test . Preincubating dha significantly (p = 0.000014) increased while epa significantly (p = 0.043948) decreased apoptosis induced by 2.5 m mehg . Total rna from ask cells, preincubated with the different fatty acids and exposed to mehg, was extracted and the gene expression of selected markers was investigated . When comparing all groups exposed to mehg versus control (mehg main effect), the b - cell lymphoma 2 (bcl2) like protein (bclx), heat shock protein 70 (hsp70), and cyclooxygenase 2 (cox2) were all upregulated by mehg (figures 5 and 6). Fatty acid transport protein (fatp), carnitine - palmitoyl transferase (cpt1), and tubulin (tuba) were downregulated by mehg (figures 5 and 6). When comparing the different fatty acids (fatty acid main effect) versus control, no effects were observed . When comparing all groups, hsp70 was significantly upregulated in ara- and mehg - treated cells compared to control . Fatp was significantly downregulated in cells preincubated with dha compared to the control, while tuba was significantly downregulated in cells preincubated with epa and exposed to mehg compared to the control . No significant effects of the treatments were observed in glutathione peroxidase 2 (gpx2) or glutathione - s - transferase (gst) (figures 5 and 6). Hek293 cells were stably transfected with rogfp plasmid and showed a clear fluorescence after g418-selection (figure 1(b)). These cells were used to investigate effects of fatty acids and mehg on oxidative status in cells . Oxidative stress caused by fatty acids and mehg treatment was compared to equivalent signals generated by the known oxidative inducer h2o2 (table 2). Incubating hek293 cells with epa and ara did not induce any change in oxidative status however, both dha and mehg significantly induced an oxidative state in the cells after 5 minutes of incubation (figure 7(a)). Dha steadily kept cells in a state of oxidative stress during its preincubation, but after addition of fresh media a normal oxidative status was recovered (figure 7(b)). Mehg also rapidly induced oxidation in the cells, but cells recovered their original oxidative status within approximately 1 hour (figure 7(c)). Preincubating cells with fatty acids did not affect the change in the oxidative status caused by later mehg exposure (figure 7(a)). In this study, the mediating effects of the marine n-3 fatty acids dha and epa on mehg toxicity were studied . Epa ameliorated the apoptotic response of ask to mehg, while dha reduced the uptake of mehg into hek293 cells . These results indicate that the metabolism of marine n-3 fatty acids may ameliorate mehg toxicity at the molecular level and that the nutrient content of a diet may affect the potential negative effect of mehg - contaminated fish . However, dha also augmented the mehg - induced apoptosis in ask cells, indicating potential potentiating effects of dha on mehg toxicity . The metabolism of nutrients into applicable energy for the cell is a vital part in maintaining cell survival . In different exploratory studies performed on fish exposed to mehg, changes in metabolic genes or proteins have been reported [8, 31]. In our study we found a significant decrease in cpt1 and fatp gene expression as a result of mehg exposure . Cpt1 is responsible for a rate limiting step in mitochondrial -oxidation of fatty acids: the transport of fatty acids into mitochondria for catabolism . The regulation of fatp is thought to be governed through peroxisome proliferator receptors (ppars), hence being dependent on induction of ppar through ligand - binding . Fatp is also, in part, responsible for the import of fatty acids into mitochondria by interacting with cpt1 . When transcription of both cpt1 and fatp is decreased in our cell system, this may signify a decrease in the availability of fatty acids as substrate for energy metabolism in the mitochondria and a subsequent reduced metabolic throughput . This could be a direct effect of mehg on the proteins themselves or their regulatory mechanisms, or alternatively it could be that the transcriptional expression of these genes is downregulated as a secondary response to metabolic shutdown after mehg - induced apoptosis is initiated . Studies have shown that mehg can disrupt the mitochondrial energy metabolism more directly, possibly through inhibiting phosphorylation of adp to atp, or depolarizing the mitochondria . The detrimental effect of mehg on mitochondrial metabolism in the cell may also increase leakage of reactive oxygen species from mitochondria and thereby increasing ros . An important metabolic pathway for 20 carbon polyunsaturated fatty acids (epa and ara) is the eicosanoid pathway, where activation of cytosolic phospholipase a2 (cpla2) catalyzes the breakdown of membrane phospholipids and releases ara for subsequent metabolite formation . An important enzyme in this pathway is cyclooxygenase 2 (cox2), which we showed to be upregulated in response to mehg exposure . This may be a secondary response to mehg - induced oxidative stress since cox2 expression has been shown to increase in response to oxidative stress [40, 41]. Cox2 is responsible for the conversion of ara into prostanoids, such as the prostaglandins . An increase in production of prostaglandins may increase the inflammatory response in the cell, meaning that mehg may induce proinflammatory metabolites of ara . Metabolites derived from ara such as the prostaglandin e2 have also shown to increase intracellular ca in osteoblast - like cells . Increase of intracellular ca is also a known toxic effect of mehg, meaning that increased cox 2 leading to increased production of prostaglandins may be part of the underlying cause of mehg - induced ca influx, with consequent increase in apoptosis . The enzymes in the eicosanoid pathway have the ability to utilize both ara and epa as substrate for production of different metabolites . However, ara- and epa - induced eicosanoids exhibit different molecular effects in the cell . In our study, epa ameliorated the apoptotic effect of mehg in the ask cells, while ara did not . If excess epa out competes ara in the eicosanoid pathway, the resulting metabolites show more anti - inflammatory effects than the respective ara metabolites . Epa might even reduce the inflammatory effects of ara - metabolites created in the same system . The abandoning of aras proinflammatory and possible ca releasing effects could be part of the explanation why epa reduces mehg - induced apoptosis in ask cells . Ara supplementation did not augment the toxicity of mehg, which one might expect if the proinflammatory ara - derived eicosanoids are damaging to the cell . However, the fbs added to the cell media in the mehg - control probably already contains relatively high ara - to - epa ratio, making the production of ara - derived metabolites saturated, and not dependent on cox2 or the availability of substrate . Another side of the story is that by replacing ara with epa in the eicosanoid system, more epa - derived eicosanoids will be produced, which could reduce inflammation and affect mehg toxicity directly, or through apoptosis signaling pathways . The effect of epa - derived eicosanoids on mehg toxicity generally, and apoptosis specifically, is not yet known, and further investigations are necessary to elucidate this . Oxidative effects of fatty acids with and without mehg were investigated using rogfp - hek293 cells, and as opposed to dha, epa and ara did not affect the oxidation of rogfp in the cells . These results are consistent with the lack of antioxidant protection against mehg of fish oil, shown in previous studies . There are, however, studies showing that epa can cause oxidative stress in muscle and liver cells of atlantic salmon [48, 49]. However, since we did not see any indications of this, there could be other molecular mechanisms explaining the antioxidant effects noted elsewhere in the literature . Epa, unlike dha, did not affect the uptake of mehg into hek293 cells, suggesting that there must be intracellular molecular mechanisms responsible for epa's ameliorating effects on mehg - induced apoptosis . Dha preincubation significantly decreased the uptake of mehg in hek293 cells, which is consistent with other studies using human cerebellar astrocytes and cerebellar neurons . No significant difference in uptake of mehg due to dha was observed in the ask cells . However, ask cells were grown at lower temperature and displayed much lower metabolic rate than hek293 cells . Given that uptake of mehg is an active metabolic process linked to carrier mediated processes, the effect of dha on mehg uptake may be disguised in our experimental settings . Unfortunately, this leaves our results in ask cells indicative instead of conclusive, and further research of uptake mechanisms affected by dha, in different cell types, is needed . The amended uptake of mehg observed in the hek293 cells may be due to altered membrane properties after dha preincubation . Pufas are important constituents in cell membranes, where they affect several functions such as membrane organization, elasticity, microdomain formation, and permeability of the lipid bilayer . However, due to the difference in chain length and the number of double bonds, dha is thought to differ in flexibility and conformational freedom compared to epa and hence will cause different structure disorganization . By changing physical properties of cell membranes, dha may affect uptake of extracellular compounds, such as mehg, into cells . Although dha decreased the uptake of mehg in the hek293 cells, we observed an increase in apoptosis of ask cells after dha preincubation and mehg exposure . This increase was profound, and real - time rt - pcr analysis of the apoptotic regulator bclx in ask cells suggested a similar effect, though not significant compared to cells only exposed to mehg . The apoptotic effect seems to be triggered by the addition of mehg, since dha treatment alone did not induce increase in apoptosis (results not shown). A possible explanation for the severe apoptotic effect of dha together with mehg may be due to changes in the red - ox status in the cells . Although some literature reports dha as an inhibitor of oxidative stress in certain cells, dha has also been reported to induce oxidative stress and production of ros [48, 55]. Mehg is known to be a pro - oxidant, so the observation can be explained by a potential effect of the compounds . Another possible explanation could be that dha has inhibited the cells innate antioxidant defense system over time . When we investigated oxidation of rogfp in the hek293 cells, both mehg and dha were observed to oxidize rogfp . Dha kept rogfp in a continuous oxidative state, whilst mehg affected the oxidation of rogfp moretemporarily . Epa and ara did not oxidize rogfp in the cells, indicating that the pro - oxidative effect of these fatty acids, compared to dha, has been obliterated or kept under control in the cells . Conversely, no significant effects of dha were noted on the transcriptional regulation of the two antioxidant enzymes gpx2 and gst in ask cells . However, this may be due to normalization of these levels after replenishing control cells with fresh media after the fatty acid preincubation . In this study we have shown that the marine n-3 fatty acid dha can decrease mehg uptake in hek293 cells as well as increase mehg - induced apoptosis in ask cells . Furthermore, the proapoptotic effect of dha may depend on its ability to induce changes in the red - ox environment in the cell . To our knowledge, this is the first time that ameliorating effects of the marine fatty acid epa on mehg - induced apoptosis are reported . Taken together, the effects shown by dha and epa on mehg - induced toxicity, in this study, may help explain the differing toxicity observed in response to type of dietary mehg source.
|
Alkyl polyethoxylates (apeo), widely used as industrial and domestic surfactants, are added to a variety of products such as dispersants, emulsifiers, detergents, dyes, antioxidants, pesticides, spermicides, and cosmetics [14]. Most of these compounds including nonylphenol polyethoxylates (npeox) are incorporated to aqueous solutions, and after being used, they are discharged in industrial or municipal water waste and eventually enter water treatment plants [5, 6]. Due to their persistency at low temperatures npeox remain in the environment and could be bioaccumulated, which is harmful to animals, humans, and other biological aquatic species [710], as its degradation products are more toxic than the original molecule [1, 3, 8, 1113]. The toxic effects exerted by npeox and its degradation products include reduction of spermatozoid number, increase of testicular cancer, and feminism in aquatic male species [7, 8, 14, 15]. The highly ethoxylated npeox compounds lack estrogenic activity, whereas the low ethoxylated ones, included nonylphenol, which arise from nonylphenol ethoxylates by degradation in natural environments, do affect fishes, amphibians, birds, mammalians, invertebrates species such as crustaceans, mollusks, algae, yeast, and plants [3, 1619]. These compounds also negatively affect microbial biomass growth by competitive inhibition mechanisms when the biomass is not acclimated . Apparently, the estrogenic activity is induced because nonylphenol mimics the structure of the female sexual hormones, the estrogens [5, 21, 22]. Thus, nonylphenol and ethoxylated alkylphenols have been classified as pseudoestrogens and endocrine disrupters because of the harmful effects on the endocrine systems, the reproductive cycles, and other vital functions in humans and other animal species [4, 6, 13, 23, 24]. Npeox degradation occurs through several pathways: (i) cleavage of the ether bonds with the generation of alkyl - phenol derivatives with shorter ethoxylated chains, which yields mono- and diethylated compounds (npeo1 and npeo2) that could further be carboxylated to form ethoxyacetic and acetic nonylphenol acids [11, 2527]. (ii) -carboxylation of the ethoxylated chain, yielding different polyethoxylated derivatives, being the most abundant the diethoxylated species (npeo2c); simultaneously, it is possible that the oxidation of the nonyl chain generates dicarboxylic compounds (cnpeo1c), without production of nonylphenol . (iii) simultaneous shortening of the ethoxylated and alkylic chains to produce propyl and heptyl diethoxylated compounds and (iv) oxidation of the polyethoxylated chain, without any shortening, to yield the corresponding carboxylic acids [27, 28]. Besides, it has been reported that the initial step in the npeox degradation occurs on the ethoxylated moiety of the molecule, followed by further attack on the aromatic nonylphenol ring . The degradation of the aromatic ring occurs under aerobic conditions yielding several soluble metabolites which are finally degraded to co2; the kinetic order of the reaction corresponds to a first - order process [31, 32]. In anaerobiosis, pseudomonas putida degraded npeox, with different length chains (x = 6, 9 and 20), yielding as a final product npeo2, no carboxylic acids were detected . Sphingomonas xenophaga was able to cleave the aliphatic nonyl chain, bound to the phenol, depending on a specific branching pattern; only the para isomer was degraded . Finally, degradation of npeox is carried out by several bacterial genera: pseudomonas, sphingomonas, cupriavidus, ralstonia, achromobacter, staphylococcus, ochrobactrum, castellania, variovorax, bacillus, and psychrobacter [25, 27, 28, 3335]. Due to the negative effects of npeox on animals and the natural environment, its use for manufacturing domestic detergents has been banned, and their industrial applications are seriously restricted in the european community, united kingdom, united states of america, new zealand, and japan . However, in many countries, including venezuela, china, and india, legislation to control the use of such surfactants is inexistent or is not realistic . Therefore, it seems necessary to carry out studies to search for indigenous bacterial strains able to degrade npeox to be used as possible bioremediation agents on contaminated natural environments . Two of them, pseudomonas fluorescens (strain yas2) and klebsiella pneumoniae (strain yas1), showed high capacity for using npeo15 as sole carbon source . The degradation process was followed by viscometry of the previously used culturing media and measurement of the chemical and biological oxygen demands . To our knowledge, this is the first report of the npeox degrading activity by klebsiella sp . The bacterial strains were isolated from soil samples collected in the gardens of the centro de investigaciones microbiolgicas aplicadas (cima - uc), campus brbula, carabobo, venezuela . To our knowledge the bacteria were grown in a minimal mineral medium (mm) containing the followings salts (p / v): 1% cuso4, 0.1 ml; 0.5% feso4, 2 ml; 1% mgso4, 0.2 ml; 1% znso4, 0.5 ml; 0.7% nacl, 0.05 ml; 0.1% nh4cl, 1.0 ml; 0.8% nh4no3, 0.125 ml and 1% caco3, 0.5 ml, volume was adjusted to 1.0 l with 0.1 m phosphate buffer at appropriated ph values, as it will be indicated further (mm medium). All salts were proanalysis quality and the ethoxylated nonylphenol (npeo15, mw 880 g mol) was kindly donated by palma products, ca valencia, venezuela . Soil samples (100 g) were suspended in mm medium (250 ml) in 500 ml flasks, at ph 7.0, in aerobiosis, and appropriate volumes of npeo15 were added to reach final concentrations of 3% v / v and 30% v / v (0.0365 and 0.365 m, resp . ). The systems were incubated at room temperature (2225c) under constant shaking during 45 days . Aliquots (3 ml), taken at different cultivation times, seeded in nutritive broth tubes and the bacterial growth was evaluated, after 24 h at 37c, by single visual inspection of turbidity . After streaking of the total bacterial population on nutritive agar plates, after 2448 h at 37c, colonies were selected and assessed for growth in mcconkey, kliger's iron and oxidase media and finally the isolated colonies were stored in nutritive broth at 4c until further use . The taxonomic identification was carried out by using the analytical profile index (api) 20e and 20ne systems (biomrieux sa, france). The selected bacterial colonies were grown in 250 ml flasks containing mm/3% npeo15 medium (50 ml), ph 7, in aerobiosis for 12 h at 27c, and then aliquots were submitted to different experimental protocols.to assess the purity and viability of the colonies, aliquots (1 ml) were added to the same medium (150 ml) at 27c and the bacterial growth was assessed, at intervals of 3 h, over a period of 9 h, by measuring the absorption at 660 nm on a spectronic genesys ii spectrophotometer . Simultaneously, aliquots (1 ml) were used, to prepare solutions by successive dilution that allowed determining the number of colony forming units per milliliter (cfu ml). The mm/3% npeo15 medium was adjusted to different ph values (7, 8, 8.5 and 9) and the bacterial growth was followed as indicated in protocol i. the mm medium was adjusted to 1, 3, and 5% npeo15 concentrations (0.0121, 0.0365, and 0.0605 m, resp . ). The bacterial growth was followed as indicated in protocol i. to assess the purity and viability of the colonies, aliquots (1 ml) were added to the same medium (150 ml) at 27c and the bacterial growth was assessed, at intervals of 3 h, over a period of 9 h, by measuring the absorption at 660 nm on a spectronic genesys ii spectrophotometer . Simultaneously, aliquots (1 ml) were used, to prepare solutions by successive dilution that allowed determining the number of colony forming units per milliliter (cfu ml). The mm/3% npeo15 medium was adjusted to different ph values (7, 8, 8.5 and 9) and the bacterial growth was followed as indicated in protocol i. the mm medium was adjusted to 1, 3, and 5% npeo15 concentrations (0.0121, 0.0365, and 0.0605 m, resp . ). The bacterial growth was followed as indicated in protocol i. the assays were executed according to the open reflux method 5220b . Bacterial strains were incubated for 24 h in mm/1% npeo15 medium, 27c, and ph 8, and bacterial growth was followed every 3 h, at 660 nm absorbance . Aliquots were withdrawn after 0, 6, and 24 h incubations, and the samples were filtered through millipore membranes (0.45 m pore size) to obtain free bacterial filtrates (fbf) and submitted to analysis . A blank system (without bacterial inoculums) after 24 h at 27c, ph 8 in mm/1% npeo15 medium, inoculums (1 ml) were incubated in the same medium and conditions . Aliquots were withdrawn after 6, 24, and 48 h incubation times and dilutions prepared in water (300 ml) were incubated for 5 days at 20c in a dark and dry chamber . Volumes (5 ml) of bacterial cultures grown in mm/5% npeo15 medium, ph 8, at 27c for 12 h, were transferred to the same medium (300 ml) and aliquots were withdrawn at different times for one week at 25c . Immediately after the removal, the samples were filtered through millipore membranes (0.45 m pore size) to obtain the fbf and stored at 20c until further use . The viscosity changes were determined in a cannon 50w404 ostwalt viscometer at 25c and densities in a 10 ml pycnometer . A calibration curve relating flow times (seconds) in the viscometer to npeo15 concentrations (mm) was obtained in order to determine the remaining npeo15 concentrations . Values, at 25c, for water density (0.99704 g ml) and viscosity (0.8904 g cm s, centipoises) were taken from weast . Relative viscosity values were calculated by the expression s = otss / too, where zero subscript refers to water and s to npeo15 aqueous solutions [39, 40]. From the soil samples five indigenous bacterial colonies were isolated, of which strain h grew on mm/3% npeo15 medium and the other four (strains f, k, n, and o) on mm/30% npeo15 . Table 1 shows the morphological and biochemical characteristics of the isolated strains . The bacterial growth on mm/3% npeo15 medium, ph 7, 27c is shown in figure 1 . Strains k and o showed the highest growth rates; both grew without lag phase and the logarithmic phase was observed until 6 h incubation time . Because of this behavior both strains were chosen to perform subsequent experiments . According to the api identification system strains k and o were identified as pseudomonas fluorescens and klebsiella pneumonia and were named yas2 and yas1, respectively . The behavior of the bacterial strains at different ph values is described in figure 2 . Maximal growth rates were achieved at ph 8 (0.04 and 0.033 absorbance units), whereas the minimal growth was observed at ph 9 (0.008 and 0.01 au) after 6 h culturing time . These data correlated well with the cfu ml numbers at 6 h culture: 1010 and 1010 cfu ml at ph 8 and 9, respectively (data not shown). In figure 3 the bacterial growth patterns with respect to the npeo15 concentration in the media are shown . Maximal (0.09 and 0.062 au) and minimal (0.019 and 0.012 au) growth values were achieved at 5% and 1% npeo15, respectively, at 9 h incubation times . Usually, in the culture media of 1% and 3% the maximal growth was observed at 6 h incubation, and then it reached the stationary growth phase at 9 h. the logarithmic growth phase persisted until 9 h for the 5% npeo15 system, and then the stationary phase disappeared . Finally, a mixture culture of yas1/yas2 in 1% npeo15 medium, ph 8, showed a synergistic effect on the bacterial growth, reaching maximal values (0.095 au) at 9 h incubations and 27c, which represents a stimulatory average factor close to 5.7 with respect to the individual bacterial cultures at 1% npeo15 medium (0.014 and 0.02 au); additionally, the lag phase was absent (see figure 4). This stimulatory effect is probably due to npeox cometabolism by the yas1/yas2 system, as it has been described for other bacterial consortiums . The npeo15 biodegradation was determined in fbf by following the flow time in a viscometer and by the chemical oxygen demand, also the biological oxygen demand was evaluated . Figure 5 shows the calibration curve that relates the molarity of npeo15 solutions and their flow times in a viscometer . The data fit the equation y = 226.9 + 0.9418x (r = 0.94) calculated by linear regression . Tables 2 and 3 show the viscosity and density changes, flow times (s), molarity (m) of remaining npeo15, and density (g l) and viscosity (g cm s) of the fbf corresponding to different incubation times for both bacterial strains . A decrease in the fbf viscosity and density correlated well to the observed decrease of the determined flow times . From an initial value of 1.150 g cm s the viscosity was reduced to 0.8959 and 0.8490 for yas1 and yas2 systems, respectively . These facts indicated the cleavage of the npeo15 to lower molecular weight species . On basis of these data yas1 and yas2 degraded 0.0392 (0.06050.0213) and 0.0383 npeo15 moles l (0.06050.0216) in 54.5 and 134 h, respectively . The extension of the degradation process has been reported as temperature dependent [6, 42]. In this study degradation was close to 65% at 27c; similar values have been reported by other authors [6, 40, 41, 43]. It was also observed that foam appearing at the beginning of the incubations decreased at late incubation times . At 71 h (yas1) and 163 h (yas2) incubations, foam had totally disappeared and simultaneously, viscosity increases were evident in both cultures . It is well known that several bacterial genera are able to produce viscous polymers (mucopolysaccharides, dextrans, proteins, poly--hydroxybutyrate, polyphosphates, and xanthans) as strategies to retain nutrients and water, as energy reserves and for defense purposes [4448]. Another aspect for consideration is the observed viscosity changes with the incubation times; yas1 decreased the viscosity from 1.15 g cm s to 0.8959 in 54.5 h, a relative short time; at 8.5 h of incubation the viscosity fell, but it suddenly rose (22.5 h) to fall again at 32.5 h incubation . This apparent data dispersion could be due to the well - known mucogenic properties of the klebsiella genus [44, 46, 47], which was also observed in this study (see table 1). On the other hand, yas2 changed the viscosity from 1.15 to 0.849 g cm s, in 134 h, a relative longer time, without abrupt changes . Thus, yas1 produced viscous materials at early and late incubation times, whereas yas2 did it only at late times . Synthesis of dextrans and alginates by klebsiella and pseudomonas, respectively, has been reported [4951]; therefore, viscometry studies to evaluate degradation of viscous substances seem to be inappropriate when the bacteria are capable of synthesizing viscous polymers during the whole incubation time, such as klebsiella did . However, if the bacteria yield viscous molecules at relatively late times during the incubation, then the viscosity changes could be a useful, cheap, and rapid method to detect biodegradation of viscous xenobiotic polymers, as in the pseudomonas system . Regardless of whether the bacteria degrade npeo15 or the bacterial polymers, differences in degradation times displayed by the bacterial strains would imply that yas1 cleaved chemical bonds near the aromatic ring in the npeo15 molecule, producing low molecular weight species and causing a rapid change in the viscosity, whereas yas2 seems to exert its action progressively on bonds near to the hydroxylated end of the surfactant ethoxylated chain, thus the decrease of the molecular mass was not as abrupt and the viscosity decrease should be slow . The reported data in tables 2 and 3 allowed obtaining kinetic information about the npeo15 biodegradation . Taking the initial (co) and remaining (cx) npeo15 concentrations at different incubation times it was possible to determine the kinetic order for the npeo15 biodegradation according to first- and second - order kinetic equations for a chemical reaction, also the kinetic rate constant k and the half life time for the npeo biotransformation were calculated . Figure 6(b) shows the ln(co / cx) versus t plot corresponding to the yas2 data (table 3). The obtained straight line (y = 0.0072x0.0053, r = 0.9728) indicated the npeo15 biodegradation obeyed first - order reaction kinetics; data from other laboratories indicated that npeo1 and npeo2 also obeyed the same order kinetics . A similar analysis for the yas1 system (figure 6(a)) did not allow assigning any reaction order because of the viscous material synthesized at early and late time incubations by the yas1 strain . The estimated values of the rate constant k and time for yas2 were 0.0072 h and 96.3 h, respectively . For these calculations the corresponding data at 163 h were not considered because the observed viscosity increments were probably due to the synthesis of viscous bacterial polymers and not due to npeo15 present in the media . Although the maximal bacterial growth was obtained at 5% npeo15, the following experiments were executed at 1% npeo15 because the principal aim of this study was to propose a satisfactory solution to the real environmental npeo contamination which according to several reports should be less than 1 mg l [23, 5255]. The chemical and biological oxygen demands, determined in broths previously used by microorganisms, are indirect measurements of the carbonaceous substrate degradation by a microbial population . Tables 4 and 5 shows the chemical oxygen demand (cod) and the biological oxygen demand (bod) of both bacterial cultures in mm/1% npeo15 medium, ph 8 at different incubation times . After 24 h incubation, the cod values decreased from an initial value of 20,230 mgo2 l (zero time) to 666 and 3,066 mgo2 l, which represent 96 and 85% npeo15 degradation for yas1 and yas2 strains, respectively (see table 4). These low cod values, representing 4 and 15% of the initial values, indicate that both bacterial strains can probably degrade npeo15 and its low ethoxylated derivatives, including nonylphenol, as it has been reported for other bacterial strains [6, 26, 43, 56]. The bod5 data (table 5) indicated that both bacterial strains consumed 99% (60.11/8,675 and 67.8/14,000) and 99.9% (5.26/8,675 and 5.11/14,000) of the available oxygen in 24 and 48 h, respectively, which implies that the npeo15 derivatives did not exert appreciable toxic effects on the bacterial strains and are biodegradable . Npeox and its derivative degrading bacterial strains have been isolated from several natural environments and wastewater treatment plants [1, 5, 21, 30, 5759]. In this paper the reported data indicated that indigenous bacterial strains, isolated from soil, are able to use npeo15 as the sole carbon source . Although the viscosity descent is indicative of bond cleavages in the npeo15 molecule, it does not imply the use of the degradation products for sustaining the bacterial viability . However, the changes in the chemical and biological oxygen demands and the increments (viability) in the cfu ml number in npeo15 complemented media indicate that yas1 and yas2 must use the npeo15 degradation products to satisfy their metabolic requirements and support cellular division . P. fluorescens (yas1) and k. pneumoniae (yas2) thus appear to be useful biotechnological tools to bioremediate npeo contaminated waters and soils . Five bacterial strains, isolated from soil, grew on a minimal mineral medium supplemented with npeo15 (0.0365 m and 0.365 m) as the sole carbon source, being pseudomonas fluorescens and klebsiella pneumoniae the two most efficient npeo15 degrading strains . The extent of npeo15 degradation after 2448 h incubations, evaluated by cod and bod5 assays, was, 8595% and 99.9% respectively . The kinetic rate constant (k) and the half life time () for the npeo15 biotransformation by p. fluorescence were estimated to be 0.0072 h and 96.3 h, respectively, and the process followed first - order kinetics.
|
Dunaliella salina teodoresco is a green alga capable of producing high concentrations of carotenoids, i.e. More than 8% of dry weight (ben - amotz et al . Good hplc - based methods already exist for the separation, detection and quantification of a wide variety of carotenoids (fraser et al . . However, these methods do not give information about the intracellular localisation of the carotenoids . To gain more insight into, for example, the milking process to extract carotenoids (hejazi and wijffels 2004), it would be advantageous to have an imaging technique at our disposal that can visualise these carotenoid - containing globules . Electron micrographs of dunaliella cells show small globules in the chloroplast, labelled as carotenoid - containing lipid droplets (ben - amotz et al . 2004; hejazi and wijffels 2004; borowitzka and siva 2007). However, a disadvantage of electron microscopy is that it cannot be used on living cells . Fluorescence microscopy is a noninvasive imaging technique and can be used to study cellular processes in vivo . The detection of endogenous fluorescence from cell components or exogenous fluorescence from added dyes can be used to show and localise cellular components in vivo . An example of an endogenous fluorophore is chlorophyll which is widely known for its autofluorescence (papageorgiou and govindjee 2004). Also, fluorescence of carotenoids in solution has been demonstrated (gillbro and cogdell 1989; bondarev 1997). However, intracellular carotenoids as part of the photosystem are known to mainly quench fluorescence emitted by other cell components (lichtenthaler 1987; chappelle et al . 1991). In this paper, we show that the carotenoid - containing globules produced by d. salina emit green fluorescence that can be detected with confocal laser scanning microscopy (clsm). Absorbance and fluorescence measurements show that the fluorescence most likely originates from the -carotene in these globules . Dunaliella salina ccap 19/18 was obtained from ccap (culture collection of algae and protozoa, oban, uk). Cells were grown and stressed in a flat - panel photobioreactor with a working volume of 2,500 ml and a light path of 3 cm . The cell suspension was mixed by gassing (0.6 n2 l.min), and ph was controlled at ph 7.5 by adding co2 pulses . The temperature was kept at 30c by circulating temperature - controlled water through the reactor water jacket . For the growth period, the reactor was illuminated from one side with an average irradiance of 206 mol photonsm s (high - pressure sodium lamp). For the stress period, the irradiance was raised to 1,672 mol photonsm s by moving the lamp closer to the reactor . Small amounts (15 ml) of green cells harvested during the growth period and orange cells harvested during the stress period were used for microscopy purposes . At the end of the cultivation 8 40 ml cell suspension was centrifuged at 1,000g for 15 min . Each pellet was resuspended in 40 ml of 30 mm nacl and centrifuged at 12,000g for 10 min . To break the cells, each pellet was resuspended in 4 ml demineralised water and again centrifuged at 12,000g for 10 min . The supernatant was mixed with a solution of 2 ml of 50% sucrose in 10 mm tris hcl (ph 8.0). On top of this mixture, 0.5 ml 10 mm tris this mixture was centrifuged for 2 h at 48,000g to separate the globules from the chloroplast membranes . The absorbance and autofluorescence of the globules were measured using a spectrophotometer (avaspec-2048-usb, avantes, the netherlands) and a spectrofluorimeter (jobin yvon fluorolog fl3 - 22, horiba), respectively . As reference sample, 10 mm tris the excitation wavelengths for the emission spectra of the autofluorescence were 450, 488 and 510 nm . For emission, the bandwidth was 0.6 nm and the step size was 0.2 nm . Bright field microscopy pictures from cells and globule suspensions were made with a microphot fluorescence microscope (nikon) or a ck 40 bright field microscope (olympus) equipped with an olympus ax 70 camera . Fluorescence microscopy pictures of cells and globule suspensions were made with a clsm (zeiss lsm 510-meta 18). The clsm was connected to an inverted microscope (axiovert 200 m) with differential interference contrast (dic). For excitation, the argon diode laser (30 mw, 488 nm) was used . For the detection of emitted fluorescence, we applied the bp505 - 530/lp650 filtre combination . A zeiss 639 -plan fluar oil objective (na 1.45) the obtained clsm pictures were a combination picture of images from three channels, namely a dic microscopy image from the cell, an image from the green fluorescence between 505 and 530 nm and an image from the red fluorescence of 650 nm and higher . 8 40 ml cell suspension was centrifuged at 1,000g for 15 min . Each pellet was resuspended in 40 ml of 30 mm nacl and centrifuged at 12,000g for 10 min . To break the cells, each pellet was resuspended in 4 ml demineralised water and again centrifuged at 12,000g for 10 min . The supernatant was mixed with a solution of 2 ml of 50% sucrose in 10 mm tris hcl (ph 8.0). On top of this mixture, 0.5 ml 10 mm tris this mixture was centrifuged for 2 h at 48,000g to separate the globules from the chloroplast membranes . The absorbance and autofluorescence of the globules were measured using a spectrophotometer (avaspec-2048-usb, avantes, the netherlands) and a spectrofluorimeter (jobin yvon fluorolog fl3 - 22, horiba), respectively . As reference sample, the excitation wavelengths for the emission spectra of the autofluorescence were 450, 488 and 510 nm . For emission, the bandwidth was 0.6 nm and the step size was 0.2 nm . Bright field microscopy pictures from cells and globule suspensions were made with a microphot fluorescence microscope (nikon) or a ck 40 bright field microscope (olympus) equipped with an olympus ax 70 camera . Fluorescence microscopy pictures of cells and globule suspensions were made with a clsm (zeiss lsm 510-meta 18). The clsm was connected to an inverted microscope (axiovert 200 m) with differential interference contrast (dic). For excitation, the argon diode laser (30 mw, 488 nm) was used . For the detection of emitted fluorescence a zeiss 639 -plan fluar oil objective (na 1.45) was used for all imaging experiments . The obtained clsm pictures were a combination picture of images from three channels, namely a dic microscopy image from the cell, an image from the green fluorescence between 505 and 530 nm and an image from the red fluorescence of 650 nm and higher . When dunaliella salina cells are stressed, they start to produce carotenoids . The green cell which is dominated by the chloroplast starts to turn orange . The chloroplast shrinks, chloroplast membranes decrease in size and carotenoid - containing lipid globules are formed . Light microscopy clearly showed this difference between non - stressed and stressed cells (fig . Fluorescence microscopy also showed that a distinct difference in fluorescence pattern arose after stress (fig . 1a, b bright field microscopy picture of non - stressed (a) and stressed (b) d. salina cells . C, d fluorescence microscopy pictures (clsm) of non - stressed (c) and stressed (d) d. salina cells . Scale bars=10 m . The clsm pictures are combination images of three channels: dic microscopy, green fluorescence (505530 nm) and red fluorescence (> 650 nm). Green fluorescence comes from the globules, red fluorescence from chlorophyll remains a, b bright field microscopy picture of non - stressed (a) and stressed (b) d. salina cells . C, d fluorescence microscopy pictures (clsm) of non - stressed (c) and stressed (d) d. salina cells . Scale bars=10 m . The clsm pictures are combination images of three channels: dic microscopy, green fluorescence (505530 nm) and red fluorescence (> 650 nm). Green fluorescence comes from the globules, red fluorescence from chlorophyll remains to prove that this green fluorescence was emitted by the carotenoid - containing globules, we isolated the globules (fig . Light microscopy showed clear orange globules, and with the clsm, the green fluorescence again was detected . This fluorescence was emitted by the globules and not by the solution as can be seen in fig . The absorbance and emitted fluorescence from the globule suspension were measured with a spectrophotometer and spectrofluorimeter, respectively, and are shown in figs . 2 and 3 . 3emission spectra of carotenoid - containing globules for three different excitation wavelengths (450, 488 and 510 nm) absorbance spectrum of carotenoid - containing globules . The peak at 670 nm was absorbance from chlorophyll emission spectra of carotenoid - containing globules for three different excitation wavelengths (450, 488 and 510 nm) in the absorbance curve, the carotenoid peak is clearly visible (350550 nm). Next to this peak, a very small peak at 670 nm was visible, originating from some chlorophyll contamination still left in the solution . In the fluorescence emission graph (fig . 3), this chlorophyll contamination showed a very high emission peak at 670 nm . At 560 nm, a second, much smaller peak was visible, which must have originated from another component of the suspension, most likely the carotenoid - containing globules . With different excitation wavelengths, this emission peak did not shift its position with respect to the wavelength . To determine whether the fluorescence peak at 560 nm was emitted by the -carotene in the carotenoid - rich globules, we compared the relative values for the quantum yields of the chlorophyll peak and the 560-nm peak to see whether these compare to values found in literature for chlorophyll and carotenoid fluorescence . Dunaliella salina stores secondary carotenoids (predominantly -carotene) in lipid globules in the chloroplast when cultivated under stress conditions . Non - stressed cells are dominated by the chloroplast, emitting red fluorescence originating from the chlorophyll in the thylakoid membranes . When the cells are stressed, the red fluorescence from chlorophyll partly disappears as the thylakoid membranes are broken down . At the same time, the cells start to produce carotenoid globules and green fluorescence appears simultaneously . Dunaliella salina cells show this distinct difference in red and green fluorescence pattern between non - stressed and stressed cells . We determined the relation between the carotenoid - containing globules and the green fluorescence and studied the possibility to visualise and localise these lipid globules inside the cells in vivo using this autofluorescence . (1982), are composed almost entirely of lipids . Over 90% of the lipids are neutral lipids, with -carotene as the dominant fraction (65% of dry weight). The carotenoid peak in the absorbance curve (350550 nm) showed great similarity to the absorption spectrum of an 80% acetone extract of the purified -carotene globules from d. bardawil, found by ben - amotz et al . (1982), and resembles the absorbance peak of pure -carotene in solution (kandori et al . The peak originated mainly from -carotene, but other carotenoids might have contributed as well, just as some chlorophyll contamination . This originated probably from some chloroplast membrane remainders that were connected to the lipid globules . Chlorophyll has absorbance peaks between 400500 and> 600 nm (lichtenthaler 1987). The small peak visible at 670 nm in the absorbance graph therefore must originate from chlorophyll still left in the solution . The fact that with different excitation wavelengths the emission peak did not shift its position with respect to the wavelength proves that the peak is indeed fluorescence and cannot be ascribed as a raman peak (shanker and bane 2008). The high relative intensity of the emitted fluorescence from the relatively small chlorophyll contamination coheres with its high quantum yield . The ratio between the absorbance peaks and the emission peaks can be used to determine the ratios in quantum yields (shanker and bane 2008). The quantum yields for chlorophyll vary from 0.02 to 0.33 depending on whether measured in various solutions or in the cell (forster and livingston 1952; latimer et al . (1994), the quantum yield for -carotene is 1.7 10 . This results in a ratio between the quantum yields of -carotene and chlorophyll varying from approximately 100 to 2000 . The ratio in fluorescence between both peaks lies between 0.07 and 0.11 when we divide the maximum height of both peaks (e.g. 3.0 10: 2.7 10 for 488-nm excitation wavelength). The ratio between the absorbance peaks is around 14 when we divide the maximum height of both peaks (0.64:0.05). Consequently, the ratio between the relative values for the quantum yields for both peaks in this research is somewhere between 100 and 200 . Comparing these to literature shows that the emission peak at 560 nm most likely originates from the -carotene in the lipid globules . In conclusion, d. salina stores secondary carotenoids in lipid globules when cultivated under stress conditions . To visualise these carotenoid - containing globules, cslm can be used in combination with the autofluorescence of cell components . This autofluorescence of the cells is emitted by chlorophyll in the red part of the spectrum and by the carotenoid globules in the green part of the spectrum . When comparing the relative quantum yields obtained from the absorbance and fluorescence emission spectra with data from literature, we can conclude that the green fluorescence most likely is emitted by the -carotene that comprises the main part of the carotenoid - rich globules.
|
Pulmonary mucoepidermoid carcinoma (pmec) is a rare cancer that comprises only 0.1 to 0.2% of all primary lung malignancies (1,2,3,4). Pmec is classified as a salivary gland type lung carcinoma, which originates from the submucosal glands of the trachea and bronchus (5,6). Histologic grade, cancer stage and lymph node metastasis are reported independent factors for long - term prognosis in patients with pmec (5). It is now generally accepted that low - grade pmec behaves like a benign or low - grade malignant tumor, while high - grade pmec shows virulent characteristics like any other non - small cell lung cancer and has occasional lymph node metastasis . Therefore, if tumor grade could be predicted before surgery, it might reduce unnecessary lymph node dissection and even preserve lung function with limited pulmonary resection in patients with low - grade pmec . On the other hand, in cases expected to have high - grade tumor, extended pulmonary resection with more radical lymph node dissection or neoadjuvant treatments could be performed . However, there is no diagnostic tool to predict tumor grade prior to surgery for pmec . This study evaluated whether the maximum standardized uptake value (suvmax) of fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography (f - fdg pet / ct) is a significant predictor for pathologic grade and postsurgical outcomes in patients following surgery for pmec . This retrospective study was approved by our hospital's institutional review board . From 2005 to 2013, 27 patients (0.5% of all primary lung cancer patients) underwent complete resection with curative intent for pmec . Four patients with pet / cts taken at other hospitals or without studies prior to surgery were excluded from enrollment . Patients were instructed to fast for six hours prior to receiving 370 mbq (10 mci) of f - fdg by intravenous injection . Forty - five minutes after the injection, pet / ct scans (ge healthcare; milwaukee, wi, usa) were performed . From 2005 to 2008, a discovery ls scanner was used for pet / ct in eight patients . Ct was performed at 140 kev, 40 - 120 ma, tube rotation time of 0.5 seconds per rotation, pitch of 6, and section thickness of 5 mm . From 2008 to 2013, a discovery ste scanner was used for the other 15 patients, with ct performed at 140 kev, 30 - 170 ma, tube rotation time of 0.5 seconds per rotation, pitch of 6, and section thickness of 3.75 mm . Pet data sets were reconstructed iteratively with an ordered subsets expectation - maximization algorithm and a segmented attenuation correction (two iterations, 28 subsets), and also with the ct data . Commercial software (advantage workstation version 4.4; ge healthcare) was used to accurately co - register the separate ct and pet scan data . The suvmax of the primary tumor was measured by the software . In brief, a volume - of - interest encircling the whole primary tumor was manually drawn, taking into account the ct, pet and fused pet / ct images, which allowed the software to automatically show the suvmax of primary tumor . Tumors were located in the segmental bronchi or lobar bronchus in 17 patients, main bronchus in five patients and trachea in one patient . Complete resection of the tumor (r0) was histologically confirmed in all subjects, and every operation also included mediastinal lymph node dissection . There were nine lobectomies, seven sleeve lobectomies, one bilobectomy, one sleeve bilobectomy, three pneumonectomies, one bronchial wedge resection, and one tracheal resection and anastomosis . Eighteen patients underwent pulmonary resection via open thoracotomy, and five patients underwent video - assisted thoracoscopic surgery (vats). The patients visited the outpatient clinic and had ct or pet / ct scans every three months for two years after surgery and then every six months for three more years . Patient survival was reviewed, and the end date was defined as the latest follow - up date or the date of patient death . Disease - free survival was defined as the time between diagnosis and the first clinical or pathologic evidence of loco - regional or distant recurrent disease . Histopathologic tumor grade was defined according to the grading system of the armed forces institute of pathology (15,16). Tumors that met the criteria for grade 1 were classified as low - grade tumors in our study . Similarly, tumors that met the grade 2 and 3 criteria were classified as high - grade tumors . Overall, there were 16 patients with low - grade tumors and seven patients with high - grade tumors (one patient with grade 2, six patients with grade 3). Pathologic staging was classified according to the 7th american joint committee on cancer staging criteria . All data were statistically analyzed using stata statistical software 2007, version 10 (statacorp lp, college station, tx, usa). Suvmax of the main tumor in pet / ct images was correlated with tumor grade . The optimal cutoff value was calculated as 6.5 by receiver operating characteristic (roc) curve and area under curve was 0.92 . Patients with a suvmax of 6.5 or higher were assigned to the high suv group (n = 7) and the rest were assigned to the low suv group (n = 16). We compared tumor grade, pathologic stage, and long - term outcomes between the low suv group and the high suv group . Tests were performed for categorical variables, and unpaired t tests were performed for continuous variables . Overall survival was analyzed with kaplan - meier curves and the log - rank test . This retrospective study was approved by our hospital's institutional review board . From 2005 to 2013, 27 patients (0.5% of all primary lung cancer patients) underwent complete resection with curative intent for pmec . Four patients with pet / cts taken at other hospitals or without studies prior to surgery were excluded from enrollment . Patients were instructed to fast for six hours prior to receiving 370 mbq (10 mci) of f - fdg by intravenous injection . Forty - five minutes after the injection, pet / ct scans (ge healthcare; milwaukee, wi, usa) were performed . From 2005 to 2008, a discovery ls scanner was used for pet / ct in eight patients . Ct was performed at 140 kev, 40 - 120 ma, tube rotation time of 0.5 seconds per rotation, pitch of 6, and section thickness of 5 mm . From 2008 to 2013, a discovery ste scanner was used for the other 15 patients, with ct performed at 140 kev, 30 - 170 ma, tube rotation time of 0.5 seconds per rotation, pitch of 6, and section thickness of 3.75 mm . Pet data sets were reconstructed iteratively with an ordered subsets expectation - maximization algorithm and a segmented attenuation correction (two iterations, 28 subsets), and also with the ct data . Commercial software (advantage workstation version 4.4; ge healthcare) was used to accurately co - register the separate ct and pet scan data . The suvmax of the primary tumor was measured by the software . In brief, a volume - of - interest encircling the whole primary tumor was manually drawn, taking into account the ct, pet and fused pet / ct images, which allowed the software to automatically show the suvmax of primary tumor . Tumors were located in the segmental bronchi or lobar bronchus in 17 patients, main bronchus in five patients and trachea in one patient . Complete resection of the tumor (r0) was histologically confirmed in all subjects, and every operation also included mediastinal lymph node dissection . There were nine lobectomies, seven sleeve lobectomies, one bilobectomy, one sleeve bilobectomy, three pneumonectomies, one bronchial wedge resection, and one tracheal resection and anastomosis . Eighteen patients underwent pulmonary resection via open thoracotomy, and five patients underwent video - assisted thoracoscopic surgery (vats). The patients visited the outpatient clinic and had ct or pet / ct scans every three months for two years after surgery and then every six months for three more years . Patient survival was reviewed, and the end date was defined as the latest follow - up date or the date of patient death . Disease - free survival was defined as the time between diagnosis and the first clinical or pathologic evidence of loco - regional or distant recurrent disease . Histopathologic tumor grade was defined according to the grading system of the armed forces institute of pathology (15,16). Tumors that met the criteria for grade 1 were classified as low - grade tumors in our study . Similarly, tumors that met the grade 2 and 3 criteria were classified as high - grade tumors . Overall, there were 16 patients with low - grade tumors and seven patients with high - grade tumors (one patient with grade 2, six patients with grade 3). Pathologic staging was classified according to the 7th american joint committee on cancer staging criteria . All data were statistically analyzed using stata statistical software 2007, version 10 (statacorp lp, college station, tx, usa). Suvmax of the main tumor in pet / ct images was correlated with tumor grade . The optimal cutoff value was calculated as 6.5 by receiver operating characteristic (roc) curve and area under curve was 0.92 . Patients with a suvmax of 6.5 or higher were assigned to the high suv group (n = 7) and the rest were assigned to the low suv group (n = 16). We compared tumor grade, pathologic stage, and long - term outcomes between the low suv group and the high suv group . Tests were performed for categorical variables, and unpaired t tests were performed for continuous variables . Overall survival was analyzed with kaplan - meier curves and the log - rank test . The mean age was significantly higher in the high suv group than the low suv group (57.6 11.7 years vs. 39.6 17.2 years respectively, p = 0.010). Notably, all three patients under age 20 were included in the low suv group and had a low grade tumor . Most of the patients (87.0%) showed an eastern cooperative oncology group performance score of 0 or 1 and only three patients had a performance score of 2 (two patients from high suv group and one patient from low suv group). The mean suvmax was 15.4 11.5 in the high suv group and 3.9 1.3 in the low suv group . 0.001) and larger tumor sizes (43.6 9.0 mm vs. 21.4 3.0 mm, p = 0.003). Typical enhanced ct and pet / ct images of low suv group are presented in figure 2 and images of high suv group in figure 3 . The high suv group also had more frequent t3/4 stage (72.4% vs. 6.3%, p = 0.006), more frequent lymph node metastases (57.1% vs. 0%, p = 0.001), and consequently, higher cancer stages (stage i / ii vs. iii, p = 0.001) than the low suv group . Enhanced ct and pet / ct images of the patient with regional lymph node metastasis are presented in figure 4 . The low suv group had low grade tumors, except for one patient, and no lymph node metastasis . The sensitivity and specificity of pet / ct for predicting tumor grade were 85.7% and 93.8%, respectively . Accuracy was 91.3% and the positive and negative predictive value was 85.7% and 93.8%, respectively . Length of follow - up was similar between the two groups (mean 48.6 38.7 months; p = 0.660). In the high suv group, four patients (57.1%) suffered cancer recurrence during follow - up, and one died of cancer 5 months after surgery . Another patient from high suv group showed no evidence of cancer recurrence, but died of brain infarct during the follow - up . In contrast, none of the patients in the low suv group experienced recurrence or mortality . As a result, the 5-year overall survival rate was significantly higher in the low suv group than the high suv group (100% vs. 71.4% respectively, p = 0.031). Three - year disease - free survival was also significantly higher in the low suv group (100% vs. 17.9% respectively, p <0.001). High grade tumor (p <0.001), pathologic stage iii (p multivariate analysis for long - term survival was unavailable, because there was no mortality or recurrence in patients with the low suv group . Kaplan - meier curves of overall and disease - free survival rates according to suv group are diagrammed in figure 5 . Since fdg - pet uptake in pmec was first reported in a 5-year - old girl (17), several studies have addressed the subject . Case of low - grade pmec without nodal metastasis and reported a suvmax of 3.63 (18) and 6.2 (19). A case report involving high - grade pmec with the suvmax data from these studies precisely matches our results, further suggesting that a suvmax higher than 6.5 indicates a possible high - grade tumor . Suvmax in salivary gland type carcinoma (including seven cases of pmec) reportedly tends to be greater in high - grade tumors (21). Additionally, a recent study concerning surgical outcomes in 14 patients with pmec, the median suvmax increased significantly along with tumor grade (p = 0.041) (14). Presently, pet revealed significant differences (p <0.001) in tumor grade according to suv group . High fdg uptake has been associated with more frequent nodal or distant metastases, but failed to predict long - term survival (22). However in this study, pet / ct data was available in 11 patients (36.7%) and other subtypes of salivary gland type lung cancer were included . Presently, nodal metastasis was significantly associated with the high suv group (p = 0.001). Furthermore, overall and disease - free survivals were significantly better in the low suv group . To our knowledge, this is the first study to report the prognostic value of fdg - pet / ct for long - term outcomes in pmec patients . The low suv group had good long - term prognosis without recurrence after complete resection of tumor . In contrast, despite complete resection, the high suv group suffered from local or distant recurrence . In the high suv group, these results are similar to the prior conclusion that adjuvant chemotherapy does not seem to be effective in high grade pmec (23). The most common site of pmec in the tracheobronchial tree is the segmental bronchi, which are located within the lung parenchyma . In the present study, nine patients (56.3%) in the low suv group underwent simple lobectomies, and five of these simple lobectomies were performed by vats . Even in patients who required sleeve resection of the bronchus, vats could be attempted . Use of vats sleeve lobectomy in low - grade pmec in the left main bronchus has been described (24). Therefore, in selected patients with low pet / ct uptake, vats represents a feasible and effective surgical option . Considering the rarity of pmec, multi - center studies with large number of cases are needed to reconfirm and support the results of this study . Another limitation is that the change in pet / ct device once during follow - up might have caused alteration of suvmax, although the differences were likely minimal . In conclusion, f - fdg pet / ct appears to be a useful preoperative imaging modality for predicting tumor grade, nodal stage and postsurgical prognosis . Patients with a suvmax greater than 6.5 were more likely to have a high - grade tumor, lymph node metastasis and cancer recurrence . Therefore, pmec patients with high uptake on pet / ct imaging might require aggressive mediastinal lymph node dissection and adjuvant therapies . Further studies with more cases of pmec are necessary to verify the validity of pet / ct for prediction of long - term prognosis.
|
Non - small cell lung carcinoma (nsclc) constitutes approximately 80% of lung cancer, with a 5-year survival of only 15% . Further study on the pathogenetic mechanism of lung cancer is needed to establish novel diagnostic or treatment strategies for this lethal disease . Ca is a ubiquitous cellular signal mediating various cellular activities such as proliferation, differentiation, and gene transcription . Store - operated ca channels (soccs) and receptor - operated ca channels (roccs) are two important pathways regulating the basal intracellular ca concentration . Both channels are thought to be formed of transient receptor potential channel (trpcs) family protein members (trpc17) and/or ca - release - actived ca channel (crac / orai) family members (orai13), and are activated by stromal interacting molecules (stim1 and stim2) (lu et al ., 2008). Recently, emerging evidence has uncovered that abnormal expression of trpcs were related to the development of various kinds of tumors, such as renal cell carcinoma, hepatoma, prostatic carcinoma, neuroblastoma imr-32 cells, and breast cancer (nasman et al ., 2006, thebault et al ., 2006, veliceasa et al ., 2007,, 2008, guilbert et al ., 2008, aydar et al ., 2009, saito et al ., 2011). Recently, a study identified that trpc expression correlates to lung cancer differentiation (jiang et al ., especially, another study showed that higher levels of trpc3 expression in tumor cells are an independent predictor of a better prognosis in patients with adenocarcinoma of the lung (ouadid - ahidouch et al . Our previous study has also demonstrated that trpcs played a role in the progresses of nsclc (zhang et al ., 2010). Since trpcs play an important role in the cell function including enzyme activity, emiocytosis, and cell proliferation and apoptosis (liao et al ., 2007, peel et al ., 2008, we hypothesized that the polymorphisms in soccs and roccs component and regulatory genes might contribute to genetic susceptibility to lung cancer . To test this hypothesis, we conducted a two - stage case - control study with a total of 2433 lung cancer cases and 2433 cancer - free controls to evaluate the effects of gene polymorphisms in the 9 selected genes related to soccs and roccs (trpc1, trpc3, trpc4, trpc6, trpc7, orai1, orai2, stim1, and stim2). To our knowledge, this is the first study to explore the associations between a comprehensive panel of polymorphisms in genes related to soccs and roccs and lung cancer risk, and to identify subgroups that would be more likely to have higher lung cancer risk . The study design and subject recruitment have been described previously (zhang et al ., 2013). The first - stage discovery study included 1422 lung cancer cases and 1422 controls, which were genetically unrelated ethnic han chinese and were from the first affiliated hospital of guangzhou medical university (guangzhou, guangdong, china) as described in a previous study (zhang et al ., 2013). Study was conducted on participants (1011 cases and 1011 controls) derived from xianyang, central hospital (xiangyang, hubei, china) to verify the results from the first - stage analysis . All the total 2433 patients with histopathologically confirmed incident lung cancer were consecutively recruited from september 2009 to september 2013 . The 2433 cancer - free controls, frequency matched to patients by sex and age (5 years) were randomly selected from the health examination center of the same hospital during the same time period when patients were recruited . Generally, all subjects met the following criteria: (1) both cases and controls were genetically unrelated han chinese; (2) all the lung cancer patients in the study were newly diagnosed and histopathologically confirmed; (3) all the control subjects were no self - reported cancer history and frequency matched to the cases by sex and age (5 years). The characteristics of the cases and controls selected for this two - stage study with a total of 2433 cases and 2433 controls are summarized in table 1 . Information on demographic data and environmental exposure history such as tobacco smoking were also obtained by the professional interviewers . Individuals who had smoked <100 cigarettes in the past lifetime were identified as never smokers; otherwise, they were defined as smokers (those smokers who stopped smoking for> 1 year were identified as former smokers). Pack - years were calculated by multiplying the number of packs of cigarettes smoked per day by the number of years the person has smoked . This study was approved by each participating center's institutional ethical committee and was conducted according to the principles of the declaration of helsinki . Written informed consent was obtained from all subjects . After informed written consent was obtained, a ~ 5 ml venous blood sample with egta - na2 as anticoagulant was collected for each participant . The genomic dna was extracted with qiagen blood dna kit (qiagen, valencia, ca). Nine genes related to soccs and roccs were selected: trpc 1, trpc3, trpc4, trpc6, trpc7, orai1, orai2, stim1, and stim2 . For each of them, we selected the tagsnps by haploview 4.2 software within 10 kb upstream of the transcriptional start site or 10 kb downstream of the transcriptional stop site . The genotypes of 236 selected tagsnps and their associations with lung cancer were described in table s1 (p <0.05) and fig . S1 snp frequency and ld data were based on the international hapmap project database, release 24, human genome build 36 . Genotypes were analyzed and exported using the illumina beadstudio software . To ensure quality control, genotyping was done without knowledge of case / control status of the subjects, and the polymorphism analysis was made by two persons independently .> 15% of the samples were randomly performed for confirmation, and the results were 100% concordant . The study design and subject recruitment have been described previously (zhang et al ., 2013). The first - stage discovery study included 1422 lung cancer cases and 1422 controls, which were genetically unrelated ethnic han chinese and were from the first affiliated hospital of guangzhou medical university (guangzhou, guangdong, china) as described in a previous study (zhang et al ., 2013). Study was conducted on participants (1011 cases and 1011 controls) derived from xianyang, central hospital (xiangyang, hubei, china) to verify the results from the first - stage analysis . All the total 2433 patients with histopathologically confirmed incident lung cancer were consecutively recruited from september 2009 to september 2013 . The 2433 cancer - free controls, frequency matched to patients by sex and age (5 years) were randomly selected from the health examination center of the same hospital during the same time period when patients were recruited . Generally, all subjects met the following criteria: (1) both cases and controls were genetically unrelated han chinese; (2) all the lung cancer patients in the study were newly diagnosed and histopathologically confirmed; (3) all the control subjects were no self - reported cancer history and frequency matched to the cases by sex and age (5 years). The characteristics of the cases and controls selected for this two - stage study with a total of 2433 cases and 2433 controls are summarized in table 1 . Information on demographic data and environmental exposure history such as tobacco smoking were also obtained by the professional interviewers . Individuals who had smoked <100 cigarettes in the past lifetime were identified as never smokers; otherwise, they were defined as smokers (those smokers who stopped smoking for> 1 year were identified as former smokers). Pack - years were calculated by multiplying the number of packs of cigarettes smoked per day by the number of years the person has smoked . This study was approved by each participating center's institutional ethical committee and was conducted according to the principles of the declaration of helsinki . Written informed consent was obtained from all subjects . After informed written consent was obtained, a ~ 5 ml venous blood sample with egta - na2 as anticoagulant was collected for each participant . The genomic dna was extracted with qiagen blood dna kit (qiagen, valencia, ca). Nine genes related to soccs and roccs were selected: trpc 1, trpc3, trpc4, trpc6, trpc7, orai1, orai2, stim1, and stim2 . For each of them, we selected the tagsnps by haploview 4.2 software within 10 kb upstream of the transcriptional start site or 10 kb downstream of the transcriptional stop site . The genotypes of 236 selected tagsnps and their associations with lung cancer were described in table s1 (p <0.05) and fig . S1 snp frequency and ld data were based on the international hapmap project database, release 24, human genome build 36 . Genotypes were analyzed and exported using the illumina beadstudio software . To ensure quality control, genotyping was done without knowledge of case / control status of the subjects, and the polymorphism analysis was made by two persons independently .> 15% of the samples were randomly performed for confirmation, and the results were 100% concordant . Test was used to evaluate differences in the distributions of demographic characteristics, selected variables, and genotypes of the variants between the cases and controls . Goodness of fit to the hardy - weinberg equilibrium (hwe) expectation in control was also evaluated by the -test for each snp . Akaike's information criteria (aic) (akaike, h., ieee trans . Automat ac-19, 716 - 723 (1974)) were applied to select the most parsimonious genetic model for each snp . Odds ratios (ors) and its corresponding 95% confidence intervals (cis) were measured by an unconditional logistic regression model with adjustment for age, sex, and pack - year of smoking . Stratification analyses were also done by variables of interest, such as age, sex, smoking status, pack year, and sex - smoking . The pairwise ld among the snps was calculated using lewontin's standardized coefficient d and ld coefficient r (lewontin, 1988) and haplotype blocks were defined by the method of gabriel et al . (gabriel et al ., 2002) in the publicly available haploview software with default settings (http://www.broad.mit.edu/personal/jcbarret/haplo/). In addition, phase 2.1 bayesian algorithm was used to validate the haplotype frequencies estimated by haplo.stats (stephens and donnelly, 2003) (http://mayoresearch.mayo.edu/mayo/research/schaid_lab/index.cfm). Statistic power (gauderman, 2002) was done by quanto 1.2 (http://hydra.usc.edu/gxe). P = 0.05 was the criterion of statistical significance and all statistical tests were two - sided . As shown in table 1, concordant results were observed in both discovery and replication populations with significant differences identified in the smoking status, pack years, and sex - smoking (p <0.001 for all) and no significant deviation in distributions of age and sex between case and control groups (p> 0.05 for all). The frequency distributions of smoking status were not homogeneous (breslow - day test p = 5.8 10), reflecting different lifestyle between the discovery and replication populations . We further combined the two populations into stratification analysis and cumulative effect analysis in order to increase the study power . In addition, these variables were further adjusted by age, sex and pack - year of smoking in the multivariate logistic regression model to control possible confounding on the main effects of the studied polymorphisms . We selected 236 tagsnps from nine genes related to soccs and roccs: trpc1, trpc3, trpc4, trpc6, trpc7, orai1, orai2, stim1, and stim2 . P <0.05 in any of the discovery, replication, and combined populations . Among these tagsnps, we found consistently significant associations of trpc4 rs9547991 and rs978156 and trpc7 rs11748198 with lung cancer risk among the above three kinds of groups (p <0.05 for all). All observed genotype distributions among these groups agreed with the hwe (p 0.05 for all). When combined discovery and replication populations, the significances were more significant than any of them in additive model . In table s2, the results of the first - stage study revealed that trpc4 rs9547991 and rs978156 variant genotypes significantly increased the lung cancer risk in additive model (adjusted or = 1.29, 95%ci = 1.031.62; adjusted or = 1.21, 95%ci = 1.051.40, respectively). Trpc7 rs11748198 significantly increased the lung cancer risk in additive model (rs11748198: adjusted or = 1.26, 95%ci = 1.041.53). In the second - stage study, the associations of trpc4 rs9547991 and rs978156, and trpc7 rs11748198 with lung cancer risk were validated with ors of 1.38 and 1.21, and 1.29, respectively . Of course, the associations remained significant after all subjects were combined (rs9547991: adjusted or = 1.33, 95%ci = 1.111.59; rs978156: adjusted or = 1.21, 95%ci = 1.081.35; rs11748198: adjusted or = 1.28, 95%ci = 1.101.47). Then, further detailed analysis was taken about the relationship between these three snps and the three groups by pooling all of the discovery and validation stage in additive models . We achieved significant associations for trpc4 rs9547991 and rs978156 (pcombined = 1.6 10, or = 1.33 at 5q31.1; pcombined = 6.6 10, or = 1.21 13q13.3, respectively), and trpc7 rs11748198 (pcombined = 1.3 10, or = 1.28 13q13.3) (table 2). Furthermore, we evaluated combined effects of the three snps variants (trpc4 rs9547991 a> g and rs978156 c> t, trpc7 rs11748198 g> t) on lung cancer risks . As shown in table 3, lung cancer risk was significantly increased with the increasing number of variant alleles of the three snps in a dose - dependent manner (p for trend = 7.2 10). Compared with those carrying 0 variant allele, subjects carrying 1 variant alleles had a 1.29-fold increased risk of lung cancer (95%ci = 1.151.46). For further study, the relationships between combined variant alleles and environmental characteristics in combined population were also taken . 16 variant alleles had a more significantly increased lung risks than 0 variant alleles in younger people (age 60, p = 1.9 10); in both sex (p = 1.5 10 for male; p = 5.0 10 for female); in current (p = 1.1 10) and never smokers (p = 12.0 10); in both 25 pack year and 0 pack year (p = 2.9 10 and p = 12.0 10, respectively); in both male smokers and female non - smoker (both p> 0.7 10) as well as in discovery population . We also found that there were significant multiplicative interactions between pack year, sex - smoking, source of population and allele genes with pmax 0.0328 (table 4). We further assessed the associations of snps rs9547991, rs978156 and rs11748198 variant genotypes with lung cancer risk stratified by selected variables . S2 and table s3, compared with the common wild - type homozygous genotype, the adverse effects of rs9547991 and rs978156 were more evident in male (rs9547991: adjusted or = 1.53 and 95% ci = 1.231.92; rs978156: adjusted or = 1.21 and 95% ci = 1.041.41); in former smokers (rs9547991: adjusted or = 2.77 and 95% ci = 1.335.57; rs978156: adjusted or = 1.63 and 95% ci = 1.072.49); in male smokers (rs9547991: adjusted or = 1.68 and 95% ci = 1.292.17; rs978156: adjusted or = 1.24 and 95% ci = 1.041.498) than the rest of all . Similar association strengths were observed among younger subjects (age 60) compared with that in older subjects (age> 60) between all subgroups for the three snps (rs9547991: adjusted or = 1.61 and 95% ci = 1.232.09; rs978156: adjusted or = 1.38 and 95% ci = 1.551.66; rs11748198: adjusted or = 1.38 and 95% ci = 1.111.73). Interestingly, stronger effects of rs11748198 were shown among female (adjusted or = 1.67, 95% ci = 1.252.24) and never smokers (adjusted or = 1.40, 95% ci = 1.111.76) than the rest of all . We also performed haplotype analysis in the combined population to assess the effect of the haplotype containing rs9547991 and rs978156 variant alleles on lung cancer risks (table s4). When compared with the most frequent ac haplotype, the haplotype carrying any of the variant allele all showed significant risk effects (adjusted or> 1), which were consistent with that in the analysis of single snp . Then the combined genotypes risk was also evaluated . We found that there was a significantly increased risk of lung cancer as the risk genotype number increased compared with those with 0 variants, implying that these variants might have a joint effect on the risk of lung cancer (p for trend = 9.6 10). Ld information of these two snps (trpc4 rs9547991 and rs978156), calculated from genotyping data of 2433 controls of the combined study, was d = 0.91 and r = 0.04 . As shown in table 1, concordant results were observed in both discovery and replication populations with significant differences identified in the smoking status, pack years, and sex - smoking (p <0.001 for all) and no significant deviation in distributions of age and sex between case and control groups (p> 0.05 for all). The frequency distributions of smoking status were not homogeneous (breslow - day test p = 5.8 10), reflecting different lifestyle between the discovery and replication populations . We further combined the two populations into stratification analysis and cumulative effect analysis in order to increase the study power . In addition, these variables were further adjusted by age, sex and pack - year of smoking in the multivariate logistic regression model to control possible confounding on the main effects of the studied polymorphisms . We selected 236 tagsnps from nine genes related to soccs and roccs: trpc1, trpc3, trpc4, trpc6, trpc7, orai1, orai2, stim1, and stim2 . P <0.05 in any of the discovery, replication, and combined populations . Among these tagsnps, we found consistently significant associations of trpc4 rs9547991 and rs978156 and trpc7 rs11748198 with lung cancer risk among the above three kinds of groups (p <0.05 for all). All observed genotype distributions among these groups agreed with the hwe (p 0.05 for all). When combined discovery and replication populations, the significances were more significant than any of them in additive model . In table s2, the results of the first - stage study revealed that trpc4 rs9547991 and rs978156 variant genotypes significantly increased the lung cancer risk in additive model (adjusted or = 1.29, 95%ci = 1.031.62; adjusted or = 1.21, 95%ci = 1.051.40, respectively). Trpc7 rs11748198 significantly increased the lung cancer risk in additive model (rs11748198: adjusted or = 1.26, 95%ci = 1.041.53). In the second - stage study, the associations of trpc4 rs9547991 and rs978156, and trpc7 rs11748198 with lung cancer risk were validated with ors of 1.38 and 1.21, and 1.29, respectively . Of course, the associations remained significant after all subjects were combined (rs9547991: adjusted or = 1.33, 95%ci = 1.111.59; rs978156: adjusted or = 1.21, 95%ci = 1.081.35; rs11748198: adjusted or = 1.28, 95%ci = 1.101.47). Then, further detailed analysis was taken about the relationship between these three snps and the three groups by pooling all of the discovery and validation stage in additive models . We achieved significant associations for trpc4 rs9547991 and rs978156 (pcombined = 1.6 10, or = 1.33 at 5q31.1; pcombined = 6.6 10, or = 1.21 13q13.3, respectively), and trpc7 rs11748198 (pcombined = 1.3 10, or = 1.28 13q13.3) (table 2). The genotype distributions of the three significant snps were also in table 2 . Furthermore, we evaluated combined effects of the three snps variants (trpc4 rs9547991 a> g and rs978156 c> t, trpc7 rs11748198 g> t) on lung cancer risks . As shown in table 3, lung cancer risk was significantly increased with the increasing number of variant alleles of the three snps in a dose - dependent manner (p for trend = 7.2 10). Compared with those carrying 0 variant allele, subjects carrying 1 variant alleles had a 1.29-fold increased risk of lung cancer (95%ci = 1.151.46). For further study, the relationships between combined variant alleles and environmental characteristics in combined population were also taken . 16 variant alleles had a more significantly increased lung risks than 0 variant alleles in younger people (age 60, p = 1.9 10); in both sex (p = 1.5 10 for male; p = 5.0 10 for female); in current (p = 1.1 10) and never smokers (p = 12.0 10); in both 25 pack year and 0 pack year (p = 2.9 10 and p = 12.0 10, respectively); in both male smokers and female non - smoker (both p> 0.7 10) as well as in discovery population . We also found that there were significant multiplicative interactions between pack year, sex - smoking, source of population and allele genes with pmax 0.0328 (table 4). We further assessed the associations of snps rs9547991, rs978156 and rs11748198 variant genotypes with lung cancer risk stratified by selected variables . S2 and table s3, compared with the common wild - type homozygous genotype, the adverse effects of rs9547991 and rs978156 were more evident in male (rs9547991: adjusted or = 1.53 and 95% ci = 1.231.92; rs978156: adjusted or = 1.21 and 95% ci = 1.041.41); in former smokers (rs9547991: adjusted or = 2.77 and 95% ci = 1.335.57; rs978156: adjusted or = 1.63 and 95% ci = 1.072.49); in male smokers (rs9547991: adjusted or = 1.68 and 95% ci = 1.292.17; rs978156: adjusted or = 1.24 and 95% ci = 1.041.498) than the rest of all . Similar association strengths were observed among younger subjects (age 60) compared with that in older subjects (age> 60) between all subgroups for the three snps (rs9547991: adjusted or = 1.61 and 95% ci = 1.232.09; rs978156: adjusted or = 1.38 and 95% ci = 1.551.66; rs11748198: adjusted or = 1.38 and 95% ci = 1.111.73). Interestingly, stronger effects of rs11748198 were shown among female (adjusted or = 1.67, 95% ci = 1.252.24) and never smokers (adjusted or = 1.40, 95% ci = 1.111.76) than the rest of all . We also performed haplotype analysis in the combined population to assess the effect of the haplotype containing rs9547991 and rs978156 variant alleles on lung cancer risks (table s4). When compared with the most frequent ac haplotype, the haplotype carrying any of the variant allele all showed significant risk effects (adjusted or> 1), which were consistent with that in the analysis of single snp . Then the combined genotypes risk was also evaluated . We found that there was a significantly increased risk of lung cancer as the risk genotype number increased compared with those with 0 variants, implying that these variants might have a joint effect on the risk of lung cancer (p for trend = 9.6 10). Ld information of these two snps (trpc4 rs9547991 and rs978156), calculated from genotyping data of 2433 controls of the combined study, was d = 0.91 and r = 0.04 . Lung cancer remains to be a challenging disease due to a 5-year survival of only 15% and the accompanied high medical costs . Using genetic markers for determining risk may help to identify high risk population for early screening, diagnosis, and therapy, which may also improve clinical outcome . This is the first study to explore the associations between a comprehensive panel of polymorphisms of trpcs genes and lung cancer risks and to explore subgroups that would more likely have higher cancer risks . We evaluated 236 tagsnps in the 9 selected genes from the socc and the rocc pathways for their associations with lung cancer risks . In this two - stage case - control study with a total of 2433 lung cancer cases and 2433 controls, we found that rs9547991 and rs978156 in trpc4 and rs11748198 in trpc7 were potentially susceptibility markers of lung cancer in chinese population . Especially, our study provides the epidemiological evidence supporting a connection between comprehensive trpcs snps and lung cancer risks . The mammalian trpcs channels are encoded by at least 28 genes (bodding, 2007). Most of these proteins have a putative topology of six transmembrane domains with a pore loop between the fifth and sixth segments . Evidences of genetic linkage to diseases and studies from numerous independent laboratories have strongly suggested that trpcs channels have substantial importance in mammalian biology and might be valuable therapeutic drug targets . Members of trpcs have been found to be implicated in abnormal proliferation, differentiation, and cancer formation (bodding, 2007). For example, trpc6 mutations cause familial focal segmental glomerulosclerosis (winn et al ., 2005), and another study has been linked a snp in trpc6 to idiopathic pulmonary hypertension (yu et al ., 2009). Gain - of - function mutation in trpc4 protects against myocardial infarction (mi) in diabetes (jung et al ., 2011). In the present study, two of the three significant snps were in trpc4, which is known to have important functions contributing to lung cancer risk . Trpc4 is widely expressed in the vasculature (yip et al ., 2004), where it participates in the generation of intracellular ca signals that regulate functions such as endothelial permeability (tiruppathi et al ., 2002) and, the best - characterized physiological role for trpc4 is in the regulation of endothelial cell function . Trpc4 has been demonstrated that is a required component of socc channels in vascular endothelial cells and that trpc4 is part of the ca entry signal transduction channel regulating vascular tone (abramowitz and birnbaumer, 2009). Similarly, vascular endothelial cells derived from trpc4 knock - out (trpc4 /) mice showed impaired store - operated ca entry channels (soce) (freichel et al ., 2001). Therefore, studies showed that trpc4-dependent ca entry is a key determinant of increased permeability in the mouse pulmonary vasculature (tiruppathi et al ., 2002). In a study of the properties of lung endothelial cells derived from the same trpc4 mice, tiruppathi et al . (tiruppathi et al ., 2002) expanded the observations of freichel et al . (freichel et al ., 2001), and identified that absence of trpc4 was associated with a loss of endothelial cell responses to thrombin, suggesting a critical involvement of trpc4 in microvascular permeability . Trpc4 antisense oligonucleotides were shown to partially inhibit soce in mouse mesangial cells, implying that trpc4 might also form part of endogenous soccs in that kind cells (wang et al . Furthermore, trpc4 appears to be involved in mediating some aspects of hypoxia - induced gene expression and cell proliferation . Culture of human pulmonary artery endothelial cells under hypoxic conditions results in increased trpc4 expression of mrna and protein, enhanced soce (fantozzi et al ., 2003). In addition, haplotype analysis was also evaluated to further explore effects of haplotypes and combined genotypes of trpc4 on lung cancer risks, because haplotype - based analysis might be more informative than single snp analysis and resequencing dna samples carrying the high - risk haplotypes might be able to improve risk assessment . Especially, the two most significant trpc4 snps we identified are all located in the intron region, which may contribute to alterations in gene expression or splicing . Alternatively, it is also possible that these snps are linked to other causal variants in trpc4 . In our previous study (zhang et al ., 2010), although studies have demonstrated that it is expressed in the heart, lung, and eye in mice (okada et al ., 1999). The main reason was that the relatively small sample size we chose might be difficult to detect the probably low expression of trpc7 . In the present study, one of the three most significant snps was in trpc7 . Unlike trpc4, trpc7 have been detected less frequently and also have not been studied extensively . Trpc7, the final member of trpc family, demonstrates properties very similar to trpc3 and trpc6 with regard to its voltage - current relationship (trpc7 is most closely related to trpc3 with 81% identity, and demonstrates 75% identity with trpc6 in mice), and activated by diacylglycerol (dag) (beck et al ., 2006). The differences between the three channel types may lie in their ion selectivity, in which trpc6 is reported to be somewhat ca - selective, while trpc3 and trpc7 do not appear to be . Trpc7 has demonstrable sensitivity to skf96365 (a novel inhibitor of receptor - mediated ca entry), and is relatively insensitive to lanthanides . Up to now, the component(s) required for coupling of the trpc7 to store depletion is unknown . It is unlikely that trpc7 alone is responsible for specific biological function among trpcs, since trpc7 is co - expressed with other trpcs in most of the tissues . It is possible that trpc7 interacts with inositol triphosphate (ip3) receptors to suppress their activity . Alternatively, trpc7 may be also localized in the endoplasmic reticulum (er) membrane and contribute to passive ca release from stores . It has been suggested that trpc7 plays key roles in the ca signaling pathway because of its unique activation properties such as constitutive activity (okada et al ., 1999). A study revealed that trpc7 mediated angiotensin ii - induced myocardial apoptosis (satoh et al ., 2007). However, another report showed that trpc3 and trpc6, but not trpc7, were essential for angiotensin ii - induced cardiac hypertrophy . But trpc7 can display some functions via association with other proteins, such as trpc6, which positively regulates calcineurin - nfat (nuclear factor of activated t cells) signaling, and was related with cardiac hypertrophy (nishida et al ., 2010). Trpc7 may also form heteromeric channels with trpc6, and be involved in cardiac failure . In this study, it is possible that the variant allele of trpc7 rs11748198 may affect gene transcription thus altering protein level . Alternatively overall, our study suggested the association of trpc4 and trpc7 polymorphisms with lung cancer risks . We applied a gene sets - based approach to comprehensively evaluate the effect of the three significant snps on the risk of lung cancer . When combined the effects of the three significant snps, subjects carrying 1 variant alleles had a higher increased risk of lung cancer compared with those carrying 0 variant allele . Lung cancer risks significantly increased with the increasing number of variant alleles of the three snps in a dose - dependent manner . Those with 2 risk genotypes had the highest risk of lung cancer, suggesting combined variations were detrimental and had a larger effect than any single variant . This emphasizes the importance of including multiple snps within a shared pathway for examining joint effects in the risk assessment . Despite the strengths and biologic plausibility of the associations observed in the present study, inherited biases in our study may have led to spurious findings . Firstly, further fine mapping and functional assays are necessary to reveal potential molecular mechanisms . However, subjects in the two - stage study covered the population of southeastern and northern chinese, which made the population representativeness more stable and reasonable . In addition, it would be interesting to exam these snps in minority populations . Finally, although our data are largely internally validated, future replication studies in independent populations are needed to validate some of the results . Our study provided evidence indicating that rs9547991 and rs978156 in trpc4 and rs11748198 in trpc7 were potentially susceptibility markers of lung cancer in chinese population . S2 supplementary tables . Locations and ld structure of the 236 selected tagsnps in trpcs pathway . This work was supported by guangdong natural science foundation team grant (1035101200300000), the national natural science foundation of china (81170052, 81071917, 81173112, 81520108001, and 81220108001), the guangdong province universities and colleges pearl river scholar funded scheme to w. lu (2014) and the key project of department of education of guangdong province (cxzd1142), a guangdong department of education research grant (cxzd1025), guangzhou department of education yangcheng scholarships (12a001s), guangzhou department of education team grant for innovation (13c08), guangdong natural science foundation (1614050002587) and guangzhou municipal university research projects (1201430298). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
|
Over the past decade the role of accelerated partial breast irradiation (apbi) for patients with early stage breast cancer has emerged as an alternative to the conventional whole breast irradiation with external beam [17]. Apbi with high dose rate (hdr) interstitial implants significantly reduces the overall treatment time and leads to lower radiotherapy - associated side effects because of the smaller treated volumes [2, 6, 811]. However, in this method, the precise target definition and implant quality are crucial for accurate and conformal delivery of the prescribe dose to the ptv with simultaneous sparing of normal tissue and organs at risk (lung at the treated side and skin) [2, 3, 6, 10]. A pre - planning procedure which involves different imaging modalities facilitates the localization of the target and provides guidance for implant parameters (template size, number of planes and catheters). Orthogonal films (2d imaging) and ct simulation (3d imaging) are the guidance techniques which can be used to assure the appropriate catheter position with respect to the marked lesion . In our institute, 2d pre - planning was employed for the group of the earliest patients treated with hdr multicatheter implants . Since the cone beam ct (cbct) simulator was installed in the operating theatre in the brachytherapy department both pre - planning and treatment planning procedures have been 3d based . In this study two different pre - planning methods (2d vs. 3d) were compared with respect to the implant quality as judged by volumetric and dose parameters of the treatment plans . The aim of this work was to evaluate the influence of the imaging modalities used for pre - planning purposes on the treatment plan quality . Twenty - four patients treated with hdr multicatheter implants were randomly selected for the experiment . Flexible catheters were implanted into the breast through the template, in a triangular pattern . Inter - catheter distance, number of planes and catheters were adjusted, with respect to the size and location of the target defined as a marked lesion with 0.5 - 2 cm margins . In the analyzed treatment plans two or three - plane implants were used for all patients with 1.0 - 1.4 cm separation between the catheters . Pre - planning was used to evaluate the implant geometry with respect to the target . A different pre - planning procedure was employed in each group . In the first group the 2d x - ray imaging system ibu - d (integrated brachytherapy unit by nucletron b.v .) Fluoroscopic films were taken before insertion of needles to evaluate the location of the surgical clips and after the implantation procedure to assess the geometric quality of the implant . In the second group the 3d pre - planning method was performed with the simulix evolution simulator (nucletron b.v . ). Before implantation of needles, cone beam ct acquisition was performed to evaluate the location of the surgical clips . After inserting the needles, the second acquisition was performed to evaluate the position of the needles in relation to the marked lesion . Finally, for treatment planning purposes, ct was performed for each patient with a 3 mm slice thickness . Treatment plans were created in the planning system oncentra masterplan version 3.1 . The planning target volume (ptv) including the lumpectomy cavity with required margin was delineated on ct slices and the catheter positions were reconstructed . The distance and active source positions were individually defined for each catheter taking into account the localization of the ptv . The delivered dose was 32 gy in eight fractions (4 gy per fraction). Treatment plans was evaluated with parameters calculated based on dose - volume histograms (dvhs). Volumetric and dose parameters were used for comparison of the dose distribution between the two experimental subgroups . In order to quantify the dose distribution the following parameters and indices were evaluated: ptv volume (vptv), the dose that covers 90% of the ptv (d90), relative value of the ptv volume receiving 100 and 150% of the prescribed dose (vptv100, vptv150), absolute volume of implant receiving 100 and 150% of the prescribed dose (vi100, vi150) and the dose homogeneity index (dhi = 1 vi150/vi100). Pre - planning was used to evaluate the implant geometry with respect to the target . A different pre - planning procedure was employed in each group . In the first group the 2d x - ray imaging system ibu - d (integrated brachytherapy unit by nucletron b.v .) Fluoroscopic films were taken before insertion of needles to evaluate the location of the surgical clips and after the implantation procedure to assess the geometric quality of the implant . In the second group the 3d pre - planning method was performed with the simulix evolution simulator (nucletron b.v . ). Before implantation of needles, cone beam ct acquisition was performed to evaluate the location of the surgical clips . After inserting the needles, the second acquisition was performed to evaluate the position of the needles in relation to the marked lesion . Finally, for treatment planning purposes, ct was performed for each patient with a 3 mm slice thickness . Treatment plans were created in the planning system oncentra masterplan version 3.1 . The planning target volume (ptv) including the lumpectomy cavity with required margin was delineated on ct slices and the catheter positions were reconstructed . The distance and active source positions were individually defined for each catheter taking into account the localization of the ptv . The delivered dose was 32 gy in eight fractions (4 gy per fraction). Treatment plans was evaluated with parameters calculated based on dose - volume histograms (dvhs). Volumetric and dose parameters were used for comparison of the dose distribution between the two experimental subgroups . In order to quantify the dose distribution the following parameters and indices were evaluated: ptv volume (vptv), the dose that covers 90% of the ptv (d90), relative value of the ptv volume receiving 100 and 150% of the prescribed dose (vptv100, vptv150), absolute volume of implant receiving 100 and 150% of the prescribed dose (vi100, vi150) and the dose homogeneity index (dhi = 1 vi150/vi100). Some of the most important parameters for verification of treatment plans are: target coverage with 100% isodose, the dose that covers 90% of the ptv and dose homogeneity index . The mean value of target coverage vptv100 is higher for 3d pre - planning than for 2d (91.7% vs. 86.1%). The dose that covers 90% of the ptv (d90) is also higher for 3d pre - planning than for 2d (4.2 gy vs. 3.6 gy). A similar relation can be observed for the values of dose homogeneity index where dhi obtained for 3d pre - planning is 0.60 and 0.53 for 2d . Comparison of selected parameters for subgroups mann - whitney u test was used to compare the vptv100 and d90 between groups . Statistical analysis shows that the differences between 2d and 3d pre - planning groups for considered parameters are statistically significant (p = 0.006 for vptv100 and p = 0.013 for d90). The mean values of vptv100 and d90 with standard errors (se) and standard deviations (sd) are graphically shown as box diagrams in fig . 1 and fig . 2, respectively . Figure 3 presents box diagrams comparing mean values with standard errors (se) and standard deviations (sd) of dose homogeneity indices (dhis) for 2d and 3d pre - planning groups . Box diagrams comparing target 100% coverage between groups for which 2d and 3d pre - planning were used box diagrams comparing d90 between groups for which 2d and 3d pre - planning were used box diagrams comparing dose homogeneity index (dhi) between groups for which 2d and 3d pre - planning were used ct - guided implantation allowed the needles to be inserted precisely with respect to the target volume . Improvement in implant quality increases the dose distribution conformity and homogeneity without extensive use of the optimization algorithms . Insufficient implant quality may result in lower ptv coverage which needs to be improved with optimization . Modification of the dwell times may produce overdose areas inside the treated volume; it reduces the homogeneity of the dose distribution and influences the cosmesis . In brachytherapy planning it is highly recommended to deliver at least the prescribed dose to the target with acceptable homogeneity of the dose distribution . However, in some situations planning involves finding a balance between homogeneity and sufficient coverage . The results of this study show that replacing the 2d pre - planning method with the 3d one seems to be the right solution, resulting in higher values of target coverage and dose homogeneity index simultaneously . Their study showed a significant increase of all dosimetric parameters when the traditional implantation technique under fluoroscopic guidance was changed to a ct - guided method . In the cancer centre in gliwice, apbi with hdr multicatheter implants was introduced in may 2006 . To reach the dosimetric and volumetric goals we are still trying to improve our procedure . First we replaced 2d planning with ct - based treatment planning, then 3d pre - planning was introduced into apbi practice . The analysis presented in this paper shows that the 3d pre - planning method improves the geometric quality of the implant, which benefits the dosimetry.
|
The incidence of neuroendocrine tumors is increasing (approximately 6% per year), but clinical presentation is nonspecific, resulting in delays in diagnosis (5 - 7 years; approximately 70% have metastases). Neuroendocrine tumors usually exist at the lung, stomach and colon, but the small bowel is a rare location . We present an unusual case of small bowel neuroendocrine malignant tumor diagnosed by double - balloon enteroscopy (dbe). The capsule was stuck in the jejunum stricture and was removed with a snare under dbe . A 36-year - old man with weight loss presented with a 1-year history of distention, abdominal pain and macies . Capsule endoscopy found segmental distribution of ulceration, erosion and nodal hyperplasia in the proximate jejunum consistent with crohn's disease (fig . 1a). Neither the doctor nor the patient remembered finding the capsule in the stool . When the scope passed 20 cm from the treitz ligament we found jejunum erosion, nodal hyperplasia, stenosis (fig . The dbe was inserted again for biopsy, and some specimen were retrieved . The next day, barium examination revealed that the stenosis was near to the treitz ligament (fig . Capsule retention is defined as the presence of the capsule endoscopy in the digestive tract for a minimum of 2 weeks after ingestion or the capsule being retained in the bowel lumen indefinitely unless a targeted medical, endoscopic, or surgical intervention is initiated . Small bowel stenosis often leads to capsule retention . In this patient, we shared an examination process of a rare case of neuroendocrine malignant tumor in the small bowel . As the capsule endoscopy was stuck in the narrow parts, the lesion images from different angles were shot at different times, which led us to mistake for multiple lesions and to make a misdiagnosis of crohn's disease . If we had adopted the therapeutic regimen in accordance to the diagnosis of crohn's disease, maybe the patient would have lost the chance of operation . At the same time, we introduced the skills that the application of dbe could be used in the removal of capsule retention.
|
Recruitment of hematopoietic progenitor and stem cells (hpscs) to the blood followed by chemotherapy or cytokine treatment is a clinical process termed stem cell mobilization . This process mimics enhancement of the physiological release of stem cells and progenitors from the bone marrow (bm) reservoir in response to stress signals during injury and inflammation . Currently, stem cells mobilized to the peripheral blood after treatment are the preferable source of hpscs harvested for stem cell transplantation because of faster engraftment and reduced procedural risks compared with the direct harvest of the bm cells [2, 3]. Successful stem cell therapy, both autologous and allogeneic, requires the infusion of a sufficient number of hpscs capable of homing to the injured site to promote tissue repair . Granulocyte - colony stimulating factor (g - csf) is the most commonly used mobilizing agent to recruit hpsc from the bm; however, impaired response to g - csf is observed in 25% of patients and 10% to 20% of healthy donors [46]. This has led to studies to identify the mechanisms underlying cytokine - induced stem cell mobilization that could offer better strategies to enhance stem cell mobilization . Plasmin, a serine protease, degrades fibrin and is the primary enzyme for clot lysis, a process called fibrinolysis . Plg, the zymogen of plasmin, can be converted to plasmin at different locations by tissue plg activator (tpa) or urokinase plg activator (upa). While tpa is distributed in the ecm of most cell types, upa is mainly localized on the cell surface via its highly specific cell surface receptor, upar . The activities of upa and tpa are regulated by plg activator inhibitor-1 (pai-1). Several studies [10, 11] have reported a marked increase in plg binding to differentiated cells compared to undifferentiated cells, suggesting an important role for plg activation for cell differentiation that requires the release and migration of cells from microenvironments . Recent evidence reveals that the plg system is crucial for cytokine- or chemotherapy - induced stem cell mobilization . Here, we will discuss the role of the plg system in regulating stem cell mobilization . The egress of stem cells from the bm involves interfering with the physiological interaction between stromal cells and hematopoietic cells, which regulate both cell transmigration and the bm remodeling processes . The dynamic secretion and inactivation of the chemokines, stromal cell derived factor-1 (sdf-1), membrane - bound kit ligand (kitl), and interleukin-8 (il-8), which anchor hpscs in the bm microenvironment, are critical for establishing the chemoattractant gradient between the bm and the peripheral blood for stem cell mobilization . Degradation and functional inactivation of the bm extracellular matrix proteins (ecm) by proteases such as elastase, cathepsin g and mmp-9, are also indicated as major players in stem cell mobilization [1, 12]. Interaction of plg with its cell surface receptors and activation to plasmin, results in degradation of matrix proteins and activation of cytokines . Plg directly binds to the ecm and upon its conversion to plasmin, degrades multiple ecm proteins including fibrin, laminin, and fibronectin [1517]. Plasmin can also activate other proteases, such as mmp-3, mmp-9, mmp-12, and mmp-13 [18, 19] to degrade other matrix components such as collagens . Many studies indicate that the plg system facilitates hpsc mobilization through plasmin - mediated proteolytic mechanisms, by which plasmin inactivates chemotactic cytokines and degrades ecm in the bm compartment . Have shown that deletion of plg prevents hematopoietic stem cells from entering the cell cycle and undergoing multilineage differentiation after 5-fu treatment, causing lethality in mice . Activation of plg by administration of tpa promoted cleavage of kitl mediated by mmp-9 secreted from stromal cells, subsequently enhancing hpsc proliferation, differentiation, and mobilization . Consistently, tjwa et al . Reported that hematopoietic recovery upon delivery of 5-fu was impaired in plg, tpa and upa deficient mice . Moreover, depletion of fibrinogen in plg deficient (plg) mice did not restore hematopoietic recovery, indicating that plg - regulated stem cell mobilization is fibrinolysis - independent . Instead, plg deficiency inhibited breakdown of the bm matrix proteins fibronectin, vcam-1, and laminin, which are required for adhesion of hpscs to their bm microenvironment and also in transendothelial migration of hpscs . These studies indicate that plg and its activators are required for hematopoietic regeneration by regulating hpsc mobilization, proliferation, differentiation through mmp-9-mediated release of kitl, and plasmin - mediated degradation of ecm in the bm . [23, 24] have found that genetic loss of pai-1 or plasmin inhibitor 2-antiplasmin, which enhances plasmin generation, increased hpsc mobilization in response to g - csf, and thrombolytic agents such as tenecteplase and microplasmin, enhanced hpsc mobilization in mice and humans . Tenecteplase is a mutant of recombinant human tpa, which has a prolonged half - life and is used for treatment of acute cardiovascular and cerebrovascular syndromes . Microplasmin is a truncated form of plasmin that has an improved safety profile (less bleeding) and is easier to produce as a recombinant protein than is plasmin . Studies of plg mice [24, 25] validated that plg is required for g - csf - induced stem cell mobilization . Fewer hpscs in the peripheral blood were detected in plg mice compared with wild - type (wt) mice after treatment with g - csf . Similarly, wt mice treated with the plg inhibitor tranexamic acid also impaired hpsc mobilization into the circulation . Furthermore, cleavage of the upa receptor, (upar), by plasmin may account for plg - regulated stem cell mobilization . Studies suggested that cleavage of the receptor upar is an important factor in regulating stem cell function . First, upar was found to be expressed on a subpopulation of hpscs, and hpsc mobilization was impaired in upar - deficient mice (upar). Second, intact upar is required for adhesion of hpscs to the bm as well as homing and engraftment of hpscs . During stem cell mobilization, upar is cleaved and subsequently stem cells are released from the bm to the circulation . Cleavage of upar was detected only in wt mice but not in plg mice during stem cell mobilization, suggesting that plasmin regulates stem cell mobilization by inactivating upar via proteolytic cleavage . However, less inhibition in hpsc mobilization was observed in upar mice compared to plg mice, suggesting that there are other mechanisms for plg regulation of g - csf induced hpsc mobilization besides upar cleavage . While kitl is important in myelosuppression - induced hpsc mobilization, it does not seem to be involved in g - csf - induced hpsc mobilization since g - csf does not affect its levels [25, 26]. Another crucial pathway controlling stem cell mobilization is the sdf-1/cxcr4 signal . Under basal conditions, sdf-1/cxcr4 anchor hpsc in the bm and during stem cell mobilization, sdf-1 in the bm is downregulated and hpscs are released and mobilized into the circulation in response to the higher sdf-1 concentration in the peripheral blood [27, 28]. Our recent study has established the interplay between plg and sdf-1/cxcr4 signals . Our data have shown that plg is required for g - csf - induced hpsc egress to sinusoidal capillaries in the bm and subsequent mobilization to peripheral circulation . G - csf induced plg - dependent activation of mmp-9 in the bm, and mmp-9 neutralization or deficiency suppressed hpsc migration and mobilization . Reconstitution of mmp-9 activity by the bm transplantation after lentiviral overexpression rescued hpsc mobilization in plg mice, indicating that mmp-9 activation is required for plg - mediated hpsc mobilization . Interestingly, after g - csf simulation, plg downregulated sdf-1 in the bm and spatiotemporally regulated the expression of cxcr4 on mobilized hpsc . Reconstitution of mmp-9 activity in plg mice reversed cxcr4 expression on hpsc in plasma and the bm, suggesting that cxcr4 serves as a newly identified downstream signal of plg / mmp-9 in hpsc mobilization . Taken together, these data indicate that the plg system plays a crucial role in chemotherapy- or cytokine - induced stem cell mobilization . It functions through activating plasmin - mediated proteolytic activity to degrade the ecm in the bm (such as fibronectin or laminin) or by inactivating some key cytokines in the bm niches, such as kitl / c - kit (kitl receptor), upar, and sdf-1/cxcr4, thus eventually leading to the release of hpscs and the facilitation of their egress from the bm to the circulation (see proposed pathway in figure 1). In addition to proteolytic activity, other regulatory pathways are involved in the plg system - mediated hpsc mobilization . Upar was originally identified as a key factor for the activation of plg to plasmin and thereby the regulation of cell surface proteolysis in space and time . The structure of upar consists of three homologous domains of ~90 amino acids each (d1, d2, and d3 as numbered from the nh2 terminus) and is anchored to the cell membrane through a glycosyl - phosphatidylinositol tail, attached to the c terminal d3 domain . Interestingly, upar, independent of proteolytic activity, regulates migration and adhesion of cells through binding to integrins and g - protein - coupled receptors and initiates intercellular signaling cascades . Previous reports [3234] have shown that upar regulates cell adhesion and migration by activating its downstream intracellular signaling pathways in various cell types . Recently, a critical role of upar in stem cell mobilization has also been documented [24, 3639]. During g - csf - induced hpsc mobilization in humans, upar expression significantly increased on peripheral blood mononuclear cells (pbmncs), in particular on cd33 myeloid precursors and on cd14 monocytic cells released from the bm into the circulation . By contrast, cd34 cells and t and b lymphocytes were upar - negative, suggesting that upar may play a selective role in stem cell mobilization . In upar mice, a very recent study has demonstrated that upar is required to mobilize mesenchymal stem cells (msc) from the bm of mice stimulated with g - csf in vivo . Down- and up - regulation of upar inhibited and stimulated msc differentiation into vascular smooth muscle cells, respectively . Consistently, infusion of mscs isolated from upar mice impaired its engraftment to injured femoral artery . Additional evidence suggests several mechanisms by which upar plays a role in stem cell mobilization: chemotactic role of cleaved upar, regulation of integrins, and regulation of cxcr4 signaling . Proteolytic cleavage of membrane bound upar in the linker region between d1 and d2 and at the juxtamembrane domain from the cell surface by plasmin or other proteases releases truncated upar (supar) into the extracellular space, where it may be proteolytically cleaved into smaller fragments (c - supar) [4043]. Upar fragments generated from upar cleavage are essential for upar - regulated stem cell mobilization . Previous studies have shown that g - csf treatment induced an increase in upar as well as supar . C - supar were released in vitro by the pbmncs and were also detectable in the serum of g - csf - treated donors . Have confirmed that both upar and cleaved forms of upar are increased in hpsc donors following g - csf treatment . Moreover, c - supar and its derived peptide (upar8495) induce in vitro migration of bone marrow hpscs towards sdf-1 . Furthermore, the chemotactic human c - supar peptide has been shown to mobilize hpsc in mice . Similarly, administration of human upar8495 peptides induced mobilization of cd34 hpscs into the circulation to an extent similar to that observed in g - csf in mice . In agreement with these findings, utilizing mice with deleted upa, tpa, upar, and plg genes, tjwa, et al . Have found that upar is expressed on the bm cells that are in close contact with osteoblasts as well as a subset of hpscs . At steady state, upar mice are partially depleted of hpscs in the bm with a decrease of cell cycle quiescence and chemoprotection . In addition, upar mice are impaired in hpsc mobilization, homing, and short - term engraftment . The membrane - anchored upar retention signal on hpscs is inactivated by plasmin via proteolytic cleavage to a c - upar truncated product, which stimulates hpsc mobilization . These studies suggest that upar serves as a new anchor factor, similar to kitl / c - kit to maintain hpsc retention in the bm, while cleaved soluble upar is a new chemoattractant and mobilizer of stem cell egress from the bm to the circulation . Lacking transmembrane and intracellular domains, upar must cooperate with transmembrane receptors to activate intracellular signaling . Extensive studies suggest that integrins, a major family of ecm receptors are signaling coreceptors of upar [4549]. Besides upa it is reported that blocking upar - vitronectin binding impaired upar - regulated cell morphology, adhesion, and migration [45, 46]. Recent studies suggest that upar binding to vitronectin activates integrin signaling by simply increasing plasma membrane ecm contact, facilitating integrin ligand interactions . Namely, vitronectin may act as an adaptor for the interaction of upar and integrins . The major integrins that upar interacts with are 11 and 41 (very late antigen-4, vla-4) [51, 52]. The integrin 41 regulates the migration and adhesion of hpscs to fibronectin and vcam-1 during their homing and engraftment in the bm [5356]. The function of 41 also depends on the presence of intact upar, as only intact upar interacts with the integrin [43, 56]. Thus, when upar is depleted, such as in upar mice, or inactive, such as after preincubation of wt hpscs with anti - upar antibody, adhesion of 41 on hpscs to the bm matrix is reduced, likely explaining why homing and engraftment of hpscs are impaired . Furthermore, anti-41 antibodies could not further aggravate the adhesion defects of hpscs when upar was absent or blocked . Likewise, homing and engraftment defects were similar in mice lacking functional upar or 41 . These data suggest that cooperation of upar with 41 may partially contribute to the upar - mediated hpsc mobilization . Recent studies have revealed that functional interactions between the upa - upar system and receptors for n - formylated peptides, such as the fmet - leu - phe (fmlp), are important for leukocyte chemotaxis . The peptide, c - supar and its derived chemotactic peptide upar8495, corresponding to the upar chemotactic region unmasked by d1-d2 cleavage, can induce monocyte chemotaxis by fprl1 activation . Fprl1 belongs to the family of fmlp receptors; the other 2 members are fpr and fprl2 . Interestingly, activation of both fpr and fprl1 can lead to the desensitization of other chemokine receptors, such as cxcr4 [60, 61]. Cxcr4 and its specific ligand sdf-1 strongly contribute to retention of hpscs in the bm since the downregulation of the cxcr4/sdf1 signal pathway increases hpsc mobilization [27, 28, 62]. Several studies have investigated whether supar is also able to interfere with the cxcr4/sdf-1 axis through fmlp receptors [36, 37]. The results have shown that sdf-1-dependent bm hpsc in vitro migration was impaired by upar8495 through the activation of fpr . Serum c - supar in vivo can also regulate cd34 hpsc mobilization by downmodulating cxcr4 activity . Sdf-1 also induced chemotaxis of the bm cd34 hpscs isolated from 3 donors, and pretreatment with fmlp or upar8495 completely abolished sdf1-dependent migration . These data indicate that upar may regulate hpsc migration through fpr - mediated cxcr4 desensitization . Altogether, these data suggest that upar regulates stem cell mobilization through several possible mechanisms . During g - csf - induced hpsc mobilization, upar expression is first upregulated on cd33 and cd14 cells and is then cleaved, thus generating chemotactic forms of supar that present in the serum of g - csf - treated donors . In the first case, cleavage of upar may disrupt the interaction between upar and 41 integrin to release hpsc from their osteoblast niche . In the second case, supar may inactivate cxcr4 by heterologous desensitization and further promote hpsc release from the bm . Most importantly, c - supar may act as a chemoattractant for the bm hpscs and stimulate their mobilization from the bm to the circulation (see proposed pathway in figure 1). In multiple pathological settings, including stroke and myocardial infarction, hpscs are mobilized from the bm to sites of injury to promote tissue repair and regeneration . Stem cell therapy, including direct transplantation of stem cells, stimulation of stem cell mobilization and homing by cytokines, for example g - csf, has emerged as a promising approach to promote tissue repair and regeneration after ischemia . The studies on plg have revealed an essential role of the plg system in cytokine - induced stem cell mobilization and have elucidated the molecular mechanisms regulating plg - mediated stem cell mobilization . This will potentially contribute to the development of new therapeutic strategies, for example, targeting plg / mmp-9 for strengthening the established g - csf treatment for ischemia disease . More importantly, the proposed experimental therapy with plm (a truncated form of plasmin with fewer side - effects) or chemotactic peptide (upar8495) to promote hpsc recruitment to the damaged cardiac tissue, will confer clinical therapeutic potentials of plasmin in stem cell - mediated treatment, especially given the verified safety and efficiency of plasmin therapy (e.g., tpa) in mi treatment.
|
Posterior elbow dislocation is the most common type of elbow dislocation with slightly higher incidence in the male population and they constitute 1025% of all injuries to the elbow among persons with a mean age of 30 years . The human instinct to protect the dominant arm from injury during fall is responsible for a slight predominance for dislocation in the nondominant extremity . A high index of suspicion should be maintained by the emergency physician in evaluation for neurovascular compromise in all cases with elbow dislocation, especially in cases where the x - ray is normal . In most of the times, a simple lateral view x - ray shows the dislocation, and absent radial and ulnar pulses insures that an arterial injury is present . In our case, the x - rays were normal, and the patient had normal pulses on presentation . A 71-year - old right - handed male presented to our emergency department (ed) with left elbow pain after he fell on his left outstretched hand 1 h prior to presentation . Physical examination revealed a swollen elbow, with a dusky cold hand; radial and ulnar pulses were initially felt and were weak in comparison with the contralateral side, but after repeated assessment, the pulses became absent . Radiographs revealed no fracture or dislocation of the elbow joint (fig . 1). Figure 1:posterior splint was applied in ed and x - rays showed no fracture, no dislocation . Posterior splint was applied in ed and x - rays showed no fracture, no dislocation . As arterial injury was suspected, angiography was done and revealed a brachial artery occlusion proximal to its bifurcation with the presence of some collateral circulation reaching and perfusing the radial and ulnar arteries . Intraoperatively, the elbow was found to be grossly unstable and easily dislocatable especially on extension . Access to the brachial artery was achieved via a lazy s incision across the antecubital fossa, and exploration revealed brachial artery contusion, with intact adventitia and median nerve (fig . 2). Figure 2:intact adventitia of the brachial artery (arrow), also the median nerve seen stretched over the articular surface of the distal part of humerus, is intact (scissors). Intact adventitia of the brachial artery (arrow), also the median nerve seen stretched over the articular surface of the distal part of humerus, is intact (scissors). The anterior elbow capsule was disrupted associated with avulsion of the flexor pronator group from the medial epicondyle . As arteriotomy was done, there was an intimal loss over the entire arterial circumference for 1 cm (fig . Figure 3:loss of intima in all the entire circumference of the brachial artery in a 1-cm segment (arrow). Loss of intima in all the entire circumference of the brachial artery in a 1-cm segment (arrow). The defective part of the artery was excised and repair was achieved by placement of a brachiobrachial end - to - end reversed saphenous bridge (fig . 4). The time of trauma - to - revascularization was 7 h; primary wound closure was performed without prophylactic fasciotomies . Figure 4:complete arterial repair using an end - to - end reversed saphenous bridge . Radial and ulnar pulses were regained directly postoperatively together with a normal color and warmth of the upper extremity, vascular observation was done to rule out compartment syndrome . In the postoperative period, the elbow was immobilized for 3 weeks with a posterior splint in 70 flexion, then active range of motion exercises was started . At 1-year follow - up, patient regained all activities, and had nearly full range of motion, but with 15 loss of extension . The frequency of vascular involvement associated with closed elbow dislocation remains difficult to establish because the literature only reports short series of sporadic case studies, it approaches 4.3%, and in some series, as low as 0.47% reported by spark et al . Who had 3 cases of vascular injury out of 634 closed elbow dislocation . While reviewing the literature, we found only one case of brachial artery injury that was reported in the middle east and was treated conservatively . This leads us to the fact that these types of injuries are either missed because of collateral circulation or underreported due to the lack of research and proper documentations . Whenever there is a suspicion of arterial damage, angiogram should be performed immediately and it still considered the gold standard for evaluation of arterial injury . Sparks et al . Reported that only 12 of 30 cases of closed dislocation investigated for arterial insufficiency by angiography had arterial injuries . Having a positive pulses do not rule out brachial artery injury as patient can have a well - developed collateral circulation around the elbow . In our case, patient first had a weak pulse, then it became absent, and this could be explained by two theories . First, an intact collateral circulation perfusing the radial and ulnar arteries and with ongoing elbow swelling, these collaterals were gradually compromised leading to impaired blood flow, and fading of the pulses . Secondly, it can be explained by the fact that the initial injury caused only an intimal injury, that was not sufficient to cause a complete brachial artery occlusion, but an ongoing thrombosis formation on top of the intimal injury was occluding it gradually . Although radiograph with lateral view of the elbow shows clearly a dislocation when present, most of the spontaneous reduction can be misleading and the injury will be overlooked . Only two cases of occult elbow dislocation with vascular injury were reported in the literature, and in both cases, there was a complete rupture of the brachial artery . Few are the cases of intimal injury associated with elbow dislocation causing acute limb ischemia, in comparison with complete arterial transection; due to the rarity of the condition, few are the articles showing the prevalence of this type of arterial injury . Concerning the management, it is now generally accepted that the standard of care is repair or reconstruction of a brachial artery injury . To our knowledge, the combination of occult elbow dislocation with intimal injury of the brachial artery in a 71-year - old male makes this case to be the first reported in the literature . In conclusion, palpable pulses after elbow dislocation should not rule out arterial injury and arteriogram should be done in case of suspicion of vascular injury as it is the gold standard of diagnosis in these injuries . Normal radiographs as they show only the position of the joint at the time the radiographs was taken, and not the time of injury . If the clinical picture is in out of proportion with the x - ray findings, the case should be dealt with caution, and further investigations should be done.
|
Sevoflurane has a low blood / gas partition coefficient and does not irritate the airways . Inhalation induction should provide rapid loss of consciousness to ensure patient's comfort and satisfaction and to avoid adverse effects such as excitations, breath holding, coughing and/or laryngospasm . Several adjuvants and techniques have been proposed to ensure a rapid induction of anesthesia with sevoflurane, such as intravenous (iv) midazolam, clonidine, fentanyl, breathing different gas flows, or ventilation with larger tidal volumes . The effect of nitrous oxide (n2o) when added to the inhalation of sevoflurane in oxygen has been controversial . N2o added to oxygen was reported to make shorter the induction time with sevoflurane, an effect similar to that produced by clonidine . These results are not consistent with the results obtained from other studies, which conclude that the addition of n2o to the sevoflurane / oxygen mixture is not advantageous regarding the speed of induction of anesthesia . In contrast, results from previous studies point out that the addition of n2o to the sevoflurane / oxygen mixture may be associated with more, though minor, excitatory phenomena . Our hypothesis was that the speed of inhalation induction with sevoflurane may benefit from the pretreatment with n2o, and subsequent volume contraction before sevoflurane administration . The aim of the present study was to investigate the effect of pretreatment with 50% n2o in oxygen on the speed of inhalation induction of anesthesia with sevoflurane in women undergoing minor gynecological procedures . The study was approved by the institutional review board (n-79/04 - 04 - 06). Eighty patients american society of anesthesiology physical status i or ii scheduled for hysteroscopy under general anesthesia, who accepted an inhalation induction with no premedication, gave their written informed consent to participate in the study protocol . Patients with body weight exceeding the ideal body weight by 25%, with central nervous system disease, respiratory disease, hyper - or hypothyroidism, intake of sedatives, hypnotics, and antidepressants were excluded from the study before randomization . Patients were randomly allocated to the air (fio2 = 0.21) or n2o (n2o / o2:50/50, fio2 = 0.5) group . Randomization was done by means of odd and even numbers retrieved from a computer - generated table (http://www.randomizer.org) corresponding to the n2o and to the air group respectively . The pretreatment gas was administered via n2o - oxygen flow meters or an air flow meter connected to the wall pipelines, all covered by drapes so the investigators were blinded to the gas administered . Group allocation to intervention was done by an independent anesthesiologist not participating in the study who arranged the gases before induction (air or n2o / o2), covered the flow meters with drapes and recorded the group each patient was assigned . In the operating room monitoring consisted of pulse oximetry, electrocardiogram, heart rate, noninvasive arterial pressure, end - tidal carbon dioxide (etco2), inspired and end - tidal sevoflurane concentrations, tidal volume and respiratory rate (s/5 anesthesia monnitor, datex - ohmeda division, datex - ohmeda, helsinki, finland) and bispectral index (bis xp a-2000 monitor, system rev 3.21, aspect medical systems, leiden, the netherlands). According to the group allocation, in the preinduction period patients were fully awake, breathing spontaneously either 50% n2o in oxygen (fio2 = 0.5) or air (fio2 = 0.21) for 10 min via a mapleson c breathing system and a tightly fitting face mask . The anesthetic circuit was primed with 8% sevoflurane: an oxygen flow 6 l / min was allowed to pass through the circle anesthetic system with the sevoflurane vaporizer dial being set at 8% for 5 min . An endotracheal tube was attached to the end of the anesthetic system with the distal end tightly surrounded by a plastic bag . After the completion of the 10 min administration of the n2o / oxygen or air, the face mask was connected to the sevoflurane primed anesthetic circuit and all patients were allowed to breathe spontaneously sevoflurane in oxygen with the sevoflurane vaporizer set at 8% and an oxygen flow rate 6 l / min . After a 5 min period of sevoflurane inhalation, the study protocol and data collection were completed . A short acting opioid was given iv and a supraglottic airway device was inserted for the ventilation of patients during surgery . During the 10 min preinduction period, bis, respiratory rate, tidal volume, etco2, heart rate and oxygen saturation (spo2) were recorded every minute . The same parameters were recorded every 30 s during the first 5 min induction period with the patient breathing sevoflurane in oxygen . During the induction period inspired and end - tidal sevoflurane concentrations were also recorded every 30 s. arterial blood pressure was recorded only before starting the pretreatment with the gas and after completion of measurements to avoid stimulus during cuff inflation affecting bis measurements . We hypothesized that the speed of inhalation induction with sevoflurane will be enhanced by n2o pretreatment, and possible subsequent volume contraction occurring before sevoflurane administration . Bis was the primary outcome measure, the rest variables being secondary outcome measures . At each time point, three consecutive bis values were read and the median one was selected . Initial sample size estimation showed that approximately 40 patients are needed in each group to detect a clinically relevant reduction of bis after induction of anesthesia by 30% with a power of 0.80 and level of significance of 5% . To assess differences in patients characteristics between the two groups, two independent samples t - tests for normally distributed responses and mann - whitney tests for nonnormally distributed responses were carried out . Overall group differences in all variables were assessed by using repeated measures anova . A paired samples t - test or a mann - whitney test was used to assess differences at each time point wherever appropriate . All analyses were performed using the statistical package for social sciences (spss) software, version 11.0 (spss inc ., chicago, il, usa). In the operating room a peripheral vein was catheterized and a ringer's solution infusion was started . Monitoring consisted of pulse oximetry, electrocardiogram, heart rate, noninvasive arterial pressure, end - tidal carbon dioxide (etco2), inspired and end - tidal sevoflurane concentrations, tidal volume and respiratory rate (s/5 anesthesia monnitor, datex - ohmeda division, datex - ohmeda, helsinki, finland) and bispectral index (bis xp a-2000 monitor, system rev 3.21, aspect medical systems, leiden, the netherlands). According to the group allocation, in the preinduction period patients were fully awake, breathing spontaneously either 50% n2o in oxygen (fio2 = 0.5) or air (fio2 = 0.21) for 10 min via a mapleson c breathing system and a tightly fitting face mask . The anesthetic circuit was primed with 8% sevoflurane: an oxygen flow 6 l / min was allowed to pass through the circle anesthetic system with the sevoflurane vaporizer dial being set at 8% for 5 min . An endotracheal tube was attached to the end of the anesthetic system with the distal end tightly surrounded by a plastic bag . After the completion of the 10 min administration of the n2o / oxygen or air, the face mask was connected to the sevoflurane primed anesthetic circuit and all patients were allowed to breathe spontaneously sevoflurane in oxygen with the sevoflurane vaporizer set at 8% and an oxygen flow rate 6 l / min . After a 5 min period of sevoflurane inhalation, the study protocol and data collection were completed . A short acting opioid was given iv and a supraglottic airway device was inserted for the ventilation of patients during surgery . During the 10 min preinduction period, bis, respiratory rate, tidal volume, etco2, heart rate and oxygen saturation (spo2) were recorded every minute . The same parameters were recorded every 30 s during the first 5 min induction period with the patient breathing sevoflurane in oxygen . During the induction period inspired and end - tidal sevoflurane concentrations were also recorded every 30 s. arterial blood pressure was recorded only before starting the pretreatment with the gas and after completion of measurements to avoid stimulus during cuff inflation affecting bis measurements . We hypothesized that the speed of inhalation induction with sevoflurane will be enhanced by n2o pretreatment, and possible subsequent volume contraction occurring before sevoflurane administration . Bis was the primary outcome measure, the rest variables being secondary outcome measures . At each time point, three consecutive bis values were read and the median one was selected . Initial sample size estimation showed that approximately 40 patients are needed in each group to detect a clinically relevant reduction of bis after induction of anesthesia by 30% with a power of 0.80 and level of significance of 5% . To assess differences in patients characteristics between the two groups, two independent samples t - tests for normally distributed responses and mann - whitney tests for nonnormally distributed responses overall group differences in all variables were assessed by using repeated measures anova . A paired samples t - test or a mann - whitney test was used to assess differences at each time point wherever appropriate . All analyses were performed using the statistical package for social sciences (spss) software, version 11.0 (spss inc ., chicago, il, usa). The n2o and the air groups did not differ in age, body weight, and height . Similarly, they did not differ in systolic and diastolic arterial pressure before or after the end of measurements [table 1]. Patient characteristics, sap and dap blood pressures before and after the measurements of the 80 patients recruited for the study, 43 patients were assigned to the n2o and 37 to the air group . Four patients in the n2o group and one patient in the air group did not accept the facemask from the very beginning and no data were collected from these patients . One patient in the n2o group presented excitatory movements and removed the mask after n2o inhalation for 7 min and no further data were collected . In another patient in the air group bis values were not at any time point obtained due to technical reasons, but all the other variables were recorded and analyzed [figure 1]. The flow diagram of the study during sevoflurane inhalation in the n2o group the study was interrupted in one patient at 120 s due to persisting cough and salivation, in one patient at 180 s due to tachypnea, tachycardia and upper airway obstruction, in one patient at 210 s due to tachypnea and tachycardia, in one patient at 240 s due to upper airway obstruction, and in one patient at 270 s due to prolonged apnea . The incidence of complications during pretreatment with n2o or air followed by sevoflurane induction in the n2o and air groups during the 10 min period of breathing 50% n2o in oxygen or air, the bis, etco2, tidal volume, respiratory rate and heart rate did not differ between the group given n2o and that given air, nor was there a trend to a difference . Spo2 was slightly but significantly greater in patients given n2o, consistent with the higher inspired oxygen concentration of oxygen breathed . During sevoflurane induction bis values were lower in the n2o group [table 3 and figure 2]. At the time points 60, 90, 120 and 150 s, the bis values in the n2o versus air group were: 77 19.0 versus 92 8.6 (p <0.001), 44 19.8 versus 73 21.4 (p <0.001), 36 12.4 versus 55 24.7 (p = 0.002) and 32 11.0 versus 45 20.8 (p = 0.014), respectively . Etco2 and tidal volume values were lower and respiratory rate higher in the n2o group when compared to the air group . Spo2, heart rate, inspired and end - tidal sevoflurane concentration did not differ significantly between the two groups during the first 300 s of sevoflurane inhalation [table 3]. Bis, etco2, vt, rr, spo2, hr and fi and fe sevoflurane concentrations in the n2o- and air - breathing groups during induction of anesthesia with sevoflurane bispectral index values (mean standard deviation) during inhalation with sevoflurane in the nitrous oxide and air groups the results of the present study suggest that pretreatment with n2o in 50% oxygen for 10 min before inhalation induction with sevoflurane enhances induction as assessed by decreased bis values . These results are not consistent with other studies when n2o was administered concomitantly with sevoflurane for inhalation induction . Nevertheless, these studies were based on clinical criteria, which are subjective and therefore more difficult to be quantified . Found that the addition of 50% n2o to the sevoflurane / oxygen mixture had no effect on the speed of induction and was associated with more excitatory effects . The investigators defined induction time as the time needed for the raised arm to fall to the horizontal level . Also, according to siau and liu, 66% n2o added to oxygen did not decrease the induction time with 8% sevoflurane when compared to the induction time of 8% sevoflurane in oxygen alone . These investigators administered higher concentrations of n2o than those administered in the present study but did not prime the circle breathing circuit with sevoflurane . In a previous study, we have shown that pretreatment with 100% oxygen enhances the inhalation induction with 7% sevoflurane as assessed by bis monitoring . Replacing nitrogen in the lungs with a more soluble gas like oxygen, results in lung collapse, decreased functional residual capacity and increased alveolar concentration of the inhaled anesthetic, that is, sevoflurane . In contrast to oxygen, in the present study the n2o was discontinued during induction . It is worthy to note that during induction, the end - tidal (fe) sevoflurane concentration (though no statistically significant) was higher during the first 120 s. the higher fe is consistent with increased ventilation in the n2o group, as indicated by the higher respiratory rates and the lower co2 values ., oxygen is also expected to enhance the sevoflurane uptake and to diminish the difference between the n2o and air groups as it is more soluble than nitrogen and part of the lungs will collapse to some extent (absorption atelectasis). Similarly, n2o - being 32 times more soluble than nitrogen - is rapidly up taken by the blood, resulting in lung contraction and increased alveolar concentration of sevoflurane . However, eventually alveolar collapsing will be associated with pulmonary shunt which will delay sevoflurane uptake . The time points at which bis values differ significantly in the present study are between 60 and 150 s. the inspired and expired sevoflurane concentrations did not differ between the n2o and the air groups during the 300 s period of induction, though the end - tidal / inspired concentration (f e / fi) ratio for sevoflurane was consistently higher by 2 - 7% in the n2o group . Sevoflurane due to its low blood gas partition coefficient might not benefit from the second gas effect phenomenon . However taheri and eger have nicely demonstrated the second gas effect for desflurane, an agent even less blood soluble . Demonstrated a higher ratio of alveolar / inspired (f a / fi) sevoflurane concentration when n2o was added to the inspired mixture . Peyton et al . Reported a two to three times more powerful second gas effect of n2o on arterial versus the end - expired sevoflurane pressures and attributed this effect to ventilation perfusion inhomogeneity by general anesthesia . In both studies, our data were collected with the patients breathing spontaneously and receiving solely sevoflurane without other anesthetics or adjuvants . Pretreatment with n2o may not ensure an overall faster inhalation induction, but highlights the failure of previous studies to demonstrate enhancement of sevoflurane induction by concomitant n2o administration . Previous studies failed to show a more rapid induction of anesthesia with sevoflurane for various reasons . As sevoflurane is an agent with low solubility, it may not benefit the very first minutes of induction by the concomitant administration of n2o . So we remain with our hypothesis that this difference between the n2o and air groups may be attributed to the pretreatment rather than the co - administration of n2o during sevoflurane induction of anesthesia . A very early increased concentration effect due to volume reduction and before the shunt effect, as n2o is taken up by the pulmonary capillaries or increased ventilation, as shown by the lower etco2, in the n2o group may have influenced the speed of the sevoflurane uptake . In clinical practice, fast inhalational induction may be beneficial for both patients and hospitals; it may shorten the second stage of anesthesia, thus reducing the risk of agitation / adverse respiratory events, and increase patient's satisfaction, while - depending on the time saved - it may also decrease the overall operating room time and facilitate fast turnover . Our measurements are limited by the sensitivity of the device we used to measure sevoflurane and n2o, thus the infrared analyzer, as the gold standard to measure concentrations of inhaled anesthetics is the gas chromatography or the mass spectrometry . Other limitations of the study are the number of dropouts, which may have an impact on the study power and the relatively long period of n2o pretreatment which weakens the clinical implementation of our results and shorter pretreatment periods like 2 or 3 min may be clinically applicable . Under the present study design, breathing of 50% n2o in oxygen before induction with sevoflurane enhances the speed of induction in the very early period as assessed by the bis monitor.
|
The clinician is always in a dilemma to choose which hemostatic solution on the basis of its effect on smear layer . Even, relationship between thicknesses of smear layer with ph of the hemostatic solution should be established . This study was planned to evaluate the effect of 21.3% aluminum chloride, 0.05% oxymetazoline hydrochloride, and expasyl paste on smear layer . The study protocol consisted of: determination of ph of three different gingival retraction systemspreparation of tooth specimens for scanning electron microscope (sem) examinationprocessing of specimens for sem examination . Determination of ph of three different gingival retraction systems preparation of tooth specimens for scanning electron microscope (sem) examination processing of specimens for sem examination . Ph of 21.3% aluminum chloride, 0.05% oxymetazoline hydrochloride, and expasyl were determined using ph meter . Caries free and periodontally sound human premolars extracted for purpose of orthodontic treatment were used for preparing specimens for sem examination . The tooth was longitudinally sectioned into two equal halves, and then the root portion of the teeth was removed to increase accessibility . Teeth were prepared using air - rotor with air - water spray to receive full crown restoration [figure 1]. Group a - 21.3% aluminum chloride for 10 mingroup b - 0.05% oxymetazoline hydrochloride for 10 mingroup c - expasyl paste for 2 min . Group a - 21.3% aluminum chloride for 10 min group b - 0.05% oxymetazoline hydrochloride for 10 min group c - expasyl paste for 2 min . Samples prepared for scanning electron microscope examination the samples for groups a and b were immersed in respective solutions for 10 min whereas expasyl was applied on the sample for group c using applicator for 2 min . Then, the tooth specimens were rinsed with tap water to remove any residue of test materials . Immediately after rinsing with tap water, treated specimens were fixed in 2.5% glutaraldehyde for 12 h at 4c . After fixation, the specimen were washed with phosphate buffer solution and then dehydrated in ascending grades of alcohol (50%, 70%, 90%, and 100%) for 10 min each at room temperature . After the specimens were air dried, they were mounted on aluminum stubs with araldite and silver paste which is used as a conducting medium as specimen is nonconducting . The specimens were sputter coated with gold - palladium (150200 a thick) using polaron es 2000, sem auto coating unit . Analysis using a cambridge steroscan 250 mk iii sem operated between 10 and 20 kv was done at working distance of 68 mm . Each specimen surface was scanned in its entire to obtain on overview of the general surface topography . Ph of 21.3% aluminum chloride, 0.05% oxymetazoline hydrochloride, and expasyl were determined using ph meter . Caries free and periodontally sound human premolars extracted for purpose of orthodontic treatment were used for preparing specimens for sem examination . The tooth was longitudinally sectioned into two equal halves, and then the root portion of the teeth was removed to increase accessibility . Teeth were prepared using air - rotor with air - water spray to receive full crown restoration [figure 1]. Group a - 21.3% aluminum chloride for 10 mingroup b - 0.05% oxymetazoline hydrochloride for 10 mingroup c - expasyl paste for 2 min . Group a - 21.3% aluminum chloride for 10 min group b - 0.05% oxymetazoline hydrochloride for 10 min group c - expasyl paste for 2 min . Samples prepared for scanning electron microscope examination the samples for groups a and b were immersed in respective solutions for 10 min whereas expasyl was applied on the sample for group c using applicator for 2 min . Then, the tooth specimens were rinsed with tap water to remove any residue of test materials . Immediately after rinsing with tap water, treated specimens were fixed in 2.5% glutaraldehyde for 12 h at 4c . After fixation, the specimen were washed with phosphate buffer solution and then dehydrated in ascending grades of alcohol (50%, 70%, 90%, and 100%) for 10 min each at room temperature . After the specimens were air dried, they were mounted on aluminum stubs with araldite and silver paste which is used as a conducting medium as specimen is nonconducting . The specimens were sputter coated with gold - palladium (150200 a thick) using polaron es 2000, sem auto coating unit . Analysis using a cambridge steroscan 250 mk iii sem operated between 10 and 20 kv was done at working distance of 68 mm . Each specimen surface was scanned in its entire to obtain on overview of the general surface topography . Ph of the tested group were as follows: group a - 21.3% aluminum chloride - 1.82group b - 0.05% oxymetazoline hydrochloride - 6.44group c - expasyl paste - 3.86 . Group a - 21.3% aluminum chloride - 1.82 group b - 0.05% oxymetazoline hydrochloride - 6.44 group c - expasyl paste - 3.86 . Representative samples of untreated and all the three treated groups were examined under sem at 2400 to evaluate the effect of three different gingival retraction chemical agents on smear layer . In the untreated sample, scanning electron microscope photograph of control group in group a, i.e., 21.3% aluminum chloride treated samples, dentinal tubules were wide open . Some of the dentinal tubules were partially occluded indicating complete removal of smear layer with opened dentinal tubules and visible etching of dentin [figure 3]. Scanning electron microscope photograph of group a, i.e., 21.3% aluminum chloride in group b, i.e., 0.05% oxymetazoline hydrochloride treated samples, amorphous mass of debris was seen . The debris was accumulated in clusters indicating intact smear layer [figure 4]. Scanning electron microscope photograph of group b, i.e., 0.05% oxymetazoline hydrochloride in group c, i.e., expasyl paste treated samples, mass of debris along with that, some of the dentinal tubules were showing recognizable tubular pattern with cracks across tubular opening . This group revealed partially removed smear layer with occluded dentinal tubules [figure 5]. Scanning electron microscope photograph of group c, i.e., expasyl paste sem examination revealed that group b produced no alteration to smear layer followed by minimum alteration by group c and complete removal of smear layer with etching of dentin with group a. ph of the tested group were as follows: group a - 21.3% aluminum chloride - 1.82group b - 0.05% oxymetazoline hydrochloride - 6.44group c - expasyl paste - 3.86 . Group a - 21.3% aluminum chloride - 1.82 group b - 0.05% oxymetazoline hydrochloride - 6.44 group c - expasyl paste - 3.86 . Representative samples of untreated and all the three treated groups were examined under sem at 2400 to evaluate the effect of three different gingival retraction chemical agents on smear layer . In the untreated sample, scanning electron microscope photograph of control group in group a, i.e., 21.3% aluminum chloride treated samples, dentinal tubules were wide open . Some of the dentinal tubules were partially occluded indicating complete removal of smear layer with opened dentinal tubules and visible etching of dentin [figure 3]. Scanning electron microscope photograph of group a, i.e., 21.3% aluminum chloride in group b, i.e., 0.05% oxymetazoline hydrochloride treated samples, amorphous mass of debris was seen . The debris was accumulated in clusters indicating intact smear layer [figure 4]. Scanning electron microscope photograph of group b, i.e., 0.05% oxymetazoline hydrochloride in group c, i.e., along with that, some of the dentinal tubules were showing recognizable tubular pattern with cracks across tubular opening . This group revealed partially removed smear layer with occluded dentinal tubules [figure 5]. Scanning electron microscope photograph of group c, i.e., expasyl paste sem examination revealed that group b produced no alteration to smear layer followed by minimum alteration by group c and complete removal of smear layer with etching of dentin with group a. researchers have confirmed that tooth preparation by rotary instrumentation would results in the production of smear layer on the remaining dentin; the thickness of smear layer may vary from 0.5 to 15 um depending upon the method of instrumentation . According to pashley, the smear layer acts as a beneficial cavity liner instrumental in protecting the tooth from postpreparation sensitivity, even better than commercially available cavity liners . On the contrary, brnnstrm advocated the removal of smear layer so as to provide better adaptation of lining and luting materials . Some investigators recommend removal of smear layer to improve the bond strength of certain dentin bonding agents while other are in favor to maintain the thickness of smear layer composite resin restoration placed without glass ionomer liners . Researchers have confirmed that chemical agents remove the smear layer to various degrees such as use of 37% phosphoric acid for 15 s, 10% of polyacrylic acid for 20 s, and even 25% of tannic acid for 60 s. land et al . Concluded that 21.3% aluminum chloride and 8% racemic epinephrine hydrochloride the removed greatest amount of smear layer . New hemostatic agents such as 0.05% oxymetazoline hydrochloride or 0.025% tetrahydrozoline hydrochloride are also effective hemostatic solutions . Cordless displacement material such as expasyl had been introduced as an alternative to liquid hemostatic solutions, and it proved to be effective and more user - friendly . Hence, in this study, it was decided to evaluate the effect of these chemical agents on smear layer . Researches have also found relationship between ph and amount of smear layer removal . In this study, to establish the relationship between thicknesses of smear layer with ph of the hemostatic solutions, the ph of all the three groups were determined using ph meter . Laufer et al . Through their study concluded that to achieve a crevicular width of 0.2 mm, cord should remain in the gingival crevice for an optimum time of 4 min prior to impression making . However, contemporary textbooks recommended that the cord should remain in the gingival crevice for an optimum time of 10 min . Hence, liquid hemostatic solution, i.e., groups a and b, was allowed to remain in contact with prepared tooth for 10 min . In our study, ph of all three groups were determined by ph meter and found that group a, i.e., 21.3% aluminum chloride had least ph of 1.82 followed by group c, i.e., expasyl paste containing kaolin and aluminum chloride, of 3.86 . It is a logical relationship that with acidic ph of retraction agents, the smear layer is bound to be altered . With more acidity, there is more alteration of smear layer and dentin . Therefore, to avoid this alteration, alternative would be to use a retraction agent that has a neutral / alkaline ph . However, chemicals used for retraction are not stable in alkaline ph and therefore, some alteration of the smear layer and dentin is to be expected . Hence, from the ph meter reading, one can propose that 0.05% oxymetazoline hydrochloride (ph-6.44) would alter the tooth structure minimally, and 21.3% aluminum chloride (ph-1.82) would have maximum effects . Expasyl paste containing of kaolin and aluminum chloride (ph-3.86) would have intermediate changes . To observe the effect of these retraction agents has on the prepared tooth structure, an sem observation was felt necessary . Sem examination of representative sample revealed that group a, i.e., 21.3% aluminum chloride sample showed complete removal of smear layer with opened dentinal tubules and visible etching of dentin . Sem observation of group b, i.e., 0.05% oxymetazoline hydrochloride treated sample showed intact smear layer . The results of this study are similar to woody et al . Where they concluded that oxymetazoline hydrochloride and tetrahydrozoline hydrochloride have a more acceptable ph and this revealed that group b produced no alteration to smear layer followed by minimum alteration by group c and complete removal of smear layer with etching of dentin with group a. the results of this study are in consistent with the results obtained by land et al . Indicating that more the hemostatic solution is acidic, more the smear layer removal . As expasyl had higher ph than 21.3% aluminum chloride and lower ph than 0.05% oxymetazoline hydrochloride, it showed intermediate changes . The period of 2 min further reduced the effect that aluminum chloride in paste form might have . Results of this study need to be verified with other chemicals with variation in timeresults of the study are to be evaluated on other teeth of both maxillary and mandibular arch . Results of this study need to be verified with other chemicals with variation in time results of the study are to be evaluated on other teeth of both maxillary and mandibular arch . Results of this study need to be verified with other chemicals with variation in timeresults of the study are to be evaluated on other teeth of both maxillary and mandibular arch . Results of this study need to be verified with other chemicals with variation in time results of the study are to be evaluated on other teeth of both maxillary and mandibular arch . From the sem examination, it is evident that group b, i.e., knitted cord impregnated with 0.05% oxymetazoline hydrochloride produced no alteration to smear layer followed by minimum alteration by group c, i.e., expasyl paste retraction system . Complete removal of smear layer with etching of dentin was demonstrated in group a sample i.e., knitted cord impregnated with 21.3% aluminum chloride . Hence, showing that oxymetazoline hydrochloride and expasyl are kind to smear layer and tooth structure . Each scientific discovery increases man's ability to predict the consequences of his actions and thus his ability to control future events with scientific research being its lifeline.
|
Familial hypercholesterolemia (fh) is a common autosomal dominant genetic disorder and is an important health issue . Patients with fh are exposed to a lifetime burden of high low density lipoprotein cholesterol (ldl - c) and have significantly increased cardiovascular risk . Therefore, early and appropriate diagnosis in affected persons and prevention of vascular complications are critical . In this review, recent studies on the prevalence, diagnosis, vascular risk, and treatment of patient with fh are discussed . The frequency of heterozygous fh has long been reported to be 1/500 (0.2%), while that of homozygous fh has been reported to be 1/1,000,000 in many studies conducted in various countries around the world . However, although heterozygous fh is influenced by diagnostic criteria including mutation positivity, the prevalence has been reported to be 1/217 in a very recent danish study and 1/250 in an american study using dutch criteria . Clinical criteria most commonly used for diagnosis of fh include the simon broome register group criteria, dutch lipid clinic network criteria, and make early diagnosis to prevent early deaths (medped) criteria . Major items for these clinical diagnostic criteria are (1) severe hypercholesterolemia; (2) physical findings such as xanthoma in the index case; and (3) family history of premature coronary artery disease (cad) or severe hypercholesterolemia . While the above - mentioned criteria designed in different countries show similarity, they also show difference with respect to specific values (table 1). For cost - effective and efficient diagnosis, however, in real practice, diagnosis using only clinical findings from history taking, physical examination, and lipid profile is very common, especially when genetic screening is not available . Most monogenic causes of fh are mutations of low density lipoprotein receptor (ldlr), apolipoprotein b (apob), or proprotein convertase subtilisin / kexin type 9 (pcsk9) genes . All of these genes are involved in the pathway that clears circulating low - density lipoprotein . Among monogenic fhs, about 90% are caused by mutations of ldlr, for which 1,200 different mutations have been identified . However, even family members who have the same mutation often have quite different ldl - c levels, responsiveness to lipid lowering therapy, and survival . Therefore, decision of whether to treat or the intensity of treatment depends mostly on the phenotype rather than genotype . In other words, the clinical importance of genetic diagnosis pathogenic mutations are not identified in about 60% of clinically diagnosed fh patients, although the proportion differs according to the ethnicity or diagnostic criteria . Most fh patients without a monogenic cause are suspected to have polygenic fh that is caused by a multiple lipid - related common variants . Although ldl - c> 500 mg / dl or a xanthoma in a child is suspicious for homozygous fh, some patients with homozygous fh have lower ldl - c levels . The most critical complication in fh is life - time cardiovascular disease due to longstanding ldl - c burden (fig . It has been reported that 25% of affected women and 50% of affected men experience cardiovascular complications . The risk of cad is known to be 3.5- to 16-fold higher in heterozygous fh patients compared to non - fh individuals . The results of studies on the risk of cerebrovascular disease have been inconsistent and the risk is not yet clear . The guidelines recommend that risk assessment in patients with fh should not be made according to european systematic coronary risk estimation or american framingham risk score, because these scoring systems underestimate cardiovascular risk in fh . Even with the same ldl - c levels, carriers of mutations for fh show higher risk for cad . In addition, cardiovascular risk in fh is also influenced by other traditional risk factors, and these often also need to be considered when determining treatment . Thus, it is essential to implement pharmaco- and non - pharmacotherapy targeting hypercholesterolemia and other combined risk factors as well . As mentioned above, because vascular risk is very high and associated with cholesterol burden, lowering ldl - c is the mainstay of cardiovascular prevention in fh . Most recent guidelines indicate that it is desirable to reduce ldl - c to 50% of baseline levels or <100 mg / dl in adults with fh . Statins are the first - line agent and ezetimibe or cholesterol - binding resins are recommended when needed . Data from the united kingdom have demonstrated that the mortality of patients with fh decreased by 25% to 48% after introduction of statins . However, because the evidence is limited, there is no sufficient consensus on when to start treatment in children with fh . Lipoprotein apheresis can be considered in patients with persistently high ldl - c after treatment, extremely high cardiovascular risk, statin intolerance, or especially in patients who have homozygous fh . Meanwhile, the achievement rate of ldl - c goal (<100 mg / dl) is reported to be 11% and a large part of patients do not reach the target . Therefore, pcsk9 inhibitors, recently approved lipid - lowering agents, are spotlighted and expected to meet the unmet medical need (table 2). Although two pcsk9 inhibitors, evolocumab and alirocumab, have shown consistent and strong lipid - lowering efficacy, limitation is their high cost . Lomitapide inhibits microsomal triglyceride transfer protein and reduces very low density lipoprotein (vldl) assembly, whereas mipomersen blocks the translation of apob and decreases vldl synthesis . . However, drug - related adverse events are relatively frequent and risk / benefit ratio needs to be taken into account for these drugs (table 2). Although asian data on fh are not sufficient, its reported prevalence is similar to that of western countries . A recent korean study suggested that the best cutoff values for predicting mutation - positive fh are total cholesterol 310 mg / dl and ldl - c 225 mg / dl . In asian patients, 80% to 100% of causing mutations were identified in ldlr, whereas the others were found in apob or pcsk9 . However, the achievement rate of ldl - c by conventional lipid - lowering therapy was not satisfactory . Diagnosis of fh by clinical rather than genetic criteria is more common in real world practice . Although, the majority of patients cannot reach a ldl - c goal by conventional pharmacotherapy, novel therapeutics such as pcsk9 inhibitors are expected to improve treatment results.
|
It is a virtually immutable universal law that when communications are needed the most desperately and urgently, the difficulty of effecting the desired communication increases exponentially . Examples in our immediate experience include the south asia tsunami, hurricanes katrina and rita in the usa, the south asian earthquake in pakistan, india, and afghanistan, and the mudslides in guatemala . The history of disaster communications before computers or the internet (or outside the realm of the internet) provides us with a long - standing testament to this sad fact . The english word' disaster' comes from a greek prefix and root word meaning' bad star' . This harks back to the notion that calamitous things happen under the influence of bad star alignment . No matter the level of faith one puts in the alignment of stars as affecting events on earth, the history of the effort to communicate over distances is inextricably rooted in the motivation to avoid, or at least mitigate, the effects of various disasters . The modern ability to chat casually or to be entertained by communication technology is but an offshoot of the development of that technology which first permitted priority communication about more urgent matters . Acknowledging some of the earlier aspects of disaster or emergency communications can be interesting and engaging, and it can enable us to understand the fundamental need to communicate about emergent events . Although much of this review is oriented to history in the usa, there were parallel activities occurring in all countries in which the new technology of radio existed . Hopefully, my geocentrism in this review in an international medium can be understood and pardoned in light of that fact . Considerably predating the discovery of radio waves, many peoples had developed means of telegraphy within the broadest sense of the word . The word' telegraph' has as its origin the union of another two greek words that essentially mean' long - distance writing' . Smoke signals, torch signaling, heliographs (flashing mirrors), and signal flags are but a few of those primitive means of communicating over distance . The late 18th century saw a near simultaneous addition of a number of very important' firsts' in the annals of communication . The applications were generally military and were developed in conjunction with the french revolution and the napoleonic wars . The system involved a variation in the theme most of us could relate to as the railroad semaphore system, the naval semaphore system, or the' wig - wag' system we envision as being used by scouts . A significant advance over the tried and true system of messengers, this optical or visual telegraphy system achieved the goal of allowing information to be transmitted more rapidly than the fastest form of transportation . This system also represents the first recorded use of error control (resending lost characters), flow control (send faster or slower), and message priority . These three essential concepts have remained a vital part of all disaster or emergency communications since that time . At close to the same time, encoded shutter systems of visual telegraphy were being developed in both england and sweden . In the usa, samuel fb morse had proved in 1835 that signals could be transmitted by wire using pulses of electrical current to deflect an electromagnet . Within a year the original device was modified to emboss a strip of paper with dots and dashes . Although this was demonstrated in public in 1838, it was not until 5 years later that congress (which had been reflecting public apathy another whole complete essay in the history of disaster communications!) Funded the construction of an experimental telegraph line from washington (dc) to baltimore (ma). The original use of' morse' code involved the embossing of the code characters onto a paper tape . In the usa, however, the operation developed into sending by key and receiving by ear . This specific development in the process would prove to be a mainstay of communications during disasters and emergencies for decades, and formed the backbone of the earliest emergency communications . Italian inventor guglielmo marconi sent his first radio signals in 1895, and by 1899 he had sent a wireless signal across the english channel . In 1901 marconi's telegraphy used spark gap technology and a very broad part of the radio spectrum . Marconi and his wireless company quickly grew to transoceanic proportions and had a significant business enterprise going, part of which involved ship - to - ship and ship - to - shore communications . Several milestones in disaster communications history and heroism came out of the titanic disaster, but there also came a us senate investigation into the practices of marconi's company . Furthermore, specifically related to the sinking of the titanic, some important principles of disaster communication were formulated . Several ships were responding to help the titanic but, during a crucial time, one that was closer than the others did not receive signals from the titanic because the vessel's lone radio operator was off duty . The earlier arrival of the closer ship could have saved many more lives . Out of that experience it required that at least two radio operators be on board all vessels carrying more than 50 passengers, and that at least one of the operators be on duty in the marconi room at all times while the vessel was underway . This was also a landmark occasion in that investigations were held to find out what could have been done better, and both the public and the government began looking with a critical eye at the unregulated and unfettered development and use of communications technology . Concurrently with code telegraphy in that latter part of the 19th century, alexander graham bell was developing his concept for' harmonic telegraphy' when he discovered he could hear a sound over a wire in 1875 . Telephonic communication along wires developed for a number of years, but the first transatlantic cable, from newfoundland to england, did not open until 1956 . The marriage of this' harmonic telegraphy' and traditional morse code telegraphy, a foundation of modern disaster communications, was to take place shortly after the turn of the century . Even in the earliest days of voice telecommunications, there was an awareness of the need for means to establish communications in case of emergency or disaster . The founders of the modern communications giant ericcson contributed to progress with the first mobile telephone application in the earliest years of the 20th century . They developed a portable phone handset and crank that could be hooked to the bare phone wires of the time . The connection was made by a pair of metal hooks that were placed over the wires by means of an extension wand . Once contact with the wires was made, the magneto in the handbox was cranked, making a signal, which hopefully would be answered by someone on the line . It was actually used to report a train robbery and contributed to the bandits' arrest at around 1907 . The 1920s saw the development of radio telephony, or voice communications using radio waves in safety and military communications . It was to be 1929 before public radio telephone service on the high seas was to be inaugurated . During the earlier part of these years, the concept of amateur radio was developing in all countries that had the technology . Indeed, other than the marconi company, most of all work in radio communications was done by varying combinations of hobbyists, scientists, and tinkerers . A portion of the radio spectrum was allotted for amateur use at that time; because this portion was only useful over relatively short distances, the need for systematic relay of messages became evident . In 1919 a dedicated amateur radio operator named hiram percy maxim originated what is now known as the american radio relay league (arrl). The purpose was to set up a voluntary network of associated radio amateurs to facilitate the long - range relay of what came to be known as' radiograms' . Development of similar networks to foster long - distance passage of radiograms was roughly parallel outside the usa . The essentials of reliability and accuracy in relaying such messages became extremely important, and concurrent systems for military, commercial, and public service relay of information were established using very specific and standardized message formats . The national traffic system was born from this process, and became, in conjunction with the arrl, the way radio messages were passed nationwide for commercial, health and welfare, and disaster information . The basic format for national traffic system messages or radiograms has not changed since the early days, even for voice messages . There is an active movement underway to redesign that format into one that is more suitable to the technologies and techniques that are used today to transmit and receive disaster communications . In 1940, before us involvement in world war ii, the arrl had developed an emergency corps that trained and drilled, even on frequencies not open for casual amateur use . Five hundred amateur operators manned listening and direction finding stations . In june 1942, at the request of the arrl, the war emergency radio service was created . Amateurs were back on the air on all bands but one that had been restricted during wartime . In 1948 the military affiliate radio system was established, which integrated amateur operators (hams) and military operators on specific common frequencies worldwide . Requirements for participation in military affiliate radio system included (and does to this day) certain minimum training and continuing active participation in practice nets and drills . As the cold war got into fill swing (1952), the radio amateur civil emergency services were formed in conjunction with the federal civil defense effort . Development of this and similar groups in the usa and wordwide continued during the 1960s and 1970s, while federal and local authorities were realizing the need for disaster and emergency communications that involved all aspects of civil life . Mindful of their own history, amateur radio operators were in the forefront of reminding the authorities that communications and preparedness for all types of emergencies were beneficial . It would be doing the population a great disservice to act as if military or nuclear disasters were the only kind of disaster worthy of thoughtful planning and preparation . In the usa, 1972 saw what had been called civil defense change its name to the federal emergency management agency (fema). During this time the world of technology had been evolving at a much higher rate than the level of sophistication of civil emergency planning . Ham radio operators were developing ways to use the most advanced communications technologies known to man, on frequencies ranging from the lowest to microwaves . The divergence of the rate of development of technology and the development of thoughtful emergency preparedness is a significant aspect of this overall study that we dare not ignore or underestimate . The advent of cellular phones, microwave relays, and fiber optic cables has allowed a wondrous set of advances in complex telecommunications . Many of these techniques are still bound to the backbone of wire at some level . Therein lays the great potential for disruption in natural or man - made disasters . Emergency services telecommunications, including public safety radio systems, have exhibited tremendous growth and improvement in capabilities . Trunking radio systems and other methods that allow for very sophisticated organizations are still breakable, as has amply been shown in the recent natural disasters . Current capabilities of amateur radio include much more than the morse code telegraphy or even the clear and intelligible voice technologies of today . There are digital technologies that include data packets, even e - mail via radio, and satellite technology . Indeed, the two entities that have the most unbreakable, most long range, most dependable emergency communications in the world are the military and the amateur radio communities . As is covered by leitl in this issue, computer linkage via the internet has permitted interlinking of radios and computers; the bridging of these modes of communication has enhanced the dependability of worldwide disaster communication . To dovetail this presentation into one that includes computers and the internet (which was developed initially as a link for the military / defense infrastructure), i shall mention the significant potential that exists for bridging the last miles of hardwire connection when that infrastructure is interrupted by disaster . Movement toward realizing that bridge will significantly improve the abilities of emergency and disaster communication in the future . Two of those rapidly emerging technologies are' winlink' and' echolink' . Both of these methods have been used in the disasters i have mentioned, and have added significantly to the effectiveness of communications following those events . This has been an extremely truncated history of disaster communications outside the world of computers and internet . There is a huge body of information, to some portions of which i undoubtedly owe apologies for lack of mention . In all the history of disaster and emergency communications, from the bleak beginnings to the 21st century, we can see how the combination of great potential with lack of planning and preparedness has caused fiasco after fiasco . It is the hope of this writer that the reviews included in this collective work will enable us as citizens of the globe to begin to find ways to adjust our planning for disasters and emergencies . An essential part of that planning includes the deployment and effective use of the best means of communications that we may have at our disposal, surmounting both political and habitual objections to that process . We all know george santayana's maxim about history, so i shall not repeat its here.
|
. However, the real impact appears in those burns that are not fatal, and cause disability, prolonged hospital stays, psychosocial stigmas, and pain.1 the latter is a constant cause of attention because it affects quality of life.2,3 most hospitals try to integrate a multidisciplinary team for the treatment of burn pain . There are two treatment options: pharmacological and nonpharmacological therapy.4 nonpharmacological therapies include psychological techniques to reduce anxiety such as: relaxation, distraction, and cognitive behavioral therapy.46 this approach seeks to reduce the use of drugs, inpatient hospital stay, and pain as well as improve the quality of life without suffering from the side effects that often occur with the use of pharmacological therapy . There are other nonpharmacological options for pain relief from diverse etiologies710 that can complement the treatment following a burn such as transcutaneous electrical nerve stimulation (tens), which is easy to use, has a low - cost, and no serious adverse effects . Tens consists of the application of low voltage electric current through electrodes placed on the skin . Electrical stimulation reduces pain through central and peripheral mechanisms.7,11 electrostimulation activates, in a selective form, the afferent fibers (a) that inhibit the nociceptive information . Moreover, the afferent fibers activate the extra - segmental circuit between the spinal cord and the brain that generates the activation of central inhibitory way of pain . The symmetrical biphasic (faradic)-pulsed currents applied continuously and interruptedly in the same session could generate analgesia and promote healing, respectively . The objective of this research was to assess the effect of continuous and intermittent electrical stimulation on the pain perception in patients with different types of burns . A pilot study was conducted in 14 adults (1860 years of age), with similar demographic and socioeconomic characteristics who had second- and/or third - degree burns of different types according to american burn association . The inclusion criteria for participation in the study included total body surface area with burns <50% and the occurrence of the burn being within 24 hours of the beginning of the study . All participants had to be able to answer simple questions and understand the nature of the study . All patients were admitted to the burn unit of centro nacional de occidente a specialties hospital of the mexican institute of social security . Patients on mechanical ventilation, without intact skin for electrode placement, pregnant women, and those with psychiatric conditions were excluded from the study . All subjects were informed about the use of electrostimulation, and informed consents were signed by each patient . The local committee of scientific research of the hospital de especialidades approved and accepted the protocol . A visual analog scale was used to assess pain . The scale was graded from 0 no pain to 10 maximum pain for assessing pain intensity before and after receiving the electrical stimulation therapy . Additionally, a complete physical examination was performed to calculate the total body surface area burned and its depth . Electrotherapy was given through a portable device, the sinapsis 4.0 (zerta technologies, guadalajara, mxico) that has output parameters that are different from the other available tens modalities . It generates automatically a biphasic waveform current with a continuous mode (15 minutes) and an intermittent mode (15 minutes). The current intensity was 40 ma, nonpolar and frequency of 80100 hz . The specific waveform current avoids muscular contractions . The device has four channels and delivers the electrical stimulus via eight electrodes placed on the skin . Rectangular (510 cm) flexible electrodes with a silver and coal conductive layer were used (pepin manufacturing, inc ., lake city, mn, usa). The electrotherapy sessions were performed three times per week (monday to friday) for 4 weeks . The position of electrodes over the skin was different in each patient according to the localization of the burn . The results of clinical characteristics are presented in mean, standard deviation, and ranges . Wilcoxon s rank - sum test was used for analyzing changes in the pain visual analog scale . A significant p - value of 0.05 (two - tailed) was considered statistically significant . All statistical analyses were calculated using spps software 17th version (ibm, corporation, armonk, new york, usa). A total of 14 hospitalized patients (female: male, 1:13) were enrolled in the study and completed all the sessions . After the intervention a statistically significant reduction in pain perception (p=0.027; 8.01.7 vs 1.00.5) was observed (table 2). The nurse team reported a long time analgesic effect on patients after the electrical intervention, but we could not measure this observation effectively . The length of hospital stay was variable for each patient, being longer for patients who had burns with greater thickness . Early and efficient management of pain can have a big impact on the quality of the patient s life . The mechanism by which pain is produced in burn patients may be due to the inflammatory response generated, primary hyperalgesia, or mechanical stimulation of nociceptive receptors at the site of injury, secondary hyperalgesia.12 electrical stimulation can reduce pain through central and peripheral mechanisms . The central mechanism includes activation of the opioid, muscarinic, and serotonin receptors in the spinal cord and brainstem . Peripherally, at site of tens application, the reduction of pain may be through activation of the opioid and -2 adrenergic receptors involved in analgesia.13 this mechanism of action is similar to the pharmacological treatment used for analgesia and sedation in intensive care units, but without the known side effects of these drugs.14 tens reduces pain without the presence of adverse effects . It does not involve any risk for the burn patient because electrodes are placed on the periphery of the injured skin . It also represents a low - cost option.8 in addition to the benefit of reducing pain, electrical stimulation can accelerate wound healing by promoting greater cell migration to the site of injury;12 by this means, it could reduce number of days of hospital stay and overall costs.15 the main limitations of the present study were its design, the lack of a comparison group, and the small sample size . However, despite the different types of burns, a significant decrease in pain was observed in all patients and this protocol opens up the possibility to use other therapies for pain management in burn patients . Electrical stimulation could be a potential nonpharmacological therapeutic option for pain management in burn patients . However, a controlled clinical trial with a bigger sample size and the use of a stratified analysis according to the different etiologies of burns is needed.
|
Environmental noise together with its impact on public health has been an important issue for many years . Substantial evidence has been accumulated on the negative physiological and psychological effects of environmental noise . Sufficiently evidenced effects on health and well - being are annoyance, sleep disturbance (polysomnographic or self - reported), learning and memory hindrance, changes in levels of stress hormones, deterioration of reported health, hypertension and ischaemic heart disease . It is estimated that in the european union member states and other western european countries, at least one million healthy life years are lost annually as a result of traffic - related noise . Sleep disturbance and annoyance, mostly related to road traffic noise, comprise the main burden of environmental noise . The biological plausibility of the association between noise and cardiovascular diseases is supported by babisch . The impact of noise on human health has been studied in a number of ways . The first is direct association between environmental noise levels and morbidity of various, mainly cardiovascular, diseases . The impact of environmental noise is considered to be sufficiently demonstrated for ischaemic heart disease and hypertension . The relationship between environmental noise and annoyance and sleep disturbance is the subject of a number of studies and is likewise considered to be sufficiently demonstrated . Other types of studies deal with the relationships between subjective responses to noise and morbidity of various diseases . Self - reported noise annoyance and sleep disturbance are commonly used markers of subjective response to noise . Although annoyance is not considered a direct health effect, it may play a mediating role in the causal chain between noise and health . This indirect pathway of activation of the organism represents cognitive perception of sound, its cortical activation and related emotional responses . This can, like noise itself, initiate physiological stress reactions affecting the hypothalamus, limbic system, autonomous nervous system and pituitary and adrenal glands . The ensuing physiological dysfunction may result in manifest physiological changes and health effects over long - term periods of chronic noise exposure . Noise annoyance acts as an effective modifier of the relationship between noise levels and hypertension . In some cases, babisch summarized the results of the studies focused on the relationships between traffic noise annoyance or sleep disturbance and hypertension or ischaemic heart disease . These results are regarded as consistent when subjective responses of disturbance and annoyance are considered, showing relative risks ranging from 0.8 to 2.7 in highly annoyed / disturbed subjects . However, the author surmises that these findings may be of lower validity due to methodological issues . The large analysis and review of european housing and health status (lares) study coordinated by world health organization (who) has revealed significantly elevated relative risks in the cardiovascular, respiratory and musculoskeletal systems as well as increased risk of depressive disorder in adults reporting strong annoyance . Lares also studied the effects of neighbourhood noise which had been considerably underestimated up to that point . It was found that the health effects of neighbourhood noise annoyance are approximately in the similar range as the health effects of traffic noise annoyance . Whereas the majority of the quoted studies dealt with the health effects of noise separately, ohrstrm and barregrd focused on the impact of exposure to single and combined noise sources . They found that combined exposure to noise from two sources, road and railway traffic, induced more extensive annoyance reactions than noise from particular sources at the same sound levels . They are usually split into two parts devoted to the effects of noise during 24 h or in night . We focused on subjective responses to noise from various sources (traffic and neighbourhood noise and non - specific noise with no given source) at various times (at day, at night and over 24-h periods) and their combination . Furthermore, our aim was to study in detail the relationships between particular and combined subjective responses to noise on one hand, and the occurrence of diseases whose risk is known to be increasing with increasing noise levels on the other . We were trying to answer the following questions: (1)what are the relationships between individual variables expressing subjective responses to noise, and which of the particular subjective responses most contribute to an overall feeling of discontent? (2)which indicator better explains probability of disease: (subjectively perceived) traffic noise, neighbourhood noise, combined exposure or the total rate of noise (irrespective of the source)? What are the relationships between individual variables expressing subjective responses to noise, and which of the particular subjective responses most contribute to an overall feeling of discontent? Which indicator better explains probability of disease: (subjectively perceived) traffic noise, neighbourhood noise, combined exposure or the total rate of noise (irrespective of the source)? The study was conducted as a part of the environmental health monitoring system in the czech republic at the national institute of public health in prague . The cities involved are of varying sizes with populations ranging from 14,000 to 1.3 million inhabitants . In each of the cities, two localities with different noise levels the localities have an area of approximately 0.5 km and comprise various types of building, mostly street houses and apartment blocks . All localities are situated in built - up urban areas; none of them are urban satellites . An overall evaluation of noise levels in all monitored localities did not reveal significantly increasing or decreasing trends . Data for this study were collected during two phases of a questionnaire survey which was undertaken in 2007 and 2013 . The involved cities are shown in figure 1 . During the first phase (2007) 14 localities and in the second phase (2013) another six localities were investigated, taking two localities from the same city . (1) praha (prague), (2) kladno, (3) st nad labem, (4) jablonec nad nisou, (5) hradec krlov, (6) havlkv brod, (7) st nad orlic, (8) znojmo, (9) olomouc, (10) ostrava localities and its characterisation are shown in table 1 . There are trams or railways too, and in quiet localities, the effect of neighbourhood noise is apparent . The day noise level range between 47 and 72 db and the night noise level range between 39 and 66 db . All persons aged 3080 living in the included localities were requested to complete the questionnaire . A total of 6777 inhabitants in the first phase and 2116 inhabitants in the second phase were addressed . Characterisation of localities included in questionnaire surveys blocks = apartment blocks, mostly built after year 1945, street = street houses mostly built before year 1938, road t.=road traffic, rail t.=railway traffic, neighb.=neighbourhood, adults 60=age 3060 years, elderly = age 60.180 years . Data from the first phase of the questionnaire survey were used to test as many hypotheses about the relationships as possible . Data from the second phase were used to validate the hypotheses from the first phase . In this way, we obtained independent validation (or falsification) of the significant relationships from the first phase, since the data from 2013 were gathered in different localities than the data from 2007 . The questionnaire consisted of sections devoted to demographic and socio - economical characteristics of respondents (age, sex, marital status, education and economic status), their health (hypertension, ischaemic heart diseases including heart attack and stroke) and rates of noise annoyance and sleep disturbance . Although the respondents completed the questionnaire independently, they were asked to report only those diagnoses confirmed by a doctor . The section of the questionnaire dealing with subjective response to noise was divided into two parts one dealing with annoyance during the day and the other dealing with sleep disturbance at night . Respondents rated their total noise annoyance without identification of source of the noise . In a separate question, respondents rated their annoyance caused by six different sources of traffic noise (cars, trucks, motorcycles, buses, air transport, rail transport) and four different sources of neighbourhood noise (noise created by neighbours, technical equipment in the house, noise from restaurants and cultural facilities and commercial supplying). Every item was rated on 6-point scale with responses ranging from strongly to not at all . Rates of noise annoyance as well as sleep disturbance were summed up separately to differentiate the effects of noise from various sources at various times of day . For each of the following three categories noise annoyance during day, noise sleep disturbance during night and feelings of discomfort (noise annoyance and sleep disturbance) during both day and night four variables were defined according to the source of disturbing noise: traffic noise only, neighbourhood noise only, simultaneous traffic and neighbourhood noise and all sources of noise . The first three groups of variables (traffic noise, neighbourhood noise, simultaneous traffic and neighbourhood noise) were based on source - specific items in the questionnaire . The last group of variables (all sources of noise) was based on separate questions pertaining to total rate of noise annoyance and sleep disturbance, respectively . Scheme of variables describing subjective responses to noise according to day / night period and noise sources a t.=annoyance by traffic noise, a n.=annoyance by neighbourhood noise, a (t. + n.)=annoyance by traffic and neighbourhood noise, a g.=the general rate of noise annoyance, sd t.=sleep disturbance by traffic noise, sd n. = sleep disturbance by neighbourhood noise, sd (t. + n.)=sleep disturbance by traffic and neighbourhood noise, sd g.=the general rate of sleep disturbance by noise, (a + sd) t.=annoyance and sleep disturbance by traffic noise, (a + sd) n.= annoyance and sleep disturbance by neighbourhood noise, (a + sd) (t. + n.)=annoyance and sleep disturbance by traffic and neighbourhood noise, (a + sd) g.=the general rate of annoyance and sleep disturbance by noise . For each of the above 12 new variables, three categories were distinguished: 1not at all, 2moderately and 3strongly annoyed / sleep disturbed . For the variables dealing with source - specific noise, the classification into one of the categories was based on the sum of scores from corresponding items in the questionnaire . For traffic noise, there are cars, trucks, motorcycles, buses, air transport and rail transport, and the sum ranges from 6 to 36 . For neighbourhood noise, there are sounds created by neighbours, technical equipment in the house, noise from restaurants and cultural facilities and commercial deliveries, and the sum ranges from 4 to 24 . Discretization into categories was performed in such a way that approximately 50% of respondents were included in the first category (not at all annoyed / disturbed), 35% were included in the second category (moderately annoyed / disturbed) and 15% of respondents were in the third category (strongly annoyed / disturbed). This distribution was chosen because we considered it to be characteristic for the european urban population on the basis of the results obtained by the who lares study . The same three categories were distinguished also for total noise annoyance / sleep disturbance (here, the original 6-point scale was used for categorization). In all following analyses, we used the 12 variables in the above - described 3-point scale form . Combined data from both phases of the study were used for the purposes of this analysis . The strength of the association between any two variables was measured by the correlation coefficient, which form the correlation matrix . Furthermore, we studied the association between subjective responses to noise and occurrence of disease . Occurrence of a particular disease (hypertension, ischaemic heart disease and stroke) was considered to be a dependent variable while one of the 12 variables described in table 2 was considered as independent variable . As the prevalence of considered diseases was highly correlated with age, all analyses were performed first separately for adults (age 60) and elderly people (age> 60.1). When the studied effects were similar for both age groups, the analysis was subsequently performed on a joint data . In this way, the statistical power was increased . Demographic and socio - economic characteristics (age, sex, marital status, education and economic status) were first tested for their significance and eventually excluded (if non - significant) to make the model as simple as possible . Models with significant association between subjective responses to noise and disease occurrence were considered to be plausible, and the usual 5% significance level was used in this phase . The same association was tested again, but now on new (independent) data . In this way, the models from the first phase in which an effect was significant just by chance were falsified, solving the problem of multiple testing . Only the models where significance remained can be considered to be plausible . Since the dataset from 2013 was smaller, the significance level was increased to 15% in the second stage . At the end, all plausible models were re - estimated on joint datasets by 5% significance level, and these models are reported in the results section . The study was conducted as a part of the environmental health monitoring system in the czech republic at the national institute of public health in prague . The cities involved are of varying sizes with populations ranging from 14,000 to 1.3 million inhabitants . In each of the cities, two localities with different noise levels the localities have an area of approximately 0.5 km and comprise various types of building, mostly street houses and apartment blocks . All localities are situated in built - up urban areas; none of them are urban satellites . An overall evaluation of noise levels in all monitored localities did not reveal significantly increasing or decreasing trends . Data for this study were collected during two phases of a questionnaire survey which was undertaken in 2007 and 2013 . The involved cities are shown in figure 1 . During the first phase (2007) 14 localities and in the second phase (2013) another six localities were investigated, taking two localities from the same city . (1) praha (prague), (2) kladno, (3) st nad labem, (4) jablonec nad nisou, (5) hradec krlov, (6) havlkv brod, (7) st nad orlic, (8) znojmo, (9) olomouc, (10) ostrava localities and its characterisation are shown in table 1 . There are trams or railways too, and in quiet localities, the effect of neighbourhood noise is apparent . The day noise level range between 47 and 72 db and the night noise level range between 39 and 66 db . All persons aged 3080 living in the included localities were requested to complete the questionnaire . A total of 6777 inhabitants in the first phase and 2116 inhabitants in the second phase were addressed . Characterisation of localities included in questionnaire surveys blocks = apartment blocks, mostly built after year 1945, street = street houses mostly built before year 1938, road t.=road traffic, rail t.=railway traffic, neighb.=neighbourhood, adults 60=age 3060 years, elderly = age 60.180 years . Data from the first phase of the questionnaire survey were used to test as many hypotheses about the relationships as possible . Data from the second phase were used to validate the hypotheses from the first phase . In this way, we obtained independent validation (or falsification) of the significant relationships from the first phase, since the data from 2013 were gathered in different localities than the data from 2007 . The questionnaire consisted of sections devoted to demographic and socio - economical characteristics of respondents (age, sex, marital status, education and economic status), their health (hypertension, ischaemic heart diseases including heart attack and stroke) and rates of noise annoyance and sleep disturbance . Although the respondents completed the questionnaire independently, they were asked to report only those diagnoses confirmed by a doctor . The section of the questionnaire dealing with subjective response to noise was divided into two parts one dealing with annoyance during the day and the other dealing with sleep disturbance at night . Respondents rated their total noise annoyance without identification of source of the noise . In a separate question, respondents rated their annoyance caused by six different sources of traffic noise (cars, trucks, motorcycles, buses, air transport, rail transport) and four different sources of neighbourhood noise (noise created by neighbours, technical equipment in the house, noise from restaurants and cultural facilities and commercial supplying). Every item was rated on 6-point scale with responses ranging from strongly to not at all . Rates of noise annoyance as well as sleep disturbance were summed up separately to differentiate the effects of noise from various sources at various times of day . For each of the following three categories noise annoyance during day, noise sleep disturbance during night and feelings of discomfort (noise annoyance and sleep disturbance) during both day and night four variables were defined according to the source of disturbing noise: traffic noise only, neighbourhood noise only, simultaneous traffic and neighbourhood noise and all sources of noise . The first three groups of variables (traffic noise, neighbourhood noise, simultaneous traffic and neighbourhood noise) were based on source - specific items in the questionnaire . The last group of variables (all sources of noise) was based on separate questions pertaining to total rate of noise annoyance and sleep disturbance, respectively . Scheme of variables describing subjective responses to noise according to day / night period and noise sources a t.=annoyance by traffic noise, a n.=annoyance by neighbourhood noise, a (t. + n.)=annoyance by traffic and neighbourhood noise, a g.=the general rate of noise annoyance, sd t.=sleep disturbance by traffic noise, sd n. = sleep disturbance by neighbourhood noise, sd (t. + n.)=sleep disturbance by traffic and neighbourhood noise, sd g.=the general rate of sleep disturbance by noise, (a + sd) t.=annoyance and sleep disturbance by traffic noise, (a + sd) n.= annoyance and sleep disturbance by neighbourhood noise, (a + sd) (t. + n.)=annoyance and sleep disturbance by traffic and neighbourhood noise, (a + sd) g.=the general rate of annoyance and sleep disturbance by noise . For each of the above 12 new variables, three categories were distinguished: 1not at all, 2moderately and 3strongly annoyed / sleep disturbed . For the variables dealing with source - specific noise, the classification into one of the categories was based on the sum of scores from corresponding items in the questionnaire . For traffic noise, there are cars, trucks, motorcycles, buses, air transport and rail transport, and the sum ranges from 6 to 36 . For neighbourhood noise, there are sounds created by neighbours, technical equipment in the house, noise from restaurants and cultural facilities and commercial deliveries, and the sum ranges from 4 to 24 . Discretization into categories was performed in such a way that approximately 50% of respondents were included in the first category (not at all annoyed / disturbed), 35% were included in the second category (moderately annoyed / disturbed) and 15% of respondents were in the third category (strongly annoyed / disturbed). This distribution was chosen because we considered it to be characteristic for the european urban population on the basis of the results obtained by the who lares study . The same three categories were distinguished also for total noise annoyance / sleep disturbance (here, the original 6-point scale was used for categorization). In all following analyses, combined data from both phases of the study were used for the purposes of this analysis . The strength of the association between any two variables was measured by the correlation coefficient, which form the correlation matrix . Furthermore, we studied the association between subjective responses to noise and occurrence of disease . Occurrence of a particular disease (hypertension, ischaemic heart disease and stroke) was considered to be a dependent variable while one of the 12 variables described in table 2 was considered as independent variable . As the prevalence of considered diseases was highly correlated with age, all analyses were performed first separately for adults (age 60) and elderly people (age> 60.1). When the studied effects were similar for both age groups, demographic and socio - economic characteristics (age, sex, marital status, education and economic status) were first tested for their significance and eventually excluded (if non - significant) to make the model as simple as possible . Models with significant association between subjective responses to noise and disease occurrence were considered to be plausible, and the usual 5% significance level was used in this phase . The same association was tested again, but now on new (independent) data . In this way, the models from the first phase in which an effect was significant just by chance were falsified, solving the problem of multiple testing . Since the dataset from 2013 was smaller, the significance level was increased to 15% in the second stage . At the end, all plausible models were re - estimated on joint datasets by 5% significance level, and these models are reported in the results section . In the first phase, 3592 questionnaires were obtained (53% response rate) whereas in the second stage, 762 questionnaires were obtained (36% response rate). The average length of living in the locality was 22 years in the first stage and 29 years in the second study stage; less than 5 years, it was in 10% of the whole respondent group . Basic socio - demographic characteristics of respondents number of cases (percentages) adults 60=age 3060 years, elderly = age 60.180 years, n. a.= not available . The correlative intensity was defined by correlation coefficients, which form the correlation matrix [table 4]. Only six variables were included in correlation matrix annoyance by traffic noise, annoyance by neighbourhood noise, sleep disturbance by traffic noise, sleep disturbance by neighbourhood noise, the general rate of noise annoyance and the general rate of sleep disturbance . The correlation between variables that were partly based on the same questions (e.g. Annoyance by transportation noise versus annoyance and sleep disturbance by transportation noise) was high (about 0.8) in all cases and was not included in correlation matrix . Correlations between variables describing subjective responses to noise - correlation coefficients a t.=annoyance by traffic noise, a n.=annoyance by neighbourhood noise, sd t.=sleep disturbance by traffic noise, sd n. = sleep disturbance by neighbourhood noise, a g.= the general rate of noise annoyance, sd g.=the general rate of sleep disturbance, all correlation coefficients are statistically significant, and p - values are less than 0.001 . High correlation could be found between the two variables dealing with traffic noise (correlation coefficient 0.7) and also between the two variables dealing with neighbourhood noise (correlation coefficient 0.7). The other pairs of source - specific variables showed only moderate association (correlation coefficient 0.2 and 0.3). The general rate of annoyance was correlated with annoyance by traffic noise (correlation coefficient 0.7) and the general rate of sleep disturbance was correlated with sleep disturbance by traffic noise (correlation coefficient 0.6), whereas the variables dealing with neighbourhood noise were not as strongly correlated with the general rates (correlation coefficients under 0.3). Besides correlations given in table 4, high correlation was also found between annoyance by traffic and neighbourhood noise and the general rate of noise annoyance, as well as between sleep disturbance by traffic and neighbourhood noise and the general rate of sleep disturbance (correlation coefficient 0.6 in both cases). In the next part of the analysis, we studied the relationship between indicators for subjective responses to noise and diseases . From the three considered diseases, ischaemic heart disease (including heart attack) was reported by 11% of respondents and stroke by 2% of respondents . The number of cases as well as corresponding percentages for adults and elderly people are summarized in table 5 . Prevalence of diseases number of cases (percentages) data collected in 2007 revealed a significant relationship between a number of subjective responses to noise and occurrence of diseases, and the outcomes are presented in table 6 . For significant associations, the odds ratio (or) ranged from 1.2 to 1.8 for hypertension, from 1.3 to 1.8 for ischaemic heart disease (including heart attack) and from 1.8 to 3.3 for stroke . Odds ratios (or) for significant association (p <0.05) in the first stage of the questionnaire survey a t.=annoyance by traffic noise, a n.=annoyance by neighbourhood noise, a (t. + n.)=annoyance by traffic and neighbourhood noise, a g.=the general rate of noise annoyance, sd t.=sleep disturbance by traffic noise, sd n. = sleep disturbance by neighbourhood noise, sd (t. + n.)=sleep disturbance by traffic and neighbourhood noise, sd g.=the general rate of sleep disturbance by noise, (a + sd) t.=annoyance and sleep disturbance by traffic noise, (a + sd) n.= annoyance and sleep disturbance by neighbourhood noise, (a + sd) (t. + n.)=annoyance and sleep disturbance by traffic and neighbourhood noise, (a + sd) g.=the general rate of annoyance and sleep disturbance by noise, adults60=age 3060 years, elderly= age 60.180 years, n. a.=not available, strongly / not at all, strongly or moderately / not at all, strongly / moderately or not at all, x = no significant correlation, adjusted for age, sex, marital status, education and economic status, or significant by level of significance p <0.005 is printed in bold, by level of significance 0.005 <p <0.01 is printed in normal font and by level of significance 0.01 <hypotheses were subsequently validated using data collected in the second stage (2013). Only some of the hypotheses were confirmed . Significant associations in both phases of the questionnaire survey were: for hypertension, none of the subjective responses to noise represented a significant indicator for the whole dataset (both age groups). However, for elderly people, annoyance by traffic noise was one significant indicator and sleep disturbance by traffic and neighbourhood noise was another significant indicator . For ischaemic heart disease, the general rate of noise annoyance and the general rate of annoyance and sleep disturbance were identified as significant indicators . For stroke, annoyance and sleep disturbance by traffic and neighbourhood noise were the only significant indicators . Ors, which describe the strength of these associations, are summarized in table 7, where the results are based on the united data file from 2007 and 2013 . Plausible models (significant in both phases of the questionnaire survey) and estimated odds ratios measuring the association between subjective responses to noise and disease occurrence a t.=annoyance by traffic noise, a n.=annoyance by neighbourhood noise, a (t. + n.)=annoyance by traffic and neighbourhood noise, a g.=the general rate of noise annoyance, sd t.=sleep disturbance by traffic noise, sd n.=sleep disturbance by neighbourhood noise, sd (t. + n.)=sleep disturbance by traffic and neighbourhood noise, sd g.=the general rate of sleep disturbance by noise, (a + sd) t.=annoyance and sleep disturbance by traffic noise, (a + sd) n. = annoyance and sleep disturbance by neighbourhood noise, (a + sd) (t. + n.)=annoyance and sleep disturbance by traffic and neighbourhood noise, (a + sd) g. = the general rate of annoyance and sleep disturbance by noise, adults 60=age 3060 years, elderly= age 60.180 years, strongly / not at all, strongly or moderately / not at all, strongly / moderately or not at all, x= no significant correlation, adjusted for age, sex, marital status, education and economic status, or significant by level of significance p <0.005 is printed in bold, by level of significance 0.005 <p <0.01 is printed in normal font and by level of significance 0.01<p<0.05 is printed in italics . The high correlation between the general rates of annoyance / sleep disturbance and variables dealing with traffic noise shows that traffic noise is a key factor affecting overall noise annoyance . The high correlation between annoyance and sleep disturbance from traffic noise is perhaps linked with the fact that localities close to the busy roads / railways have high noise exposure both in day and at night . High correlation is also between variables dealing with combination traffic and neighbourhood noise and the general rates of noise annoyance / sleep disturbance, but these variables are not identical . Traffic and neighbourhood noise are dominant sources of noise, but other sounds could also contribute to the general rate of annoyance / sleep disturbance (e.g. Natural sounds and sounds from unknown origin). Comparison of the relevance of the variety of indicators revealed that the source - specific indicators are usually weak only the association between traffic noise and hypertension was shown to be significant in the elderly population . In contrast, indicators that combine levels of annoyance / disturbance from multiple sources or that are based on the total rate of annoyance / disturbance are better indicators in many situations, as they are associated with the studied diseases more frequently than the source - specific factors . Factors based on the combination of traffic and neighbourhood noise are significantly associated with hypertension and stroke while the general rate of noise annoyance (and sleep disturbance) is significantly associated with ischaemic heart disease . The strong point of the current study lies in its two - phase design which enables elaboration of hypotheses in the first phase and their independent validation in the second phase . In this manner, we have overcome a statistical problem of multiple testing which is present in almost all to date published papers on this topic . One possible solution of this problem is to use bonferonni or some other correction, leading to use of lower significance level . We solved the problem in other way we tested the associations significant in the first dataset on new independent dataset, and only the associations significant in both datasets were considered as confirmed . The reduction of false - significant results might be quite dramatic as seen from the comparison of tables 6 and 7 . Comparison of our results with those of other studies has to be done cautiously; studies involve populations of varying ages with various predictors, adjustments for variables and health endpoints . Furthermore, the degree of noise annoyance / sleep disturbance was not addressed directly in our questionnaire but was calculated during data summarization . In view of this, comparison of results is indicative independently validated overall results reveal a relationship between traffic noise annoyance and hypertension in the elderly (or 1.38), whereas in the lares study, this relationship was demonstrated in the adult population (or 1.42) and in a berlin, germany study for all respondents aged 3170 (or 1.29, road traffic noise only). Other associations detected in our study are based on the general rates or combined subjective responses to noise, in contrast to the majority of other studies which deal with source - specific (traffic or neighbourhood) subjective responses and are therefore not comparable . A greater number of comparable results can be found among the partial results from the first phase in 2007 . The interdependence between traffic noise and hypertension (or 1.47 for adults aged 3060 and 1.60 for all respondents aged 3080) demonstrated in our study corresponds to results from lares (or 1.42 for adults) and is slightly greater than that quoted in the study in berlin, germany (or 1.29 for all respondents aged 3170). We have demonstrated the significant association between neighbourhood noise annoyance and hypertension for seniors (or 1.51), whereas in the lares, this association was detected in the adult population (or 1.42). We found a significant association between traffic noise sleep disturbance and hypertension in all respondents (or 1.44), whereas the german study (general population sample) revealed greater interdependency (or 2.32 for all respondents aged 3170). The relationship between sleep disturbance from non - specific sources and hypertension (or 1.26 for all respondents) is comparable to that found by lares, although in this case, it was confirmed in the adult group only (or 1.5). Comparison with other studies dealing with ischaemic heart disease is problematic because the majority of the studies show the relationship between angina pectoris and myocardial infarction, or heart attack, separately . The association between neighbourhood noise annoyance and stroke was demonstrated by this study for seniors (or 2.63) as in the lares study (or 2.4 for seniors). The present study as well as lares gives insignificant results for the relationship between sleep disturbance for noise from non - specific sources and stroke . The majority of the studies restrict their focus to partial aspects of mutual relationships among noise levels, feelings of discomfort and the effects on human health . It is worth noting that there might be a two - way causal effect between feelings of discomfort and disease . Subjectively perceived permanent feelings of discomfort might cause cardiovascular problems in accordance with the stress theory of noise effects . On the other hand, ill persons, along with the elderly and children, health condition is also considered a potential effect modifier of the relationship between noise annoyance and disease . Not even our study can determine the prevailing direction of effects in the relationship between discomfort associated with subjective perception of noise and disease because the analysed data are acquired from a cross - sectional study which is generally unsuitable for demonstrating causality . We are likewise aware of other possible major limitations of the study, such as the summarization of effects of partial noise sources to transportation and neighbourhood noise . Determining the effects of a series of partial sound sources was primarily included in the questionnaire because this information was desired for other purposes . Although categorization of respondents according to their feelings of discomfort was performed so as to yield proportional representation of individual groups similar to lares, different formulations of questions and the necessity of summarizing noise from a number of sources may lead to disparate results, complicating comparison to other studies . Further, there is adjustment of models only for age and socio - economic characteristics but not for other possible causes of the diseases, as could be revealed by anamnesis or lifestyle factors . The reason for this is that the study was targeted at comparison of the effects of individual subjective responses to noise and not specific diseases and their causes . Supposed relationships among noise, subjective response to noise and noise impact on human health high correlation can be found between the general rate of annoyance / sleep disturbance and variables dealing with traffic noise . We have also studied the association of subjective responses to noise with selected chronic diseases (hypertension, ischaemic heart disease and stroke). Only one association was significant for source - specific factors the association between traffic noise and hypertension . Factors that include multiple sources of noise or that are based on total rates of annoyance / disturbance are associated with the studied diseases more frequently . The combination of traffic and neighbourhood noise is significantly associated with hypertension and stroke whereas the general rate of noise annoyance (and sleep disturbance) is significantly associated with ischaemic heart disease . The importance of independent validation of the hypotheses created by multiple models fitting was demonstrated.
|
The outbreak involved a group of 3 persons and a group of 29 persons who ate lunch at a catering college restaurant . A probable case - patient was defined as a restaurant diner with diarrhea onset within 7 days after eating at the restaurant on may 12, 2011 . Environmental health officers inspected the restaurant kitchen and reviewed food preparation processes on may 17 . The lunches had been ordered in advance, and officers recorded the food choices made by each diner . Menu choices and occurrence of illness were verified by face - to - face interviews (22 diners), postal interviews (9 diners), and other diners for 1 diner who had died . When food consumption history differed from the diner s lunch order, which occurred mainly through sharing of food, consumption history was used . Fisher exact test p - values and odds ratios with cis were calculated for the association of each menu option with illness . Lower cis were estimated by using the cornfield method in stata 11 (statacorp lp, college station, tx, usa). Repeat analysis was restricted to patients with laboratory - confirmed illness and those who were not ill . In addition, a sample of duck liver, not from the batch used to prepare the meals in question, was obtained from the supplier on june 13 and tested for campylobacter spp . By using 25 g of sample cultured on campylobacter blood - free selective agar base after enrichment in bolton broth (oxoid, basingstoke, uk). Sts for samples from case - patients and the liver sample were compared with those of published isolates from chickens (mainly sampled in the united kingdom during 20012005) (9,10), farmed ducks (sampled in the united kingdom, 2007) (11), wild ducks (sampled in the united kingdom, 2007) (11), and wild geese (sampled in the united kingdom, 20022004) (12) by using a neighbor - joining algorithm and default parameters in mega (www.megasoftware.net/) as described (13). Of the 32 diners, 18 (56%) reported diarrhea: 8 had laboratory - confirmed campylobacteriosis, 6 had samples that were negative for campylobacter infection, and 4 were not tested (figure 1). Five case - patients described severe diarrhea (profuse, explosive, uncontrollable, or watery), 5 reported fever or shivering, and 2 reported abdominal pain . No other positive associations were identified (table). When analysis was restricted to confirmed cases, campylobacteriosis was strongly associated with pt (lower ci of odds ratio 5.5; p = 0.001). Onset dates of diarrheal illness related to a duck liver associated outbreak of campylobacteriosis among humans, united kingdom, 2011 . Symptoms recorded with or without laboratory confirmation of campylobacter infection, among persons eating lunch at a catering college restaurant on may 12, 2011 . 95% cornfield cis are in parentheses . Where odds ratio is undefined, lower ci is presented ., we found that 1 kg of duck livers was seared and flambed in batches without ensuring that adequate internal cooking temperatures were achieved . Campylobacter isolates were available from 6 of 8 confirmed case - patients and the duck liver . The c. jejuni sts were st356 (3 cases), st50, and st607 . These sts are genetically diverse (figure 2), but each clustered with chicken and farmed duck rather than wild waterfowl isolates . The duck liver isolate, st5097, clustered with wild waterfowl isolates (figure 2). Comparison of campylobacter jejuni sequence types (sts) from a duck liver associated outbreak of campylobacteriosis among humans in the united kingdom during 2011 (solid squares) with published sequence types of isolates from chicken (hollow circles) (9,10), domesticated duck (hollow triangles) (11), wild duck (solid triangles) (11), and wild geese (hollow squares) (12). St5097 was isolated from a duck liver sample, st356 from 3 case - patients, and st50 and st607 each from 1 case - patient . The attack rate of 86% among persons who ate duck liver pt was similar to rates for outbreaks associated with chicken liver pt (5,6). If the internal temperature reaches 70c and is sustained for at least 2 minutes and if total cooking time is at least 5 minutes (14). The cooking process for the pt, as reviewed by environmental health officers, was insufficient to kill bacteria inside the livers . Aseptic testing of 30 chicken livers showed internal infection in 90% (14); testing of 50 chicken and 50 duck livers identified campylobacter spp . The high level of internal and external contamination in chicken liver in these studies and failure of insufficient cooking to destroy the bacteria in the current outbreak suggest that internal contamination of duck liver also occurs . Undercooked duck liver may therefore present a hazard similar to that presented by undercooked chicken liver . Deliberate undercooking was identified in 68% of 25 poultry liver associated campylobacteriosis outbreaks that occurred during 19922009 (4). Outbreaks associated with chicken and duck liver pt and parfait are being increasingly identified in the united kingdom and are likely to occur in other countries because the cooking procedures described in the united kingdom outbreaks are not based on recipes restricted to the united kingdom . Sporadic cases associated with similar home cooking of poultry liver products are also likely to occur, but such cases will be difficult to identify unless specifically sought . The diversity of isolates in this outbreak resembles that in an outbreak of campylobacteriosis related to chicken liver pt (6). As with that outbreak, the diversity in the outbreak in this study could reflect individual livers co - infected with> 1 campylobacter strain,> 1 infected liver in the food item, or both . This diversity suggests that bacterial invasion of chicken and duck livers is possible for a wide range of fairly distantly related campylobacter spp . The clustering of c. jejuni isolates from this outbreak with sts associated with farmed duck and farmed chicken and the genetic separation from wild duck and wild goose isolates (figure 2) suggests that the farm environment may favor some campylobacter spp . An alternative hypothesis is that among a wide range of subtypes infecting ducks, those that are found in other farm animals are more effective at causing human disease . The single campylobacter isolate from a later, non outbreak - associated batch of duck liver clustered with isolates from wild waterfowl rather than the outbreak isolates or other isolates from farmed ducks . The limited data on campylobacter populations in poultry other than chickens restrict our ability to interpret this discrepancy . Further work to characterize the campylobacter populations of wild and farmed ducks may facilitate more reliable inference.
|
Facial muscles such as the buccinator, orbicularis oris, and risorius play an important role in the oral phase of swallowing and are also involved in facial expression . However, neurological disorders such as stroke cause paralysis of the opposite sides of the body, thereby affecting the facial muscles1 . The impairment of the facial muscles in patients with central facial palsy (cfp) is typically more pronounced in the lower than in the upper face . As a result, weakened facial muscles cause problems in the oral phase of swallowing, such as decreased mastication and bolus control, oral residue, and drooling, as well as facial expression . Neuromuscular electrical stimulation (nmes) provides electrical stimulation over the skin in the anterior throat or facial region . Nmes is effective in muscle strengthening, prevention of muscle atrophy, and neuromuscular re - education2, 3 . However, most studies have reported applying it on the swallowing - related muscles located on the front side of the neck in patients with pharyngeal dysphagia to examine the effects on swallowing function4, 5 . Therefore, there is insufficient evidence on the effects of nmes on patients with oral phase dysphagia accompanied by cfp . The present study aimed to investigate the effects of nmes on the facial muscles and oral phase of swallowing in patients with oral phase dysphagia who have cfp following a stroke . Nine stroke patients with dysphagia (age, 60.78 4.76 years; 5 males and 4 females) were eligible for this study . The inclusion criteria for participation were as follows: 1) oral dysphagia with cfp from a stroke that was confirmed by a videofluoroscopic swallowing study (vfss), 2) onset <3months, and 3) a mini - mental state examination score of 24 . The exclusion criteria were as follows: 1) implanted cardiac pacemaker, 2) severe communication disorder such as severe aphasia, 3) unstable medical condition, and 4) skin problems that could affect the electrode placement . All subjects provided written informed consent before participation according to the ethical standards of the declaration of helsinki . Nmes was performed using the vitalstim (chattanooga group, hixson, tn, usa). One set of electrodes was placed on the paretic facial region according to the device manufacturer s instructions . The electrical stimulation unit provided 1 channel of bipolar electrical stimulation at a fixed 80-hz pulse rate and a fixed biphasic pulse duration of 700 s . The intensity was increased gradually at an interval of 0.5 ma for the experimental group . The stimulation intensity was increased until subjects felt a grabbing sensation in their facial muscles; a therapist confirmed the visible muscle contraction . The stimulation intensity was set differently for each participant, from 9.0 to 14.0 ma (average, 13.2 ma). Subjects received the treatment for 30 minutes / session, 5 sessions / week, for 4 weeks . The iowa oral performance instrument (iopi medical llc, carnation, wa, usa) was used to measure maximal cheek strength (mcs) and maximal lip strength (mls) in all subjects . The videofluoroscopy dysphagia scale (vds) was used to quantify the functional recovery of swallowing . Vds is a functional evaluation scale that comprehensively reflects the overall swallowing function in stroke patients7, 8 . In this study, 7 subtests of oral stage function were analyzed such as lip closure, bolus formation, mastication, apraxia, tongue to palate contact, premature bolus loss, and oral transit time . The outcomes were analyzed using a statistical software program (spss version 20), with descriptive statistics presented as mean standard deviation . Mcs and mls improved following intervention from 14.3 3.4 to 18.4 2.8 kpa and from 10.6 2.7 to 13.4 2.7 kpa, respectively . The oral phase vds score statistically significantly decreased from 27.0 5.0 to 22.2 4.3 points (table 1table 1.test results before and after nmesbefore nmes (n=9)after nmes (n=9)mcs (kpa) 14.3 3.418.4 2.8*mls (kpa)10.6 2.713.4 2.7*vds (points) 27.0 5.022.2 nmes: neuromuscular electrical stimulation; mcs: maximal cheek strength; mls: maximal lip strength; vds: videofluoroscopy dysphagia scale). Nmes: neuromuscular electrical stimulation; mcs: maximal cheek strength; mls: maximal lip strength; vds: videofluoroscopy dysphagia scale the present study aimed to investigate the effects of nmes on facial muscle strength in patients with oral phase dysphagia who have cfp following a stroke . The study demonstrated improvement in the strength of the mcs and mls . In the present study, the electrodes are placed on the lower part of the face to stimulate the buccal branch of the facial nerve, as well as the trigeminal nerve . This not only stimulates the nerves, but also stimulates motion via muscle contraction, and the buccal branch of facial nerve controls both mcs and mls . Nmes involves electrical stimulation of the muscles using surface electrodes and leads to muscle contraction by depolarization of nerve fibers . Such continued muscle contraction has a positive influence on muscle activation and can be effective for muscle strengthening, reduction of spasm, atrophy prevention, and retraining2 . Nmes increases recruitment of motor units, which is closely associated with an increase in muscle strength . The present study showed significant improvement in the oral phase parameters of the vds . The oral phase parameters of the vds include lip closure, bolus formation, and mastication, for which performance of the facial muscles is important . Facial muscles are involved in mastication of food and in formation of intraoral pressure during the oral phase and play a role in preventing the leaking of food via lip closure9 . Therefore, the present study demonstrated that improvement in the strength of facial muscles contributed to improvement in the oral phase of swallowing . First, because sample size may have influenced the results, they cannot be generalized . Second, because this study was conducted in subacute patients, the effects of natural recovery, considering the rapid nature of neurological recovery, cannot be excluded . Third, the absence of follow - up after the end of intervention did not allow for determination of the long - term effects.
|
Toxoplasmosis is an infection caused by the intracellular protozoon t. gondii, for which the primary host is cats . Sexual reproduction of this parasite takes place in the intestinal environment of cats, and the oocysts produced are eliminated together with the feces . The oocysts remain viable in the external environment for up to one year . Within this setting, t. gondii contaminates secondary hosts through these hosts' contact with sand, foods, or plants that have been contaminated by the oocysts . After ingestion of the oocysts, the oocyst wall becomes thinned by the digestive juices, thereby leading to release of sporozoites into the intestinal lumen . The sporozoites rapidly invade the intestinal epithelium, though the vascular endothelium . At this stage of the evolution, they are transformed into tachyzoites, which are the invasive form of the parasite . Through tachyzoite dissemination, the parasite will lodge in a wide variety of tissues in the secondary host, in which large numbers of cysts that are rich in bradyzoites are produced . The secondary hosts are commonly humans, rodents, birds, crustaceans, domestic animals, and practically all other warm - blooded animals, which explains why consumption of raw or undercooked meat can contaminate other hosts with bradyzoites from tissue cysts . Ingestion of sporozoites occurs mainly through eating poorly washed fruits or vegetables, doing gardening, coming into contact with children who were playing on the ground or on sand, and so on . Data in the literature consistently draw attention to the importance of proper guidance regarding the commonest means of becoming infected with t. gondii, with the aim of preventing this event within the pregnancy cycle and the possible harm done to the fetus [2, 3]. A study conducted in the economic research service in the united states concluded that approximately half of the cases of toxoplasmosis occurred due to consumption of raw or undercooked meat and that the annual cost of treating such cases in that country was approximately u$7.7 billion . This high amount was due mainly to the congenital complication resulting from vertical transmission of the parasite to the fetus . Although toxoplasmosis is extremely benign among immunocompetent women, there is a risk of vertical transmission of the parasite when this infection occurs during pregnancy . The risk increases with advancing gestational age in the following manner: first trimester 1025%, second trimester 3050%, and third trimester 6090% . This seems to occur as a function of the increase in the mass of the placenta, thus increasing the tissue available for tachyzoites to invade . On the other hand, the increase in the volume of the placenta also contributes towards increasing the quantity of cysts rich in bradyzoites, which implies a greater risk of fetal infection in cases of reactivation of the pathological condition . Investigation of igg and igm levels should be incorporated into the prenatal routine for the commonest infections and for teratogenic infections, including rubella, cytomegalovirus, and toxoplasmosis . Diagnoses of acute or progressive toxoplasmosis infection are based on detection of its specific antibodies, with the aim of making an early diagnosis of maternal seroconversion and instituting appropriate treatment . This is extremely important for preventing vertical transmission of t. gondii and its deleterious effects on the fetus [69]. Findings of toxoplasmosis - specific igm indicate occurrences of acute infection, although these antibodies may be present in the maternal serum from one week to 18 months after the date of invasion by the parasitic tachyzoites . Specific igg appears in the maternal serum between one and two months after the initial infection . In this light, it is clear that it is absolutely impossible for clinicians to define the starting time of the acute infection based only on the presence of igg and igm . Moreover, the specificity and sensitivity of igm are not 100%, but in the ranges of 93.3 to 100% and 77.5 to 99.1%, respectively, according to evaluations on the six elisa kits most commonly used in the united states, in a study commissioned by the food and drugs administration (fda). The igg avidity test is the laboratory resource currently accepted for the diagnosis of the approximate time when the initial infection occurred . This measures the affinity of igg for binding to the antigens of t. gondii, and it tends to increase with the length of time that has elapsed since the initial infection [1013]. A mexican study on 100 pregnant women showed that there was no correlation between igm levels and the igg avidity test results . Thus, it was demonstrated in that study that the igg avidity test is useful for inferring the infection phase and assisting in managing toxoplasmosis during pregnancy . In this manner, avidity test results of up to 30% allow it to be said that the initial infection occurred not more than four months earlier . On the other hand, results of more than 60% indicate that the initial infection occurred at least six months earlier . Results of between 30 and 60% are inconclusive regarding the exact time of the initial infection . However, in practice, all the antibodies discussed above only allow conclusions consisting of suppositions and probabilities . A prospective study assayed igg avidity for toxoplasmosis among 146 pregnant women who presented with igm positive for t. gondii . The patients underwent a multiplex nested polymerase chain reaction (pcr) for dna of t. gondii in the amniotic fluid, maternal blood, and blood of the umbilical cord . Fifty (34.9%) of the pregnant women presented with low igg avidity (less than 30%). The pcr performed on the amniotic fluid or performed at birth was positive in the cases of nine patients with low igg avidity . Among these nine patients, only three presented with congenital toxoplasmosis . None of the pregnant women with high or threshold avidity presented positive pcr results in the amniotic fluid or congenital toxoplasmosis . There were no diagnoses of congenital toxoplasmosis among the patients with negative pcr results in the amniotic fluid . Thus, it was concluded from that study that using igg avidity in association with pcr on the amniotic fluid was important for diagnosing congenital toxoplasmosis . A prospective cohort study evaluated women with toxoplasmosis infection that had been detected in the prenatal screening at three centers, by means of real - time pcr on the amniotic fluid . Pcr analysis was performed on 261 of the 377 patients who were included in the study . The sensitivity and negative predictive values were, respectively, 92.2% (95% confidence interval, ci: 8198%) and 98.1% (95% ci: 9599.5%). There was no significant association with the trimester of pregnancy in which the infection occurred . Thus, real - time pcr was considered to be an important tool for predicting fetal infection due to t. gondii and for making more appropriate treatment decisions . In a study conducted in france, at the university hospital of toulouse, 352 amniocentesis procedures were performed on pregnant women who were infected with t. gondii . The sensitivity and specificity of the diagnosis of congenital toxoplasmosis by means of pcr on the amniotic fluid were 91% and 99.5%, respectively . Pcr was also performed on the placenta, which showed specificity of 52% and sensitivity of 99% . The specific igg and igm tests on the cord blood presented specificity of 91% and 92% and sensitivity of 53% and 64%, respectively . It was concluded in that study that pcr on the amniotic fluid has higher sensitivity and specificity for diagnosing congenital toxoplasmosis, thus enabling a more certain diagnosis of fetal infection . A study conducted at the university of the suez canal, in egypt, on 358 pregnant women with toxoplasmosis, showed sensitivity of 92.9% and specificity of 94.4% for pcr on the amniotic fluid, with a positive predictive value of 76.5% and a negative predictive value of 98.5% for the diagnosis of congenital toxoplasmosis . Based on these studies, it has been accepted that the gold - standard examination for identifying fetal infection is pcr, which has high sensitivity and specificity when performed on amniotic fluid samples obtained from the sixteenth week of pregnancy onwards . In this manner, diagnosing the presence of dna particles from t. gondii in this medium can be done with great certainty . Since colonization of the fetal kidneys occurs around two to three weeks after invasion by the tachyzoites of t. gondii and production of the amniotic fluid occurs basically by means of fetal diuresis, it can be concluded that a positive pcr indicates the presence of infection in the fetus, which has been eliminating t. gondii dna into the amniotic environment, in its urine . Attention has also been drawn to the possibility of reactivation of latent toxoplasmosis in immunosuppressed patients . Maternal immunosuppression and contamination by t. gondii may also be related to higher risk of fetal disruption disorders . Likewise, if it is considered that the pregnancy cycle naturally confers immunosuppression on pregnant women, it would not, in our view, be unreasonable to consider that reactivation of latent toxoplasmosis might occur in some pregnant women . The world health organization and the centers for disease control and prevention recommend pyrimethamine, sulfadiazine, and folinic acid as the standard of care for people with congenital toxoplasmosis . These medications were proven to be effective in a randomized prospective study called the national collaborative chicago based congenital toxoplasmosis study (nccbts). This study found that treatment with the three aforementioned medications significantly decreased adverse signs and symptoms associated with congenital toxoplasmosis, including ocular and central nervous system symptoms and sensorineural hearing loss . For patients with sensitivity to sulfadiazine, when a diagnosis of acute maternal toxoplasmosis infection is made, spiramycin should immediately be administered to the mother, at a dose of 2 to 3 g per day . This medication does not go beyond the placental barrier, but it diminishes the risk of vertical transmission by up to 60% . Likewise, if pcr on the amniotic fluid is positive, institution of bacteriostatic therapy that crosses the placental barrier is essential, with the aim of diminishing the fetal malformations that result from acute toxoplasmosis . The following drugs can then be administered: sulfadiazine, at a dose of 3.0 g per day, and pyrimethamine, at a dose of 50 mg per day . However, these medications have high teratogenic potential, since they noticeably diminish fetal serum folate synthesis . It is known that insufficient concentration of serum folates noticeably diminishes synthesis of the enzyme tetrahydrofolate reductase . This enzyme acts within the cell medium to transform homocysteine, which is a cytotoxic and teratogenic agent, into methionine, which is an essential amino acid . High tissue concentration of homocysteine is therefore one of the causes of higher incidence of structural abnormalities in fetuses . For this reason, the administration of sulfadiazine and pyrimethamine should not be continuous and should be alternated with spiramycin administration every three weeks . In addition, a precursor of serum folate synthesis should be administered: folinic acid, at a dose of 10 to 20 mg, two to three times a week, while the patient is receiving sulfadiazina and pyrimethamine . Administration of these three drugs decreases the risk that the fetus might develop disruption abnormalities due to t. gondii infection, by 70% . This adverse effect may be avoided with the simultaneous administration of folic acid during treatment [29, 30]. Despite these preventative measures, weekly monitoring of cell counts and platelet counts should be done to assess the level of marrow suppression and adjust these medications as necessary . Recently, the society of obstetricians and gynecologists of canada proposed a clinical practice guideline to the toxoplasmosis in pregnancy . This guideline reinforces the conclusion that the combination of pyrimethamine, sulfadiazine, and folinic acid should be offered as treatment for women in whom fetal infection has been confirmed or is highly suspected, usually by a positive amniotic fluid pcr (level i - b of evidence). Women who are immunosuppressed or hiv - positive should be offered screening because of the risk of reactivation and toxoplasmosis encephalitis (level i - a of evidence). The necessity of the treatment of t. gondii in human immunodeficiency - virus infected pregnant women is proved by several case reports [3234]. In study realized in brazil that presents high incidence of toxoplasmosis in pregnancy, porto and duarte analyzed the correlation between toxoplasmosis in pregnant women and incidence of congenital toxoplasmosis . Among the pregnant women classified as confirmed cases of toxoplasmosis in pregnancy (n = 19), the congenital toxoplasmosis risk was six times greater than that in the probable / possible group . No case of congenital toxoplasmosis was identified in the group of pregnant women classified as unlikely to have toxoplasmosis in pregnancy . The children with no prenatal treatment (46.2% n = 242/524) presented a risk almost of congenital toxoplasmosis three times greater than the treated children (odds ratio or 2.77; 95% ci 1.544.97; p = 0.001). Complete prenatal treatment was identified as a protecting factor for congenital toxoplasmosis (or 0.35; 95% ci 0.190.65; p = 0.001). In study realized in germany with 685 pregnant women and 33 children with positive serological tests for t. gondii infection, the overall transmission rate of t. gondii from the infected mother to her child was 4.8% . The prenatal treatment with spiramycin until sixteenth week was followed by at least 4 weeks of combination therapy with pyrimethamine, sulfadiazine, and folinic acid independent of the infection stage of the fetus . These results are consistent with other studies in which only a small study population was included [37, 38]. Other alternative proposed treatment to toxoplasmosis in pregnancy is the spiramycin / cotrimoxazole association . This association was used in 76 pregnant women with positive serological tests for t. gondii . The treatment consisted of spiramycin 3,480 g 4 times a day, cotrimoxazole 960 mg (sulfamethoxazole 800 mg plus trhmetroprim 160 mg) twice a day, and folinic acid 4 mg / day . The intrauterine transmission rate was only 2.6% (two babies) and none of them showed signs or symptoms of congenital infection at birth or during followup . The treatment did not need to be stopped in any mother because of adverse drug effects . In a case report, tamaru et al . The ultrasound realized at 23 weeks of pregnancy evidenced fetal ascites, cardiac effusion, cardiomegaly, enlarged lateral ventricles, and thickened placenta . Sulfadoxine (500 mg / day) and pyrimethamine (25 mg / day) were administered from 25 to 27 weeks . Cyclic administration of azithromycin (500 mg / day for 3 days followed by an interval of no medication for 4 days) was subsequently started at 28 weeks and continued for 3 weeks followed by an interval of no medication for a week until delivery . Then cyclic administration of acetylspiramycin (1.2 g / day for 3 weeks followed by an interval of no medication for 2 weeks) was combined with azithromycin for 31 weeks . Fetal ascites, cardiomegaly, enlarged lateral ventricles, and thickened placenta persisted until delivery; cardiac effusion of the fetus completely disappeared at 29 weeks, which the authors considered to be the partial effect of administration of azithromycin started at 28 weeks . Figure 1 shows a diagram with the sequence of serological screening of toxoplasmosis during pregnancy and its treatment . From a critical analysis on the data presented, we can conclude that it is essential to have results available from the igg avidity test and from pcr on the amniotic fluid, so that treatment of pregnant women affected by t. gondii can be adequately managed . Without these test results, no conclusions regarding the presence or absence of vertical transmission of t. gondii to the fetus can be reached and doubts will remain regarding whether medications that cross the placental barrier, to treat the fetus, should be introduced . This uncertainty therefore could condemn a fetus that might have become contaminated across the placenta to develop a variety of congenital abnormalities, with serious postnatal repercussions for the family and for society as a whole, given that the ensuing costs to the public healthcare system are far from small.
|
The development of bleaching agents containing hydrogen peroxide or its precursor, carbamide peroxide, in varying concentrations, ranging from 10 to 38%, has made in - office bleaching effective . Although effective bleaching has been achieved in terms of esthetics, the deleterious effects of bleaching agents on the tooth surface have been an area of concern . Various scientific reports have demonstrated that changes occur in the surface texture, composition, and microhardness of the enamel, when teeth are bleached with hydrogen peroxide . Any attempt to achieve high efficiency dental bleaching with less or no deleterious effects on enamel is a welcome change in dentistry . One such attempt is the addition of vegetative enzymes to the bleaching agent that may promote and accelerate the dissociation of the latter . The present study aims at providing a tooth bleaching formulation containing vegetative enzyme extract obtained from plant tubers . Sweet potato (ipomoea batatas l) is one such plant tuber, which has a high content of enzymes such as polyphenol peroxidase (po), catalase (cat), and superoxide dismutase (sod). Hence, the aim of this in vitro study is to evaluate the color change in teeth bleached with two different concentrations of hydrogen peroxide, using sweet potato extract as an additive, with the help of a spectrophotometer, and furthermore, to evaluate the surface changes in the enamel post bleaching, using a scanning electron microscope (sem). Two hundred grams of sweet potato, with purple color flesh, were cleaned, peeled, and cut into cubes . The cubes were smashed to a concentrate with 25 ml of deionized water in a blender and the concentrate was filtered out . One hundred milliliters of the filtered sweet potato concentrate was centrifuged at 2000 rpm for two minutes at a temperature of 4c . Twenty - four maxillary central incisor teeth, extracted due to periodontal disease, and free of visible cracks, caries, defects, or decalcification were collected for the study . The teeth were cleaned of calculus and the remaining soft tissue using an ultrasonic scaler (satelec / acteon suprasson newtron ultrasonic scaler, new jersey, usa). The teeth were stored in 0.2% thymol and refrigerated under 4c until use . A tea bag (2 g) (ranfer tea, colombo, sri lanka) was suspended in 100 ml of boiling deionized water for five minutes, and the solution was cooled to room temperature . After 24 hours, the teeth were washed and stored under 100% humidity at 37c, until use . The baseline color values of the specimens were measured over a white background using a reflectance spectrophotometer (x - rite gretag macbeth, berlin, germany), which recorded the color variables l, a, b according to the cielfab color system . The teeth were randomly divided into two groups of 12 teeth each, based on the concentration of hydrogen peroxide, as follows: group i (n = 12) - 35% (h2o2) group ii (n = 12) - 10% (h2o2) the roots of all the teeth were sectioned at the cementoenamel junction using a rotating diamond disk under water cooling . Then the crowns were sectioned labio - palatally to obtain equal mesial and distal halves . Each half was mounted on a self - curing acrylic resin block, leaving the labial surface exposed . One - half of the tooth was bleached with hydrogen peroxide alone (subgroup a) and the other half of the same tooth was bleached with a combination of hydrogen peroxide and sweet potato extract (subgroup b), as follows: group ia: (n = 12) 35% hydrogen peroxide solution . Group ib: (n = 12) 1 ml of sweet potato extract was blended with 28 ml of (100 mm) phosphate buffered saline (pbs) and 1 ml of 35% (1 m) hydrogen peroxide to prepare a solution of 30 ml . Group iib: (n = 12) 1 ml of sweet potato extract was blended with 28 ml of pbs (100 mm) and 1 ml of 10% hydrogen peroxide (1 m) to prepare a solution of 30 ml . The specimens in each subgroup were covered with a piece of gauze, saturated with 3 ml of the experimental solution, for a period of 30 minutes, with the bleaching agent being changed every 10 minutes . This bleaching procedure was repeated twice, with a one - week interval, during which time the specimens were stored in artificial saliva at 37c . After carrying out the bleaching protocols, the teeth were rinsed and stored in artificial saliva at 37c for 24 hours . The color of the bleached specimens were then measured over a white background employing a spectrophotometer, which recorded the color variables l, a, b according to the cielab color system . The color change (e) was calculated from the l, a, and b values employing the following formula: e = [(l) + (a) + (b)] the color change before and after bleaching was taken as an index to evaluate the whiteness after bleaching . Data pertaining to color change was analyzed using the student's t test at a 5% significance level . To evaluate the effect of bleaching solutions on the surface morphology of enamel, all the samples were subjected to scanning electron microscopic analysis (sem jeol model, jse-5610 lv). The specimens were vacuum desiccated first in alcohol and subsequently in acetone, followed by sputter - coating with gold . The entire exposed labial surface was scanned and the most critical areas were selected for sem photomicrographs . Two hundred grams of sweet potato, with purple color flesh, were cleaned, peeled, and cut into cubes . The cubes were smashed to a concentrate with 25 ml of deionized water in a blender and the concentrate was filtered out . One hundred milliliters of the filtered sweet potato concentrate was centrifuged at 2000 rpm for two minutes at a temperature of 4c . Twenty - four maxillary central incisor teeth, extracted due to periodontal disease, and free of visible cracks, caries, defects, or decalcification were collected for the study . The teeth were cleaned of calculus and the remaining soft tissue using an ultrasonic scaler (satelec / acteon suprasson newtron ultrasonic scaler, new jersey, usa). Artificial staining of the teeth as established by suleiman m et al ., was followed in this study . A tea bag (2 g) (ranfer tea, colombo, sri lanka) was suspended in 100 ml of boiling deionized water for five minutes, and the solution was cooled to room temperature . The teeth were then immersed in tea solution for 24 hours . After 24 hours, the teeth were washed and stored under 100% humidity at 37c, until use . The baseline color values of the specimens were measured over a white background using a reflectance spectrophotometer (x - rite gretag macbeth, berlin, germany), which recorded the color variables l, a, b according to the cielfab color system . The teeth were randomly divided into two groups of 12 teeth each, based on the concentration of hydrogen peroxide, as follows: group i (n = 12) - 35% (h2o2) group ii (n = 12) - 10% (h2o2) the roots of all the teeth were sectioned at the cementoenamel junction using a rotating diamond disk under water cooling . Then the crowns were sectioned labio - palatally to obtain equal mesial and distal halves . Each half was mounted on a self - curing acrylic resin block, leaving the labial surface exposed . One - half of the tooth was bleached with hydrogen peroxide alone (subgroup a) and the other half of the same tooth was bleached with a combination of hydrogen peroxide and sweet potato extract (subgroup b), as follows: group ia: (n = 12) 35% hydrogen peroxide solution . Group ib: (n = 12) 1 ml of sweet potato extract was blended with 28 ml of (100 mm) phosphate buffered saline (pbs) and 1 ml of 35% (1 m) hydrogen peroxide to prepare a solution of 30 ml . Group iib: (n = 12) 1 ml of sweet potato extract was blended with 28 ml of pbs (100 mm) and 1 ml of 10% hydrogen peroxide (1 m) to prepare a solution of 30 ml . The specimens in each subgroup were covered with a piece of gauze, saturated with 3 ml of the experimental solution, for a period of 30 minutes, with the bleaching agent being changed every 10 minutes . This bleaching procedure was repeated twice, with a one - week interval, during which time the specimens were stored in artificial saliva at 37c . After carrying out the bleaching protocols, the color of the bleached specimens were then measured over a white background employing a spectrophotometer, which recorded the color variables l, a, b according to the cielab color system . The color change (e) was calculated from the l, a, and b values employing the following formula: e = [(l) + (a) + (b)] the color change before and after bleaching was taken as an index to evaluate the whiteness after bleaching . Data pertaining to color change was analyzed using the student's t test at a 5% significance level . To evaluate the effect of bleaching solutions on the surface morphology of enamel, all the samples were subjected to scanning electron microscopic analysis (sem jeol model, jse-5610 lv). The specimens were vacuum desiccated first in alcohol and subsequently in acetone, followed by sputter - coating with gold . The entire exposed labial surface was scanned and the most critical areas were selected for sem photomicrographs . There was no significant difference between the mean e values of group ia (35% h2o2 - 65.24 1.02) and group iia (10% h2o2 - 64.19 1.88) (p> 0.05). The mean e values of group ib (35% h2o2 + sweet potato extract - 72.52 2.03) and group iib (10% h2o2 + sweet potato extract - 71.50 1.81) were significantly higher compared to their respective baseline values (p <0.001). The mean e values of groups ib and iib were significantly higher than those of groups ia (35% h2o2 - 65.24 1.02) and iia (10% h2o2 - 64.19 1.88), respectively, (p <0.05). There was no statistically significant difference between the mean e values of groups ib and group iib (p> 0.05). Mean e values and standard deviation of the study groups the sem micrographs of group ia [figure 1a] and group iia [figure 1c] showed a roughened enamel surface, with loss of aprismatic enamel . The sem micrographs of group ib [figure 1b] and group iib [figure 1d] showed a lesser number of morphological surface irregularities, with an absence of cracks and craters . Loss of the aprismatic layer, presence of crater and surface irregularities, (b) sem micrograph of group ib (35% h2o2 + sweet potato extract). Lesser number of surface irregularities, with absence of craters and cracks, (c) sem micrograph of group iia (10% h2o2). Loss of aprismatic layer, surface irregularities, cracks and depressions, (d) sem micrograph of group iib (10% h2o2 + sweet potato extract). Treatment of discoloration varies from bleaching to even a full coverage restoration, depending on the severity of the stains, with bleaching serving as a more conservative, cost - effective and time - saving procedure . The theory of bleaching involves the release of free radicals from the dissociation of the bleaching agent, which attacks the organic molecules (stains) in the teeth to achieve stability . This is followed by a further release of free radicals, which in turn react with the unsaturated bonds of the stains, disrupting the electron conjugation and providing a change in the absorption energy of the organic molecules in the enamel . These disrupted molecules reflect less light, thus making the tooth appear lighter in shade . Hydrogen peroxide readily decomposes when it encounters substances with which it can react and results in the release of free radicals . If the bleaching procedure is continued beyond the saturation point, in the course of decomposition, hydrogen peroxide also interacts with the organic components of the tooth, such as proteins and lipids, resulting in their removal . Hydrogen peroxide also dissolves the inorganic components of enamel by penetrating the intra- and interprismatic regions . An increased exposure to hydrogen peroxide leads to an increase in its penetration into the enamel . Hence, this in vitro study aims at achieving high efficiency dental bleaching, with less or no deleterious effects on the enamel surface . Sweet potato contains a plurality of antioxidant molecules, which are either enzymatic or non - enzymatic in nature such as catalase (cat), superoxide dismutase (sod), carotenoids, phenolic compounds, and ascorbic acid . Several studies in the field of food chemistry have indicated that these phytochemicals have a high free - radical scavenging activity . In the present study, the cie lab values were used to assess the color change of the bleached enamel . In 1976, cie recommended the cie lab color scale for use . This scale defined the color more closely to human perception, and thus, provided a standard scale for comparison of color values . A spectrophotometer was selected for the study over a calorimeter, as the latter was designed to measure the color of flat surfaces of objects rather than tooth surfaces, which were not usually flat . Also the inter - instrument repeatability with a calorimeter was comparatively poor when compared with intra - instrument repeatability . (1998) and tung et al ., (2002) inferred that the colors assessed by the colorimeter and the shade guides were inconsistent . On the other hand, the spectrophotometer not only demonstrated high accuracy and reproducibility similar to the colorimeter, it even performed better than the shade guide assessment . The results of this in vitro study indicated that there was no significant difference in the mean e values of group ia and group iia . Leonard et al ., in 1998, and matis et al ., in 2000, showed that lower concentrations of carbamide peroxide achieved the same result in whitening teeth, as compared to the higher concentrations, when shade assessment was done after a period of two to six weeks . The addition of sweet potato extract to both 35% (group ib) and 10% (group iib) of hydrogen peroxide yields significantly higher mean e values, when compared to groups ia and iia, in which no sweet potato extract is added . This can be attributed to the enzymatic action of the catalase present in sweet potato, which, when added to hydrogen peroxide, reduces its high activation energy and increases the rate of release of the free radicals . Activation energy is critical to any intended chemical reaction . In order to initiate the reaction, this minimum energy barrier has to be overcome by the reactant molecules, so that the reaction can be activated, whereby, subsequent reaction products can be produced . Certain enzymes, when added to the reactant molecules, can reduce the needed level of activation energy and increase the efficiency or rate of the chemical reaction . When catalase is added to hydrogen peroxide in specific concentrations, the enzyme catalase combines temporarily with the hydrogen peroxide molecule forming a catalase - hydrogen peroxide complex . This combination places added stress on the intermolecular bonds holding the substrate molecules together, thereby lowering the activation energy (21 kj / mol) needed to initiate the chemical reaction . Owing to this, large quantities of free radicals of hydrogen peroxide are released within a shorter period of time . This in turn reduces the time the bleaching agent is in contact with the tooth, and thus, lessens the possibility of creating grooves or micropores across the surface of the bleached enamel . The effectiveness of bleaching is directly related to exposure time and concentration of the active ingredient . With an increase in the exposure time and concentration, the oxidative process becomes stronger, and hence, the resultant complications become greater the most common being weakening of the enamel . The sem micrographs of group ib [figure 1b] and group iib [figure 1d] show lesser number of surface irregularities, with absence of cracks and craters, when compared to group ia [figure 1a] and group iia [figure 1c]. The lesser enamel surface changes in groups ib and iib may be attributed to the presence of enzymatic and non - enzymatic antioxidants in sweet potato, which exert a scavenging action on free radicals, thus limiting their deleterious effects on the enamel . Achieving a smooth enamel surface post bleaching reduces the possibility of stain or pigment deposition within a certain period of time, after bleaching, and the addition of sweet potato extract to hydrogen peroxide enables one to achieve the same . Under the limitations of this in vitro study, it can be concluded that the use of hydrogen peroxide (both 35 and 10%) containing sweet potato extract, as a bleaching agent, not only results in the restoration of natural tooth color, but also decreases the effects of bleaching on the enamel morphology, compared to the use of hydrogen peroxide alone.
|
Joint - preserving procedures for the treatment of osteonecrosis of the femoral head in young patients include core decompression, vascularized bone grafting, and proximal femoral osteotomy . Since 1995, we have performed rotational acetabular osteotomy (rao) for 90 hips with osteonecrosis associated with collapse of the femoral head in young patients . The rationale behind the use of this procedure to treat osteonecrosis of the femoral head is that it shifts the weight - bearing region to articular cartilage that is still supported by the intact lateral cortex of the femoral head . We observed interesting mri changes in a 39-year - old man with osteonecrosis of the femoral head at six months after rao, which are reported here . He complained of severe right hip pain during rest as well as on walking for one year before his first visit . An anterior radiograph showed minor discontinuity of the bone trabeculae in the medial one - third of the weight - bearing region of the femoral head and slight collapse of the femoral head (fig . 1). This osteonecrosis was graded as stage iii - a according to the method of steinberg et al . . Mri displayed typical features of osteonecrosis of the femoral head in the same region (fig . 2). Three - dimensional ct also showed collapse of the femoral head (fig . 3). He underwent rao of the right hip in june 2007 using the technique of ninomiya and tagawa . Use of a wheel was allowed from one week postoperatively, and non - weight - bearing walking on two crutches was commenced after the second postoperative week . Partial weight - bearing was permitted at two months after surgery, and full weight - bearing was allowed at four months.fig . 1a anteroposterior radiograph shows faint bone trabeculae in the medial one - third of the weight - bearing region of the femoral head . B lateral radiograph shows a small depression in the center of the femoral headfig . 2a t2-weighted mr image shows a small band - like area in the midsagittal slice . 33dct shows mild collapse of the femoral head a anteroposterior radiograph shows faint bone trabeculae in the medial one - third of the weight - bearing region of the femoral head . B lateral radiograph shows a small depression in the center of the femoral head a t2-weighted mr image shows a small band - like area in the midsagittal slice . B fat suppression image shows a high intensity in the same region 3dct shows mild collapse of the femoral head at follow - up, the patient had no pain and could walk without crutches . An anterior radiograph showed improvement of the bony trabeculae and complete resolution of osteonecrosis was revealed by mri at six months (figs . 4, 5). 4a remodeling of bone trabeculae in the osteoncrotic region is revealed by an anteroposterior radiograph at six months after surgery . B the fat suppression image also shows almost normal findings a remodeling of bone trabeculae in the osteoncrotic region is revealed by an anteroposterior radiograph at six months after surgery . B lateral radiograph also shows remodeling of trabeculae a the t2-weighted mr image is almost normal . The natural history of osteonecrosis of the femoral head is generally thought to be one of progressive deterioration if no intervention is undertaken . However, it is unknown whether surgical intervention is beneficial for patients with a small region of osteonecrosis . The earliest mri finding is a low signal intensity line on t2-weighted images that represents the interface between normal and ischemic bone, and is also called a band . There is controversy about whether or not the presence of asymptomatic disease is an indication for a joint - preserving procedure . Joint - preserving surgical intervention is generally more successful at an earlier stage of the disease than after the occurrence of subchondral fracture [4, 5]. On the other hand, cheng et al . Reported three hips with evidence of spontaneous resolution on serial magnetic resonance images and stated that prolonged observation over several years is necessary in order to detect evidence of resolution with asymptomatic disease . Reported that in some patients with smaller avn lesions, symptoms do not develop and the abnormalities seen on mri occasionally improve spontaneously . Mulliken et al . Performed a prospective study with mri and found that 15 hips of 132 renal transplant recipients developed osteonecrosis, with 11 of these 15 hips being initially asymptomatic and only one lesion showing progression during an average follow - up period of 22 months . Described that 13 out of 16 hips with osteonecrosis similar to our case in size, location of necrotic lesion and stage did not progress to collapse at an average follow - up of over five years radiographically . On the other hand, hernigou et al . Reported that all of 45 symptomatic hips which were graded as stage - ii or stage - iii osteonecrosis according to the steinberg classification with sickle - cell disease progressed to stage iv without surgical intervention . There have been few reports about the resolution of symptomatic osteonecrosis on mri . In our patients, resolution of osteonecrosis was complete at six months after rao on radiographs and mri, possibly because redistribution of weight - bearing force led to accelerated remodeling of the necrotic region . Though we have performed rao for the treatment of osteonecrosis of the femoral head with collapse in 90 hips, we have not found early resolution of the mri changes like that recognized in this case . Reported the effectiveness of posterior rotational osteotomy for nontraumatic osteonecrosis with extensive collapse in young patients, but they did not mention the changes in mri findings after surgery . Chan et al . Reported two cases in which a small region of ostenecrosis decreased in size on mri at one year after core decompression and bone grafting . There is a correlation between the outcome and the extent of osteonecrosis, whether the hip is treated conservatively or subjected to an operative procedure . We believe that achieving adequate acetabular coverage of the viable lateral portion of the femoral head by rao was the most important factor leading to resolution of necrosis in this case . In summary, early surgical intervention such as rao that alters the mechanical force acting on the necrotic region of the femoral head may accelerate the recovery from osteonecrosis and the improvement of symptoms.
|
Plica neuropathica is an acquired, rare condition characterized by sudden and irreversible matting of scalp hair in otherwise healthy individuals . It was formerly supposed to be a disease peculiar to poles (hence named as plica polonica) and was usually the result of neglect or parasitic infestations . Subsequently, other factors such as shampoos, conditioners, herbal soaps, and psychiatric morbidity were also reported to result in matting of scalp hair . A dermatology consult was sought for a 65-year - old female who developed severe matting of scalp hair for 1 week . She was admitted under medical services for the management of azathioprine (50 mg once daily for a month) induced pancytopenia, which was prescribed for pulmonary sarcoidosis . She gave a history of loss of hair from frontal area of scalp, that came out in bunches, followed by spontaneous tangling of hair over the top of her head to form a stiff protuberant mass [figure 1]. She had no features of scabies or lice and shampooed her hair once a week with a non medicated shampoo . There was no history of use of any chemical treatment for her hair such as streaking or straightening of hair . Examination of scalp revealed diffuse non scarring loss of hair over the frontal area and a mass of solid irregular matted hair located over the vertex, approximately 10 cm in height [figure 1]. Investigations revealed total leucocyte count of 0.9 10/l (reference range 4.011.0 10/l), hemoglobin of 7.4 g% (reference range 1215.5 g%), and platelet count of 0.49 10/l (reference range 1.54.5 10/l). Examination revealed noncicatricial hair loss over the frontal region and elongated stiff protuberant mass of matted hair on the vertex which could not be detangled . The matting of hair in case 1 . Also diffuse hair loss form the scalp can be appreciated a 30-year - old female was referred for the sudden loss of hair and severe tangling of hair that could not be combed for 3 days . Her medical history was significant for the development of hydatidiform mole followed by methotrexate induced pancytopenia, severe stomatitis, and erythema multiforme over hands, feet, and upper trunk [figure 2a]. She was on methotrexate 25 mg once a day for 5 days, two cycles given over a period of 1 month . During her hospital stay, she found difficulty in combing her hair that became extensively tangled . Over next few days, she tried to comb her hair without success and found that her hair had been irreversibly matted and also the loss of hair over frontal area of scalp [figure 2b]. There was no history of skin or hair disease in past, and she regularly shampooed her hair once or twice a week . Pertinent investigations revealed total leucocyte count of 1 10/l (reference range 4.011.0 10/l), hemoglobin of 8 g% (reference range 1215.5 g%), platelet count of 0.55 10/l (reference range 1.54.5 10/l) and peripheral blood film predominantly normocytic normochromic . On examination, she had extensive noncicatricial alopecia involving the middle two - third of the scalp . She was managed conservatively for pancytopenia and scalp hair were shaved off as a part of treatment for plica . A dermatology consult was sought for a 65-year - old female who developed severe matting of scalp hair for 1 week . She was admitted under medical services for the management of azathioprine (50 mg once daily for a month) induced pancytopenia, which was prescribed for pulmonary sarcoidosis . She gave a history of loss of hair from frontal area of scalp, that came out in bunches, followed by spontaneous tangling of hair over the top of her head to form a stiff protuberant mass [figure 1]. She had no features of scabies or lice and shampooed her hair once a week with a non medicated shampoo . There was no history of use of any chemical treatment for her hair such as streaking or straightening of hair . Examination of scalp revealed diffuse non scarring loss of hair over the frontal area and a mass of solid irregular matted hair located over the vertex, approximately 10 cm in height [figure 1]. Investigations revealed total leucocyte count of 0.9 10/l (reference range 4.011.0 10/l), hemoglobin of 7.4 g% (reference range 1215.5 g%), and platelet count of 0.49 10/l (reference range 1.54.5 10/l). Examination revealed noncicatricial hair loss over the frontal region and elongated stiff protuberant mass of matted hair on the vertex which could not be detangled . The matting of hair in case 1 . Also diffuse hair loss form the scalp can be appreciated a 30-year - old female was referred for the sudden loss of hair and severe tangling of hair that could not be combed for 3 days . Her medical history was significant for the development of hydatidiform mole followed by methotrexate induced pancytopenia, severe stomatitis, and erythema multiforme over hands, feet, and upper trunk [figure 2a]. She was on methotrexate 25 mg once a day for 5 days, two cycles given over a period of 1 month . During her hospital stay, she found difficulty in combing her hair that became extensively tangled . Over next few days, she tried to comb her hair without success and found that her hair had been irreversibly matted and also the loss of hair over frontal area of scalp [figure 2b]. There was no history of skin or hair disease in past, and she regularly shampooed her hair once or twice a week . Pertinent investigations revealed total leucocyte count of 1 10/l (reference range 4.011.0 10/l), hemoglobin of 8 g% (reference range 1215.5 g%), platelet count of 0.55 10/l (reference range 1.54.5 10/l) and peripheral blood film predominantly normocytic normochromic . On examination, she had extensive noncicatricial alopecia involving the middle two - third of the scalp . She was managed conservatively for pancytopenia and scalp hair were shaved off as a part of treatment for plica . In 1884, when le page first described a case of acute matting of scalp hair, he referred to it as plica neuropathica as he believed it stemmed from hysterical tendencies . It was prevalent in poland in the 19 century, hence was named plica polonica or polish plait . It presents as a compact mass of scalp hair with irregular twists and irreversibly entangled plaits which are firm to hard impenetrable mass of keratin cemented together with dirt and exudates . The process of matting is essentially similar to the phenomenon of felting which occurs in wool and textile industries in which there is compacting of contiguous fibers exposed to surface damage and friction . It occurs when fibers are stirred together in a liquid medium and are subsequently exposed to increased functional forces . If the hair is rubbed along its shaft, it gets electrically charged with positive polarity if the friction is toward the root and negative if friction is toward the free end . Probably matting of hair does not occur either from electrostatic attractions or from liquid crystal formation but from the combination of the two . The exact mechanism for matting is not well - understood but both physical and chemical factors that damage hair shafts may play a role [figure 3]. Plausible mechanisms of pathogenesis of plica neuropathica various etiologies have been propounded from time to time . A thorough review of the available literature has led to a plethora of causes [table 1]. The various etiological factors of plica neuropathica temporary hair loss (alopecia) is a common side effect of chemotherapy . Hair follicles (hf) are hair shaft - producing miniorgans showing during postnatal life a unique pattern of cyclic activity with periods of active growth (anagen), relative resting (telogen), and apoptosis driven involution (catagen). Hf's are strongly affected by many chemotherapeutic agents because of the rapid proliferative rate of hair matrix keratinocytes during anagen . Immunosuppressive drugs commonly lead to anagen effluvium due to abrupt cessation of mitotic activity in the rapidly dividing hair matrix cells so that either no hair is produced, or a narrowed and defective hair shaft is produced and the hair loss is evident within days to weeks of drug administration . However, azathioprine is not normally known to be a cause of anagen effluvium and it is possible that the sudden pancytopenia results in hair shaft damage leading to hair loss and hair shaft cuticular damage resulting in matting of hair . Plica neuropathica generally affects healthy persons but has been described in a 54 years and a 14-year - old chronically ill female with azathioprine - induced pancytopenia, without any history of neglect, parasitic infestation, and shampooing . On the other hand, methotrexate has not been reported to cause matting of hair though it can lead to hair fall . Antimitotic chemotherapeutic agents such as methotrexate induce arrest of the anagen phase and present a toxic insult to the rapidly dividing hair matrix . Hair loss usually begins 12 weeks after chemotherapy is started and is most noticeable by 12 months . These antimetabolite drugs induce dystrophic changes in the new follicles as well as in the already growing hf . They also lead to premature regression as a result of massive apoptosis in the entire proximal hair bulb leading to subsequent hair shedding . When functional forces are applied to the already damage cuticle of the long and old hair, proximity of shafts increases, and tangling occurs leading to plica . Furthermore the unfruitful efforts by the patient to comb the unruly hair lead to electrostatic attraction and increase the chances of matting of the long and old hair . The chemotherapy - induced hair loss and the effects on the growing hf, and the resultant cuticular damage is much more complex than previously appreciated and may require distinct molecular studies to further collaborate these theories . Both of our patients agreed to the manual removal of hair as a part of treatment . However, it can still be prevented from developing by adequate hair care and washing habits . Prevention measures that can be adopted are: regular cleaning of hair with mild cleansers or shampoosgentle oiling and combing to avoid entanglingregular hair trimmingavoid hair piling over vertex while washing and backcombingavoid rotatory rubbing of hairlong hair should be given a backwash or be washed in the sink . Regular cleaning of hair with mild cleansers or shampoos gentle oiling and combing to avoid entangling regular hair trimming avoid hair piling over vertex while washing and backcombing avoid rotatory rubbing of hair long hair should be given a backwash or be washed in the sink . Matting of hair in two patients on azathioprine and in a patient on chemotherapy (doxorubicin, cyclophosphamide and cisplatin after surgery for papillary cystadenoma ovary) following washing of hair with a soap containing acacia concinna, have been reported previously . The current report is probably only the third case of plica neuropathica associated with azathioprine - induced pancytopenia and first with methotrexate in literature and unusual in that it occurred not because of neglect and poor hair care or overzealous shampooing of hair but due to cuticular damage of hair shaft secondary to the immunosuppressive drug induced pancytopenia . We consider that matting of hair is not truly a hair disorder, rather a reaction resulting from the interplay of great motley of factors . Moreover, the role of myriad factors such as chronic illness, hospital stay, pancytopenia, and drug induced cuticular damage is still debatable.
|
A 63-year - old man with diabetes and end - stage kidney failure had been receiving maintenance hemodialysis in the outpatient clinic at odense university hospital in odense, denmark, since 1997 . A femoral femoral bridge graft was used for vascular access . In november 2013, he was admitted to the hospital because of a fever he experienced during dialysis and inflammation around his bridge graft . The organism was also cultured from the patient s bridge graft and from a sample of joint fluid from his right shoulder . A transesophageal echocardiography revealed mitral valve endocarditis . Despite relevant treatment with vancomycin and rifampin and surgical debridement of his shoulder joint on inquiry by the staff, the patient had reported no previous history of mrsa infection or colonization and no direct or household - related contact with pigs . Four months before patient 1 s illness, mrsa cc398 spa type t011 had been cultivated from an infected decubitus ulcer of another patient who was receiving hemodialysis in the same outpatient clinic as patient 1 . Subsequent mrsa screening revealed that patient 2 was a nasal and pharyngeal carrier . On inquiry by the staff, the patient reported no direct or household - related contact with pigs . A 74-year - old nursing home resident had hemiparesis and recurrent aspiration pneumonia after an apoplectic insult . In april 2014, he was admitted to the hospital with severe pneumonia . On admission blood cultures grew mrsa cc398 spa type t034, and the organism was found in a tracheal aspirate and from the area around a percutaneous gastrostoma tube . Despite relevant treatment with piperacillin / tazobactam, metronidazole, and vancomycin, the patient died from respiratory failure after 1 week . On inquiry by the staff, the patient and his attending daughter reported no direct or household - related contact with pigs . In july 2010, mrsa cc398 spa type t034 had been isolated from a bedsore of another patient living in the same nursing home as patient 3 . In november 2013, the organism was isolated once more from the patient, this time from an indwelling urine catheter . Patients 3 and 4 lived in the same wing of the nursing home and shared common facilities . After hospital staff recognized the transmission chain, all residents in this wing and all attached staff were screened for mrsa, but none tested positive . The mrsa cc398 isolates identified in the 2 transmission chains were spa types t011 and t034, which are common among livestock - associated mrsa strains (12). Draft whole - genome sequencing was performed on 7 isolates from the 4 patients in the 2 transmission chains, and results were compared with similar data for cc398-related mrsa and methicillin - sensitive s. aureus isolates from denmark obtained during a previous study of the global dissemination of isolates belonging to this clonal complex (13). Sequence files for the individual isolates from patients are available at the european nucleotide archive (http://www.ebi.ac.uk/ena; accession no . A phylogenetic tree was constructed from single - nucleotide polymorphism differences in genome sequences of isolates from the 4 patients and from the isolates obtained during the previous study by using the s0385 complete genome sequence (genbank accession no . Am990992.1) as reference (figure). This analysis showed that the patient isolates within each transmission chain were closely related but that no close relation between the 2 chains existed . In addition, the isolates from both chains clustered among isolates previously found to be animal associated (clade iia; 13). Consistent with an animal origin, all isolates carried the tet(m) and czrc determinants (similar to most mrsa strains from clade iia) and lacked the sa3 phage (typical of the human clade i) (13). Phylogeny of methicillin - resistant staphylococcus aureus (mrsa) clonal complex (cc) 398 isolates linked to fatal septicemia in a hospital patient and a nursing home resident in denmark . Draft whole - genome sequencing was performed on 7 isolates from the 4 patients identified in the 2 transmission chains, and results were compared with similar genomic data for cc398-related mrsa and methicillin - sensitive s. aureus isolates obtained in denmark during a previous study of isolates belonging to cc398 (13). Single - nucleotide polymorphism differences were identified, and a maximum - likelihood phylogeny was inferred from raw data by using the web tool csi phylogeny (https://cge.cbs.dtu.dk//services/csiphylogeny). The region of bp 12252135180 was excluded from analysis because it contains the spa region and disrupts the phylogenic signal (13). P, pig; h, human; met, methicillin susceptibility; r, resistant; s, susceptible . A 63-year - old man with diabetes and end - stage kidney failure had been receiving maintenance hemodialysis in the outpatient clinic at odense university hospital in odense, denmark, since 1997 . A femoral femoral bridge graft was used for vascular access . In november 2013, he was admitted to the hospital because of a fever he experienced during dialysis and inflammation around his bridge graft . The organism was also cultured from the patient s bridge graft and from a sample of joint fluid from his right shoulder . A transesophageal echocardiography revealed mitral valve endocarditis . Despite relevant treatment with vancomycin and rifampin and surgical debridement of his shoulder joint on inquiry by the staff, the patient had reported no previous history of mrsa infection or colonization and no direct or household - related contact with pigs . Four months before patient 1 s illness, mrsa cc398 spa type t011 had been cultivated from an infected decubitus ulcer of another patient who was receiving hemodialysis in the same outpatient clinic as patient 1 . Subsequent mrsa screening revealed that patient 2 was a nasal and pharyngeal carrier . On inquiry by the staff, the patient reported no direct or household - related contact with pigs . A 63-year - old man with diabetes and end - stage kidney failure had been receiving maintenance hemodialysis in the outpatient clinic at odense university hospital in odense, denmark, since 1997 . A femoral femoral bridge graft was used for vascular access . In november 2013, he was admitted to the hospital because of a fever he experienced during dialysis and inflammation around his bridge graft . The organism was also cultured from the patient s bridge graft and from a sample of joint fluid from his right shoulder . A transesophageal echocardiography revealed mitral valve endocarditis . Despite relevant treatment with vancomycin and rifampin and surgical debridement of his shoulder joint on inquiry by the staff, the patient had reported no previous history of mrsa infection or colonization and no direct or household - related contact with pigs . Four months before patient 1 s illness, mrsa cc398 spa type t011 had been cultivated from an infected decubitus ulcer of another patient who was receiving hemodialysis in the same outpatient clinic as patient 1 . Subsequent mrsa screening revealed that patient 2 was a nasal and pharyngeal carrier . On inquiry by the staff, the patient reported no direct or household - related contact with pigs . A 74-year - old nursing home resident had hemiparesis and recurrent aspiration pneumonia after an apoplectic insult . In april 2014, he was admitted to the hospital with severe pneumonia . On admission, he had sepsis . Blood cultures grew mrsa cc398 spa type t034, and the organism was found in a tracheal aspirate and from the area around a percutaneous gastrostoma tube . Despite relevant treatment with piperacillin / tazobactam, metronidazole, and vancomycin, the patient died from respiratory failure after 1 week . On inquiry by the staff, the patient and his attending daughter reported no direct or household - related contact with pigs . In july 2010, mrsa cc398 spa type t034 had been isolated from a bedsore of another patient living in the same nursing home as patient 3 . In november 2013, the organism was isolated once more from the patient, this time from an indwelling urine catheter . Patients 3 and 4 lived in the same wing of the nursing home and shared common facilities . After hospital staff recognized the transmission chain, all residents in this wing and all attached staff were screened for mrsa, but none tested positive . The mrsa cc398 isolates identified in the 2 transmission chains were spa types t011 and t034, which are common among livestock - associated mrsa strains (12). Draft whole - genome sequencing was performed on 7 isolates from the 4 patients in the 2 transmission chains, and results were compared with similar data for cc398-related mrsa and methicillin - sensitive s. aureus isolates from denmark obtained during a previous study of the global dissemination of isolates belonging to this clonal complex (13). Sequence files for the individual isolates from patients are available at the european nucleotide archive (http://www.ebi.ac.uk/ena; accession no . A phylogenetic tree was constructed from single - nucleotide polymorphism differences in genome sequences of isolates from the 4 patients and from the isolates obtained during the previous study by using the s0385 complete genome sequence (genbank accession no . This analysis showed that the patient isolates within each transmission chain were closely related but that no close relation between the 2 chains existed . In addition, the isolates from both chains clustered among isolates previously found to be animal associated (clade iia; 13). Consistent with an animal origin, all isolates carried the tet(m) and czrc determinants (similar to most mrsa strains from clade iia) and lacked the sa3 phage (typical of the human clade i) (13). Phylogeny of methicillin - resistant staphylococcus aureus (mrsa) clonal complex (cc) 398 isolates linked to fatal septicemia in a hospital patient and a nursing home resident in denmark . Draft whole - genome sequencing was performed on 7 isolates from the 4 patients identified in the 2 transmission chains, and results were compared with similar genomic data for cc398-related mrsa and methicillin - sensitive s. aureus isolates obtained in denmark during a previous study of isolates belonging to cc398 (13). Single - nucleotide polymorphism differences were identified, and a maximum - likelihood phylogeny was inferred from raw data by using the web tool csi phylogeny (https://cge.cbs.dtu.dk//services/csiphylogeny). The region of bp 12252135180 was excluded from analysis because it contains the spa region and disrupts the phylogenic signal (13). P, pig; h, human; met, methicillin susceptibility; r, resistant; s, susceptible . A 74-year - old nursing home resident had hemiparesis and recurrent aspiration pneumonia after an apoplectic insult . In april 2014, he was admitted to the hospital with severe pneumonia . On admission, he had sepsis . Blood cultures grew mrsa cc398 spa type t034, and the organism was found in a tracheal aspirate and from the area around a percutaneous gastrostoma tube . Despite relevant treatment with piperacillin / tazobactam, metronidazole, and vancomycin, the patient died from respiratory failure after 1 week . On inquiry by the staff, the patient and his attending daughter reported no direct or household - related contact with pigs . In july 2010, mrsa cc398 spa type t034 had been isolated from a bedsore of another patient living in the same nursing home as patient 3 . In november 2013, the organism was isolated once more from the patient, this time from an indwelling urine catheter . Patients 3 and 4 lived in the same wing of the nursing home and shared common facilities . After hospital staff recognized the transmission chain, all residents in this wing and all attached staff were screened for mrsa, but none tested positive . The mrsa cc398 isolates identified in the 2 transmission chains were spa types t011 and t034, which are common among livestock - associated mrsa strains (12). Draft whole - genome sequencing was performed on 7 isolates from the 4 patients in the 2 transmission chains, and results were compared with similar data for cc398-related mrsa and methicillin - sensitive s. aureus isolates from denmark obtained during a previous study of the global dissemination of isolates belonging to this clonal complex (13). Sequence files for the individual isolates from patients are available at the european nucleotide archive (http://www.ebi.ac.uk/ena; accession no . A phylogenetic tree was constructed from single - nucleotide polymorphism differences in genome sequences of isolates from the 4 patients and from the isolates obtained during the previous study by using the s0385 complete genome sequence (genbank accession no . This analysis showed that the patient isolates within each transmission chain were closely related but that no close relation between the 2 chains existed . In addition, the isolates from both chains clustered among isolates previously found to be animal associated (clade iia; 13). Consistent with an animal origin, all isolates carried the tet(m) and czrc determinants (similar to most mrsa strains from clade iia) and lacked the sa3 phage (typical of the human clade i) (13). Phylogeny of methicillin - resistant staphylococcus aureus (mrsa) clonal complex (cc) 398 isolates linked to fatal septicemia in a hospital patient and a nursing home resident in denmark . Draft whole - genome sequencing was performed on 7 isolates from the 4 patients identified in the 2 transmission chains, and results were compared with similar genomic data for cc398-related mrsa and methicillin - sensitive s. aureus isolates obtained in denmark during a previous study of isolates belonging to cc398 (13). Single - nucleotide polymorphism differences were identified, and a maximum - likelihood phylogeny was inferred from raw data by using the web tool csi phylogeny (https://cge.cbs.dtu.dk//services/csiphylogeny). The region of bp 12252135180 was excluded from analysis because it contains the spa region and disrupts the phylogenic signal (13). P, pig; h, human; met, methicillin susceptibility; r, resistant; s, susceptible . We report 2 fatal mrsa cc398 infections after human - to - human transmission in institutional settings . Both patients had debilitating underlying diseases but were in a stable condition until the time of their infections . The sequence of events leaves no doubt that septicemia attributable to mrsa cc398 was the cause of death in both cases . The cc and spa types of the isolates causing fatal infections were typical for mrsa isolates from pigs . Phylogenetic analyses of whole - genome sequences indicated that the human isolates from the 2 transmission chains were located in different clusters that intermingled with isolates from pigs . The different spa types and the clustering of the mrsa isolates from the 2 chains clearly indicate 2 separate chains of infection . However, epidemiologic investigations and typing analyses strongly suggested that the 2 mrsa - infected patients could have acquired their infections from an asymptomatic carrier in the outpatient hemodialysis unit (transmission chain 1, patient 2) and the nursing home (transmission chain 2, patient 4). Transmission of mrsa cc398 in hospitals and institutions has been reported elsewhere, which underscores its potential to spread through person - to - person contact (911). In conclusion, the organism implicated in these 2 fatal cases was by all accounts spread from person to person . These findings suggest that this clonal complex can be of high pathogenicity and is readily transmissible among humans.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.