text
stringlengths 0
868k
|
|---|
Langerhans cell histiocytosis (lch) is a rare monoclonal disease, of which incidence rate is 4 to 5 per 1 million individuals, and mortality rate is about 3% in adults . Its clinical presentation is highly variable because it can affect multiple organs, such as lung, bone, skin, lymph nodes, hypothalamopituitary axis, and other multiple sites . However, due to the fact that involvement of the thyroid either as an isolated mass or as part of multisystemic disease is extremely rare, the diagnosis and therapeutic evaluation for such disease is still controversial . According to preliminary statistics, to the best of our knowledge, few studies had reported that the positron emission tomography / computed tomography (pet / ct) was used for diagnosis and therapeutic evaluation for lch involving thyroid in detail . The purpose of this article was to report a case and describe the use of pet / ct to make a diagnosis and therapeutic evaluation for lch involving thyroid . A 27-year - old man came to our hospital with painless thyroid nodules that had been present for more than 3 months . He had no symptoms, such as dysphagia, dyspnea, hoarseness, appetite changes, weight changes or palpitations, and no history of thyroid cancer . In the past thyroid ultrasound showed diffused hypoechogenicity and a 28 13 22 mm hypoechoic nodule on the right side of the thyroid and a 16 7 11 mm hypoechoic nodule on the left . Thyroid function tests were as follows: thyroid - stimulating hormone (tsh): 1.67 miu / l (0.354.94 miu / l); free triiodothyronine (ft3): 5.49 pmol / l (3.6710.43 pmol / l); and free thyroxine (ft4): 11.3 pmol / l (7.521.1 pmol / l). Additionally, calcitonin, parathyroid hormone, thyroglobulin, antithyroglobulin, and antimicrosomal antibodies were also within normal range . Fine - needle aspiration biopsy (fnab) showed atypical hyperplasia in thyroid nodule and considered the possibility of langerhans cells infiltration (figure 1a). With the consideration of the thyroid nodules with limitation of cytologic results and lch usually involving multiple systems, additional pet / ct was performed, and the result showed fluorodeoxyglucose (fdg) intense accumulation in the thyroid (suv = 7.2) and in the vertebral body of s12 (suv value = 10.7) (figure 2a, b). Therefore, according to his symptom and the result of pet / ct, we got a biopsy in the vertebral body of s12 and confirmed the lch by the positive immunohistochemical staining of cd1 and s100 (figure 1b d). Subsequently, the patient received a series of treatments containing chemotherapy (2 cycle vpe + mtx [vindesine 4 mg + etoposide 100 mg + methotrexate 1.0 g] + 1 cycle iae [ifosfamide 3 g + mesna 3.2 g + etoposide 100 mg + cytosine - arabinoside 200 mg] + 1 cycle minibeam [carmustine 125 mg + etoposide 50 mg + cytosine - arabinoside 150 mg + melphalan 50 mg] + 1 cycle beam [armustine 600 mg + etoposide 150 mg + cytosine - arabinoside 300 mg + melphalan 200 mg]) and autologus bone marrow stem cell transplantation . After about 8 months treatment, pet / ct was performed to evaluate the therapeutic effect, and showed that the suv in vertebral body of s12 (suv value = 4.3) reduced significantly compared with the previous pet / ct(2015.03) (figure 1e, f). A, fine - needle aspiration cytology of thyroid showed the possibility of langerhans cells infiltration (200). B, the pathologic findings of vertebral body of s1 - 2 showed langerhans cell proliferation (200). E, before treatment, the result of pet / ct (2012.03) showed intense accumulation in the vertebral body of s1 - 2 (suv value = 10.7). F, after treatment, the result of pet / ct (2012.11) showed slight accumulation in the vertebral body of s1 - 2 (suv value = 4.3). Pet / ct (2012.03) showed fdg intense accumulation in the (a, arrow) thyroid (suv value = 7.2) and (b, arrow) the vertebral body of s1 - 2 (suv value = 10.7). Fdg = fluorodeoxyglucose, pet / ct = positron emission tomography / computed tomography . The written informed consent for the case report was obtained from this patient, and the consent procedure was approved by the ethics committee of the first affiliated hospital of wenzhou medical university . Langerhans cell histiocytosis can be confirmed as one organ or a systemic disease, with lung, bone, and central nervous system being the most favored sites of involvement . The incidence of lch involving the thyroid gland either as an isolated lesion or as a part of multisystemic disease is extremely rare . Due to the first symptom of lch involving thyroid, which often shows painless thyroid nodules and the lack of other apparent presentations, the lch involving thyroid is very easy to be ignored . However, it can be confused with other far more common thyroid diseases and the misdiagnosis rate is not low . Considering the lch is a multisystemic disease and has a high misdiagnosis rate, the diagnosis of lch involving the thyroid or multisystem can be a medical puzzle . Although the diagnostic thyroidectomy was considered as an exact diagnostic method for lch involving thyroid, it had a lot of complications after thyroidectomy and had no benefit for multisystem lch . Several publications reported that pet / ct is a competent examination for thyroid nodules with inconclusive cytologic results . Giovanella et al had suggested that pet / ct can be performed for lch . In this case, pet / ct was performed to help make an accurate diagnosis of lch involving thyroid . Moreover, it plays an important role to find other potential lch lesions, which has a great guiding effect on the diagnosis of lch . Additionally, the fdg uptake is predictive to therapeutic response during the course of cancer treatment and a lot of studies recommended that the pet / ct is of great value in the therapeutic evaluation of cancer treatment . In our case, the result of pet / ct suggested that the multisystemic lch had a radiologic remission and a good clinical recovery during the subsequent follow - up period . In clinical settings, the diagnosis of lch involving the thyroid or other rare isolated lesions is a challenge, since it is difficult to get ideal biopsy specimens in thyroid nodules for the identification of lch . According to our clinical practice, some easily ignored lesions, such as bone area, suitable for biopsy and immunohistochemical detection, can be found by the imaging technology of pet / ct . During the treatment of lch, pet / ct can be performed to assess the therapeutic effect, the therapeutic response, and the surveillance firstly, the lch involving thyroid is extremely rare and the use of pet / ct for this is unusual . Therefore, there are not enough studies to make a literature review of the use of pet / ct in lch involving thyroid . Secondly, we only make a case report and sum up some experience of diagnosis and therapeutic evaluation for lch involving thyroid . More cases should be enrolled to summarize more reliable diagnostic and therapeutic experience . In conclusion, when the thyroid nodule fnab results showed the possibility of langerhans cells infiltration, the lch involving thyroid should be considered . The pet / ct should be kept in mind for lch involving thyroid, which provides evidence to select the most effective and reliable treatment, and contributes to the individualized treatment for lch.
|
It explains why the flowers of some orchids have extraordinarily long spurs to store their nectar, and why the moths that pollinate them have extraordinarily long tongues to drink it . It explains why we don't all succumb to diseases, and why diseases still exist . How coevolution actually works is far from clear, however, if one looks into it in any depth . How is the genetic variation that is the raw material of coevolution, or any other sort of evolution for that matter, maintained when faster or longer is always better? How can genetically homogeneous populations attacked by pathogens survive long enough to mount a coevolutionary response? The answers may lie in the fact that the world is not made up of single populations of organisms freely exchanging genes . Instead, populations are not the same everywhere, and interactions between organisms are not the same everywhere . As is clear from our own species' experience with its coevolving pathogens, things vary geographically . It was thinking about such questions over the past two decades that led john thompson to propose his geographic mosaic theory of coevolution . Although this theory has been widely discussed and has become a unifying framework for many coevolutionary studies, it is still often misunderstood . That there are differences between how organisms interact at different spots on earth is, in itself, a fairly trivial observation, but thompson's big idea is that without those differences, there would be no coevolution . The geographic mosaic drives coevolution, rather than being merely a consequence of the fragmentation of interacting populations . Pattern and process it is significant that thompson's book the coevolutionary process, which first brought his theory to most of the scientific community, emphasizes process rather than pattern . The processes underlying the geographic mosaic theory of coevolution are difficult to test experimentally, but a new study in bmc biology of pines and their mycorrhizal fungi, provides the first experimental support for one of the key processes . The geographic mosaic theory of coevolution puts forward three distinct processes that are conjectured to be the basis of coevolutionary change (figure 1): coevolutionary hot and cold spots, selection mosaics and trait - mixing . A) populations of interacting species are distributed in a spatial mosaic, with the strength of coevolutionary selection exerted by each partner on the other varying between populations . In cold spots (here represented by light - colored tiles), the traits of each species evolve independently, whereas in hot spots (dark tiles) coevolutionary selection is intense . (b) as well as varying in strength, the direction of selection varies spatially (there is a selection mosaic; represented here as different colored tiles), depending on the interactions between the genotypes of both interacting species and the local environment . (c) there is some mixing of genes due to the dispersal of individuals between populations (represented as the individual dots making up the shaded areas). The level of mixing must be sufficient to allow the occasional introduction of new genotypes into populations, but low enough that adaptations are not swamped by gene flow from populations experiencing different selection pressures or strengths . (d) the combination of all three elements leads to a system in which coevolution is a continuous dynamic process that, at the same time, retains ample genetic variation to allow long - term coevolution . Termed hot spots, coevolutionary selection is intense, whereas in cold spots, the interacting species evolve independently of each other . This can be for the simple reason that one of the interacting partners is absent in a cold spot, as is often the case with parasitic interactions in which not every host population is parasitized . Cold spots can also exist for other reasons, for example because alternative hosts are present that are preferred by a parasite . There is a continuum between cold and hot spots, with the strength of coevolutionary selection increasing as spots become progressively' hotter' . Selection mosaics are also important for the theory, but these have often been misunderstood . It is not enough that the strength of coevolutionary selection varies between populations, it is also necessary that the direction of that selection varies, so that the outcomes of coevolution are different in different populations, depending on their environment . In other words, the costs and benefits to both partners of any particular adaptation are dependent not only on the adaptations of their partner, but also on the environment in which the interaction occurs . This is perhaps most easily seen in what have been termed' conditional mutualisms', in which interactions can be mutualistic, commensal or parasitic depending on the ecological conditions in which the partners interact [15 - 17]. The variation does not, however, need to be so great as to lead to shifts between parasitism and mutualism, but outcomes are dependent on the interactions of the adaptations of both partners with the environment that they find themselves in . Hence, the selection mosaic is a result of gene gene environment (g g e) interactions . The different outcomes in different environments can be due either to abiotic factors or to biotic factors, such as the presence and density of a predator or competitor . Finally, in order for the coevolutionary process to work, there must be a mechanism that allows traits that have evolved in one population to be transferred to and mixed with traits that have evolved in other areas . In other words, there must be gene flow between populations to enable genes that are favorable to track the conditions in which they are favorable, and to allow the maintenance of genetic variation that would otherwise disappear . Gene flow must also be at the right level; too much mixing, and there will never be a response to selection because the best adapted genes are always swamped by the inflow of non - adaptive genes; too little mixing, however, will allow specific alleles to go to fixation so that, barring novel mutations, the coevolutionary process will grind to a halt . As well as the three processes involved in coevolutionary mosaics, there are several patterns that are expected to result from the process . For example, it is expected that there will be spatial variation in the traits that are involved with interspecific interactions; that in some areas, traits will be mismatched (local maladaptation); and finally that there will be few species - level traits that have become fixed as a result of coevolution . These patterns are often used as evidence for the presence of a geographic mosaic of coevolution, but they can also result from other, non - coevolutionary processes . In a key paper last year, richard gomulkiewicz and co - workers set out a rather daunting manifesto for how the geographic mosaic theory of coevolution should be tested and, specifically, how the presence of geographic mosaics of coevolution can be demonstrated . So far there are no studies that have fulfilled all the requirements that have been set forth for testing the theory . There have been several studies inferring hot and cold spots of coevolutionary selection, and others characterizing gene flow between populations involved in interspecific interactions, but most studies have been observational rather than experimental, so that process and pattern cannot be disentangled . The area of the theory to which this limitation applies most is the demonstration of selection mosaics, and as a result these have received little rigorous attention . Resolving this deficiency has been the focus of the paper in bmc biology, which is the first to examine explicitly the g g e interactions required for a selection mosaic to generate coevolutionary change . The study system chosen was the interaction between bishop pine (pinus muricata) and the ectomycorrhizal fungus rhizopogon occidentalis . Interactions between plants and mycorrhizae are strong candidates for model systems to test the geographic mosaic theory of coevolution, because there are several clear cases of conditional mutualism in which not only the magnitude but also the nature of interaction (mutualistic or antagonistic) varies between different ecological situations [32 - 34]. In a simple but elegant factorial experimental design, piculell et al . Tested the interaction between two different lineages of pine and two lineages of fungus in four environments, representing a factorial combination of two different abiotic environments (two different sterile soil types) and two different biotic environments (the presence or absence of potentially competing soil microorganisms). Measuring various fitness components of the pines and fungi showed that there were variable outcomes for the same combinations of pine and fungus lineages under different conditions (figure 2) and that for one of the pine families, this could indeed result in a mutualistic or parasitic interaction depending on the environment ., showing the measured fitness components of two maternal half - sib families of bishop pine plants (m18 and m19, measured as relative growth rate and root length) and two full - sib families of its mycorrhizal fungus (132 and 133, measured as the number of roots of the host that are inoculated) under four different environments . The performance of both partners in the interaction varies depending on both the lineage of partner they are interacting with and the environment . This is most clearly seen for fungal performance in field soil, where the number of host roots inoculated varies by an order of magnitude . One simple answer is that the need for such studies has only become apparent recently . Piculell and co - workers needed to successfully raise 128 combinations of pine and fungus, and this was still not quite sufficient to detect any statistically significant g g e effects (although the g g biotic environment effects on relative growth rate and shoot: root ratio were close; p = 0.066 and p = 0.059 respectively; see additional file 2 in). In other systems, in which changes in interaction strength and direction are likely to be more subtle, the experimental replication required for tests powerful enough to demonstrate selection mosaics is intimidating . So, although theoretical studies of the geographic mosaic theory of coevolution are multiplying, it is almost inevitable that empirical studies are lagging behind and tend to be concerned with confirming the predicted patterns rather than experimentally testing the process . Translating the outcomes of experimental studies such as that of piculell et al . Into real - world coevolutionary mosaics at the appropriate geographic scale remains a distant goal . In the meantime, large - scale studies of geographical patterns are still crucial for solidifying the foundations of the theory, and for parameterizing the next generation of theoretical models . I thank koos boomsma for valuable discussion and comments . Funding for the centre for social evolution
|
If medical radiation sciences is to evolve as an evidencebased profession, we must increase research productivity and publication in our field . The importance of research collaboration has been recognised and strongly supported by research organisations and policy makers alike1 and there has been a marked rise in international collaboration in numerous industries over the last three decades.2 international collaboration is recognised for enhancing the ability to approach complex problems from a variety of perspectives, increasing development of a wider range of research skills and techniques, and improving publication and acceptance rates.3 these benefits could be leveraged to increase research capacity in medical radiation science and support the further development of our professional knowledge base . The aim of this paper is to describe the current status of international collaboration in medical radiation science and compare this to other allied health occupations . Individuals may be identified as research collaborators if they: (1) work on the same project, (2) aid in the research proposal, and/or (3) make decisions regarding the plans for the research project.4 kimiloglu et al.3 studied the most crucial requirements for collaborative research . They determined that for collaboration to be effective, each researcher should be allocated clearly defined tasks, prior to conducting research (i.e. All members agreeing how responsibilities will be shared) and collaborators should willingly share their knowledge, experience and resources with all group members . As interest has grown over the years, collaboration with one or more institution(s) in other countries excluding all other national institutions. With the recent intensification of collaboration, specific groups and countries have been more engaged in the trend than others . Additionally, some fields are more international than others.6 the rate of international collaboration has grown significantly over the last 35 years . There are a variety of reasons countries and fields become involved with international collaborations, ranging from sharing expensive research equipment to using unique countryspecific data . Researchers in some countries may seek to improve a lagging research capacity in a field by cooperating with leading researchers in other countries . International collaboration may also allow researchers to partner with others with their own specialised focus who are not available in geographic proximity . Externally, increased financial support for international collaboration from nations and sponsors may have played a role in the increase, and the growth of internetbased communication systems has certainly facilitated effective international collaboration . Historical ties and geographic proximity seem to play a decreasing role in the promotion of international collaboration, but may arise more from geographic funding such as that provided by the european commission, than from a preference for colocation . Interactions may also be facilitated or discouraged by language, culture and political climate.5 while we know that international scientific collaboration is on the rise, little is known about international collaboration within the medical radiation sciences community or how it compares to other health professions . This study utilised a content analysis approach where coauthorship of a journal article was used as a proxy for research collaboration, and the papers were assigned to countries based on the corporate address given in the byline of the publication . This method of analysis is well established and accepted across studies of research activity.8 the content analysis focused on the major professional journals published in the countries represented within our research team australia, the united kingdom (uk) and the united states of america (usa). For medical radiation sciences, the three journals chosen for analysis were journal of medical radiation sciences the joint journal of australia and new zealand (aus / nz) (previously the radiographer), radiography from the uk and radiologic technology from the usa . A convenience sample method was employed and articles published in the three major medical radiation science journals over a 3year period from 2012 to 2014 were inspected manually for author and author affiliation . Allied health professions australia defines allied health professionals as a subset of healthcare professionals that do not include those of medicine, nursing or dentistry.9 physiotherapy, speech pathology and occupational therapy were chosen as comparisons for medical radiation science for international collaboration as all these occupations are included as allied health professionals . Nursing was also selected for comparison as this is a longer established health profession with a longer history of academic research . The journals chosen for comparison to the medical radiation science journals are detailed in table 1 . The content analysis on the frequency of international coauthorship was performed on all of these journals . Number of articles published (pub), number of articles with international collaboration (ic) and the percentage of articles with international collaboration (rate). Only articles where all authors did not share a country affiliation were counted as representing international collaboration in the study . Letters to the editor, corrigenda or errata, newsletters and conference papers were excluded to limit the study to only original published articles . In total, table 1 presents the breakdown of publications by professional field, publication country of origin, and publication year . To determine the rate of international collaboration, the number of articles having authors from two or more countries was divided by the total number of articles reviewed . While rates of publication vary by country and field, by examining the number of internationally collaborative articles as a percentage of the total articles published within that journal, we correct for variances introduced by fields and countries with differing publication rates and health occupation populations . The data was analysed using minitab 17 statistical software . Rates of international collaboration across the health professions have increased over the past 3 years . When all the professions were combined, the rates of international collaboration steadily rose over the 3year period from 7.2% to 10.3% (see fig . This figure demonstrates the overall change in international collaboration seen across the allied health occupations over the 3year period studied . Likewise, rates of international collaboration in medical radiation science journals from aus / nz, the uk and the usa have steadily increased over the 3year period sampled from 2012 to 2014 (see fig . 2). Overall, the journal published in the uk had the highest average rate of international collaboration (11.0%), the usa the lowest (5.1%) with aus / nz demonstrating an average of 8.5% . This figure illustrates the changes seen in international collaboration rate within the medical radiation sciences over the 3year period studied . The pooled standard deviations were used to calculate the intervals . Using oneway analysis of variance (anova) analysis, this analysis employed the null hypothesis that all means are equal and the alternative hypothesis that at least one mean is different . The mean international collaboration rate for nursing was significantly lower than that for speech pathology, occupational therapy and physiotherapy . Medical radiation science demonstrated lower average rates of international collaboration (7.9%) than the other allied health occupations sampled, but there was not a statistically significant difference in the means between medical radiation science and any of the other fields . Speech pathology had the highest average rate with 15.1%, followed by physiotherapy (12.5%) and occupational therapy (12.4%). The average rate of international collaboration in nursing of 2.7% was far below that of the allied health occupations sampled (see fig . This figure compares rates of international collaboration for the fields of nursing, occupational therapy (ot), physiotherapy (pt), medical radiation sciences (mrs), and speech language pathology (slp). The same trends as those seen in the medical radiation science journals by country of publication continued when all the professions were combined . While the differences in the means were not significantly different, those published in the uk had the highest average rate of international collaboration of 11.8%, followed by australia (9.8%), then the usa (8.0%) (see fig . 4). Boxplot of international collaboration rate for all allied health occupations by country of publication . This figure illustrates the differences and overlap between international collaboration rates by country of publication australia (aus), the united kingdom (uk) and the united states of america (usa). The increase in the rate of international collaboration in medical radiation science is to be expected as it mirrors the trends in numerous other branches of science over recent years.2, 10, 11 the increase is closely aligned with the increase of globalisation and improved it communication facilities so to see a decrease in international collaboration would defy the global trend . However, the medical radiation science community is lagging in developing international collaborations in comparison to other allied health fields . While the differences are not currently significant, we should act to remedy the situation before the gap widens . Analysis of strategies employed by other health professions can be instructive for improving international collaboration in medical radiation sciences . Initiatives developed within the european medical radiation sciences community may account for the increased rate of international collaboration growth in the uk in comparison to australia and the usa . The usa is the third largest country by area,12 the third most populated in the world13 and has over 50 jurisdictions.14 a country with the diversity of the usa would allow ample opportunity to collaborate on research projects without the need to seek coresearchers from overseas, which may contribute to the lower rates of international collaboration found in journals from that country . Historically, the usa is a very nationalistic country15, which may be another possible explanation for their lower rates of international collaboration . There are several possible explanations why the uk has a higher average rate of international collaboration . Time zone differences are a significant barrier to international collaboration16 and the uk's geographical location with its proximity to numerous other countries with comparable time zones lessens this burden . The european union has also developed programmes to promote international collaboration like the european institute of innovation and technology, the european higher education area and the erasmus mundus programme.17 the greatest increase in the rate of international collaboration in medical radiation science journals sampled was in the uk journal radiography from 2013 to 2014 increasing from 5.6% to 16.2%, the highest rate in the medical radiation science journals sampled, close to the rates of other allied health occupations . This increase coincided with the first offering of the annual optimisation of image quality and xradiation dose in medical imaging (optimax) residential summer school held at the university of salford in manchester, england.18 due to the increasing emphasis on collaboration and raising the profile of research in the medical radiation science profession,19, 20 the optimax summer school programme was initiated . The programme is open to bsc, msc and phd students from the disciplines of radiography, nuclear medicine, biomedical science and physics, and is funded by the erasmus mundus programme . The programme strives to develop teambased radiography research on an international level by enabling students to experience international collaboration firsthand and develop multinational / cultural partnerships early in their careers.18, 21 the universities and professional associations can play a large part in raising the profile of research in the medical radiation sciences throughout the world by promoting international collaboration within the profession . Universities can follow the lead taken by those who formed the optimax summer school programme, while medical radiation science professional associations can encourage collaboration with similar associations as has been done in physiotherapy22 and occupational therapy23, which may contribute to those professions' higher rate of international collaboration . This study focused on internationally collaborative articles, published in the most widely accepted professional journals in only three countries studied, as these are the most likely to impact practice in the allied health fields of those countries . This could have resulted in missing some significant collaborations with medical radiation science professionals published in less specific journals . However, it is the evidence informing professional practice that we most hoped to capture . This study focused on internationally collaborative articles, published in the most widely accepted professional journals in only three countries studied, as these are the most likely to impact practice in the allied health fields of those countries . This could have resulted in missing some significant collaborations with medical radiation science professionals published in less specific journals . However, it is the evidence informing professional practice that we most hoped to capture . Overall, medical radiation science is lagging in international collaboration in comparison to other allied health fields in their respective journals, although the mean international collaboration rate for the medical radiation sciences journal in the uk is quite competitive with physiotherapy and occupational therapy . The medical radiation science community needs to examine the strategies for encouraging international collaboration if goals of increasing research capacity in the profession and developing a more robust professional knowledge base are to be realised.
|
Maintenance of blood glucose levels as close as possible to the nondiabetic range over time is an important goal in the current management of patients with diabetes . Assessment of a patient's diabetes management can be accomplished by directly analyzing the pattern of multiple blood glucose samples drawn over time . However, a high degree of cooperation is required on the part of the patient to collect a sufficient number of blood glucose samples that adequately represent typical diurnal glucose patterns . Once collected, statistical analysis is then necessary to assess the central tendency and variability of glucose levels . As an alternative, a patient's hba1c level can be easily and conveniently determined from a single blood sample . A large number of studies have shown that hba1c is strongly associated with the preceding mean plasma glucose (mpg) over previous weeks and months [25]. Based on the statistical relation of hba1c and mpg, hba1c is widely used as a clinical estimation of mpg, and it has been proposed as a diagnostic criterion for diabetes, as well . Hba1c has, therefore, become a standard assessment of glycemia and a standard part of diabetes management . One of the most important limitations of hba1c is that it is not applicable in short intervals . Erythrocyte life span in normal conditions averages ~120 days, and the glycation of hemoglobin (hb) is a continuous, nonenzymatic, relatively slow and nearly irreversible process that means change in effects of previous glycation on hb takes several weeks to months to occur . To permit a much clearer assessing of diabetes management, it is generally recommended that the hba1c assay be used every 2 - 3 months . Ideally, if measured each 120 days (4 months) it gives a precise estimation of mpg over preceding 4 months, reliably comparable to previous hba1c value . If measurement is taken earlier than erythrocyte life span intervals (4 months), because of existing previously glycated hbs which have not reached end of their lives, the estimated mpg would be affected by previous plasma glucose levels . This would be an important issue, and if measured following a significant variations in plasma glucose during changes in patient's diabetes control or medication, then it would end to a remarkable error in estimation of mpg . I devised an innovative mathematical model to describe novel equations governing hba1c which enables analysis of hba1c behavior and provides emerging new concepts in assessment of diabetes management . Quarterly hba1c and corresponding seven - point capillary blood glucose profiles obtained in the dcct have been analyzed to define the relationship between hba1c and mpg . Hba1c is linearly related to mpg based on linear regression analysis weighted by the number of observations per subject (figure 1), producing a relationship of (1)mpg(mg / dl)=35.6hba1c77.3 . Or (2)hba1c=135.6mpg+2.17 . Mpg at increasing levels of hba1c is shown in table 1 based on dcct data correlating hba1c with mpg using 7-point blood glucose profiles along with adag data using continuous glucose monitoring systems [5, 9]. The kinetic analysis of hba1c formation depicted in figure 2 shows the linear relationship between hba1c formation rate and time, with the slope proportional to the mpg . The higher the blood glucose is, the faster hba1c will be formed, resulting in higher hba1c levels . For instance, it is elicited from the curve mpg = 137, that the hba1c rate in newly born rbcs is 0%, and in rbcs with 60 and 120 days old, 6 and 12%, respectively . It can be corroborated that the mean hba1c in a collection of erythrocytes with different ages and hba1c rates is the median point or arithmetic mean of the upper and lower limits of the curve . Erythrocyte life span in normal conditions is about 120 days and the level of hba1c at any point in time is contributed to by all circulating erythrocytes, from the oldest (120 days old) to the youngest . Since the rate of rbc formation is equal to its degradation, the percentage of rbc count in a single day is 1/120 of total rbc mass . Hence, 1/120 of rbc collection are one day old, 1/120 are two days old, and likewise 1/120 are 120 days old . The mean value of hba1c in a collection of rbcs with different ages can be calculated by averaging of hba1c rate in each rbc as follows: (3)mean hba1c=1120n(1/120)rbcmassrbcmass, where n is hba1c rate in rbcs with n days old and rbc mass is total number of rbcs in the body . Since glycation of hb according to figure 2 follows a linear pattern, it is expected that (4)2=21, 3=31,, 120=1201 . Hence, (5)hba1c=(1/120)rbcmass(1+120)(120/2)rbcmass=(1+120)2 . Accordingly, the mean value of hba1c in a collection of rbcs would be the arithmetic mean of upper and lower limits of the curve . The mathematical relationship between data leading to the curves depicted in figure 2 can be correlated by the following formula: (6)hba1c = mpg/35.6 + 2.172 m, where mpg contributes the mean plasma glucose in which hb glycation is progressing and m is the variation of time in month . We will now map this model into mathematical expressions and start with an example . Example 1assume that you have visited a diabetic patient with hba1c = 9% and mpg = 244 mg / dl and after adjusting the medications, patient's mpg has fallen to the curve mpg = 137 as visualized by graphic presentation in figure 3 . After one month you are interested in calculating the hba1c which is the mixture of previously and newly glycated hbs and is estimated to be in range of 6% to 9%.as described in figure 3, after passing one month of changes in mpg, the erythrocytes with 3 to 4 months old will reach the end of their lives and destroy themselves . This upper extreme can be calculated as (7)upper = mpg1/35.6 + 2.172(4m)=hb12(4m)=13.5% . As described before (by (5)) the mean value of hba1c in this group of rbcs is arithmetic mean of upper and lower extremes of the curve, that is (8)mean=upper2=mpg1/35.6 + 2.174(4m)=hb14(4m)=6.75% . Over the past one month, these previously glycated rbcs undergo new glycation on the curve mpg = 137 to convey the prior mean hba1c to a newly higher point . This displacement of mean hba1c point on the second curve over m months can be written as (9)mean = mpgx/35.6 + 2.172m = hbx2m=3% . The sum of contributions (8) and (9) represents the cumulative mean hba1c in this group of rbcs with former and later glycation on two different curves . (10)1=mpg1/35.6 + 2.174(4m)+mpgx/35.6 + 2.172m = hb14(4m)+hbx2m=9.75% . Furthermore, during the past one month, second group of rbcs have been newly formed and undergone glycation on the new curve (mpg = 137) with mean hba1c of (11)2=mpgx/35.6 + 2.174m = hbx4m=1.5% . Following all above steps, we can find the final desired hba1c by averaging equations 1 and 2 considering their coefficients according to available rbcs in each group (3: 1, three months versus one month). (12)hbmix=2m+1(4m)4,hbmix=((mpgx/35.6 + 2.17)/4)m24 + (mpg135.6 + 2.174(4m)+mpgx35.6 + 2.172m)4 (4m)4,hbmix=(hbx/4)m2+((hb1/4)(4m)+(hbx/2)m)4 (4m)4 . And rearranging gives (13)hbmix = mpgx(8mm2)+mpg1(m28m+16)+1236570 . Or (14)hbmix = hbx(8mm2)+hb1(m28m+16)16=7.6875% . Although this is the answer to our initial riddle, this value (hbmix) is a simply measurable variable by laboratory assays . In fact, our unknown desirable variable in this setting would be mpgx and hbx representative of the second curve in which glycation occurs over recent months . And this is the finding that was one of the most important limitations of hba1c, some minutes ago.access to the equations governing hba1c by this comprehensive analysis could have potentially valuable implications on diabetes control . No matter how frequently done, measurement of hba1c can lead to the desirable mean plasma glucose over previous m months and makes all doubts about time wasting over patient's observations, even . Finally, for practical aspects of this model in clinical setting, (15)mpgx=570hbmixmpg1(m28m+16)1236(8mm2). Or (16)hbx=16hbmixhb1(m28m+16)(8mm2), wherehb1: initially measured hba1c, hbmix: measured hba1c after m months, hbx: hba1c corresponding to the curve on which the patient has moved during previous m months, m: time interval between measured hb1 and hbmix in month.it is of note that, the final equation (16) is independent of presumed equations correlating hba1c with mpg such as dcct data ((1) and (2)) or other data such as nathan's et al . . The calculated hbx has a capability to be converted to the corresponding mpg using any of mentioned hba1c - mpg relationships (table 1). Assume that you have visited a diabetic patient with hba1c = 9% and mpg = 244 mg / dl and after adjusting the medications, patient's mpg has fallen to the curve mpg = 137 as visualized by graphic presentation in figure 3 . After one month you are interested in calculating the hba1c which is the mixture of previously and newly glycated hbs and is estimated to be in range of 6% to 9% . As described in figure 3, after passing one month of changes in mpg, the erythrocytes with 3 to 4 months old will reach the end of their lives and destroy themselves . This upper extreme can be calculated as (7)upper = mpg1/35.6 + 2.172(4m)=hb12(4m)=13.5% . As described before (by (5)) the mean value of hba1c in this group of rbcs is arithmetic mean of upper and lower extremes of the curve, that is (8)mean=upper2=mpg1/35.6 + 2.174(4m)=hb14(4m)=6.75% . Over the past one month, these previously glycated rbcs undergo new glycation on the curve mpg = 137 to convey the prior mean hba1c to a newly higher point . This displacement of mean hba1c point on the second curve over m months can be written as (9)mean = mpgx/35.6 + 2.172m = hbx2m=3% . The sum of contributions (8) and (9) represents the cumulative mean hba1c in this group of rbcs with former and later glycation on two different curves . (10)1=mpg1/35.6 + 2.174(4m)+mpgx/35.6 + 2.172m = hb14(4m)+hbx2m=9.75% . Furthermore, during the past one month, second group of rbcs have been newly formed and undergone glycation on the new curve (mpg = 137) with mean hba1c of (11)2=mpgx/35.6 + 2.174m = hbx4m=1.5% . Following all above steps, we can find the final desired hba1c by averaging equations 1 and 2 considering their coefficients according to available rbcs in each group (3: 1, three months versus one month). (12)hbmix=2m+1(4m)4,hbmix=((mpgx/35.6 + 2.17)/4)m24 + (mpg135.6 + 2.174(4m)+mpgx35.6 + 2.172m)4 (4m)4,hbmix=(hbx/4)m2+((hb1/4)(4m)+(hbx/2)m)4 (4m)4 . And rearranging gives (13)hbmix = mpgx(8mm2)+mpg1(m28m+16)+1236570 . Or (14)hbmix = hbx(8mm2)+hb1(m28m+16)16=7.6875% . Although this is the answer to our initial riddle, this value (hbmix) is a simply measurable variable by laboratory assays . In fact, our unknown desirable variable in this setting would be mpgx and hbx representative of the second curve in which glycation occurs over recent months . And this is the finding that was one of the most important limitations of hba1c, some minutes ago . Access to the equations governing hba1c by this comprehensive analysis could have potentially valuable implications on diabetes control . No matter how frequently done, measurement of hba1c can lead to the desirable mean plasma glucose over previous m months and makes all doubts about time wasting over patient's observations, even . Finally, for practical aspects of this model in clinical setting, (15)mpgx=570hbmixmpg1(m28m+16)1236(8mm2). Or (16)hbx=16hbmixhb1(m28m+16)(8mm2), wherehb1: initially measured hba1c, hbmix: measured hba1c after m months, hbx: hba1c corresponding to the curve on which the patient has moved during previous m months, m: time interval between measured hb1 and hbmix in month . Hb1: initially measured hba1c, hbmix: measured hba1c after m months, hbx: hba1c corresponding to the curve on which the patient has moved during previous m months, m: time interval between measured hb1 and hbmix in month . It is of note that, the final equation (16) is independent of presumed equations correlating hba1c with mpg such as dcct data ((1) and (2)) or other data such as nathan's et al . . The calculated hbx has a capability to be converted to the corresponding mpg using any of mentioned hba1c - mpg relationships (table 1). Example 2assume a diabetic patient with hb1 = 12% and mpg1 = 350 to whom changing in therapeutic regimens is applied . After two weeks, the rechecked hba1c is hbmix = 11% . According to (16), the mean plasma glucose in recent two weeks can be calculated as (17)hbx=161112(0.254 + 16)(40.25)=6.93%.hbx = 6.93% represents that the patient is shifted to and moving on the curve mpg = 170 (see (1)) showing a significant improvement in patient's diabetic control . Otherwise, the measured hbmix = 11% corresponds to the mpg = 315 with a remarkable error and deviation from reality due to a mixture of former and later glycated hemoglobins.it is of note that, variation in glycation rates between individuals and also difference in rbc life span especially in hemoglobinopathies are not factored in this model to attenuate intricacy of equations.another application of this derived mathematical model is describing the changes in hba1c with time . For the patient presented in example 2, (14) takes the form of (18)hbmix=6.93(8mm2)+12(m28m+16)16 . And can be plotted as in figure 4.percentage of changes in hba1c during the time intervals can be expressed as (19)hba1c = hb1hbmix(timerelated)hb1hbx100 . And is presented in table 2.the calculated changes of hba1c over time derived from devised mathematical model are in full quantitative agreement with previous clinical studies [1113] showing that plasma glucose levels in the preceding 30 days contribute ~50% to the final results, and pg levels from 90120 days earlier contribute only ~10%.as briefly described, without applying the presented equations, early measurement of hba1c will end to a crude and erroneous estimation of patient's mpg . How frequently should it be checked is a great controversy among authorities, but the general trend and recommendation vary from 2 to 3 months.additional application of our mathematical model is calculation of emerged error at any desired time intervals, defined as deviation of the crude estimation of mpg derived via hbmix, from real mpg calculated by devised equations (20)error = mpgrealmpgcrudempgreal100 . Or (21)error=1(35.6hbmix77.3)(570hbmixmpg1(m28m+16)1236(8mm2))100 . To make the presented 3-variable equation more applicable, it can be used at definite points of time with different values of mpg1 and laboratory measured hbmix . As an instance, error estimation of measured hba1c for detection of patient's mean plasma glucose in 2 and 3 months intervals is expressed in tables 3 and 4 according to different values of mpg1 and hbmix.as presented in tables 3 and 4, estimated error emerged in different values of mpg1 and hbmix ranges from 50% to + 20% for 2-month interval and 26% to + 5% for 3-month interval . Negative and positive errors contribute to overestimation and underestimation of patient's mpg, respectively . The higher the difference between hb1 and hbmix is, the bigger the error emerged from crude estimation of patient's mpg via laboratory measured hbmix . Assume a diabetic patient with hb1 = 12% and mpg1 = 350 to whom changing in therapeutic regimens is applied . After two weeks, the rechecked hba1c is hbmix = 11% . According to (16), the mean plasma glucose in recent two weeks can be calculated as (17)hbx=161112(0.254 + 16)(40.25)=6.93%.hbx = 6.93% represents that the patient is shifted to and moving on the curve mpg = 170 (see (1)) showing a significant improvement in patient's diabetic control . Otherwise, the measured hbmix = 11% corresponds to the mpg = 315 with a remarkable error and deviation from reality due to a mixture of former and later glycated hemoglobins . It is of note that, variation in glycation rates between individuals and also difference in rbc life span especially in hemoglobinopathies are not factored in this model to attenuate intricacy of equations . Another application of this derived mathematical model is describing the changes in hba1c with time . For the patient presented in example 2, (14) percentage of changes in hba1c during the time intervals can be expressed as (19)hba1c = hb1hbmix(timerelated)hb1hbx100 . And is presented in table 2 . The calculated changes of hba1c over time derived from devised mathematical model are in full quantitative agreement with previous clinical studies [1113] showing that plasma glucose levels in the preceding 30 days contribute ~50% to the final results, and pg levels from 90120 days earlier contribute only ~10% . As briefly described, without applying the presented equations, early measurement of hba1c will end to a crude and erroneous estimation of patient's mpg . How frequently should it be checked is a great controversy among authorities, but the general trend and recommendation vary from 2 to 3 months . Additional application of our mathematical model is calculation of emerged error at any desired time intervals, defined as deviation of the crude estimation of mpg derived via hbmix, from real mpg calculated by devised equations (20)error = mpgrealmpgcrudempgreal100 . Or (21)error=1(35.6hbmix77.3)(570hbmixmpg1(m28m+16)1236(8mm2))100 . To make the presented 3-variable equation more applicable, it can be used at definite points of time with different values of mpg1 and laboratory measured hbmix . As an instance, error estimation of measured hba1c for detection of patient's mean plasma glucose in 2 and 3 months intervals is expressed in tables 3 and 4 according to different values of mpg1 and hbmix . As presented in tables 3 and 4, estimated error emerged in different values of mpg1 and hbmix ranges from 50% to + 20% for 2-month interval and 26% to + 5% for 3-month interval . Negative and positive errors contribute to overestimation and underestimation of patient's mpg, respectively . The higher the difference between hb1 and hbmix is, the bigger the error emerged from crude estimation of patient's mpg via laboratory measured hbmix . Hemoglobin is continuously glycated during the 120-day life span of erythrocyte such that the cumulative amount of hba1c in an erythrocyte is directly proportional to the time - averaged concentration of glucose within the erythrocyte [8, 10, 14, 15]. Glycated hemoglobins provide an index of the patient's average blood glucose concentration over a long time period . This index is not affected by short - term fluctuations in blood sugar (hour to hour) and hence gives a relatively precise reflection of the state of blood glucose control in diabetes . To introduce novel applications and new concepts about hba1c, an innovative mathematical simulation was analytically modeled to describe the hba1c behavior and process of events . The basic suppositions are cited from available equations expressed in figures 1 and 2 [9, 10]. The devised model is used to predict the mean plasma glucose at any desired point in time with great certainty . By using derived formulas, it does not take 120 days to detect a clinically meaningful and reliable value for hba1c and mpg over preceding months . In addition to the presented application, i specifically was interested in assessing the pattern of hba1c changes over time and calculation of emerged error during crude estimation of mpg from hbmix . As described in table 2 and figure 4, change in hba1c shows a prompt fall upon institution of rigorous diabetic control . This finding can be readily explained by decay of older erythrocytes with highest rates of glycated hb, as demonstrated in figure 3 . This model refutes the explanation that recent pg levels (i.e., 3 - 4 weeks earlier) contribute considerably more to the level of hba1c than do long past pg levels (i.e., 3 - 4 months earlier) [1113]. According to calculated error for 2- and 3-month interval and its explained logic, without employment of the devised model, hba1c should be used with caution as a surrogate measure of mpg because it may significantly under or overestimate patient's mpg . The tests currently in use for diagnosis are the fasting plasma glucose test and the less common oral glucose tolerance test . However, these tests can be inaccurate if a person has eaten recently or is sick . Advantages of the hba1c test are that it can be given at any time and, because it reflects blood glucose levels over a longer period, it is not unduly influenced by events on the day of the test . This devised model also makes hba1c more befitting and useful for being a main part of guidelines on using the hba1c test as a diagnostic tool for diabetes . However, a consensus statement is necessary because right now there is no agreement on what hba1c level would constitute a diagnosis of diabetes.
|
Malaria remains a major cause of mortality and morbidity especially in sub - saharan africa . Children under five and pregnant women remain the most vulnerable groups afflicted by this disease . Control programs are strongly affected by resistance to insecticides and to antimalarials, including the recently implemented combination therapies with artemisinin and its derivatives [2, 3]. Development of new antimalarial drugs is necessary though expensive and time consuming, and a number of potential antimalarials exist either derived from plants or as new synthetic compounds . Parasite drug - resistance and its spread throughout the world can develop quite rapidly (as exemplified by the drug pyrimethamine / sulfadoxine), and there is a need to intensify the search for new antimalarial agents preferably acting on newer targets . Curcumin, the active compound derived from the plant curcuma longa, has anticancer, anti - inflammatory, antiviral, and antimalarial activity [510]. Curcumin has also shown potent activity against other organisms including: schistosoma mansoni adult worms, cryptosporidium parvum, and trypanosoma cruzi [810]. Previous studies have shown that a combination of oral curcumin and intramuscular administration of artemisinin derivative - arteether to p. berghei - infected mice improved the survival rates and prevented recrudescence . In contrast, a previous work done by our group has shown that oral administration of 300 mg / kg of body weight (bw) of curcumin in combination with 20 mg / kg / bw of piperine and 150 mg / kg of artemisinin showed no conclusive effect on the course of infection . However, antimalarial activity and peak parasitemia reached by the curcumin and curcumin / piperine treatment groups were significantly lower compared to the control untreated group . Some authors have suggested that the target of curcumin might be similar to that which initially was thought to be the target of artemisinin (pfatp6); however, a recent study has shown that the targets of artemisinin remain unclear . Others have shown that curcumin might be an inhibitor of histone acetyltransferase (hat) and it can also induce the production of reactive oxygen species which may contribute to parasite's death . However, a recent study has shown that curcumin may interfere with many signaling pathways including: the mitogen - activated protein kinases (mapks), casein kinase ii (ckii), and the cop9 signalosome (csn) as well as the ubiquitin proteosome pathway (ups) which will be analyzed in this study . Ubiquitylation is a regulated posttranslational modification of proteins in which an ubiquitin molecule is attached to a lysine amino acid in the target protein [15, 16]. Attachment of ubiquitin molecules to proteins is catalyzed by the action of ubiquitin activating enzymes (e1), ubiquitin - conjugating enzyme (e2), and ubiquitin ligase (e3) [15, 16]. In general, ubiquitylation linked via lys29 or lys48 with four or more ubiquitin molecules is targeted for degradation by the proteasome [17, 18]. On the other hand, ubiquitylation linked via lys63 on the target protein is involved in the regulation of a myriad of cellular processes [17, 18]. The removal of ubiquitin molecules is carried out by de - ubiquitylating enzymes (dubs) [1519], which are responsible for the generation of free ubiquitin molecules and the disassembly of mono- or polyubiquitin chains on substrate proteins [1519]. The plasmodium genome encodes at least 20 to 40 putative dubs [1519] which are classified as cysteine proteases and zinc - dependent metalloproteases based on their ubiquitin protease domain [1519]; these are: the ubiquitin c terminal hydrolases (uchs), the ubiquitin specific proteases (usp / ubps), the machado joseph disease protein domain proteases (mjds), the otubains (otus), the jamm motif metalloproteases (jamms), and the permuted papain fold peptidase (pppde) as well as [1519] deubiquitylating - like enzymes (dubls), which have been thoroughly reviewed by others [1519]. It has become apparent that deubiquitylation plays an important role in the regulation of the ups as confirmed by aberrations in genes encoding dubs . Furthermore, dubs have also been implicated in antimalarial drug resistance as confirmed by mutations found in a gene encoding a de - ubiquitylating enzyme ubp-1 (mal1p1.34b) in plasmodium chabaudi parasites resistant to artemisinin and artesunate . The v2697f and v2728f mutations lie close to the catalytic site of the enzyme and probably affect protein structure and function . However, the role of those mutations in artemisinin drug resistance is yet to be clarified through transfection assays . The aim of the present study was to analyze the efficacy and the drug interactions between curcucmin / piperine / chloroquine and curcumin / piperine / artemisinin in plasmodium chabaudi parasites resistant to chloroquine (as-3cq) and artemisinin (as - art) and to verify the effects of curcumin, chloroquine, and artemisinin drug treatment on the ups . Plasmodium chabaudi clones available in our database and used in this study were as-3cq (resistant to chloroquine) and selected from the clone as - pyr which was subjected to six daily doses of chloroquine (cq) at 3 mg / kg . This parasite line was cloned and named as-3cq . The as - art clone resistant to artemisinin was obtained from a clone known as as-30cq which tolerated 300 mg / kg / day of artemisinin obtained by serial passages in the presence of increasing subcurative doses of artemisinin [23, 24]; this parasitic line was cloned and named as - art . The clones displayed a stable phenotype even after freezing / thawing serial blood passages through mice in the absence or presence of drug treatment, and transmission through the mosquito vector anopheles stephensi . Balb / c male mice weighing 15 g and 6 - 7 weeks old were purchased from the animal house facility at the ihmt (institute of hygiene & tropical medicine, lisbon, portugal). The ld50 of curcumin in balb / c mice was determined by oral administration of five doses 2 g / kg / bw; 2,5 g / kg / bw; 3 five grams is the concentration reported by others [27, 28] to be the highest dose known to be administered to mice for the acute toxicity test of any drug . Animals were observed for 14 days for any physical signs of toxicity including trembling, lethargic behavior, and impaired body movements . In the present study the in vivo efficacy and the interaction of curcumin / piperine in combination with artemisinin and chloroquine was assayed using the 4-day suppressive test . Curcumin 94% cucuminoid content (sigma - aldrich, madrid, spain) and artemisinin (sigma - aldrich, madrid, spain) were dissolved in dmso (sigma - aldrich, madrid, spain) and chloroquine (sigma - aldrich, madrid, spain) was dissolved in water . The parasites kept in liquid nitrogen were thawed and mice were inoculated with 1 10 infected red blood cells . Parasitemia was allowed to evolve and once parasitemia reached 30%, infected blood was collected and diluted with citrate saline solution . An intraperitoneal injection of 1 10 infected red blood cells was administered to individual mice . Cages contained a maximum of 5 mice each and were kept in a light - dark cycle and mice had food and water ad libitum . Three hours later mice were administered by oral gavage either chloroquine alone, curcumin alone, or the combination of curcumin / piperine / chloroquine as piperine 97% (sigma - aldrich, madrid, spain) has been reported in a previous study to have no antimalarial activity, but it is reported to enhance curcumin uptake . The same procedure was carried out in mice infected with as - art resistant parasites . Infected mice received an inoculum of 1 10 infected red blood cells and three hours later groups of 5 mice per cage were administered an oral dose of artemisinin alone, curcumin alone, and curcumin / piperine, and another group received a combination of curcumin / piperine / artemisinin . Drugs were administered orally for 4 days (day 0, 1, 2, 3). Parasitemia was monitored every day following drug treatment for a period of 7 consecutive days, as previous work has shown that differences in curcumin / piperine combination versus the control group can be observed between 5 and 7 days after drug treatment had ended . Thin blood smears were prepared and stained with 20% giemsa / pbs solution (sigma - aldrich, madrid, spain) ph 7.2, and microscopic slides were analyzed by light microscopy . The ed50 values (the concentration that produces 50% reduction of parasitemia) of the drug alone and in combination were calculated by plotting the log dose versus relative percentage inhibition using graphpad prism 4 software (graphpad prism 4, ca, usa) using nonlinear regression, dose - response curve according to the 4-parameter logistic equation (hill slope). From the ed50 and the hill slope the ed90 values were calculated using the formula loged50 = loged90 (1/hill slope) log(9) and the equation y = bottom + (top bottom)/(1 + 10((loged50-x) hill slope)). In order to generate isobolograms the ed90 values of the drug combination and the drug alone were calculated from the linear equation of the dose - response curve of the drug alone and in combination 7 days after treatment had ended . The ed90 values were then used to calculate the isobolar equivalent (ie) values [25, 26]. Isobolograms were designed to include a diagonal line (black solid) which represents the line of additivity (figures 2 and 4). If the ie values are below 1 it produces an isobologram that skews below the additivity line indicating synergism [25, 26]. When the ie values are equal or close to 1 most values will lie closely to the additivity line indicating additivity . If most ie values are above 1, this indicates antagonism [25, 26]. A student t - test and the anova test were used for statistical analysis using graphpad prism 4 software and spss software version 9.0 usa . All experiments were carried out according to the guidelines of the animal facility of the institute of hygiene and tropical medicine (ihmt), lisbon, portugal and according to the felasa guidelines . As previously mentioned curcumin is known to interfere with the ups . This was verified here by rt - pcr . In this study we selected three genes encoding deubiquitylating enzymes and the sequences were retrieved from the plasmodb database and used for primer design (table 2). The human homologue of pcuch - l3 regulates the apical membrane recycling of epithelial sodium channels . The human homologue of pcuch - l5 appears to be associated with the proteosome and possibly involved in tg signaling . Ubp-8 gene in yeast regulates transcription mechanisms and it is responsible for the deubiquitylation of histone h2b . Given the importance of these genes in other biological systems, we analyzed the basal expression of these genes in p. chabaudi throughout the parasite's life cycle and their response to treatment with subtherapeutic doses of chloroquine (2 mg / kg), artemisinin (2 mg / kg), and curcumin (2 mg / kg). Plasmodium chabaudi - infected red blood cells were collected at time point 0 h; a microscopy analysis revealed that the parasites present were mainly young trophozoites . Infected red blood cells were passed through a column of fibrous cellulose powder (cf11) (sigma - aldrich, madrid, spain) to remove lymphocytes . The resulting solution was centrifuged at 700 g for 5 minutes and rna was extracted from the obtained pellet using trizol (sigma - aldrich, madrid, spain) and following the manufacturer's instructions . Rna (1 g) was mixed with 5 l of dnase i buffer and 1 l of dnase i (promega, mannheim, germany) and incubated at 37c for 15 mins . Dnasei was inactivated by adding 1 l of edta (promega, mannheim, germany) and incubated at 65c for 5 min . Rna (50 ng) previously treated with dnase i was used as template and was mixed with the maxima first strand cdna synthesis kit for rt - pcr (fermentas, madrid, spain) and water to a final volume of 25 l according to the manufacturer's instructions . Samples were incubated for 10 min at 25c, followed by 30 min at 50c and the reaction of cdna synthesis was terminated by incubation at 85c for 5 min . Real - time pcr using the iq sybr green supermix (bio - rad, lisbon, portugal) was carried out using microamp 96-well plates (applied biosystems, madrid, spain) in triplicates with a 25 l final volume containing iq sybr green supermix dye, 0.025 u/l itaq dna polymerase (promega, mannheim, germany), 200 m dntps (promega, mannheim, germany), and 3,5 mm mgcl2 (promega, mannheim, germany), and each individual mixture contained 300 nm of the forward primer (stabvida, lisbon, portugal) and 300 nm (stabvida, lisbon, portugal) of the reverse primers specific for pcuch - l3, pcuch - l5, and pcubp-8; finally, 2 l of cdna diluted 1: 10 obtained from infected mice treated with curcumin, chloroquine, and artemisinin were added to each individual mixture . The reaction was performed under the following amplification conditions: 10 min of preincubation at 95c, followed by 40 cycles for 15 seconds at 95c and 1 min at 60c in a 7500 fast rt - pcr thermocycler (applied biosystems, madrid, spain). Primers designed against p. chabaudi pc-actini gene (pc-actini) were used as the endogenous control as previously reported by others . In order to determine pcr efficiencies for each individual gene, samples were diluted in serial 10-fold ranges, and the ct value at each dilution was measured . Real - time pcr efficiencies (e) were calculated from given slopes according to the equation: e = 10(1/slope), where e = 2 corresponds to 100% efficiency . The purpose was to analyze first the expression of the studied genes throughout the parasite's life cycle, in the absence of any kind of treatment . The second aim was to analyze the differences in expression of each studied gene in parasites exposed to drug treatment versus a sample collected at time 0 h which was not exposed to drug treatment . Differences in n - fold expression compared to the untreated sample were analyzed using a student t - test p 0.05 (n = 3 assays) performed in graphpad prism 4 software and spss software version 9.0 . Given the emergence of artemisinin combination therapy (act), drug resistance new antimalarials are urgently needed . The aim of this study was to determine the in vivo efficacy of curcumin alone or in combination: curcumin / piperine / chloroquine and curcumin / piperine / artemisinin in order to clarify their drug interactions in plasmodium chabaudi resistant parasites . The acute toxicity studies revealed that curcumin was nontoxic to mice even at 2 g / kg / bw (table 1); mice survived for 14 days with no signs of toxicity . The results show that curcumin alone was able to delay peak parasitemia in a dose - dependent manner (figures 1 and 3) in both p. chabaudi clones . Statistically, there was no significant difference (p> 0.05) between the control untreated group and the groups treated with 50 mg and 150 mg curcumin alone . Significant results were observed especially at 500 mg / kg / bw where parasitemia dropped to 47% in the as-3cq clone and 45% in the as - art clone compared to the control untreated group (p = 0.003) 65% and 62% (figures 1 and 3). Curcumin combined with piperine showed a mild antimalarial effect which is in agreement with previous work . Again in both clones curcumin / piperine combination was more efficient at reducing parasitemia at higher doses . At 250 mg curcumin + 20 mg of piperine parasitemia dropped to 45% in mice infected with the chloroquine resistance clone (as-3cq) and 44% in mice infected with the artemisinin resistance clone (as - art) relative to the control (p = 0.04) (figure 3). When curcumin at 500 mg was combined with 20 mg of piperine parasitemia dropped to 42% in mice infected with the chloroquine - resistant parasite line and 40% in mice infected with the artemisinin - resistant parasite line with p value significant (p = 0.02), indicating that the efficacy of the curcumin / piperine combination in p. chabaudi clones was also in a dose - dependent manner . For the drug interaction studies four doses of chloroquine were administered orally to mice infected with the chloroquine - resistant parasite line (as-3cq) and of the 4 doses given 2,5 mg of chloroquine was found to reduce parasitemia to 48% after 7 days post drug treatment . As-3cq parasites were treated with 5 mg / kg and 10 mg / kg which reduced parasitemia to 15% and 9%, respectively . Hence a choice was made not to combine these higher doses with curcumin / piperine as they would mask the effect of the combination . When curcumin / piperine was combined with a fixed dose of 2,5 mg / kg of chloroquine, parasitemia reduction was better than when curcumin was used either alone or when it was used in combination with piperine (figure 1). When curcumin / piperine / chloroquine was administered to mice a significant reduction in parasitemia was achieved compared to the control group . This reduction was even more evident at higher doses (150 mg + 20 mg + 2,5 mg) parasitemia 45% (p = 0.033), (250 mg + 20 mg + 2,5 mg) parasitemia 39% (p = 0.01), and (500 mg + 20 mg + 2,5 mg) parasitemia 37% (p = 0.0001) relative to the control sample (figure 1). It is interesting to note that when curcumin / piperine / chloroquine are combined together less curcumin is needed to actually see a statistically significant suppression in parasitemia . This is evident as parasitemia dropped to 50% with the combination (curc 50 mg + pip 20 mg + cq 2,5 mg) (p <0.03) compared to the control group 65%, indicating an additive / weak synergistic effect which was confirmed by the isobologram (figure 2) with most values achieved below 1,5 . Although the interaction of curcumin / piperine / chloroquine was favorable and helped to reduce the parasite load, a followup of parasitemia for another 8 days (total 15 days) showed that a complete clearance of parasites to submicroscopic levels was not achieved . The group of mice infected with the artemisinin - resistant parasite line as - art was also treated with four doses of artemisinin alone (50 mg, 150 mg, 250 mg, and 350 mg) and at 350 mg / kg of artemisinin alone parasitemia dropped to 5% compared to the control group 67% (p = 0.0001) (figure 3). A decrease in parasitemia was also observed at 50 mg, 150 mg, and 250 mg (figure 3) and 150 mg / kg was chosen as the dose used to combine with curcumin / piperine (figure 3). Again treatment of plasmodium chabaudi resistant as - art parasite line with curcumin alone only resulted in a significant parasitemia reduction at higher doses . At 500 mg / kg of curcumin parasitemia reduced to 45% (p = 0.0001) compared to the control group 62% (figure 3). This reduction was even more evident when curcumin was combined with piperine which resulted in a parasitemia reduction from 67% to 40% (p = 0.0001) (figure 3). Addition of a fixed dose of 150 mg / kg of artemisinin to curcumin / piperine did not result in a clear difference in parasitemia reduction between the control group and the artemisinin / curcumin / piperine (p = 0.08) which is in agreement with previous work . In fact, even at higher doses (curcumin 500 mg + piperine 20 mg + 150 mg artemisinin) parasitemia dropped to 50% relative to the control group (p = 0.055) 62% (figure 3). It seems that curcumin, curcumin / piperine, and artemisinin alone performed better separately as opposed to when the three compounds are combined (figure 4). The isobologram indicates that most values were bigger than 1,5 which resulted in an isobologram where most of the values are far away from the additivity line, indicating antagonism amongst the components of the drug combination . Three genes encoding de - ubiquitylating enzymes pcuch - l3, pcuch - l5, and pcubp-8 were analyzed by rt - pcr in the presence and absence of drug treatment in order to verify whether drug treatment interferes with the ups . The results suggest that in both clones as-3cq and as - art the three genes under study are highly expressed at 6 h time point (figures 5 and 6). Microscopic slides prepared at that time point when mrna was collected revealed most of the parasites were mainly at the mature trophozoite stage, which is the most replicative stage of the parasite's life, and statistically there is no difference in the basal expression of the three genes between the two clones (p = 0.08). Treatment of as-3cq parasites with a subcurative single dose of chloroquine and a subcurative single dose of curcumin induced an increase in the expression of all three genes (figures 7 and 8) specially at 6 h and 12 h after drug exposure, compared to the untreated sample collected at time point 0 h (p = 0.002). Statistical analysis was also applied to compare the basal expression of the genes at 6 h and 12 h time points versus the same samples exposed to treatment, which revealed a difference (p = 0.01). Microscopic slides analyzed revealed mostly the presence of schizonts at 12 h time point, which is also the stage of the parasite in which chloroquine is known to act . The effects appear to be transient with all genes returning to levels similar to the untreated sample 24 hours later . Microscopic slides revealed the presence of ring - stage parasites at the 24 h collection point . In both treatments pcubp-8 was the gene that exhibited the highest increase in expression relative to the untreated sample 0 h (p = 0.001) (figures 7 and 8). In as - art parasites treated with a single subcurative dose of artemisinin and a single subcurative dose of curcumin there was also an increase in the expression of all three genes relative to the untreated sample 0 h, which was more evident at 6 h and 12 h following drug exposure (p = 0.002). In both treatments pcubp-8 was the gene that exhibited the highest increase in n - fold expression relative to the control untreated sample (p = 0.0001). The expression levels induced by drug treatment were transient with the three genes returning to levels similar to the untreated sample 0 h (figures 9 and 10). Given the emergence of drug resistance against acts, new alternatives for the treatment of malaria are urgently needed . Curcumin has already shown great potential both in vitro and in vivo against plasmodium spp . [6, 7]. However, its poor availability and rapid metabolism are issues to overcome in order to exploit the full benefits of this plant - derived compound . Enhancers such as piperine derived from black pepper which is already known to improve the bioavailability of curcumin were hereby tested as a combination: curcumin / piperine / chloroquine and curcumin / piperine / artemisinin . The results show that the interaction between curcumin / piperine / chloroquine was additive and helped in the reduction of the parasite load 7 days after treatment had ended . The results are interesting: although both drugs have different structures and different modes of action, they both have anti - inflammatory properties which possibly contribute to parasitemia reduction . Curcumin is well known for its immunomodulatory properties which include: activation of tlr2, increase in il-10, and production of antiparasite antibodies . Chloroquine is well known for its antimalarial schizonticidal activity as well as its anti - inflammatory properties such as inhibition of tumor necrosis factor-, il-1, and il-6 making both drug combinations interesting in the treatment of other diseases where an excess of proinflammatory cytokines is produced . It is believed that curcumin is an attractive compound for adjunctive treatment of cerebral malaria which is often treated with quinine, from which chloroquine derives . Hence further pharmacokinetic studies between curcumin and quinine and its derivatives the combination of curcumin / piperine / artemisinin did not show a favourable drug interaction . Although it was able to reduce parasitemia statistically there was no difference between the control untreated group and the curcumin / piperine / artemisinin group . In fact the mice treated with artemisinin alone and curcumin alone actually had a significant reduction in parasitemia compared with mice treated with the drug combination curcumin / piperine / artemisinin (figure 3). An in vitro study carried out in p. falciparum revealed synergism between curcumin and artemisinin, and the in vivo assay where,-arteether was injected intramuscularly in p. berghei - infected mice followed by curcumin feeding was able to prevent recrudescence . However, in the study mentioned piperine was not used as an enhancer and the difference in the biology of p. chabaudi and p. berghei parasites also needs to be taken into consideration . In the present study the mixture of the three compounds administered orally resulted in an unfavorable pharmacodynamic interaction . Recent studies in p. berghei - infected mice using a combination of artemisinin and curcumin have also shown that although parasites can be cleared from the blood, they remain in the spleen and the liver, favoring recrudescence . Artemisinin has a half life of approximately 814 hours and curcumin has a half life of 8 h . Studies carried out in rats have reported that only about 0,1%0,25% of piperine administered orally can be detected in the liver whereas intraperitoneal administration of piperine resulted in 12,5% of piperine detection in the liver 6 hours later . Given the fact that the three drugs have different structures and different modes of action, clearly more studies are needed including different administration routes and hplc analysis of mice tissue after treatment with curcumin / piperine / artemisinin in order to clarify drug distribution and elimination . Artemisinin derivatives as well as curcumin derivatives might offer an alternative to the pure compound . A study has shown that the pyrazole analogue of curcumin (methyl curcumin) has 79 fold activity against p. falciparum cq - sensitive and cq - resistant strains with ic50 values of 0.48 and 0.45 m compared to curcumin which has an in vitro ic50 of 5 m . Previous work has also shown that artemisinin at 50 mg / kg / bw combined with curcumin at 100 mg / kg / bw encapsulated in conventional liposomes cured all p. this study concludes that delivery systems such as liposomes and nanoparticles may be the key in delivering drugs with short half life and poor bioavailability . It has also been shown that curcumin when bound to chitosan nanoparticles is able to completely cure p. yoelii infected mice . Hence future studies with curcumin should aim at finding suitable drug - delivery systems and better drug partners in order to maximize the benefits of curcumin as an antimalarial agent . The gene expression assays showed evidence of an active ups in p. chabaudi parasites mainly at the trophozoite stage which coincides with high metabolic activity, which is necessary for parasite replication . In the present study all three drugs administered orally were able to induce transient changes in the expression of the three genes with pcubp-8 showing the highest increase when exposed to all three drugs (figures 7, 8, 9, and 10) relative to the untreated sample . As mentioned previously, pcubp-8 gene in yeast saccharomyces cerevisiae is required for optimal gene activation and is responsible for the de - ubiquitylation of histone h2b, which is involved in chromatin remodeling . In p. chabaudi parasites the role of pcuch - l3, pcuch - l5, and pcubp-8 enzymes is unknown . It is not clear whether these enzymes are controlling epigenetic mechanisms or regulating the transcription of p. chabaudi genes . Previous work using serial analyses of gene expression (sage) technique has shown that in chloroquine - treated p. falciparum cultures a 5.5-fold increase in a gene encoding an ubiquitin - specific protease and a 5.5-fold increase in a gene encoding a proteosome subunit were observed . On the other hand, treatment of human breast carcinoma mcf-7 cells with doxorubicin, which also has antimalarial activity, showed an 18.6-fold increase in the 26s proteosome regulatory subunit indicating that alterations in the ups may represent a general adaptation of the parasite to drug treatment . It is already known that drug treatment can interfere with ion homeostasis, which would result in alterations in the intracellular ph of several organelles that are crucial for parasite survival, thereby interfering with enzyme activity and function, which would explain the necessity of an increase in the transcription and translation of pcuch - l3, pcuch - l5, and pcubp-8 gene products to compensate for enzyme damage . Damaged proteins are likely to act as a stimulus to induce the expression of genes encoding enzymes involved in protein synthesis and protein degradation in order to allow the parasite to cope with intracellular stress . Hence, upregulation of the ups in general would be needed to help the parasite survive under drug pressure, which could very well be a mechanism of defense and or resistance, making the ups an attractive drug target.
|
There are well over 50,000 commercial ships which move goods around the world among over 300 major ports . However, the ballast water associated with merchant vessel traffic is also responsible for the transfer and introduction of aquatic invasive species to coastal waters where they can cause enormous ecological and economic damage . In an attempt to minimize the risk of bw introductions, the international maritime organization (imo(6)) and u.s . Coast guard (uscg(7)) have each proposed discharge standards limiting maximum concentrations of living organisms that can be released with bw, including new regulations requiring ship operators to meet those limits . The uscg has proposed to implement regulations in two phases: phase 1 proposes to set standards similar to current imo standards and phase 2 proposes standards up to 1,000 times stricter . The imo and uscg phase 1 standards require bw discharged by ships to contain: fewer than 10 viable organismsm 50 m in minimum dimension or smallest measure among length, width, and height excluding fine appendages such as sensory antenna and setae (the majority of organisms in this size class are zooplankton). Fewer than 10 viable organismsml <50 m and 10 m in minimum dimension . (the majority of organisms in this size class are protozoa, including zooplankton). Fewer than the following concentrations of indicator microbes, as a human health standard: (a) toxicogenic vibrio cholerae (serotypes o1 and o139) with <1 colony forming unit100 ml; (b) escherichia coli <250 cfu100 ml; and (c) intestinal enterococci <100 cfu100 ml . To achieve the above discharge standards, technology developers and manufacturers around the world are advancing on - board bw treatment systems that use methods such as filtration + uv radiation, deoxygenation, ozonation, and chlorination. (9) despite rapid technological advancement, the regulatory framework around bw treatment and discharge is still emerging . In contrast, more mature regulations such as the national primary drinking water regulations have, for many years, required the use of specific test protocols by certified laboratories for validating treatment efficacy. (10) at present, there are no such codified test procedures designed for validating the effectiveness of bw treatment systems, either on land - based test beds or aboard working ships . The formulation of standardized bw treatment testing protocols is essential if shipboard bw treatment technologies are to be widely implemented and discharge standards are to be enforced . The success of bw regulations for reducing biological invasions will depend, in large part, on whether (a) approved treatment systems do in fact reduce organism concentrations to the specified standards and (b) individual ships are in compliance with the standards . This requires the ability to reliably quantify very few living organisms in large volumes of water . Emelko et al. (13) showed that even when using certified sampling and analytical protocols, enumeration of cryptosporidium oocysts in drinking water can yield variable results due to two sources of uncertainty: (1) sampling error and (2) analytical recovery error . The sampling and analysis of bw are prone to the same kinds of error (see supporting information for detailed summary of sampling and recovery errors associated with bw discharge analyses). In the absence of standardized sampling and analytical protocols, currently available data are insufficient to create a comprehensive model that quantifies all sources of uncertainty for bw discharge analysis, as has been possible for drinking water . Although we are not yet able to parameterize all potential sources of error, we present a theoretical model that is designed specifically to ascertain the baseline sample volumes required to robustly discern noncompliant zooplankton concentrations under ideal sampling and detection conditions, thereby establishing a rigorous lower limit (or minimum threshold) for sampling effort . This is a crucial first step toward establishing robust sampling procedures for bw regulations that are verifiable and effective, as these do not currently exist . Our goal is to provide formal evaluation and guidance on minimum sampling effort to verify bw concentrations, since additional error can never decrease the sampling effort required under the optimized poisson model presented (which represents the best case scenario). As subsequent studies quantify the various sources of additional error, especially recovery errors, sample volumes should be adjusted to reflect these measures . In this study, we focus on imo and uscg proposed phase 1 standards (hereafter imo standard) and organisms of 50 m minimum dimension (hereafter zooplankton) to (1) characterize the uncertainty associated with estimating the concentration of organisms in bw due to the stochastic nature of sampling bw (i.e., sampling error); and (2) demonstrate, using specific examples, how various regulatory decisions regarding rates of both type i (i.e., false positive) and type ii (i.e., false negative) errors(17) affect the sample volumes needed to verify organism concentrations . In particular, we estimate the statistical power to detect bw concentrations that exceed the current imo standard of <10 organismsm using different sample volumes and regulatory scenarios . As discussed above, we focus only on the sampling error expected from bw discharges, since sampling error should represent a significant source of uncertainty, especially at low concentrations . Of primary concern is characterizing the sampling effort necessary to quantify live zooplankton concentrations in bw in order to reliably classify bw as noncompliant (10m) or compliant (<10m), with high statistical confidence . Importantly, this sampling effort must be feasible given the realities and logistic constraints specific to bw treatment system testing and ship compliance monitoring . Furthermore, bw verification and compliance testing also require that several decisions be made at the regulatory level, especially if standardized sampling protocols are to be developed . One regulatory decision is how best to handle the inherent uncertainty associated with sampling discharge concentrations, even when using the best sampling protocols . There are at least two philosophies concerning the regulation of bw discharge, which differ according to where the burden of proof is placed . The first is based on the presumption of innocence until proven guilty, which places the burden of proof on the regulator . In this context, a random sample of ballast discharge may contain> 10 zooplanktonm and still pass inspection as long as the sample is not statistically significantly 10 zooplanktonm . An alternative is to place the burden of proof entirely on the regulated entity, whereby a ship with a measured zooplankton concentration that is not statistically significantly <10m is presumed guilty until proven innocent . We use the presumed innocent approach in the examples presented in this paper, however, the general methods we describe will apply to other approaches . Given this, treated bw is assumed to have a concentration <10 zooplanktonm until proven otherwise, thus the null hypothesis is as follows: (ho): concentration of live zooplankton in treated ballast water is <10 zooplanktonm . At present neither the imo nor uscg have voiced guidance on which approach will guide regulatory actions, but the approach that is used may depend on the setting and the kind of testing being carried out . For compliance monitoring of individual ships, the presumed innocent approach may be preferred . Because a high degree of certainty may be desired for type approval testing of treatment systems (type approval is the process of testing equipment to ensure that it meets technical, safety, and regulatory requirements), it may be reasonable for the burden of proof to be on the manufacturer or ship (i.e., presumed guilty). Regardless of the approach, regulators must also define a standard for how extreme data must be before the null hypothesis is rejected . In statistical terms, this refers to the type i error rate, . (17) in the scientific arena, the typical standard is = 0.05, however, there is no theoretical reason to assume this should be the default standard for bw regulation, and in fact, this value is often debated in scientific literature . In regard to ballast discharge, if the presumed innocent approach is used, then larger values will result in more ships being falsely accused of exceeding the limit (i.e., increased false positives). For the examples in this paper given the statistical framework described above (i.e., = 0.05 or 0.20 and a presumed innocent approach), we estimated the likelihood of detecting bw with various concentrations that exceed the standard . In statistical terms,, regulators must determine the statistical power that is required to adequately enforce bw discharge standards . Low power occurs when the exceedance is small or when sampling is insufficient to yield adequate precision for detecting even a large exceedance. (18) from the vantage point of environmental protection, low power is of great concern because sampling results can falsely suggest that no significant threat is present. (19) insufficient sampling that yields low power can result in a false sense of security, thereby undermining the intended goals of a testing or monitoring program . To understand which sampling designs maximize power (and optimize sampling effort), we calculated statistical power for a variety of sampling efforts and zooplankton concentrations that exceed the compliance concentration of <10 zooplanktonm . Nevertheless, di stefano(21) argues that the selection of statistical parameters should be based on the respective costs of false positives (i.e., classifying bw as noncompliant when it actually meets the standard) and false negatives (i.e., failing to identify bw that exceeds the standard). We use power values of 0.8 as a reference for comparison among sampling scenarios, but report results from a range of values that correspond to power values ranging from <0.1 to 1.0 . Poisson sample distribution for a population with a concentration that meets the discharge standard of <10 zooplanktonm (blue curves) and a theoretical test population with a concentration of 14 zooplanktonm (black curves) for sample volumes of 1 m and 7 m. gray shading () indicates regions where concentrations cannot be distinguished . Red vertical lines indicate the noncompliance threshold for = 0.05 (table 1); random samples that are noncompliance threshold are classified as compliant with discharge standards based on our definition that ballast is presumed innocent . When the concentration of ballast discharge is 14 zooplanktonm, nearly 70% of 1 m sample volumes will result in false negatives (power 0.30 or 1). About 8% of 7-m sample volumes will result in false negatives (power 0.92). A two - stage sampling model was applied to a range of hypothetical sample volumes, plankton concentrations, and regulatory scenarios (i.e., levels of type i and type ii errors). Power to detect noncompliant discharge concentrations from the proposed discharge standard was calculated for each combination . Stage 1 assesses compliance based on a single sample and is expected to be most useful when the degree of noncompliance is large . Stage 2 combines several independent samples to assess compliance and is expected to improve discrimination when actual concentrations are close to, but still exceed, the discharge standard . If zooplankton are randomly distributed throughout bw discharge (i.e., the presence of one individual does not influence the presence or absence of others), then the poisson distribution can be used to accurately predict sampling probabilities . This is because integrating a nonhomogenous poisson process results in a poisson distribution which has a mean equal to the mean concentration in the discharge. (22) we employ the following postulates when applying the poisson distribution to bw discharge: (1) the probability of having some number of organisms in one volume is independent of the number in other discrete volumes; (2) the probability of a single organism in a sample is proportional to the volume of the sample; and (3) the probability of two or more organisms in a very small volume is negligible . The assumption that biota will be randomly distributed throughout discharge is likely optimistic, since it presupposes that organisms are independent of one another in a bw discharge . Planktonic organisms in bw tanks are known to exhibit complex, yet unpredictable spatial structure owing to diversity of ballast tank design, operation, content, physical mixing that occurs in tanks, and biological interactions and swimming behavior of plankton. (23) furthermore, some biota are known to aggregate, such as colonial or chain - forming phytoplankton (see table s1, supporting information). Appropriate sampling designs may help ameliorate the effects of aggregation though (see below). Nevertheless, assuming a poisson sampling distribution will provide the best case scenario with respect to required sample volumes, thereby estimating a lower volumetric limit for what is necessary and sufficient to characterize bw discharge . When organisms are aggregated, estimates of concentrations will be more variable, and consequently larger sample volumes must be taken to obtain reliable estimates of concentration . The land - based testing centers that are currently evaluating ballast treatment systems circumvent this problem by using in - line sampling of the ballast discharge pipe to collect a representative sample of the entire discharge. (24) in this case, the poisson distribution can theoretically be used to accurately predict sampling probabilities, but the sample must be well - mixed if an additional subsampling step is performed . For ship - board testing, time - integrated sampling of the entire discharge is probably not possible; however, the problem of aggregation may still be mitigated by sampling at several time points during discharge . Alternatively, if only a single discrete sample is taken from the discharge pipe, it may be indicative of the instantaneous concentration of discharge, but will not necessarily accurately estimate the mean concentration of the entire bw discharge . More empirical research is necessary to determine how the aggregation of organisms in bw affects sample estimates . In the examples that follow, we assume that organisms are randomly distributed throughout bw or that sampling protocols that eliminate or mitigate this problem are used, and thus can be modeled using the poisson distribution . Our assumptions include the following: the bw sample is time - integrated and proportional to the discharge flow to control for any underlying spatial / temporal structure of organism distribution . All live organisms 50 m are captured and detected (i.e., recovery error is negligible; table s1, figure s1, supporting information). Poisson probability and statistical powerwhere x = a random variable taking values x where x = non - negative integer (i.e., 0, 1, 2..., where x represents the count observed in a sample taken from a population); e = base of natural logarithms; m = mean of poisson distribution (i.e., true concentration of organisms in discharge); c = count of organisms at the noncompliance threshold for a given and sample volume (table 1); p = the probability of exceeding c. in this application, p is the false positive rate () when the bw is compliant and is power when bw is noncompliant with the discharge standard, i.e., using the poisson distribution, we modeled the probability that a random sampling unit of ballast discharge will contain a specific number of organisms (eqs 1a and 1b). For example, if the true concentration of ballast discharge is 5 zooplanktonm, the probability that a random sampling unit (1 m) will contain 0 organisms is 0.0067 (eq 1a). Alternatively, the probability that a sampling unit will contain 3 organisms is 0.265 (eq 1b). The units for this parameterization of the poisson distribution equal the number of organisms per sampling unit . To convert to concentration, the total count is divided by the total sampling unit volume . Inherent uncertainty around sampling data is reduced by sampling larger volumes. (17) we determined how increased sample volume improves the ability to identify sample concentrations that exceed the imo standard of <10m . We compared the sampling distribution of a zooplankton concentration of <10m to sampling distributions obtained from theoretical populations with concentrations 10 zooplanktonm in order to calculate statistical power, based on the poisson distribution described in eq 1a . In our framework, a sample of ballast discharge must be statistically significantly 10 zooplanktonm to be classified as noncompliant . The noncompliance threshold represents the maximum number of organisms that are likely to occur in a sample if the concentration does not exceed the standard (figure 1) given our predetermined values . These noncompliance threshold values (table 1) were determined (eq 1b) by summing the probabilities of obtaining counts from 0 to x, given a true concentration of 10m, until the cumulative probability just exceeded 0.95 (= 0.05) or 0.80 (= 0.20). Statistical power was calculated for each value to determine how reliably population concentrations ranging from 10 to 20 zooplanktonm could be discriminated from populations of <10 zooplanktonm (eq 1c) for sample volumes of 0.1, 1, 3, and 7 m. single trial analyses may be the only tractable sampling approach available on working ships, and best suited for detecting large exceedances of the discharge standard . An alternative approach for gauging the efficacy of a treatment system is to pool the results from multiple independent ballast trials and to examine them simultaneously . The simplest, and arguably most powerful, approach for evaluating multiple tests relies on the fact that poisson distributions are additive and generate a summed poisson distribution . For example, the total number of zooplankton from two 4-m trials would be summed and compared to a poisson distribution where mean and variance = 80 (i.e., the expected count for a 10 zooplanktonm discharge standard and total sample volume of 8 m). To determine how summing the results from multiple trials affects statistical power, we calculated the probability of identifying noncompliant concentrations of 1114 zooplanktonm for 115 independent trials, using 7-m sample volumes . For each total sample volume (7105 m), we calculated a noncompliance threshold value, based on the upper probable count expected in samples with concentrations of 10 zooplanktonm (= 0.05 in this scenario). Power was calculated by determining the predicted proportion of samples with counts greater than noncompliance threshold values (eqs 1a1c). Multiple test trials may be most feasible on land - based test beds, which have fewer logistical constraints than ships, and allow for more controlled and repeated sampling and analysis . To demonstrate the potential practical utility of this statistical approach, we applied our analysis to discharge data from tests of three bw treatment systems . The tests were conducted at the maritime environmental resource center (a test facility at the port of baltimore, maryland, usa) to evaluate compliance with the imo discharge standard . For each treatment system, tests occurred in 45 replicate trials, and all live zooplankton were enumerated from 5-m time - integrated samples for each trial . Using the zooplankton counts, we analyzed per - trial results and composite results using the summed poisson method . Importantly, while actual bw treatment system data are used as examples to test our model, it was not our goal to draw conclusions on the performance of any particular system or approach . For sample volumes of 1, 3, and 7 m, the noncompliance threshold concentrations are 15.0, 13.0, and 12.0 zooplanktom, respectively, if = 0.05, and 13.0, 11.7, and 11.0 if = 0.20 (table 1). When zooplankton concentrations (1020m) were modeled under the poisson distribution (eqs 1a and 1b) at four sampling efforts (0.1, 1, 3, and 7 m), we observed substantial increases in power to discern statistical differences between noncompliant and compliant (<10 zooplanktonm) concentrations (eq 1c) with larger sample volumes (figure 2). When = 0.05, for a 1-m sample volume, zooplankton concentrations must be 20m before the statistical power of the test to correctly identify a noncompliant tank exceeds 0.8 . Increasing to 0.20 effectively reduces the benefit of doubt that ships are afforded; in this case, for a 1-m sample volume, zooplankton concentrations must be 18m before statistical power exceeds 0.8 . For = 0.05, when sample volume is increased to 3 m, zooplankton concentrations of 15 and 18m can be differentiated from the discharge standard with power = 0.8 and 0.98, respectively . Further power gains are achieved when sample volume is increased to 7 m: power = 0.92 for a concentration of 14m and near certain detection is expected for concentrations above 15m (figure 2). Not surprisingly, further increasing sample volumes provides greater precision and confidence; however, additional gains in precision with incremental increases in volume diminish beyond 7 m (table 1) and the likelihood of nontreatment effects (i.e., increased mortality) with extended sampling and analysis is expected to increase . Power of the poisson one - sample test to detect noncompliance with a discharge standard of <10 zooplanktonm as a function of sample volume (0.1, 1, 3, or 7 m), discharge concentration (1020 zooplanktonm), and = 0.05 and 0.20 . In a single trial, if zooplankton concentration exceeds the noncompliance threshold, one can reliably infer (with high statistical confidence) that the mean concentration of the discharge exceeds the standard (see table 1). As discharge concentrations approach 10 zooplanktonm, it becomes progressively more difficult to differentiate compliant from noncompliant samples . Since single trial volumes cannot be increased indefinitely, it becomes necessary to combine trials for further gains in statistical power . Although we have chosen to concentrate exclusively on sampling error in order to help define the lower limits of sample volume, analytical recovery errors can introduce uncertainty that will influence enumeration and the required sample volume . Recovery errors are expected to result in under - counting rather than over - counting (i.e., sample bias, table s1). Although existing bw testing data are insufficient to accurately parameterize recovery errors, we investigated how hypothetical rates of zooplankton recovery (100, 90, 75, and 50%) strongly affect the power to detect noncompliance . As expected, the putative effect of incomplete recovery is most pronounced for smaller sample volumes and concentrations that are near the discharge standard (figure s1). Using repeated, independent trials of a bw treatment system provides a more robust test of performance than a single trial for multiple reasons . Less appreciated is the potential use of a summed poisson analysis, whereby integrative sampling allows zooplankton counts from multiple trials to be added together, providing a cumulative probability based on total volume sampled (table 1). This approach can overcome many critical limitations of volume and handling time for single trials . Using this summed poisson technique, statistical power exceeded 0.8 when comparing concentrations of 14, 13, and 12 zooplanktonm (with 1, 2, and 3 trials respectively; 7 m per trial; = 0.05) to the discharge standard (figure 3). Nearly 100% power was achieved for all three test concentrations with 7 trials (total volume = 49 m). As concentrations approach the discharge standard, more trials when the 11 zooplanktonm concentration was examined, 10 trials (70 m) were required to attain a power of 0.8 when = 0.05 (figure 3).when small sample volumes are used, there is a high probability of mistakenly attributing observed counts to a compliant concentration due to extensive overlap of concentration distributions, with either a single trial or the summed poisson approach . For example, with a sample volume of 0.1 m the power to detect a moderate exceedance (14m or 40% above the imo standard) is very low (0.05). Even when ten trials are completed, power to detect exceedance is still low (0.35) (figure 2). However, increasing sample volume from 0.1 or 1.0 to 7 m enables robust differentiation (power> 0.9) of noncompliant zooplankton concentrations of 14m and greater from the imo standard . Power analysis of the summed poisson method for identifying bw concentrations that exceed a discharge standard of 10 zooplanktonm using multiple, 7-m sample volumes from independent trials, = 0.05 . The application of the summed poisson approach is simple and can be applied iteratively as test results become available . If sample volume per trial is set at 7 m, then compliant and noncompliant tests will often be apparent after a single test . In cases where results are very close to compliance thresholds when the summed poisson method was applied to test data from three different bw treatment systems, results were readily interpreted at the per - trial and multiple trial levels . Although two systems yielded mixed results in which some trials positively rejected the null hypothesis and others did not, when summed poisson was applied, noncompliance with the discharge standard was unequivocal (table 2). Red shading indicates noncompliance and green indicates compliance with imo discharge standard for zooplankton (= 0.05). In addition to land - based testing currently underway, bw treatment systems on ships will require shipboard evaluations to (1) verify initial performance, and (2) ensure that treatment consistently meets the standard throughout the vessels lifetime. (15) the summed poisson method permits rapid and robust analyses of results and can, in some instances, provide extremely prompt performance feedback . In all probability, identical or because discharge standards are concentration - based, they apply to all vessel types, regardless of the environmental conditions of operation . If sampling protocols are standardized across vessels and meet the assumptions described above, then results from multiple vessels might also be considered as independent tests of the same treatment system . Under these circumstances the summed poisson approach allows individual installations to be assessed separately, thereby providing specific information about the performance of specific installations (single vessels) across time . Alternatively, the fleet can be assessed as a whole, yielding more generalized performance information on the treatment system across platforms . Although detailed sampling and analysis may not be feasible for frequent, routine, or continuous compliance monitoring of operational bw treatments systems,(15) there will likely be a need for targeted, comprehensive biological assessments of high - risk vessels entering ports . Results from the present analyses indicate that 7-m time - integrated samples may provide a reasonable balance of statistical power and logistic achievability when applied to zooplankton discharge . When applied to actual bw treatment test facility results, the summed poisson approach provided clear - cut results, even at sample volumes of 5 m. given the apparent power of this testing protocol, one course of action would be to conduct selected but infrequent biological assessments of bw interspersed with continuous, automated monitoring of treatment system mechanical operations and indirect measures of treatment performance, such as changes in bw physical or chemical conditions. (15) our approach is well suited for discharge testing of zooplankton (biota 50 m in dimension) at the imo discharge standard . In theory, the same basic statistical treatment should apply to organisms in the regulatory size class (10 and <50 m in minimum dimension but admonishments concerning colonial or chain - forming phytoplankton on aggregation must be considered, see table s1 and references therein), with sample volume and threshold lowered to account for higher concentration allowed in the discharge standard (<10 viable organismsml), and assuming viable organisms can be as readily detected and differentiated from dead . Phase 2 discharge standards proposed by uscg are effectively up to 1000 times more stringent than phase 1, and if implemented, will clearly require protocols (and sample volumes) that differ from what is presented here . Indeed, more sophisticated technologies for use in bw sampling, biological detection, biological viability analysis, and enumeration may be necessary for compliance testing at the uscg phase 2 standard level . Furthermore, while other sources of error must be addressed to identify proper sample volume thresholds (see supporting information) regardless of the discharge standard, this likely becomes even more important as the discharge standard becomes more stringent . There are various criteria that must be considered in establishing robust sampling protocols and methods . However, the statistical approach that is ultimately used to enforce ballast water discharge standards will influence the ecological and economic outcomes of these regulations . Consequently, it is imperative that the statistical aspects of the sampling protocols be defined . For example, it will be necessary to identify the thresholds used to classify ballast discharge as compliant or noncompliant based on the chosen value and enforcement approach . Thus, if all the organisms in 1 m of bw are counted, and a presumed innocent approach is used with = 0.05, then a ship would be classified as compliant if 15 organisms were counted . Approach is used with the same parameters, then a ship would be classified as compliant if 4 organisms were counted . Currently our understanding of how large an inoculation must be to achieve a successful invasion remains coarse. (12) a firmer comprehension of doseresponse relationships and invasion success could inform us about which regulatory approach is most appropriate, as well as whether it is crucial to differentiate concentrations that are very close to, but still exceed proposed discharge concentrations . Unfortunately, such biological information is difficult to collect and strong generalities remain elusive . Given the profound influence that these variables can have on regulatory outcome, the consequences of regulatory decisions must be described clearly . In the end, it is necessary for regulators to determine the level of environmental protection that is acceptable in accordance with scientific evidence and societal needs and desires . In the case of bw - borne biota, the scientific component of decision - making includes a specific set of target discharge standards as well as guidance about the required stringency of tests and/or monitoring procedures to provide sufficient confidence that discharge standards are achieved . Scientific analyses can inform policy makers about the levels of uncertainty associated with testing and monitoring protocols, but regulators must determine how much uncertainty is acceptable.
|
Cancer cachexia occurs most frequently in malignancy and is associated with more than 20% of cancer deaths . Patients with upper gastrointestinal cancer are especially likely to suffer from substantial weight loss, and patients with pancreatic cancer have the highest frequency of developing a cachectic syndrome . Thus the research groups and physicians dealing with pancreatic cancer are very interested in finding an effective treatment for cachectic patients . But there is still little known about this clinical issue, and our knowledge grows slowly . Much more research and many more clinical trials are needed to increase our understanding of the syndrome and to develop therapeutic strategies for one of the major symptoms of cancer . The word " cachexia " comes from the greek words " kakos " and " hexis ", meaning " bad conditions " . Cachexia is a complex metabolic status with progressive weight loss and depletion of host reserves of adipose tissue and skeletal muscle . Cachexia should be suspected if involuntary weight loss of greater than five percent of premorbid weight occurs within a six - month period . Cachexia represents the clinical consequence of a chronic, systemic inflammatory response, with high hepatic synthesis of acute - phase proteins resulting in depletion of essential amino acids . In contrast, in starvation only fat metabolism is increased while the organism tries to conserve lean body mass . In addition to metabolic changes, cachexia is often associated with anorexia . In cancer patients there can be mechanical interference such as obstructions, as well as treatment - related toxicity . In patients receiving chemotherapy or radiation, subsequent nausea, vomiting and diarrhea can contribute to weight loss . But the lack of nutrients alone cannot explain the metabolic changes seen in cachexia . In clinical trials, nutritional supplementation and dietary counseling failed to increase body weight . Several appetite - stimulating drugs have been tested in an attempt to increase the food intake of cachexia patients, but most of them had little or no effect on body weight . Only limited treatment options exist for patients with clinical cancer cachexia . In one trial, corticosteroids improved the sensation of well - being and led to increased food intake, but this effect lasted only a few weeks . Body composition analysis showed that the weight gain resulted only from increased body fat and fluid, with no change in lean body mass . Additionally, therapy with progestogens led to a decline in the response rate to chemotherapy and an increase in the frequency of thrombembolic events . Demonstrated that neuropeptid y (npy), the most potent feeding - stimulatory peptide in this cycle, is deregulated in the hypothalamic orexigenic network, leading to decreased energy intake but high metabolic demand for nutrients . High levels of leptin, a hormone secreted by adipocytes, block the release of npy . In cachexia the leptin feedback loop seems to become out of control, altering the neuropeptidergic control cycles . The second theory is based on the idea that tumor - derived factors maintain the cachectic syndrome . Postulated a factor that was extracted from the urine of cachectic patients and which induces protein degradation in skeletal muscle by upregulation of the ubiquitin - proteasome pathway . This proteolysis - inducing factor (pif) is closely related to weight loss in cachexia, and in a recent study it was shown that pif is produced in human colon cancer . A second factor extracted from the urine of cachectic patients lipid mobilizing factor (lmf) is closely related to weight loss and induces lipolysis in murine adipocytes . Lmf produces a significant increase in the ucps in brown adipose tissue, skeletal muscle and liver . Mitochondrial uncoupling proteins (ucps) 1, 2, and 3 are involved in the control of energy metabolism through thermogenesis in brown adipose tissue and possibly in skeletal muscle tissue in humans . In many animal models, overexpression of ucps (especially ucp 2) in white adipocytes and in muscle and liver tissue was associated with cachexia . However, it is still uncertain how they interact and whether they come into play at the beginning or at the end stage of the disease . Despite the controversial discussion of cachexia - inducing mechanisms uncertainty over what causes cachexia, it is quite clear that proinflammatory cytokines are linked to all pathways that induce cachexia . As mentioned, cachexia is associated with a chronic systemic inflammatory response and the elevation of acute phase proteins . High serum levels of il-1, il-6 and inf gamma are present in many cancer patients, and the levels of these cytokines seem to correlate with tumor progression . These cytokines stimulate the expression of leptin and/or mimic the hypothalamic effect of negative feedback from leptin by disarranging the signaling pathway of npy, resulting in long - term inhibition of food intake . Il-1 antagonizes npy induced feeding in rats and disrupts the orexigenic pathway of npy . On the other hand, central corticotropin - releasing factor (crf), which is upregulated by il-1, seems to influence satiety, and is a potent anorexigenic signal . Tumor necrosis factor alpha (tnf-) also increases the mrna levels of ucp2 and 3 . In combination with inf tnf- activates the transcription factor nfb that leads to reduction of myo d, a transcription factor essential for repairing damaged muscle tissue . Although il-6 is one of the key cytokines involved in the development of cachexia, the definite mechanisms have not yet been clarified . Improvements in appetite and weight gain through decreased cytokine expression after the application of corticosteroids or special antagonists like il-6 antibodies were seen over short periods, but further investigations of the cytokine system are necessary to elucidate the interaction between host and tumor - derived cytokines and to determine their effect on biochemical mechanisms . Many trials have been performed in the search for a treatment for cachexia, but most therapies have not fulfilled expectations . Currently, eicosapaentanoic acid is being tested in cachectic patients . Eicosapaentanoic acid seems to interfere with the signaling pathway of pif, and first results are promising . Although in recent years our understanding of cachexia has increased, we are still in the fledgling stages . The scientists and clinicians dedicated to finding an effective treatment for cachectic patients have their work cut out for them . Mem and pk drafted the paper . Hf provided comments and suggestions for its finalization.
|
A number of methods of reconstruction have evolved over a short period.12345678910111213141516171819202122232425 a majority of described techniques use either implants or bone tunnels for fixation of the mpfl graft . It has now been widely accepted that the reconstruction needs to be anatomical, both at the femoral and patellar insertion sites . A number of studies have confirmed the anatomy of mpfl and its relation to the bony landmarks of the femur and patella . The mpfl has a soft tissue attachment on the femoral condyle on an average 1.9 mm anterior and 3.8 mm distal to adductor tubercle, anterior to the region in between the medial epicondyle and adductor tubercle.26 on the patellar side, it has a broad attachment extending right from the superior pole of the patella extending inferiorly to almost 5060% of its medial border . The ligament therefore runs underneath the lower margin of the vastus medialis obliquus in the second layer of medial retinaculum with the superior fibers fanned out to have a soft tissue attachment onto the vastus intermedius.27 this anatomy cannot be reconstructed using patellar bone tunnels . With the patellar insertion extending high near the superior pole of the patella (soft tissue insertion of the mpfl into the vastus intermedius and not a bony insertion), none of the techniques described with bone tunnels would precisely replicate the anatomical insertion points with a reconstruction . Bone tunnels can cause further tissue trauma and increase the risk of patella fracture.2829303132 these cannot be implemented in the skeletally immature, hypoplastic patellae or cases where a patella arthroplasty has been performed . Implant fixation also forms a very rigid construct increasing medial patellar compression forces.33 these have been known to result in early patellofemoral arthrosis due to increased contact pressure . Rare cases of over constraint or mal positioning of rigid fixation points have even resulted in medial instability 34 of the patella since the rigid fixations are less forgiving . A soft tissue fixation to the extensor retinaculum over the patella other complications such as limitation of range of motion,35 arthrofibrosis,36 graft loosening,37 early hemarthrosis,3839 and painful and prominent implants 5 have been reported . On the femoral insertion point, similar methods have been devised to make a bone tunnel at the anatomical site and use screw fixation . These bone tunnels however are not advisable in skeletally immature patients as it is close to the physis . Also, bone tunnels cause additional tissue injury by avulsing remnants of the mpfl at its insertion and bone trauma . Implant related complications are also known to occur,5 and the fixation is nonforgiving and rigid, leading to overloading of the medial patellofemoral joint even due to minor errors.33 these have given compromised results, either due to the limitation of motion,35 failure to achieve normal patellofemoral mobility or even pain . Soft tissue fixations on the femoral side using the adductor magnus 3940 or the medial collateral ligament 18 for the sling are nonanatomical . Similarly, using the adductor magnus itself is also a nonanatomical construct.4142 these nonanatomical constructs cannot reproduce normal patellofemoral mobility and stability, thus compromising results with a lower score . In order to overcome these pitfalls of the current techniques, this method utilizes a soft tissue method of fixation on the femoral side using bony landmarks, thus avoiding complications related to bone tunneling and implants . Also, it results in a more normal pliable construct compared to a rigid construct with implants which is important for normal patellar mobility . Thus by avoiding implants and bone tunnels, we aimed to have lesser complications . By being more precise in the anatomical reconstruction the study was conducted to confirm if comparable or even better results than those documented in literature could be achieved implementing this implantless and bone tunnel - free technique with a low complication rate . Fifty - six knees (50 patients) were treated with mpfl reconstruction using basket weave technique in the past 49 months . Eleven cases had bilateral patellar dislocations, of which 6 patients (2 males, 4 females) underwent mpfl reconstruction for both knees . Five knees were revision cases with previously performed medial retinacular reefing with or without lateral release . A private ethics committee approval and written informed consent of all patients were obtained for the study . The cases included were those with lateral patellar instability having recurrent lateral patellar dislocation or first time dislocators with associated nonrepairable osteochondral fracture fragment with a clinically dislocatable patella . Those with a repairable osteochondral fragment from the patella underwent a medial arthrotomy with fixation of the fragment followed by repair of the medial arthrotomy by a medial retinacular advancement without mpfl reconstruction . Mpfl reconstruction was undertaken only after all knees achieved a full normal range of motion with an adequate period of appropriate preoperative rehabilitation . The meantime interval for mpfl reconstruction from the first dislocation was 1 year (range 2 weeks - 3 years) knees that were asymptomatic following rehabilitation did not undergo mpfl reconstruction . Only those presenting with symptomatic patellar instability (dislocatable or subluxating) were subjected to mpfl reconstruction . Exclusion criteria included cases of habitual patellar dislocation, chronic irreducible patella dislocation and severe patellofemoral arthrosis . Investigations included plain radiography of the knee including anteroposterior and lateral views of both knees in standing . Those with valgus alignment of knee beyond normal were subjected to an alignment view x - ray of full lower limb in standing . Mri was done in all cases to assess integrity of mpfl, presence of osteochondral fragments, trochlear dysplasia, patellofemoral articulation and associated injuries if any . Superimposition computed tomography (ct) scan was done in cases where clinical assessment suggested torsion malalignment of the femur or tibia and those having an abnormal q angle (for tt - tg distance). Those with suspected dejours 44 type c and d trochlea had a three - dimensional ct reconstruction of the lower end femur to assess the trochlear geometry . Based on the clinical and radiological correlation, these cases were subjected to either isolated mpfl reconstruction or performed along with an adjunctive procedure considered necessary for the management of the instability . Among the adjunctive procedures performed were loose body removals, limited lateral retinacular release (release of lateral patellofemoral ligament without release of patellomeniscal ligament), tibial tuberosity transfer and anterior cruciate ligament (acl) reconstruction . All loose bodies that were long standing with rounded edges or those partially resorbed with the patellar defect showing a healed lesion were excised arthroscopically . Also, fresh fragments having a size of 1 cm 2 or smaller were excised . Only knees with a tight lateral retinaculum with less than quarter patellar breadth medial mobility and a negative lateral lift off underwent a limited lateral retinacular release of the lateral patellofemoral ligament . Four knees with tt - tg distance more than 20 mm were subjected to a tibial tuberosity medialization prior to mpfl reconstruction during the surgery . One knee having a concomitant acl injury underwent an acl reconstruction [table 1]. Rest of knees underwent an isolated mpfl reconstruction . Associated pathologies and procedures along with mpfl reconstruction surgery was performed either under general anesthesia with a postoperative femoral block or under spinal anesthesia . The graft of choice is the ipsilateral gracilis with a minimum length of 210 mm . The semitendinosus was used in the nonathletic, female population or if gracilis length was insufficient . . 2 ethibond (ethicon, johnson and johnson) cinch knots on either end and is pretensioned over a graft preparation board prior to the reconstruction . A 2 cm long medial patellar skin incision was taken . The medial retinaculum was identified and incised along the medial patellar border to expose the second layer of the retinaculum [figure 1]. If the mpfl could be identified, its lower margin was defined to confirm its extent of insertion . A plane was achieved between the first and this second layer of the retinaculum from the medial patellar border to the femoral insertion point using scissors and a tissue elevator - suture passer designed by the author [figure 2]. Performing the reconstruction in this plane avoids detachment of the original mpfl that otherwise requires to be incised if the reconstruction is to be carried out deeper to this second layer . Peroperative photograph showing first layer of medial retinaculum lifted from second layer photograph of tissue elevator - suture passer a 1 cm skin incision was made in the region overlying the medial epicondyle and adductor tubercle . Palpation commenced from the adductor magnus to the first bony bump of adductor tubercle followed by the second bony prominence of the medial epicondyle . On exposure of the medial retinaculum in this region, a sharp 1 cm long incision was made up to the bone extending from the anterior margin of the medial epicondyle to the anterior margin of the adductor tubercle . The saddle shaped groove between the two bony prominences were covered by a ligamento - periosteal tissue formed by the confluence of insertion of the medial collateral ligament, medial retinaculum with the mpfl and the adductor magnus . A centimeter broad, strong sleeve of this ligamento - periosteal tissue was elevated from this saddle groove [figure 3]. Schematic diagram and (b) clinical photograph of knee showing ligamento - periosteal sleeve (*) in yellow the graft is looped up to its center underneath this ligamento - periosteal sleeve . The two limbs of the graft were then shuttled through the plane between the first and second layer of the retinaculum to be delivered through the medial parapatellar incision . The two limbs of the graft were then planned for fixation such that the proximal limb was at the superior pole . This proximal limb was fixed to the extensor retinaculum at the level of proximal extent of the native mpfl . These were the mpfl fibers that insert into the vastus intermedius at the superior pole of patella (this is a soft tissue insertion and not a bony insertion on the patella). The distal limb was fixed at the level of lower extent of the original mpfl . If this extent was not clear, then it was attached at the middle level of the medial patellar margin . To achieve a robust soft tissue fixation on the patella, sleeves of extensor retinaculum on the anterior aspect of the patella were elevated . For this, sharp vertical incisions up to the bone were made at one centimeter intervals . Alternate strips of the retinaculum are elevated using a 15 number knife passed flush parallel to the anterior bony surface of the patella and then elevated using the tissue elevator - suture passer. Thus, the graft was passed alternately below and above the extensor retinaculum sleeves on the anterior aspect of the patella . The sleeves elevated for the proximal and distal limb of the graft were also elevated alternately so that they did not coalesce together . This method of passage of proximal and distal limb of the graft through the extensor retinaculum is in a clinical photograph showing basket weave pattern of graft fixation on patella simple suturing of the graft to the sleeves might not be adequate, as it might cut through or might result in too many knots on the anterior surface . To avoid this issue, a special pretzel stitch [figure 5a d] was designed for fixing the graft to each of the sleeves . This stitch cinched the sleeve around the graft and simultaneously transfixes the graft to the sleeve thus giving a firm fixation to the sleeves . These pretzel stitches are taken at each sleeve level where the graft passes above or below them . Each level of suturing beyond the first suture provides a backup fixation for the previous thus reinforcing the fixation . A total of three or four fixation sutures were ensured for each limb of the graft [figure 6]. Peroperative photographs (1 - 4) showing steps of technique schematic diagram showing final medial patellofemoral ligament construct the proximal limb of the graft was sutured to these sleeves of the retinaculum keeping the graft taut, patella centered and the knee in 30 flexion . Thirty - one knees had dejours type a or b and 12 had type c trochlea . In presence of trochlear dysplasia, the bony stability to the patella beyond 30 flexion is compromised therefore the distal limb is fixed by suturing it with the knee in 90 flexion . This differential fixation ensures stability and normal mobility of the patella throughout the range of motion . All knees irrespective of the status of trochlear dysplasia underwent this differential method of graft fixation . The first incised layer of retinaculum was then sutured back to the medial margin of the patella on its anterior aspect to eliminate the slack in the retinaculum . This suturing was done keeping the knee in 30 of flexion thus completing the procedure . Postoperative arthroscopic view shows that the reconstruction and fixation are extracapsular and anatomical extending from the region between the medial epicondyle and adductor tubercle to the upper half of the medial margin of patella [figure 7]. Arthroscopic view showing medial patellofemoral ligament extracapsular and anatomic the knee was immobilized in 30 flexion in a rigid long knee brace for 2 weeks with the limb with toe touch weight bearing . Active range of motion and quadriceps toning exercises are started following suture removal (1014 days). The brace was discarded after 6 weeks or once the patient regains strength and good quadriceps control . One expects to regain full range of motion by 23 months postoperatively . Following this foot, ankle, the graft of choice is the ipsilateral gracilis with a minimum length of 210 mm . The semitendinosus was used in the nonathletic, female population or if gracilis length was insufficient . . 2 ethibond (ethicon, johnson and johnson) cinch knots on either end and is pretensioned over a graft preparation board prior to the reconstruction . The medial retinaculum was identified and incised along the medial patellar border to expose the second layer of the retinaculum [figure 1]. If the mpfl could be identified, its lower margin was defined to confirm its extent of insertion . A plane was achieved between the first and this second layer of the retinaculum from the medial patellar border to the femoral insertion point using scissors and a tissue elevator - suture passer designed by the author [figure 2]. Performing the reconstruction in this plane avoids detachment of the original mpfl that otherwise requires to be incised if the reconstruction is to be carried out deeper to this second layer . Peroperative photograph showing first layer of medial retinaculum lifted from second layer photograph of tissue elevator - suture passer a 1 cm skin incision was made in the region overlying the medial epicondyle and adductor tubercle . Palpation commenced from the adductor magnus to the first bony bump of adductor tubercle followed by the second bony prominence of the medial epicondyle . On exposure of the medial retinaculum in this region, a sharp 1 cm long incision was made up to the bone extending from the anterior margin of the medial epicondyle to the anterior margin of the adductor tubercle . The saddle shaped groove between the two bony prominences were covered by a ligamento - periosteal tissue formed by the confluence of insertion of the medial collateral ligament, medial retinaculum with the mpfl and the adductor magnus . A centimeter broad, strong sleeve of this ligamento - periosteal tissue was elevated from this saddle groove [figure 3]. Schematic diagram and (b) clinical photograph of knee showing ligamento - periosteal sleeve (*) in yellow the graft is looped up to its center underneath this ligamento - periosteal sleeve . The two limbs of the graft were then shuttled through the plane between the first and second layer of the retinaculum to be delivered through the medial parapatellar incision . The two limbs of the graft were then planned for fixation such that the proximal limb was at the superior pole . This proximal limb was fixed to the extensor retinaculum at the level of proximal extent of the native mpfl . These were the mpfl fibers that insert into the vastus intermedius at the superior pole of patella (this is a soft tissue insertion and not a bony insertion on the patella). The distal limb was fixed at the level of lower extent of the original mpfl . If this extent was not clear, then it was attached at the middle level of the medial patellar margin . To achieve a robust soft tissue fixation on the patella, sleeves of extensor retinaculum on the anterior aspect of the patella were elevated . For this, sharp vertical incisions up to the bone were made at one centimeter intervals . Alternate strips of the retinaculum are elevated using a 15 number knife passed flush parallel to the anterior bony surface of the patella and then elevated using the tissue elevator - suture passer. Thus, the graft was passed alternately below and above the extensor retinaculum sleeves on the anterior aspect of the patella . The sleeves elevated for the proximal and distal limb of the graft were also elevated alternately so that they did not coalesce together . This method of passage of proximal and distal limb of the graft through the extensor retinaculum is in a basket weave pattern [figure 4]. Clinical photograph showing basket weave pattern of graft fixation on patella simple suturing of the graft to the sleeves might not be adequate, as it might cut through or might result in too many knots on the anterior surface . To avoid this issue, a special pretzel stitch [figure 5a d] was designed for fixing the graft to each of the sleeves . This stitch cinched the sleeve around the graft and simultaneously transfixes the graft to the sleeve thus giving a firm fixation to the sleeves . These pretzel stitches are taken at each sleeve level where the graft passes above or below them . Each level of suturing beyond the first suture provides a backup fixation for the previous thus reinforcing the fixation . A total of three or four fixation sutures were ensured for each limb of the graft [figure 6]. Peroperative photographs (1 - 4) showing steps of technique schematic diagram showing final medial patellofemoral ligament construct the proximal limb of the graft was sutured to these sleeves of the retinaculum keeping the graft taut, patella centered and the knee in 30 flexion . Thirty - one knees had dejours type a or b and 12 had type c trochlea . In presence of trochlear dysplasia, the bony stability to the patella beyond 30 flexion is compromised therefore the distal limb is fixed by suturing it with the knee in 90 flexion . This differential fixation ensures stability and normal mobility of the patella throughout the range of motion . All knees irrespective of the status of trochlear dysplasia underwent this differential method of graft fixation . The first incised layer of retinaculum was then sutured back to the medial margin of the patella on its anterior aspect to eliminate the slack in the retinaculum . This suturing was done keeping the knee in 30 of flexion thus completing the procedure . Postoperative arthroscopic view shows that the reconstruction and fixation are extracapsular and anatomical extending from the region between the medial epicondyle and adductor tubercle to the upper half of the medial margin of patella [figure 7]. Arthroscopic view showing medial patellofemoral ligament extracapsular and anatomic the knee was immobilized in 30 flexion in a rigid long knee brace for 2 weeks with the limb with toe touch weight bearing . Active range of motion and quadriceps toning exercises are started following suture removal (1014 days). The brace was discarded after 6 weeks or once the patient regains strength and good quadriceps control . One expects to regain full range of motion by 23 months postoperatively . Following this foot, ankle, hip and core the mean followup was of 26 months (range 7 months - 4 years). Cases were assessed at 1 month intervals until one achieved full range of motion, followed by 3 monthly assessments until they achieved normal function of the knee . Remainder 5 did not fit our inclusion criteria for mpfl reconstruction for the second knee as they recovered well with appropriate rehabilitation . Those who underwent bilateral mpfl reconstruction had the full normal function of the first knee followed by surgery for second knee . Two knees with patellar osteochondral fragments had minimal anterior knee pain following running, jumping and squatting for an average of 1 year following which the pain resolved, and they could get back to full normal sporting activities . Sixteen knees had grade 2 or 3 chondral changes on the medial patellar facet or lateral trochlea . Three female patients from the study group were found to be apprehensive to pain with the rehabilitation protocol and regained full flexion with normal function at 56 months postoperatively as compared to 3 months on an average for remainder cases . Those operated bilaterally showed a more rapid recovery in the second knee with respect to the range of motion and resumption of activities as compared to the first knee . Four knees had vastus medialis wasting as compared to the contralateral normal knee at their final followup . Their mean koos score was near normal following the mpfl reconstruction with return to all normal activities without any recurrence of instability . Intraoperatively, the mpfl reconstruction construct was found intact despite the patella fracture [figure 8]. It was evident from this example that this mpfl reconstruction was a sturdy and reliable construct . She however had restriction of motion up to 110 at the last followup 1 year after the fracture fixation . Intraoperative photograph of 8 months postoperative fracture patella showing good incorporation of graft and the intact medial patellofemoral ligament graft construct the remainder cases had normal, symptom free, painless function with near 100 points (koos) at their final followup in all parameters [figure 9]. Those into sporting activity, without any quadriceps wasting could resume back to preinjury level of sports in 45 months . Cases with unilateral dislocations could get a sense of normalcy as compared to the contralateral knee and expressed a subjective feeling of the knee being as good as the opposite normal knee . There was no case with recurrence of dislocation following mpfl reconstruction . A chart cum table showing koos score the mean kujala score for these 56 knees improved to 99.69 from a preoperative value of 64.3 . The mean koos scoring was near normal (near 100 in all parameters) for all except the case with patella fracture . No complications were found with regards to growth plate disturbance or loss of stability or motion in the 21 skeletally immature patients (age range 919 years). Since there are no implants or bone tunnels in this technique, their related complications were completely averted . This technique with soft tissue fixation on the patellar and femoral site has given good results . It is more forgiving and does not result in an over constraint of the patellofemoral joint or limitation of flexion unlike rigid fixation methods . Rigid fixation methods on the patellar side are nonanatomical and therefore may not restore normal physiometricity and biomechanics of the patellofemoral joint . A radiological landmark for insertion point of mpfl on femur has been described by schttle et al.45 however, it is important to go into the details of this article and to note that one of the eight mpfl insertions studied was in fact found to be posterior to the posterior line of schottles area . The point suggested by the author is just an average of all the points in the 8 cadaveric knees studied . The schottle point therefore does not give us the precise radiological point of insertion of mpfl on the femur for all cases . Moreover in the skeletally immature knee, this radiographic marking cannot be followed as it has been shown to be incorrect for these knees . Following this radiological point to guide ones we therefore decided to eliminate the use of this radiological marker for our mpfl reconstructions and preferred to use the more reliable method of anatomic landmarks . The mpfl just as any other ligament attachments shows consistent attachment in relation to bony prominences . It is well documented that the mpfl attaches on the femur just anterior to the region between the adductor tubercle and the medial epicondyle.26 these palpable bony prominences were used as landmarks for precise anatomic surgical reconstruction and to avoid the errors of using an imprecise radiological marker . Since the femoral attachment is crucial for the anatomical reconstruction, this more reliable method of using the medial epicondyle and adductor tubercle as the guide for reconstruction reduced errors and avoided unnecessary fluoroscopy . Careful palpation of bony landmarks and elevation of ligamento - periosteal sleeves, extensor sleeves over the patella can avoid intraoperative errors . Graft fixation with pretzel stitches gives a good fixation . With adequate precautions and precisely following all the steps of the procedure, one can ensure optimal results . No technique related complications were encountered in cases operated with this method of reconstruction . This basket weave technique of mpfl reconstruction has a number of advantages over other techniques . It therefore avoids bone tunnels and implant related complications and physeal disruption (b) the technique avoids the use of intraoperative fluoroscopy and relies on bony landmarks for fixation points . It therefore gives a precise anatomical reconstruction, being a more precise anatomical construct it possibly gives more reliable results (c) it does not disrupt the capsule or any other structures around the joint as in the all arthroscopic techniques described . It is therefore more biological, tissue preserving, minimally invasive and less traumatic procedure (d) the soft tissue fixation is a firm but less rigid construct than tunnel fixations and therefore prevents erroneous over constraint of the medial patellar forces . The postoperative examination therefore demonstrates a normal mediolateral mobility with a normal soft endpoint with a high patient satisfaction scores in their followup . (f) the procedure can be utilized for the skeletally immature cases, those with hypoplastic patellae or even for cases with patellar arthroplasty . (g) since there are no bone tunnels, a revision surgery if ever necessary would not be complicated as a result of this primary procedure . (h) the procedure is also economical since it avoids the use of expensive implants . The limitations of this study were that it was not a randomized, comparative or blinded study, a small sample size, and a single operating surgeon . However, the aim of the study was to assess the efficacy of this technique of mpfl reconstruction for its rate of complications and compare the results to other series currently reported in literature . A majority of the procedures described for mpfl reconstruction have shown good results with kujala scores ranging from 83 to 96 . If the case with patellar fracture is excluded from the study, the average kujala score would be 99.85 which is higher than any of the other reported series253035374041464748495051 [table 2]. This technique has a number of advantages over the other currently described techniques in literature . It also has a broader applicability since there are no limitations due to patient age, bone structure or arthroplasty . Comparative results of mpfl reconstructions in literature we conclude that an implantless, tunnel - free mpfl reconstruction using this technique could reduce complications, simplify the procedure and give optimal outcomes . Therefore, this is possibly a well suited option for an mpfl reconstruction where indicated.
|
Antiretroviral therapy (art) has brought important benefits to hiv - infected patients, such as increased survival, better quality of life, significant reduction in the incidence of opportunistic infections and lower costs related to ambulatory care and hospitalization.1,2,3 the brazilian national std / aids program of the ministry of health has guaranteed universal and free access to art since 1996.4 patients diagnosed in that year had a median survival three times longer than those diagnosed in 1995, clearly indicating the benefits of art.5 the clinical goals of hiv treatment and care, including maximizing survival and improving quality of life, are optimally accomplished only through a high - level of adherence to art and, consequently, a durable suppression of the hiv viral load.6 non - adherence has become a common cause of therapy failure, with failure rates varying from 7.0% to 43.0% in different health care settings worldwide.714 factors potentially associated with non - adherence include characteristics related to the antiretroviral regimen (e.g., complexity of therapy, pill burden, food requirements, adverse reactions), a patient s perception of the treatment, the interference of art in a patient s daily life, symptoms of aids and level of education, among others.815 however, there are few published epidemiologic studies that investigate the difficulties reported by patients initiating antiretroviral therapy, and to our knowledge, none in brazil . Patients may feel emotionally unprepared for treatment due to a lack of understanding and/or belief in art, leading to increased difficulties with everyday treatment management.1617 identifying and understanding the difficulties that arise in the beginning of treatment may help prevent further episodes of non - adherence and potentially increase long - term adherence with sustainable clinical benefits and improvement in patient quality of life.16,17 the present study aimed to describe the degree of difficulty with art reported by hiv - infected patients in public aids reference centers using two cross - sectional analyses issued subsequent to the beginning of treatment (after one and seven months). In addition, we explored potential factors associated with such difficulties, including sociodemographic, psychosocial, clinical and health care - related variables . This analysis is part of a prospective concurrent study conducted at two public health referral centers in a large metropolitan city in brazil . The objective of the main project was to estimate the incidence of non - adherence to art among patients initiating treatment and the factors associated with it . Briefly, eligibility criteria were serologic - confirmed hiv infection; no prior history of antiretroviral use; age over 18 years old (or 16 years old for pregnant women); having had one s first antiretroviral regimen dispensed in one of the centers and voluntarily participation consent . Patients were interviewed after first receiving medication (baseline interview), and subsequently in the first, fourth and seventh month of follow - up . The project was approved by the ethical committee board of both participating centers and the federal university of minas gerais (etic 106/99). Data were collected using a pre - tested semi - structured questionnaire consisting of closed and short open - ended questions . Face - to - face interviews were conducted by trained research personnel in private rooms . Sociodemographic (e.g., gender, age, schooling, income), behavioral (e.g., disclosure of hiv - seropositive status, condom use and alcohol and injection drug use), health services and clinical characteristics (e.g., difficulty of access to services, embarrassment, understanding of medical orientation) were obtained during baseline interviews, while data on arv use (e.g., difficulties with the treatment, prescribed regimens, change in regimen, pill burden, adverse reactions and adherence) were obtained from each follow - up interview . Additionally, the cdc clinical classification18 and cd4 + t - lymphocyte count were obtained from medical charts during the study period . Symptoms of anxiety and depression were assessed using the hospital anxiety and depression scale during the baseline interview.19 disclosure of one s hiv - seropositive status was self - reported and defined as having communicated an hiv positive result to a close acquaintance such as a relative, friend or sexual partner . For the current analysis, the outcome measurement (i.e., the difficulty of antiretroviral therapy use) was assessed in a cross - sectional approach at the first (first month) and third (seventh month) visits . We used only these visits as points of comparison because the time between the first and second visits was brief . Patients were asked to classify the degree of difficulty of their treatment at each visit as very high, high, medium, low, or very low and to justify their choice . The reported reasons were classified as problems associated with adverse reactions, scheduling, pill burden, emotional status, adaptation, social interactions, health care service, organoleptic properties of the drugs or dietary interference . Descriptive analysis was conducted for the reported difficulties while crude associations were assessed by chi - square test . The degree of difficulty was categorized as a dichotomous variable, comparing all values falling between medium and very high difficulty to those in the range of low to very low difficulty, due to power considerations . The magnitude of the associations between putative risk factors and the degree of difficulty with treatment was estimated by the odds ratio (or) with a 95% confidence interval (95% ci). The independent effect of potential exposure variables was assessed by multivariate analysis using logistic regression for each visit . All variables with p - values equal to or less than 0.20 obtained in the univariate analysis a backward deletion strategy was applied, and those variables with p - values equal to or less than 0.05 remained in each of the final models . Goodness of fit was evaluated using the hosmer - lemeshow test,20 while the sas system and egret for windows, were used for data analysis, and paradox was used for data storage . This analysis is part of a prospective concurrent study conducted at two public health referral centers in a large metropolitan city in brazil . The objective of the main project was to estimate the incidence of non - adherence to art among patients initiating treatment and the factors associated with it . Briefly, eligibility criteria were serologic - confirmed hiv infection; no prior history of antiretroviral use; age over 18 years old (or 16 years old for pregnant women); having had one s first antiretroviral regimen dispensed in one of the centers and voluntarily participation consent . Patients were interviewed after first receiving medication (baseline interview), and subsequently in the first, fourth and seventh month of follow - up . The project was approved by the ethical committee board of both participating centers and the federal university of minas gerais (etic 106/99). Data were collected using a pre - tested semi - structured questionnaire consisting of closed and short open - ended questions . Face - to - face interviews were conducted by trained research personnel in private rooms . Sociodemographic (e.g., gender, age, schooling, income), behavioral (e.g., disclosure of hiv - seropositive status, condom use and alcohol and injection drug use), health services and clinical characteristics (e.g., difficulty of access to services, embarrassment, understanding of medical orientation) were obtained during baseline interviews, while data on arv use (e.g., difficulties with the treatment, prescribed regimens, change in regimen, pill burden, adverse reactions and adherence) were obtained from each follow - up interview . Additionally, the cdc clinical classification18 and cd4 + t - lymphocyte count were obtained from medical charts during the study period . Symptoms of anxiety and depression were assessed using the hospital anxiety and depression scale during the baseline interview.19 disclosure of one s hiv - seropositive status was self - reported and defined as having communicated an hiv positive result to a close acquaintance such as a relative, friend or sexual partner . For the current analysis, the outcome measurement (i.e., the difficulty of antiretroviral therapy use) was assessed in a cross - sectional approach at the first (first month) and third (seventh month) visits . We used only these visits as points of comparison because the time between the first and second visits was brief . Patients were asked to classify the degree of difficulty of their treatment at each visit as very high, high, medium, low, or very low and to justify their choice . The reported reasons were classified as problems associated with adverse reactions, scheduling, pill burden, emotional status, adaptation, social interactions, health care service, organoleptic properties of the drugs or dietary interference . Descriptive analysis was conducted for the reported difficulties while crude associations were assessed by chi - square test . The degree of difficulty was categorized as a dichotomous variable, comparing all values falling between medium and very high difficulty to those in the range of low to very low difficulty, due to power considerations . The magnitude of the associations between putative risk factors and the degree of difficulty with treatment was estimated by the odds ratio (or) with a 95% confidence interval (95% ci). The independent effect of potential exposure variables was assessed by multivariate analysis using logistic regression for each visit . All variables with p - values equal to or less than 0.20 obtained in the univariate analysis a backward deletion strategy was applied, and those variables with p - values equal to or less than 0.05 remained in each of the final models . Goodness of fit was evaluated using the hosmer - lemeshow test,20 while the sas system and egret for windows, were used for data analysis, and paradox was used for data storage . Of the 406 participants enrolled in the study, 362 (89.2%) patients returned for the first and 218 (53.7%) for the third visit after initiating art . Twelve and nine patients did not classify the degree of difficulty of their treatment in the first or third visits, leaving 350 (86.2%) and 209 (51.5%) patients for analysis, respectively . No difference was observed when comparing the two visits for most variables, although there were fewer participants in the third visit . Descriptive data indicated that, for both visits, most participants were male, younger than 35 years old, and had less then 8 years of schooling, a low individual monthly income and no health insurance (table 1). While more than half of the sexually - active participants reported always using condoms in the last month, fewer patients reported alcohol or injection drug use for both periods . Similarly, most patients had disclosed their hiv - seropositive status to relatives or friends while fewer participants declared embarrassment during clinic visits, reported some difficulty of access to the health service or were receiving psychotherapy . Clinical markers indicated high proportions of patients with lower cd4 + t - lymphocyte count (200 cells / mm) or with cdc clinical classification b or c. protease inhibitors were commonly prescribed, while a reasonable proportion of patients reported more than four adverse reactions or had a low understanding of their prescription s medical orientation . Overall, 51.4% (n=180) patients found their treatment to be of medium to high difficulty in the first visit while this rating frequency dropped to 37.3% (n=78) in the third visit (table 2). Adverse reactions were the main reason reported (33.3%), followed by complex scheduling (23.9%), among those reporting medium to high degree of difficulty in the first visit . Less frequent reasons were those associated with emotional status (9.4%), social interaction (7.2%), pill burden (6.7%), health care service (6.1%) and the organoleptic properties of the drugs (5.6%). On the other hand, adverse reactions only accounted for 19.2% and scheduling became the foremost difficulty by the third visit (37.2%). Among those with less difficulty with the treatment overall, the main reason reported was scheduling, while there was an increase in treatment adaptation over time (23.5% and 32.1%, for the first and third visits, respectively) (table 2). Univariate analysis indicated similar proportions of patients with increased difficulty with treatment across age, schooling, income, condom, alcohol or injection drug use, for both visits . Although more patients reported a change in regimen in the first visit, this was not associated with greater difficulty with treatment (data not shown). On the other hand, at the first visit, an increased degree of difficulty (p - value <0.05) was found for those who disclosed their hiv - seropositive status, reported embarrassment during clinic visits, had a higher cd4 + t - lymphocyte count (> 200 cells / mm), presented moderate to severe symptoms of anxiety, had 4 adverse reactions and had experienced a longer time period between the first hiv medical visit and the first antiretroviral prescription (> 3 months). Borderline significance was observed for difficulty of access to services, psychotherapy attendance and being clinically asymptomatic (table 3). Fewer factors were statistically associated (p - value <0.05) with difficulty with treatment in the third visit, including higher cd4 + t - lymphocyte counts (> 200 cells/ mm), arv antiretroviral regimen with protease inhibitor, daily pill burden (7 pills), use of other medication, 4 adverse reactions and low understanding of medical orientation . It should be noted that women had more difficulties with treatment in the third visit, although this result is only of borderline significance (p=0.068). Adjusted or with 95% ci because women showed a statistically - independent borderline association during the third visit (p=0.081), we decided to retain this variable in the final model of each visit for comparison purposes . Hiv - seropositive status disclosure, 4 adverse reactions reported, presence of symptoms of anxiety and absence of psychotherapy were independently associated with the degree of difficulty in the first visit while cdc clinical category a, pill burden (> 7 pills), use of other medication, 4 adverse reactions reported and low understanding of one s medical orientation were associated with difficulties during the third visit, in addition to gender . By using several simple questions, we were able to assess patient perception of difficulties related to initial art . We chose to compare visits at two separate, cross - sectional time points due to power considerations, despite the known limitation of cross - sectional designs with regard to causal inferences . However, we should emphasize that no difference was observed with regard to non - participation rates and most variables were similarly distributed between the two periods . In addition, patients at these centers represented approximately 90% of all reported aids cases during the study period for the region . Notably, a high proportion of patients indicated a high degree of difficulty in the beginning of treatment (51.4%). Health care - related variables seem to have played a more important role in the first visit, while treatment and clinical characteristics were more prominent in the third visit . Although most sociodemographic variables were not statistically associated with our outcome of interest, women tended to report more difficulties, but only for the third visit, and this with borderline significance . This is corroborated by other data indicating that women may have higher rates of non - adherence21 or a poorer quality of life.22 because of the need to cope with their partners and/or children s treatment, women often fail to adhere to their own treatment, which may partially explain the finding from the third visit.23 factors related to health care providers are crucial for patients initiating art therapy, including compliance to regular clinic visits, counseling, availability of support services and a multidisciplinary approach . A complete understanding of the complexity of the regimen, side effects and scheduling, among other concerns, may help patients deal with their medication with less difficulty . In addition, earlier access to care and counseling before actual art may help prepare patients for long - term treatment effects and reinforce the need for high adherence . As shown, patients with a longer time between their initial medical visit and their antiretroviral prescription and those who reported embarrassment were more likely to have increased difficulties with the treatment in the first visit, although these results did not remain in the final statistical model . Factors such as irregular medical visits, discontinuation of their clinical follow - up24 and poor health professional - patient relationships25,26 may indirectly explain such findings . In addition, particularly related are the lack of psychotherapy and the presence of moderate - to - severe symptoms of anxiety, which were also associated with increased difficulty in the first visit . This may clearly indicate the lack of adequate psychiatric counseling by trained professionals in these services before treatment started, as shown in other studies27 . Although adverse reactions remained statistically significant in both visits, they were more common in the first visit and indicated a stronger early effect of treatment . They were also more commonly cited as the main reason for difficulty with treatment in the first relative to the third visit, at rates of 33.3% and 19.2%, respectively . This is consistent with the literature, which indicates that adverse effects are related to a decrease in the quality of life and low adherence among hiv - treated patients.21,2830 however, art is a dynamic phenomenon, which changes over time, as patients tend to adapt their daily routine to regimen scheduling and more readily learn how to identify and deal with side effects.31 as shown, better scheduling and easier adaptation were the most common reasons reported by those patients with low to very low difficulty in the third visit (34.4% and 32.1%, respectively). However, pill burden, the inclusion of regimens with protease inhibitor and the additional use of other medications over time are factors which also tend to create more difficulties . Additionally, it should be noted that poor understanding of medical orientation remained a predictor of difficulties only for the third visit . This may indicate that, even if adequately counseled when beginning treatment, long - lasting and sustained good levels of information may not be feasible if routine counseling and reminders by health professionals are not continuously received by patients . Finally, the association of a higher cd4 + cell count and the asymptomatic patient designation (cdc classification a) with increased difficulties may reflect a lower perception of these patients with regard to the need for treatment, and thus a lower threshold for dealing with the daily burden of art regimens . Findings from these analyses suggest the need for early assessment of factors associated with increased difficulties and therefore the need to identify patients who are at a greater risk of lower adherence before starting treatment . Health care professionals and aids referral services must develop focused interventions to address modifiable factors such as compliance with medical visits, counseling, improved physician - patient relationships and better arv orientation to achieve immediate and sustainable adherence.
|
The influence of diet on human health has been studied for a long time . In the fourth century bc, hippocrates already stated: let food be your medicine and medicine be your food . This theory was again recalled in the nineteenth century thanks to ludwig feuerbach who wrote man is what he eats . Today recent studies have shown that our diet is an important factor which could contribute not only to the development but also to the inhibition of chronic diseases, including osteoporosis, diabetes, cancer, atherosclerosis, cardiovascular disease, neurodegenerative diseases and obesity (virmani et al . 2006, 2013; joseph et al . 2009; lillycrop and burdge 2012). It is possible due to nutritional factors, which may induce epigenetic changes also via direct influence on gene expression (alam et al . 2012). In the late twentieth century, nancy fogg - johnson and alex meroli created a new term which combines two fields of science: nutrition and genetics, named nutrigenomics . The aim of nutrigenomics is to study how various food ingredients affect the expression of specific genes and therefore provide tools to understand and control the worldwide epidemic of specific chronic diseases . It has been proven that these diseases more often arise from dysfunctional biological networks, instead of single common gene mutation (liu et al . 2010; ferguson et al . 2007a, b; astley 2007). Dietary interventions may induce changes in the metabolic and inflammatory state by modulating the expression of important genes involved in the chronic disorders (lottenberg et al . This particularly applies to biologically active substances which have a protective influence on the body . For example, recent studies have shown that polyunsaturated fatty acids (pufa) downregulate atp - binding cassette transporter a-1 (abca-1), which results in reductions in hdl - c concentrations . Pufa suppress the liver x receptor / retinoid x receptor (lxr / rxr) gene responsible for abca-1 synthesis, which is a transporter involved in the hdl formation (uehara et al . Furthermore, pufa modulate expression of several genes involved in oxidative processes (such as ppar-), while impairing the sterol - regulatory element binding proteins (srebps) involved in lipogenesis (hannah et al . A different study demonstrated that diet enriched with anti - inflammatory mixture containing resveratrol, green tea extract, -tocopherol, vitamin c, omega-3 polyunsaturated fatty acids and tomato extract affected genes involved in inflammatory processes, oxidative stress and metabolism (bakker et al . Also various dietary components including omega-3 fatty acids, plant flavonoids and carotenoids have been demonstrated to modulate gene expression, by decreasing inos and cox-2 gene expression induced by gliadin in raw 264.7 macrophages stimulated with ifn-. Therefore, these compounds could preserve intestinal barrier integrity, play a protective role against toxicity of gliadin peptides and have a role in nutritional therapy of, for example, celiac disease (ferretti et al . 2012; de stefano et al . 2007). Taking the latest data from the fields of nutrigenomics into consideration, the aim of the present study was to evaluate the influence of long - term (14 months) use of biologically active substances - enriched diet (base - diet) containing the mixture of polyphenolic compounds, -carotene, probiotics and n-3 and n-6 polyunsaturated fatty acids on transcriptomic profile of rats liver . However, in the present study we did not want to investigate the mechanisms of action of the individual components, as these are already known . The main emphasis has been placed on the possible cumulative action of these compounds in the situation when they were added simultaneously as ingredients of semi - synthetic diet . Since 14-month period in case of rats is more than half of their life s span, the obtained results could be of great value . Experiment was carried out on thirty - six 8-week - old male sprague dawley rats (charles river laboratories, germany). The environment was regulated at 22 0.5 c, air humidity of 50% on a 12 h/12 h l / d photoperiod throughout the entire experiment . The body weight and animals were divided into two groups: a control group (n = 18) and an experimental group (n = 18). Rats from both groups were receiving for 14 months semi - synthetic diets (control and base - diet) formulated according to the nutritional requirements for laboratory animals (nrc 1995) and are described in table 1 . Application of the semi - synthetic diet allowed the elimination of the additional impact of biologically active compounds contained in commercially available diets . Base - diet was additionally enriched with the following biologically active compounds: 6% of salmon fat replacing lard (to increase the level of unsaturated fatty acids), 8% of hydrolysed water extract from small - leaved linden (tiliacordata) inflorescence (as a source of antioxidant compounds), 8% of puree from giant pumpkin (curcubitamacima) (the source of beta - carotene) and 1% of two strains of bacteria with documented probiotic activity: lactobacillusacidophilus la-5 and bifidobacteriumanimals ssp . Exact composition of macronutrients, micronutrients and vitamins mixtures included in the experimental diets is presented in table 2.table 1composition of diets used for 14-month - long feeding of ratscontrol diet (g / kg diet)base - diet (g / kg diet)rapeseed oil10.020.0salmon fat0.060.0lard90.020.0hydrolysed water extract from linden (tilia cordata) inflorescence0.080.0puree from pumpkin (cucurbita maxima)0.080.0probiotic (la5/bb12)0.01.0mixture of macronutrients36.336.3mixture of micronutrients0.50.5mixture of vitamins10.010.0 l - methionine2.22.2casein200.0200.0wheat starch482.0465.0potato starch10.010.0water144.00.0saline15.015.0table 2composition of the mixtures of macronutrients, micronutrients and vitamins used in control and base - diet fed to rats for 14 monthsmacronutrients mixture composition (g / kg of mix) cahpo4 2h2o27.89 k2hpo4 2.43 nacl0.92 k2so4 2.04 caco3 0.63 na2hpo4 12h2o1.61 mgo0.75micronutrients mixture composition (g / kg of mix) c3h4(oh)(coo)3fe x 3h2o3.76 zn(ch3coo)2 2h2o0.79 mnco3 2.34 cu(ch3coo)2 h2o0.5 kj0.004 c3h4(oh)(cooh)3 ad 100 gvitamins mixture composition (mg / kg of mix) vitamin a0.69 vitamin d3 0.5 vitamin e98.2 para - aminobenzoic acid100.0 inositol100.0 niacin40.0 ca - pantothenate40.0 vitamin b2 8.0 vitamin b1 5.0 vitamin b6 5.0 composition of diets used for 14-month - long feeding of rats composition of the mixtures of macronutrients, micronutrients and vitamins used in control and base - diet fed to rats for 14 months the content of biologically active substances in feed was measured as follows . The fatty acid content was determined both in the raw ingredients and in the feed samples using gas chromatography (table 3). Quantitative analysis of the total polyphenolic compounds in the hydrolysed water extract from small - leaved linden inflorescence was made using the method with folin reagent (1 n) in the presence of na2co3 (20%). The analysis of beta - carotene and other carotenoids content was performed using high - performance liquid chromatography coupled with electrochemical detection (hplc ecd).table 3the fatty acid profiles in control and base - dietsfatty acidscontrol dietbase - dietsaturated (%) 32.7017.24monounsaturated (%) 32.4430.75polyunsaturated (%) 10.4318.3220:5 n-3 (%) 0.022.1022:6 n-3 (%) 0.023.60sum of n-3 fatty acids (%) 2.909.02sum of n-6 fatty acids (%) 7.549.42 the fatty acid profiles in control and base - diets after 3 and 14 months of experiment, animals from each experimental group (n = 9) were euthanized by exsanguination under general anaesthesia with the isoflurane . Liver samples were frozen with liquid nitrogen immediately after collection and stored at 80 c until extraction . Total rna was extracted with rneasy lipid tissue mini kit (qiagen, germany) following the manufacturer s recommended protocol . Subsequently, potential genomic dna contamination was eliminated using deoxyribonuclease i amplification grade (sigma, usa) and rneasyminelute cleanup kit (qiagen, germany). Rna quantity and quality was measured using nanodrop 2000 (nanodrop technologies, usa) and bioanalyzer (agilent technologies, usa). To ensure optimal data quality, only rna samples with rin number 8.8 the analysis of gene expression profile was performed using sureprint g3 rat gene expression microarray, 8 60 k (agilent technologies, usa). The low input quick amp labeling kits (agilent, usa) was used to amplify and label target rna to generate complementary rna (crna) for oligo microarrays used in gene expression profiling . Experiment was performed using a common reference design, where the common reference was rna from 10-week - old healthy rats not participating in the experiment, housed for 2 weeks in the same room with experimental rats . On each two - colour microarray, 300 ng of crna from the control rats (labelled by cy3) and 300 ng of crna from the rats fed with base - diet (labelled by cy5) were hybridized . Microarray hybridization was performed with the gene expression hybridization kit (agilent technologies, usa), according to the manufacturer s protocols . Rna spike in kit (agilent technologies, usa) was used as an internal control . In total, 24 microarrays, one for each animal, were done . The final analysis was carried out on 22 microarrays, which passed through the agilent feature extraction s and the gene spring s control (one microarrays from the control group after 3 months of experiment and one from the experimental group after 3 months of experiment were rejected due to insufficient quality). Data were extracted and background was subtracted using the standard procedures contained in the agilent feature extraction (fe) software version 10.7.3.1 . The statistical analysis was performed using gene spring 12 software (agilent, usa). The samples underwent quality control and the results showed that each sample had similar qc metric profile . The next step was filtering probe sets by flags to remove poor - quality probes (absent flags). The statistical significance of the differences was evaluated using one - way anova and tukey s hsd post hoc test (p <0.05). A multiple testing correction was performed using benjamini and hochberg false discovery rate (fdr) <5% . Microarray data were deposited at the gene expression omnibus data repository under the number gse51657 according to the miame requirements . To identify the list of signalling pathways, the microarray data were analysed using pathway studio 6.0 (ariadne genomics). To verify microarray results, the expressions of three randomly selected genes (gpx1, irf7 and prodh) were measured using real - time pcr method . Primers were designed using primer - blast software (ncbi database) and then checked for secondary structures using oligo calculator (free on - line access). The secondary structures of the amplicon were examined using m - fold web server (free on - line access). As a house keeping gene actb were used (huang et al . The sequences of the primers are listed in table 4.table 4primer sequences for real - time pcr verification of microarray resultsgene s namenm numbersense primer (53)antisense primer (53)tested genes gpx1nm_030826.2cctaaggcattcctggtatcccatctgaggggatttttct irf7nm_001033691.1gtctagcaccaatagtctctacaaggtccactagagatgaca prodhnm_001135778.1cacaggtgccttaactatgttctaactccttcatcctgcacaacreference gene actbnm_031144.3cccacactgtgcccatctataagggtgtaaaacgcagctc primer sequences for real - time pcr verification of microarray results cdna was synthesized using enhanced avian hs rt - pcr kit (sigma - aldrich, st . All analyses were performed on individual samples of total rna using a brilliant iii ultra - fast sybr green qpcr master mix kit (agilent technologies, usa) following the manufacturer s protocol . Each sample was tested 3 times in a stratagene mx3005p quantitative pcr instrument for rt - pcr . The relative expression of the target gene was calculated according to the following formula:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\delta \vardelta {\text{ct}} = \delta {\text{ct}}\left ({\text{sample}} \right) - \delta {\text{ct}}\left ({\text{normal}} \right)$$\end{document}where ct is the difference in ct between the targeted gene and housekeeping controls by minimizing the average ct of the controls . The fold - change calculated as: 2 (livak and schmittgen 2001). Experiment was carried out on thirty - six 8-week - old male sprague dawley rats (charles river laboratories, germany). The environment was regulated at 22 0.5 c, air humidity of 50% on a 12 h/12 h l / d photoperiod throughout the entire experiment . The body weight and animals were divided into two groups: a control group (n = 18) and an experimental group (n = 18). Rats from both groups were receiving for 14 months semi - synthetic diets (control and base - diet) formulated according to the nutritional requirements for laboratory animals (nrc 1995) and are described in table 1 . Application of the semi - synthetic diet allowed the elimination of the additional impact of biologically active compounds contained in commercially available diets . Base - diet was additionally enriched with the following biologically active compounds: 6% of salmon fat replacing lard (to increase the level of unsaturated fatty acids), 8% of hydrolysed water extract from small - leaved linden (tiliacordata) inflorescence (as a source of antioxidant compounds), 8% of puree from giant pumpkin (curcubitamacima) (the source of beta - carotene) and 1% of two strains of bacteria with documented probiotic activity: lactobacillusacidophilus la-5 and bifidobacteriumanimals ssp . Exact composition of macronutrients, micronutrients and vitamins mixtures included in the experimental diets is presented in table 2.table 1composition of diets used for 14-month - long feeding of ratscontrol diet (g / kg diet)base - diet (g / kg diet)rapeseed oil10.020.0salmon fat0.060.0lard90.020.0hydrolysed water extract from linden (tilia cordata) inflorescence0.080.0puree from pumpkin (cucurbita maxima)0.080.0probiotic (la5/bb12)0.01.0mixture of macronutrients36.336.3mixture of micronutrients0.50.5mixture of vitamins10.010.0 l - methionine2.22.2casein200.0200.0wheat starch482.0465.0potato starch10.010.0water144.00.0saline15.015.0table 2composition of the mixtures of macronutrients, micronutrients and vitamins used in control and base - diet fed to rats for 14 monthsmacronutrients mixture composition (g / kg of mix) cahpo4 2h2o27.89 k2hpo4 2.43 nacl0.92 k2so4 2.04 caco3 0.63 na2hpo4 12h2o1.61 mgo0.75micronutrients mixture composition (g / kg of mix) c3h4(oh)(coo)3fe x 3h2o3.76 zn(ch3coo)2 2h2o0.79 mnco3 2.34 cu(ch3coo)2 h2o0.5 kj0.004 c3h4(oh)(cooh)3 ad 100 gvitamins mixture composition (mg / kg of mix) vitamin a0.69 vitamin d3 0.5 vitamin e98.2 para - aminobenzoic acid100.0 inositol100.0 niacin40.0 ca - pantothenate40.0 vitamin b2 8.0 vitamin b1 5.0 vitamin b6 5.0 composition of diets used for 14-month - long feeding of rats composition of the mixtures of macronutrients, micronutrients and vitamins used in control and base - diet fed to rats for 14 months the content of biologically active substances in feed was measured as follows . The fatty acid content was determined both in the raw ingredients and in the feed samples using gas chromatography (table 3). Quantitative analysis of the total polyphenolic compounds in the hydrolysed water extract from small - leaved linden inflorescence was made using the method with folin reagent (1 n) in the presence of na2co3 (20%). The analysis of beta - carotene and other carotenoids content was performed using high - performance liquid chromatography coupled with electrochemical detection (hplc ecd).table 3the fatty acid profiles in control and base - dietsfatty acidscontrol dietbase - dietsaturated (%) 32.7017.24monounsaturated (%) 32.4430.75polyunsaturated (%) 10.4318.3220:5 n-3 (%) 0.022.1022:6 n-3 (%) 0.023.60sum of n-3 fatty acids (%) 2.909.02sum of n-6 fatty acids (%) 7.549.42 the fatty acid profiles in control and base - diets after 3 and 14 months of experiment, animals from each experimental group (n = 9) were euthanized by exsanguination under general anaesthesia with the isoflurane . Liver samples were frozen with liquid nitrogen immediately after collection and stored at 80 c until extraction . Total rna was extracted with rneasy lipid tissue mini kit (qiagen, germany) following the manufacturer s recommended protocol . Subsequently, potential genomic dna contamination was eliminated using deoxyribonuclease i amplification grade (sigma, usa) and rneasyminelute cleanup kit (qiagen, germany). Rna quantity and quality was measured using nanodrop 2000 (nanodrop technologies, usa) and bioanalyzer (agilent technologies, usa). To ensure optimal data quality, only rna samples with rin number 8.8 the analysis of gene expression profile was performed using sureprint g3 rat gene expression microarray, 8 60 k (agilent technologies, usa). The low input quick amp labeling kits (agilent, usa) was used to amplify and label target rna to generate complementary rna (crna) for oligo microarrays used in gene expression profiling . Experiment was performed using a common reference design, where the common reference was rna from 10-week - old healthy rats not participating in the experiment, housed for 2 weeks in the same room with experimental rats . On each two - colour microarray, 300 ng of crna from the control rats (labelled by cy3) and 300 ng of crna from the rats fed with base - diet (labelled by cy5) were hybridized . Microarray hybridization was performed with the gene expression hybridization kit (agilent technologies, usa), according to the manufacturer s protocols . Rna spike in kit (agilent technologies, usa) was used as an internal control . In total, 24 microarrays, one for each animal, were done . The final analysis was carried out on 22 microarrays, which passed through the agilent feature extraction s and the gene spring s control (one microarrays from the control group after 3 months of experiment and one from the experimental group after 3 months of experiment were rejected due to insufficient quality). Data were extracted and background was subtracted using the standard procedures contained in the agilent feature extraction (fe) software version 10.7.3.1 . The statistical analysis was performed using gene spring 12 software (agilent, usa). The samples underwent quality control and the results showed that each sample had similar qc metric profile . The next step was filtering probe sets by flags to remove poor - quality probes (absent flags). The statistical significance of the differences was evaluated using one - way anova and tukey s hsd post hoc test (p <0.05). A multiple testing correction was performed using benjamini and hochberg false discovery rate (fdr) <5% . Microarray data were deposited at the gene expression omnibus data repository under the number gse51657 according to the miame requirements . To identify the list of signalling pathways to verify microarray results, the expressions of three randomly selected genes (gpx1, irf7 and prodh) were measured using real - time pcr method . The sequences of these genes were obtained from ensembl database . Primers were designed using primer - blast software (ncbi database) and then checked for secondary structures using oligo calculator (free on - line access). The secondary structures of the amplicon were examined using m - fold web server (free on - line access). As a house keeping gene actb were used (huang et al . 2013; wang et al . 2013). The sequences of the primers are listed in table 4.table 4primer sequences for real - time pcr verification of microarray resultsgene s namenm numbersense primer (53)antisense primer (53)tested genes gpx1nm_030826.2cctaaggcattcctggtatcccatctgaggggatttttct irf7nm_001033691.1gtctagcaccaatagtctctacaaggtccactagagatgaca prodhnm_001135778.1cacaggtgccttaactatgttctaactccttcatcctgcacaacreference gene actbnm_031144.3cccacactgtgcccatctataagggtgtaaaacgcagctc primer sequences for real - time pcr verification of microarray results cdna was synthesized using enhanced avian hs rt - pcr kit (sigma - aldrich, st . All analyses were performed on individual samples of total rna using a brilliant iii ultra - fast sybr green qpcr master mix kit (agilent technologies, usa) following the manufacturer s protocol . Each sample was tested 3 times in a stratagene mx3005p quantitative pcr instrument for rt - pcr . The relative expression of the target gene was calculated according to the following formula:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\delta \vardelta {\text{ct}} = \delta {\text{ct}}\left ({\text{sample}} \right) - \delta {\text{ct}}\left ({\text{normal}} \right)$$\end{document}where ct is the difference in ct between the targeted gene and housekeeping controls by minimizing the average ct of the controls . The fold - change calculated as: 2 (livak and schmittgen 2001). There was no difference in initial body weight and liver to body weight ratio among all experimental groups . Over the course of the 14-month study, all animals gained body weight in a time - dependent manner, regardless the treatment (figs . 1, 2). There was also no difference in the amount of diet eaten between control and experimental rats (fig . Earlier published data showed that there were no statistically significant differences between control and base - diet groups in blood morphology parameters as well as biochemical liver function parameters (oszkiel et al . Cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experimentfig . 2liver to body weight ratio (%). Cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experimentfig . Cd rats from control group; bd rats from base group weight of rats participating in the experiment . Cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experiment liver to body weight ratio (%). Cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experiment average food consumption [g] of rats participating in the experiment . Cd rats from control group; bd rats from base group the consecutive steps of microarray data analysis have been presented in fig . Analysis started from identification of all differentially expressed (de) genes in whole experiment and was conducted using anova in gene spring software . In total, n = 3,017 de genes were identified . Then, using tukey s hsd post hoc test the lists of differentially expressed genes between experimental groups were identified (table 5). This analysis revealed n = 218 differentially expressed genes between control and base groups after 3 months of feeding, and n = 1,262 differentially expressed genes between control and base after 14 months of feeding . These two sets of differentially expressed genes were considered as diet - induced genes since the differences in expression resulted only from the diet fed to the animals.fig . 4the analysis diagram of the data obtained in the experimenttable 5the number of differentially regulated genes between each experimental group (total number of differentially regulated genes n = 3,017)group name cd 3bd 3cd 14bd 14cd 33,0172182822,264bd 33,0171422,255cd 143,0171,262bd 14 3,017 cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experiment the analysis diagram of the data obtained in the experiment the number of differentially regulated genes between each experimental group (total number of differentially regulated genes n = 3,017) cd 3rats from control group after 3 months of experiment; bd 3rats from base group after 3 months of experiment; cd 14rats from control group after 14 months of experiment; bd 14rats from base group after 14 months of experiment each of the two data sets was analysed using pathway studio 6.0 (ariadne genomics) software in order to identify statistically significant ariadne cell signalling pathways in which differentially expressed genes were involved (based on gene ontology). After 3 months of base - diet feeding, three ariadne cell signalling pathways were significantly regulated (p value <0.05) (table 6). After 14 months of base - diet feeding, five ariadne cell signalling pathways were significantly regulated (p value <0.05) (table 7). There were two signalling pathways which were regulated both after 3 and 14 months of base - diet administration, namely guanylate cyclase pathway and gonadotrope cell activation pathway.table 6the list of ariadne cell signalling pathways significantly regulated in rats liver after 3 months of base - diet feedingnametypetotal entitiesexpanded #of entitiesoverlappercent overlapoverlapping entities p valuemast cell activationpathway6455891shc4, gipc1, cyp4a11, mapk12, hip1, elk1, ppp3cb, cyp2b6, dhrs40.02204guanylate cyclase pathwaypathway361, 219151slc23a3, vasp, gipc1, slc5a5, trpv5, slc28a2, slc24a4, prkaca, dnmt3a, hip1, anp32a, dcx, sptbn1, eml2, nrm0.0308gonadotrope cell activationpathway71728101shc4, gipc1, cyp4a11, prkaca, mapk12, hip1, elk1, ppp3cb, cyp2b6, dhrs40.04255table 7the list of ariadne cell signalling pathways significantly regulated in rats liver after 14 months of base - diet feedingnametypetotal entitiesexpanded #of entitiesoverlappercent overlapoverlapping entities p valuegap junction regulationpathway51661365nrg1, pmch, ccl20, erbb2, prkg1, drd2, agrp, galp, penk, hrh1, cga, cnr1, fgf19, npy5r, ffar1, cckbr, oprl1, oprk1, ucn3, fgf5, mc2r, htr2c, npsr1, rln1, prkg2, fgf22, nrg2, vgf, sstr1, grm3, pth2r, grm7, gjb3, rasgrf2, shc3, gpr1390.00019melanogenesispathway50694324nrg1, pmch, ccl20, erbb2, drd2, cyp1b1, agrp, wnt10b, galp, penk, fgf19, npy5r, oprl1, ucn3, fgf5, mc2r, lrp5, dct, rln1, tyrp1, wnt11, ndp, fgf22, nrg2, vgf, sstr1, wnt16, grm3, grm7, shc3, dzip3, ech10.00682guanylate cyclase pathwaypathway361, 219494gabrg3, krt82, aif1l, krt26, glra4, rims2, slc12a5, slc26a4, p2rx2, kcnd2, kcnj6, clcn1, atp12a, scn2a, nos1, prkg1, trpm5, trpv3, trpm3, nppc, ank2, trpa1, mybpc3, scn10a, slc1a1, slc1a2, slc34a3, kalrn, slc28a3, scn3a, prkg2, suv39h1, suv39h2, gria1, disc1, trpc7, kcnj13, krt34, tube1, kcnip1, espn, kcnc2, gabra2, capza3, kcne1l, krt31, atp1a4, slc6a15, tekt30.01162gonadotrope cell activationpathway71728324rims2, nrg1, pmch, erbb2, galp, penk, cga, fgf19, ucn3, fgf5, catsper4, pou1f1, npsr1, rln1, ehf, fgf22, nrg2, pou4f1, vgf, arhgef7, pth2r, cacna1b, lhx4, rasgrf2, shc3, cacna2d4, lhx6, ppp3r2, etv2, cacng3, pou6f2, cacnb10.01346apoptosis regulationpathway69624264nxph2, il4, p2rx2, trpv3, trpm3, tgfb2, trpa1, il21, ntrk2, il6st, catsper4, tnfrsf18, tnfsf18, il9r, il5ra, cntfr, cacna1b, trpc7, omg, il1f5, cacna2d4, ppp3r2, ifna16, il28ra, cacng3, cacnb10.04523 the list of ariadne cell signalling pathways significantly regulated in rats liver after 3 months of base - diet feeding the list of ariadne cell signalling pathways significantly regulated in rats liver after 14 months of base - diet feeding obtained microarray results were also validated using real - time pcr on randomly selected three genes . As shown in fig . 5, gene expression for gpx1, irf7, prodh matched the expression obtained from microarray analysis.fig . 5expression of gpx1, irf1 and prodh genes in livers of control rats and rats fed with base - diet measured using dna microarrays and real - time pcr (normalized vs. actb) expression of gpx1, irf1 and prodh genes in livers of control rats and rats fed with base - diet measured using dna microarrays and real - time pcr (normalized vs. actb) in the present study, we investigated the influence of biologically active substances - enriched diet (base - diet) fed for a long period of time (14 months) on the transcriptome of rat liver . It means that two factors could influence the results the experimental diet and age of rats . Based on the numbers of genes regulated in individual comparisons (adult vs. older; control diet vs. base - diet), we could conclude that age factor was responsible for the regulation of higher number of genes (number of differentially regulated genes between adult and old base - diet fed rats was n = 2,255) than the diet factor (number of differentially regulated genes between control and base - diet fed rats was n = 218 after 3 months of experiment and n = 1,262 after 14 months of experiment) (see table 5). Our previous study has shown that base - diet, which was enriched with the mixture of polyphenols, beta - carotene, probiotics and polyunsaturated fatty acid, prevented from hepatic and systemic oxidative damage and was able to attenuate the development of some senile features in adult and old rats (oszkiel et al . The gsh / gssg ratio has increased, gsh - px and gssg - r activities decreased, and sod activity decreased when compared to control animals . These results suggest that base - diet positively influenced some parameters of antioxidant defence within the body . Because of that we investigated whether differentially regulated genes were involved in antioxidant activity . Analyses performed in pathway studio software show relations between proteins encoded by genes involved in antioxidant activity and proteins encoded by genes differentially regulated in livers of rats fed with base - diet (figs . 6, 7). It is clearly visible that in older rats the number of differentially regulated genes involved in antioxidant activity is significantly higher when compared to adult rats.fig . 6interactions between proteins involved in antioxidant activity (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feedingfig . 7interactions between proteins involved in antioxidant activity (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feeding interactions between proteins involved in antioxidant activity (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feeding interactions between proteins involved in antioxidant activity (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feeding as expected, we were able to identify differentially expressed genes between control and base - diet both in adult (after 3 months of feeding) and older rats (after 14 months of feeding). Significant difference in the expression of these genes resulted in significant regulation of a few signalling pathways (three in the case of adult rats and five in the case of older rats). Two of these pathways were the same in adult and older rats, so we concluded that these two were purely dependent on the diet . Base - diet significantly influenced the expression of gonadotrope cell activation pathway and guanylate cyclase pathway . It regulates the activity of the basophilic cells of the anterior pituitary gland specialized in secreting follicle - stimulating hormone (fsh) or luteinizing hormone (lh). Fsh and lh are released by a trophic peptide hormone gonadotropin - releasing hormone (gnrh). Lh causes ovulation and formation of the corpus luteum in the ovary, stimulates production of oestrogen and progesterone by the ovary and stimulates testosterone production by the testis (guyton and hall 2006; okamura et al . Previous studies reported that reproductive activity can be directly influenced by nutrients, including the biologically active compounds . Among such compounds chen et al . (2010) indicate that genistein and resveratrol can increase the ovarian follicular reserve and prolong the ovarian lifespan in rats . (2005) proved that the extract of rumex steudelii (ethiopian plant which roots contain phytosterols and polyphenols) prolonged significantly the oestrus cycle and the dioestrous phase . 2001; zhang et al . 2006; colitti and stefanon 2006; sgorlon et al . 2006; colitti et al . 2007). -carotene is not only a retinol precursor, but also fulfils similarly function to vitamin e. it is a free radical scavenger, acting especially on singlet oxygen, and thus it is a potent antioxidant, similarly to other carotenoids . Moreover, many gene products linked to reproduction can be modulated by the product of retinol oxidation retinoic acid . Therefore, it is considered that an optimal intake of -carotene has a positive effect on fertility (schweigert et al . Recent study has shown a direct relationship between -carotene concentration at ovarian level and size and progesterone secretion by corpora lutea . It is suggested that -carotene may have a positive effect on luteogenesis and luteal activity (haliloglu et al . 2002; arellano - rodriguez et al . 2009). Study carried out on cows shows that fat supplementation is associated with increased dominant follicle diameter, greater progesterone concentrations, modulation of prostaglandin synthesis and improved oocyte and embryo quality . 1998; lucy et al . 1993; mattos et al . 2002). However, there is some evidence that diet affects the reproductive system also on the transcriptome level . Majority of the studies focusing on transcriptional regulation of gnrh genes concerned gnrh - i; however, recently also a study concerning gnhr - ii has been published (lee et al . 2008). In our study, gnrh - i and gnrh - ii genes, which are expressed mostly in the brain, were not directly regulated . However, we identified 38 genes involved in indirect regulation of gnrh - i and gnrh - ii expression (figs . 8, 9). The expression of some genes involved in regulation of gnrh can be modulated by food interventions . Plant polyphenols can alter the expression levels of oestrous cycle genes encoding pghs-2 (upregulation), sod2 and foxo3 (downregulation) (colitti et al . -carotene is a precursor (inactive form) of vitamin a. it is currently believed that vitamin a regulates gene transcription also by retinol - binding proteins (rbp). Expression of the rbp genes is dependent on progesterone, which is dominant ovarian steroid hormone, known to be involved in the regulation of gonadotropin secretion . Progesterone regulates the gnrh - i gene through a feedback mechanism (van arnum 1998; berry et al . . Moreover, it has been demonstrated that unsaturated fatty acids may influence reproduction directly interfering with basal and gnrh - dependent gonadotrope activity (garrel et al . Diet enriched with fish oil rich in 20:5 and 22:6 n-3 fatty acids modulate the hepatic expression of genes influencing reproductive performance: srebf1, ascl1 and fabp1 (hutchinson et al . Dietary n-3 fatty acids also increase the progesterone receptor (pr) mrna and oestrogen receptor - alpha (er-1) expression (bilby et al . Additionally, free fatty acids might directly modulate pituitary gonadotropin production by upregulating lhb mrna expression and suppressing fshb mrna expression (sharma et al . None of the above - mentioned genes have been directly regulated in our experiment; however, a significant part of differentially expressed genes in the livers of base - diet fed rats was involved in regulation of all above - mentioned food - interventions - related proteins (figs . 8interactions between gnrh - i and gnrh - ii (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feedingfig . 9interactions between gnrh - i and gnrh - ii (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feedingfig . Involved in reproductive system regulation (green) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feedingfig . 11interactions between food interventions - related proteins involved in reproductive system regulation (green) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feeding interactions between gnrh - i and gnrh - ii (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feeding interactions between gnrh - i and gnrh - ii (blue) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feeding interactions between food interventions - related proteins involved in reproductive system regulation (green) and proteins encoded by differentially regulated genes (red) in livers of rats after 3 months of base - diet feeding interactions between food interventions - related proteins involved in reproductive system regulation (green) and proteins encoded by differentially regulated genes (red) in livers of rats after 14 months of base - diet feeding however, there are some latest data indicating that gonadotrope cell activation pathway gene could be expressed not only in reproductive tissues (millar 2005). So far, the only well - known pathway connected with gnrh action was associated with fertility regulation in the hypothalamic pituitary gonadal axis . However, current research showed also that expression of genes involved in regulation of gonadotrope cell activation pathway was observed in other cells such as embryonic stem cell, adult brain, skeletal muscle, myocardium tissues, breast cancer stem cells, prostate cancer cell lines, pancreatic ductal adenocarcinoma, liver, kidney, thyroid cancer cells, mammary gland, prostate cancer, bone matrix and neuroblastoma cells (ames et al . 2013; jones et al . 2007; kim et al . 2014; li et al . 2013; ma et al . 2014; polovlkova et al . 2009; singer et al . 2012; turco et al . 2012; zhang et al . Moreover, the latest studies demonstrate that gnrh are associated with regulation of proliferation, angiogenesis and inflammatory response, which are important in the pathogenesis of diseases associated with aging (pincas et al . There are also some data about the negative relation between gnrh receptors and growth factors, which play a part in aging processes related to activity of stem cells, tissue regeneration, protein homeostasis and regulation of inflammatory processes leading to the age - related diseases (cheung and wong 2008). So far, there are only few reports about the influence of gnrh on the aging process and aging - associated diseases . (2013) showed that silencing of the gene encoding the gnrh receptor resulted in prolongation of c. elegans life . In addition, zhang et al . (2013) pointed out the relationship between the pituitary gnrh and immunoaging . The second pathway which was influenced by base - diet guanylyl cyclase, in response to calcium levels, synthesizes 3,5-cyclic guanosine monophosphate (cgmp) from guanosine triphosphate (gtp). Cgmp is associated with processes, such as phototransduction, circadian entrainment, olfactory transduction, vascular smooth muscle contraction, gap junction, long - term depression, salivary secretion, borderline and spontaneous hypertension, platelet activation and learning ability (cornilescu et al . 2007; golombek et al . 2003; wang et al . 2013; dismuke et al . 2013; dam et al . 2014; mao et al . 2013; kameritsch et al . 2012; robinson et al . However, none of these processes were earlier described as related to the liver functions and the metabolism of biologically active compounds . Some data suggest a direct link between guanylate cyclase pathway and gonadotrope cell activation, since there is a link between cgmp and genes involved in reproduction regulations, especially prkg1 and nos1 . It has been demonstrated that cgmp analogues stimulate gnrh release, while a cgmp - dependent protein kinase (prkg1) inhibitor conversely blocks nitric oxide - induced gnrh release . Therefore, nitric oxide may regulate the heme - containing signalling enzyme, guanylate cyclase, and thereby elevate the second messenger cgmp and facilitate gnrh secretion . Additionally, an effect of nitric oxide on the heme - containing enzyme should also be taken into account . Cyclooxygenase controls production of prostaglandins, known stimulators of gnrh secretion (brann and mahesh 1997). Taken together, the present study showed that long - term (3 and 14 months) rats feeding with base - diet (diet enriches with polyphenolic compounds, -carotene, probiotics and n-3 and n-6 polyunsaturated fatty acids) can affect liver genes expression . On transcriptomic level, the diet exerted its activity by modulating the expression of genes involved particularly in the gonadotrope cell activation pathway and guanylate cyclase pathway, as well as in mast cell activation, gap junction regulation, melanogenesis and apoptosis . The results indicating the strong influence of base - diet on genes involved in the gonadotrope cell activation pathway may suggest the impact of base - diet on reproduction system at the transcriptome level . Base - diet especially strongly affects genes involved in regulation of gnrh which is responsible for the release of fsh and lh . This effect is stronger with the age of animals and the length of diet use . The reproductive - cell cycle theory assumes that the hormones that regulate reproduction, mainly lh and fsh, act in an antagonistic pleiotrophic manner to control aging through cell cycle signalling (atwood and bowen 2011). It means that the improvement of functioning of reproductive system may slow down the rate of senescence, thereby decelerating the rate of aging, and thus the lifespan . It allows us to draw the conclusion that the long - term use of biologically active substances - enriched diet can positively affect the reproductive system, and thus, as a consequence may delay the aging process . However, according to the latest scientific reports, the gonadotrope cell activation pathway plays a part not only in reproduction system, but also in regulation of the aging process . Therefore, the results indicating the strong influence of base - diet on genes involved in the gonadotrope cell activation pathway may also suggest the strong impact of base - diet on the aging process by the regulation of gnrh - dependent cells . These results indicate that it is highly probable that base - diet can modify the signalling pathways which control the aging process by changing the expression of genes involved in gonadotrope cell activation and as a result delay the flow of the aging process.
|
Throughout the world, especially in developing countries, the incidence of lung cancer is on the rise . In the united states, the last decade has seen an increased availability of techniques to aid screening, early diagnosis and targeted treatment of all forms of lung cancer, despite which the incidence continues to rise . However other systemic manifestations as well as signs and symptoms related to metastatic spread and paraneoplastic syndromes should be kept in mind . Through this case presentation and review of the literature, we aim to discuss one such scenario, where a patient presented with central diabetes insipidus (di) related to pituitary metastasis, even though there was no identifiable primary lung lesion at the time of presentation . Metastatic lesions account for about 1% of all sellar and parasellar pituitary tumors and have to be borne in mind when evaluating patients . A 47-year - old female with a 20-pack year smoking history presented to an outside hospital after she overdosed on acetaminophen for relief of her headache . She had been presenting to various hospitals with complaints of headache, nausea and intermittent episodes of vomiting for 18 months . She had previously been evaluated at our institution a year before for headache and had a computed tomography scan done, which was reported negative for any intracranial lesions . Her review of systems was positive for polyuria and polydipsia, which had started about 2 weeks prior to presentation . Her initial laboratory studies at the outside hospital revealed serum sodium of 157 meq / l (nl: 135 - 146 meq / l) in addition to abnormal liver function studies; the latter attributed to acetaminophen overdose . She was treated with high dose desmopressin (ddavp) for presumed di and transferred to our facility, which is a tertiary level referral hospital . A magnetic resonance imaging (mri) study of her brain done at the outside hospital had revealed a lesion, 2.5 1.5 cm in size, in - homogeneously enhancing in the sellar with some extension into the suprasellar cistern and erosion of the posterior wall of the sphenoid sinus . No other brain lesions were noted on this scan . On admission to our institute, she continued to have headache, polyuria and polydipsia . Her cbc revealed anemia, with hemoglobin of 9.5 g (nl: 11.7 - 15.5 g), normocytic and normochromic in nature . Based on her hormonal assay, namely low tsh of 0.3 lh <0.1 miu / l, normal prolactin and cortisol levels, she was thought to have a non - functioning pituitary mass . She was presumed to have a diagnosis of central di and was given a dose of ddavp again . An mri of her brain was repeated in our institution with contrast this time, which revealed a large, invasive suprasellar mass with heterogeneous enhancement and extension into the adjacent sphenoid sinus . The mass was associated with mild suprasellar extension and compression of the optic chiasm [figure 1a]. Another ring - enhancing centrally cystic lesion was identified in the right superficial frontal lobe with mild surrounding edema [figure 1b]. Although the sellar mass could represent an invasive pituitary macroadenoma with preferential inferior growth, given the relatively rapid growth of the sellar lesion and the concomitant presence of additional frontal lobe lesion, the possibility of a metastatic disease needed to be considered at this time . (a) sagittal view of the brain demonstrating an invasive suprasellar mass with heterogeneous enhancement and extension into the adjacent sphenoid sinus, (b) ring - enhancing centrally cystic / necrotic lesion in the right superficia l fronta l lobe with mild surrounding edema she underwent a trans - sphenoidal pituitary biopsy subsequently and had to be transferred to the intensive care unit after the biopsy due to acute hypoxic respiratory failure . The pathological examination of the mass in pituitary revealed the typical features of an adenocarcinoma: solid nests and glands formed by tumor cells that have abundant cytoplasm containing intracellular mucin and pleomorphic nuclei [figure 2a]. The cells were positive for thyroid transcription factor-1 (ttf-1) [figure 2b], which is a sensitive and specific marker of lung adenocarcinoma . The tumor cells demonstrated a cytokeratin profile typical of lung adenocarcinoma (ck-7 and cam 5.2-positive, ck-20-negative) and were negative for the neuroendocrine markers (cd-56, chromogranin, and synaptophysin). An identical immunophenotype can be found in thyroid carcinomas, which have a distinctly different histologic appearance, and some primary adenocarcinomas of the head and neck, including sinonasal carcinoma, which can express ttf-1 in rare cases . Solid nests of cells with abundant clear cytoplasm and focal formation of gland - like structures with eosinophilic cytoplasm (h and e, magnification 60), (b) trans - sphenoidal resection of pituitary mass . Immunohistochemistry stain highlights the expression and nuclear localization of ttf-1 in the neoplastic cells, which supports the diagnosis of metastatic lung adenocarcinoma (ttf-1 ihc, magnification 20) to evaluate further for a primary lesion, a ct scan of the chest was obtained which revealed multiple pulmonary emboli, mediastinal lymphadenopathy, and patchy ground - glass opacity within the lateral aspect of the right lower lobe with no distinctly visible mass . Endobronchoscopy with ultrasound - guided fine needle aspiration of the right hilar lymph nodes yielded malignant cells that had the cytological appearance of lung adenocarcinoma [figure 3]. A biopsy performed concomitantly revealed tumor cells that resembled those in the pituitary mass . With this evidence of a primary lung adenocarcinoma, the pathologist concluded that the pituitary mass most likely represented metastasis from a lung malignancy and not local spread of a sinonasal adenocarcinoma . Cytological examination of the hilar lymph nodes reveals malignant cells with eccentric nuclei and prominent nucleoli on papanicolaou stain thereafter the patient had a rapid decline in her performance status . Pulmonary adenocarcinoma, a subtype of the non - small cell type is the most common type of lung cancer in the united states and also accounts for the most frequent type in non - smokers . While lung cancers rarely metastasize to unusual locations, they do so most commonly to the liver, adrenal glands, bones, and the brain parenchyma . According to a recent swedish study, small cell lung cancer most commonly metastasizes to liver and central nervous system while adenocarcinoma metastasizes to bone and respiratory system . Rare cases of adenocarcinoma of the lung like ours do metastasize to the pituitary gland . In addition to metastatic lesions, the differential diagnosis for tumors in the sellar and suprasellar region of the pituitary gland include pituitary adenomas, craniopharyngiomas, optic or hypothalamic gliomas, germ cell tumors, lipomas, and choristomas . Lung cancer is the second most common type of malignancy to metastasize to the pituitary gland (breast cancer being the leader). According to a recent meta - analysis, breast and lung cancer account for 37.2% and 24.2% of the pituitary metastatic lesions, respectively . Despite this knowledge, when patients with primary lung cancers present without respiratory symptoms their diagnosis is often delayed due to a delay in making the connection between pituitary symptoms and lung cancer, similar to our patient . When a patient presents with a pituitary mass, benign lesions like adenomas are difficult to distinguish from metastatic pituitary lesions based on imaging studies . There are certain clinical characteristics that help discern whether a pituitary lesion is benign vs. whether the lesion needs a more thorough work up to rule out metastasis from a distant primary . Studies, including a recent meta - analysis indicate that di is the most common clinical manifestation in patients who have pituitary metastasis . Reports have indicated that di may be used to distinguish between an adenoma and a metastatic lesion, in that it is more commonly associated with the latter . This is because metastases target the posterior lobe of the pituitary gland and the infundibulum in preference to the anterior lobe, likely due to a preference of the metastases to follow the pattern of pituitary blood flow in the neurohypophoseal blood vessels . Therefore, if a patient with di is found to have a pituitary mass, the suspicion for a primary lesion elsewhere should increase and aggressive search to look for a primary malignancy should ensue . Several case series have demonstrated how patients have presented with symptoms related to pituitary dysfunction, and have ultimately been diagnosed with other primary malignancies . However, a study also indicates that only about 50% patients who present with a sellar mass have a known primary malignancy . Thus in a female patient search for primary breast cancer and in a male patient search for primary lung cancer should ensue since these are the most common cancers metastasizing to the pituitary gland . Other clinical characteristics that raise the suspicion for a pituitary lesion to represent a metastatic lesion rather than a benign adenoma include headaches, visual field deficits due to cranial nerve palsies (especially abducens nerve palsy), presence of skull - bone destruction, demonstration of rapid growth on serial scans, and presence of coexisting focal lesions (metastasis). Hormonal assay to be most commonly affected is high prolactin levels, which is however the case in both metastatic lesions and macroadenomas; hence does not help distinguish the two . Our patient had an unusual situation where there was no discernible primary lesion in the lungs, and yet the biopsy histopathology was suggestive of lung - based adenocarcinoma . Clinicians should be aware of malignancies that are well known to metastasize to the posterior pituitary and consider breast and lung as potential sources . Conversely, since not every patient presents with symptoms of metastasis there is a need to recognize the clinical syndromes (e. g., di like symptoms or more subtle symptoms like cranial nerve palsies) associated with potential metastasis to the pituitary . Work up should then include dedicated imaging of the involved region and potential primary malignancies . Early recognition will result in timely institution of therapy for such patients and improved quality of life.
|
The article " efficacy of and tolerance to mild induced hypothermia after out - of - hospital cardiac arrest using an endovascular cooling system " by pichon et al . In the previous issue of critical care only 10% of patients undergoing out - of - hospital cardiopulmonary resuscitation are discharged alive from the hospital . This high mortality is to a major part due to ischaemic brain damage . In 2002, a european multicentre trial on the use of mild therapeutic hypothermia as well as other clinical trials clearly demonstrated a decrease in mortality and a better neurological outcome in cardiac arrest patients . Only six patients have to be treated to save one life (number needed to treat = six). This is far better than with most other expensive approaches in the intensive care unit (icu). Consequently, therapeutic hypothermia has been recommended in an advisory statement by the international liaison committee on resuscitation (ilcor) already in 2003 . In 2005, the european resuscitation council (erc) guidelines stated: 1 . Unconscious adult patients with spontaneous circulation after out - of - hospital ventricular fibrillation cardiac arrest should be cooled to 32 to 34c . Cooling should be started as soon as possible and continued for at least 12 to 24 hours . 2 . Induced hypothermia might also benefit unconscious adult patients with spontaneous circulation after out - of - hospital cardiac arrest from a non - shockable rhythm, or cardiac arrest in hospital . 3 . A child who regains a spontaneous circulation but remains comatose after cardiopulmonary arrest may benefit from being cooled to a core temperature of 32 to 34c for 12 to 24 hours . Therapeutic hypothermia influences postresuscitation brain and other organ injury in many different ways: it reduces metabolism, free radical formation, intracellular calcium overload, as well as translation and transcription of pathogenic proteins . Additionally, it has anti - apoptotic, anti - inflammatory and anti - coagulatory properties and can reduce oedema formation . There are few areas in emergency and intensive care medicine where scientific evidence is so strong and where international guidelines are so clear . Nevertheless, implementation of hypothermia is lousy . In most countries on both sides of the atlantic, under 30% of cardiac arrest patients are receiving hypothermia . Colleagues are stating that they do not have enough information and experience, that this therapy is not evidence - based and that it is technically too difficult . Mild therapeutic hypothermia is definitely underused post cardiac arrest, and many patients who need not die are dying because of this clinical reality . Here pichon and colleagues report on the efficacy and tolerance of a commercially available intravascular cooling device used in 40 post cardiac arrest patients . Cooling with this device was safe, relatively fast and effective in maintaining the targeted temperature . Regardless of the initial cardiac rhythm about which the brain does not care all patient groups benefited from cooling with this device . Maintenance of hypothermia is practicable with both surface and endovascular cooling . In the past, very recent data on different techniques of body surface cooling suggest that these techniques are also able to maintain body temperature in a clinically sufficient way . Animal experimental data suggest that hypothermia is more effective the faster it is established after the arrest . Therefore, the use of other and faster methods to induce hypothermia must be considered . Infusion of ice - cold ringer's solution (30 ml / kg within 30 minutes) has been shown to be an easy, cheap, effective and safe way of inducing hypothermia in less than one hour . This is even possible in the out - of - hospital setting . For subsequent maintenance of hypothermia, intravascular and body surface cooling techniques well known side effects of therapeutic hypothermia, like hypokalaemia, hypomagnesaemia and bacteraemia may occur, and it is important to know this . Major complications including arrhythmias, bleeding, pneumonia, sepsis et cetera, however, do not occur more often in hypothermic as compared to normothermic cardiac arrest patients . The most important' side effect' of hypothermia is that it is not used routinely in most cardiac arrest patients . According to hippocrates, we have to treat the next unconscious cardiac arrest patient with mild therapeutic hypothermia, regardless of which technique we are using . Erc = european resuscitation council; icu = intensive care unit; ilcor = international liaison committee on resuscitation.
|
Minimal change nephropathy (mcn) accounts for 25% of adults presenting with a nephrotic syndrome . Although most patients respond to corticosteroid therapy, a significant number relapse frequently and may present a real therapeutic difficulty . We present a case of apparently refractory relapsing mcn that was successfully treated with a combination of sirolimus and cyclosporin . In 1989, a 35-year - old female presented acutely with heavy proteinuria (22 g/24 h) and normal renal function . She was commenced on oral prednisolone (60 mg od), and achieved complete remission within weeks . However, multiple relapses followed on reduction of the corticosteroid dose . Azathioprine, cyclosporin, mycophenolate mofetil, tacrolimus and chlorambucil were all tried unsuccessfully, but neither the relapse rate nor the steroid requirements improved . In 2003, cyclosporin was re - introduced to minimize steroid exposure with trough plasma levels of 149 g / l . In the preceding 14 years, the prednisolone dose had rarely been below 15 mg / day, and there had typically been two to three relapses per year . In 2006, sirolimus 2 mg / day was added to her prednisolone (15 mg / day), and cyclosporin (6 mg / kg / day)she was also prescribed primidone since childhood for epilepsy . At review, the trough plasma levels of cyclosporin and sirolimus were 153 g / l and 2.9 g / l, respectively . Steroids were gradually reduced and subsequently completely discontinued 24 months after sirolimus was added with no relapses in the last 30 months . Mcn is predominantly a steroid - responsive disease, with around 75% of adult patients achieving remission by 8 weeks . Unfortunately, 3060% will suffer at least one episode of relapse and around 25% will do so more frequently . A variety of immunosuppressive medications, each with its own side effect profiles, have been trialled as steroid - sparing agents with variable success . Frequently relapsing minimal change disease the first documented use of sirolimus in combination with tacrolimus as a therapeutic option in mcn was published in 2005 by patel et al . . In conclusion, we have detailed a case of relapsing mcn, which has only been controlled by the combined use of sirolimus and cyclosporin . This has not only resulted in the longest period of remission, but has also allowed for the discontinuation of corticosteroids . This is the second documented use of sirolimus in this manner that we are aware of and the first that has trialled the combination of sirolimus and cyclosporin.
|
Dysthymic disorder (dysthymia) is a disabling psychiatric disorder characterized by mild but persistent depressive symptoms . In the usa, it is reported that the lifetime prevalence of dysthymia ranges from 3% to 6% in the general population,1,2 and up to 36% in psychiatric outpatient clinics.3 in japan, a low lifetime prevalence (1.4%)4 and a 12-month prevalence of 0.7%5 for dysthymia have been reported . It has been suggested that the low rate of dysthymia in japan is due to a lack of familiarity with operational diagnostic criteria, such as the diagnostic and statistical manual of mental disorders (dsm). Early diagnosis is of vital important for the successful treatment of dysthymia, especially in primary health care . Additionally, about 25% of patients with dysthymia experience a chronic unchangeable status, and a subset of these patients develop major depressive disorder despite various treatments, such as antidepressants and antianxiety drugs . In japan, traditional herbal (kampo) medicines (thm) are covered by national health insurance and play an important role in primary care, and several kampo formulae have been prescribed for mental disorders.6,7 thm has two points that differ from western medicine, i) the kampo formula is a crude drug, not a purified chemical product; ii) the diagnostic system in kampo medicine differs from that of western medicine . A kampo formula is generally composed of several herbal components and is generally considered safe . There have also been allergic effects, such as skin eruption and liver injury, induced by crude drugs . Furthermore, it is crucial to understand that the kampo diagnostic system is constructed from a paradigm that differs from the paradigm underlying western natural science . When we treat a patient with dysthymia using kampo medicine, kampo diagnosis is required in addition to that of western medicine . Therefore, there is no evidence supporting the use of kampo formulae for dysthymia although kampo formulae are often applied for mental disorders in japan . However, it is a fact that there are responders to thm among patients with dysthimia . In this regard, we prescribed kamiuntanto (kut), one of these kampo formulae, for the treatment of dysthymia with several physical and mental symptoms diagnosed by dsm-4th edition (dsm - iv). Here, we describe four patients with dysthymia who were successfully treated with kut . A 63-year - old male consulted the department of japanese oriental (kampo) medicine (djom), gunma university in october 200x requesting traditional herbal medicine (kampo) for dysthymic disorder with sleeplessness and malaise that had persisted for about 5 years despite treatment with antidepressants (table 1). He was neither a smoker nor a drinker . At the initial examination, there were no remarkable findings in the chest or abdomen, and hepatorenal and thyroid functions appeared normal on both blood analysis and image diagnosis . Additionally, he had not complained of any clinical features indicating the dementia . Treatment with kamikihito, one of the kampo formulae, for 4 weeks failed to improve his symptoms . The patient was accordingly relieved from dysthymia and estazolam was discontinued, and the patient became able to commute every day . In addition, we evaluated the improvement of depressive symptoms using global assessment of functioning (gaf) scale by dsm-4th ed . A 62-year - old female consulted djom requesting kampo treatment for general malaise and lack of volition that had persisted for 2 years despite conventional western therapy, which consisted of benzodiazepines . Her status was diagnosed as dysthymic disorder by operational diagnostic criteria; dsm - iv . Saikokeishikankyoto (decoction) therapy in addition to western medicines for 4 months failed to improve her symptoms . Dysthymia, consisting of general malaise and depressive symptoms was reduced by 80% after kut therapy for about 4 months, along with the occasional use of kousosan (tj-70, 2.5 g tsumura co. ltd japan) to relieve her anxiety . A 61-year - old female developed a feeling of heavy head and sleeplessness in april 200x . She was receiving atorvastatin for hyperlipidemia, and had also received a sleeping drug from a local hospital . However, her symptoms persisted, followed by the development of depressive symptoms and malaise, although she continued to work as a pharmacist . Her symptoms relieved by 80% after 4 months of kut administration, and thereafter she became able to concentrate on work and housekeeping . A 53-year - old female (menopause: 51-year - old) came to djom requesting kampo treatment for dysthymic disorder with sleeplessness, malaise and nervousness without vasomotor symptoms, consisting of hot flashes and sweating, which had persisted for about 5 years . She had not been taking antidepressant therapy, although she was taking hypotensive drugs for essential hypertension . Depressive symptoms were relieved after 4 months of kut treatment and the improvement continued for 6 months . Therefore, we changed kut to another kampo formula (kamikihito: decoction) and have obtained improvement by 50% ., there were no remarkable findings in the chest or abdomen, hepato - renal and thyroid functions appeared normal on both blood analysis and image diagnosis, and dysthymic disorder had been diagnosed by a psychiatrist based on dsm - iv criteria . During the follow - up periods, there were no adverse reaction attributable to kampo medicines . Dysthymia is defined in dsm - iv as follows: mild depressive mood continued nearly all day for 2 years, and there were no major depressive episodes observed during at least the first 2 years . It has been reported that youth are susceptible to dysthymia, while elderly people demonstrate symptoms closer to major depressive disorder . Three (no . 1.2.3 in table 1) of our cases were elderly patients, however kampo treatment with kut resulted in an improvement of depressive mood . However, one of the patients (no . 4 in table 1 .) Experienced dysthymic symptoms in the postmenopausal period, and her status was categorized as a climacteric mental disorder . It is well known that depressive symptoms in climacterium are associated with a decrease in estrogen (e2). Although an e2-like action of kut has not been recognized, it is possible that kut may also be effective for dysthymia in postmenopausal females . Although dysthymia is apt to be regarded as a mild depressive disorder by non - psychiatrists, social loss due to dysthymia is serious . Cassano et al have reported that social activity shows greater reduction in patients with dysthymia than in patients with major depressive disorders.9 the clinical features of dysthymia are characterized by low adl despite mild depressive symptom . The etiology of low adl remains unclear, but it is possible that it may be difficult to diagnose dysthymia early because the depressive symptoms are mild . In addition, the physical symptoms such as general malaise as well as emotional symptoms probably contribute to decreasing adl in dysthymia . Furthermore, it is well known that dysthymia in climacterium is characterized by severe malaise . Kut treatment resulted in the improvement of depressive status, as well as easy fatigability and sleeplessness, and so adl would probably improve . These clinical courses suggest that kut (kampo medicine) may be useful as an additional or alternative treatment for dysthymia, especially in the field of primary health care . During this period, we encountered 2 other patients with depressive symptoms, who did not fulfill the criteria for dysthymia because the period of mild depressive symptoms was less than 2 years . Howevere, these patients were also successfully treated with kut (data not shown). Kampo treatment generally aims not only at improving or regaining physical health, but also taking the patient s psychic and emotional imbalance into account.10 however, the efficacy is limited among responders to kut treatement . To confirm this efficacy, further clinical trial such as n of 1 clinical study,11 will be required . In japan, traditional herbal medicines (kampo) are covered by national health insurance, and are generally used in primary health care . Kut (kamiuntanto) is one of the kampo formulae used for the treatment of mental disorders, such as insomnia or dementia.12 kampo formula is administered following traditional diagnosis, in addition to diagnosis by western medicine . The traditional target group for kut comprises patients with sleeplessness, anxiety, and malaise after a serious illness as well as depressive status in patients lacking physical strength.9 since patients with dysthymia who complain of general malaise are close to the target group for kut, we therefore treated 4 dysthymia patients with kut and achieved good outcomes . Further, the traditional target group of kamikihito (a kampo formula), which was administered in case nos . 1 and 4, comprises patients characterized by appetite loss in addition to other symptoms . It is still not clear whether kut improves the status of dysthymia, but several actions of kut on the nervous system have been demonstrated . It has been reported that kut potentiates the brain cholinergic system in an aged mouse model and its effect may be attributed to an increase in the activity of choline acetyltranseferase (chat).13 those effects have also been demonstrated in thiamine - deficient mice that demonstrate impairment of learning and memory.14 it has been considered that the beneficial effect of kut on alzheimer s disease (ad) is due to the potentiation of chat, but not inhibition of cholinesterase (che).12 although an excess of hpa axis was observed in the patients with dysthymia, suppression of the hpa axis by kut has not been demonstrated . However, recently it has been reported that ad and depression are significant associated in the aging population, and interestingly chat polymorphism is significantly associated with depression.15 three of our patients were elderly, and kut might improve dysthymic status through action on chat as in dementia . Furthermore, smith et al have demonstrated that cholinergic neurons were also decreased in the cerebral cortex such as the frontal lobe in postmenopausal females, and estrogen replacement therapy (ert) suppressed the decrease in cholinergic neurons using spect and i - iodobenzovesamicol.16 therefore, it is possible that kut treatment may potentiate chat in the postmenopausal female . 4 in table 1) in climacterium was also successfully treated with kut due to its effects on chat . Thus, it is considered that kut may be useful for various patients with dysthymia . Finally, we present 4 patients with dysthymia successfully treated with the kampo formula: kut . These observations encourage us to proceed further with controlled trials to confirm the efficacy of kut.
|
The incidence of autoimmune diseases (aids) such as systemic lupus erythematosus (sle), rheumatoid arthritis, and primary biliary cirrhosis (pbc) has been increasing in china . Until now, the antinuclear antibody (ana) test, wherein antibodies are detected by indirect immunofluorescence assay on hep-2 cells, is commonly used as an initial screening method . The presence of ana is nonspecific and can be associated with many nonautoimmune factors, such as carcinoma, infection, pharmaceuticals, and environmental factors . As a result, an ana positive frequency in healthy individuals> 20% has been reported . On the other hand, ana may exist several years before an aid can be diagnosed, with higher titer of ana being correlated closely with a higher risk of the onset of aids during adolescence and adulthood . The epidemiologic characteristics of aid in different countries and districts varies . To our knowledge, information about the ana prevalence and the susceptibility or potential of aids in the general population of china is lacking . We aimed to evaluate the ana prevalence in a wide range of the general chinese population (aged 288 years). To assess the ana positive rate among the general population of china, we conducted a cross - sectional study . Twenty thousand nine hundred seventy sera were taken from the physical examination center in baoding, hebei, china, from july 2011 to september 2013 (figure 1). The sample size and male to female ratio conform to the standard of the sixth national census of china in 20102011 (http://www.stats.gov.cn/tjsj/pcsj/rkpc/6rp/indexch.htm). A total of 6800 children (including 3300 girls and 3200 boys) aged from 2 to 18 years were recruited from 3 public kindergartens, 5 middle schools, and 2 high schools . The other participants consisted of 14,170 individuals (7220 women and 6950 men) obtained by random sampling . The study complied with the world medical association declaration of helsinki and was approved by the ethics committee of the first center hospital of bao ding . To assess the ana positive rate among the general population of china, we conducted a cross - sectional study . Twenty thousand nine hundred seventy sera were taken from the physical examination center in baoding, hebei, china, from july 2011 to september 2013 (figure 1). The sample size and male to female ratio conform to the standard of the sixth national census of china in 20102011 (http://www.stats.gov.cn/tjsj/pcsj/rkpc/6rp/indexch.htm). A total of 6800 children (including 3300 girls and 3200 boys) aged from 2 to 18 years were recruited from 3 public kindergartens, 5 middle schools, and 2 high schools . The other participants consisted of 14,170 individuals (7220 women and 6950 men) obtained by random sampling . The study complied with the world medical association declaration of helsinki and was approved by the ethics committee of the first center hospital of bao ding . Sera were tested by indirect fluorescence on hep-2 cells according to the manufacturer s instructions (euroimmun ag, lubeck, germany). Titer 1:320 was considered to be positive . As a result, 243 positive samples were further tested by line immunoassay (lia) (euroimmun ag) for 15 specific autoantibodies (ie, anti - nrnp, anti - sm, anti - ssa, anti - ro52, anti - ssb, anti - jo-1, anti - scl-70, anti - cnepb, anti - dsdna, anti - his, anti - pcna, anti - nuk, anti - rib, anti - m2, and anti - pmscl-70). Euroblotmaster (euroimmun ag) and eurolinescan (euroimmun ag) were used to complete the operation and for test result interpretation, respectively . Spss for windows version 17.0 (ibm - spss, inc, armonk, new york) was used for statistical calculations . Spss for windows version 17.0 (ibm - spss, inc, armonk, new york) was used for statistical calculations . The age and sex distribution of 20,970 participants are summarized in table i. the ages ranged from 2 to 88 years, with mean age 32 (19.7) years for both sexes . The prevalence of ana in male and female participants by age groups are shown in table i. the overall prevalence of ana was 5.92% and correlated positively with age . There were significant differences among each age group except age older than 80 years, as shown in table i (p <0.01). In the female group, there are 2 sharp peaks in ana positivity at the 20-year and 40-year age groups . In 1243 ana - positive sera tested by lia, 44.2% were positive for at least 1 of 15 specific ana antibodies . In terms of the effect of age and sex on ana positivity, there were significant differences among the 3 groups (ie, 20 years, 2149 years, and 50 years; = 275.04; p <0.01), and between male and female (= 236.47; p <0.01), as shown in table i and table ii, respectively . The autoantibodies with the top-3 positive frequency were anti - ro-52 (19%), anti - m2 (17.8%), and anti - ssa (14.3%); whereas anti - scl-70, anti - jo-1, and anti - sm were the less frequently detected antibodies among the autoantibodies detected (table iii). This is the first research into the prevalence of ana in the general chinese population . Satoh et al hold that the ana prevalence in the us population of individuals aged 12 years and older is 13.8%, and based on national health and nutrition examination survey 1999 - 2004 data, more than 32 million people in the united states are positive for ana . Other studies indicate that japanese show a 9.5% prevalence at a 1:100 cutoff level dilution, whereas for indians it is 12.3% . Anti - ro-52/ssa was the most detected antibody in both of those studies . In the present and another relevant study, based on that comparison among different nations, we hold the opinion that ana positive frequency in adults differs by geography . Sex and age had been assumed to be the factors that influenced ana positivity . In our study, ana prevalence correlated positively with age on the whole, with higher prevalence present in the 20- to 30-year and 40- to 50-year groups . The latter peak is in line with the single peak at age 40 to 49 years described in a us population that was characterized by the physiologic stage of puberty and menopause, implying that estrogen may play an important role . As such, some similarities of genetic deposition and hormone factors may have an influence on disease manifestations . Between the sexes, our results indicate that the female to male ratio in ana positive cohorts is almost 4:1, except in the 80 years group . Our study also showed that ana positivity in girls (8.2%) was higher than in boys (2.5%). This indicated that females have a higher ana titer than males even at a relatively immature stage . Because ana - iif is a primary screening test for adolescent sle, hayashi et al reported that it is important to emphasize the ana titer as a prognostic marker in certain aids, and a 1:160 or 1:320 dilution titer is recommended . Although ana may be influenced by nonimmune factors, several articles show that the positive frequency is no more than 5% at a dilution titer of 1:160 in the general population . In our study, at the cutoff value of 1:320 titer, we found a similar result to previous studies in that older people were prone to higher frequency of ana positivity than younger people (figure 2). Consistent with the findings in a japanese population, we found anti - ro52/ssa was the most prevalent autoantibody in the general population . Ro-52/ssa is a useful serologic marker for sle and sjogren syndrome, myositis, systemic sclerosis, and pbc . Anti - ro / ssa and antichromatin had the highest predictive value for sle diagnosis . The prevalence of patients with asymptomatic pbc in an asian population derived from previous studies seemed to be larger than that inferred from our study . Coincident to the data from japanese residents, our results showed that anti - scl-70, anti - jo-1, anti - nuk, and anti - sm were the least - detected antibodies . It is a pilot study on a large - scale population without comprehensive consideration of other factors such as occupation, genetic deposition, and biochemical factors . Ana positive frequency is high in the general chinese population and differs in different sex and age groups . The authors have indicated that they have no conflicts of interest regarding the content of this article.
|
For repeated administration of chemotherapeutic agents, intravenous hydration, or parenteral nutrition to cancer patients or chronically ill patients, the role of the totally implantable central venous port (ticvp) system is greatly increasing to address concerns about quality of life . Annually, more than 5 million central catheters are implanted in the us, and the proportion of implantable catheter systems has been increasing since niederhuber et al . First reported this system . Surgeons cut down or percutaneously puncture the cephalic, subclavian, or jugular vein, whereas interventional radiologists access the subclavian or jugular vein with the guidance of venography, ultrasound, or fluoroscopy . Recently, ultrasound - guided access to the vein, especially the internal jugular vein, and fluoroscope - guided positioning of the catheter have become widely accepted to reduce complications such as pneumothorax, pinch - off phenomenon, hematoma, or malposition of the catheter tip . However, because thoracic surgeons are familiar with the percutaneous puncture technique, cut down insertion of the central catheter, and the anatomy of the chest and neck vasculature, they can detect complications and manage them promptly and accurately . They can also create a pocket port easily, given their training in pacemaker pocket creation . In keimyung university dongsan medical center, the ticvp system has been provided by a thoracic surgeon since march 2009 . All of the procedures were performed with one small skin incision and subcutaneous puncture of a subclavian vein . In this article, we summarize our experience of the ticvp system and present the success and complication rate of this surgical method . The purpose of this study is to determine whether implanting a ticvp system with surgical methods is as safe as performing it with radiologic guidance . Between march 2009 and december 2010, 245 port systems were implanted into 242 patients by thoracic surgeons . The patients' age, sex, underlying diseases, indications of the implantable port system, immediate and delayed complications, and total period of implantation of the port system were evaluated . All of the study protocols were accepted by the institutional review board of keimyung university dongsan medical center . Before performing the procedure, the patient's coagulation status including prothrombin time, activated partial thromboplastin time, and platelet count were checked . In the operating room, intravenous sedation was not performed and the patient was monitored with electrocardiography, pulse oximetry, and automatic cuff blood pressure . The neck and whole chest was prepared and draped . A circulating nurse was positioned near the patient's head and constantly checked the patient's condition during the operation . As a port site, however, if the patient had received mastectomy or radiation therapy on the right side, or had a previous port scar, the left anterior chest was chosen . After subcutaneous injection of 1% lidocaine for local anesthesia, a 3 cm transverse incision was made just 2 cm distal to the lower margin of the clavicle at the deltopectoral groove level . Gentle dissection of the subcutaneous tissue was done with electrocautery until the fascia layer was reached . At this layer, a pocket for the port was created with blunt and sharp dissection . To prevent skin tightness or necrosis, sufficient space for the port was provided with minor bleeding control . After preparing the port site, an additional subcutaneous injection of lidocaine an introducer needle was inserted at the deltoid tuberosity level while gently withdrawing the plunger of the syringe . Because the needle was inserted through previously dissected subcutaneous tissue, no additional incision was needed . Then the needle was inserted under and along the inferior border of the clavicle, making certain that the needle was virtually horizontal to the chest wall . Once under the clavicle, the needle was advanced toward the suprasternal notch until it entered the vein . When we failed infraclavicular subclavian vein access, we converted to a supraclavicular subclavian vein puncture just lateral to the sternocleidomastoid muscle (fig . 1). After insertion of a j - tip wire, a groshong catheter (bardport; bard, salt lake, ut, usa) was introduced through the peel off sheath . After checking the venous return through the catheter and ensuring adequate heparinization, the catheter was cut to connect with the port (bardport). The catheter was inserted to a depth of 13 to 16 cm of the catheter length through the subcutaneous puncture site (fig . Two anchoring sutures between the port hole and subcutaneous tissue were made to fix the port . After checking the patency of the port and flushing it with heparin, the wound was closed with tight obliteration of the dead space to prevent hematoma . After returning from the operating room, a routine chest x - ray was obtained to check the catheter position and to rule out postoperative complications like pneumothorax . A series of 245 port systems were implanted into 242 patients, including 82 men and 160 women, with an age range of 14 to 86 years (mean, 55.74). In 240 of the patients, the ticvp system was implanted for chemotherapy and other oncologic management, while in 2 noncancerous patients, the system was implanted for parenteral nutrition or to secure an intravenous route . The pocket sites for the port were created on the right side of the chest wall in 203cases (85.3%). In 42 cases (14.7%), the left side of the chest wall was used due to previous scarring or wound problems in 10, right side mastectomy in 9, the patient's preference for the left side in 9, failure of right side subclavian venous puncture in 4, pain or edema in the right arm in 4, and other reasons in 6 . Two patients (0.82%) underwent supraclavicular access of the subclavian vein after failure of infraclavicular access . Secondary insertion of the port system was performed in 6 patients, including 3 after it was surgically inserted with this method, 2 after radiology - guided insertion, and 1 inserted at another institution . The mean operating time was 22.611.5 minutes (range, 10 to 80 minutes). Accidental arterial puncture occurred in some cases, but there was no hematoma or hemothorax occurrence . Early complications within 30 days of surgery occurred in 11 patients (4.49%), including malposition of the catheter tip in 6, malfunction of the catheter in 3, and port site infection in 2 . Among patients who experienced malposition of the catheter tip, 2 were explanted, but the others refused to remove the catheter (fig . There was no evidence of venous thrombosis during their catheter indwelling . At the time of chart review, late complications occurred in 12 patients (4.90%) including venous thrombosis in 4, fever of unknown origin in 4, skin necrosis in 3, and sepsis in 1 patient . We performed explantations in 25 patients (10.2%) including 6 explantations after completion of chemotherapy . During explantation compression of the puncture site for a while and complete obliteration of the port site dead space was performed . The median duration of the ticvp system was 287.2 days, ranging from 3 to 980 days . A totally implantable port system has been used increasingly since its introduction by niederhuber et al . . The types of access vein and port site have varied according to the surgeon's preference . With cut down procedures, the cephalic vein or external jugular vein was preferred, while for percutaneous access, the subclavian or internal jugular vein approach was more frequently used . Nowadays, to reduce perioperative complications and for accurate positioning of a catheter, ultrasound-, venography-, or fluoroscope - guided access interventional radiologists prefer the sonographic approach using the internal jugular vein than the external landmark - guided technique [6 - 8]. Some surgeons prefer the cut down procedure to the cephalic vein instead of the percutaneous approach of the subclavian vein to avoid the risk of pneumothorax . However, for a long period of time, the subclavian vein has been a preferred route for placement of the central venous catheter . This route provides a lower chance of infection and good stability on the chest wall . Because the left innominate vein forms an acute angle from the vena cava, and has the possibility of damaging the thoracic duct, the right subclavian vein is preferred over the left . Pneumothorax occurs at a rate of 1% to 2.5% incidence after interventional radiologic placement of the chest port [6 - 8], while occurring at an incidence of 2.4% to 4.3% after implantation by a surgeon . Found that there was no difference in early complications among the internal jugular, subclavian, and cephalic veins in their comparison of central venous insertion sites . They also found that ultrasound - guided subclavian insertion showed the lowest proportion of failure . Meanwhile teichgraber et al . Reported no incidence of pneumothorax after 3,160 cases with an ultrasound - guided internal jugular vein approach . In our study, if surgeons are very familiar with chest and neck vasculature, and have good hands with subclavian vein access, the incidence of pneumothorax will decrease . In addition, if the needle should proceed toward the sternal notch slowly and directly without changing the axis, the chance of pneumothorax would be rare . However, the slow and gentle advance of the needle during venipuncture, accurate checking on the venous blood return to the syringe, and rapid withdrawal of the needle after puncturing the artery can prevent these events . In our experience, even after arterial puncture, rapid removal of the puncture needle and compression of the adjacent soft tissue for 1 or 2 minutes could prevent hematoma formation in every event . In early insertion periods (march to may, 2009), when puncture through right subclavian access failed, the insertion site was changed to the left side . As a skin incision on the right anterior chest had already been made, an additional incision and pocket making was needed in the left side . Supraclavicular needle puncture to the subclavian vein just lateral to the sternocleidomastoid muscle was performed . With this route, the surgeon did not need to change the original patient's right side position . When trying to access the internal jugular vein, the surgeon should change position to the patient's head side . Two operations (0.82%) were performed and no occurrence of pneumothorax with this method was observed . Lin et al . Reported their experience using external jugular vein cut down, when the cephalic vein approach failed . Below the cutdown site of the cephalic vein, they made a pocket for the port, where a new external jugular vein provided an excellent alternative route . For secure and long - term maintenance of a ticvp system, the catheter tip position is crucial . The united states food and drug administration has stated that the catheter tip should not be placed in or allowed to migrate into the heart . When the catheter is positioned in the right atrium, it may cause cardiac - related complications such as perforation, tamponade, arrhythmia, or cardiac thrombosis . Furthermore, catheter tips placed in the superior vena cava (svc) may cause port malfunction . Many authors agree with positioning the tip at the svc - right atrial junction . On standard chest radiograph, because the upper border of the svc is at the level of the inferior border of the clavicle, or the angle of the right main bronchus and trachea, the catheter tip should be located below this level . The svc - right atrium junction level on chest radiograph is somewhat different according to different authors . Defalque and campbell have mentioned that the ideal tip position is between the fifth and sixth thoracic vertebrae, whereas rutherford et al . Mentioned that it is between the right lateral margin of the svc and superior border of the cardiac silhouette, while another author described it as 1 cm inferior to the right superior cardiac border . With preliminary evaluation of the optimal catheter tip length under fluoroscopic guidance prior to the operation, we attempted to keep the catheter length 13 to 16 cm from the subcutaneous insertion site in the operative field . As our procedures were performed without radiologic guidance, we tried to keep the catheter tip from entering the svc area by a j - tip wire heading caudally, slowly proceeding the catheter, and checking cardiac ectopy on the monitor . However, we found a malpositioned catheter tip located in the internal jugular or contralateral innominate vein in 6 patients (2.45%). In this situation, we could have changed the tip position by the endovascular snaring technique or by reinsertion of the catheter in the operating room . But no patient wanted these procedures . 1) since all of the procedures are performed in the operating room, the risk of infection will be lower than procedures done in the angiographic suite . 2) because we form the pocket and perform subcutaneous cannulation of the catheter with one small skin incision, no additional incisions or subcutaneous tunneling is needed . 3) because the implanted catheter length is short, the risk of catheter - associated complications like lumen occlusion and infection might decrease . However, since we did not perform a comparative study with a radiology assisted port insertion group, we have a limited ability to test these advantages . For a surgically implanted system using a subclavian vein, complication rates of 5% to 24.6% have been reported and those radiologically implanted at the same site show a lower complication rate up to 20.7% . However, considering the high incidence of malposition of the catheter tip, complementary cooperation with a radiologist would be needed . Surgical insertion of a ticvp system with percutaneous subclavian venous access is a safe procedure with a lower complication rate and many clinical benefits.
|
Miliary mottling consists of opacities, between 0.5 to 2 mm in size, in chest radiography . In indian settings, although miliary mottling is more commonly associated with miliary tuberculosis, it can be seen in other conditions such as fungal infections (histoplasmosis, coccidioidomycosis, cryptococcosis, and blastomycosis), sarcoidosis, coal miner s pneumoconiosis, silicosis, hemosiderosis, fibrosing alveolitis, acute extrinsic allergic alveolitis, pulmonary eosinophilic syndrome, and pulmonary alveolar proteinosis . The incidence of lung cancer is higher in males and peaks between age 55 and 65 years . The miliary pattern in chest radiography is very rare in patients with primary lung cancer . Here is a rare case of a young, female patient with non - small cell carcinoma of the lung presenting as miliary mottling . A 28-year - old housewife presented with a history of fever, cough, and chest pain of 15 days duration . The patient was apparently normal 15 days prior to admission, when she developed a fever that was gradually progressive, moderate to high grade, and associated with chills . She also had a pricking type of chest pain, which was central and non - radiating . The patient was not a diabetic or a hypertensive, and nor was she a known case of ischemic heart disease or tuberculosis . Also, she was not a smoker or an alcoholic . There was no family history of tuberculosis or close contact with tuberculosis . On examination, the patient was afebrile with a pulse of 90 beats per minute and blood pressure of 130/80 mmhg . General physical examination did not reveal pallor, icterus, clubbing, cyanosis, edema, or lymphadenopathy . Thyroid examination was within normal limits, and respiratory, cardiovascular, abdominal, and central nervous systems were clinically normal . Hemogram revealed a total count of 11,900 /mm . Additionally, the differential count was within normal limits and the erythrocyte sedimentation rate (esr) was 35 mm / h . A gram stain showed plenty of epithelial cells, pus cells, gram - positive cocci, and gram - negative bacilli . Thoracic computed tomography (ct) revealed a small, mildly enhancing, nodular lesion containing central density involving the posterior basal segment of the left lower lobe with a few enlarged pretracheal, retrocaval, aortopulmonary, and right hilar lymph nodes . In addition, numerous tiny nodular lesions were scattered in both lung fields and there was no pleural effusion . Chest radiograph, showing miliary mottling thoracic computed tomography, demonstrating a small, mildly enhancing, nodular lesion containing central density (arrow) with a few enlarged pretracheal, retrocaval, aortopulmonary and right hilar lymph nodes . Additionally, numerous tiny nodular lesions are scattered in both lung fields, suggestive of tuberculoma with miliary tuberculosis ct - guided fine needle aspiration cytology (fnac) was performed to confirm the diagnosis of tuberculosis . However, fnac sprang a surprise by revealing tumor cells arranged in an acinar pattern with a hyperchromatic nucleus with a background of hemorrhage and necrosis, suggestive of a lower - lobe, left lung non - small cell carcinoma (adenocarcinoma) (figure 3). Computed tomography - guided fine needle aspiration cytology smear, showing pleomorphic tumor cells arranged in an acinar pattern, with a hyperchromatic nucleus with a background of hemorrhage and necrosis, suggestive of non - small cell carcinoma (adenocarcinoma) the word lung cancer is applied to tumors that arise from the respiratory epithelium (bronchi, bronchioles, and alveoli), whereas mesotheliomas, lymphomas, and stromal tumors are different from epithelial lung cancer . The incidence of lung cancer is at its highest between ages of 55 and 65 years . Active smoking increases the relative risk of developing lung cancer by about thirteenfold, and long - term passive exposure to cigarette smoke increases it by 1.5 fold . According to the world health organization (who) classification, four major cell types constitute 88% of all primary lung neoplasms: squamous carcinomas; small - cell carcinomas; adenocarcinomas; and large cell carcinomas . Individual cell types have distinct natural histories and responses to therapy, and treatment decisions are chiefly made on the basis of whether a tumor is classified as a small cell carcinoma or as one of non - small cell subtypes . Squamous and small cell carcinomas commonly present as a central mass with endobronchial growth, while adenocarcinomas and large cell carcinomas present as peripheral nodules or masses often with pleural involvement . A subtype of adenocarcinomas called bronchioloalveolar carcinomas grow along the alveoli without invasion and they can present radiologically as a single mass or a diffuse, multi - nodular lesion or even as fluffy infiltrate . Our patient was a young, non - smoking female (28 years old). When three samples of sputum for afb and the mantoux test proved negative and thoracic ct showed a nodular lesion suggestive of tuberculoma, the patient was subjected to ct - guided fnac, which completely changed the diagnosis to a non - small cell carcinoma of the lung . For further management, the literature contains a small number of similar cases reported as miliary never - smoking adenocarcinoma of the lung . Our patient also showed striking similarities to the 5 patients reported by umeki in 1993 inasmuch as they also had non - small cell carcinoma (adenocarcinoma) of the lung with miliary metastases to the lung . The author identified these 5 cases in a consecutive cohort of 630 patients and suggested that the prevalence of miliary phenotype might be approximately 1% in japanese patients . Moreover, he reported a short survival time after the appearance of the miliary lung metastases . Be that as it may, lung cancer can be seen in individuals who have never smoked . The most common type of lung cancer occurring in lifetime non - smokers, in females, and in patients belonging to younger age groups is non - small cell carcinoma . The differential diagnoses of miliary mottling on chest radiography comprise miliary tuberculosis fungal infections (histoplasmosis, coccidioidomycosis, cryptococcosis, and blastomycosis), sarcoidosis, coal miner s pneumoconiosis, silicosis, hemosiderosis, fibrosing alveolitis, acute extrinsic allergic alveolitis, pulmonary eosinophilic syndrome, pulmonary alveolar proteinosis, and hematogenous metastases from the primary cancers of the thyroid, kidney, trophoblasts, and some sarcomas . However, tissue diagnosis continues to play an important role in establishing the definitive diagnosis.
|
Proteins assemble into dynamic macromolecular complexes that regulate fundamental cellular processes such as cell cycle progression and mitosis . Affinity purification coupled to tandem mass spectrometry (ap - ms) has been used extensively to decipher the composition of protein complexes and their networks involved in a variety of biochemical processes in different organisms . But in contrast to the large number of expression proteomic studies that have generated quantitative data, large - scale ap - ms protein interaction studies have led to mostly qualitative data . Only recently, a small number of studies aimed to investigate the dynamics of protein complexes within protein interaction networks using affinity purification coupled to quantitative ms (ap - qms) (reviewed in ref (11)). One promising application of ap - qms is the determination of protein complex stoichiometry, which is important information about the structural organization of a complex . Accurate and precise stoichiometry determination is particularly susceptible to errors in sample preparation; for example, it has been shown that choice of protein digest conditions can affect the results for the stoichiometry. (16) as the hydrolysis conditions have to be optimized for every complex to achieve complete digestion, stoichiometry determination has not been addressed in high - throughput studies so far and has therefore been limited in use to the characterization of individual protein complexes . Immunoadsorption is one of the most widely used methods in biochemistry to purify proteins and their interaction partner(s). It makes use of a specific antibodyantigen interaction and therefore does not necessitate any artificial sequence (tag) incorporated into the bait which could interfere with the protein s function such as the assembly into a macromolecular protein complex . Chemical labeling with reagents that target primary amines such as itraq, tmt or mtraq for relative and absolute quantification are incompatible with the use of glycine . Therefore protein elution is performed with diluted acids such as hcl, tfa or fa at concentrations of 100 mm if chemical labeling using these reagents is to be performed . Independent of the acid elution protocol used incomplete elution from the antibody - conjugated beads is frequently observed . As a direct consequence, less material is available for the lcms analysis, leading to lower sequence coverage and lower signal - to - noise ratio in quantification experiments, respectively . Protocol, which led to an increase in sequence coverage in the study of their protein of interest . In this protocol proteins are reduced, alkylated and subsequently digested for a prolonged period of time (usually overnight) while still bound to the antibody - conjugated beads . Although this protocol has been used in a number of studies several important parameters / factors have not been tested yet; (i) the sample contamination from cleaved antibody peptides when using cross - linked and noncross - linked antibody - conjugated beads, respectively, (ii) a comparison of acid elution methods to the on - bead digestion in a quantitative fashion, (iii) the time period required for efficient elution by the protease . Furthermore, in light of the recent shift toward quantitative interaction studies, there is a need to test the compatibility of the on - bead digestion protocol with quantification strategies such as the absolute quantification of protein complex subunits and the subsequent calculation of complex stoichiometry . As a model complex for stoichiometry determination based on absolute quantification cohesin s main function is to hold sister chromatids together from their synthesis in s - phase of the cell cycle until the metaphase to anaphase transition, where cohesin is removed to allow separation of sister chromatids and exit from mitosis . Cohesin is an evolutionary well conserved protein complex consisting of four core components; smc1, smc3 and rad21 form a ring - like structure to which stag binds (reviewed in ref (28)). The exact subunit stoichiometry is not known, but on the basis of electron micrographs and biochemical experiments, a 1:1:1:1 stoichiometry has been proposed . Adding to the cohesin complexity, in somatic cells stag occurs in two isoforms (stag1, stag2) which associate with the cohesin subunits in a mutually exclusive manner . In other words, cohesin complexes exist in two different populations; stag1 and stag2 containing cohesins, respectively . In human cultured hela cells, stag2 was shown to be more abundant than stag1, but the exact ratio of stag1:stag2 containing cohesins is not known . Here we show by labelfree and absolute quantification that a short 1560 min predigestion with lysc (modified on - bead digestion termed protease elution) is 2- to 3-fold more efficient than the acid elution protocols . Using 19 reference peptides generated with our etep strategy,(31) of which 6 are specific for stag1 and stag2, respectively, we determined the cohesin complex stoichiometry and the exact stag1/stag2 stoichiometry from exponentially growing hela cells . All chemicals purchased were of highest purity available . Trifluoroacetic acid (tfa), hydrochloric acid (hcl), isopropanol and tris(2-carboxyethyl)phosphine hydrochloride (tcep) were purchased from sigma - aldrich (steinheim, germany). Formic acid (fa) was obtained from safc biosciences (andower, u.k . ); triethlyammonium bicarbonate (teab) and s - methyl thiomethanesulfonate (mmts) from fluka (buchs, switzerland); and ms - grade modified trypsin was purchased from promega (madison, wi). Ultrapure 18-m water was obtained from a millipore milli - q - system (bedford, ma). Generation of reference peptides was performed essentially as described. (31) in brief, peptides were synthesized by solid - phase fmoc chemistry and purified on a vision hplc instrument (applied biosystems, foster city, ca). According to the etep strategy, peptides were then trypsinized, labeled with mtraq heavy (absciex, foster city, ca), quantified via mtraq light labeled equalizer peptide (gvtasvagar, amino acid analyzed) and mixed in equimolar amounts (figure s6, supporting information). For immunoadsorption experiments, affinity - purified antibodies were coupled to affiprep protein a beads (bio - rad, hercules, ca) in a ratio of 1 mg antibodies to 1 ml beads . For purification of cohesin we used an antibody raised against peptide fhdfdqplpdlddidvaqqfslnqsrveec of rad21 (antibody 575) and for purification of acp / c we used an antibody raised against peptide ctdaddtqlhaaesdef of apc3 (antibody 233). Cross - linking 300 l beads with 300 g antibody was performed in 20 mm dmp (dimethyl pimelimidate dihydrochloride; sigma - aldrich, steinheim, germany) in 0.2 m na - borate ph 9.2 for 30 min at rt . After two wash steps with 3 ml (10 bead volumes (bv)) 0.2 m tris - hcl at ph 8.0 antibody - conjugated beads were washed twice with 3 ml (10 bv) of 0.1 m glycine at ph 2.0 to remove noncross - linked antibodies and finally washed with 3 ml (10 bv) of 1 pbs . Hela cells were grown in dmem supplemented with 10% fetal bovine serum, 0.2 mm l - glutamine and antibiotics (all invitrogen, carlsbad, ca). For each immunoadsorption cells from four trays (25 25 cm, 70% confluent) were harvested, washed once in 1 pbs and lysed with 15 strokes using a dounce homogenizer in 6 ml lysis buffer (20 mm hepes ph 7.5, 150 mm nacl, 10% glycerol, 1% triton x100, 2 mm edta and protease inhibitor cocktail mix). For binding, hela total cell extract s-20 was incubated with 30 l antibody - conjugated beads and incubated on a rotary shaker for 90 min at 4 c . Subsequently, the beads were washed 6 times with 1.5 ml (50 bv) of wash buffer (as lysis buffer but 1% trition x-100 was substituted for 0.2% np-40). Finally, before elution beads were washed with 1.5 ml (50 bv) of 150 mm nacl, pelleted and the supernatant was carefully removed . For acid elution, 15 l beads were incubated on a rotary shaker for 3 min at rt with 30 l (2 bv) of 100 mm glycine ph 2.0, 100 mm hcl, 100 mm fa and 100 mm tfa, respectively . The supernatant was collected and neutralized by adding 1.5 l (0.1 bv) 2 m naoh . For protease elution, 15 l beads were resuspended with 30 l (2 bv) of 500 mm teab and incubated with 500 ng lysc (wako, richmond, va) or trypsin (ms grade trypsin gold, promega), respectively for the time periods indicated in the results and discussion section . After elution by predigestion the supernatant was collected and diluted with 500 mm teab to give the same final volume as after acid elution . Next, differently eluted fractions were reduced in 1 mm tcep for 30 min at 56 c and alkylated in 2 mm mmts for 30 min at rt in the dark . Samples were then further digested by addition of 500 ng of lysc for 14 h at 37 c followed by a 16 h digest with 1 g trypsin at 37 c (in case of lysc elution) or digested by addition of 500 ng trypsin and incubation for 16 h at 37 c (in case of trypsin elution). Digested samples were then either analyzed on an orbitrap xl for labelfree quantification or labeled with mtraq heavy (hcl elution) according to the manufacturer s instructions for absolute quantification on a 5500 qtrap instrument . To assess completeness of mtraq labeling a fraction of the labeled sample was analyzed on an orbitrap xl and spectra were searched against the ipi database using mascot 2.2 with and without mtraq light as variable modification . Thirty l apc3 and rad21 antibody - conjugated beads were suspended with 60 l (2 bv) 500 mm teab and incubated with 500 ng trypsin and 500 ng lysc, respectively . After incubation for 1, 4, and 16 h at 37 c under constant shaking at 1300 rpm in an eppendorf thermomixer, 10 l of the supernatant were collected and proteolysis was stopped by addition of 240 l 1% tfa . Then 1.5 l sample diluted in 20 l 0.1% tfa was separated on a dionex ultimate equipped with a 200 m i.d . Monolithic column (pepswift from dionex, amsterdam, the netherlands) using a gradient from 5% acn, 0.1% tfa to 80% acn, 10% tfe, 0.08% tfa over 25 min . One fifth of each eluate was separated using a dionex ultimate 3000 nanolc system equipped with a c18 pepmap column (75 m i.d . 150 cm length, 3 m particle size, 100 a pore size) (dionex, amsterdam, the netherlands) using a 55 min gradient from 5% acn, 0.1% fa to 30% acn, 0.1% fa followed by a 5 min gradient from 30% acn, 0.08% fa to 80% acn, 10% tfa, 0.08% fa . Peptides eluting from the nano - rp - hplc were analyzed on an ltq orbitrap xl mass spectrometer (thermo fisher scientific, bremen, germany), equipped with a nanoelectrospray ion source (proxeon, odense, denmark) with an applied voltage of 2 kv . The mass spectrometer was operated in data - dependent mode: 1 full scan (m / z 3501600) was acquired in the orbitrap (resolution of 60 000) followed by ms / ms scans of the five most abundant ions in the ltq . The chosen ions were excluded from further selection for 60 s. fragment ion data were interpreted using mascot 2.2 (matrix science, london, uk) within the proteome discoverer software (thermo fisher scientific, v 1.2). Data were searched against the human international protein index (ipi) database (v 3.74). Following search parameters were used: tryptic peptides; up to 3 missed cleavage sites; oxidation (m), phosporylation (s, t, y), pyro - glutamate (n - term) as variable modifications and methylthio (c) as fixed modification; peptide mass tolerance of 3 ppm and fragment ion tolerance of 0.5 da . Extracted ion chromatograms (xics) of peptides with a mascot score of 25 and which were ranked 1 were extracted using the precursor ion area detector feature within proteome discoverer 1.2 with a mass tolerance of 3 ppm . For labelfree quantification ratios of xics of peptides identified with all 5 elution methods were calculated relative to glycine elution . Only peptides without chemical modification (such as oxidized methionine, s, t, y - phosphorylation, n - terminal pyroglutamate) were included in relative quantification . Immediately before lc - srm analysis digested and labeled cohesin was spiked with 25 fmol of each internal reference peptide in case of the experiment shown in figure 4a and with 10 fmol in case of the experiment shown in figure 4b . To remove excess of 2-propanol samples were concentrated in a speed vac for 10 min to a final volume of approximately 25% of the starting volume and rediluted with 0.1% tfa to identical sample volumes . Samples were then separated on a dionex ultimate nano - hplc equipped with a c18 pepmap column (75 m i d 150 mm length, 3 m particle size, 100 pore size) (dionex, amsterdam, the netherlands) using the following gradient of solvents a (5% acn, 0.1% fa), b (30% acn, 0.08% fa) and c (80% acn, 10% tfe, 0.08% fa) at a flow rate of 300 nl / min: from 0% b, 0% c to 100% b, 0% c over 30 min followed by a gradient to 0% b, 90% c over 5 min . Peptides eluting from the nanolc were analyzed on a 5500 qtrap instrument (absciex, foster city, ca) equipped with a nanoelectrospray source with applied voltage of 2.3 kv . The mass spectrometer was operated in scheduled srm mode with the following parameters: mrm detection window of 180 s, target scan time of 2 s, curtain gas of 20, ion source gas 1 of 15, declustering potential of 75, entrance potential of 10 . Three srm transitions per peptide (table s1, supporting information) were selected and optimized for collision energy by direct infusion of internal reference peptides . Collision cell exit potentials (cxp) were calculated by dividing q3 mass by a factor of 29 . Peak integration was performed using multiquant 1.2 (absciex, fostercity, ca) software and manually reviewed . Light to heavy peak area ratios were calculated over the three transitions and two replicates to calculate absolute amounts loaded on column and complex stoichiometry . In the standard on - bead digestion protocol antibody - conjugated beads are incubated for a prolonged period of time with a protease to allow digestion of the purified sample . To test the proteolytic stability of the cross - linked antibody beads and therefore to assess a potential sample contamination from antibody peptides, we incubated affiprep protein a sepharose beads cross - linked with two different antibodies (apc3 and rad21) with trypsin and lysc, respectively . After 1, 4, and 16 h of incubation, beads were removed by centrifugation and an aliquot of the supernatant was separated using a monolithic column, which allows the simultaneous separation of peptides and proteins (figure 1). We loaded a volume of the supernatant that corresponded to 2 pmol of antibody (assuming complete proteolysis and hence release of antibody peptides to the supernatant). After 1 h of incubation with trypsin and lysc, respectively no signals other than background were visible in the uv chromatograms, indicating no or only little cleavage of the antibodies . In case of trypsin, after 4 h of incubation the first additional signals were visible, indicating minor cleavage and after 16 h signal intensities stemming from cleaved antibodies were further increased (compare to 1 pmol of trypsinized bsa shown in figure s1, supporting information, and to figure 3a). In contrast to incubation with trypsin, antibody beads incubated with lysc resulted in no, or only minor, cleavage (after 16 h, rad21) of the antibody . The observed higher resistance of the antibodies toward proteolysis when incubated with lysc can most likely be explained by two factors: (i) the trypsin we used is chemically modified to inhibit autolysis and to increase stability whereas the unmodified lysc undergoes autolysis and therefore loses activity during incubation and (ii) trypsin cleaves c - terminal to arginine and lysine whereas lysc only cleaves after lysine, which in turn is chemically modified by the cross - linker . Hence, cross - linking results in one recognizable cleavage site for trypsin but no site for lysc on the surface of the antibody . (panels (a) and (b)) and apc3 (panels (c) and (d)) antibodies cross - linked to affiprep a beads were incubated with trypsin and lysc, respectively . At the indicated time points an aliquot, which corresponded to 2 pmol antibody (assuming complete cleavage) was separated using a monolithic column . Increasing absorption in the uv chromatograms indicate proteolytic cleavage of the antibodies . For better illustration, chromatograms are displayed with a 5% time and a 15% signal offset . In none of the studies that employed on - bead digestion a potential contamination from cleaved antibody peptides was assessed, although proteolysis of cross - linked antibodies was described. (34) due to the fact that the antibody is usually present in excess compared to the purified sample, already minor antibody cleavage, as observed after 4 h of proteolysis, can lead to a significant increase of background unfavorable for subsequent lc - srm or lcms / ms analyses . To test the influence of antibody proteolysis on ms - based identification we purified cohesin and apc / c and performed on - bead digestion for 1, 4 and 16 h followed by a sequential digestion after separation of beads and sample . Ms analysis on an ltq orbitrap revealed that the number of peptides identified (mascot score> 25) was highest after only 1 h of on - bead predigestion for elution compared to 4 and 16 h, regardless of the protease used for on - bead predigestion (table s2, supporting information). For example, the known cohesin interactor wings apart - like (wapl) was identified with 11 peptides after 1 h lysc elution, with 8 peptides after 4 h lysc elution and with only 3 peptides after 16 h lysc elution . In case trypsin was used for elution this effect was even more pronounced; we identified 9 wapl peptides after 1 h, 1 peptide after 4 h and no peptide was identified after 16 h predigestion for elution . Ms analysis of apc / c eluted with 1, 4 and 16 h on - bead predigestion showed a similar result (table s3, supporting information). These effect most likely results from two factors: (i) the mass spectrometer spends time on sequencing antibody peptides and more importantly (ii) extended on - bead digestion periods result in a dramatically increased protein concentration due to released antibody peptides (figure 1), which limit the amount of sample that can be loaded onto the column (see tables s3 and s4 for further details, supporting information). For example, of the 16 h trypsin on - bead predigested cohesin sample we could only load 1/5th of the volume compared to the 1 h on - bead predigestion, nevertheless the total amount of protein loaded was considerable higher and close to the columns capacity as judged by the uv chromatogram (not shown). Consequently, to limit the degree of antibody proteolysis and to therefore increase sensitivity, we decided to shorten codigestion of sample and antibodies to 1 h followed by a sequential digestion of the sample after separation from antibody - conjugated beads . Hence we refer to this protocol as protease elution rather than on - bead digestion . To test such a protease elution protocol in terms of elution efficiency and sample contamination from cleaved antibody peptides we purified cohesin and apc / c by immunoadsorption from soluble extract of hela cells, performed labelfree quantification on an orbitrap xl and compared the results to standard acid elution protocols . Protein complexes were purified using affiprep beads cross - linked with rad21 and with apc3 antibodies, respectively and eluted using glycine at ph 2.0 (figure 2a). Analysis on an orbitrap xl and mascot searches of the acquired spectra against the ipi database (v 3.74) identified the four core cohesin subunits within the top 8 identifications and 12 out of 13 apc / c subunits within the top 50 identifications, respectively . In order to allow a quantitative comparison of different elution methods we purified cohesin and apc / c and performed xic (extracted ion chromatogram) based labelfree quantification on an ltq orbitrap xl instrument . Immediately before the elution step, affiprep beads were split into 5 aliquots and proteins were eluted using 2 bead volumes (bv) of the following reagents; 100 mm glycine ph 2.0, 100 mm hcl, 100 mm fa and 100 mm tfa (figure s2, supporting information). Additionally we resuspended 1 aliquot of beads in 2 bv of 500 mm teab buffer and added lysc protease . We selected lysc protease for elution because our standard digest protocol for quantification studies is comprised of a sequential lysctrypsin double digestion . Additional results obtained using trypsin for elution is presented in the supporting information . In the on - bead digestion protocol proteins bound to the antibody beads in contrast to standard on - bead digestion and based on the proteolytic stability experiments discussed above we incubated the antibody beads for only 1 h at 37 c with lysc, arguing that a short predigestion of the bait protein might be sufficient to release the protein complexes from the antibody beads . We therefore refer to this protocol as protease elution rather than on - bead digestion . Supernatants were collected and subsequently digested as described in the materials and methods section using a lysctrypsin double digest and identical sample volumes were analyzed on an orbitrap xl instrument . Spectra were searched against the human ipi database using the mascot search engine and ion chromatograms (xic) were extracted through proteome discoverer 1.2 software . Labelfree quantification based on xics of cohesin peptides identified in all 5 samples revealed that elution using hcl, fa and tfa was less efficient than standard glycine elution, while xics of lysc eluted peptides were on average 3-fold higher compared to glycine elution (figure 2b and figure s3, supporting information). Labelfree quantification of apc / c subunits showed a similar result; hcl, fa and tfa elution were equally or slightly less efficient, while lysc elution was on average 2-fold more efficient compared to standard glycine elution (figure 2c and figure s4, supporting information). Sds - page of eluate fractions and the supernatant after boiling the beads in sds containing buffer (laemmli buffer) revealed that a considerable portion of the purified protein complexes were not eluted by the acidic buffers (figure s2, lanes denoted as beads, supporting information). Using the protease elution protocol, therefore no conclusion can be drawn from the corresponding lanes on the protein gel with respect to the elution efficiency . However, the 2- to 3-fold more intense xics after lysc elution correspond well with the tightly bound fraction not eluted using the acidic buffers, suggesting greatly improved if not complete elution after only 1 h of lysc predigestion . (a) sds - page of isolated apc / c and cohesin from soluble extract of hela cells . (b) labelfree quantification of cohesin subunits eluted using different protocols by xic relative to glycine elution . (c) labelfree quantification of apc / c subunits eluted using different protocols by xic relative to glycine elution . See also figures s3 and s4 for peptide scattering within subunits in the technical duplicates (supporting information). Proteolytic stability tests described above using a monolithic column revealed that no or only a minor amount of antibody is cleaved during the 1 h lysc incubation (figure 1). However, to verify this result and to compare the degree of sample contamination from the antibody in acid elution versus lysc elution we extracted xics of identified peptides stemming from the fc region of the igg (3 identified in glycine eluate, 7 in lysc eluate of apc / c purification using apc3 antibody). Xics of the lysc eluate were on average 20-fold more intense compared to glycine eluate (3 peptides in common) (figure s5, supporting information). Similar results were obtained when the contamination from rad21 antibody peptides was evaluated (not shown). But in general, antibody peptides accounted for only a minor amount of the tic (total ion current) in the glycine and protease eluted sample, respectively (figure s5, supporting information). Hence the protease elution protocol allowed the complete recovery of immunoadsorbed protein complexes after only 1 h of incubation with lysc with only very little contamination from antibody peptides . Chemical cross - linking not only covalently attaches the antibody to the protein a affiprep beads but also introduces intramolecular cross - links within the antibody . This can affect the binding sites leading to a reduction or even loss in specificity toward the antigen . Therefore, we tested whether noncross - linked antibody - conjugated beads are also compatible with the protease elution method . We purified cohesin using cross - linked and noncross - linked antibody beads and performed lysc elution . To monitor whether the antibody is intrinsically stable to proteolysis or whether chemical cross - linking confers resistance we separated lysc predigested aliquots of the 15 min, 30 and 60 min time - point using a monolithic column . As performed in the initial proteolytic stability experiments we again loaded a volume that corresponded to 2 pmol of antibody (assuming complete digestion). Figure 3a shows uv absorption of the 15 min time point in the range of 1.53.5 mau in case of the noncross - linked antibody and lesser then 0.3 mau in case of the cross - linked antibody . As 1 pmol digested bsa separated on the same column gives absorption in the range of 2.55 mau (figure s1, supporting information) it can be concluded that the noncross - linked antibody is rapidly predigested and therefore contaminates the sample to an extent unsuitable for further ms analysis . In contrast, when chemically cross - linked, the antibody was again shown to be resistant to proteolysis . To monitor the kinetics of sample protein release from cross - linked antibody - beads we separated a 50-fold greater amount of the sample from the 15 min, 30 and 60 min predigestion time - point again using a monolithic column . Figure 3b shows only a minor increase in uv absorption from the 15 min to the 60 min time - point, indicating rapid predigestion and release of proteins . Subsequent lcms / ms analyses revealed that the number of unique peptides identified (mascot score> 25) from the core cohesin subunits was essentially identical in all three predigestion periods analyzed (table s4, supporting information). Hence, mass spectrometry based identification confirmed the interpretation of the results obtained with the monolithic column . Proteins bound to the affinity beads are sufficiently predigested already after 15 min leading to the release of proteins from the affinity beads . Uv chromatograms of proteolyzed cross - linked and noncross - linked antibodies analyzed using a monolithic column . (a) cross - linked and noncross - linked rad21 antibody beads were incubated with lysc for 15 min and an aliquot, which corresponded to 2 pmol antibodies (assuming complete cleavage) was separated using a monolithic column . (b) 50-fold the amount shown in (a) (of cross - linked rad21 antibody beads) was separated using a monolithic column, after 15, 30, and 60 min of incubation with lysc . For better illustration chromatograms are displayed with a 5% time and a 15% signal offset . To test the robustness and compatibility of the protease elution protocol with ap - qms strategies we performed absolute quantification of core cohesin subunits, tested whether different protease predigestion periods influence the outcome of stoichiometry determination and compared the obtained results to a standard acid elution protocol . First, to perform absolute quantification according to the idms principle we generated 19 internal reference peptides (table s1, supporting information) using our previously described etep method (figure s6, supporting information, and ref (31)). The sequences of selected reference peptides including an n - terminal k / r were blasted against the nonredundant (nr) database and all, but two peptides (vedelk from scc1 and edllr from stag1), were found to be proteotypic . Lcms / ms analysis of affinity purified cohesin identified no other peptides from proteins that share these two peptides, thus allowing inclusion of vedelk and edllr for quantification . Our etep method allows the cost - efficient generation of an equimolar mixture of reference peptides of high accuracy by using an equalizer peptide to circumvent amino acid analysis and by using the mtraq reagent to introduce the isotopic label (figure s6, supporting information). As peptides are only surrogates of the protein to be quantified, we selected 4 peptides per cohesin subunit to increase the accuracy of quantification . In case of stag, 3 peptides are specific for isoform 1, 3 are specific for isoform 2 and one peptide is specific for both isoforms . We then set up a scheduled srm method monitoring 3 transitions each for light (sample) and heavy (reference) peptide (table s1, figure s9, supporting information). Transitions were optimized for intensity by direct infusion of peptides and ramping of collision energy . To allow accurate quantification by calculating light / heavy ratios we determined the linear range of the reference peptides . This is of particular importance for peptides that will not be close to a light / heavy ratio of 1 and are of low abundance . For our set of peptides this scenario was expected for stag1 specific peptides as stag1 was shown to be the less abundant of the two stag isoforms . For all reference peptides ms detector signal response was linear in the range from 1.56 to 100 fmol and most important, all stag1 specific peptides showed a linear response from 390 amol to 100 fmol (figure s7, supporting information). Time course experiments of the protease elution analyzed on the monolithic column and by ms suggested that a 15 min predigestion might be sufficient to release proteins from the affinity beads (figure 3 and table s4, supporting information). Here, using absolute quantification we validated this finding and determined the complex stoichiometry to test whether different lysc predigestion periods influence the analysis . Figure 4a and b and figure s8 (supporting information) show the result of the srm analysis where we spiked 25 fmol of each reference peptide to the digested complex eluted by 15 min, 30 and 60 min lysc predigestion, respectively . Apparently lysc predigestion for as short as 15 min is sufficient to release the complex from the antibody, although longer predigestion led to a minor increase in abundance of measured cohesin subunits . Most importantly, measurements and subsequent stoichiometry calculation of all 3 time points are in agreement with a 1:1:1:1 stoichiometry of the four core cohesin subunits . Absolute quantification of isolated cohesin subunits by lc - srm analysis on a 5500 qtrap . Data are mean sd of four measured peptides in case of smc1, smc3 and rad21 and of three measured peptides in case of stag1 and stag2, respectively (b) calculation of complex stoichiometry relative to the bait (rad21) protein . Data are mean sd of four measured peptides in case of smc1, smc3 and rad21 and of three measured peptides in case of stag1 and stag2, respectively (d) calculation of complex stoichiometry relative to the bait (rad21) protein . We also performed absolute quantification from preparations that used trypsin to elute the protein complex from the antibody beads, followed by a single 16 h trypsin digestion overnight (figures s12s13, supporting information). However, strong differences in quantitative results from peptides derived from the same protein, as well as a high number of missed cleavage sites identified in lcms / ms experiments indicated in - complete digestion, a situation not compatible with absolute quantification . This result again highlights the importance of assessing the completeness of sample digestion and the measurement of at least two to three peptides per protein . Results using trypsin elution followed by overnight trypsin digestion are presented in the supporting information . Furthermore, because a change in stoichiometry determination after digestion under denaturing conditions was reported,(16) we also performed lysc elution and subsequent lysctrypsin digestion in the presence of 2 m urea (30 min lysc elution). Measurements and calculation of stoichiometry were again in agreement with a 1:1:1:1 stoichiometry (data not shown). To test whether the lysc elution protocol introduces a bias in the quantitative composition of complex subunits compared to a standard acid elution we again determined the stoichiometry of cohesin isolated from soluble extract of hela cells . As a reference elution protocol we used hcl elution, which was the most efficient mtraq compatible elution protocol in the initial labelfree experiments . Quantification using the established srm method revealed again a 1:1:1:1 stoichiometry of the four cohesin subunits independently of the elution method used (figure 4c and d). Furthermore, the experiment confirmed the significantly better elution efficiency of the lysc elution (30 min) compared to acid elution . For quantification of stag1 we set a minimum transition intensity of 500 cps over background in our srm method . Calculation of peptide amount was performed by averaging the light / heavy ratios of all three transitions monitored . Due to the low abundance of stag1, upon hcl elution all three transitions of the peptide ysadaek were below the threshold, not allowing quantification (not shown). Intensity of edllvlr specific transition 499.3710.4 (b5 fragment) was below the 500 cps threshold, leaving only two transitions for quantification (figure s10, supporting information). Additionally, the calculated absolute amount of stag1 loaded onto the column was 330 amol and was thus below the tested dynamic range of stag1 specific reference peptides . In contrast, due to the 3-fold better recovery of the protease elution all ysadaek and edllvlr transitions were above the 500 cps threshold allowing quantification of stag1 based on all 3 spiked reference peptides . The measured absolute amount of stag1 was 820 amol and therefore within the tested dynamic range . In summary, the experiments illustrate the superiority of the protease elution method over standard acid elution with respect to recovery from affinity beads . Furthermore, they demonstrate the robustness and also the compatibility of the protease elution protocol with ap - qms strategies such as the stoichiometry determination of protein complexes . Stoichiometry determination based on the absolute quantification of interacting subunits requires purification of a homogeneous sample. (12) we selected a rad21 antibody for coimmunoadsorption experiments because most if not all rad21 is found in the 14s cohesin complex, where other subunits have also been detected in subcomplexes of cohesin . For example, smc1 and smc3 also exist as a heterodimer. (29) thus, using a rad21 antibody allowed us to separate both of the 14s cohesin complexes (stag1 and stag2 containing) from cohesin subcomplexes without enriching for free, non cohesin associated rad21 . In the present study we showed for the first time that cohesin from soluble hela this is in agreement with the current structural model of cohesin based on electron micrographs, crystal structure of subunit fragments and available biochemical data (reviewed in ref (28)). We used a total of 7 reference peptides for stag quantification; three were specific for isoform 1, three were specific for isoform 2 and one measured both isoforms (dgiefafk). In all cases measured amounts of dgiefafk were within a 10% tolerance of stag1 + stag2 amounts, thus increasing the confidence of stag quantification (figure s8). It was previously shown by immunoadsorption and western blot analysis that the ring - like smc1-smc3-rad21 structure preferentially associates with stag2 . The authors concluded from their experiments that the stag1:stag2 ratio of cohesin subpopulations is about 1:3 (see figure 3d in ref (30)). Here, using ms based absolute quantification we determined the stag1:stag2 ratio to be in the range of 1:12 to 1:15 in cohesin purified from soluble extract of exponentially growing hela cells (figure 5). The discrepancy could be explained by the limited dynamic range and the semiquantitative nature of quantification based on western blotting and densitometry. (39) relative abundance of stag isoforms in the population of cohesin complexes . Cohesin is predicted to form a ring - like structure (ref (28)) with a subunit stoichiometry of 1:1:1:1 as measured in this study . The relative abundance of stag1 containing cohesin is 68% and that of stag2 is 9294% in soluble extract of logarithmically growing hela cells . In the present study, we have shown that a protease mediated elution increased the recovery of cohesin and apc / c from antibody - conjugated affinity beads by a factor of 2 to three . Hence, while acid elution was found to be less efficient, a simple predigestion for 1560 min was sufficient for greatly improved if not complete recovery without leading to a significant sample contamination from cleaved antibody peptides . Furthermore, absolute quantification and subsequent stoichiometry determination of the cohesin complex demonstrated the robustness and compatibility of the protease elution method with ap - qms studies . Using this elution technique we have for the first time measured the subunit stoichiometry of the cohesin complex from soluble extract of hela cells . The protease elution method is ideally suited for absolute quantification studies where sensitivity is crucial, demonstrated in this study by measuring the exact stag1:stag2 stoichiometry within the population of cohesin complexes . It can further be applied to the determination of protein copy numbers due to efficient if not complete recovery from affinity beads (if complete depletion of the protein from the extract is shown). Applied to the identification of protein complexes in ap - qms studies it has the potential to increase the sensitivity for detecting low abundant interactors, again due to higher recovery compared to acid elution and because of no or only insignificant contamination from cleaved antibody peptides compared to standard on - bead digestion.
|
During adolescence, children undergo rapid physical, mental, and emotional changes, and thus become prone to risk - taking behaviors such as voluntary poisonings . Voluntary poisoning has been defined by the world health organization multicenter study on parasuicide as an act with a nonfatal outcome in which an individual deliberately ingests a substance in excess of the prescribed or generally recognized therapeutic dosage . The significance of the event may vary by age, but the risk assessment in emergency units is usually identically . According to the annual report of the american society of toxicology centers, the children in the 10 to 19 years age group presenting to the hospital with intentional ingestions can be divided into 3 categories: voluntary abuse, intentional misuse, and suicide attempt . There is a tendency to underestimate the importance of voluntary poisoning in adolescent because usually it is not fatal . A triple assessment must be carried out in voluntary poisoning: somatic, psychological, and social . The initial somatic examination will assess the immediate severity of the poisoning in order to apply an appropriate treatment (possibly cure). The psychological evaluation should begin as early as possible, as soon as the patient's state of consciousness permits . This evaluation should analyze the history and identify risk factors leading to relapse and the existence of underlying conditions, particularly depression . The social assessment must be carried out with the participation of a social care team, comprising the patient's familial, scholar, and educational context . There is a little literature describing the epidemiology of acute poisoning and intoxication among adolescents . The aim of this study was to analyze the epidemiological profile and to identify the triggering factors of voluntary intoxications and poisonings in adolescents admitted at st . We performed an observational cross - sectional retrospective study on a group of 219 adolescents with voluntary poisoning, admitted at regional center of toxicology in st . Mary children's emergency hospital, iasi during 2014 . In our patients, poisonings included pharmacological drugs, alcohol intoxication, chemical substances, and maladaptive effects of illicit drugs . We assessed the following factors: sociodemographic data, educational status, the substance used, the motivation for overdose, psychiatric problems, and the outcome of poisoning . During admission, these patients had received psychosocial assessment by a psychiatrist, a psychologist, and a social worker . Diagnosis of depression was established by the psychiatrist according to standard dsm - iv criteria for major depressive disorder, through structured clinical interview, questioning both the teens and their parents or other caregivers . The psychiatric examination in children with coma the patients who could not be subjected to psychological and psychiatric examinations at the time of their admittance, according to the toxicology department's protocol, were excluded from the study . We refer to poisoning as the consumption of some substances with an intentional aim to self - harm (e.g., pharmaceutical drugs). Similarly, we refer to intoxication as excessive ingestion of some substances otherwise not harmful in habitual behavior (e.g., alcohol). All statistical analyses were performed using statistical package for social science (spss), version 19 for windows . The results have been reported as mean standard deviation for normally distributed variables . Groups comparison for categorical data was performed by chi - squared test and relative risk (rr) was calculated . The mean age was slightly lower in girls, but not statistically significant (16 2.05 years in boys and 15.5 0.7 years in girls). Poisonings were more prevalent in summer and autumn, approximately 60% of all events . The agents used to commit poisoning, in order of frequency, were pharmaceutical drugs, alcohol, illicit drugs, caustics, and insecticides raticides (table 1). We noticed that pharmaceutical drugs were the most involved in self - poisoning, 34.7% of total cases, mainly in girls (56.3% vs. 15.5%; p = 0.0001), with an rr 3.63 times higher than in males . Regarding the poisoning with a single type of medicine, we found that the most frequently involved were paracetamol (acetaminophen)23.1% (12) of cases, benzodiazepines19.2% (10) of cases, antiepileptics15.4% (8) of cases, and antibiotics13.5% (7) of cases . Others drugs involved in self - poisoning were hydrazide and ibuprofen (4 cases each); tricyclic antidepressants (2 cases); and antipsychotics, iron salts, anti - parkinson agents, mineral supplements, and calcium salts (1 case of each). We encountered mild, as well as severe cases of acetaminophen poisoning, the median (min max range) of liver transaminase being 543 ui / l (721866 ui / l) for alanine aminotransferase and 214 ui / l (46428 ui acute ethanol intoxication was encountered in 32.4% of cases, especially in males (77.4%), with an rr 3.05 times higher than in females, and in rural areas (table 1). The average blood alcohol level at admission in the emergency unit was slightly higher in boys (3 0.77 g vs. 2.5 0.61 g in girls). The highest alcohol level encountered was 5.07 g to a 17-year - old teenager admitted with alcoholic coma . Acute voluntary illicit drug intoxications were not only important (20.5%), but also more common in boys, with an rr 3.55 higher than in girls . The most common drugs were those involving so - called ethnobotanical substances (68.8%), while the frequency of high - risk drugs intoxications was lower (31.2%). In our study, 7 teenagers were chronic users of ethnobotanics . Self - poisoning with caustics and insecticides were rare, but potentially serious, and both were more common in women . Drugs voluntary poisoning was more frequently encountered in rural areas (38.1% vs. 28.8%), but without statistical significance; however, voluntary illicit drugs intoxications were significantly more common in urban areas (30% vs. 15.1%; p = 0.009), with an rr 1.99 times higher than in rural areas . Regarding ethanol, caustics, and insecticides raticides poisoning the most common given reasons for poisoning were family and school conflicts, with 24.7% of cases and 13.2% of cases, respectively . We noticed that both family and school conflict triggered voluntary poisoning in girls more often than in boys, but the differences were not statistically significant (table 2). The desire for group integration was significantly more frequently invoked in boys (p = 0.001), with rr over 4 times higher than in girls (table 2). Less frequently identified reasons for poisoning were conflict with partner, curiosity, defiance, demonstration purpose, festive events, victim of aggression, and the failure of attempts to lose weight in 2 girls (table 2). In 16% of cases, teens came from dysfunctional families, 4% were cared by their grandparents and 6.4% of cases were institutionalized children . Suicidal purpose was confessed only in 6 cases in girls and in 2 cases in boys . No triggering factor has been identified in a large percentage of the cases, especially in boys (20.7% vs. 8.7%; p = 0.023). Eight teenagers committed self - poisoning twice, 4 teens did it for the 3rd time, and 1 case was admitted at his 4th attempt . We found that voluntary poisoning rr was slightly higher in boys presenting emotional and/or conduct disorder (rr = 1.33) or adjustment disorder (rr 1.5 times higher than in girls). It was noticeable that an important percentage of adolescent girls had severe depression (23.3% vs. 6.9%; p = 0.001) with an rr more than 3 times higher than in boys . Suicidal ideation or autolysis was more frequently encountered in girls and even though the percentage differences were not statistically significant; it was noticed an rr 3.38 and 2.82 times, respectively, higher than in boys . Many patients had no psychiatric disorder, but the percentage of boys who did not have any mental disorder at the time of examination was significantly higher than that of girls (52.6% vs. 34%; p = 0.008) (table 3). It was found that most teenagers who presented with voluntary poisoning had no school problems (71.7%). Yet some of them faced dropout (12.8%), absenteeism (9.13%), repeaters (4.1%), or expulsion (5 cases) (table 4). Nevertheless, it has to be noted that 8.4% of teenagers initially presented an extremely serious condition, being admitted in various stages of coma (glasgow score <8). Clinical manifestation associated with voluntary poisoning were traumatic cranial and brain injury by falls in 8 cases and 7 cases presented self - harm signs (sectioning veins). Self - poisoning, the most common method of self - inflicted injuries and attempts to suicide among adolescences, represents a public health problem in industrialized countries . Therefore, it is important to identify the risk factors and predictors in order to insure proper preventive care . We analyzed the adolescents admitted in a regional center of toxicology, where patients are sent from the northeast part of romania . This is the first study that analyses the epidemiological issue of voluntary poisoning and intoxication in a representative cohort for this region . According to the literature, one of the main risk factors in self - poisoning is female gender, due to the facts that girls consider suicide more frequently during adolescence . However, a slightly predominance of boys is observed in our study . According to the literature, instead, the use of drug and alcohol intoxication was found especially in boys . In our study, other studies recorded a greater percentage of self - poisoning involving medicines, reaching 84.5% or even 97.8% . Also, many patients presented with polydrugs poisonings . The drugs most frequently involved in self - poisoning are different from one country to another and from one toxicology center to another, depending on drugs prescription, their availability and accessibility, and the purpose of poisoning . Similarly to the results of a recent prospective study conducted in france, we found that the most common pharmaceutical drug involved in single - drug self - poisoning was acetaminophen . Studies carried out in united states also report analgesics (acetaminophen and nonsteroidal anti - inflammatory) as most commonly involved in intentional poisoning attempts, followed by sedative / hypnotic and antipsychotic drugs . Literature data suggest that substance use is a powerful independent risk factor for self - inflicted injury and suicidal behavior . Some studies underline the importance of including alcohol intoxication and maladaptive effects of drugs in the spectrum of adolescent poisoning, given that they can be an important cause of death . Ethanol poisoning was one of the most frequent cause of intoxication . Considering that this study included only hospitalized cases, we may think that the frequency of ethanol intoxication is even higher among teenagers, because the mild forms were not admitted . Some studies performed in other countries show that the child's age for his first alcohol ingestion has declined in recent years . Thus, a french investigation showed that 59% of children ages 11, 72% of children ages 13, and 84% of those ages 15 have already drunk alcohol at least once . In our cohort, the ethanol intoxication was more frequent in rural areas due to alimentary behaviors, parents examples, and the greater availability of ethanol products, especially in autumn, in this region . In our study, the most common acute voluntary drug intoxications were those involving the improperly called ethnobotanic substances . The products dubbed ethnobotanic are used for their psychoactive and physiological effects which resemble that of classic drugs; they contain chemical substances or mixtures of vegetal and chemical substances and are sold on the internet and smart shops / head shops . They are commonly consumed as cigarettes or joint and are known as novel psychoactive substances (designer drugs). . The socioeconomic status in middle - income countries like romania may be the reason for the more frequent use of ethnobotanic substances compared with other countries . Studies suggested that an authoritative parenting or rejecting neglecting parenting style associated with lack of affection (inflexible families) generates risk for suicidal thoughts and attempts in adolescence . These studies also identified some other familial risk factors, such as absenteeism, parental separation events, and migration background . An important percentage of adolescents in our study came from dysfunctional families or were raised by their grandparents, as their parents work in other countries . Growing up without their parents became an important issue in the determinism of children behavioral disorders in the last decade in romania . Also, school failure itself is not a triggering factor, but the association with academic pressure, personal dissatisfaction due to school results and lack of social / family support may cause suicidal behavior . Underlying psychiatric illness confers a significant risk for committing self - harm and can promote the transition to a suicidal act and to relapse . The presence of a psychiatric disorder multiplies by a factor of 11 to 27 the risk of suicidal attempt over the general population . In our study, around half of the children had mental health issues . Out of these, a third accounted for depression, making them extremely susceptible to suicidal attempts . Depression was found in 31% of girls, with a 3 times higher rr for voluntary poisoning in girls than in boys . The rates of depression increase greatly during adolescence to reach a prevalence of around 1% in boys and 2% in girls . Our results are similar with those in the literature, indicating that females are at risk for traditional suicidal ideation / depression measures, whereas risk - taking behaviors (alcoholism or drug abuse) are more common in males . In our patients, suicidal ideation was assessed by a psychiatrist communicating with the patients, taking into account the adolescents psychosocial factors and history and encouraging them to share their feelings and concerns . Children diagnosed with depression or suicide ideation were transferred into the psychiatric clinic for treatment, after the acute episode . It is important to follow these patients and to give a specific treatment, in order to avoid repeated episode of suicidal attempts . Only a few patients of the study group confessed the suicide attempt . For a lot of them, poisoning had only a demonstrative purpose, or it was meant as a call for help or a resumption of dialog, but the passage to an act should not be neglected . Some authors opined that it is hard to distinguish between suicide attempter's adolescents and at - risk adolescent, suicide attempts being one point on a continuum of adolescent problem behaviors . Physiological counseling and personal approach in accompanying patients to overcome suicidal ideation should be a priority to the healthcare providers . It included only children with voluntary poisoning admitted in a tertiary hospital from the northeast part of romania; mild poisoning cases who did not need hospital care were excluded, as well as patients without a psychological and psychiatric examination . Due to these limitations, we cannot estimate a rate of adolescent poisoning and the presented result are not representative of all self - inflicted poisoning cases among adolescents in romania . The incidence of alcohol and ethnobotanic substances intoxication is higher in general population, if we consider also the less dramatic cases, but without differences in terms of gender or demographic distribution from severe cases . Further detailed studies on screening and surveillance, with focus on the circumstances of poisoning and motives, are needed . We found that self - inflicted poisonings with pharmaceutical drugs were more common in girls and the use of drug and alcohol intoxication was found especially in boys . Family or school conflicts and emotional and/or conduct disorders were the most important triggering factors of voluntary poisoning . Triggering factors and adolescents with suicidal risk should be identified in order to avoid fatal events . Familial factors have to be carefully considered, because they play an important role in the process of personality development in adolescents.
|
Immune hemolysis is a shortening of red blood cell survival due, directly or indirectly to antibodies . It is necessary to identify these atypical antibodies in the patient s serum in order to select appropriate blood for transfusion . Even in the most vexing situation encountered by a transfusion specialist where no compatible units are available for a patient with severe anemia transfusion requirement should be considered as a medical emergency even if serologic testing is incomplete . A 20-year - old female was referred to our hospital with complaints of icterus and breathlessness . She had similar complaints one year back and was treated for jaundice by a local physician . Prior to her referral, she had been transfused three units of ab positive blood over one week . On general physical examination, there was mild leucocytosis and blood film showed autoagglutination with the presence of nucleated red cells (19/100 wbcs). Plasma and urine hemoglobin were raised . Direct antiglobulin test with poly - specific coomb's reagent (igg + c3d) (tulip diagnostics) was positive . Patient also had a positive antibody screen with all three reagent cells in the anti - human globulin test (ortho cell panel, ortho diagnostics). Since the patient had life - threatening anemia with urgent requirement for transfusion, detailed phenotyping was not done and crossmatching was performed with several random a rh - positive packed red cells but no compatible unit was detected . She received three least incompatible a rh - positive non - leuco reduced packed red cell units over three days as a life - saving measure after informed consent . No adverse events were reported during or after transfusion . Besides, she was also started on steroid therapy, antibiotics and diuretics . However, she developed sudden cardiorespiratory arrest on fifth day and could not be revived . The patient was a case of coronary artery disease with off and on gastric bleed and a recipient of multiple transfusions in the past . Peripheral blood smear showed dimorphic blood picture with moderate anisocytosis and poikilocytosis with mild hypochromia, microcytes, macro - ovalocytes and polychromasia . Blood group was o rh - positive and two units of o rh - positive packed cells were transfused . Since there was not much improvement in hemoglobin, another transfusion was requested but crossmatch was incompatible and antibody screen was positive . There was a difference in the strength of reaction at different phases and auto - control was negative . Antibody identification studies suggested anti e, jka and s as the implicating antibodies (patient e-, jka- and s-). Strong possibility of anti e was considered on 11 cell identification panel results . Meanwhile, patient improved clinically and was discharged at hemoglobin of 10.5 gm / dl with no further requirement for transfusion . Subsequently, he was readmitted with another bout of hematemesis and hemoglobin of 6.4 gm / dl . Patient received two transfusions by standard compatibility testing procedure since the blood bank was not informed about his previous immuno - hematological work up and hence a phenotypically matched blood was not given . However, there was a reaction with the first unit in the form of fever and mild jaundice (serum bilirubin 2.2 mg / dl), which recovered subsequently . A 20-year - old female was referred to our hospital with complaints of icterus and breathlessness . She had similar complaints one year back and was treated for jaundice by a local physician . Prior to her referral, she had been transfused three units of ab positive blood over one week . On general physical examination, there was mild leucocytosis and blood film showed autoagglutination with the presence of nucleated red cells (19/100 wbcs). Plasma and urine hemoglobin were raised . Direct antiglobulin test with poly - specific coomb's reagent (igg + c3d) (tulip diagnostics) was positive . Patient also had a positive antibody screen with all three reagent cells in the anti - human globulin test (ortho cell panel, ortho diagnostics). Since the patient had life - threatening anemia with urgent requirement for transfusion, detailed phenotyping was not done and crossmatching was performed with several random a rh - positive packed red cells but no compatible unit was detected . She received three least incompatible a rh - positive non - leuco reduced packed red cell units over three days as a life - saving measure after informed consent . No adverse events were reported during or after transfusion . Besides, she was also started on steroid therapy, antibiotics and diuretics . However, she developed sudden cardiorespiratory arrest on fifth day and could not be revived . The patient was a case of coronary artery disease with off and on gastric bleed and a recipient of multiple transfusions in the past . Peripheral blood smear showed dimorphic blood picture with moderate anisocytosis and poikilocytosis with mild hypochromia, microcytes, macro - ovalocytes and polychromasia . Blood group was o rh - positive and two units of o rh - positive packed cells were transfused . Since there was not much improvement in hemoglobin, another transfusion was requested but crossmatch was incompatible and antibody screen was positive . There was a difference in the strength of reaction at different phases and auto - control was negative . Antibody identification studies suggested anti e, jka and s as the implicating antibodies (patient e-, jka- and s-). Strong possibility of anti e was considered on 11 cell identification panel results . Meanwhile, patient improved clinically and was discharged at hemoglobin of 10.5 gm / dl with no further requirement for transfusion . Subsequently, he was readmitted with another bout of hematemesis and hemoglobin of 6.4 gm / dl . Patient received two transfusions by standard compatibility testing procedure since the blood bank was not informed about his previous immuno - hematological work up and hence a phenotypically matched blood was not given . However, there was a reaction with the first unit in the form of fever and mild jaundice (serum bilirubin 2.2 mg / dl), which recovered subsequently . Autoimmune hemolytic anemia is a fairly uncommon disorder with estimates of the incidence at 13 cases per 100 000 per year . In contrast, alloimmune hemolytic anemia requires exposure to allogeneic red cells through pregnancy, transfusion or transplantation . The incidence of acute hemolytic transfusion reactions has been estimated to be 0.0030.008%, while 0.050.07% of transfused patients develop a clinically recognized delayed hemolytic transfusion reaction. [46] delayed serologic transfusion reactions are more common and are a frequent finding in patients who receive multiple transfusions . Anemia is of variable severity and some patients present with fulminant hemolysis, jaundice, pallor, hemoglobinuria and hepatosplenomegaly . In the first case, the patient was erroneously grouped and transfused ab positive blood before referral to our center . She presented with severe life - threatening anemia, jaundice, mild hepatosplenomegaly and evidence of hemolysis . Approximately 57% of patients with warm autoimmune hemolytic anemia have free serum autoantibody and a positive indirect antiglobulin test . Due to pan agglutinin in the serum of patients with autoimmune hemolytic anemia, crossmatching blood is a difficult and time - consuming process since the pan agglutinin reacts with all donors red blood cells .. moreover, the most pressing problem is detection and identification of rbc alloantibodies that may be masked by the autoantibodies . In our patient, the anemia was life threatening with time constraints to perform adsorption studies with subsequent identification of underlying alloantibodies . Even after thorough serological evaluation, the optimal blood for transfusion is still likely to be mismatched . Clinical reluctance to administer transfusions to such patients due to serological mismatch or an incomplete workup can have devastating consequences . Factors such as rate of onset of hemolysis and anemia, presence or absence of accompanying hypovolemia and the underlying health status and cardiorespiratory reserve must be taken into account to determine the transfusion trigger . When a decision to transfuse mismatched blood is taken, transfusion of small aliquots to provide relief of symptoms and avoid fluid overload has been recommended . It has also been recommended to transfuse using leucocyte - reduced blood products and pre - medication with antihistaminics and antipyretics to prevent febrile and allergic reactions, respectively, in patients with multiple antibodies . The second patient was a recipient of multiple transfusions with difficulty in finding a compatible unit . Antibody screen was positive with difference in the strength of reaction in immediate spin, 37c, and in the antihuman globulin phase . The patient had multiple alloantibodies, which did not cause any clinical evidence of delayed hemolytic transfusion reaction except mild subclinical jaundice . However, in spite of repeated transfusions, there was not much improvement in the hemoglobin . The reason could be that the antibody titer was low initially but subsequent to transfusion, an anamnestic response led to rise in antibody titer and hence subsequent crossmatching did not give a compatible unit . When the patient's sample was received in the first instance, crossmatch was compatible . The incidence of alloimmunization in random multi - transfused patients has been reported to be 034%. [1519] it is more in transfusion - dependent patients, such as those with sickle cell disease, aplastic anemia, myelodysplastic syndrome and other congenital or acquired anemia . In a prospective study on the incidence of red cell alloimmunization following transfusion, 8.4% of patients developed antibodies within 24 weeks of transfusion . Takeuchi and coworkers have reported a delayed hemolytic transfusion reaction due to anti e, anti c and anti jka that are clinically significant antibodies . Such patients present a challenge for elective transfusions particularly if multiple clinically significant alloantibodies are present . If such a situation arises, transfusion should be withheld until suitable antigen - negative donor units are located . Patients with multiple alloantibodies should receive phenotypically matched red blood cells to avoid transfusion reaction and they should be given a card indicating the antibody specificities so that he can receive antigen negative blood . In either case, a good communication must be established between the clinician and the transfusion specialist to assess the clinical urgency and the complexity of serological studies . The final decision to transfuse should depend on the evaluation of the patient's clinical status and the benefits must be weighed to the potential risks of transfusion.
|
Characterization of the carotid flow waveform is important as its contour determines regional shear stress, a strong determinant of atherosclerosis, and its pulsatility contributes to cerebral damage [13]. The carotid flow velocity waveform in healthy human arteries is unidirectional (predominantly antegrade) and triphasic, exhibiting characteristic peaks in early systole, late systole, and early diastole [46]. Late systolic flow velocity increases with age and contributes to increased cerebrovascular risk [4, 7]. Carotid late systolic flow velocity augmentation may be quantified using the carotid flow augmentation index (faix). It has been suggested that pressure from wave reflections is a primary determinant of late systolic flow augmentation as there is a strong association between carotid faix and carotid pressure aix . Additional vascular and hemodynamic correlates of faix remain unexplored . An additional novel hemodynamic factor that may influence the contour of the carotid flow wave is related to myocardial properties . During late systole as the left ventricle (lv) begins to untwist and myocardial shortening rate is reduced, there is rapid decline in outflow momentum and lv pressure [8, 9]. This results in propagation of a forward travelling expansion wave (also known as a decompression wave or rarefaction wave) which creates a suction effect that applies a braking action to the column of blood from behind and actively decelerates flow [10, 11]. Suction waves contribute to late systolic / early diastolic flow in the coronary circulation, the aorta / aortic valve closure [8, 13], and the femoral artery . Previous studies have identified the existence of a late systolic forward travelling expansion wave in the carotid artery as well [15, 16]. Whether this expansion / suction wave is specifically associated with carotid flow velocity in late systole the purpose of this study was to examine hemodynamic correlates of cca faix in young healthy men . Using doppler - ultrasound, wave intensity analysis (wia), and wave separation analysis (wsa), we measured carotid artery flow velocity, carotid stiffness, wave reflections, and suction . We hypothesized that in addition to pressure from wave reflections, the contour of the carotid flow waveform would be associated with a forward travelling expansion / suction wave . We hypothesized that, faix would be associated with cca intima media thickness (a measure of subclinical atherosclerosis / vascular wall damage) [1719] and cerebral pulsatility index (a known correlate of cerebral microvascular damage) [2022]. Eighteen young healthy nonsmoking men free of cardiovascular and metabolic diseases and not taking medications of any kind served as subjects for this investigation . All subjects provided written consent and this study was approved by the institutional review board of syracuse university . Participants fasted for 3 hours and refrained from vigorous exercise, caffeine, and alcohol the day of testing . Following 10 minutes of quiet supine rest, images of the left common carotid artery (cca), just distal to the carotid bulb, were obtained using a 5.013.0 mhz linear - array probe (prosound 7, aloka, tokyo, japan). Echo - tracking was used to measure diameter changes within 1/16th of an ultrasound wavelength (0.013 mm) creating a distension waveform almost identical to pressure waveforms (figure 1(a)). Range gated color doppler signals averaged along the doppler beam were used to simultaneously measure flow velocity waveforms . At least 8 waveforms were ensemble - averaged to provide a representative average waveform . Wave intensity was calculated using time derivatives of blood pressure (p) and velocity (u), where wave intensity = (dp / dt du / dt); thus the area under the dp / dt du / dt curve represents the energy transfer of the wave (figure 1(b)). Wia states that, if these wave fronts carry a positive rate of pressure change, they are referred to as compression waves . Conversely, if the wave front carries a negative rate of pressure change, they are referred to as expansion waves . It should be noted that expansion in this setting is an expression from fluid dynamics theory referring to decreasing pressure and not to be confused with dilitation . Using wia, (1) w1 represents a forward compression wave produced during early systole that accelerates flow and increases pressure; (2) w2 represents a forward expansion / decompression wave that decelerates flow and reduces pressure; (3) the negative area (na) between w1 and w2 is a backward travelling compression wave due to the sum of waves reflected from the periphery that decelerates flow but increases pressure [23, 25]. Arterial stiffness was assessed using a single - point pulse wave velocity (pwv) as previously described: (1)pwv=xpmin2, where =ln(pmax/pmin)[(dmaxdmin)/dmin]. P and d correspond to pressure and diameter, respectively, and max and min refer to maximum (systolic) and minimum (diastolic) pressure values during the cardiac cycle, obtained from simultaneous assessment of carotid pressures from the contralateral cca (calibrated against brachial mean and diastolic pressure assessed from an oscillometric cuff, described below). Blood density,, is assumed constant and equal to 1050 kg / m . Systolic peak (vs), late systolic peak / shoulder (vsr), and diastolic (ved) and mean blood velocities (vm) were measured using doppler - ultrasound and calculated as follows: vm = v(t)dt / ft, where v(t)dt is the velocity - time integral of the velocity waveform and ft is flow time . Carotid flow augmentation index (faix), as depicted in figure 2, was calculated as (vsr ved)/(vs ved). Cca shear rate was calculated as 4 (vmean / cca mean diameter). Intima media thickness (imt) was measured from the lumen - intima interface to the media - adventitia interface across a 5 mm region distal to the carotid bulb using semiautomated digital calipers . Middle cerebral artery (mca) blood velocity was assessed via transcranial doppler ultrasound using a 2 mhz probe (dwl doppler box - x, compumedics, germany). Velocity envelopes were obtained at a depth of 5065 mm and the pulsatility index calculated as described above for the cca . Simultaneous pressure waveforms were obtained from the contralateral cca using applanation tonometry (sphygmocor, atcor medical, syndey, australia). Following cca measures, synthesized aortic (ao) pressure waveforms were generated from radial artery pressure waves using a generalized transfer function . Carotid and aortic pressure waveforms were calibrated to brachial mean arterial pressure (map) and diastolic bp obtained from simultaneous measures using an oscillometric cuff (panasonic ew3109, secaucus nj). Augmentation index (aix) was calculated as the difference between the early and late systolic peaks of the pressure waveforms to the total pulse pressure and expressed as a percentage (p2 p1/pp 100). Using a modified pseudo average - flow waveform, carotid and aortic pressure waveforms were separated into forward (pf) and backwards / reflected (pb) components as previously described [2830]. This rounded triangular flow waveform (figure 3, generated by the sphygmocor, atcor medical) assumes zero flow during diastole and is interpolated such that the base of the flow wave (triangle) corresponds to the upstroke of the pressure wave (pressure at waveform foot = time 0) and the incisura / dicrotic notch (i.e., aortic valve opening signifying the start of ejection and aortic valve closure signifying end ejection). Peak ejection is set at the inflection point (if augmented pressure> primary wave pressure) or peak pressure (if augmented pressure <primary wave pressure). More specifically, the inflection point is determined from the first negative zero crossing of the first derivative (inflection point occurs before peak pressure; pressure wave is transitioning from positive to negative). If a zero crossing is not present before peak pressure, peak ejection is determined from the positive zero crossing of the second derivative (inflection point occurs after peak pressure; pressure wave is transitioning from negative to positive). The forward and backward components of the pressure wave were constructed using the following equations: (2)(1) pf(t)=0.5[pm(t)+zcqm(t)],(3)(2) pb(t)=0.5[pm(t)zcqm(t)], where pm(t) is the measured time - varying pressure wave (aortic or carotid), qm(t) is the approximated pseudo flow wave, pf is the forward pressure component, and pb is the backward pressure component . P and q denote harmonics derived from fourier decomposition of the pressure and flow signals into a series of sinusoidal harmonics with zc being calculated by averaging the modulus of the 4th to the 7th harmonic of the input impedance (accounting for fluctuations due to wave reflections). Because calculation of pf and pb involves the product of flow and characteristic impedance (zc), which itself has flow in the denominator, calibration of the flow waveform is not needed . Thus as seen in figure 3, the flow scale is arbitrary / unit - less . Pulse transit time can be estimated from the time difference between the derived forward and reflected waves (maximum time lag determined from the highest cross - correlation of pb and pf normalized to same amplitude) and used to provide an estimate of aortic pulse wave velocity (pwv). The wave separation analysis (wsa) reflection index (rix) was calculated as pb / pf . The aortic - carotid transmission index (tix) was calculated as aortic rix / carotid rix and used to provide insight into aortic - carotid impedance matching . If a primary outcome variable was not normally distributed, it was log transformed for parametric analyses . Participants were 22 1 years of age with a body mass index of 24 1 kg / m . Resting brachial sbp and dbp were 122 2 and 73 1 mmhg, respectively . Mean values for carotid and aortic vascular - hemodynamic parameters are presented in table 1 and table 2, respectively . Values of rix obtained from wia were not normally distributed and were thus logarithmically transformed to allow for parametric statistical analyses . Primary correlates of faix were w2 (r = 0.52, p <0.05), carotid wia logrix (r = 0.56, p <0.05), carotid pressure aix (r = 0.60, p <0.05), and carotid wsa rix (r = 0.63, p <0.05). Faix was not directly associated with carotid imt, carotid stiffness (measured as pwv), carotid shear, carotid pulsatility index, cerebral pulsatility index, and aortic stiffness (pwv) nor was it associated with aortic pressure aix (p> 0.05). Correlates of the individual carotid velocity components that comprise faix are presented in table 3 . Of interest, vsr was inversely correlated with w2 (p <0.05) and positively correlated with aortic aix (p <0.05) and aortic rix (p <0.05). Tix was associated with aortic pwv (r = 0.66, p <0.05), cca shear (r = 0.53, p <0.05), cca imt (r = 0.56, p <0.05), cca pulsatility (r = 0.48, p <0.05), and mca pulsatility (r = 0.39, p = 0.06). Cca pulsatility was also associated with mca pulsatility (r = 0.63, p <0.05). Findings of this study support previous suggestions that faix is associated with measures of wave reflections . This is primarily due to attenuation of vs (primary peak in early systole) by waves reflected from the cerebral circulation and augmentation of vsr (secondary peak in late systole) related to wave reflections arriving from the lower body / aorta . Faix is also inversely associated with a forward travelling decompression wave of myocardial origin, suggesting a role for lv suction in affecting the carotid flow contour . This was primarily due to the inverse association between w2 and vsr. Thus faix is a unique ventricular - vascular coupling parameter that reflects a complex interplay between lv properties (relaxation / suction), aortic - peripheral vascular properties (wave reflections from the descending aorta / lower body), and carotid - cerebral properties (wave reflections from the cerebral circulation). Faix itself was not associated with cca imt or mca pix in young healthy adults . According to the pioneering work of murgo et al ., blood pressure waveforms may be characterized into any 1 of 4 categories based on their contour . Type waveforms denote waveforms in which the late systolic shoulder is greater than pressure at a clearly defined inflection point yielding a positive aix (usually> 12%). Conversely type c waveforms are defined as those waveforms in which the late systolic pressure shoulder occurs after peak systolic pressure and is less than the primary wave pressure, yielding a negative aix . Use of aix as a measure solely attributable to pressure from wave reflections in young adults with type c waveforms has been challenged [33, 34]. In this setting, aix suffers from a tip - of - the - iceberg phenomenon in which only the pressure above the forward wave pressure is captured . Reflected wave pressure may be submerged along the falling edge of the forward pressure wave and/or may occur in diastole and in this setting aix provides little insight into wave reflection magnitude as calculated values are negative (p2 <p1). Wave intensity analysis (wia) and wave separation analysis (wsa) are distinct yet complimentary techniques that allow for a more parsimonious appraisal of pressure from wave reflections in young adults with type c waveforms [33, 35]. Using these techniques to calculate the reflection index, it was revealed that although carotid rix was associated with faix, it was not associated with carotid late systolic flow augmentation per se . It is generally acknowledged that pressure from wave reflections augments incident wave pressure but attenuates antegrade flow [28, 37, 38]. Therefore, wave reflections of cerebral origin would be expected to attenuate flow in the cca manifesting as an inverse association between carotid rix and vsr and this was not seen . Cca rix was inversely associated with vs suggesting that wave reflections are indeed important in affecting the carotid flow contour and faix . Our findings support computational multibranched fluid dynamics models put forth by masuda et al . That have revealed that vs is attenuated by arrival of a reflected pulse wave downstream of the cca . Owing to physical distance to the effective reflecting sites and/or speed of transit, wave reflections may arrive during midsystole rather than late systole, attenuating early systolic (vs) rather than late systolic (vsr) flow velocity . There was a positive association between aortic wave reflections and cca late systolic and diastolic flow (vsr and ved) and this is consistent with recent findings . Masuda et al . Also previously noted that vsr in the cca occurred as a result of arrival of reflected waves from downstream of the thoracic aorta, increasing flow rate in the cca in late systole . As such, the interface between aorta and carotid as related to cerebrovascular disease has recently received attention . It has been suggested that disproportionate stiffening of the aorta as compared to the cca affects regional impedance matching, reducing wave reflection at this junction and facilitating transmission of pulsatile flow into the cerebral circulation . In support of this, we noted an association between aortic pwv and the transmission index . The transmission index was further associated with cca shear, cca imt, cca pulsatility, and mca pulsatility . Thus alteration of wave reflection timing / magnitude in the aorta owing to increased pwv coupled with reduced wave reflection in the cca is associated with greater transmission of flow pulsatility into the cca and is further associated with regional shear rate, subclinical atherosclerosis / vascular wall damage (i.e., imt), and mca pulsatility . This may have important implications for cerebrovascular disease . According to the present findings, the decompression / expansion wave was a direct correlate of late systolic flow augmentation and this is highly novel . W2 as measured herein is a forward travelling expansion wave created by myocardial shortening rate (lv relaxation) and inertial force of aortic blood flow (momentum) that causes a rapid fall in lv pressure [10, 25]. Waves in the systemic circulation with a pulling effect have been known to exist for quite some time . This suction wave has been shown to be an important correlate / moderator of late systolic / early diastolic flow in the coronary [12, 43], aorta [8, 10], and femoral arteries . Most notably, this suction wave has been implicated as a factor contributing to aortic flow reversal and valve closure [8, 9]. It is interesting to note that retrograde flow in the aorta has recently been shown to be associated with late systolic / early diastolic antegrade flow in the cca . Our findings extend and link these observations suggesting for the first time that the expansion / suction wave is also associated with late systolic flow in the cca . Overall findings suggest a complex interplay between lv, aortic, and carotid hemodynamics in affecting the contour of the carotid flow waveform in young healthy adults . Based on current observations, late systolic flow augmentation in the carotid artery may be due to the summative effect of increased forward wave pressure from aortic origin arriving in midlate systole (reflected waves entering the carotid artery as forward waves causing flow acceleration, i.e., increased push from behind) and reduced suction (decreased pull from behind). This push - pull balance may be altered with aging or in the presence of hypertension owing to increased aortic stiffness and/or reduced lv function . More research will be needed to examine these hemodynamic interactions with aging and disease . We believe that these findings, however small, do fill an important void in the literature as studies to date that have examined hemodynamic correlates of carotid flow have done so in middle - age / older adults with predominantly type a and type b waveforms . Many of the parameters were derived from the same pressure and flow waveforms; thus there is potential that existence of relations is due to methodological colinearity . Cca pressure, and subsequent measures derived from the cca pressure waveform, was not measured in the same artery as that used to assess faix and measures of target organ damage (imt and mca pi). The left cca directly connects to the aortic arch, while the right cca indirectly connects to the ascending aorta via the innominate / brachiocephalic artery . Indeed, flow velocity is higher in the left cca in young adults compared to the right cca and may explain the slightly greater imt in left cca in later life . It should be noted that hemodynamic variables derived from wia were measured in the same cca as that used to assess faix and measures of target organ damage and results obtained from wia support results from wsa . In conclusion, faix is a complex parameter that reflects the integrated effects of lv, carotid, and aortic hemodynamics on specific cca flow components across the cardiac cycle . Late systolic flow augmentation in the cca is associated with both increased expansion wave magnitude (suction from the lv) and increased pressure from wave reflections.
|
A 43-year - old woman diagnosed with intravenous leiomyomatosis at another hospital was transferred to our hospital . She had suffered from palpitation, dizziness, dyspnea, and chest pain for two weeks prior to admission into another hospital, and had experienced syncope three times on the day of admission to our hospital . No cardiac murmur was noted, and laboratory findings were unremarkable with the exception of anemia (hemoglobin: 9.7 g / l). Cardiac and pelvic magnetic resonance imaging (mri) taken at the previous hospital revealed multiple low attenuation masses in the uterus, involving both ovaries, the left gonadal vein, the left internal iliac vein, and the left renal vein, which extended into the inferior vena cava (ivc), and to the right atrium (ra) (fig . 1). A trans - thoracic echocardiogram revealed a 4.81.8-cm hypermobile and echogenic mass in the ra connected to the mass in the ivc . Emergency one - stage operation was planned with a gynecologist, and upon being transferred to the operation room, the patient had a sudden onset of dyspnea and unstable blood pressure . Rapid endotracheal intubation was performed to maintain blood oxygen saturation . In transesophageal echocardiography (tee), the echogenic mass in the ra and ivc was not seen . We suggested that the mass detached from the ra and migrated to the right ventricle or the pulmonary artery . We discovered an echogenic linear mass in the pulmonary artery between the arterial bifurcation and both main pulmonary arterial branches (fig . Trans - abdominal hysterectomy and left salphingo - oophorectomy were performed through median laparotomy, and the mass in the left gonadal and internal iliac veins was completely removed (fig . Another mass in the pulmonary artery was also removed under conventional cardiopulmonary bypass without circulatory arrest (fig . The ra was opened to confirm that there was no remnant mass in the ra and the ivc . The patient's postoperative course was uneventful, and she has received follow - up care for two years without any evidence of tumor recurrence . Intravenous leiomyomatosis is a benign intravascular proliferation of smooth muscle cells originating from the intrauterine venules and reaching the right heart . The uncommon benign tumor usually arises from either the uterine venous wall or uterine leiomyoma, and although it is histologically benign, it can cause fatal cardiovascular complications such as cardiac failure, pulmonary embolization, or sudden death . In previously reported cases describing intracardiac involvement, the tumor extended to the right atrium in 30% of cases, and to the right ventricle in 70% of cases . Extension or embolization into the pulmonary artery or lung metastasis is a very rare complication constituting less than 5% of the reported cases . However, when it occurs, the course of the patient can be fatal, and urgent surgical correction is imperative . Ariza and colleagues described the first successful two - stage removal of an intracaval mass, with delayed laparotomy after resection of the intracardiac portion of a tumor in 1982 . Since then, a staged operation has been performed in many cases (radical resections of intracavocardiac tumors and intrapelvic components in separate operations), but more recently, a one - stage approach by median sternotomy with cardiopulmonary bypass with or without hypothermic circulatory arrest, and a separate laparotomy has been performed successfully . The advantages of the one - stage resection include avoiding risks of tumor embolism, tumor progression, or hemodynamic complications in the interval between the two stages of two - staged operations . In addition, because both abdominal and thoracic cavities are opened, the tumor can be removed completely, and vascular reconstruction and bleeding control may be more easily performed . However, in hemodynamically unstable patients, the longer operative time may not be appropriate, and a two - stage operation may be beneficial . Since incomplete resection of the tumor may causes recurrence, gathering detailed preoperative information regarding tumor localization, size, and extent by using abdominal ultrasound, echocardiogram, computed tomography, magnetic resonance imaging, and venography is required . Transesophageal echocardiography should also be performed to detect possible changes in the location and size of the tumor, as occurred in this case . In conclusion, intracardiac leiomyomatosis should be considered in a female patient presenting with an extensive mass in the right side of the heart, and urgent surgical removal should be performed to avoid possible fatal complications, even if the patient is asymptomatic . As the tumor may move or detach from the central venous system even during operation, intraoperative tee
|
Discovery of carbon nanoparticle (np) in 1980s was perhaps most important discovery of the last century . It was observed quite early that there is a radical alteration of physical and chemical properties of matter when it exists at nanoscale . Manmade nps range from the well - established multi - ton production of carbon black and fumed silica for applications in plastic fillers and car tyres to microgram quantities of fluorescent quantum dots used as markers in biological imaging . Substances smaller than 100 nm in size have been added in recent years to an increasing numbers of consumer products used in day - to - day life: in food packaging, medical devices, pharmaceuticals, cosmetics, odor - resistant textiles and household appliances . The extensive application of nanomaterials in a wide range of products for human use poses a potential for toxicity risk to human health and the environment . Such adverse effects of nanomaterials on human health have triggered the development of a new scientific discipline known as " nanotoxicity " the study of the toxicity of nanomaterials. [1 - 7] discovery of nps sounded the last death knell for the occupational hygiene movement . In 1990s it was accepted almost by consensus that statistical models of dose - response on which legislative limits are based may not be correct . While benefits of nanotechnology are widely publicized, the discussion of the potential effects of their widespread use in the consumer and industrial products are just beginning to emerge . Acceptance of np toxicity led to wide acceptance of the fact that nanotoxicology, as a scientific discipline shall be quite different from occupational hygiene in approach and context . Understanding the toxicity of nanomaterials and nano - enabled products is important for human and environmental health and safety as well as public acceptance . The scientific literature is a primary source of information about nanomaterial toxicology and thus plays a role in the emerging dialogue about the safety of nano - enabled products . American heart association's scientific statement concludes that short - term exposure to elevated particulate matter concentrations in outdoor air significantly contributes to increased acute cardiovascular mortality, particularly in certain at - risk subsets of the population . Long - term exposure to air pollution increases the risk of dying from coronary heart disease . Respiratory exposure can result in inflammatory reactions and release of pro - coagulatory cytokines into the circulatory system and may result in cardiovascular effects . The inflammatory nature of particulate matter has been convincingly confirmed, and there is an increasing appreciation of the adverse effects of particulates on endothelial function, fibrinolysis, and thrombogenesis . Very limited data exist for health effects secondary to inhalation of very fine respirable particles in the occupational environment . Nanomaterials may have effects on health due to their size, surface, shape, charge, or other factors, which are not directly predictable from mass concentration measurements . Evidence exists for disproportionately higher toxicity of nano - sized particles measured on mass basis. [8 - 12] the methods characterizing exposure and translocation of nps in the body are still experimental and there are reports of nps clearing from airways readily and gaining access to circulation and simultaneously reports are claiming that nps do not readily clear form peripheral airways and exert their effects mediated through inflammatory cytokines released into circulation . However, there are reports of acute impairment of vascular and myocardial function as a consequence of respiratory exposure of elemental carbon . The observed effects on cardiovascular function may be secondary to direct or indirect effects of carbon nps . The international life sciences institute research foundation / risk science institute convened an expert working group to develop a screening strategy for the hazard identification of engineered nanomaterials . The working group report presents the elements of a screening strategy rather than a detailed testing protocol . Based on an evaluation of the limited data currently available, the report presents a broad data gathering strategy applicable to this early stage in the development of a risk assessment process for nanomaterials . Oral, dermal, inhalation, and injection routes of exposure are included recognizing that, depending on use patterns, and exposure to nanomaterials may occur by any of these routes . The three key elements of the toxicity screening strategy are physicochemical characteristics, in vitro assays (cellular and non - cellular), and in vivo assays . There is a strong likelihood that biological activity of nps will depend on physicochemical parameters not routinely considered in toxicity screening studies . Physicochemical properties that may be important in understanding the toxic effects of test materials include particle size and size distribution, agglomeration state, shape, crystal structure, chemical composition, surface area, surface chemistry, surface charge, and porosity . Numerous epidemiological studies have associated exposure to small particles such as combustion - generated fine particles with lung cancer, heart disease, asthma and/or increased mortality. [11 - 12] both donalson et al, and oberdorster concluded in their reviews that ultra - fine particles of low solubility and low toxicity materials are more inflammogenic in the rat lung than larger particles of the same material . Additionally, nps are able to penetrate deeply into the respiratory tract . Once deposited in the alveolar region, they may translocate to blood and to sites distant from their portal of entry such as the liver, spleen, kidney and brain . The kidney is particularly susceptible to xenobiotics owing to its high blood supply and ability to concentrate toxins . Few studies have examined the impact of nps in kidney, while both glomerular structures during plasma ultra - filtration and tubular epithelial cells may be exposed to nps . There are two types of nps to be considered in hygiene science; one is the environmental np emitted from automobiles and the other is the manufactured np . In general nps (less than 100 nm) are reported to be permeable through the cell membrane and tissues and their large surface area is responsible for the greater toxicity compared to larger particles . However, there are contradictory reports on the health effects of nps . Recent reports suggest that carbon nanotubes, fiber - shaped biopersistent nps, resemble asbestos in the pathogenesis of granuloma and mesothelioma . Literature search describes a limited number of toxicological studies, but that all conclude that there are some health risks following exposure to nps . For a given substance, the toxicity is much greater when the substance is of nanometric dimensions than when it is of micrometric dimensions . Since these particles are very small, they could have significant toxic effects on workers' health . Due to the many unknowns related to nps and their potential health effects, caution and stringent prevention procedures are required for exposed people . The biggest hurdle is the practical impossibility of measuring nps' exposure on mass basis . Nps are omnipresent and exist almost always as a mixture . Except for occupational setting where only one type of np is manufactured taking cue from the studies in the arena of occupational medicine, it is being proposed that study of toxicity of asbestos may provide the models for np toxicity as chrysotile asbestos is a nanofiber . There is almost a consensus that asbestos fiber has surface properties quite different from the chemical properties of its constituents and it has been conclusively proven that only asbestos fibers in nanorange produce health effects . Carbon nanotube " is another nanofiber and workers involved in grinding operations are chiefly exposed to this type of nanofiber . It was found that carbon nanotubes have higher inflammatory potential as compared to another type of carbon nps fullerenes . Echocardiographic assessment of cardiac functions and actual measurement of left atrium and other chamber in three dimensions shall provide insights into the mechanisms of cardiovascular toxicity of carbon nps . A practical demarcation of healthy and diseased state is mainly the word of mouth of the patient hearing which a doctor starts formulating his diagnosis . Public health in the 21 century attempts to characterize markers for the incipient states of disease or sub - optimal health . Unlike disease states, sub - optimal health is a community diagnosis, and a well - accepted marker of sub - optimal health is lower average life span of population . There is an urgent need for the identification of clustering of " established risk factors " in a given population and devising interventional strategies . . The further study should plan in which established biomarkers for sub - optimal health shall be correlated with statistically determined exposure averages . Simultaneously, indicators like cimt, lae shall be used to assess the target organ damage . The omnipresence of nps shifts focus of research toward efforts to mitigate the health effects of nps . Newer health assessment methods and newer techniques need to be developed for diagnosing sub - optimal health in populations exposed to carbon nps . At present there exist no reliable and validated standards for measurement of aerosolized nanomaterials and there is considerable debate how nanomaterials gain access to different organ systems . The observed health effects can be thought to be due to the exposure to engineered nanomaterial in accordance with " precautionary principle " and " uncertainty - based decision making " . The occupational environments may be the places to look for high exposure to engineered nanomaterials and to assess their health effects . Furthermore, the potential use of new high throughput " predictive"toxicity " strategies, such as that envisioned in the recent nrc report " toxicity testing in the 21 century, " have emerged as possible solutions to deal with the issue of how to assess the safety of the thousands of chemicals to which humans are potentially exposed.
|
The broad mite, polyphagotarsonemus latus (banks) (acari: tarsonemidae), is a serious pest of several greenhouse crops worldwide, including pepper, cucumber and egg plants (gerson 1992; palevsky et al . Because of their small size (0.10.3 mm long), broad mites are not initially noticed in crops, but are detected when plants show damage symptoms (venzon et al . Broad mites attack young, growing plant parts and oviposit on the undersides of leaf surfaces . Young pepper plants have a particular low tolerance for broad mite damage (de coss - romero and pea 1998; jovicich et al . 2009); only five adult mites on a young pepper plant can result in lower fruit weight (weintraub 2007). A number of phytoseid mites, such as neoseiulus californicus (mcgregor) and neoseiulus barkeri (hughes) have been described to offer good control of broad mites (fan and petitt 1994; pea and osborne 1996). Neoseiuluscucumeris (oudemans) was also described to control broad mites on peppers when releasing individuals on each plant or every other plant (weintraub et al . 2003). However, broad mites are still one of the major pests on greenhouse peppers in south - eastern spain (e. vila personal observation). This is mainly due to high temperatures and low humidity during summers in this region and the prevalence of whiteflies, the vector of broad mites (parker and gerson 1994). This paper reports on a candidate natural enemy for biological control of broad mites, the generalist predatory mite amblyseius swirskii (athias - henriot) (acari: phytoseiidae). It has been shown capable of suppressing populations of the tobacco whitefly [bemisia tabaci (gennadius)], the greenhouse whitefly [trialeurodes vaporariorum (westwood)] (hemiptera: aleyrodidae) and the western flower thrips [frankliniella occidentalis (pergande)] (nomikou et al . Currently, a. swirskii is widely used to control thrips and whiteflies (vector of broad mites) in sweet pepper crops, also in south - eastern spain . In order to establish the suitability of a. swirskii to control broad mites, we measured oviposition and predation on broad mites in the laboratory and tested the ability of a. swirskii to control broad mites on pepper plants in a greenhouse . Sweet pepper plants were grown, pesticide free, in pots (2 l) with potting soil (jongkind bv, aalsmeer, hol03/no.3) in a greenhouse compartment (3 7 m). Amblyseius swirskii was reared on plastic arenas (8 15 cm), placed on a wet sponge in a plastic tray containing water (nomikou et al . Females were collected from infested pepper leaves with a fine brush, and a culture was started on intact pepper plants, which were grown as above, but kept in a box made of glass (45 45 55 cm) inside a walk - in climate room (25c 1.5 and 60% 0.5 humidity), free of other herbivores . The oviposition and predation rate of a. swirskii were measured during 2 days on a diet of adult female broad mites . Adult female broad mites are larger than adult males and relatively easy to detect . As a control, we measured oviposition rates without food and on a diet of pollen, which is known to be a good food source for this predator (nomikou et al . Young adult female predators (89 days old since the egg stage) were tested individually on a pepper plant leaf disc (diam . 24 mm) with a supply of 15 broad mites per leaf disc per day . A pilot study showed that this density is high enough to ensure maximum prey consumption . Predation was recorded as the number of broad mites consumed (as judged by the presence of the remaining transparent cuticles) after 24 and 48 h. because oviposition rates are affected by the previous food source of adult predatory mites, we used oviposition data from the second day of the experiment only (sabelis 1990). The distribution of oviposition data was non - normal due to zero inflation (especially in the treatment without food), even after transformations; we therefore used the more conservative nonparametric kruskal wallis test with post - hoc comparisons (siegel and castellan 1988) to compare oviposition among diets . The capacity of a. swirskii to control populations of broad mites was tested on sweet pepper plants in a greenhouse . Young plants without flowers were used because they produce no pollen that could be used as food by the predatory mites . Twenty or forty adult female broad mites, collected from the culture with a fine brush, were released on each plant . After 1 h, two females of a. swirskii were released on each plant, except for the controls . This resulted in four initial predator: prey ratios; 0:10; 0:20; 1:10 and 1:20, ratios were replicated four to seven times . Contamination of the plants with other herbivores was avoided by keeping the plant pots isolated in a water layer on tables inside the greenhouse compartments . The greenhouse compartments were free from flying herbivores such as whiteflies during the whole experiment . The replicates of different treatments of the experiment were performed in two different greenhouse compartments . The average temperature and relative humidity were similar for each treatment (25c 1.5 and 60% 0.5 humidity). The numbers of predatory mites and broad mites were assessed 3 weeks after introduction of the mites by collecting all leaves from each plant of each treatment . The leaves of each plant were put in a separate plastic bag and stored in a freezer . Later, they were cut into strips of 5 cm and the number of all stages of predatory mites and adult female broad mites was counted using a binocular microscope (magnification 40). For similar reasons the oviposition and predation rate of a. swirskii were measured during 2 days on a diet of adult female broad mites . Adult female broad mites are larger than adult males and relatively easy to detect . As a control, we measured oviposition rates without food and on a diet of pollen, which is known to be a good food source for this predator (nomikou et al . Young adult female predators (89 days old since the egg stage) were tested individually on a pepper plant leaf disc (diam . 24 mm) with a supply of 15 broad mites per leaf disc per day . A pilot study showed that this density is high enough to ensure maximum prey consumption . Predation was recorded as the number of broad mites consumed (as judged by the presence of the remaining transparent cuticles) after 24 and 48 h. because oviposition rates are affected by the previous food source of adult predatory mites, we used oviposition data from the second day of the experiment only (sabelis 1990). The distribution of oviposition data was non - normal due to zero inflation (especially in the treatment without food), even after transformations; we therefore used the more conservative nonparametric kruskal wallis test with post - hoc comparisons (siegel and castellan 1988) to compare oviposition among diets . The capacity of a. swirskii to control populations of broad mites was tested on sweet pepper plants in a greenhouse . Young plants without flowers were used because they produce no pollen that could be used as food by the predatory mites . Twenty or forty adult female broad mites, collected from the culture with a fine brush, were released on each plant . After 1 h, two females of a. swirskii were released on each plant, except for the controls . This resulted in four initial predator: prey ratios; 0:10; 0:20; 1:10 and 1:20, ratios were replicated four to seven times . Contamination of the plants with other herbivores was avoided by keeping the plant pots isolated in a water layer on tables inside the greenhouse compartments . The greenhouse compartments were free from flying herbivores such as whiteflies during the whole experiment . The replicates of different treatments of the experiment were performed in two different greenhouse compartments . The average temperature and relative humidity were similar for each treatment (25c 1.5 and 60% 0.5 humidity). The numbers of predatory mites and broad mites were assessed 3 weeks after introduction of the mites by collecting all leaves from each plant of each treatment . The leaves of each plant were put in a separate plastic bag and stored in a freezer . Later, they were cut into strips of 5 cm and the number of all stages of predatory mites and adult female broad mites was counted using a binocular microscope (magnification 40). For similar reasons oviposition was significantly different among treatments (fig . 1, kw = 44.4, df = 2, p <0.0001). The oviposition rate of a. swirskii on a diet of broad mites was lower than the oviposition rate on a diet of pollen (difference in average rank = 14.9, p <0.05), but higher than oviposition in the absence of food (difference in average rank = 36.9, p <0.0005, fig . 1). The predators consumed on average 8.6 (se = 0.80) adult female broad mites per female during the first day and 10.2 (se = 0.70) during the second day.fig . 1average oviposition rate of young adult amblyseius swirskii on a diet of broad mites, pollen or without food . Shown are average numbers of eggs (+ sem) per female per day measured from 24 to 48 h since the predators were put on the diet or kept without food . Different letters indicate significant differences among treatments average oviposition rate of young adult amblyseius swirskii on a diet of broad mites, pollen or without food . Shown are average numbers of eggs (+ sem) per female per day measured from 24 to 48 h since the predators were put on the diet or kept without food . Different letters indicate significant differences among treatments amblyseius swirskii was very effective at controlling populations of broad mites (fig . 2). There was a significant effect of the initial predator prey ratio on the numbers of broad mites at the end of the experiment (kw = 12.7, df = 3, p = 0.0053). There was no significant difference in broad mite densities on plants without predators (difference in average rank = 3.75, p> 0.05). Also, the density of broad mites did not differ significantly between the two treatments with predators (difference in average rank = 4.2, p> 0.05). This is probably due to the large variation between plants within the treatment with initial ratio 1:10 . Sweet pepper plants without predatory mites had significantly more broad mites than sweet pepper plants with predatory mites (kw = 12.7, df = 1, p = 0.0015). The release of predatory mites resulted in successful control of broad mites (fewer than 4 broad mites per plant) on plants with an initial ratio 1:20 . After 3 weeks, the average number of predators per plant did not differ between the two treatments with predators (kw = 0.135, df = 1, p = 0.71).fig . 2average number of polyphagotarsonemus latus females (+ sem) per plant, 3 weeks after introducing broad mites and predators simultaneously (1:20 means 40 females of p. latus were introduced with 2 amblyseius swirskii females; 1:10 means 20 p. latus females were introduced with 2 a. swirskii). Different letters indicate significant differences among treatments average number of polyphagotarsonemus latus females (+ sem) per plant, 3 weeks after introducing broad mites and predators simultaneously (1:20 means 40 females of p. latus were introduced with 2 amblyseius swirskii females; 1:10 means 20 p. latus females were introduced with 2 a. swirskii). Oviposition was significantly different among treatments (fig . 1, kw = 44.4, df = 2, p <0.0001). The oviposition rate of a. swirskii on a diet of broad mites was lower than the oviposition rate on a diet of pollen (difference in average rank = 14.9, p <0.05), but higher than oviposition in the absence of food (difference in average rank = 36.9, p <0.0005, fig . 1). The predators consumed on average 8.6 (se = 0.80) adult female broad mites per female during the first day and 10.2 (se = 0.70) during the second day.fig . 1average oviposition rate of young adult amblyseius swirskii on a diet of broad mites, pollen or without food . Shown are average numbers of eggs (+ sem) per female per day measured from 24 to 48 h since the predators were put on the diet or kept without food . Different letters indicate significant differences among treatments average oviposition rate of young adult amblyseius swirskii on a diet of broad mites, pollen or without food . Shown are average numbers of eggs (+ sem) per female per day measured from 24 to 48 h since the predators were put on the diet or kept without food . Amblyseius swirskii was very effective at controlling populations of broad mites (fig . 2). There was a significant effect of the initial predator prey ratio on the numbers of broad mites at the end of the experiment (kw = 12.7, df = 3, p = 0.0053). There was no significant difference in broad mite densities on plants without predators (difference in average rank = 3.75, p> 0.05). Also, the density of broad mites did not differ significantly between the two treatments with predators (difference in average rank = 4.2, p> 0.05). This is probably due to the large variation between plants within the treatment with initial ratio 1:10 . Sweet pepper plants without predatory mites had significantly more broad mites than sweet pepper plants with predatory mites (kw = 12.7, df = 1, p = 0.0015). The release of predatory mites resulted in successful control of broad mites (fewer than 4 broad mites per plant) on plants with an initial ratio 1:20 . After 3 weeks, the average number of predators per plant did not differ between the two treatments with predators (kw = 0.135, df = 1, p = 0.71).fig . 2average number of polyphagotarsonemus latus females (+ sem) per plant, 3 weeks after introducing broad mites and predators simultaneously (1:20 means 40 females of p. latus were introduced with 2 amblyseius swirskii females; 1:10 means 20 p. latus females were introduced with 2 a. swirskii). Different letters indicate significant differences among treatments average number of polyphagotarsonemus latus females (+ sem) per plant, 3 weeks after introducing broad mites and predators simultaneously (1:20 means 40 females of p. latus were introduced with 2 amblyseius swirskii females; 1:10 means 20 p. latus females were introduced with 2 a. swirskii). We studied the ability of a generalist predatory mite to control broad mites on sweet pepper plants . Although the predators produced fewer eggs per day when offered a diet of broad mites compared to a diet of pollen, they successfully controlled broad mites on greenhouse - grown sweet pepper plants with an initial predator: prey ratio of 1:20 (fewer than 4 broad mites per plant after 3 weeks). Although the oviposition of a. swirskii on a diet of broad mites is not as high as on other arthropods food sources, such as thrips larvae or whitefly eggs (messelink et al . 2008), we expect an effective control of broad mites in greenhouses for two reasons.the predatory mites are generalists and prey on eggs of whiteflies . Broad mites often co - occur with whiteflies because adult whiteflies are vectors of broad mites (natarajan 1988; flechtmann et al . The predator will decrease the future vector population, thus reducing the dispersion of broad mites.besides feeding on broad mites and whiteflies, a. swirskii also feeds and reproduces on thrips and pollen and can therefore be released preventively in the crop . Because a few individual broad mites can lead to substantial damage of sweet pepper plants, preventive release of biological control agents broad mites often co - occur with whiteflies because adult whiteflies are vectors of broad mites (natarajan 1988; flechtmann et al . 1990). By feeding on whitefly eggs, the predator will decrease the future vector population, thus reducing the dispersion of broad mites . Besides feeding on broad mites and whiteflies, a. swirskii also feeds and reproduces on thrips and pollen and can therefore be released preventively in the crop . Because a few individual broad mites can lead to substantial damage of sweet pepper plants, preventive release of biological control agents our results demonstrate the potential of amblyseius swirskii to control broad mites on sweet pepper plants . However, large greenhouse experiments are necessary to confirm its efficacy in reducing p. latus under commercial growth conditions . Furthermore, experiments are needed to study the control of broad mites in the presence of whiteflies and other food sources for the predators (messelink et al . If, for example, a. swirskii has a strong preference for feeding on whiteflies over broad mites, this could lead to temporarily reduced predation in the presence of whiteflies, but at the same time to reduced dispersal of broad mites through phoresy on whiteflies.
|
We identified 648,276 individuals in the swedish medical birth register who were born from 1973 through 1979 . Of this total, we excluded 6,553 (1.0%) individuals who were no longer living in sweden at the time of follow - up (20052009), 7,926 (1.2%) who had significant congenital anomalies (i.e., other than undescended testicle, preauricular appendage, congenital nevus, or hip dislocation), and 1,882 (0.3%) who had missing information on birth weight . To remove possible coding errors, we also excluded six (<0.01%) individuals who had a reported gestational age <23 weeks and 1,819 (0.3%) individuals who had a reported birth weight> 4 sds above or below the mean birth weight for gestational age and sex from a swedish reference growth curve (15). A total of 630,090 individuals (97.2% of the original cohort) remained for inclusion in the study . Study participants were followed for diabetes medication prescriptions from 1 july 2005 through 31 december 2009, the first 4.5 years that the national pharmacy register was kept . These individuals were between 25.5 and 37.0 years of age during the follow - up period . Medication prescription data were obtained using a national pharmacy register maintained by the swedish national board of health and welfare . This register contains a record of each medication prescribed by a health care provider and dispensed to a patient by any outpatient or inpatient pharmacy in sweden . For inpatients, all medication data are categorized according to the anatomical therapeutic chemical (atc) classification system developed by the world health organization collaborating centre for drug statistics methodology . These data were linked to the national medical birth register using an anonymous identification number . The outcome was defined alternatively as at least one prescription of any diabetes medication (a10) or at least one prescription of insulin (a10a) and no prescriptions of oral diabetes medications (a10b), during the follow - up period . The exposure of interest was gestational age at birth, which was based on maternal report of last menstrual period and categorized as 2328, 2934, 3536, 3742 (full term), and 43 weeks . This information was obtained from prenatal and birth records in a national research database, wommed, located at the center for primary health care research, lund university, sweden . Cut points were chosen in order to have adequate numbers in each category for statistical analysis . The wommed database also contains sociodemographic information for the parents, including age, marital status, and socioeconomic indicators, collected annually starting in 1990 . For the current study, sociodemographic characteristics were obtained using the swedish population and housing census of 1990, the most recent census when the young adults in this study (who were then 1117 years of age) were still likely to be residing in the same household as their mothers . This information was used to identify maternal characteristics that would reflect the social conditions of these young adults during their upbringing, which may be associated with subsequent risk of diabetes . An anonymous, serial - number version of the personal identification number (similar to the u.s . Social security number but nearly 100% complete) was used to link the mothers to their children . The following variables were included as potential confounders . This was included because advanced maternal age of <20, 2024, 2529, 3034, or 35 years is associated with preterm delivery and with gestational diabetes, which is a risk factor for the development of diabetes in the offspring (16). Compulsory high school or less (9 years), practical high school or some theoretical high school (1011 years), or theoretical high school and/or college (12 years). Calculated as the annual family income divided by the number of people in the family or family income per capita, using a weighted system whereby prescription of diabetes medications (atc code a10) to the mothers of the study participants during the follow - up period, dichotomized as none or one or more prescriptions . Birth weight for gestational age and sex was used as a measure of fetal growth, categorized into six groups according to the number of sds from the mean birth weight for gestational age and sex from a swedish reference growth curve (<2 sds, 2 sds and <1 sd, 1 sd and <0 sds, 0 sds and <1 sd, 1 sd and <2 sds, and 2 sds) (15). Generalized estimating equations were used to estimate odds ratios (ors) and 95% cis for the association between gestational age at birth (categorized as 2328, 2934, 3536, 3742, and 43 weeks) and prescription of diabetes medications (as defined above) in young adulthood (ages 25.537.0 years), using full - term birth (3742 weeks) as the reference category . Adjusted model 1 included the following infant and maternal characteristics as potential confounders: age, sex, maternal age at delivery, maternal marital status, maternal education, family income, and maternal prescription of diabetes medications during the follow - up period . Robust ses were used in all models in order to account for correlation among siblings . We also explored first - order interactions between gestational age at birth and each of the model covariates with respect to diabetes medication prescription in young adulthood, using a likelihood ratio test to evaluate for statistical significance . Study participants were followed for diabetes medication prescriptions from 1 july 2005 through 31 december 2009, the first 4.5 years that the national pharmacy register was kept . These individuals were between 25.5 and 37.0 years of age during the follow - up period . Medication prescription data were obtained using a national pharmacy register maintained by the swedish national board of health and welfare . This register contains a record of each medication prescribed by a health care provider and dispensed to a patient by any outpatient or inpatient pharmacy in sweden . For inpatients, all medication data are categorized according to the anatomical therapeutic chemical (atc) classification system developed by the world health organization collaborating centre for drug statistics methodology . These data were linked to the national medical birth register using an anonymous identification number . The outcome was defined alternatively as at least one prescription of any diabetes medication (a10) or at least one prescription of insulin (a10a) and no prescriptions of oral diabetes medications (a10b), during the follow - up period . The exposure of interest was gestational age at birth, which was based on maternal report of last menstrual period and categorized as 2328, 2934, 3536, 3742 (full term), and 43 weeks . This information was obtained from prenatal and birth records in a national research database, wommed, located at the center for primary health care research, lund university, sweden . Cut points were chosen in order to have adequate numbers in each category for statistical analysis . The wommed database also contains sociodemographic information for the parents, including age, marital status, and socioeconomic indicators, collected annually starting in 1990 . For the current study, sociodemographic characteristics were obtained using the swedish population and housing census of 1990, the most recent census when the young adults in this study (who were then 1117 years of age) were still likely to be residing in the same household as their mothers . This information was used to identify maternal characteristics that would reflect the social conditions of these young adults during their upbringing, which may be associated with subsequent risk of diabetes . An anonymous, serial - number version of the personal identification number (similar to the u.s . Social security number but nearly 100% complete) was used to link the mothers to their children . The following variables were included as potential confounders . Modeled as a continuous variable by infant s date of birth . This was included because advanced maternal age of <20, 2024, 2529, 3034, or 35 years is associated with preterm delivery and with gestational diabetes, which is a risk factor for the development of diabetes in the offspring (16). Compulsory high school or less (9 years), practical high school or some theoretical high school (1011 years), or theoretical high school and/or college (12 years). Calculated as the annual family income divided by the number of people in the family or family income per capita, using a weighted system whereby small children were given lower weights than adolescents and adults . Prescription of diabetes medications (atc code a10) to the mothers of the study participants during the follow - up period, dichotomized as none or one or more prescriptions . Birth weight for gestational age and sex was used as a measure of fetal growth, categorized into six groups according to the number of sds from the mean birth weight for gestational age and sex from a swedish reference growth curve (<2 sds, 2 sds and <1 sd, 1 sd and <0 sds, 0 sds and <1 sd, 1 sd and <2 sds, and 2 sds) (15). This was included because advanced maternal age of <20, 2024, 2529, 3034, or 35 years is associated with preterm delivery and with gestational diabetes, which is a risk factor for the development of diabetes in the offspring (16). Compulsory high school or less (9 years), practical high school or some theoretical high school (1011 years), or theoretical high school and/or college (12 years). Calculated as the annual family income divided by the number of people in the family or family income per capita, using a weighted system whereby small children were given lower weights than adolescents and adults . Prescription of diabetes medications (atc code a10) to the mothers of the study participants during the follow - up period, dichotomized as none or one or more prescriptions . Birth weight for gestational age and sex was used as a measure of fetal growth, categorized into six groups according to the number of sds from the mean birth weight for gestational age and sex from a swedish reference growth curve (<2 sds, 2 sds and <1 sd, 1 sd and <0 sds, 0 sds and <1 sd, 1 sd and <2 sds, and 2 sds) (15). Generalized estimating equations were used to estimate odds ratios (ors) and 95% cis for the association between gestational age at birth (categorized as 2328, 2934, 3536, 3742, and 43 weeks) and prescription of diabetes medications (as defined above) in young adulthood (ages 25.537.0 years), using full - term birth (3742 weeks) as the reference category . Adjusted model 1 included the following infant and maternal characteristics as potential confounders: age, sex, maternal age at delivery, maternal marital status, maternal education, family income, and maternal prescription of diabetes medications during the follow - up period . Robust ses were used in all models in order to account for correlation among siblings . We also explored first - order interactions between gestational age at birth and each of the model covariates with respect to diabetes medication prescription in young adulthood, using a likelihood ratio test to evaluate for statistical significance . Of 630,090 individuals who were identified, 27,953 (4.4%) were born prematurely (gestational age <37 weeks), including 419 (0.1%) born at 2328 weeks, 8,509 (1.4%) born at 2934 weeks, and 19,025 (3.0%) born at 3536 weeks . Compared with individuals who were born full term, those who were born prematurely were more likely to be male, and their mothers were more likely to be aged <20 or 35 years at the time of delivery, to be divorced or never married, to have the lowest educational attainment and lowest family incomes, and/or to be prescribed diabetes medications during the follow - up period (data not shown). A higher prevalence of any diabetes medication or of only insulin prescription was observed among individuals born preterm (gestational age <37 weeks), including among those born late preterm (3536 weeks), compared with those born full term (table 1). A total of 7,751 (1.2%) young adults from the entire cohort were prescribed at least one diabetes medication, including 1.5% of those born at 3536 weeks, 1.4% of those born at 2934 weeks, and 1.9% of those born at 2328 weeks gestation . A total of 4,997 (0.8%) individuals were prescribed insulin without being prescribed oral diabetes medications during the study period, including 1.0% of those born at either 3536 weeks or 2934 weeks, and 1.2% of those born at 2328 weeks gestation . Diabetes medication prescription in young adulthood (ages 25.537.0 years) by gestational age at birth (19731979) young adults who were born preterm, including those born late preterm (3536 weeks gestation), had modestly increased relative odds of diabetes medication prescription (table 2). Adjustment for potential confounders, with or without fetal growth, had only modest effects on the ors . In the fully adjusted model, comparing young adults born preterm (<37 weeks gestation) to those born full term, the or for any diabetes medication prescription was 1.13 (95% ci 1.021.26) and for insulin without oral diabetes medication prescription 1.22 (1.081.39). Higher ors were observed for young adults born extremely preterm (2328 weeks gestation), but the small number of these individuals and the low background prevalence of diabetes in young adulthood resulted in wider cis for these estimates . Modestly increased ors were observed for young adults born at 2934 weeks and 3536 weeks gestation, and there was little difference in risk estimates across this gestational age range . Ors for association between gestational age at birth (19731979) and diabetes medication prescription in young adulthood (ages 25.537.0 years) * adjusted for age, sex, maternal age at delivery, maternal marital status, maternal education, family income, and maternal prescription of diabetes medications during the follow - up period (1 july 2005 through 31 december 2009). A weak association also was found between poor fetal growth and diabetes medication prescription in young adulthood . After adjusting for gestational age at birth and the other potential confounders included in adjusted model 1, ors were 1.41 (95% ci 1.261.59) and 1.13 (1.061.21) for the two smallest fetal growth categories 2 sds and 2 sds and <1 sd, respectively), relative to individuals with fetal growth 0 sds and <1 sd from the reference using a standard swedish growth curve (15). No first - order interactions were statistically significant at the p <0.01 level, including no interaction between gestational age at birth and fetal growth (p = 0.33). These findings based on nationwide outpatient and inpatient medication data show that individuals who are born prematurely, including the large numbers who are born late preterm, have an increased risk of diabetes in young adulthood . Most diabetes in this cohort was likely type 1 diabetes, as identified by the prescription of insulin without any oral diabetes medications . The highest relative odds were observed for young adults born extremely preterm (2328 weeks gestation), although the precision of these estimates was limited as a result of the relatively small number of these individuals who have now reached young adulthood . Larger effect sizes and disease burden may be expected in older populations as increasing numbers of individuals who were born preterm continue to age . The modestly increased risk of diabetes in young adulthood that was observed in this study may have a disproportionately large public health impact as a result of the high morbidity and mortality that tend to follow diabetes when diagnosed at this age . It is estimated that a diagnosis of diabetes at the age of 40 years, for example, is associated with a loss of 11.6 and 14.3 life - years for men and women, respectively (14). In addition, most diabetes in young adulthood is type 1 diabetes, which incurs a disproportionately high economic burden in terms of medical costs and lost income (18). The observed association between late preterm birth (3536 weeks gestation) and diabetes medications in young adulthood also has important implications . 19) similar to that in africa (20) or brazil (21), compared with 49% in europe (19). Late preterm births constitute approximately two - thirds of this total in the current study and in other populations (19). Given the large and increasing number of late preterm births, even a modestly increased risk of diabetes among these individuals may have a large public health impact . These results are compatible with most previous smaller studies of preterm birth and either type 1 or type 2 diabetes . A study of 72 children aged 410 years reported that those born preterm, regardless of whether appropriate or small for gestational age, had decreased insulin sensitivity compared with children born full term and appropriate for gestational age (3). Another study of 332 adults aged 1827 years reported that individuals born preterm, regardless of whether small or appropriate for gestational age, had increased insulin resistance and glucose intolerance compared with those born full term and appropriate for gestational age (5). A study of 87 young adults, average age 22 years, confirmed these findings (6), although a study of 305 young adults aged 1824 years did not (10). There are fewer data on the specific contribution of gestational age at birth on risk of type 1 diabetes, but two relatively large studies of individuals aged <15 years reported an association between gestational age <37 weeks (11) or <39 weeks (12) and type 1 diabetes, after adjusting for birth weight . The few studies to date of middle - aged or older adults have consistently reported an association between preterm birth and type 2 diabetes . A danish study of 4,744 individuals aged 3060 years reported that preterm birth, independent of fetal growth, was associated with type 2 diabetes diagnosed by an oral glucose tolerance test (8). A swedish study of 6,425 individuals born from 1925 to 1949 reported that preterm birth was associated with a diagnosis of diabetes as identified from hospital discharge records from 1987 to 2006 (ages 3881 years) (7). Unlike our study, diabetes was ascertained solely from hospital discharge data, which did not include the larger number of diabetic patients treated in outpatient settings . A u.k . Study of 5,792 adults aged 4650 years reported that preterm birth was associated with self - report of a physician s diagnosis of diabetes after age 20 years (4). A finnish study of 12,731 adults born between 1934 and 1944 reported that preterm birth at gestational age <35 weeks was associated with special reimbursement for diabetes medication after 40 years of age (9). However, in contrast to the current study, late preterm birth (35 to <37 weeks gestation) in that study was associated with a nonsignificantly lower risk of diabetes medication reimbursement . Previous evidence for an association between low birth weight and insulin resistance led to the fetal origins hypothesis that fetal undernutrition in middle and late gestation triggers hormonal and metabolic changes that lead to lasting insulin resistance and diabetes (22). Experimental (23) and clinical (24) data have shown that prenatal and/or postnatal dietary restriction predisposes individuals to persistent abnormalities in glucose regulation . Additional research on the effects of perinatal nutrition and growth patterns on glucose metabolism and autoimmune responses is needed to clarify the etiologic pathways . One limitation of the current study is the use of diabetes medication prescriptions as a surrogate measure for diabetes . This approach fails to identify individuals who have diabetes but remain undiagnosed and those who are not medically treated . If this occurs nondifferentially with respect to preterm birth status, it biases the results toward the null hypothesis, in which case the reported ors in the current study would underestimate the true effect sizes . We are unable to exclude the possibility of diagnostic or prescription bias among individuals in this cohort who were born preterm . However, the prevalence of diabetes medication prescription in this study was similar to previously published prevalences of diabetes in the same age range in sweden using world health organization diagnostic criteria (25), suggesting that the amount of bias, if any, is small . Gestational diabetes, maternal weight, and/or postnatal growth patterns may be important potential modifiers of the effect of preterm birth on diabetes in later life, and this information was unavailable for this cohort . Another limitation is the estimation of gestational age by maternal report of last menstrual period rather than by ultrasound, which was not yet widely used at the time these study participants were born (19731979). To reduce misclassification, we excluded individuals whose birth weight deviated> 4 sds from the mean reference birth weight for gestational age and sex . Any remaining misclassification is expected to be nondifferential with respect to preterm birth status and therefore to bias the results toward the null hypothesis . The most important strength of this study is its ability to examine the association between preterm birth and diabetes in a large national cohort using nationwide outpatient as well as inpatient medication data . These data are remarkably complete because they are obtained from all outpatient and inpatient pharmacies from all health care settings throughout sweden, thus avoiding bias that may result either from self - reporting or from the sole use of hospital - based data . This also was a very large study, which was essential for improving statistical power, which would otherwise be limited because of the low background prevalence of diabetes in a young - adult population . Most diabetes identified in this cohort was type 1 diabetes, which has been relatively understudied . In summary, this national cohort study shows that preterm birth, including late preterm birth, is associated with an increased risk of diabetes in young swedish adults . These findings have important public health implications because of the high morbidity and mortality associated with diabetes when diagnosed in young adulthood . Larger effect sizes and a larger burden of disease may be expected as increasing numbers of individuals born preterm continue to age . Additional research on the effects of perinatal nutrition and growth patterns on glucose metabolism and autoimmune responses is needed to elucidate the etiologic mechanisms . Improved recognition of diabetes and other cardiovascular risk factors among individuals born preterm is an urgent priority and may lead to earlier interventions to prevent disease.
|
Medical emergency teams (mets) and critical care outreach are no longer new ideas . The services were founded in australia in the 1990s with the concept of mets using the well - recognised principle that early recognition and aggressive intervention improves outcome from critical illness . The systems have now developed into a variety of incarnations around the globe becoming critical care outreach services (ccos) in the united kingdom, and the rapid response teams in north america [3 - 5]. Although there are some differences between these services, they all have the same primary aim of preventing critical illness with its associated morbidity and mortality . Ccos losing its youth produces an urgent requirement for efficacy and cost - effectiveness to be demonstrated . The most detailed evaluation to date of these systems is the merit study from australia, which was a multicentre cluster randomised trial of mets . Sadly, the study failed to demonstrate a reduction in intensive care unit (icu) admissions, cardiac arrests or inhospital mortality . There are some weaknesses in the trial but it still represents by far the highest level of evidence to date on mets / ccos . The publication of this disappointing result led to a rapid distancing of ccos from their met parent, clearly fearing that this result would tarnish their new - found status . Indeed, since the publication of the merit study, proponents of ccos have commonly stated that ccos cannot be tested using a randomised controlled trial design, and some proponents seemed to believe that supportive evidence was not required at all . Thankfully, in the previous issue of critical care a detailed evaluation of ccos in the united kingdom from a group based at the intensive care national audit & research centre in london was published . In the paper the authors restate the principle that' ccos cannot now be evaluated using the gold - standard research design, a multicentre, randomised controlled trial', and instead one must use an interrupted time - series method . The analysis was performed on the intensive care national audit & research centre case - mix programme (a high - quality clinical database of nearly 400,000 icu admissions) and on data taken from a large national survey of ccos . A range of outcomes designed to' reflect the ccos objectives of averting admissions, ensuring timely admission and enabling discharge were investigated', including the proportion of admissions direct from wards, the length of icu stay, icu mortality and hospital mortality . Sadly, despite reductions in cardiopulmonary resuscitation rates and physiological disturbance in the time before icu admission, ccos were not associated with an improvement in icu mortality or hospital mortality . Further, the authors were unable to identify which of the many highly variable operational characteristics of the ccos were optimal . Interestingly, they observed that there was no' dose response' relationship for ccos that could have implied that the greater the ccos coverage, the better the outcomes that can be achieved . Finally, the authors observed that'...changes in admission characteristics may be attributable in part to the use of physiological track and trigger warning systems', despite the fact that this group's previous work demonstrated very poor sensitivity and specificity for such scores . So where does this leave us with regard to future of ccos in the united kingdom and beyond? The continued inability of studies to demonstrate the efficacy of ccos and a complete lack of evidence for cost - effectiveness is worrying . A recent guideline by the national institute for health and clinical excellence on the management of the acutely ill hospital patient was unable to recommend outreach services due to a lack of supportive evidence . The national institute for health and clinical excellence did feel able to recommend the use of early warning scoring systems but was unable to identify a particular system or cutoff points due to the lack of evidence of accuracy for these scores in clinical practice . Despite the lack of evidence, the institute of healthcare improvement recommends' deploying rapid response teams' as one of their 12 interventions' proven to prevent morbidity and mortality' in their 100,000 lives campaign . The institute of healthcare improvement clearly has access to an evidence base that the rest of us do not . Do early warning systems actually allow early identification of sick patients, or are their diagnostic accuracies too low to justify use in clinical practice? 2 . Is there an optimal configuration for ccos that can actually lead to an improvement in important patient - based outcomes? 3 . If ccos can be demonstrated to be efficacious will it prove to be cost - effective? Should countries that fund ccos now disinvest and spend these resources in more effective ways? Ccos = critical care outreach services; icu = intensive care unit; met = medical emergency team.
|
It is rare for an acute myocardial infarction (ami) to occur without angiographic evidence of atherosclerosis . Possible mechanisms for such an event include coronary artery spasm, coronary embolism from an intracardiac or paradoxical (venous) source, thrombosis caused by hypercoagulable states, and inflammation in response to specific infectious agents.1) paclitaxel has been associated with acute myocardial infarction.2) we report a case of coronary artery thrombosis associated with paclitaxel in advanced ovarian malignancy . A 63-year - old woman was diagnosed with ovarian cancer and peritoneal carcinomatosis . A large left ovarian mass and omental cake with a large volume of ascites were noted on pelvic computed tomography (ct), and through positron emission tomography (pet), f - fluorodeoxyglucose (f - fdg) uptake was noted in the left ovarian mass and omental cake . The serum ca-125 level was markedly elevated (4,290 u / ml; normal, <35 u / ml). The patient had a history of hypertension, but no history of recent infectious disease, drug use, or smoking . First, paclitaxel was administered intravenously over 3 hours at 175 mg / m, and after 48 hours, the administration of carboplatin was planned . However, the day after we administered the paclitaxel, the patient complained of typical angina . An electrocardiogram (ecg) showed st segment elevation in the v2 - 5 leads (fig . The cardiac troponin t and creatine kinase - mb (ck - mb) levels were elevated at 1.03 ng / ml (normal, <0.01 ng / ml) and 80 u / l (normal, <24 u / l), respectively . An echocardiogram demonstrated mid - anterior, septal, and apical akinesia, consistent with infarction in the left anterior descending (lad) territory . Emergency coronary angiography revealed a filling defect in the left main coronary artery and total occlusion in the distal left anterior descending coronary artery with no luminal irregularity or narrowing . After we guided the catheter into the left main ostium, an additional cine view revealed that the filling defect in the left main had disappeared and the distal portion of the obtuse marginal branch of the left circumflex artery was now totally occluded . Intravascular ultrasonography (ivus) showed no significant plaque burden or atheromatous rupture from the proximal left anterior descending artery to the left main coronary ostium . We made an unsuccessful attempt with balloon angioplasty to restore coronary blood flow (fig . A thrombophilia work - up revealed normal or negative values for antithrombin iii, protein c, protein s, lupus anticoagulant antibody, factor viii, anti - phospholipid igg, factor 5 leiden, homocysteine, c3, and c4 . Treatment with tirofiban, clopidogrel, and aspirin was planned, and a follow - up electrocardiogram was obtained (fig . Eighteen days after the index procedure, a follow - up echocardiogram and coronary angiogram were performed . The echocardiogram showed much improvement of the previous akinesia, except at the tip of the apex of the left ventricle . The coronary angiogram showed that the occlusion of the distal obtuse marginal branch and distal left anterior descending artery had cleared (fig . The patient is being followed in our outpatient department and has had no further cardiac symptoms . An acute myocardial infarction (ami) without angiographic evidence of atherosclerosis is uncommon; possible mechanisms include 1) coronary artery spasm, 2) coronary embolism from an intracardiac or paradoxical (venous) source, 3) thrombosis caused by certain hypercoagulable states, and 4) inflammation in response to specific infectious agents, such as chlamydia pneumoniae, cytomegalovirus, and helicobacter pylori.1) coronary thrombosis may follow blood disorders causing hypercoagulability, oral contraceptives or estrogen - replacement therapy, endothelial dysfunction, or cigarette smoking, as well as an excess of lipoprotein(a) [lp(a)] and type-1 plasminogen activator inhibitor (pai-1).1) our patient had no history of recent infection, drug use, or smoking . Furthermore, there was no specific finding in the thrombophilia work - up . In the setting of malignancy, there are a few reported cases involving myocardial infarctions caused by tumor emboli, direct malignant infiltration, and non - bacterial thrombotic endocarditis (nbte).3) however, an extensive search of the literature found only one report of in situ coronary thrombosis associated with malignancy in the absence of other procoagulant conditions.3) according to a recent report, malignancy itself usually does not cause coronary artery thrombosis without other hypercoagulable states.1) however, paclitaxel use has been associated with acute myocardial infarction.2)5) in our case, the coronary angiogram and ivus showed a smooth wall without a significant stenotic lesion or plaque burden in the left main coronary artery . In the follow - up coronary angiogram, because the lesion in the culprit vessel disappeared, we presumed that the lesion was not a tumor embolus, but a thrombus . In addition, no intracardiac shunt was seen on the echocardiogram, and the regional wall motion abnormality of the left ventricle was consistent with the coronary territory . Acute myocardial infarction can be caused by a coronary thrombus in association with a myocardial bridge and slow coronary flow.6) however, the coronary angiogram of our case did not show a myocardial bridge or slow coronary flow . Except for the malignancy, the patient showed no evidence of thrombophilia based on the thrombophilia work - up, and as mentioned above, malignancy does not usually cause coronary artery thrombosis . Therefore, in this case, we considered paclitaxel to be the probable cause of the myocardial infarction due to spontaneous formation of a thrombus in the left main coronary artery . It has been seen that paclitaxel can disturb cardiac rhythm and cause cardiac ischemia and myocardial infarction.2)4) myocardial infarction associated with paclitaxel therapy has been reported in some patients.2)5) in one of these patients, a 70% lesion with a fresh thrombus in the infarct - related artery was documented at autopsy.2) to date, the pathogenesis of myocardial infarction associated with paclitaxel is not known . However, this case raises the possibility that paclitaxel can induce coronary artery thrombosis and cause myocardial infarction . Additionally, we recommend that clinicians take extra care in ruling out myocardial infarction if chest pain occurs during paclitaxel administration.
|
Ameloblastoma is a rare tumour of odontogenic epithelial origin, which accounts for approximately 1% of all mandibular tumours and cysts [1 - 2]. It has high propensity for local recurrence if not adequately removed and although the tumour may appear microscopically benign, the development of distant metastasis is possible . Classification as a benign or malignant lesion has generated much debate because ameloblastoma has different histopathologic patterns and displays a wide spectrum of biologic behaviours . In the who classification, a clear distinction between ameloblastoma, metastasizing ameloblastoma and ameloblastic carcinoma was made . Here, metastasizing ameloblastoma is defined as an ameloblastoma that metastasize in spite of a benign histology . This occurrence is estimated in approximately 2% of the cases, and the most common site for metastasis is the lung (75 - 80%), followed by the cervical lymph nodes, the diaphragm, the liver and the brain . On the other hand, ameloblastic carcinoma shows combined histologic features of ameloblastoma with cytologic atypia, regardless of the presence of metastasis . This report describes a patient who presented a long history of local recurrence and distant metastasis of ameloblastoma . Molecular analysis was performed with the aim to better characterize this neoplasm and its peculiar behaviour . A 29-year - old male presented a swelling of the oral cavity without any symptoms . The radiographic examination showed diffuse opacity of the right nasal fossa and maxillary sinus, with destruction of the medial and inferior walls of the maxillary sinus, and thinning of the pavement of the orbita (figure 1a). He underwent extended right maxillectomy with resection of a portion of the hard palate with a histologic diagnosis of ameloblastoma . In the following years, his medical history was significant for an adenocarcinoma of the colon and an acute myocardial infarction . After a disease - free interval of 20 years, the tumour recurred locally in the right maxillary sinus (figure 1b), and the diagnosis of ameloblastoma was confirmed histologically . One year later a computed tomography highlighted a recurrence involving the right orbita (figure 1c) and the hard palate (figure 1d). After 10 months, twenty - seven years after the onset of the primary lesion, the patient referred frontal headache, postural instability, disorientation and bewilderment with impaired short - term memory . Magnetic resonance imaging revealed a recurrence in the infratemporal fossa (figure 1e) and a single metastasis in the right temporal area of the brain (figure 1f). These were surgically removed, and the sphenoidal - orbital region and the right temporal lobe were also treated with radiation therapy (60 gray total dose). Nine months later the patient developed a further metastatic deposit in the right neck, which was surgically removed . A = diffuse opacity of the right nasal fossa and maxillary sinus, with destruction of the medial and inferior walls of the maxillary sinus, and thinning of the pavement of the orbita . B = axial computed tomography showing the first recurrence in the maxillary sinus, which occurred 20 years after the surgical treatment of the tumour . F = single metastasis in the right temporal area of the brain . The histological appearance of the tumour was the same in the primary lesion, in the recurrence and in the metastases . The tumour mainly presented a plexiform pattern, characterized by a proliferation of basal cells organized in anastomosing strands with an inconspicuous stellate reticulum (figure 2). The basal cells were columnar and hyperchromatic, with nuclei displaced away from the basement membrane . In the primary lesion, focal areas of the tumour displayed cystic changes (figure 2). There were no cytologic atypia, mitotic activity and areas of necrosis in any of the specimens . A = low power view of the primary lesion, showing a plexiform pattern, with cystic areas . B = high power view of the primary lesion, showing anastomosing strands of epithelium in fibrous stroma, with tall columnar at the periphery . C = metastatic lesion of the neck, showing infiltration of the salivary tissue of the parotid gland . Staining for epidermal growth factor receptor (egfr) conducted on the infratemporal recurrence and on the brain metastasis, showed strong membrane and cytoplasmic positivity of neoplastic cells . Tumour protein p53 (tp53) nuclear immunostaining was detected in the majority of neoplastic cells . Conversely, human epidermal growth factor receptor 2 (her2) was negative in all samples tested . A = immunohistochemical staining showing positivity for egfr . Fluorescent in situ hybridization (fish) analysis the analysis was conducted on the infratemporal recurrence . Neoplastic cells showed disomy, with an average ratio of egfr gene to chromosome 7 centromere signals (cep7) signals per cell of 0.8 . Direct dna sequencing of tp53 gene exons 5 - 9 was carried out in tumour samples from the infratemporal recurrence and brain metastasis, with no mutational alteration detected . Similarly, sequencing analysis of b - raf proto - oncogene (braf) exon 15 (v600) and egfr showed wild type results in all samples tested . According to the current who classification, metastasizingameloblastoma shows the same histological features of non - metastasizing ameloblastoma, and therefore the diagnosis can be made only retrospectively, when metastasis has occurred . Thus, it is difficult to predict the behaviour of this neoplasm, which has always an uncertain malignant potential . Generally accepted risk factors for the development of metastasis include large primary lesion, late diagnosis of the initial tumour, multiple local recurrences, inadequate surgical treatment, radio - chemotherapy treatment and plexiform pattern, even if the exact nature and the role played by each factor is not clear . In addition, long - term follow - up is recommended, because metastasis may occur after a very long disease - free interval, which may be up to 42 years after the treatment of the primary lesion, with an average time to metastasis of 18 years . Indeed, in the present case the first recurrence occurred 20 years after the primary lesion, and 7 years later two metastases were detected ., in the absence of malignant cytologic transformation of the metastatic lesion, the clinical course of the metastatic tumour is relatively indolent, with an average survival of 10 years after the diagnosis of metastasis . In the recent past, several studies attempted to elucidate the complex aspects of ameloblastoma biology, in order to improve treatment and outcome of the patients . In addition, patients must be followed strictly with instrumental exams and punctual follow - up to prevent recurrence . Recently, several molecular studies have been undertaken in order to improve our understanding of the pathogenesis of this neoplasm, and to identify possible targets for alternative treatments, to potentially reduce the need for extensive and repeated surgery . The status of different genes has been evaluated, including transmembrane tyrosine kinase egfr, braf, her2 and tp53 . Epidermal growth factor and egfr participate in the differentiation of ameloblasts and in the control of their cellular function . Egfr regulates the proliferation of both normal and neoplastic cells, it is expressed by normal odontogenic epithelium and the presence of alterations of this gene has been investigated both with immunohistochemical [11 - 13] and molecular analysis . Immunohistochemical studies have shown positivity for egfr both in primary lesions and in metastases, although this marker did not predict recurrence . In agreement, in the present case we observed egfr cytoplasmic and membranous immunostaining in both the recurrence and the brain metastasis . In the molecular study performed by kurppa et al ., an over - expression of egfr was observed in ameloblastomas studied with real - time reverse transcription polymerase chain reaction (rt - pcr), while in the present case, fish analysis did not demonstrate gene amplification . Therefore, data from literature indicate that anti - egfr targeted therapy could be potentially used in the treatment of recurrent disease, especially in cases where the surgical approach is limited . Indeed, as reported by vered et al ., egfr treatment is recommended in aggressive ameloblastomas not only in monotherapy, but also in combination with conventional radiotherapy . The administration of anti - egfr agents could be also intralesional, to avoid the adverse events of the treatment . Recently, new anti - egfr monoclonal antibodies were developed, and the target therapy with these drugs showed clinically successful results, underlying the possibility to control the disease also in advanced cases . Braf is a potent activator of the mitogen activated protein kinase (mapk) cascade, which in turn phosphorylate and activate extracellular signal - regulated kinases 1 and 2 (erk1/erk2). Erk regulates the expression of several genes through the phosphorylation of nuclear transcription factors or by targeting other intracellular signalling molecules . Thus, through the stimulation of erk signalling, braf is capable to induce proliferation and to promote transformation . More than 40 different mutations are identified in braf gene human cancer . Ninety percent of b - raf mutations are represented by a missense mutation at residue 600 that substitutes a glutamine with a valine (v600e), resulting in constitutively activation of the gene . In a study of braf v600e mutation in 24 ameloblastomas, 15 tumours (63%) resulted positive for the mutation, without significant association with specific ethnicity, sex or age of the patients, or tumour histology . This mutation has been associated with resistance to egfr - targeted drugs in primary ameloblastoma cells, similar to what happens in colorectal cancer . Her2, also known as c - erb or her2/neu, is a human epidermal growth factor receptor belonging to the same family of egfr and its protein overexpression has been found in several carcinomas . Previous studies showed that immunoreactivity for her2 in ameloblastoma is significantly lower than in normal dental follicles and, albeit with some differences, all variants of ameloblastoma resulted negative or weakly positive for her2 . This is in agreement with the present case, which showed no immunohistochemical expression of her2 protein, neither in the primary or metastatic lesions . Tp53 suppressor gene is situated on chromosome 17p13 and is one of the most frequently altered genes in tumours . Mutation or loss of heterozygosity in the p53 gene or accumulation of its protein is associated with increased cellular proliferation and malignant transformation . Ameloblastoma shows variable reactivity to p53 depending on the histological types, with plexiform variant being more frequently positive than follicular variant . In our study, direct sequencing of tp53 did not show any alteration of the gene, while immunohistochemistry showed positive nuclear staining of neoplastic cells . This is in agreement with the results of the study by kumamoto et al ., who observed no tp53 gene alteration in a series of 11 ameloblastomas, including a metastasizing example . However, these authors found a higher expression of p53, mdm2 and p14 in benign and malignant ameloblastomas than in tooth germs, supporting the hypothesis that these factors may be involved in the malignant transformation of odontogenic epithelium, while tp53 gene mutation is likely to play a minor role . We report a case of ameloblastoma with metastatic spread to the brain and the neck after repeated local recurrences . Further studies are needed to identify molecular pathways that may provide an opportunity of alternative treatments and/or new potential predictive markers of local and distant spread of this rare tumour.
|
The extrapolymeric substance (eps) produced by bacillus subtilis and bacillus licheniformis have carbohydrate components as in levan (fructan) or peptide component as in gamma polyglutamic acid (pga) [15]. Although pga - producing bacillus isolates have been reported many of these produced exopolysaccharide also . Extracellular polymeric substances (eps) are produced by microorganisms in nature [6, 7] to serve different functions such as biofilm formation, resistance to desiccation, high salinity, and other stress . However, in vitro, microbial eps have been produced using specific / selective media, induced using high carbon substrate, other nutrient ratio, or in presence of specific nutrients and at specific incubation condition of temperature, ph . The present study shows that amongst eps - producing bacillus species isolated from the environment, the pga - producing isolates are more frequently obtained as compared to isolates that produce polysaccharide substance, if isolated / screened using rich or synthetic but nonselective media using samples from various locations . In literature the pga - producing strains are reported to be of two types, either glutamic acid - dependent or independent but ones which are glutamic acid independent pga producers are adversely affected if glutamic acid or other related components are present in medium [9, 10]. The strains isolated and used in the present study however are not glutamic acid dependent for their ability to produce only pga type of eps and are not affected even in presence of glutamic acid or glutamine, in solid media and broth media containing various substrates and are thus suitable for low cost pga production . The importance of pga in pharmaceutical products, food industry, and wastewater treatment is well established [9, 11, 12]. Bacillus strains were isolated from soil samples collected from various locations in gujarat, india: hot water spring, oil well, desert, petrol pump, garden, saline creek region, salt pan region, from crude oil, effluent of dye industry, and untreated domestic sewage . Fermented flour samples of soyabean and bengal gram (threefold increase in batter volume after 18 h after addition of sterile water in sterile container) were also used for isolation of bacillus strains . All samples were suspended in saline and vortexed, and supernatants were heated to 80c for 15 minutes to kill most of the vegetative, nonsporulating microbial cells and then used to isolate bacillus cultures (colonies) on luria agar . Morphology of cells of pure cultures of isolates was observed microscopically (1000x) at 6 h48 h, after inoculating into broth followed by gram staining, capsule staining (maneval's method), and endospore staining (schaeffer and fulton method) according to standard procedures . The identification of selected mucoid / eps - forming bacillus - type colonies was determined by blast analysis of 16s rdna partial sequences of isolates with sequences in genbank . An accession number was obtained for bacillus t. by submission of sequence to genbank . Several solid media used for growth of eps producers were luria bertanii, soyabean meal, and synthetic media with different substrates: 520 g / l of sodium citrate (with 40 g glycerol), glucose, lactose, starch, or skimmed milk . The synthetic basal (bushnell and haas) medium used contained (in g / l) mgso4 0.2, cacl2 0.02, fecl3 0.05, k2hpo4 1, kh2po4 1, and nh4no3 1 . All the media were autoclaved at 10 psi for 20 min . For detection of components of eps, it was harvested from solid medium in order to rule out contamination of medium constituents in the eps . Cell - free eps was hydrolysed using 6 n hydrochloric acid at 110c either for 2 h in autoclave (10 psi) or for 18 h in oil bath . Solvent system is composed of n - butanol: acetic acid: water (9: 6: 5). Detection reagents used were ninhydrin reagent for amino acids and paraanisidine phthalate for carbohydrates . After concluding that the eps was pga, native pga was visualised on sds - page gel by specific staining with methylene blue because pga consists of only acidic amino acids and silver staining . For study of accumulation of eps, biomass of culture priorly grown on rich inoculum media or seed production media was centrifuged at 10,000 g for 10 min, washed, and resuspended into fresh production medium (broth). After removal of biomass from broth, eps was extracted using 3x volumes of acetone and subsequently dried at 60c . Yield of pga was calculated as average dry weight (g) of polymer / l of broth . Viscosity of pga was measured using brookfield dvii+ viscometer and small sample adapter at different spindle speed . Bacillus subtilis (nonmucoid strain) and mucoid isolates bacillus t and f were inoculated in 1% starch broth or skimmed milk broth and incubated at 37c . The extracellular amylase activity was assayed using 1% starch substrate and phosphate buffer and the product (reducing sugar) was estimated after 10 minutes using reaction with dnsa reagent and absorbance measured at 540 nm using maltose standard . The extracellular protease activity was assayed using bsa as substrate and by precipitating the residual protein using trichloroacetic acid and the product (amino acids) was estimated using folin ciocalteau reagent and absorbance measured at 660 nm using tyrosine as standard . Pga - producing bacillus isolates have been reported but many of these produced exopolysaccharide also as in the case of natto producing bacillus strains produced eps consisting of a mixture of pga and polysaccharide while fermentation of soybeans . Bacillus amyloliquefaciens was reported to produce more pga only if mutants with depressed biofilm (polysaccharide) production ability were used . Pga has several established / potential applications in pharmaceutical, food, agriculture industry whereas specific levans of bacillus may have properties similar to exopolysaccharides of other bacterial genera (xanthan, gellan, curdlan, levan, and dextran). Thus it is important to select bacillus strains that produce either pga or exopolysaccharide not a mixture of both as it will complicate product recovery and further purification of specific product . It is known that high carbon: nitrogen ratio of medium is used for exopolysaccharide production and high glutamic acid in medium induces pga formation but in both cases the producer culture is usually found to produce more than one type of polymer later in other media . Thus in this study only rich and synthetic but nonselective media (media containing neither glutamic acid nor specific carbohydrate for selection) were used for primary screening and isolation of eps - producing bacillus strains from ten different ecological locations of gujarat and also from fermented food batter . Since the samples were heated at 80c for ten minutes, only endospore - bearing cells were isolated as colonies . Out of 56 bacillus isolates obtained (40 from soil from regions of different petrol pumps, oil wells, hot water springs, desert, gardens, and saline creek; 2 from industrial wastewater; 2 from domestic sewage; 2 from seawater; 10 from fermented flours / beans) only 7 (4 from soils near petrol pumps or oil wells or desert; 1 from sea water, 2 from fermented batter) showed mucoid / highly mucoid colonies on rich media, luria bertanii, and subsequently screened using soybean meal medium and on synthetic media containing citrate with glycerol . Morphologically, the colonies were irregular and mucoid and microscopic observation showed presence of gram positive rods in chains or single, and at a definite stage in growth cycle the cells also showed presence of endospores and capsule . Partial identification using biochemical tests followed by comparison of partial 16s rdna sequence of six of the eps - forming isolates with sequences available in genbank was done . This leads to the conclusion that six isolates were bacillus licheniformis and one was bacillus subtilis, all from different locations (table 1). The accession number obtained for bacillus licheniformis t. is jn885459 . For confirmation of the nature of eps of all the seven isolates, eps from cells grown on solid medium was extracted so as to rule out carryover contamination of medium constituents . Such cell free of eps was hydrolysed using acid and monomers obtained in hydrolysed eps were identified by chromatography (figure 1). Surprisingly all showed the presence of only glutamic acid (rf = 0.5, only sample as well as cochromatography with pure glutamic acid), indicating that the eps is polyglutamic acid . The absence of carbohydrate (glucose standard was detected as positive control) in the hydrolysate indicated that the eps is not an exopolysaccharide . This study thus proves that amongst bacillus strains isolated from nature, pga - type of eps producers is more predominant than exopolysaccharide producers . The formation of such pga - type of eps was not a feature of all the capsulated bacillus isolates, as isolate p was capsulated but nonmucoid and did not yield any extractable polymer . When further visualization of pga from all 7 isolates was done by sds - page (figure 2) only methylene blue (cationic dye) but not coomassie blue could detect the native polymer . Pga consists of only acidic amino acids and thus does not bind to coomassie brilliant r or g . The general method of detection by silver staining is used less frequently by other workers for pga detection . However in the present study both the methods of staining were found to be equally successful for pga detection, though detection with methylene blue is more conclusive for pga . The pga band obtained using unhydrolysed sample indicated the polymer was of high molecular weight and polydisperse as indicated by smear obtained if high concentration of pga is used and concentrated staining near high molecular weight location . This is reported in other studies also but our study showed that using a dilute sample, the predominant molecular weight can be more distinctly visualized (figure 2 lane 5). As expected, the acid - hydrolysed pga, consisting of only glutamic acid was not detected by sds - page . The native pga was found to be resistant to protease action of proteinase k, an alpha protease (standard bovine serum albumin was used as usual substrate for positive control of activity of proteinase k) and this further proved that the eps was pga with gamma linkage . Eps production by three of the bacillus licheniformis isolates k, t, and f was further studied and screened using synthetic media with glucose, starch, and skimmed milk as nutrient source individually or in combination and with a range of ph and sodium chloride, keeping in mind the potential industrial applications [8, 9, 11]. Both of the isolates were found to be suitable for eps production . In case of media containing only starch as carbon source, though starch was utilized (amylase activity detected), supplementation of minimum amount of glucose (12.5 the probable reason for obtaining strains which are able to produce eps consistently on various media was that initially, for isolation / primary screening, a general, nonspecific synthetic or rich medium was used, instead of specific media containing high carbon: other nutrient ratio or media containing specific nutrients, as recommended for eps producers [3, 8]. A comparison of relative extracellular amylase: protease activity of mucoid bacillus isolates and nonmucoid bacillus subtilis strain revealed that a higher ratio was found in pga - producing bacillus licheniformis strain t which produced pga on all media tested, as compared to strain f or strain bacillus subtilis natto, which produced pga only in some media . In laboratory conditions it is the medium (nutrient) composition and nutrient utilization which is the inducing factor for polymer production . Other workers have studied the intracellular racemase activity of interconversion of l and d glutamic acid as a parameter to correlate its level with pga yields . However no earlier studies have reported the use of relative amylase: protease activity (extracellular) for pga production though this directly indicates nutrient utilization . For shake flask production, media containing citrate and glycerol as reported in literature for maximum production were used after confirming utilization of citrate as carbon source using ph indicator bromothymol blue (blue colour obtained due to increase in ph due to citrate utilization). Combining the results of pga produced on solid media and broth, bacillus t. was found to be the most consistent using all media tested . The isolates produced up to 20 g / l pga in synthetic medium containing sodium citrate and glycerol but without glutamic acid . As concentration of glycerol in production medium increased the pga production by bacillus licheniformis was markedly increased in broth but not in solid medium (figure 3). As expected however the important parameter was the physiological status of inoculum of cells which is important for subsequent product formation in most fermentations; pga production was studied with respect to use of inoculum developed in rich media and synthetic media and use of strictly vegetative cells inoculum (24 h) or a mixture of vegetative and endospore - bearing cells (table 3(a)). A twofold increase was obtained using inoculum cells grown in rich media as compared to cells grown in synthetic (production) media though use of the same medium for inoculum should minimise adaptation . Similarly a twofold increase in pga production was obtained using inoculum consisting of young (24 h) vegetative cells as compared to mixture of vegetative cells and sporulated cells (72 h). However the amount of inoculum used (420% v / v) did not change the yield of pga . Such kind of studies has not been reported for pga production and these results will lead to pga production using low cost nutrients but high biomass . The production of pga was fourfold higher in presence of glutamic acid (up to 3040 g / l) as compared to when it was not supplemented in the medium (table 3(b)). The yield of pga by the isolates used in this study, in medium containing glutamic acid, was comparable to that reported in literature (wild type / genetically engineered bacillus strains) as 5100 g / l [9, 17]. But these earlier reports do not clearly mention whether the production of eps is of only pga or also exopolysaccharide by the bacillus strain . Though glutamic acid independent production of pga from bacillus strain has also been earlier reported to be 22 g / l, a very high level of carbon (75 g fructose or glucose / l and 18 g ammonium chloride / l) was required in that case and again there is no clear indication in that report of the production of only pga or also exopolysaccharide as a mixture . Moreover in this case in the presence of glutamic acid the pga production was reported to be decreased threefold, and such a case may be often prevalent in raw material containing mixture of substrates . The isolates reported in this present study did not need higher amount of carbon source and pga production is not decreased even if mixture of substrates is present in medium . Pga is known to have several applications due to its water retention capacity and also due to its viscosity . The viscosity of broth containing pga is usually reported to increase and shows non - newtonian characteristics . Whenever pga is not the primary product desired, pga mutants have to be used . In the present study the viscosity broth culture producing the broth cultures of bacillus k, r, d, t, and f showed increase in viscosity after 24 h of incubation, visibly indicating accumulation of eps, but the same was not true for other pga - producing isolates . Subsequently the precipitated pga itself was solubilised in water and used for measurement of viscosity rather than that of the whole broth which would contain mixture of cells along with pga (table 4). Pga obtained from isolate t was subjected to varying shear stress and as expected, with an increase in shear rate the viscosity of pga decreased (thinning effect of non - newtonian polymer solutions). An interesting observation was that there was a difference in viscosity of pga solution (fixed concentration) depending on use of either glutamic acid or glutamine in medium used for pga production by the same bacillus strain . The use of rich but nonselective media for isolation of bacillus strains capable of eps - production leads to isolation of pga producers capable of producing only high molecular weight, polydisperse, viscous pga as constituent . The amount and viscosity of pga produced depend on the relative amylase: protease activity and use of specific medium constituents and pga was even produced in presence of mixed substrates . These isolates are glutamic acid independent pga producers which do not produce exopolysaccharide and thus are superior for pga production to the other wild type or genetically engineered bacillus strains reported earlier in literature.
|
Although the prevalence of metastases to the thyroid gland is variable in previous reports, metastasis to the thyroid gland is known to be an uncommon condition . Fourteen cases of metastatic tumor to the primary thyroid carcinoma have been reported previously in the literature . The majority of reported primary thyroid carcinomas were papillary thyroid carcinoma (ptc), including follicular variant papillary thyroid carcinoma (fvptc) (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11). To our knowledge, there has been no reported case of a tumor metastasizing to medullary thyroid carcinoma (mtc). We report a case of tumor - to - tumor metastasis involving metastatic colonic adenocarcinoma and medullary thyroid carcinoma . A 53-yr old man underwent an anterior resection of his cancerous sigmoid colon and adjuvant chemotherapy on november 14, 2005 . About one year after surgery, a fluorine-18-fluorodeoxyglucose - positron emission tomography integrated with computed tomography (f - fdg pet / ct) scan showed focal hypermetabolism in the right lobe of the thyroid gland (standardized uptake value, [suv] 4) and pulmonary nodules in the right lung, suggesting hematogenous metastatic lesions . Two years later, a pet scan still revealed a nodule, showing focal activity in the thyroid gland (suv 2.5) (fig . A thyroid gland ultrasonography showed a marked hypoechoic solid nodule with a lobulated margin and inner microcalcification in the right mid pole, suggesting malignancy (fig . The patient underwent ultrasound - guided fine needle aspiration biopsy (fnab) of the thyroid nodule . Serum calcitonin and carcinoembryonic antigen (cea) levels were mildly elevated (17.3 pg / ml (reference range: 0 - 10 pg / ml) for calcitonin; 29.31 ng / ml (reference range: 0 - 4.7 ng / ml) for cea . Thyroid stimulating hormone was 2.47 iu / ml (0.25 - 4.0 iu / ml), thyroglobulin antigens were 9.96 ng / ml (0 - 35 ng / ml), antithyroglobulin antibodies were 0.19 iu / ml 0 - 0.3 iu / ml). The serum level of intact parathyroid hormone was 40.83 pg / ml (15 - 65 the 24-hr urine cortisol / metanephrine / cathecholamin levels were within the normal range . Rearranged during transfection (ret) proto - oncogene mutations were not detected . Subsequently, the patient underwent a total thyroidectomy and bilateral central neck dissection . On gross examination, the capsule of the right lobe of thyroid was intact, smooth, and the surface was irregularly bosselated . The cut sections revealed a well - circumscribed, round gray - tan nodular mass, measuring 1.51.2 cm . There is an ill defined white solid mass with central irregular yellow necrosis, measuring 0.80.7 cm in the gray - tan nodular mass (fig . An immunohistochemical stain of cea and caudal type homeobox protein cdx-2 showed a strong, diffuse positivity in colonic adenocarcinoma . In contrast, the medullary thyroid cancer cells were positive for chromogranin - a and calcitonin and negative for the colonic adenocarcinoma marker . After thyroidectomy, the patient continued palliative chemotherapy for the colon cancer and supportive care . One year later, he died from dyspnea due to the aggravation of pulmonary metastases . While the coincident occurrence of multiple primary malignant tumors in the same host is not unusual, tumor - to - tumor metastasis is a rare phenomenon . (13), proposed criteria for the diagnosis of tumor - to - tumor metastasis; 1) the presence of more than one primary malignant tumor must be proved, 2) the recipient tumor must be a true neoplasm, and 3) the donor malignant tumor must be a true metastasis, with established growth and invasion in the tumor . Direct contiguous growth of one tumor into another adjacent tumor (collision tumor), embolism of tumor cells, and metastasis to leukemic nodes are not defined as metastases . Previous studies reported the prevalence of metastases to the thyroid gland varied greatly (14, 15, 16, 17). However, the previous studies included preexisting or coexisting thyroid conditions, such as benign thyroid diseases (goiter and adenoma), and primary thyroid neoplasms . Cases involving metastasis to primary thyroid carcinoma only, have a prevalence rate estimated to be less than 1%, and only 14 cases have been reported in the literature (table 2). Rosai (3) reported the first documented case of metastatic breast carcinoma to a papillary thyroid carcinoma (ptc) in 1992 . The most commonly reported non - thyroid malignancies to metastasize to the thyroid gland are renal cell carcinoma and lung cancer (18). Colorectal carcinoma was an uncommon donor, accounting for only two of the cases (2, 4). Willis (19) proposed a hypothesis for why the thyroid gland receives few metastatic deposits despite its rich blood supply . According to the willis hypothesis, fast arterial flow through the thyroid and the high oxygen saturation and iodine content of the thyroid gland prevent of metastatic tumor survival in the thyroid (19). Due to the rarity and complexity of tumor metastasis, some views suggested that the thyroid tumor makes an environment in which metastatic tumor cells can easily grow by altering the normal thyroid structure as stated above (20). Mtc is a relatively rare type of primary thyroid carcinoma, accounting for only about 5% of all thyroid carcinomas . The majority of previously reported recipient primary thyroid carcinomas were ptc, including fvptc (12 among 14 cases) (1, 2, 3, 5, 6, 7, 9, 11). The other two cases were oncocytic / hurthle cell carcinomas (4, 8). As far as we know, fnab diagnosis of both primary thyroid malignancy and non - thyroid malignancies metastasizing to the thyroid gland at the same time is difficult and often incorrect (18). In most cases, fnab can diagnose primary thyroid carcinoma but not the metastases to the thyroid . In the present case, fnab allowed us to diagnose mtc, but we did not find the colorectal cancer with the technique . After surgical resection of the thyroid gland and several specific stains, we were able to diagnose the tumor - to - tumor metastasis (mtc and colorectal cancer). Although tumor - to - tumor metastasis to the primary thyroid carcinoma is very rare, metastasis to the thyroid gland should be considered, when a patient with history of other malignancies presents with a new thyroid finding . In this case, although the patient already had pulmonary metastasis of colonic adenocarcinoma, he underwent surgical treatment . The prognosis of the patient was determined by the coexisting advanced colon cancer . In conclusion, the present patient is the first example of colonic adenocarcinoma metastasizing to medullary carcinoma of the thyroid.
|
Giant cell tumor (gct) of bone is a relatively common benign bone lesion . Gcts are usually located in long bones, and most lesions are found around the knee . Although gcts have been observed in other less frequent sites, such as the patella, great trochanter, and skull; involvement of the olecranon we present a case of solitary gct of bone in the olecranon that was confirmed by preoperative needle biopsy and postoperative histological examination . Therefore, the treatment included intralesional curettage, allogeneic bone grafting, and plating . At 26 months follow - up, the patient had no local recurrence . Informed written consent was obtained from the patient for submission of the data for publication . An approval from the institutional review board a 32-year - old female was admitted to the first hospital of jilin university of changchun with a complaint of left elbow pain after a minor injury . Upon physical examination, obvious tenderness was observed at her left olecranon, but no soft tissue mass was palpated . Anteroposterior and lateral plain radiographs showed an expansile lytic lesion located in the left olecranon and extending into the subchondral region and the coronoid process . Cortical breach was also identified in the dorsal aspect of the olecranon, suggesting a pathological fracture as a source of the pain . Magnetic resonance imaging (mri) showed no soft tissue extension [figure 2], but the tumor had broken through the subchondral bone and extended into the elbow joint . Anteroposterior and lateral plain radiographs showing an expansile lytic lesion located in the left olecranon and extending into the subchondral region and the coronoid process . Note the pathological fracture in the dorsal aspect of the olecranon (white arrow) magnetic resonance imaging (mri) showing a relatively well - defined lesion of hyperintensive signals in a t2-weighted image, and no soft tissue extension the differential diagnosis included gct of bone, solitary bone cyst, metastasis, and brown tumor of hyperparathyroidism . A fine needle was positioned in the pathological fracture area along the operative incision after the administration of local anesthesia . A needle biopsy was then performed and a gct of bone was identified by pathological section . In order to prevent local recurrence, en bloc resection surgery was proposed, but the patient refused . Thus, the patient was managed with intralesional curettage, allogeneic bone grafting, and plating . During the operation, gross findings of the tumor indicated that it was soft in texture and yellow in color . Histology revealed that the tumor was composed of mononuclear ovoid and spindle - shaped cells associated with multinucleated giant cells and macrophages . This appearance was characteristic of gct of bone [figure 3]. At the 26-month follow - up, the patient did not present with any local recurrence . Histological analysis showing that the tumor was composed of mononuclear ovoid and spindle - shaped cells associated with multinucleated giant cells and macrophages . In addition, patients with gcts of bone present most often in the 3 or 4 decade of life . Most gcts arise in metaphysical - epiphysical areas and are most commonly found in the distal femur, proximal tibia, and distal radius . Other less frequent sites include the proximal femur, vertebral bodies, distal tibia, proximal fibula, hand, and wrist . In addition, gcts occurring in the patella and great trochanter have been reported . In several large studies, a total number of 1,447 gct of bone cases has been reported, but none of them were located in the olecranon ., reported one patient with multicentric gcts involving the left proximal ulna from a 12 year retrospective study conducted at the mayo clinic . To the best of our knowledge, the olecranon ossific nucleus first appears around 9 years of age and fuses completely by 12 - 15 years of age, which is relatively earlier than other long bones . The radiographic appearance of gct is usually characteristic of the disease and may be sufficient for making a correct diagnosis . However, in this case, although the plain films showed characteristic findings of gct, it was difficult to make a definitive conclusion . This was largely due to the rare location of the lesion, and the olecranon is a rare area for neoplasms to occur . Only a few cases involving this anatomical region a brown tumor resulting from hyperparathyroidism also presents with similar radiographic features as this type of tumor . However, the clinical course and x - ray examination of this case excluded those differential diagnoses . Other than the eccentric location, the lesion in this case had characteristics that were similar to lesions in bones with a smaller diameter, such as the proximal fibula . Intralesional curettage has been the preferred treatment for most cases of gct of bone, despite a higher incidence of local recurrence . The use of local adjuvants, such as liquid nitrogen, bone cement, and hydrogen peroxide, may reduce the rate of local recurrence . Radiotherapy has also been used to treat gct of bone in order to decrease local recurrence and is especially useful for treating difficult locations, such as the spine and sacrum . Gct of bone is a relatively common benign bone lesion that is usually located in long bones, while involvement of the olecranon is extremely rare.
|
Human capital and health improvement programmes are of central importance towards sustainable development and economic growth in any country . In malaysia, the health care system has changed from traditional remedies to meeting the emerging needs of the population . Since the independence of malaysia in 1957, the first reorganization started at the public primary health care services and accelerated since the alma ata declaration in 1978 . In malaysia, the ministry of health (moh) is the main provider of health care services to the public . The organizational structure of the moh has three levels, federal, state and district, which are decentralized to ensure efficiency . Each hierarchical level determines the level of authority, information flow, accountability and supervision . This system encompasses all aspects of care such as preventive, promotive, curative and rehabilitative . The main objective is to provide a greater network of physical facilities, equity, accessibility and utilization of health care resources . At the same time, national referral centres were established to provide specialized care to enhance the basic care provided in health clinics . Over the past decade there has been an explosion of tertiary level specialized care to meet the needs of the population . This is expensive, fragmented and institutionally focused and inappropriate for the majority of health consumers . In the current era this service includes a lifetime health plan that focuses on keeping the child and family well . This gives greater prominence to preventive issues and takes on healthier lifestyles by choices with risk prevention . The health care providers also need not function as controllers but act as facilitators or partners with health consumers (figure 1). Figure 1transformation from industrial age medicine to information age health care (source: amar). Transformation from industrial age medicine to information age health care (source: amar). Apart from the size of the hospitals, there are differences in terms of the services provided . Small district hospitals provide general medical and nursing care and their manpower consist of medical officers and other personnel . Larger district hospitals and regional hospitals provide a wide range of specialist services and the public has easy access through a walk - in or referral system . Moh seeks to ensure the public is informed of health issues and has access to safe water, safe food and quality medicine . The malaysian health care system focuses on primary health care (phc) that places social equity as important and allocates public funds for the poorest 20% of the population . In 1956, there were only 42 phc facilities in the country . After independence, the health sector became an integral part of the national and development process and moh has been able to deliver health care to communities throughout the country . Table 1 shows increasing health care facilities in secondary and tertiary care over the years . Table 1health facilities of the ministry of health, malaysia in 1984, 2001 and 2008.moh's facilities198420012008health clinics361843802rural / community clinics103919241927mobile teams35204193hospitals89 (21,159 beds)115 (29,123 beds)130 (33,004 beds)medical institutions8 (10,235 beds)6 (5551 beds)6 (5000 beds)source: adapted from merican and bin yon;planning and development division, ministry of health, malaysia . Source: adapted from merican and bin yon; planning and development division, ministry of health, malaysia . The number of hospitals, community clinics and other facilities such as special medical institutions (national heart institute, institute of pediatrics and institute of respiratory medicine) has increased (table 2). The total expenditure from the health department of selangor in 2006, for instance, has increased to rm 881.3 million compared to rm 628.83 million in 2005 and rm 577.77 million in 2004 . The increase is due to new hospitals and comprehensive health services that are provided by the government . The second national health and morbidity survey in 1996 reported that 88.5% of the population stays within 5 km of a health facility and 81% lived within 3 km . Findings also show that basic health care and facilities are accessible to about 70% of the population in sabah and sarawak and more than 95% of the population in peninsular malaysia . These estimates do not include other types of outreach services such as flying doctors, mobile health teams, dental clinics, travelling dispensaries and riverine services . Table 2health care facilities in malaysia 2009.governmentno.beds (official)ministry of health hospitals13033,083 special medical institutions64974 special institutions*6- national institutes of health6- dental clinics17242952 mobile dental clinics and teams5601392 health clinics808 community clinics (klinik desa)1920 maternal & child health clinics90 mobile health clinics196non ministry of health hospitals83523privateno.beds (official)licensed hospitals20912,216 maternity homes21102 nursing homes12273 hospice328 ambulatory care centre21108 blood bank5#- haemodialysis centre75848 community mental health centre19registered medical clinics6307- dental clinics1484-*national blood centre, national public health laboratory and 4 regional laboratories;dental chairs;#refers to 4 cord blood stem cells banks and 1 stem cell and regenerative medicine research lab and services;refers to dialysis chairs . National blood centre, national public health laboratory and 4 regional laboratories; refers to 4 cord blood stem cells banks and 1 stem cell and regenerative medicine research lab and services; refers to dialysis chairs . There are other government agencies that complement the role of moh to preserve the health of the people . For instance, the ministry of human resources that enforces safety and health regulations of employees, ministry of education that is responsible for the operation of the teaching hospitals and training of health personnel of the country, ministry of defence that provides health services for its population within the territory, ministry of rural development that is responsible for the health of the aborigines and ministry of housing and local government that is responsible for some of the licensing and enforcement under its purview . Studies have also shown that the malaysian health standard is almost at par with those of developed countries . Data from the world health report in 1999 indicated that the health indicators of malaysians were much better compared to some of the asean countries . For example, the infant mortality rate (imr) in malaysia is 11 per 1000 live births while in indonesia it is 48 per 1000 live births and in thailand it is 29 per 1000 live births . This figure is still high compared to the imr of singapore (5/1000 live births), united kingdom (7/1000 live births) and america (7/1000 live births). Equity is an assessment of fairness . Despite malaysia's effort in socio - economic development plans, there still exist issues in equity and accessibility especially for the indigenous groups, rural population and the hard - core poor . This can be seen through quality in terms of health services, manpower and equity in terms of geographical location and accessibility in terms of price and tariff . The asian economic crisis in 1998 has increased 50% of the poverty level in several countries which added difficulty for the poor and middle class in accessing health care . Nevertheless, efforts are taken by the government to strengthen the rural health services in malaysia through the improvement of existing facilities and introducing new health services that range from outpatient curative care to preventive and promotive services . The rural health units consist of one health centre, four rural health units and mobile clinics . The rural health unit follows a two - tier system that provides subsidized or free health services to 15,000 to 20,000 rural population . There are 500 people per doctor in kuala lumpur and 4000 per doctor in terengganu and east malaysia ., the ratio of doctors to patients in malaysia is 1:927 compared to 1:1105 in 2008 . One of the pending concerns of the government is that there are high concentrations of private practices in the urban areas due to the demand by the affluent community . In 1993, there are 3055 general practitioners clinics and 190 private hospitals and nursing homes in malaysia . In 2000, 46.2% of all doctors were in the private sector and were accountable for only 20.3% of hospital beds while the rest of the 53.8% of doctors were in the public sector looking after 79.7% of the beds . It is reported that 58.8% of the specialists were in the private sector and about 41.2% were in the public sector . The findings through interviews from key personnel from moh states that the charges from private hospitals on services component range from 15% to 28% of the hospital bills and medication whereby 15% of this bill is not made known to patients . Furthermore, professional fees take up almost 50% of the total bill . The difference in the public and private sectors in terms of specific services provided may have a significant effect on the equity of services and the question of efficiency and effectiveness . This leads to an imbalance of the distribution of manpower in public and private sectors in malaysia . Generally, the services provided by private hospitals are curative and selective in nature, either free or subsidized and much more comprehensive which is controlled by issues of equity . Access to private health services is limited to the richer society that can afford out - of - pocket payments of higher fees . Immigrant health is another concern in malaysia whereby 5% of the malaysian population, which consists of about one million people, are immigrant workers . These foreign workers may harbour communicable diseases which originate from their country and this incurs health care cost when they use the health facilities in malaysia . Moreover, there are many cases whereby foreign workers who have been admitted have defaulted in settling their bills and collectively with a number of other reasons unsettled hospital bills in public sectors are increasing . To address these issues, more comprehensive preventive measures and plans must be taken by designing and implementing conducive national health care financing scheme under the national health financing authority (nhfa) within the realm of moh . Professionals in health care and the health care systems have changed at a much slower pace and are not usually suitable for the present health needs of the population . Throughout the world there seems to be fundamental changes in medical care delivery systems that is in progress . Asia pacific region is the most varied health region in the world because it contains the country with the largest population in the world . This includes malaysia which has about 8.3% of the population above 30 years suffering from diabetes and 29.9% from hypertension . In the less - developed countries in the region, a large percentage of the population is moving through the economic transition and about 70% of the deaths are due to chronic diseases . The united nations development program (undp) has published projections for changes in populations over the next 50 years . For population over 60 years, malaysia will have an increase from 5.7% in 1996 to 11% by 2020 . The world health organization (who) and individual countries are taking control of the progress by phc . Although the definition of phc varies from country to country, it cannot be denied that accessibility, quality of basic health care and equity within countries have improved . Nevertheless, the populations most in need are the aborigines, the poor, the disadvantaged and the disabled . These groups have the least access to health services according to the inverse care law which explains that health care tend to operate based on active market forces . However, meeting their needs will be very challenging, because every individual has a right to health care services and it is essentially the responsibility of the government to ensure this access . Health care financing is a key concern all over the world today . Among others, some of the sources of funding health care are through taxation, social and private health insurance and out - of - pocket payments . The malaysian government finances the public health services through the consolidated revenue fund under the ministry of finance while the sources from the private sector are essentially from the consumers . The system of financing is inclined towards the public sector whereby only a nominal fee of rm1 for each outpatient visit is charged in accordance to the fees (medical) order 1976 . Government employees and their family members benefit from these services even after their retirement while the social security organization (socso) and employees provident fund (epf) do not finance employees in the private sector during their retirement . Comparatively, the british government initiated the 1912 national health insurance policy to compensate salaries of workers who have lost their jobs due to sickness . Commercialization of health care is not financially viable for the majority of the consumers and is inappropriate because any framework of health care provision must be in line with the needs of the consumers . As a result, it has undermined the trust of individuals to the health care profession and the government . Health care financing is a main challenge in many countries and should be taken into consideration in providing a safety net for the poor . The united states spends 14% of its gnp compared to asian countries that spends about 48% of their gnp on health care . With new technologies, capitalization of expensive hospital facilities and specialization has increased the cost of medical services . In 2001, returns collected by moh malaysia in providing medical, health and dental care services amounted to 2.2% of the total operating budget . The medical price index in malaysia has increased more than the consumer price index . In some parts of the countries, where the force of the financial crisis is bigger, structural adjustments to high costs of debt servicing and reduced rates of exchange have caused cuts to the public health budget . As a result, many of the countries anxiously look for cost - containment measures and different sources of financing including cost sharing . In doing so, no one should be denied access to health care due to financial reasons and malaysia should not adopt solutions from failed regions that have failed in health care delivery . Despite the high - tech medical technology in the health care sector in the united states, 45 million residents are lacking health insurance, including 10 million children who are uninsured . One possible suggestion in managing long term health problems is by looking at the chronic care model (ccm) that leads to improved patient care and better health care systems, which is widely practiced for ambulatory care improvement in the united states and internationally . Through privatization in malaysia, the weight of the cost of care was moved to a sizeable proportion of the population that could least afford it . Comparatively, the provision of medical care through the national health service in britain is committed to horizontal equity which describes equal treatment for equal need while the australian experience in health care financing is described as the classical liberal manner in which the government operates . Fortunately, countries such as malaysia and thailand provided a safety net for primary care and ensured minimal essential care for the high risk groups . Equity is an assessment of fairness . Despite malaysia's effort in socio - economic development plans, there still exist issues in equity and accessibility especially for the indigenous groups, rural population and the hard - core poor . This can be seen through quality in terms of health services, manpower and equity in terms of geographical location and accessibility in terms of price and tariff . The asian economic crisis in 1998 has increased 50% of the poverty level in several countries which added difficulty for the poor and middle class in accessing health care . Nevertheless, efforts are taken by the government to strengthen the rural health services in malaysia through the improvement of existing facilities and introducing new health services that range from outpatient curative care to preventive and promotive services . The rural health units consist of one health centre, four rural health units and mobile clinics . The rural health unit follows a two - tier system that provides subsidized or free health services to 15,000 to 20,000 rural population . There are 500 people per doctor in kuala lumpur and 4000 per doctor in terengganu and east malaysia ., the ratio of doctors to patients in malaysia is 1:927 compared to 1:1105 in 2008 . One of the pending concerns of the government is that there are high concentrations of private practices in the urban areas due to the demand by the affluent community . In 1993, there are 3055 general practitioners clinics and 190 private hospitals and nursing homes in malaysia . In 2000, 46.2% of all doctors were in the private sector and were accountable for only 20.3% of hospital beds while the rest of the 53.8% of doctors were in the public sector looking after 79.7% of the beds . It is reported that 58.8% of the specialists were in the private sector and about 41.2% were in the public sector . The findings through interviews from key personnel from moh states that the charges from private hospitals on services component range from 15% to 28% of the hospital bills and medication whereby 15% of this bill is not made known to patients . Furthermore, professional fees take up almost 50% of the total bill . The difference in the public and private sectors in terms of specific services provided may have a significant effect on the equity of services and the question of efficiency and effectiveness . This leads to an imbalance of the distribution of manpower in public and private sectors in malaysia . Generally, the services provided by private hospitals are curative and selective in nature, either free or subsidized and much more comprehensive which is controlled by issues of equity . Access to private health services is limited to the richer society that can afford out - of - pocket payments of higher fees . Immigrant health is another concern in malaysia whereby 5% of the malaysian population, which consists of about one million people, are immigrant workers . These foreign workers may harbour communicable diseases which originate from their country and this incurs health care cost when they use the health facilities in malaysia . Moreover, there are many cases whereby foreign workers who have been admitted have defaulted in settling their bills and collectively with a number of other reasons unsettled hospital bills in public sectors are increasing . To address these issues, more comprehensive preventive measures and plans must be taken by designing and implementing conducive national health care financing scheme under the national health financing authority (nhfa) within the realm of moh . Professionals in health care and the health care systems have changed at a much slower pace and are not usually suitable for the present health needs of the population . Throughout the world there seems to be fundamental changes in medical care delivery systems that is in progress . Asia pacific region is the most varied health region in the world because it contains the country with the largest population in the world . This includes malaysia which has about 8.3% of the population above 30 years suffering from diabetes and 29.9% from hypertension . In the less - developed countries in the region, a large percentage of the population is moving through the economic transition and about 70% of the deaths are due to chronic diseases . The united nations development program (undp) has published projections for changes in populations over the next 50 years . For population over 60 years, malaysia will have an increase from 5.7% in 1996 to 11% by 2020 . The world health organization (who) and individual countries are taking control of the progress by phc . Although the definition of phc varies from country to country, it cannot be denied that accessibility, quality of basic health care and equity within countries have improved . Nevertheless, the populations most in need are the aborigines, the poor, the disadvantaged and the disabled . These groups have the least access to health services according to the inverse care law which explains that health care tend to operate based on active market forces . However, meeting their needs will be very challenging, because every individual has a right to health care services and it is essentially the responsibility of the government to ensure this access . Health care financing is a key concern all over the world today . Among others, some of the sources of funding health care are through taxation, social and private health insurance and out - of - pocket payments . The malaysian government finances the public health services through the consolidated revenue fund under the ministry of finance while the sources from the private sector are essentially from the consumers . The system of financing is inclined towards the public sector whereby only a nominal fee of rm1 for each outpatient visit is charged in accordance to the fees (medical) order 1976 . Government employees and their family members benefit from these services even after their retirement while the social security organization (socso) and employees provident fund (epf) do not finance employees in the private sector during their retirement . Comparatively, the british government initiated the 1912 national health insurance policy to compensate salaries of workers who have lost their jobs due to sickness . Commercialization of health care is not financially viable for the majority of the consumers and is inappropriate because any framework of health care provision must be in line with the needs of the consumers . As a result, it has undermined the trust of individuals to the health care profession and the government . Health care financing is a main challenge in many countries and should be taken into consideration in providing a safety net for the poor . The united states spends 14% of its gnp compared to asian countries that spends about 48% of their gnp on health care . With new technologies, capitalization of expensive hospital facilities and specialization has increased the cost of medical services . In 2001, returns collected by moh malaysia in providing medical, health and dental care services amounted to 2.2% of the total operating budget . The medical price index in malaysia has increased more than the consumer price index . In some parts of the countries, where the force of the financial crisis is bigger, structural adjustments to high costs of debt servicing and reduced rates of exchange have caused cuts to the public health budget . As a result, many of the countries anxiously look for cost - containment measures and different sources of financing including cost sharing . In doing so, no one should be denied access to health care due to financial reasons and malaysia should not adopt solutions from failed regions that have failed in health care delivery . Despite the high - tech medical technology in the health care sector in the united states, 45 million residents are lacking health insurance, including 10 million children who are uninsured . One possible suggestion in managing long term health problems is by looking at the chronic care model (ccm) that leads to improved patient care and better health care systems, which is widely practiced for ambulatory care improvement in the united states and internationally . Through privatization in malaysia, the weight of the cost of care was moved to a sizeable proportion of the population that could least afford it . Comparatively, the provision of medical care through the national health service in britain is committed to horizontal equity which describes equal treatment for equal need while the australian experience in health care financing is described as the classical liberal manner in which the government operates . Fortunately, countries such as malaysia and thailand provided a safety net for primary care and ensured minimal essential care for the high risk groups . Multidisciplinary interventions are required to promote health financing, health care and disease prevention . In malaysia, the partnership between the public and private sectors should be encouraged to maximize resources and minimize duplication of health delivery in order to provide equitable health care . Subsequently, the community engagement in self care, planning, organizing and management will lead to self sufficiency in health . One effective way to improve the shortage and distribution imbalance especially in rural areas which is practiced in china is to rely and train the locals as paramedical workers . Three interrelated strategies to help the poor access health care are to design appropriate training for village health workers (preventive and promotive intervention), design appraisals on programs implemented and introduce community participation . The proposed nhfa would be a feasible option as a health care financing mechanism in malaysia with vested authority in providing equitable and quality services both in the public and private health care services . This has also been urged by the federation of malaysian consumers associations (fomca) which has pointed out the benefits that will be gained in implementing the national health financing scheme (nhfs), one of which will be regulating fees charged by the private hospitals and providing the public the freedom of choice to seek treatment either at public or private hospitals in malaysia . Another suggestion of intervention is to establish a national health insurance fund (nhif) to be the main funding source for the public health care sectors which allows compulsory contribution from employers and employees . The traditional support systems in some countries were also being commented to have been taken for granted and governments need to mobilize these social networks to take care of these problems . In this respect, the development of traditional medicine is encouraged in china where traditional medicine complements western medicine and this practice is allowed in hospitals in order to give the people the choice . In australia, the demand for alternative medicine is increasing steadily and findings have shown that the consumer expenditure have doubled from $a1 billion in 1993 to $a2.3 billion in 2000 . A survey conducted by the malaysian moh in 2004 has concluded that 70% of malaysians have used traditional and complementary based medicine to improve their health or to treat illnesses . The fields include malay traditional medicine, chinese traditional medicine, ayurvedic medicine and natural medicine . Utilization of cross - cultural traditional medicine by the various ethnic groups in malaysia is also gaining popularity . This has raised significant issues in public health policy . Even though the practice of alternative medicine is recognized in statutory form under section 34(1) of medical act 1971 (act 50), however the safety and efficacy of these medicine must be ensured through strict regulations and public education forums . Since the goal of medicine is essentially helping people to improve their health, therefore it is important for medical health professionals to work together with social workers from traditional and complementary medicine by respecting each others' beliefs and training and working as a team . Currently guidelines and the passing of the traditional and complementary medicine bill for the various fields in traditional medicine are being studied carefully by various organizations in malaysia . The malaysian government has also encouraged private hospitals to take on more social responsibility of the country and the private sectors are responding well to this . Over the last couple of years, there has been an increase in efforts to improve systems and attract foreign workforce . With the tenth malaysian plan in place, it is hoped that the mechanisms set by the government will improve the situation . Multidisciplinary interventions are required to promote health financing, health care and disease prevention . In malaysia, the partnership between the public and private sectors should be encouraged to maximize resources and minimize duplication of health delivery in order to provide equitable health care . Subsequently, the community engagement in self care, planning, organizing and management will lead to self sufficiency in health . One effective way to improve the shortage and distribution imbalance especially in rural areas which is practiced in china is to rely and train the locals as paramedical workers . Three interrelated strategies to help the poor access health care are to design appropriate training for village health workers (preventive and promotive intervention), design appraisals on programs implemented and introduce community participation . The proposed nhfa would be a feasible option as a health care financing mechanism in malaysia with vested authority in providing equitable and quality services both in the public and private health care services . This has also been urged by the federation of malaysian consumers associations (fomca) which has pointed out the benefits that will be gained in implementing the national health financing scheme (nhfs), one of which will be regulating fees charged by the private hospitals and providing the public the freedom of choice to seek treatment either at public or private hospitals in malaysia . Another suggestion of intervention is to establish a national health insurance fund (nhif) to be the main funding source for the public health care sectors which allows compulsory contribution from employers and employees . The traditional support systems in some countries were also being commented to have been taken for granted and governments need to mobilize these social networks to take care of these problems . In this respect, the development of traditional medicine is encouraged in china where traditional medicine complements western medicine and this practice is allowed in hospitals in order to give the people the choice . In australia, the demand for alternative medicine is increasing steadily and findings have shown that the consumer expenditure have doubled from $a1 billion in 1993 to $a2.3 billion in 2000 . A survey conducted by the malaysian moh in 2004 has concluded that 70% of malaysians have used traditional and complementary based medicine to improve their health or to treat illnesses . The fields include malay traditional medicine, chinese traditional medicine, ayurvedic medicine and natural medicine . Utilization of cross - cultural traditional medicine by the various ethnic groups in malaysia is also gaining popularity . This has raised significant issues in public health policy . Even though the practice of alternative medicine is recognized in statutory form under section 34(1) of medical act 1971 (act 50), however the safety and efficacy of these medicine must be ensured through strict regulations and public education forums . Since the goal of medicine is essentially helping people to improve their health, therefore it is important for medical health professionals to work together with social workers from traditional and complementary medicine by respecting each others' beliefs and training and working as a team . Currently guidelines and the passing of the traditional and complementary medicine bill for the various fields in traditional medicine are being studied carefully by various organizations in malaysia . The malaysian government has also encouraged private hospitals to take on more social responsibility of the country and the private sectors are responding well to this . Over the last couple of years, there has been an increase in efforts to improve systems and attract foreign workforce . With the tenth malaysian plan in place, it is hoped that the mechanisms set by the government will improve the situation.
|
Physical activity refers to any movement produced by skeletal muscles that results in energy expenditure, and can be measured quantitatively using metabolic equivalents or step - counts (9). As such, physical activity is an encompassing term that includes exercise, training, participating in sport, active play and active transportation . Secular trends for increasing levels of sedentary behavior and low levels of physical activity result in only 7% of children aged 5 to 17 years engaging in the recommended 60 minutes of moderate to vigorous physical activity (mvpa) a day (1). This recent report identifying children s low level of physical activity also noted, that: north americans value efficiency - doing more in less time - which may be at odds with promoting children s physical activity and health (1). To promote an environment that allows children to reach the minimum physical activity recommendations, it is paramount for influencing factors to be identified . Reduced use of active transportation, decreased levels of spontaneous active play (especially outdoor play), and decreased school physical activity and physical education, has resulted in low levels of physical activity and high levels of sedentary time in children and youth (specifically, ages 517 years) (3). One of the most prominent influences on children s physical activity levels may be their parents / guardians (referred to as parents, hereafter). Parents serve as role models for their children, logistical supporters (financially and otherwise), encouragers, and as co - participators (2). Parents also act as guardians and can either promote or restrict children s activity . As the literature suggests, more controlling and restrictive parents relate to children with lower physical activity levels (7). The varying domains of parental influence may have lasting effects on their children s physical activity with numerous studies reflecting the importance of parental involvement and encouragement specifically (2). The intent of this study was to examine the relationship between physical activity levels in parents and their children as well as the various influences parents have on their children s physical activity . If highly related, encouraging not only children s physical activity but also their parents physical activity and how, when, and in what manner parents encourage their children to be physically active could have an emerging influence on increasing physical activity levels in children . Using convenience sampling, parents and their children aged 7 to 10 years old from a local afterschool physical activity program were invited to participate in this study . In total fifteen child - parent pairs parents were asked to complete a 17-item self - report questionnaire regarding their child s participation in physical activity and the various ways they might influence it . This questionnaire was developed specifically for this study with questions about (1) parent s support / encouragement, (2) restrictiveness (willingness to allow children to play actively outside) and (3) personal participation in physical activity . I arrange to get my child to and from his / her sporting events and/or after school programs . An example of a question regarding restrictiveness is: i feel it is safe for my child to play outside . For these two types of questions, a 5-point likert scale was used with responses ranging from strongly disagree to strongly agree . Parental participation was determined from questions like: how often, in a typical week, do you participate in physical activity or exercise? . Response options included never / rarely, 12 times, 34 times, 56 times, and daily . Responses to each section of the questionnaire were scored 1 to 5 with higher values given to positive affirmation of children s physical activity (such as higher levels of support, and/or higher levels of physical activity participation). Upon receipt of the completed questionnaire, the child and parent were asked to wear pedometers (piezo step rx, stepcount) for all waking hours for seven days, excluding all water - based activities (i.e., bathing, swimming, etc . ). Parents were also asked to record any non - wear time for themselves and for their child as well as the time the pedometer was put on in the morning and taken off at night . For each child and parent in the study, their moderate - vigorous intensity activity and total number of steps were recorded and averaged over the number of days collected (3 to 7 days) to provide an overall summary or indication of their level of physical activity . Although each child - parent pair were asked to wear their pedometer for seven days, participants data were still included in the analyses provided there were at least three complete (10 + hours) days of pedometer data . To determine the relationship between parent and child physical activity levels, a one - tailed pearson product correlation analyses was conducted between the parent and child s average steps per day with an -level of p 0.05 to determine significance . To address the secondary purposes of this study, data obtained via the questionnaires the parents likert - scale responses to the questionnaire were totalled for each section of the questionnaire with total scores ranging from a possible 5 to 20 points for support / encouragement and 5 to 15 for restrictiveness and self - reported participation . Pearson product correlations were then used to determine the correlation coefficients between these variables and the children s average steps per day with significance set at p 0.05 . Using convenience sampling, parents and their children aged 7 to 10 years old from a local afterschool physical activity program were invited to participate in this study . In total fifteen child - parent pairs parents were asked to complete a 17-item self - report questionnaire regarding their child s participation in physical activity and the various ways they might influence it . This questionnaire was developed specifically for this study with questions about (1) parent s support / encouragement, (2) restrictiveness (willingness to allow children to play actively outside) and (3) personal participation in physical activity . I arrange to get my child to and from his / her sporting events and/or after school programs . An example of a question regarding restrictiveness is: i feel it is safe for my child to play outside . For these two types of questions, a 5-point likert scale was used with responses ranging from strongly disagree to strongly agree . Parental participation was determined from questions like: how often, in a typical week, do you participate in physical activity or exercise? . Never / rarely, 12 times, 34 times, 56 times, and daily . Responses to each section of the questionnaire were scored 1 to 5 with higher values given to positive affirmation of children s physical activity (such as higher levels of support, and/or higher levels of physical activity participation). Upon receipt of the completed questionnaire, the child and parent were asked to wear pedometers (piezo step rx, stepcount) for all waking hours for seven days, excluding all water - based activities (i.e., bathing, swimming, etc . ). Parents were also asked to record any non - wear time for themselves and for their child as well as the time the pedometer was put on in the morning and taken off at night . For each child and parent in the study, their moderate - vigorous intensity activity and total number of steps were recorded and averaged over the number of days collected (3 to 7 days) to provide an overall summary or indication of their level of physical activity . Although each child - parent pair were asked to wear their pedometer for seven days, participants data were still included in the analyses provided there were at least three complete (10 + hours) days of pedometer data . To determine the relationship between parent and child physical activity levels, a one - tailed pearson product correlation analyses was conducted between the parent and child s average steps per day with an -level of p 0.05 to determine significance . To address the secondary purposes of this study, data obtained via the questionnaires were examined in greater detail . The parents likert - scale responses to the questionnaire were totalled for each section of the questionnaire with total scores ranging from a possible 5 to 20 points for support / encouragement and 5 to 15 for restrictiveness and self - reported participation . Pearson product correlations were then used to determine the correlation coefficients between these variables and the children s average steps per day with significance set at p 0.05 . Although 17 parent - child pairs consented to participate in this study, only the data from 15 parent - child pairs were included in the data analyses because one child lost the pedometer and another set was not returned . As previously mentioned for inclusion in the study, parents needed to complete the questionnaire and parents and children had to provide at least three days of sufficient pedometer data (minimally 10 hours). In fulfilling these requirements, 30 participants or 15 parent - child pairs were included in the data analyses . On average, parents took 8438.13 2758.67 steps per day while their children took 13077.00 3026.93 steps . There was no significant correlation between the average number of steps for parents and their children (r = 0.069; p = 0.597) as shown in figure 1 . A pearson product correlation analyses between children s number of steps per day and the various measures of parental influence (see table 2) were then conducted . It was found that there were no relationships between (a) children s steps and parent s self - reported support / encouragement (r = 0.045, p = 0.564), (b), children s steps and parent s self - reported restrictiveness (r = .0254, p = 0.820), or (c) children s steps and parent s self - reported participation / co - participation in physical activity (r = 0.002, p = 0.503). The purpose of this study was primarily to determine the relationship between parents and their children s physical activity . A secondary purpose was to determine the relationship of other parental factors (encouragement / support, restrictiveness and self - reported participation / co - participation) with children s physical activity levels . The lack of significant relationship between children and their parents physical activity might suggest that the basis of children s activity does not lie primarily in parental factors and their role modeling . Other influences such as intrinsic motivations to be physically active might play more prominent roles then once perceived . Although on average, the children (~ 13,000 steps / day) exceeded the minimum recommendations of 12,000 steps per day, their parents (~ 8,400 steps / day) did not meet the recommended 10,000 steps per day (3). A possible explanation for this data might be that in some instances, such as sporting practices or tournaments, parents drive their child to participate but when their child is partaking in the physical activity, parents are in most instances, spectators . For most of the day, some parents engage in high amounts of sedentary time (as required by their jobs). These low levels of physical activity are confirmed with only 15% of canadians adults meeting the minimum physical activity requirements of 150 minutes of mvpa per week (1). Children on the other hand have recess, and in some instances afterschool programs that allow for higher levels of physical activity . The parent s lower levels of physical activity while their children are active may help to explain the lack of support for the hypothesis that parents and children s physical activity levels would be related . Perhaps there might be a more complex interconnection between parental modeling of physical activity and children s level of physical activity than expected . With lower levels of physical activity, rates of chronic and acute health concerns increase, making it paramount for attention to be given to identify possible factors connected to children s physical activity . It is important to note the lack of variance in children s steps (as most were between 10,000 and 15,000 steps per day) while the adult steps showed considerable variability ranging from about 4,000 to 15,000 steps per day . In other words, this suggests these children were equally physically active despite differences that may exist among them such as sport participation and/or parental factors . There was a much larger fluctuation in the parents step counts and therefore also in their level of physical activity . A closer look at the individual data shows that only three parents, or 19% of the sample obtained more than 10,000 steps per day while nine children (or 56%) had over 12,000 steps per day . Further, in this study, every child obtained the recommended minimum amount of 60 minutes of moderate or more intense physical activity per day (as determined by the time of pedometer steps greater than 100 per minute). The parents were also on pace for acquiring the minimum recommendations of 150 minutes of moderate or more intense physical activity per week (assuming their steps were obtained in bouts of at least ten). This paradox of the parents attaining the physical activity recommendations according to minutes of mvpa but not reaching the recommended number of steps / per day could possibly be explained by parents who are extremely active for two or more hours one day, and are less active through the rest of the week (or something similar). It should be noted that the sample of children in the study was more physically active than the general population . With 56% of children in the study obtaining more than the recommended steps per day, it is difficult to draw reasonable conclusions reflective of the general populace where only 7% of 5 to 17 year olds achieve the minimum physical activity requirements . As such, within a normal population, parental factors may play a more prominent role in the development and/or adherence to their children s physical activity . The lack of relationship between parents self - reported support / encouragement of their children s physical activity was surprising, given previous research (2, 10). The results indicate that although parents self - reported considerable supportive and encouraging behaviours, it did not relate to their children s physical activity . Parental support, particularly positive encouragement and interpersonal actions it has also been suggested that physical activity interventions should focus on improving parental encouragement specifically increasing positive tangible support, such as helping and teaching certain techniques; however, the results of the present study do not support this suggestion (11, 12). Contrarily, the results of our study suggest parental support and encouragement may not play as a significant role as once thought . Many parents in our study self - reported high levels of financial support as they noted their children attending sporting programs and afterschool programs; however, the correlation between this influence and children s level of physical activity was non - significant . A prevailing theme to understand this complexity is to note that the sample selected in this study was more active than the population, and that despite the overwhelming parental support / encouragement, it did not relate to their children s level of physical activity . Another hypothesis not supported in this study was that less parental control or restrictiveness would relate to higher physical activity rates in children . This finding is also surprising because up until this point, advocates for physical activity promotion in children, particularly those for outdoor play, have said that allowing children to be more creative and explorative is paramount to permitting them to be more physically active (6, 7). It is possible; however, that with the influences of technology and social media that less restrictive parents are giving their children more freedom, just to have their children hang - out with friends, playing gaming systems or watching television . Realistically, parents do not always know what their children are doing with friends when away from their supervision, and this could be one theory that could explain the lack of a correlation . Equally surprising was the lack of significant relationship between the parents self - reported participation and children s level of physical activity primarily because children often do what they see . By this notion, a higher level of parental participation in physical activity should then relate to higher levels of physical activity in children . It has been speculated that higher levels of parental co - play could relate to higher levels of children s physical activity because children might enjoy playing with their parents (8). However, some children report that parents are too rule - driven when they play together, and that parental games are not as fun as children s games (5). This lack of enjoyment of being physically active together could contribute to the lack of correlation between parents and children s physical activity levels . The sample size for this study was relatively small, with only 15 child - parent pairs providing complete data and may be a limitation, particularly as the participants were localized in a smaller demographic and came from the same afterschool physical activity program . As such the findings are limited to children 7 to 10 years of age and their parents . It is also important to identify cultural aspects of the study, which could also pose limitations; as participant experiences may have been affected by a north american culture . Self - report questionnaires are inherently limited by their nature of self - report and the potential for bias to present oneself as a good parent who does all they could / should for their children . More female (11) than male (4) parents provided data for this study, and parental age was not taken into consideration, both potential limitations . Further research could ensure a balanced representation of parent participants as well as data collection from a larger age range of children and family situations (single parent, lower income, younger / older parents, different bmis, etc . ). Future studies should consider children s motivations for being physically active as well as identifying possible influences of how different parenting styles (e.g., supportive, authoritative) might affect physical activity in children . Further, it may be worth exploring the children s perceptions of how their parents involvement may affect their overall activity levels . What is not clear is the impact of parental influences, particularly interrelated in relation to peer influences and how much of a role they play in children s adherence and physical activity participation . It may be that parents think they are positive role models for their children s physical activity and that they think they are supportive and encouraging when in fact they may not be, or may not have as great an influence as they think as found in this study . Given that only 7% of children aged 5 to 17 years are meeting the minimal physical activity guidelines (3), there is a high importance to identify possible factors that influence physical activity for current and long term health, something must be done . In conclusion, the lack of significant relationships found between parents and their children s physical activity in the data suggests that there is more to children s physical activity levels than parental support / encouragement, restrictiveness and participation . Clarity and an objective evaluation of this relationship may lead to a better understanding, which may lead to more effective physical activity promotion in children . Maybe it is time that we begin to change the way we think about physical activity, as the theories engrained in our minds are not the same as the realities being produced.
|
Magnetization transfer (mt) imaging is a quantitative approach for detecting subtle or occult abnormalities in brain tissue . In previous studies, the magnetization transfer ratio (mtr), an index of mt imaging, was sensitive to brain changes in patients with mild cognitive impairment, an alzheimer's disease prodrome [1, 2], to new lesions in patients with multiple sclerosis, and to changes associated with progression in chronic neurological disorders . The higher magnetic field strength afforded by 3 t allows mt image resolution to be augmented compared with conventional mt acquisition at 1.5 t [57]. We developed a high resolution mt technique to detect subtle changes in anatomically small, functionally eloquent brain structures . The increased field strength affords whole - brain coverage with considerably thinner slices, potentially reducing partial volume artifacts . However, even among healthy subjects, numerous factors may introduce variability in measures derived from magnetic resonance (mr) data, such as static field b0 signal dropout and rf nonuniformity . Measurement variation may be introduced by scan repetitions, repositioning at different time points, and image post - processing . Moreover, 3 t may be susceptible to variation associated with increased field strength . Such variability may pose limitations when conducting clinical comparisons to differentiate normal and diseased brains or in developing statistically predictive algorithms . To validate high resolution mt for detecting early disease or for monitoring progression in chronic neurological disease, it is necessary to collect information on normative values and to evaluate the reliability and reproducibility of the measurements when measured across time in healthy controls . This investigation evaluated observer - agreement of high - resolution mt measurements determined from repeated brain scans of 9 healthy volunteers . We evaluated the reliability and reproducibility of the high resolution mt measurements in 12 brain regions of interest (rois), applied statistical measures to the data and used complex multivariate mixed - effects models to test the statistical significance of several effects due to region, subject, observer, time, and manual repetition . The study was approved by the irb at the north shore university health system, and conducted following the ethical principles outlined in the declaration of helsinki . Eleven healthy adult volunteers were randomly selected from a database maintained at the center for advanced imaging, radiology department, northshore university health system provided written informed consent and evaluated for eligibility criteria . To protect the subjects' confidentiality, all data were de - identified and handled according to the guidelines specified by the health insurance portability and accountability act (hipaa) in the usa . Brain images were acquired using a 3 t general electric (ge) hdx system (waukesha, wi, usa). Each volunteer was scanned twice in a randomly - selected time interval between 1 to 4 weeks . Methods for reducing random errors in image acquisition included the use of a body - coil for excitation to control b1 non - uniformities and an 8-channel quadrature receive - only coil . Mt pulses with (ms) and without saturation (m0) were applied at an offset frequency from water resonance . To accelerate the scan for whole - brain coverage, while maintaining thin slices, the image protocol was optimized based on 3 t using 3d spgr . The gaussian sinc mt pulse was applied in 8 ms at a 1200 hz offset . The stability of the scanner and set - up procedure were addressed with a fixed set of parameters per subject . Mt pulse was based on a three - dimensional spoiled gradient recalled (3d spgr) acquisition . The image protocol included the following parameters: tr 34 to 35 ms, te 4 to 8 ms, imaging fa 5, bandwidth 15.6 khz, 0.75 nex, phase fov 0.75, voxel dimensions 0.9 0.9 0.9 ~ 1.3 mm . The whole brain was covered in 90 to 140 slices with acquisition time ranging from 7 minutes 40 seconds to 10 minutes 20 seconds using a partial k - space acquisition . Mtr maps were generated off - line on a general electric aw workstation (general electric, milwaukee, wi, usa) using the standard equation: (1)mtr = m0msm0100%, where ms and m0 were the signal intensities in a given voxel obtained, with and without the mt saturation pulse, respectively . The 12 rois were: genu, splenium, left and right hemispheres of the hippocampus, caudate, putamen, thalamus, and cerebral white matter . Each roi was sized approximately 30 to 43 mm and manually and independently placed by observers 1 and 2 (authors s.s . And y.w . After an initial consensus decision was drawn regarding the sizes and locations of the 12 rois, the observers performed manual segmentations of the roi independently on each set of images . Mtr values were extracted using the manually - defined rois with the combinations of observer, time point, and repetition (table 1). The mean and sds of the roi values were calculated . Meta - data were stored in a sas 9.1 (sas, cary, nc, usa) dataset, with individual volunteer identification numbers withheld and replaced by a sequence of 1 to 9 for each subject . Statistical analyses were performed using sas 9.1 (sas institute, cary, nc, usa; http://www.sas.com). Proc univariate, proc means, proc corr, and proc mixed . Let y = yijklm having the indices described in table 1 be a random variable representing the mean roi value . For the mth roi, we first computed the sample mean and standard deviation of all mean roi values: (2)mean^(ym)=ym=1nml=12k=12j=12i=19yijklm, sd^(ym)={var ^(ym)}1/2={1nm1l=12k=12j=12i=19(yijklmym)2}1/2, where nm = i j k l = 9 2 = 72 measurements and the operator the 95-percentile normality range was approximately within the following interval, with the following lower and upper bounds: (3)(mean^(ym)2sd^(ym), mean^(ym)+2sd^(ym)). The term normality range as used in europe, could be arbitrarily - defined according to the number of standard deviations away from the mean . Thus, it should not be viewed as the range of the entire dataset, but rather an interval useful for estimating the population value by one or several standard deviations away from the mean . Here the critical value of 2 was chosen as recommended by bland and altman . Additionally, we justified using a student's t - distribution with nm 1 = 71 degrees of freedom . For any tail probability of /2 (e.g., 0.025 for a 95-percent normality range), we used the quantile of the corresponding to particular t - distribution, such that (4)tnm11(12)=t711(0.975)=1.994, this value happened to be close to the recommended multiplier of 2 . We first explored and measured the concordance between the various measurements fully nonparametrically via spearman's rank correlation coefficient . Suppose that we correlated the roi values by observers j = 1 and j = 2, then denoted the marginal ranks, rijklm = ranki(yijklm) and rijklm = ranki(yijklm), respectively, for all j j with j = 1 and j = 2 . The sample version of pearson's product - moment correlation coefficient between the ranks of the data was equivalent to spearman's rank correlation coefficient: (5)cor^(rijklm, rijklm)=(nm/2)l=12k=12i=19(ri1klmri2klm)l=12k=12i=19ri1klml=12k=12i=19ri2klm{(nm/2)l=12k=12i=19ri1klm2}1/2{(nm/2)l=12k=12i=19ri2klm2}1/2,=l=12k=12i=19(ri1klmri2klm)(nm/2)ri1klmri2klm(nm/21)sd(ri1klm)sd(ri2klm). Where denotes (l = 1k = 1i = 1ri1klm) and denotes (l = 1k = 1i = 1ri2klm). Assuming that there was no presence of any ties since the roi values were of continuous random variables, the spearman's rank correlation coefficient between observers j and j was (6)corr(rijklm, rijklm)=16l=12k=12i=19diklm2(nm/2)(nm2/41), where the difference of an arbitrary pair of marginal ranks for observer j and j was denoted by diklm = rijklm rijklm, for all j j. consequently, all of the raw mean roi values were converted to their marginal ranks and the differences between the ranks of each observation on the two variables spearman's rank correlation coefficient was also computed for the roi values between any two different time points k = 1 and k = 2 . Bar diagrams were made to display the spearman's rank correlation coefficients between observers or time points for each roi . We used the normalized measure of dispersion of a distribution to evaluate the reproducibility of the measurement . The measure was the coefficient of variation (cv), defined as the ratio of the sd to the mean . (7)cv^(ym)=sd^(ym)mean^(ym), where both the numerator (i.e., sample sd) and the denominators (i.e., sample mean) in the above expression for cv are provided in (2). Skewed data, such as those generated by an exponential distribution for which the underlying population mean and standard deviation would be equal, and thus the cv became 1 . <1 would generally represent low variability, and cv> 1 would represent high variability . As in (4) and (6), further stratified computations of cv for different observers, time point, or repetitions were achieved using formulae similar to (7). As overall variability was likely a result of the effects illustrated in table 1 . We employed a multivariate mixed - effects regression analysis to direct model the roi values . A variance - component approach has advantages over many stratified analyses, especially studying studies with a limited sample size . Here, because of the novel imaging modality using mt and 3 t acquisitions with labor - intensive manual segmentation procedures, large number of subjects would not have been feasible . To conduct an analysis of variance (anova) based on the various effects, a distributional assumption of normality was necessary and convenient . We would demonstrate (see section 3.4) that the normality assumption was generally satisfactory . Thus, we could then consider adopting a linear random - effects model with all pair - wise interactions, in addition to a third - order interaction term: (8)yijklm=m+si+oj+tk+rl + sioj+sitk+sirj+ojtk + ojrl+tkrj+ojtkrl+ijklm, i=1,,9, j=1,2, k=1,2, l=1,2 . The effects represented the following: m as intercept, si as subjects, oi as observers, ti as time points, ri as repetitions, and ijklm as the error team . A random - effects model assumed that each of the effects would have independent normal distributions with mean and variance . If normality had failed and because the data were mean roi values that were positively - valued, we would recommend a box - cox transformation, h(yijklm,), of the outcome variable with an optimal power coefficient [1719]. Note that the log - normal becomes a special case when the power coefficient = 0 . This normality transformation is given by: (9)yijklm=h(yijklm,)={yijklm1,0log (yijklm),=0i=1,,9, j=1,2, k=1,2, l=1,2 . A profile log - likelihood, llik of given the observations yijklm, would be maximized to estimate an optimal box - cox transformation via a nonlinear minimization routine, where the log - likelihood was (10)llik(yijklm)=nmlog {sd(yijklm)}+(1){i=1nmlog (yijklm)}+c, where c was a constant free of the power coefficient to be optimized . Due to the limited number of subjects, however, even with an optimal normality transformation, over - fitting and non - convergence might be issues . Alternatively, we could regard all of the observers, time points, and repetitions as fixed and specify a mixed - effects model . The significances of the sources of variability were tested via a restricted maximum likelihood (reml) approach . For our multivariate analysis, the significance threshold for two - tailed p - values was set if p .05 . Stratified by the time points within each roi, a two - way anova was performed by regarding all of the observers, time points, and repetitions as fixed . We specified a mixed - effects model for simplicity . Due to the complexity of the variance components for example, all subjects were segmented by the same observers who were from an entire population of observers . In other words, the subject effect was always assumed to be random, while the remaining effect (e.g., here the observer) was assumed to be fixed . We simplified our notations by only keeping the indices for the subject and observer effects of interest . We decomposed the data as follows: (11)yij=+si+oj+sioj+ij, i=1,,9, j=1,2, where the subject effect si was assumed to be random in an upper - case letter, which had a normal distribution with mean 0 and variance s, for all i = 1, i = 9); the observer effect oj was considered to be a fixed effect in a lower - case letter, with the constraint j = 1oj = 0, with the corresponding parameter to the variance being o = (1/(j 1))j = 1oj, for all j = 1,, j (here j = 2); the interaction term between the subject and the observer si oj was the degree to which the jth observer departed from his or her usual rating tendencies for the ith subject, which had a normal distribution with a mean of 0 and variance so; the errors terms ij were assumed to have an independent and identical distribution (iid) normal distribution with a mean of 0 and variance e . For the same ith subject, the effects are further assumed to be subjected to the constraint j = 1(so)ij = 0 over all of the observers . Shrout and fleiss gave the true definition of icc using the variance ratio of the subject variance over the total variance, with its estimated version using the quantities via anova (table 3): (12)icc=s2so2/(j1)s2+so2+e2,icc^(3,1)=bsmsemsbsms+(j1)ems . Similar to the analysis described above, we adopted a hybrid approach by considering two effects at once, with the subject effect always assumed to be random and the time point assumed to be fixed . The associate model was given by (13)yij=+si+tk+sitk+ik, i=1,,9; k=1,2 . As in (12), the estimated intraobserver agreement and its estimate were provided by: (14)icc=s2st2/(k1)s2+st2+e2,icc^(3,1)=bsmsemsbsms+(k1)ems, where the interaction term the interaction term between the subject and the time si tk had a normal distribution with a mean of 0 and variance st . We performed a sensitivity analysis by computing 6 different icc values shrout and fleiss previously proposed assumptions for iccs (table 4). A sas macro, written by professor robert hamer, university of north carolina school of medicine, chapel hill, nc, usa (http://www.bios.unc.edu/~hamer), was run to perform the various icc computations . Eleven healthy adults provided written informed consent to be evaluated and 9 underwent brain scans . Mean age of participants who received scans was 37.9 14.2 years; 7 participants were men and 2 were women . The mean roi values varied across different region (table 5). The left and right hemispheres tended to yield similar results when the average over these healthy subjects was considered . Spearman's rank correlation coefficients showed that a majority of correlations within each observer was above 0.5, suggesting a moderate to high concordance (figure 3). Time point 2 tended to yield higher concordance between the observers, which suggested a possible learning effect over time (figure 4). Due to limited sample sizes in this pilot study, in figures 3 and 4, we demonstrated the effect of observers by averaging over repetitions by each observer . Similarly, we demonstrated the effect of time points by averaging over repetitions at each time point . Overall, cvs ranged from 1.2% in the genu for observer 2 to 7.0% in the right hippocampus for observer 1 (table 6). Since all of the cvs were within 7%, that is, the tests of the normal distribution assumption marginally using the shapiro - wilk test indicated that only occasionally (e.g., for left caudate, left and right putamen, and right hippocampus), this assumption was not met (see table 7). Therefore, it was reasonable to specify linear mixed - effects modeling and two - way anova reported in sections 3.5 and 3.6 . At time point 1, iccs were greater than 0.7 in regions of genu, left and right putamen, whereas iccs were from 0.5 to 0.7 in regions of splenium, left and right hippocampus, left caudate, and right cerebral white matter (table 8). These results indicated moderate to strong interobserver reliability . In comparison, at time point 2, iccs were greater than 0.7 in regions of genu, splenium, left and right caudate, putamen and cerebral white matter, and left hippocampus and thalamus, while iccs were from 0.5 to 0.7 in right hippocampus and thalamus . However, for some rois such as the left cerebral white matter, right caudate, right thalamus, iccs increased from 0.2 (at time point 1) to 0.9 (at time point 2), making it difficult to determine whether this represents a learning effect . At each time point, intraobserver agreement was at least 0.5 for a majority of the regions (table 9). Six different methods for generating iccs exhibited similar patterns for high vs. low reliability results in different rois (table 10). These mathematical and statistical methods may easily be generalized to practical studies with larger sample sizes or to studies of patients with active disease . We acquired repeat brain measurements based on a high resolution mt imaging protocol at 3 t in 9 healthy adults . Our results indicate moderate to high reproducibility, supporting the validity of this method for further studies . Overall, higher intraobserver reliability was observed at the second time point than that at the initial time point, suggesting a possible learning curve effect for both observers . Interobserver reliability was generally lower than intraobserver variability, suggesting a strong observer effect in this comparison, which may be a factor in future investigations using mt imaging . Our analyses examined different aspects in a typical observer - agreement study, using measures for concordance, reproducibility, reliability, variance - component analysis, and multivariate analysis . In other studies, all or some of such methods may be considered . However, with a simpler study of either several observers, or one observer with several repetitions at different sessions or time points, then these scenarios may only require several of our methods . Only a small sample of healthy volunteers was evaluated in this initial pilot study . Therefore, the generalization of the 95-percentile normality range may be limited with respect to the wider spectrum of brain mechanisms represented in the broader population . For instance, demonstrating summary measures using all possible observer and time point combinations may not lead to meaningful interpretations in all cases . Nevertheless, since the technology is new, this research may provide useful pilot information for future investigations . Moreover, the statistical methods employed and illustrated here may easily be generalized to studies with larger sample sizes and diseased subjects . Another limitation was that this study aimed to evaluate only the reproducibility and reliability, rather than the accuracy in a more comprehensive validation study . In the absence of a true gold standard, such as one based on digital phantoms where realistic variability may still not be simulated, or on histopathology, improved reliability further research would benefit from a useful algorithm to perhaps statistically and optimally estimate the underlying spatial ground truth [22, 23]. Finally, future research may be directed to evaluating the diagnostic utility of high resolution mt for early detection of alzheimer's disease, multiple sclerosis or other neurological disorders and for monitoring progression across the clinical course.
|
Inflammatory mediators play a key role in acute pancreatitis development and in the systemic complications of the disease, which are a main cause of patient's death . One of the most important mediators of inflammation is interleukin-6 (il-6), which can be considered as a factor modulating the defence mechanism in organism . It was demonstrated that the il-6 level is increased in the blood of patients with acute pancreatitis (ap). The concentration of this cytokine was correlated with both the severity of ap and other indicators of inflammation, c - reactive protein and the activity of phospholipase a2 . The level of il-6 is an early marker of pancreatitis (2436 hours after the occurrence of symptoms) and it can be considered as a predictor of disease . Recent results have confirmed an essential role of oxidative stress in pathogenesis and pathophysiology of pancreatitis [25]. Numerous studies have suggested an essential role of antioxidants in the course of inflammatory process, among which a significant role plays: glutathione (gsh), glutathione peroxidase (gpx) (ec 1.11.1.9), and cu / zn superoxide dismutase (cu / zn sod) (ec 1.15.1.1) [37]. Glutathione (glutamyl - cysteinyl - glycine) is mainly known for its important role as a major contributor to the intracellular reducing environment . Along with gpx it participates in the depletion of hydrogen peroxide and other organic peroxides, protecting the cells before protein sh groups, nucleic acids, and lipids oxidation . The role of cu / zn sod in the protection against the gsh depletion, the lipids peroxidation, and the progression of ap was shown [79]. The relation between cu / zn sod and gpx in acute pancreatitis is controversial . In experimentally induced acute pancreatitis, a substantial decrease of cu / zn sod activity was detected, while gpx activity considerably increased in blood hemolysates and pancreatitis cells . No substantial differences in gpx activity between the control group and the group of patients with ap of were noticed by szuster - ciesielska et al . . Cu / zn sod activity significantly increased in the serum of patients with ap and chronic pancreatitis . The cu / zn sod activity can influence the level of zinc and copper ions participating in the maintenance of the proper stability of the subunits of enzyme and neutralization of superoxide radical anion . Pancreas plays an important role in the homeostasis of metals, what is confirmed by the changes in the cu / zn ratio in the course of the disease [6, 11]. Sh groups of proteins play an important role in the maintenance of pro / antioxidative balance . One of them is metallothionein (mt), a cysteine rich (2033%) small molecular weight protein (6 - 7 kda). Mt can neutralize reactive oxygen species (ros) and scavenge free radicals, thereby acting as antioxidant . The role of this protein in maintaining the homeostasis of zn and cu was also shown . The ability to scavenge free radicals in organism can be assessed by total peroxyl radical trapping potential (trap) determination, which is the combined capacity of all antioxidants to neutralize free radicals in serum . It is a marker to signal the beginning of oxidant - antioxidant imbalance, which results in oxidative stress . Oxidative damage induces cascade of reactive oxygen species production, some of which are relatively transients, such as hydroxynonenol, while others appear later and accumulate, such as malondialdehyde . As a result of intensified pancreatitis and oxidative stress, the tissue damage of pancreas and the increased release of cellular enzymes to extracellular space are observed . The membrane enzymes there are alanine aminopeptidase (aap) (ec 3.4.11.2) and -glutamyltransferase (ggt) (ec 2.3.2.2). Aap is a glycoprotein with low content of cysteine residue and high content of zn ions . Ggt is a microsomal enzyme, which catalyzes hydrolysis of the bond linking the glutamate and cysteine residues of glutathione and glutathione - s - conjugates . It was suggested that ggt activity can be considered as a good marker, which allows differing alcohol - related ap from others ap . In other studies, it was shown that alcohol abuse did not cause the increase in ggt activity . N - acetyl--d - glucosaminidase (nag) (ec 3.2.1.30) and -glucuronidase (-gd) (ec 3.2.1.31) are known as lysosomal enzymes . A statistically significant increase in nag activity in pancreatocytes was shown as a result of tissue damage in rats with ap . The aim of the study was to assess the degree of disturbances in the pro / antioxidative balance of above mentioned markers and estimate which antioxidant plays the main role in the maintenance of pro / antioxidative balance during acute pancreatitis . The study was aimed to determine an early marker of pancreatic damage in patients with acute pancreatitis . The tests were conducted in the blood, serum, and plasma derived from the patients of department and clinic of gastrointestinal and general surgery, medical university of wroclaw . All hospitalized patients and healthy volunteers of the control group had been informed about the aim of the study and gave their consent . The study protocol was approved by local bioethics committee of wroclaw university of medicine (no: kb-257/2005 and kb-829/2012). The venous blood was collected on the patients' admission to hospital and during their hospitalization . They were classified into the group of patients with ap due to clinical symptoms, personal interview, physical examination and clinical method used in the diagnosis of pancreatitis (ultrasonography, radiological examinations, and computed tomography of abdominal cavity), and laboratory tests (c - reactive protein, leukocytosis, the activity of amylase, lipase, aspartate and alanine transaminase, alkaline phosphatase, the level of bilirubin, urea, creatinine, and albumin in serum). From the study, were excluded the patients with pancreatic cancer arising in the course of pancreatitis . As control group, the patients were in age of 53.1 10.6 (4 patients in age of 3140, 12 in age of 4150, 6 in age of 5160, 8 in age of 6170, and 2 in age of 7180). The serum was collected according to the routine procedure, by taking the venous blood to disposable test tube . The plasma was obtained through collecting blood to a test tube with edta or heparin and they were mixed immediately and centrifuged (2500 g/15 min). The serum and plasma were frozen rapidly and stored at 30c . From the fresh collected blood, samples hemolysates were prepared (150 l of blood and 1050 l h2 omq), and then 300 l 25% metaphosphoric acid (cat . No: 23 927 - 5, sigma - aldrich, germany) was added, so that the final concentration of it in hemolysate was 5% . The samples were thoroughly mixed and then centrifuged for 6 minutes (10000 g). The supernatant obtained in this way for gsh analyzing was collected and used . In the case of some patients with ap, the dynamics of selected examined parameters was performed . Additionally, on the basis of personal interview and medical diagnosis, the group of patients was divided according to the etiology of disease to check the course of disease changes . Two groups of patients (patients with gallstone and idiopathic ap and patients with alcohol - related ap) were distinguished . The concentration of il-6 in serum was determined using duoset - elisa development system test (cat . Dy206, r&d systems, usa) using mice antibodies against human il-6, immobilized on 96-wells polystyrene plate (nunc - immuno modules maxistrip, cat . No . 468667, nunc, germany). Gsh level was determined in blood hemolysates with the method early described using glutathione standard (cat . No: 23 437 - 0, sigma - aldrich, germany) developed by patterson and lazarow . Thiol groups (sh groups) concentration was measured in plasma using a colorimetric method based on the reaction with 2,2-dithiobisnitrobenzoic acid (ellman's reagent) (sigma aldrich, germany) according the method described earlier . Mt concentration in plasma was measured using two - step direct elisa method with commercial antibody (dako, denmark) according the method described by milnerowicz and bizo . Measurements of metals (cu and zn) concentrations in the serum were assessed with the use of faas method (flame atomic absorption spectrometry) in the acetylate flame on the solaar m6 apparatus (thermo elemental, solaar house, cambridge, uk). The accuracy and repetition of the method were verified by determining the metal concentrations in control serum samples (seronorm tm trace elements serum of sero as, bilingstad, norway, cat . No: 201405). On the base of the concentration of cu and zn in serum gpx activity in the blood plasma was determined using glutathione peroxidase colorimetric / kinetic assay test (cat . Total peroxyl radical trapping potential (trap) was determined in plasma according to the modified method of alho and leinonen and described earlier . The concentration of lipid peroxidation products (thiobarbituric acid reactive substances, tbars) in the plasma was measured using thiobarbituric acid (tba; cat . No: 011.350 - 6, sigma - aldrich, germany) according to the method described earlier . Serum nag activity was performed by colorimetric methods with use of p - nitrophenyl - n - acetyl--d - glucosamide (cat . 222 - 398 - 7, sigma - aldrich, germany) as a substrate according to the method of maruhn . -gd activity in serum was measured according to the method developed by maruhn et al . . No . 211 - 956 - 5, sigma - aldrich, germany) as substrate according to the method described earlier . 1105902, lachemia, czech republic) and -glutamyl - p - nitroanilide as substrates . The results for control group and the group of patients with alcohol - related ap were analysed using student's t test . Normality of distribution was confirmed by shapiro - wilk test . In the absence of normal distribution, the nonparametric u mann - whitney test was used . In order to verify the correlation between parameters, results of determination of antioxidant balance parameters were calculated for the first day of hospitalization (tables 1, 2, and 3). More than 55-fold increase in il-6 concentration in the group of ap was demonstrated compared to control group (table 1). In ap patients, il-6 concentration has been increased rapidly within several tens of hours since the occurrence of acute pancreatitis symptoms . The maximum of il-6 concentration was reached after 2 - 3 days and thereafter gradually decreased to about 10 u / ml . The results have shown significant decrease in gsh level in blood of the examined patients compared to control group . In the blood of ap group compared to control group, 3-fold decreased gsh level was noted (table 2). The dynamics of the changes in gsh level and il-6 concentration in the case of selected patients were performed . It was shown that an increase in severity of pancreatitis caused a decrease in antioxidant status of organism in the serve ap (the patient died). An increase in il-6 concentration which caused a decrease in gsh level was shown (figure 1). In the other case, it was demonstrated that a lower concentration of il-6 is accompanied by an increased gsh level (figure 2). The dynamics of these parameters have shown that increased gsh level is beneficial to patient and it can lead to decreased il-6 concentration . A significant increase in mt concentration in the group of patients with ap no differences in the concentration of sh groups between ap group and control group were shown (table 2). An increase in gpx activity in the plasma of patients with diagnosed ap compared to control group was observed . No statistically significant difference was detected in cu / zn sod activity between the group of patients with ap and control group (table 2). The concentration of cu and zn participating in the maintenance of the stability of cu / zn sod subunits was also measured . In the serum of control group, the values of cu / zn ratio ranged from 0.3 to 1.2 . No difference between the group of patients with ap and control group was shown (table 2). No differences in the concentration of trap between examined groups were shown (table 2). In this study, a statistically significant increase in the concentration of tbars in ap group compared to control group was determined . The average concentration of this parameter in plasma of ap patients was over 2-fold higher as compared to the group of healthy volunteers (table 2). 11-fold increase in ggt activity in the group of patients with ap compared to control group was shown . However, no differences in aap activity between examined groups were noted (table 3). The analysis of aap and ggt activities in depending on etiology has shown an increased aap and ggt activity in idiopathic and gallstone ap compared to alcohol - related ap (table 4). An increase in nag activity in ap group compared to control group was demonstrated . In ap group, however, no differences in -gd activity between examined groups were shown (table 3). In the ap group with gallstone and idiopathic etiology, an increased nag activity compared to alcohol - related ap was shown (table 4). In the group of patients with ap, the correlation between il-6 concentration and ranson criteria was also shown (table 5). There were also the correlations between nag activity and the concentration of il-6 and activity of cu / zn sod and gpx . The correlations between cu / zn sod activity and il-6 concentration and gpx activity were observed . Negative relations were noted between the gsh concentration and ggt activity and between gpx activity and tbars concentration . There was a relation between gpx activity and the il-6 concentration . The relation between activity of -gd and nag, -gd and ggt, and aap and ggt was demonstrated . The studies suggest that an essential mediator in the pathophysiology of acute pancreatitis is the inflammatory cytokines . A special role in initiating an inflammatory response in the course of acute pancreatitis was attributed to interleukin-6 (il-6). Il-6 is a major inducer of acute phase protein synthesis in liver, and therefore an increase in this cytokine concentration in serum precedes (24 hours) the appearance of c - reactive protein . Points of ranson criteria commonly used to assess the patient's state only partly seem to confirm its usefulness as a predictor of disease course . Only four from seven patients, which died during hospitalisation as a severe case of acute pancreatitis (6.3 points in ranson criteria), the disadvantage of ranson criteria is also the fact that it is important parameter only in the first 48 hours after the occurrence of acute pancreatitis symptoms . The usefulness of ranson criteria in later period of disease was not confirmed . Berney et al . Have confirmed that the method of determining the severity of pancreatitis on the base of serum il-6 concentration (in the first three days of disease duration) is characterized by high specificity (6795%), sensitivity (69100%), and accuracy (8084%). In addition, in our study, the positive correlation il-6 with ranson criteria was noted, which can confirm usefulness of il-6 to assess acute pancreatitis severity . In this study, was demonstrated over 55-fold increase in the level of il-6 in the serum of patients with ap during the first 48 hours of hospitalization compared to the control group . In the study of mayer et al ., it has been shown that high level of il-6 is associated with increased mortality of patients with ap and it can be a marker for the development of systemic complications of pancreatitis . This study confirmed that an increase in severity of pancreatitis caused a decrease in gsh level in organism, which led to death of patient . A dramatic decrease in gsh concentration in this group of patients correlated with an increase in lipid peroxidation products (tbars) (p <0.01). Significant changes in gsh level in the first phase of ap may be the result of massive attack of ros and the participation of gsh in enzymatic elimination of oxidative stress products . A statistically significant increase in plasma gpx activity (participating mainly in gsh - dependent hydrogen peroxide elimination) was detected in patients with ap . A decrease in gsh level with a simultaneous increase in gpx activity has also found the confirmation in a statistically significant negative correlation (p <0.001). This study suggests that a decrease in gsh level can be related to enhanced activity of gpx using gsh as substrate . The studies on the people linking cu / zn sod with pancreatitis turned out to be contradictory . It is possible that, in the course of acute pancreatitis, both gpx and cu / zn sod were involved, but gpx / gsh system seems to play a role in the first defence line against ros, whereas cu / zn sod may play a role in chronic pancreatitis and its exacerbation . In the studies of hausmann a lowered enzyme activity in patients with severe ap than in those with mild pancreatitis was also shown . Zinc and copper ions participate in maintaining the proper stability of cu / zn sod subunits and superoxidase radical anion neutralization . Have shown considerably lowered zn concentration in pancreatic tissues in the course of pancreatitis . Due to zn participation in antioxidant processes, the authors suggested that zn deficit might impair lipid metabolism and negatively influence the cell membrane protein synthesis . In present study, an increase in value of cu / zn ratio in the group of patients with ap compared to control group was not statistically significant . It can suggest that zn deficiency in the group of patients with ap was not so considerable to cause the changes of cu / zn sod activity, but it has influence on cu / zn imbalance . The cu / zn index can be increased and cu may have a prooxidative effect . An increase in ros production can be a cause of 2-fold increase in mt concentrations in ap group compared to control group . A significant increase in mt concentration in the plasma with ap (2.8 ng / ml) compared to control group (0.9 ng / ml) was shown . Probably, mt is the protein, which plays an important role in the defence against oxidative stress . It may be considered as a sensitive marker, which protects before the changes in pro / antioxidant balance . The pro / antioxidant imbalance in ap patients could lead to oxidative stress, which reflected an increase in tbars concentration in the blood . An increase in lipid peroxidation products in the course of ap in its severe (6.2 mol / l) was also observed by tsai et al . And was later confirmed by the results of the further studies . In our studies, the concentrations of sh groups and trap were measured, but the differences in ap group compared to control group were not statistically significant . It is contradictory in comparison to other studies, in which a decrease in sh groups concentration and an increased trap level in the group of patients with ap compared to healthy volunteers were shown . It can suggest that the pro / antioxidant imbalance in acute pancreatitis can cause little changes in the level of trap, which indicate a small usefulness of trap determination . We observed an increase in levels of antioxidants, such as gpx or mt and the decrease in gsh concentration . These antioxidants seem to be important in the first line of defence against oxidative stress in acute pancreatitis . The development of pancreatitis can cause the formation of numerous tissue damages and it can lead to enhanced release of enzymes from the cells and the extracellular space . In this study, membrane enzymes including aap and ggt or lysosomal enzymes nag and -gd were measured . In current study, an increase in ggt activity in patients with ap compared to control group can be caused by pancreatocytes damage as a result of pancreatitis or it can be an effect of increased demand for gsh in metabolism of organism, in which ggt is involved . Mcknight suggested that the induction of ggt activity depends on bile stasis within the biliary tree . However, hayakawa has demonstrated that the increase of enzyme activity is result of alcohol abuse, which can cause an increase in enzyme release into serum (probably as a result of changes in cell membrane permeability). It was confirmed by other researchers which maintained that ggt determination can be a good marker differentiating alcohol - related ap from others ap . In our study, the enhanced release of ggt into serum in gallstone and idiopathic ap compared to alcohol - related ap was demonstrated . It can indicate that ap is induced mainly by cholestasis and damage of duct epithelium . This process caused also the release of aap in this group of patients, which can result in disorder of metabolic processes catalysed by aap and ggt . Inflammation can cause an increase in nag level, what can be considered as a marker of lysosomal dysfunction and abnormal cellular integrity . In this study, more than 3-fold increase in nag activity in serum of patients with ap was demonstrated . The analysis of ap patients in terms of etiology suggests that nag was released into serum mainly as a result of pancreas damage during inflammatory process . It can indicate deep damages of pancreas, which led to total destruction of its structure . The measurement of -gd activity in examined groups did not show significant differences . In wilson's studies, an increase in -gd activity in the blood of rats with protein deficiency treated with ethanol was demonstrated . An increase in -gd activity (but not statistically significant) in the group of patients with alcohol - related ap was also noted . This suggests that greater destruction of cells structure and lysosomal enzymes release in patients with gallstone and idiopathic etiology of ap compared to patients with alcohol related ap were observed . In the patients with ap, the correlation between determinated parameters was shown . In the group of patients with ap, the correlation between il-6 level and the activity of antioxidant enzymes: cu / zn sod and gpx or between the il-6 concentration and the activity of nag was shown . The positive correlation of il-6 concentration and nag activity can confirm that inflammation increases tissue damage . The inflammatory state caused the increase in cytokine level and the running of antioxidant mechanism, wherein the correlations between antioxidant enzymes (gpx and cu / zn sod) were negative . The relation between the activities of membrane enzymes (ggt and aap) was noted, which can confirm the interaction of them, similar to the activities of lysosomal enzymes (nag and -gd). The membrane damages can lead to the enzymes release and an increase in the activity of aap and ggt in serum . However, the destruction of cell organelles can lead to an increase in the activity of nag and -gd . The confirmation on the significant involving of gsh in the defence against oxidative stress was the increase in tbars concentration and increased gpx activity, which correlated with a decrease in gsh level . With the development of the pancreatitis, the release of lysosomal enzymes, such as nag, was increased . Its activity correlated with antioxidant enzymes activity (gpx and cu / zn sod). An increased activity of ggt in the serum of patients with ap and a decreased level of gsh involving in the defence against free radicals in the negative correlation between these parameters were demonstrated . The main findings from the study were demonstrated in figure 3 . This study can be concluded as follows: gsh, gpx, and mt seem to be the antioxidants the most involved in the defence against oxidative stress in acute pancreatitis.a significant decrease in gsh level can be a result of increased gpx and ggt activities.an increased tbars concentration and the activities of membrane or lysosomal enzymes indicate deep tissue damage, more in gallstone and idiopathic ap than in alcohol - related ap.the release of membrane and lysosomal enzymes in inflammatory process can contribute to metabolism dysfunction in nutrition and detoxification process, which can deteriorate the patient's condition . Gsh, gpx, and mt seem to be the antioxidants the most involved in the defence against oxidative stress in acute pancreatitis . A significant decrease in gsh level can be a result of increased gpx and ggt activities . An increased tbars concentration and the activities of membrane or lysosomal enzymes indicate deep tissue damage, more in gallstone and idiopathic ap than in alcohol - related ap . The release of membrane and lysosomal enzymes in inflammatory process can contribute to metabolism dysfunction in nutrition and detoxification process, which can deteriorate the patient's condition.
|
One of the common predicaments experienced by patients undergoing tooth preparation and cementation on vital tooth for crown and bridge restorations is dentinal hypersensitivity.1 the phenomenon of dentinal hypersensitivity is best explained by brannstroms hydrodynamic theory, which states that when exposed, dentinal tubules are stimulated by changes in temperature or osmotic pressure resulting in displacement of tubular fluid . This fluid movement is conveyed to the nerve fibers in the pulp, causing stimulation that is interpreted as pain or hypersensitivity . Vital teeth that are prepared for restorations are at a risk of developing hypersensitivity because a large number of tubules are exposed during the tooth preparation . When teeth are prepared for complete crowns, approximately 1.2 - 1.5 mm of tooth structure is removed to ensure appropriate crown contours and adequate occlusal clearance.2 richardson et al . Reported that approximately 1 - 2 million dentinal tubules are exposed during an average tooth preparation for a posterior crown.3 desiccation and frictional heat generated by the preparation also increases the chances of hypersensitivity.4 during the procedure of crown cementation, the cement is forced into the patent dentinal tubules before the luting agent sets, and displaces an equal amount of dentinal fluid, thus leading to excessive hydrostatic pressure and resultant irritation of pulpal tissues.1,5 the smear layer evident after tooth preparation was demonstrated to be ineffective against luting agent irritation . Before cementation of the final prosthesis dentin can still become sensitive as a result of microleakage of the temporary restoration and the resultant formation of bacterial byproducts.6 oxalates, resin bonding agents, and formulations containing sodium fluoride or potassium ions have been documented to have desensitizing property by blocking the dentinal tubules.7 however, the effects of these agents are limited, and the hypersensitivity can recur in the future.8 tooth sensitivity after cementation of crowns, therefore, is a pertinent issue . The use of low power low potency desensitizing laser treatment before cementation of crowns has shown to occlude exposed dentinal tubules and relieve the hypersensitivity for longer periods than any other desensitizing agents, and this procedure is growing in popularity the world over.9 it has been proved by sipahi et al . That application of low - power low - potency desensitizing laser treatment has an effect on the tensile bond strength of full veneer crowns luted with glass - ionomer cement.10 however, the effect of laser desensitizing treatment on the crown retention, when resin cements are used, has not been documented . This is of importance, because of the growing popularity of these cements due to their better physical and mechanical properties.11 the purpose of this study therefore was to assess, evaluate and compare the effect of desensitizing laser treatment on the bond strength of self - adhesive resin cement to glass - ionomer luting cement . The teeth were mounted into a metal jig filled with softened impression compound with the aid of a surveyor, so as to enable the specimen to be mounted parallel to its long axis . Tooth preparation of all the samples is planned . For bringing about standardization in the tooth preparation, it was mandatory for all the specimens to have a uniform taper, uniform length, and width . In order, to obtain uniform taper for the preparation a specially designed clamp was fabricated, which was able to secure a high - speed air - rotor hand - piece to the surveyor . The metal jig with the mounted tooth specimens were secured to the surveying table maintaining parallelism to the floor prior to starting the preparation . A round end tapered diamond bur was used to prepare the occlusal surface of the premolars, to a depth of 1 mm below the central groove (figure 1). The axial reduction of teeth done up to a uniform depth of 1.5 mm with the help of depth - cut diamond bur and tapered chamfer bur . Crown preparation using surveyor . The surface area of the preparations thus obtained was calculated using a formula for truncated cone,12 which is described below: truncated cone area ac = 3.141 l (r1 + r2) mm flat surface area a0 = 3.141 r2 mm surface area of preparation at = ac + a0 mm ac - area of axial surface a0 - area of occlusal (flat) surface at - total surface area l - length of the prepared surface, the axial surface r1 - radius of the base of the prepared tooth, i.e. At cervical region r2 - radius of the prepared tooth at the occlusal end only the samples with closely matching surface area were selected . The 48 specimens thus selected were then randomly distributed into different groups as follows (figure 2). Impressions of all the 48 prepared samples were made on a special tray using putty wash impression technique using polyvinyl siloxane impression material . The impressions were then poured in type iv stone to obtain the master cast following the impression procedure the specimens were stored in isotonic saline . A loop of approximately 5 mm diameter was then attached onto the occlusal surfaces of the patterns using 0.8 mm thick sprue wax . This loop in the cast metal crown was to engage a hook during the retention testing on the universal testing machine . The wax pattern and dies were then assigned numbers corresponding to the respective prepared specimens so that each of the casting can be identified to its respective receptor tooth . Following casting and sandblasting (figure 3) the sprues were cut, and each casting trimmed, finished, and examined under magnification for any internal surface irregularities . Prior to cementation of the full veneer metal crowns, the prepared tooth surfaces of the 24 teeth samples, grouped for laser treatment were treated with erbium, chromium: yttrium, selenium, galium, garnet (er, cr: ysgg) laser at 0.5 w potency for 15 s without air or water spray (figure 4). After laser application, some of the samples were examined under environmental scanning electron microscopy (e - sem) for dentinal tubule obliteration (figure 5). Environmental scanning electron microscopy . The cementation of the crowns was done according to the manufacturer's instructions and was performed by a single operator to prevent interoperator variation . One hour following the cementation procedure, all the samples were stored in an isotonic saline solution for 24 h prior to testing . The retention testing of all the samples was performed on the instron automated universal testing machine . Impressions of all the 48 prepared samples were made on a special tray using putty wash impression technique using polyvinyl siloxane impression material . The impressions were then poured in type iv stone to obtain the master cast following the impression procedure the specimens were stored in isotonic saline . A loop of approximately 5 mm diameter was then attached onto the occlusal surfaces of the patterns using 0.8 mm thick sprue wax . This loop in the cast metal crown was to engage a hook during the retention testing on the universal testing machine . The wax pattern and dies were then assigned numbers corresponding to the respective prepared specimens so that each of the casting can be identified to its respective receptor tooth . The patterns were sprued, invested and casting done using nickel - chromium alloy . Following casting and sandblasting (figure 3) the sprues were cut, and each casting trimmed, finished, and examined under magnification for any internal surface irregularities . Prior to cementation of the full veneer metal crowns, the prepared tooth surfaces of the 24 teeth samples, grouped for laser treatment were treated with erbium, chromium: yttrium, selenium, galium, garnet (er, cr: ysgg) laser at 0.5 w potency for 15 s without air or water spray (figure 4). After laser application, some of the samples were examined under environmental scanning electron microscopy (e - sem) for dentinal tubule obliteration (figure 5). Environmental scanning electron microscopy . The cementation of the crowns was done according to the manufacturer's instructions and was performed by a single operator to prevent interoperator variation . One hour following the cementation procedure, all the samples were stored in an isotonic saline solution for 24 h prior to testing . The retention testing of all the samples was performed on the instron automated universal testing machine . The samples after storage in isotonic saline solution for 24 h, the tensile bond strength of each specimen in the study were tested in a universal testing machine . Statistical analysis was done with the help of descriptive statistics, independent samples t - test and two - way anova analysis using spss (version 16.0) and minitab software's (version 11.0) for windows (tables 1 - 3, graph 1). Mean tensile bond strength values for glass - ionomer luting cement on specimens with and without laser application . Mean tensile bond strength values for self - adhesive resin luting cement on specimens with and without laser application . Results of the 2-way anova analysis for the mean tensile bond strength of control and experimental groups with glass ionomer and self - adhesive resin cement . Results of the 2-way anova analysis for mean tensile bond strength of control and experimental groups with glass ionomer and self - adhesive resin luting cements . Dentinal hypersensitivity is an age old complaint experienced by patients during the cementation of crown and bridge restorations on vital abutment teeth.1 brannstrom in his hydrodynamic theory had stated that, when dentinal tubules are exposed in vital teeth they are stimulated by changes in the temperature or osmotic pressure resulting in displacement of tubular fluid . This fluid movement is conveyed to the nerve fibers in the pulp, causing stimulation that is interpreted as pain or hypersensitivity . The cements used during the luting of the prosthesis bring about these stimuli, resulting in postcementation hypersensitivity.1,5,13 many a tried and tested methods are currently available as dentine desensitizing agents, among which oxalates, resin bonding agents and formulations containing sodium fluoride or potassium fluoride are more commonly used.7 however, the effects of these agents are temporary leading to recurrence.8 with the advent of lasers into dentistry, desensitizing laser treatment has gained in popularity as an effective means to counter dentinal hypersensitivity . The use of lasers for treating dentinal hypersensitivity was first attempted by harper et al . In 1992.14 the precise mechanism of ablation of hard tissues with the er, cr: ysgg laser remains unclear . One of the theories put forward suggests that when the laser interacts with the dentinal tissue it is absorbed by the water and hydroxyapatite . This expansion during the change of state of water causes cracking of the dentinal tissue . As the steam expands, it also forces the cracked material away from the ablation zone . Since this reaction happens at a rapid pace, it is explosive in nature, and hence it is termed microexplosion.9 as a result of this micro explosion, dentinal debris similar to a smear layer forms on the surface of the dentin, there by blocking the exposed dentinal tubules . Laser application also lead to decrease in diameter, and size of the dentinal tubules by shrinking it.15 an e - sem study done to understand the tubule - occluding effect of desensitizing laser treatment on prepared dentin surfaces by sipahi et al . Observed that the application of desensitizing laser at 0.5 w potency without air and water can be done to reduce hypersensitivity of prepared abutment teeth in prosthodontics.9 according to this study, desensitizing laser application causes blockage and reduction in the size of patent dentinal tubules by deposition of dentinal debris created by micro explosion . These observations can raise queries regarding the effect of desensitizing laser application on the bond strength of commonly used luting cements, viz: glass - ionomer and resin cements to treated dentin . Have also observed that the tensile bond strength of glass - ionomer luting cement to the abutment tooth decreased by 15% after laser application.10 however, there are not many studies currently available on the bond strength of self - adhesive resin cements to desensitizing laser treated teeth . It is imperative to understand the bond strength of self - adhesive resin cement to laser irradiated teeth, as these cements are gaining in popularity as a luting agent due to their improved mechanical and physical properties.11 this study therefore was done to assess and compare the tensile bond strength of crowns luted with glass - ionomer and resin cements to laser irradiated prepared abutment tooth, and control group . Within the limitations of this study, it was found that laser treatment on dentine appreciably decreased the tensile bond strength of crowns luted with glass - ionomer cements . However, the bond strength of self - adhesive resin cement remained unaffected with a marginal increase in strength, it was not statistically significant . The results of the present study with glass - ionomer cement are concurrent with the findings of a previous study by sipahi et al.10 the mechanism of adhesion of glass - ionomer cement to dentinal surface is through an ionic bond between negatively charged polyacid chains of the ionomer matrix and the positively charged calcium on the tooth surface.16 these polyacids also form hydrogen bonds and undergo ion exchange in the collagen and the inorganic components of the tooth structure, particularly to calcium, carboxylate and phosphate ions of the tooth surface.17 the formation of dentinal debris formed during laser application as observed in sem picture in this study probably would have interfered with the above mentioned chemical bondage of glass - ionomer cement with the exposed dentinal surface leading to loss of bond strength . The desiccation of collagen fibrils due to laser application may also be another reason, leading to decreased bond strength due to the weak hydrogen bonds and poor ion exchange in the dentinal collagen.18 the bond strength of the samples luted with self- adhesive resin cements remaining unaffected or showing a marginal increase in bond strength may be due to the following reasons . The ability of resin cement to partially decalcify the smear layer and the dentin leading to the formation of short - resin tags into the remaining dentinal tubules after laser application.19improved chemical bondage due to increased calcium ions on dentinal surface during laser application20 leading to enhanced chelating reactions.21 the ability of resin cement to partially decalcify the smear layer and the dentin leading to the formation of short - resin tags into the remaining dentinal tubules after laser application.19 improved chemical bondage due to increased calcium ions on dentinal surface during laser application20 leading to enhanced chelating reactions.21 the above observations are in accordance with the study conducted by yazier et al . On the effect of erbium: yttrium, aluminum, garnet and neodymium: yttrium, aluminum, garnet laser hypersensitivity treatment parameters on the shear bond strength of self - etch adhesives.22 the exact mechanism behind the bond strength being unaffected or having a marginal increase have to be studied and interpreted further . The e - sem pictures of the laser irradiated samples in this study showed that a dentinal smear layer was produced due to microexplosion during laser application, which obliterated the patent dentinal tubules . These findings could be the reason as to how the laser application brings about desensitization . A few micro - cracks were found in some of the samples; possibly due to an accidental increase in duration of laser exposure.23 which reiterates the fact that one has to be judicious while handling and using technology like laser to be an effective tool in dentistry . From the observation and discussion postulated from this study, it can be concluded that self - adhesive resin cement should be a preferred luting medium to glass - ionomer cement, for abutments, which has undergone desensitizing laser treatment . The possible mechanism of dentin desensitization brought about by laser treatment could also be studied and understood from the e - sem pictures of the samples used for the study . Within the limitations of this in vitro study the following conclusions were drawn: glass - ionomer luting cement showed a statistically significant reduction in the tensile bond strength values after desensitizing laser treatment at 0.5 w for 15 s duration to prepared teeth as compared to the control group.tensile bond strength of self - adhesive resin luting cement showed a marginal increase in values after desensitizing laser application, which was not statistically significant.since combination of er, cr: ysgg laser for desensitization of dentin and the self - adhesive resin cement for luting crowns showed a marginal increase in bond strength values after laser application, these crowns could be recommended for luting crowns in laser treated abutments.scanning electronic microscopic study revealed that application of the er, cr: ysgg laser at a power of 0.5 w for 15 s to exposed dentinal surface resulted in obliteration of dentinal tubules and formation of a smear layer formed by dentinal debris, which possibly describes the desensitizing property of lasers . Glass - ionomer luting cement showed a statistically significant reduction in the tensile bond strength values after desensitizing laser treatment at 0.5 w for 15 s duration to prepared teeth as compared to the control group . Tensile bond strength of self - adhesive resin luting cement showed a marginal increase in values after desensitizing laser application, which was not statistically significant . Since combination of er, cr: ysgg laser for desensitization of dentin and the self - adhesive resin cement for luting crowns showed a marginal increase in bond strength values after laser application, these crowns could be recommended for luting crowns in laser treated abutments . Scanning electronic microscopic study revealed that application of the er, cr: ysgg laser at a power of 0.5 w for 15 s to exposed dentinal surface resulted in obliteration of dentinal tubules and formation of a smear layer formed by dentinal debris, which possibly describes the desensitizing property of lasers.
|
The two hemispheres of the human brain are not equivalent . Relative functional differences between the left and the right side of the brain, so - called functional hemispheric asymmetries, have been observed for several cognitive functions (corballis, 2009). For example, most individuals show a right - hemispheric dominance for visuo - spatial processing (e.g., vogel et al ., 2003) and a left - hemispheric dominance for production and processing of language (e.g., bethmann et al ., 2007 in addition to these functional hemispheric asymmetries, anatomical differences between the two sides of the brain (e.g., in volume or size of a certain area), so - called structural hemispheric asymmetries, have can be found in a wide range of brain regions (e.g., amunts, 2010). Several explanations for the emergence of hemispheric asymmetries have been given, including an enhancement of an individual s ability to perform two different tasks at the same time (rogers et al ., 2004), an increase in neural capacity due to an avoidance of unnecessary duplication of neural networks (vallortigara, 2006) and the greater speed of uni - hemispheric processing since no interhemispheric transfer via the corpus callosum is needed (ringo et al ., 1994). Historically, the scientific exploration of hemispheric asymmetries started with a seminal paper by a french surgeon called broca (1861), who described a patient called monsieur tan because the only syllable he was able to generate was tan . Post - mortem analysis of this massively speech - impaired patient s brain revealed a large lesion in the left posterior inferior frontal gyrus, an area now known as broca s area . This result indicated for the first time that the left hemisphere is highly relevant for language production . After this initial discovery in the language system, hemispheric asymmetries were thought to be uniquely human . In contrast to this view, left right asymmetries of brain and behavior have now been observed in all vertebrate classes including mammals (corballis, 2009), birds (rogers, 2008; george, 2010; gntrkn and manns, 2010), reptiles (bisazza et al ., 1998; bonati et al ., 2008, 2010; csermely et al ., 2010, 2011), amphibians (bisazza et al ., 1998; vallortigara, 2006), bony fishes (vallortigara and rogers, 2005; lippolis et al ., 2009; dadda et al ., 2010a), as well as cartilaginous, and jawless fishes (concha and wilson, 2001). Recent evidence for asymmetrical organization in only distantly related invertebrate species, ranging from octopus vulgaris (byrne et al ., 2002) to the honey bee apis mellifera (rogers and vallortigara, 2008; frasnelli et al ., 2010) and the nematode caenorhabditis elegans (taylor et al ., 2010) just to name a few examples revealed that lateralization is indeed not restricted to humans, but constitutes a fundamental principle of nervous system organization . For example, chicks recognize familiar birds better with the left than with the right eye (vallortigara, 1992) and react faster to a predator approaching from the left than from the right side (vallortigara, 2006), while most species fish show a consistent tendency to turn preferentially to one side when facing an obstacle while fleeing from a predator (bisazza et al ., 2000). These discoveries yield tremendous possibilities regarding the employment of model species in order to investigate the ontogenesis and phylogenesis of human brain asymmetry . Unfortunately, there has never been a strong integration of research in humans and non - human animals in the field of hemispheric asymmetries, a circumstance that may be rooted in the assumption of human exceptionalism that dominated the field from early on (taylor et al ., 2010). In the present review, we argue that an interdisciplinary comparative approach, combining findings from psychology, biology, neuroscience, and genetics, provides a uniquely powerful tool in order to advance understanding of the ontogenetic and phylogenetic processes responsible for lateralization . For example, one field of research in which the integration of findings from diverse animal species has influenced current views about evolution and development of human lateralization is the study of language lateralization . About 95% of right - handers and 75% of left - handers show left - hemispheric language dominance (bethmann et al ., 2007), a feature that was widely thought to be uniquely human (corballis, 2009). Contradictory to this view, evidence suggesting a left - hemispheric dominance for conspecific communication has now been observed not only in a wide variety of mammals like chimpanzees (taglialatela et al ., 2008), rhesus monkeys (hauser and andersson, 1994), gray mouse lemurs (leliveld et al ., 2010), dogs (siniscalchi et al ., 2008), mice (ehret, 1987), and sea lions (bye et al ., 2005) but also in some non - mammalian vertebrate species like frogs (bauer, 1993). Moreover, a left hypoglossal dominance has been reported in canaries (nottebohm and nottebohm, 1976). Interestingly, it has been shown that animal communication asymmetries are modulated by the emotional content of the communicative sounds, with a greater involvement of the right hemisphere during production or perception of communicative sounds expressing or eliciting fear (hook - costigan and rogers, 1998; siniscalchi et al ., 2008). These findings parallel the right - hemispheric dominance for negative emotions in humans (e.g., onal - hartmann et al ., 2011). Taken together, while the evidence remains sparse for most vertebrate orders and certainly more research addressing this topic is needed, a recent cladographic comparative study (ocklenburg et al ., 2011b) concluded that there is convincing evidence for lateralization of production and perception of conspecific vocalization in several mammalian species, especially within the order of primates . Thus, human language lateralization might not be due to a dominance of the left hemisphere for language as such, but rather due to a left - hemispheric dominance for more basic features of species - typical communicative sounds or their production (bye et al . Hence, lateralization of cognitive functions in the human brain did not necessarily emerge during human evolution . Instead, it may have been incorporated into the functional architecture of cognitive functions of which some, like language, are unique to homo sapiens (macneilage et al ., therefore, we will now focus on several key questions of human lateralization and will outline how a comparative approach could possibly help to elucidate them . A common conception is that functional asymmetries are a consequence of structural asymmetries in the brain (wada, 2009). Traditionally, research regarding this question has focused on macroscopic gray matter asymmetries such as volume or shape of certain brain areas (amunts, 2010). However, it has been surprisingly difficult to find any clear - cut links between structural gray matter asymmetries in the human brain and left right differences of behavior (dos santos sequeira et al ., interestingly, evidence from recent studies in animal models suggests that structural asymmetries in connectivity patterns of homologous regions in the two hemispheres may be of greater functional relevance than asymmetries in region size or volume . One of the major animal models to investigate the neuronal foundations of hemispheric asymmetries is the visual system of birds . The left hemisphere is specialized for detailed object analysis, attends to local features and excels in the categorization of visual stimuli (vallortigara et al ., 1996; yamazaki et al ., 2007). In contrast, the right hemisphere extracts relational configurations of visual stimuli that can be relevant during spatial orientation (vallortigara et al ., 2004; yamazaki et al ., 2007; rugani et al ., 2011). Additionally, the right hemisphere is in charge of visually guided social interactions (rosa salva et al ., 2010), fear and escape responses (rogers, 2000; koboroff et al ., 2008), sexual contacts (glbetekin et al ., 2007), and encoding of relational spatial information (tommasi and vallortigara, 2001). Anatomical and physiological studies support this dissociation and demonstrated that asymmetrical projections of the ascending visual pathways underlie parts of these lateralized visual behaviors . Like mammals, birds process visual information within two ascending pathways, the thalamofugal, and the tectofugal system (see figure 1). Comparison of mammalian and avian ascending visual pathways and asymmetries of the tectofugal pathway in pigeons . (a) schematic sagittal view of the geniculostriate (blue) and extrageniculostriate (orange, red) projections in the monkey brain . Brainstem and thalamic structures are depicted as transparent to visualize their position under the cortex . (b) schematic sagittal view of the thalamofugal (blue) and tectofugal (orange, red) pathways in the pigeon brain . (c, d) schematic frontal views of the forebrain and brainstem of the pigeon brain showing the thalamofugal (c) and the tectofugal (d) pathways . Note the larger right - to - left projection of the tectorotundal efferents in the tectofugal system (d). The organization of the sections in (c, d) shows all relevant components within the same plane and is not anatomically correct . Abbreviations: gld, nucleus geniculatus lateralis pars dorsalis; mt, middle temporal visual area (also v5); v1, primary visual cortex . The thalamofugal pathway corresponds to the mammalian geniculostriate system and transfers retinal information via the contralateral geniculate complex (gld) bilaterally onto the telencephalic visual wulst . The tectofugal system corresponds to the mammalian extrageniculostriate pathway and projects via the contralateral midbrain optic tectum and the thalamic nucleus rotundus to the telencephalic entopallium (manns and gntrkn, 2009). A wealth of studies has revealed connectional asymmetries in the thalamofugal and tectofugal pathways of both chicks and pigeons (rogers, 2008). For example, rajendra and rogers (1993) retrogradely traced projections from the dorsolateral anterior thalamus to the hyperpallium apicale (old nomenclature: hyperstriatum accessorium) in chicks and found that the ratio of labeled cells in the side of the thalamus contralateral to the injection site compared to the number of labeled cells in the side of the thalamus ipsilateral to the injection site was significantly greater for tracer injections in the right hemisphere compared to injections in the left hemisphere . In pigeons, the tectofugal pathway is the most important pathway for visually guided behavior . Since the optic nerve of birds is essentially crossed and since pigeons have laterally placed eyes, retinal fibers of the tectofugal system create a uni - hemispheric representation of the contralateral visual field in the midbrain tectum . From there, tectal neurons project bilaterally onto the thalamic rotundus (gntrkn et al ., 1993). Accordingly, rotundal and entopallial neurons often respond to visual stimulation from both eyes (folta et al ., 2004). However, the tectorotundal pathway has an asymmetry in its crossing component: more fibers cross from right tectum to left rotundus than from left tectum to right rotundus (gntrkn et al ., 1998). In line with the stronger bilateral input toward the left half of the brain, electrophysiological studies demonstrated that a higher number of left rotundal neurons respond to contralateral as well as ipsilateral visual input (folta et al ., 2004). Thus, the left tectofugal pathway predominantly integrates input from both eyes and possibly enables a more complete representation of the visual scenery . This assumption was tested psychophysically by gntrkn and hahmann (1999) with unilateral rotundus lesions . They demonstrated that damages to the left rotundus led to a bilateral decrease in visual acuity whereas right - sided lesions only had a minor contralateral impact . In a further study, valencia - alfonso et al . (2009) trained pigeons in a task where each eye was exposed to different color pairs . (learned with the contralateral eye) and unknown (learned ipsilaterally) colors for each hemisphere . Then, each eye / hemisphere was separately tested with a mixture of known and unknown color pairs . While discriminating known color pairs evinced no asymmetry, the left hemisphere demonstrated better performance in discriminating the unknown stimulus pair . Thus, the left hemisphere had more access to information from the ipsilateral eye than the right hemisphere . This is a strong argument for the left hemisphere having a more bilateral representation of the visual input compared to the right hemisphere . In sum, the ascending tectofugal pathway displays a neuronal organization that creates an asymmetrical representation of the visual scene at the forebrain level . This enables the left hemisphere to process and to compare visual objects irrespective of their location within the whole visual scenery . This functional asymmetry results from left to right differences of white matter projections at the junction between midbrain and thalamus . In humans, much less is known about the relation between structural asymmetries in white matter projections and functional lateralization . A first clue comes from a recent diffusion tensor tractography study (barrick et al ., 2007) in which two asymmetric white matter pathways were identified in the human brain: firstly, a rightward - asymmetric pathway connecting the posterior temporal lobe to the superior parietal lobule and secondly a leftward - asymmetric pathway connecting the parietal and frontal lobes to the temporal lobe . The authors suggest that the rightward - asymmetric pathway may be related to a rightward functional lateralization of auditory spatial attention and working memory whereas the leftward - asymmetric pathway may be related to leftward functional lateralization for language, but they did not test this assumption on a behavioral level . More direct evidence comes from a combined diffusion tensor imaging tractography and functional magnetic resonance imaging study in alcoholics and healthy controls (schulte et al ., 2010) were it was observed that white matter fiber degradation in the corpus callosum due to alcoholism leads to an attenuated pattern of functional visuo - motor asymmetries . While these studies are only a first step, they nevertheless show that, parallel to the work that has been conducted in birds, it may indeed be a promising approach to further investigate the role of structural white matter asymmetries in the human brain in order to reveal the underlying neurophysiological processes of human functional hemispheric asymmetries . Do non - genetic factors play a role in human asymmetry formation or not? For handedness, some evidence suggests so, including the frequent observation of discordant handedness in monozygotic twins (gurd, 2006), the lower incidence of left - handedness in countries where the left hand is associated with uncleanliness (zverev, 2006), the higher incidence of left - handers among individuals born in spring and ensuing months than among individuals born during the rest of the year (jones and martin, 2008) as well as parental influences on handedness (laland, 2008). For other types of functional hemispheric asymmetries, not much is known in humans . In birds, however, early ontogenetic signals have repeatedly been shown to play a crucial role for asymmetry formation and similar findings have also been reported for zebrafish (andrew et al ., 2009). Avian embryos consistently keep their head turned such that the right eye is close to the egg shell and the left eye is occluded by the body (kuo, 1932). Since breeding birds regularly turn their eggs and intermittently leave the nest, eggs are frequently exposed to light which traverses the egg shell and primarily stimulates the right eye (buschmann et al ., 2006). As a consequence, most chickens and pigeons develop right eye superiority in visual discrimination (gntrkn et al . Incubation in the dark prevents development of functional asymmetries (rogers, 1982; zappia and rogers, 1983; deng and rogers, 2002), and abolishes anatomical asymmetries within the visual pathways (manns and gntrkn, 1999). Experimentally induced embryonic bilateral light exposure creates symmetrical posthatch performance (deng and rogers, 2002). Embryonic (rogers, 1990) or posthatch (manns and gntrkn, 1999) visual stimulation of the left eye can even reverse behavioral asymmetry, in chicks and pigeons respectively . Thus, normal rearing conditions correspond to right eye stimulation, resulting in left hemisphere superiority for visual object discrimination . This population bias is not genetically determined by factors within the visual system but by the lateralized epigenetic light factor that results from the genetically determined body position . The resulting asymmetry in visual object discrimination is mediated through activity differences between left and right retinal ganglion cells . Since synaptic maturation of visual pathways is regulated by retinal activity (ruthazer and cline, 2004), transiently blocking right eye retinal activity in pigeons reverses visual asymmetry for the entire life (prior et al ., 2004). The lateralized retinal activation asymmetrically regulates tectal neurons, which in turn possibly release tectal brain derived neurotrophic factor (bdnf) asymmetrically (manns et al ., 2008). Bdnf affects synaptic transmission and controls neurite sprouting and maintenance (cohen - cory and lom, 2004). Bdnf and the signaling cascade of its high - affinity receptor trkb are asymmetrically activated in response to embryonic light stimulation (manns et al ., 2005). The small g protein p21ras is a critical molecular switch for relaying neurotrophic actions into morphological changes . Its amount within the pigeon s optic tectum depends on photic stimulation and consequently shows profound left it is likely that bdnf, trkb, and p21ras represent one of the biochemical pathways that translate a transient embryonic visual stimulation asymmetry into structural left right differences of the tectofugal system that then determine lateralized visually guided behavior for the entire lifespan of the animal . The biased embryonic photic input ignites several asymmetries (object discrimination: rogers, 1990; left right discrimination: chiandetti and vallortigara, 2009), while leaving others unaffected (visual reaction to novelty: chiandetti et al . Thus, the neuronal effects of lateralized embryonic visual stimulation only affect some of the visually guided functions . The development of visual object discrimination asymmetries in birds demonstrates that the establishment of a functional asymmetry can proceed along the same principles of synaptic plasticity that are already well known from other sensory systems . Avian visual asymmetry results from an interaction between an epigenetic event (left right differences of light stimulation) and a genetic factor (embryonic right - turn of the head; see figure 2; manns, 2006; manns and gntrkn, 2009). Sequence of relevant ontogenetic events that possibly constitute components of the development of visual asymmetry in pigeons . Note the position of the head that is turned to the right such that the right eye is positioned close to the eggshell . The resulting biased light input before hatch is translated into morphological asymmetries of ascending visual pathways that then results in left the bottom picture shows an adult pigeon wearing an eye cap and participating in a pattern discrimination task . An asymmetrical environmental stimulation is able to induce the formation of structural and physiological left it is conceivable that such a critical role of a lateralized experience is not confined to sensory systems but also applies to the development of motor asymmetries as in the case of human handedness . For example, the ability of spinally controlled motor asymmetries to influence the cerebral cortex may represent a human corollary to the avian system (ververs et al ., 1994). In this case, early spinal asymmetries could act as lateralized precursors of asymmetrical cortical motor functions (hiscock and kinsbourne, 1995). But early motor asymmetries could also shape sensorimotor circuits of hand control in a lateralized way . Like birds, humans have an early bias to turn the head to the right (ververs et al ., 1994). This early prenatal bias not only persists into adulthood (gntrkn, 2003) but also correlates with right handedness (ocklenburg and gntrkn, 2009). This relation between head position and hand use could result from a higher probability of visuo - motor coupling between gaze position and the right hand during early childhood . To test the causal nature of this link, ocklenburg et al . (2010) studied children with torticollis, a condition that causes a subtle pathological tilt of the head to the left or to the right, in combination with a contralateral rotation of face and chin . The resulting head posture leads to an increased visual experience of the hand contralateral to the head - tilt and had a strong effect on handedness . Relative to controls, children with torticollis had a higher probability of right- or left - handedness when having a head - tilt to the opposite side . Thus, early biased sensory input or motor preference could modify lateralized systems of humans . The physiological mechanism underlying this modulation may be not identical to the impact of early visual stimulation of one eye in birds . Nevertheless, these findings show that, comparable to birds, a non - genetic, experience - based factor can influence human lateralization . Which genetic factors play a role in human asymmetry formation? While there is very little doubt that handedness and language lateralization, the two most obvious examples of functional lateralization in humans, are, at least to some extent, genetically determined (corballis, 2009), the answer to this question proved to be surprisingly difficult to find . Based on indirect statistical evidence, several authors suggested a common monogenetic background for these two traits (e.g., annett, 2002). This view has repeatedly been questioned during recent years and it has been suggested that at least partly independent polygenic mechanisms for the inheritance of language lateralization and handedness exist (e.g., medland et al ., 2009; tzourio - mazoyer et al ., 2010). The biggest problem of monogenic theories of handedness and language lateralization is that, despite continuous efforts to do so, no single gene has ever been identified that explains even remotely enough variance in behavioral lateralization data to qualify for a single gene explanation . Moreover, a recent study found an effect of lrrtm1 on chromosome 2p12 (a gene that is possibly involved in neural differentiation in the brain) on handedness in a sample of dyslexic siblings, but not in a sample of healthy siblings (francks et al ., 2007). The authors therefore suggest that the effect of lrrtm1 on behavioral lateralization depends on other genetic and environmental factors in order to manifest and they concluded that handedness and brain lateralization are likely to be etiologically complex traits that are influenced by multiple genetic and environmental factors (francks et al ., 2007). This conclusion was also recently supported by a genome - wide association study that reported an association of another gene (pcsk6) with handedness in as dyslexic sample (scerri et al ., 2011). Comparative studies on the genetics of brain lateralization also indicate that it is indeed highly unlikely that handedness and brain lateralization are determined by a single gene . The most widely used vertebrate model species in research on the genetic background of hemispheric asymmetries is the zebrafish (danio rerio). The epithalamus of the zebrafish, a brain region consisting of the left and right habenula as well as the medial pineal organ and the parapineal organ, shows pronounced structural hemispheric asymmetries regarding its neuronal organization (dadda et al ., 2010b). Most notably, the parapineal organ lies to the left of the pineal organ in most individuals (see figure 3). Leftward asymmetry of the parapineal organ in a zebrafish made visible by green fluorescent protein expression in a transgenic tg(foxd3:gfp)zf15 zebrafish (modified from dadda et al ., 2010b). These epithalamic asymmetries are regulated by several genes in the nodal signaling pathway with the exact mechanisms having been reviewed elsewhere (snelson and gamse, 2009; taylor et al ., 2010; roussign et al ., interestingly, when nodal genes are not expressed at all, epithalamic asymmetries are not absent, but their direction is determined at random (concha et al ., 2000). This shows that nodal genes only determine the direction of asymmetries but not their initial establishment (concha et al ., 2000), possibly indicating that another signaling pathway is relevant for initial symmetry breaking . Recently, several studies have reported a link between the genetically controlled structural asymmetry in the zebrafish epithalamus and functional lateralization . For example, the commonly observed reversal of heart, gut, and structural diencephalic asymmetries in the frequent - situs - inversus (fsi) line of zebrafish is related to a reversal of functional asymmetries in several behavioral laterality tests, including mirror viewing and approaching a target to bite (barth et al ., 2005). These findings suggest that at least two different genetic mechanisms influence different forms of functional lateralization in the zebrafish (barth et al ., 2005). More recently, it has been reported that zebrafishes with a left or right parapineal organ show significant differences in several behavioral laterality tests, including eye preference for viewing their own reflection, eye use in predator inspection, rotational preference, and turning direction in the dark (dadda et al ., 2010b), indicating a clear link between structural and functional asymmetry . Apart from zebrafish, similar findings regarding habenular and behavioral asymmetry have also been observed in two different cichlid species (reddon et al . Not much is known about the relation of epithalamus structure and functional lateralization in humans, and human functional asymmetries are most likely driven by different genetic mechanisms . However, functional hemispheric lateralization is a conserved feature of the central nervous system in vertebrates (vallortigara et al ., 1999; vallortigara and rogers, 2005; bianco et al ., 2008) and, as such, the findings in the zebrafish could possibly help to understand why no single gene determining handedness and language lateralization in humans has been found yet . From a comparative point of view, it is highly questionable that a trait like brain asymmetry which is determined by two complex polygenic signaling pathways in one vertebrate species is determined by only a single gene in another vertebrate species . Thus, when viewing lateralization in h. sapiens from this perspective, it becomes clear that it is necessary to develop polygenic instead of monogenic theories for its ontogenesis . Particularly, the idea that two different signaling pathways may control for the initial establishment and direction of asymmetries could fundamentally change theoretical approaches to asymmetry formation in humans . Comparative approaches have greatly enhanced our understanding of several different human cognitive domains (de waal and ferrari, 2010; haun et al ., 2010). In line with these scientific success stories, comparative neuroscience also allows for unique insights into ontogenetic and phylogenetic processes responsible for human brain lateralization . These insights, however, are only parts of the whole story and it becomes increasingly clear that we are still far away from having a complete understanding of the complex interactions of non - genetic and genetic factors that underlie the neurophysiological processes that drive human functional hemispheric asymmetries . Genetic and neuroscientific methods are rapidly advancing but we need to integrate the resulting insights into a broader comparative schema . To this end, it is fundamentally important to understand that human lateralization is not unique, but a trait that is shared with a multitude of other vertebrates . The idea of human exceptionalism had and still has a strong impact on lateralization research . Only by abandoning this approach and viewing h. sapiens as one vertebrate species among many, we will be able to solve the riddle of functional hemispheric asymmetries in humans and other animals . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
The 2 huvec cell lines used in the study were derived from male caucasian donors genotyped as heterozygotes for the 9p21 cad associated snps . The 4 ebv transformed lymphoblastoid cell lines (lcl) were selected for their genotypes (2 homozygous cad risk or 2 homozygous cad non - risk) using the hapmap data27 . Experiments were performed within 24 passages by treating cells with 100 ng / ml of ifn (r&d) for 24 hrs . Treated and untreated cells were subjected to rt - pcr (huvec), chip (huvec and lcl), 3c analysis (huvec) or fish (huvec). Probe design: we designed 12 acceptor probes in the interval chr9:22100523 - 22126469 (hg18; spanning from ecad7 to the et2d2 enhancer), on both strands immediately 3 of the 6 bamhi sites in the region . We designed 290 donor probes on both strands immediately 5 of the 145 bamhi sites in the interval chr9:21035934 - 22494089 (hg18; except where acceptor probes were designed). A universal sequence added to the probes is compatible with illumina ga adapters for direct sequencing . The 12 acceptor probes and 290 donor probes (supplemental table 8) were pooled in equimolar amounts, separately . 3d - dsl sequencing: the dsl ligation products were prepared as described in kwon et al.23 . 3c was performed as per lieberman - aiden et al 28 and the products were sheared by sonication . Donor and acceptor probes pools were annealed to the biotinylated 3c samples and the biotinated dna was bound on to streptavidin magnetic beads . The 5 phosphate of acceptor probes and 3 oh of donor probes were ligated using taq dna ligase . The ligated products were washed and eluted from the streptavidin magnetic beads, followed by pcr amplification and deep sequencing on the illumina ga2 (supplemental information). The 2 huvec cell lines used in the study were derived from male caucasian donors genotyped as heterozygotes for the 9p21 cad associated snps . The 4 ebv transformed lymphoblastoid cell lines (lcl) were selected for their genotypes (2 homozygous cad risk or 2 homozygous cad non - risk) using the hapmap data27 . Experiments were performed within 24 passages by treating cells with 100 ng / ml of ifn (r&d) for 24 hrs . Treated and untreated cells were subjected to rt - pcr (huvec), chip (huvec and lcl), 3c analysis (huvec) or fish (huvec). Probe design: we designed 12 acceptor probes in the interval chr9:22100523 - 22126469 (hg18; spanning from ecad7 to the et2d2 enhancer), on both strands immediately 3 of the 6 bamhi sites in the region . We designed 290 donor probes on both strands immediately 5 of the 145 bamhi sites in the interval chr9:21035934 - 22494089 (hg18; except where acceptor probes were designed). A universal sequence added to the probes is compatible with illumina ga adapters for direct sequencing . The 12 acceptor probes and 290 donor probes (supplemental table 8) were pooled in equimolar amounts, separately . 3d - dsl sequencing: the dsl ligation products were prepared as described in kwon et al.23 . 3c was performed as per lieberman - aiden et al 28 and the products were sheared by sonication . Donor and acceptor probes pools were annealed to the biotinylated 3c samples and the biotinated dna was bound on to streptavidin magnetic beads . The ligated products were washed and eluted from the streptavidin magnetic beads, followed by pcr amplification and deep sequencing on the illumina ga2 (supplemental information).
|
This assistant could be taught the uses of the appropriate pills for the treatment of the major fevers, dysentery and high altitude headaches . Besides assisting the party home, it would slowly diminish the deep - rooted superstitions that exist in the home villages, wrote new zealand mountaineer norman hardie in his account of the several months in 1955 that he spent living among the sherpas of the mt everest region of nepal.1 european travellers, and the routes taken, have had a considerable influence on the introduction and spread of modern medicine in many parts of the himalayan region, and hardie was under no illusion about the importance of the appropriate pills for treating sickness and also for promoting this new system of medicine to the inhabitants of the area.2 while it can be argued that such a comment about the importance of medicines was not surprising in the 1950s, when the discovery and introduction of many new medicines (and particularly antibiotics) were revolutionising medical treatment, especially for infectious diseases, twenty years earlier, lieutenant - colonel f.m . Bailey, in his report from the british legation in the nepalese capital of kathmandu to the foreign office in london, wrote that a large number of pensioners come in from the surrounding areas they make use of the opportunity of obtaining medicines from the legation hospital.3 earlier still, the indian explorer hari ram travelled through the everest area for the survey of india in 1885 . Baid [physician] and carried with him a stock of european and native medicines.4 even if hari ram had more native medicines than european ones, the carrying of medicines was normal practice and they were intended for giving out to the local population.5 medicines are a key tool in the prevention and treatment of sickness, but, although interest in medicines is increasing in the literature, their central role in the introduction and spread of modern medicine in the late nineteenth and twentieth centuries, apart from vaccination, has been given inadequate attention in histories of medicine . Yet, as michael worboys notes, medicines more readily transferred across cultures than other features of western medicine.6 while medicines are viewed as part of the material culture of empire,7 historical studies about the introduction and spread of modern medicine more commonly examine knowledge, power, disease, institutions and people . Alex mckay, in his study of the development of modern medicine in the himalayan region, focuses on the political environment in british india and the conversion strategy of christian missionaries.8 references to medicines are scattered throughout the text and allude to their important role in the introduction and spread of modern medicine in the region . Kennedy of the indian medical service, who was travelling in bhutan in 1910, which records that one gained the impression that they had great faith in our english medicines.9 nevertheless, an appreciation of their significant role is implicit in the text rather than explicit . Similarly, in my recent study about khunde hospital and the mt everest area, the presence of adequate medicines to provide health services is assumed and medicines are otherwise viewed as a supply issue by hospital staff.10 a much richer source of literature about medicines is the many anthropological studies that have been undertaken, particularly since the growth of the specialised field of medical anthropology since the 1970s.11 leading medical anthropologist mark nichter has written recently that indeed, i do not think it an overstatement to say that explanatory models of pharmaceuticals have proven just as important as explanatory models of illness . Of even more importance is the interactivity of explanatory models of illness and medicines.12 within the everest area, however, despite the considerable activity of anthropologists since the 1950s, there are no specific studies about medicines and the sherpa.13 in her doctoral thesis, sherry ortner discussed different types of medicines in sherpa culture and linked them to some of the meanings of food symbolism, seeing medicines as super - food because they had the ability to create health from illness.14 john draper has examined the complexities of choice and health - seeking behaviour among sherpas, but in this study, as in other research, references to medicines and medicines of different medical systems are scattered throughout the text.15 mckay notes two other forces as relevant to the discussion about the introduction and spread of modern medicine in the wider himalayan region . These are trade and the influence of european travellers, and both could spread the influence of modern medicine beyond official efforts.16 although the everest area is on a long - distance route and sherpas travelled, trade was not an important aspect of the introduction and spread of modern medicine in the region; however, the influence of european travellers, as the initial quote suggests, was . The everest area provides a case study to examine the neglected role of medicines in this process and also serves to highlight the significant contribution of travellers . While i make some reference to individual medicines, the emphasis in this article is on considering medicines more generally, issues and context . Visitors carried medicines to treat themselves, employees and the people of the areas through which they travelled . In the great majority of instances, the care provided by travellers was short - term, and mckay uses this point to distinguish the role of travellers from those of government and missionaries.17 in the everest area, however, the region s most famous western traveller, new zealand mountaineer sir edmund hillary, turned his initial short - term involvement into a long - term one . The second part of the article discusses medicines and khunde hospital, which was built by hillary in 1966 and became the main source of medicines for people living in or travelling through the area . While this article focuses on biomedical products, modern medicine, as elsewhere in the wider himalayan region, continued to be practised within a changing but plural medical environment . In 1955, norman hardie was part of a british mountaineering expedition that made the successful first ascent of mt kangchenjunga, the world s third highest mountain . Wanting to learn about the sherpa, who by this period had become an integral and celebrated part of himalayan climbing expeditions, he journeyed on foot through the mountains to their home villages in the everest area . While european visitors were part of a long tradition of travel in the himalayan region, hardie was one of the early western travellers to approach everest from the southern, nepalese side of the mountain, as the nepalese government had only allowed the first western visitors into khumbu (the sherpa name for the area) in 1950 . Although nepal may have been a generally friendly neighbour to british rule in india, it had largely retained its independence and kept out its more powerful neighbour and other westerners, despite the presence of a british residency in kathmandu.18 early attempts to climb mt everest were made from the northern side via tibet, but as china intensified its presence in tibet from 1950, and with the withdrawal of the british from india after independence in 1947, the nepalese government responded to the changed political climate in the region and began to pursue a less isolationist policy towards western countries.19 although few western personnel had been allowed to visit nepal, such exclusion did not preclude the entry of western goods or ideas about modernisation . From the late nineteenth century, european medicine slowly expanded within nepal and was promoted by the government along with rather than instead of ayurvedic medicine . Services and personnel were limited for either system, but medicines had a wider reach . Hemang dixit, in the third edition of his useful and ongoing history of health services in nepal, writes that to make medicines more freely available the chandra sale dispensary was set up at bir hospital in kathmandu in 1917.20 many of the personnel at the hospital were recruited from india, and specimen signatures of the medical practitioners were kept at the dispensary to prevent the misuse of drugs . Dixit also refers to the speech of colonel kishore narsingh rana at the opening of the military hospital in 1926 . He spoke of how maharaja chandra shumsher, the ruler of nepal, had established several allopathic dispensaries in populous areas of the hills and terai, but in remote areas he has arranged to start many ayurvedic pharmacies where up to now the nostrum from village quacks was all the medical help available to the people.21 chandra shumsher also opened ayurvedic schools to provide trained men for those pharmacies. By the time the number of western visitors to nepal increased in the 1950s, people throughout the country had heard about allopathic medicine even if they had little access to its treatments . As in bhutan, christian missionaries were not allowed into nepal, but in 1952, the nepal evangelistic band, which was based at nautanwa close to india s border with nepal, received permission from the nepalese government to set up a hospital in the pokhara valley.22 dr lily ohanlon described their journey as the small group walked through the hills with porter - loads of medicines and equipment . He declined the surgical help that the group thought the baby needed . Just a little medicine and it will be all right . I have heard much about your medicine and how good it is.23 prior to the 1950s, sherpas living in their home area of khumbu had little access to modern healthcare or its medicines, and none on a regular or long - term basis . The sherpa are ethnically tibetan and first came over the mountain passes and settled in the high valleys in the early sixteenth century . Approximately three thousand of them lived in a series of villages.24 like other remote areas, government services in the mt everest region were very limited . Nepal, along with other countries in south asia, was developing a state - funded health service, but no government health services were as yet established in the everest region . Located near nepal s northern border, the area was also far from the christian missions that were to be found to the south in india and that some nepalese accessed.25 in the 1950s, a military check - post was situated at namche bazar, the administrative centre of the everest area, but the nepalese military had no significant involvement in providing healthcare to local people . A long - distance trade route between northern india and tibet passed through the region, with the sherpa holding a monopoly along the everest section . Nevertheless, while sherpas travelled extensively for trade and religious purposes, they appear to have carried and purchased while away traditional medicines.26 khumbu was a centre where medicinal and aromatic plants grew, but their local use was limited . Geographer stanley stevens refers to some families collecting medicinal mountain herbs such as hugling in khumbu and adjacent regions, which they took south to the terai or further on to india to sell.27 they then bought grain for use back home, for buying trade goods to sell in tibet or to barter for salt or wool . Anthropologist john draper has suggested that sherpas were not as entrepreneurial as might first appear . When hugling [huling] became highly sought after by indian traders around the early 1960s, sherpas rapidly over - harvested the herb, over - supplied the market and sold it at low prices in competition with each other.28 new forms of transport, with the construction of an airstrip at lukla in 1964, facilitated the distribution of medicinal plants . Louise hillary, wife of sir edmund, wrote at the end of 1966 how they came across a group of sherpas carefully packing a root into large baskets . The root was so precious that the owners were willing to have six baskets of it flown to katmandu at considerable cost.29 at first, the group was unwilling to say what it was or its use, but eventually she found that the root was to be sold in india for use in making a cough mixture. The people s appearance of being secretive and embarrassed was perhaps not surprising as she had just come from the opening of a small new hospital at khunde . Dr lhakpa norbu sherpa refers to plants being harvested in khumbu and then sent to tibet for processing.30 when tibetan demand declined, khumbu people stopped collecting the plants . The later rise of tourism in the everest area provided an alternative source of income, but the collection of plants also became prohibited because of the area's national park status from 1976 . While sherpas inhabit a world that is full of supernatural beings that are considered to be dangerous if offended or ignored, these can be appeased through appropriate measures.31 sherpas employ a number of strategies to deal with sickness, including prevention, self - help or consulting a lama or lhawa [spirit medium]. Finding out the cause takes precedence over dealing with the symptoms, although the perceived severity can influence whether or not the patient or family sought assistance . Draper has argued that while individuals do seek to choose appropriate healers, their choices are constrained by the structure of knowledge power relations to be found in sherpa society.32 among sherpas of the lower solu region where she carried out her research in the 1960s, ortner described three types of medicines: western medicines, folk medicines and religious medicines . Folk medicines referred to medicines found and/or made by laymen for their own use, without the assistance of religious or curing specialists.33 particularly popular were medicines to cure poisoning . Religious medicines referred to medicines made by a lama from instructions in the religious books . These medicines might be a charm printed on paper and generally not edible, or a medicine to eat compounded from medicinal plants and herbs and generally made to order for a specific person and their complaint.34 in khumbu, some medicines were regarded as more preventive and not really medicine.35 small red or brown / black pills were beneficial for everything and helped a person keep healthy . Sherpas in the everest area also had another option for obtaining medicines the use of an amchi, a practitioner of tibetan medicine . Oral sources, indicate that prior to 1950, however, there were no amchi there on a permanent basis.36 apart from an occasional visitor, such as hari ram in 1885, who endeavoured to ingratiate himself with the inhabitants by treating their sick,37 sherpas had to travel outside the area if they wanted to obtain allopathic medicines . The rinpoche [reincarnate lama] at tengboche monastery, the leading monastery in the area, recalled that when he was about six years old he was taken to kathmandu to have a smallpox vaccination.38 some sherpas travelled to darjeeling to look for employment with the climbing expeditions, and these often carried an extensive range of medical supplies.39 renowned british climber eric shipton described the struggles of the 1933 mount everest expedition to keep fit and healthy . The valiant efforts of the doctors had little effect . We consumed enormous quantities of anti - septic tablets and were forever gargling and dousing our noses . Nor were the sherpas exempt.40 in another account, fellow expedition member frank smythe recounted how dr raymond greene had to anaesthetise lobsang with chloroform to set a broken collar bone, that lobsang s heart stopped soon after he became unconscious, but that he was given an injection of coramine and the heart started to work again.41 while references to medicines are scattered in the texts, one medicine that is mentioned specifically in a number of travellers accounts is medicine to combat malaria . Ralph izzard, a reporter for the british newspaper the daily mail, was sent to cover the 1953 everest expedition in competition with the times, which had copyright to the expedition's dispatches . He wrote how medical supplies i purchased in abundance not so much for myself (i was only to use paludrine) but to patch up the coolies when necessary .42 hardie wrote that the sherpas are well aware of the value of paludrine, and they always ask for their ration if someone has forgotten to issue it. He continued that although they frequently go out to darjeeling to sell equipment given to them by expeditions, i have never heard of a man selling his precious paludrines.43 the situation began to change in the 1950s and 1960s with the arrival of different groups of western visitors into khumbu . Europeans travelling through the wilderness, as izzard wrote, are expected to administer a pill or a plaster to all who happen to need them whom he may meet by the way.44 not all the visitors to khumbu were associated with climbing expeditions . Anthropologist christoph von frer - haimendorf wrote in 1963 about his wife elizabeth, who accompanied him on his travels, that to many she endeared herself also by ministering to their medical needs, and their faith in her remedies enabled her to achieve several notable cures.45 nevertheless, while the number of visitors to the everest area rose during the 1950s and 1960s and increased local people's access to such medical practice, the numbers were still small . In 1964, only twenty outsiders visited khumbu.46 while on an expedition, sick sherpas were treated with western medicines and procedures, and some sherpas assisted the western doctors . They acquired new knowledge that could then be brought back home, but once back in khumbu they usually did not have the medicines to prove their effectiveness . Sherpas, however, sometimes received medicines from expeditions for use at a later date . Hardie wrote about a group of expedition sherpas returning from the lower indian altitudes who carried supplies to cover a number of ills.47 this group experienced only minor problems, but among another group of nine, who had no medicines and had begun walking home in the monsoon when the risk of sickness increased, five died.48 in the early 1960s, in an example that shows indigenous people taking an active role in spreading modern medicine, the teachers from a school that hillary built at khumjung began going up to everest base camp and approaching expeditions for medicines.49 they then returned to the village, and from their living quarters, provided treatment for the local people . By this time, hillary s involvement with the inhabitants of the everest area was beginning to change its focus . Although initially hillary had thought that the school he had built at the end of his himalayan scientific and mountaineering expedition in 1961 would be a one - off project, it was instead to become the start of an ongoing aid programme.50 education was the main thrust of hillary's early involvement, but he also believed that western medicine could help the sherpa . In the everest area most people s first experience of modern medicine was vaccination during the 1963 smallpox epidemic . New zealand medical student michael gill noted in 1961 that while some smallpox vaccination was carried out by a united nations doctor at approximately 5-yearly intervals, most of the population was unprotected.51 hillary knew that the disease might be a problem during his himalayan schoolhouse expedition because the american mount everest expedition had reported a case.52 hillary s expedition came across other cases and deaths, and fear of the disease grew amongst the local population who began asking for help . Hillary resolved that a vaccination programme had to become a major part of the expedition . At namche bazar he discussed the situation with the check - post captain who had a radio.53 hillary sent a message to kathmandu requesting a supply of vaccine which, with unprecedented alacrity, arrived two days later on a swiss red cross plane.54 the disease was spreading rapidly . Members of the expedition immediately began vaccinating villagers and eventually were to give over seven thousand vaccinations throughout the district . Hillary later wrote that of all the expedition's activities the one most widely appreciated was undoubtedly the vaccination, and this hadn't been part of my original plans.55 on this occasion, the nepalese authorities in kathmandu also appreciated hillary s efforts.56 not everyone, however, was enthusiastic . Gill s account in 1963 of an encounter with the epidemic illustrates the power vested in the physical presence of a medicine . Even allowing for the writer s sense of the dramatic making a good story the medicine was something that people could see and could be more powerful than words . I opened an ampoule of vaccine and showed on my arm the sore where i had recently been revaccinated.57 the medicine, here in the form of a vaccine, represented the whole system of modern medicine . They will take your medicine if the head lama gives it his blessing.58 acceptance of smallpox vaccination was voluntary and appeared to be a matter for individual choice . The sherpa were buddhist, but even the religious adopted different strategies . While the rinpoche at tengboche was vaccinated as a child, at the village of thamo the lama and monks who had recently arrived from tibet declined the offer of a vaccination from hillary's expedition . They said that it would show lack of faith with their own powers to deal with the disease.59 none of the group died . As hillary was impressed, then it was also likely that other people in the area would have felt the same way . The additional fact that a woman died, who had been vaccinated a few days earlier, added to the weight of evidence against vaccination . That probably she had already contracted the disease when she was vaccinated, and so the vaccine would not have been effective, was not an appropriate sherpa explanation . They believed the vaccine had killed her.60 expedition medical practice was, in general, a response to the lack of modern medical services in such regions and inherently a short - term measure . Usually, the expedition would see a patient, treat and move on, not knowing whether or not the person recovered . Hillary wanted to go beyond this type of response to medical problems among local populations . He set up a clinic which provided services for six months, but by the end of 1963 he was talking to authorities in nepal and new zealand about the possibility of establishing a small hospital . In 1966, having received approval from the nepalese government and having raised the funds privately, hillary built a small hospital in the village of khunde.61 this soon became the main provider of health services in the area . The opening of khunde hospital was a major development for local people in terms of medicines and health services as both of these now became available on a year - round basis.62 the main single - storey building contained a one - room clinic in which most examinations, investigations and treatments were carried out and where patients received their medicines from the hospital medical staff.63 although the hospital has always had in - patient facilities, most people continue to be seen and treated as out - patients for a wide range of curative and preventive health services . This discussion of medicines and khunde hospital will be framed around a series of relationships that hospital staff had with the community, the government and overseas visitors . These have profoundly affected the spread of modern medicine in the region . In the 1960s nepal had few doctors or other trained health workers and so the nepalese government gave hillary permission to bring in foreign medical staff . They were volunteers who went to work and live at khunde for around two years and trained local staff to help them . The initial assumption of the overseas staff was that once people saw the superiority of their ian harper has suggested that the foreignness of the united mission to nepal hospital, which was established at tansen in 1954 in palpa district, south - west of kathmandu, gave it authority over local traditions and that this applied to both doctors and the medicines.64 the evidence from khunde suggests a somewhat different story . Initial curiosity brought crowds of people to the opening of the hospital and in the first three months of 1967, dr john mckinnon, the hospital s first doctor, treated 722 patients.65 he was optimistic for the future of the hospital, but six months later, when he reviewed khunde hospital's first nine months of working in the area, he also wrote of the mixed response to modern medicine.66 the total of 1,924 people who attended the hospital for treatment during 1967 was smaller than expected.67 mckinnon remained optimistic, believing that attitudes towards using the hospital had begun to change . He wrote that the passage of several years, with exposure to modern medical practice and local publication of therapeutic successes will lead to even greater acceptance.68 medical practice at khunde hospital held many challenges for the volunteers from new zealand who had mostly only recently qualified . Away from the environment of medical school and teaching hospital in dunedin the doctors had limited resources and support . In the case of medicines, they found they had to think about some basic issues and had to adapt their prescribing and dispensing . Dr richard and lesley evans succeeded the mckinnons in 1968 . In a letter for radio in new zealand, lesley wrote: the more ordinary things of life cannot be taken for granted . Most people havent got a teaspoon at home; if they have to measure a baby s cough syrup, we give them one of the few plastic ones that come in the drug packets, and ask the mother to bring it back when she has finished . Not many people know the names of the days of the week; very few people use them . Is medicine for 20 days. One cannot instruct a patient to take his tablets at 8, 12, 4 and 8 oclock . You must say take one morning, noon, afternoon and night, and hope that their ideas of noon and afternoon are not too close together.69 the more ordinary things of life cannot be taken for granted . Most people havent got a teaspoon at home; if they have to measure a baby s cough syrup, we give them one of the few plastic ones that come in the drug packets, and ask the mother to bring it back when she has finished . Not many people know the names of the days of the week; very few people use them . Is medicine for 20 days. One cannot instruct a patient to take his tablets at 8, 12, 4 and 8 oclock . You must say take one morning, noon, afternoon and night, and hope that their ideas of noon and afternoon are not too close together.69 for patients, too, the situation was initially strange . People decided whether or not to use the hospital, but nima yangen, the hospital s first nurse - assistant, described how people answered questions and had examinations just because they had to rather than because they thought such knowledge was important.70 as has been found elsewhere in the himalayan region, understanding a biomedical model was not necessary for acceptance of health interventions.71 also different for patients was that in their traditional healing practices sherpas ingested little, compared with the role of medicines at the hospital, since people were reluctant to use something for which they did not know the ingredients.72 although khunde hospital treated an increasing number of patients annually, either as out - patients or in - patients, and people became more familiar with the way the hospital functioned, their use of the hospital was pragmatic and selective based on people s perceptions of efficacy and whether using the hospital was the appropriate course of action.73 people retained a spirit - based system of disease aetiology and continued with other practices when sick . People could come to the hospital and receive medicine while still going to other healers.74 western medicine was seen to treat the symptoms rather than the cause and so the different medical systems were seen to have varying areas of effectiveness . Martin gaenszle similarly describes how the mehawang rai of east nepal attribute western medicine to work on a physical level and the shaman on a metaphysical level.75 the two were not contradictory . To nima yangen, people began to use the khunde hospital more for two reasons . Along with procedures such as extracting teeth, which freed people from pain, medicines were an important part of these therapeutic successes . Many came for eye ointment for reasons associated with the smoky rooms of their houses.76 cooking was done on open fires in the main room of the house, but windows were small, because of the cold and lack of glass, and there were no chimneys to extract the smoke . This contributed to other problems; the out - patient register shows that much of mckinnon s medical practice was dealing with respiratory infections.77 other common medical problems were worms and impetigo . As lesley evans wrote in her diary during the walk into khunde: we saw awful impetigo on two children in tonight s surgery . [] but gosh, how speedily infections get better . The underlying importance of medicines in treatment and people s use of the hospital is further signified by their lack of enthusiasm for surgery . Although mckinnon had carried out a number of procedures, such as skin grafting for burns cases, and had seen acute surgical cases, all patients have refused hospitalisation when seriously ill because of their great fear of dying away from home.79 the second reason that people began to use the hospital more was that when people travelled to kathmandu they found that medicines were expensive to buy . To make healthcare affordable and accessible, if a medicine was free, then it must be no good.80 during her fieldwork, ortner visited the mckinnons at khunde hospital and obtained some medicines, but when she returned to solu and gave these out, many people insisted on paying for them as otherwise they would not be effective.81 more recently, a focus - group study on health post - usage in taplejung in north - east nepal also concluded that the idea of a regular supply of medicines at a supposedly affordable fee would in itself increase attendance has been shown to be erroneous.82 other factors, such as community attitudes, also needed to be taken into consideration . Services and medicines at khunde hospital remained free for local people until 1982 . At a meeting of the kunde hospital board in april, which was attended by hillary and the senior government official in namche bazar, it was agreed to introduce a one - rupee charge for each course of medicine and that the funds obtained through this fee were to be used to buy more.83 consultations remained free . Although imposing a fee was permitted under the terms of the agreement between the trust and the nepalese government, and hillary s other hospital at phaphlu had such a charge, the decision was not popular in the everest area.84 a further meeting took place on 10 september, but the charge was retained.85 while the number of patient attendances at khunde hospital dropped during the following year, the increase in numbers resumed in 1984 and has continued to do so, despite increases to the patient fee.86 from the start, mckinnon visited other villages, and this also gave him the opportunity to reach people who perhaps would not go to the hospital.87 he also began to develop services closer to where people lived to encourage patients with tuberculosis to continue medication on a long - term basis . After three months of daily treatment at the hospital, tuberculosis patients returned home to their villages, but still required twice - weekly streptomycin injections and isoniazid tablets for eighteen months to two years . Some villages in khumbu were up to five - hours walk from the hospital, and the journey could take much longer when a person was sick.88 the requirement to come to the hospital for treatment so frequently was a major disruption in people's lives and people could not afford to spend long periods of time away from their homes or work . Mckinnon began to train a young man from each of the main villages to give treatment in a patient s home.89 by may 1968 there were forty - three patients receiving their treatment in this way.90 nevertheless, in 1970, doctors selwyn and ann lang reported that, of eighty - five cases diagnosed with tuberculosis since 1967, twenty - three have discontinued therapy against advice.91 although the tuberculosis treatment regimen later became shorter, non - completion continued to be an issue for hospital staff . From 1970, the doctors began to use teachers from the local schools as hospital assistants . As well as being taught to administer the necessary drugs prescribed to people receiving tuberculosis treatment, they had a simple medical kit to treat patients who came to them with minor complaints.92 a supply of basic medicines has remained central to khunde hospital s village health worker services and contrasted with the government s community health volunteer scheme that was introduced in the mid-1970s and was always short of supplies.93 villagers in khumbu did not expect too much from these village health workers and often went directly to the hospital for more serious problems . Whether medicines were obtained from the village health workers or from hospital staff, positive and negative responses to the medicines played a key role in people s use and non - use of health services . A number of studies from other societies have documented and offered interpretations for the popularity of injections, but in khumbu, the response to medicines administered by injection was mixed.94 iodised oil injections for goitre were one of the most popular treatments amongst the sherpas wrote evans in his report to dr das, the director of the department of health, in 1969.95 people who missed out saw the dramatic effects and a steady stream present at the hospital for injections. In this instance, injections were not regarded as a problem, but the hospital s annual report in 1984 referred to the perennial problem of injections being blamed for people s death.96 the doctors continued, unfortunately sick people frequently need drips and injections and sick people have a high chance of dying . It is difficult to get around the problem. Unfortunately, this also had a negative effect on the hospital s vaccination programme . As the doctor was about to vaccinate a child in one village, the mother of another child interjected, injections kill babies.97 this was a reference to an incident four years earlier when a baby died of anaphylaxis following a penicillin injection . Not until 1997 could hospital staff report a great success in this village.98 having an adequate and reliable supply of medicines has been a cornerstone for khunde hospital . Both staff and patients expected the hospital to have medicines, unlike the government health post at namche bazar . Hillary's dealings with khunde hospital show that from the beginning, and throughout, he treated khunde hospital as an integral part of his broader programme of assistance to the sherpa.99 this meant that despite its remote location, the hospital was able to operate within a supported environment, with a key part of this being the provision of medicines.100 although the world health organization has promoted the concept of essential medicines since the late 1970s and nepal has various essential drug lists, khunde hospital staff have not had a medicines budget and have mostly operated on the basis of exercising additionally, in a mountainous area without roads, transport costs have always been a significant item of expenditure for the hospital, as it was also for other organisations and businesses that were gradually established in the area . Although from the beginning some drugs were bought in kathmandu, most medical supplies in the early period were brought from new zealand with trust members gathering donations from drug companies and the free samples given out to general practitioners.101 despite the medicines being donated for an aid project, the nepalese government levied a tax of ten per cent on these imported drugs and medical equipment.102 gradually hospital staff worked out what medicines were most needed and the quantities . Lesley evans described that when we do the stocktaking on medicines it takes days and days, counting tablets and pessaries and cc s of drugs . We do an afternoon at a time, and we have about four more afternoons to do.103 although some supplies continued to come from new zealand, by the mid-1970s the focus had shifted to obtaining the hospital's medicines largely from within nepal, using a basic range of items from royal drugs limited in kathmandu, which in 1972 started manufacturing modern drug preparations commercially.104 another source was unicef.105 the pharmacy at the united mission to nepal (umn) shanta bhawan hospital was also helpful, but in 1976, their pharmacist had to inform staff at khunde that they could no longer purchase drugs for the hospital because their own import licence was not large enough for their own needs.106 supplies could also be bought at retail outlets in kathmandu, but these tended to be expensive.107 the trust s medical committee in new zealand would help when the hospital was unable to obtain an item from more local sources . Sometimes the availability of supplies from royal drugs was very limited, while in 1987, complicated regulations, imposed by the nepalese government after the 1986 chernobyl nuclear explosion in russia, made it difficult to order from overseas drug companies.108 obtaining medicines was a function that, because of their isolated situation, hospital staff could not handle on their own from khunde, and so the himalayan trust s kathmandu office increasingly liaised, purchased and then despatched to khunde . Khunde hospital provided the people of the everest area with a wide range of curative and preventive health services, but although initially the doctors sent six - monthly reports to the director of health, and later monthly statistics, contact with local and national government health services was limited . Less than fifty per cent of the population of nepal today has regular access to essential medicines.109 periodically, the hospital s annual report mentioned the government health clinic in namche bazar, with the most common observation relating to its regular shortage of medicines . This hindered the work that could be done by the clinic s staff, but also highlighted a major difference between the two institutions . The main obstacle to his [biru gurung] lack of functioning as a very good health worker declared the hospital s 1987/88 annual report: [i]s his lack of drugs and equipment (a recent survey of hmg health clinics confirmed that most still only receive supplies for 3 to 6 months of each year). We have given him a few of the basics and he has managed to get hold of some trekker left overs, but this is not really satisfactory.110 [i]s his lack of drugs and equipment (a recent survey of hmg health clinics confirmed that most still only receive supplies for 3 to 6 months of each year). We have given him a few of the basics and he has managed to get hold of some trekker left overs, but this is not really satisfactory.110 hospital staff had more contact with the government regarding preventive health services as its own preventive health programmes became increasingly aligned with those of the government . Most of the medicines for the government s vaccination and family planning programmes, as well as tuberculosis and leprosy treatment, came from international aid sources . We are greatly indebted to unicef for the supply of anti - tuberculous drugs through the tb control centre; they have supplied the hospital with lipiodised oil used in the iodination programme, and various other basic drugs.111 over the next couple of years, staff increasingly found that they were directed to go through the government programme.112 with increasing decentralisation of health services to district level from the 1980s, staff at khunde also began to deal more with government staff at salleri and phaphlu hospital . For those at khunde, the relationship centred on ensuring an adequate supply of medicines for the different programmes . The annual report in 1991/92 commented that contraceptive supplies have been a bit of a sore point over the past year . The bureaucracy has intensified and each month there seemed to be another form to fill in before supplies would be given.113 following correspondence and a visit from an official from salleri things were finally sorted out . The situation still remains cumbersome but at least we now know what we are meant to do! This focus on ensuring an adequate supply has continued, remaining at the centre of the hospital s relationship with the government and essential for enabling staff at khunde to provide these services . While visitors were instrumental in the initial establishment of health services in the region, they have continued to have a major influence on medicines and medicines use . This has been accentuated by the great expansion of tourism in the everest region where the number of visitors has risen from twenty in 1964 to 28,899 in 2008/09.114 tourists, whether they travel as individuals or in groups, carry medicines since sickness is common; they consume these medicines and other medicines if they seek help from a health facility; and tourists give out medicines to local people who approach them for treatment or they donate to a health facility . All these aspects have been important for khunde hospital and contribute to the distinct features of the introduction and spread of modern medicine in the everest region . The presence of visitors in the everest area has contributed to a considerable range and quantity of medicines being widely available in the community . Medicines brought in by tourists could both complicate the work of hospital staff who focused on providing basic medicines and primary health care, and could also assist by increasing hospital supplies with little or no extra cost . In his annual report in 1976 dr rob riley wrote that: it has been said that the upper khumbu is now the most over medicated area in nepal . With the massive influx of tourists and expeditions every year there are large numbers of doctors passing through the area, all carrying extensive medical kits which often contain some of the world s most expensive medicines! It has been said that the upper khumbu is now the most over medicated area in nepal . With the massive influx of tourists and expeditions every year there are large numbers of doctors passing through the area, all carrying extensive medical kits which often contain some of the world s most expensive medicines! A little later in the report he continued: no one can blame an itinerant doctor for offering treatment to sick people seen along the path as he feels it is his duty, but for the sherpa people, to receive pills and potions from so many avenues without proper assessment and certainly no follow up, may make them happy in the short term but is far from providing long term, comprehensive and continuing medical care.115 trekker medicine,116 as it came to be called, continues to be a factor, but thirty years later, despite much larger visitor numbers, the development of the area and the arrival of other health providers, the hospital s position in khumbu is well established, staff have become accustomed to change and the level of communication in the area has improved . No one can blame an itinerant doctor for offering treatment to sick people seen along the path as he feels it is his duty, but for the sherpa people, to receive pills and potions from so many avenues without proper assessment and certainly no follow up, may make them happy in the short term but is far from providing long term, comprehensive and continuing medical care.115 for the hospital, however, visitors have provided an important avenue for donations of medicines . Despite his reservations about visitors and medicines, riley, in the same report, mentioned that the hospital received medicines from ten large and many small trekking groups, the british army and the japanese lhotse expedition . He also noted that the two british doctors at the pheriche aid post passed on a lot of surplus medicines that trekkers would be unlikely to need.117 over the years, while some visitors brought medicines or equipment that supplemented the basic range stocked at the hospital, others brought items specifically requested by the overseas volunteer doctors . The annual report for 1993/94 commented that more people were contacting the hospital to ask what would be useful.118 related to the desirability of having donations, was the quality of medicines . The hospital s doctors in the 1987/88 annual report wrote that: financial reasons were not the only reason for actively courting these gifts, for with all our drugs coming from the indian subcontinent and of variable standard it was very reassuring to have high quality european and american products to use for our sickest patients.119 financial reasons were not the only reason for actively courting these gifts, for with all our drugs coming from the indian subcontinent and of variable standard it was very reassuring to have high quality european and american products to use for our sickest patients.119 the system of overseas volunteers at khunde ended in 2002 when dr kami temba sherpa took charge of the hospital . The number of patients has risen and donations of medicines continue to be important, with antibiotics and analgesics being considered particularly useful.120 in recent years, for both residents and visitors, more medicines have also become available in the community as has been the case in other parts of the himalayan region . A recent study on urban and rural pakistan comments on the large number of people using medicines.121 in other parts of nepal many people obtain their medicines from medicine shops, but these have not been present in the everest area until very recently . Mohan joshi and balkrishna khakurel suggest that about ninety per cent of medicines sales in nepal occur in the private sector, and mostly through retailers without training in pharmacy.122 some general shops, especially in namche bazar, might have a few medicines for sale, but in 1995, the doctors from khunde helped set up the newly established dental clinic with a stock of basic medicines that did not require a doctor modern medicines provided through khunde hospital continued to circulate within a plural medical environment . Today in nepal, for political and registration reasons, the ancient himalayan origins of amchi medicine are emphasised.124 with some amchi living permanently in the area, their medicines also became more widely available . Recently, the development of the sacred land project, founded by and under the chairmanship of the tengboche rinpoche, aimed both to provide traditional healthcare for the community and also to cater for the large number of visitors to the area with a clinic established in namche bazar.125 initially this clinic used medicines brought in from india and had the aim of establishing medicinal herb gardens to make its own medicines . This project, however, has not worked out as intended and a tourist lodge has been built on the nursery site at deboche.126 amchi medicines are also available in namche bazar through a medicine shop, the lord buddha pharmacy.127 european travellers have had a considerable influence on the introduction and spread of modern medicine since the opening up of the everest region in 1950 . These visitors carried medicines to treat themselves, employees and the people of the areas through which they travelled . In most instances the care they provided was short - term, but while biomedical knowledge and skills were important, medicines often provided the central and visible symbol of an encounter between travellers and local people . Some sherpas came into contact with modern medicines when they travelled out of the area to work on climbing expeditions, but when they returned they no longer had access to these . Sir edmund hillary s involvement with local health problems began as the more usual short - term response, but changed to the provision of a small hospital in 1966 that quickly became khumbu s main provider of biomedical services and its medicines . Medicines continued to occupy a key role in the spread of modern medicine throughout the area, but to focus only on availability and affordability is too narrow an approach . Khunde hospital operated in a plural medical environment and people s beliefs and practices were an important factor in people s acceptance of the hospital and the healthcare it offered . From the early days, the volunteer medical staff began to train health workers and develop village - based services so that people could continue their tuberculosis medication and receive basic healthcare, both curative and preventive, and basic medicines closer to where they lived . For hospital staff, a supply of medicines was implicit in their medical practice, while their explicit concern was the need to ensure an adequate supply of medicines for their remote hospital . They also adapted their practice to how people used the hospital . Over the years the hospital aligned itself increasingly with government preventive health programmes to obtain these medicines, which mostly came from international aid sources, although in terms of medicines for personal healthcare, the hospital maintained its independence and could be more flexible . Initially, medicines at khunde hospital were free, but in 1982, charges were introduced which led to some criticism in the community . The rise of tourism, however, was underpinning the economic development of the region . With increasing numbers of visitors, more medicines circulated in the community as tourists carried medicines for their own use, but also might give these to local people, or at the end of their stay, to the hospital . Economic development also meant that local people as well as visitors could now afford to buy medicines from other outlets in the community, especially in namche bazar, or when they travelled to kathmandu . This development and expansion of tourism during the second half of the twentieth century can reinforce a belief in the modern origins of globalisation . If, however, the modern visitor in the everest area is set in a wider context of travel in the region, then the influence of the traveller becomes part of a longer and broader history that moves beyond the rise of the west and its export to the rest of the world . Travellers, whether sherpa or western, carried medicines with them, and through these medicines local people encountered the modern system of medicine, while people s experiences with different kinds of medicines influenced their use and non - use of modern healthcare . This study provides an initial discussion for the everest region, but it also suggests the need to look further into people s attitudes and practices regarding particular types of medicines, whether or not these have changed and if so, how and why . Although interest in medicines is increasing in the historical literature, it is time to acknowledge explicitly their central role in the introduction and spread of modern medicine in the late nineteenth and in the twentieth centuries and give medicines a more prominent place in discussions about the provision of healthcare.
|
Eosinophilic chronic rhinosinusitis (ecrs) has been established as a subtype of chronic rhinosinusitis (crs). It is characterized by a resistance to conventional treatment with long - term macrolides, and frequent recurrences develop unless treated by steroids.13 ecrs is common in asians . To make a diagnosis, the following must be examined: history of respiratory diseases; imaging tests of the rhinosinuses; laboratory data related to allergic reactions; and histopathological tests.3,4 only one case of ecrs has been published that was associated with optic neuropathy, although several cases with optic nerve complications in cases of allergic fungal sinusitis have been reported.5,6 we have examined a case of ecrs with optic neuropathy probably caused by compression or inflammatory invasion of the optic canal by an expansion of the inflamed tissues . Even though endoscopic surgery (ess) and steroid therapy were performed on the same day, the vision did not return . A-68-year - old man noticed a sudden loss of vision in his right eye when he woke up . He was examined in our hospital the same day and his best - corrected visual acuity (bcva) was no light perception in the right eye and 1.2 in the left eye . The pupillary light reflex was almost absent in the right eye, and a relative afferent pupillary defect was present . Fundus examination showed no optic disc edema and atrophy, and spontaneous venous pulsations were not present . The macular area was normal, and optociliary shunt vessels were not present . From the clinical findings, we suspected a retrobulbar lesion and ordered an orbital computed tomography (ct) on the same day . His history included nasal polypectomy more than 20 years earlier, and asthma that was not being treated . The ct scan also showed pan - sinusitis, multilobular nasal polyps, and a defect of the sphenoid bone (figures 1a c). The laboratory data showed no elevation of the white blood cell count, eosinophilia, and c reactive protein . We consulted an otorhinolaryngologist on the same day, and an emergency endoscopic sinus surgery (ess) was performed . Intraoperatively, the ethmoid, maxillary, and sphenoidal sinuses were filled with highly viscous mucosal fluid . In addition, several polyps were found in the nasal cavity . After excision of the polyps and thickened mucosa and drainage of the mucosal fluid, an erosion and thinning of the lateral wall of the sphenoid sinus bone and partial defects of the optic canal were found . The optic canal was cleared to try to decompress the optic nerve, and betamethasone was applied to the exposed optic nerve to try to suppress the inflammatory changes . No fungal hyphae were detected by grocott and periodic acid schiff (pas) staining (figures 2a d). Unfortunately, the right visual acuity did not improve and remained at no light perception in spite of the postoperative betamethasone (total 324 mg). Six months later, nasal polyps recurred and nasal administration of betamethasone was started and is currently being continued . The laboratory data showed an elevation of total ige and eosinophils compared to that before the surgery (before 1.2% and post - surgery 6.2%). The specific iges against candida and aspergillus were negative with the radioallergosorbent (rast) test . Chronic rhinosinusitis (crs) is a chronic inflammation of the rhinosinus mucosa and is characterized by the presence of two or more symptoms, viz ., nasal discharge, nasal obstruction, post - nasal drip, and reduction or loss of the sense of smell . The diagnosis of crs is made by the signs and symptoms that remain for longer than 3 months and opacification of the sinus in x - ray and ct images . Although crs is common, its subclassification, pathology, and treatment have still not been completely established . Cases of crs have been divided into two groups; chronic rhinosinusitis with nasal polyps (crswnps) and chronic rhinosinusitis without polyps (crssnps) in europe and the united states . Crswnps has a strong predisposition to recurrences even after ess, and pathological examinations show numerous eosinophils invading the mucosa . In contrast, crssnp is diagnosed by purulent changes, and histopathological examinations of the nasal polyps and nasal mucosa show lymphocytes and neutrophils as the dominant inflammatory invaders . However, some cases of crswnp in asians do not show eosinophil - dominant changes in the inflammation . In addition, this subtype is not fully resolved by conventional long - term macrolide therapy combined with surgical dissection of the mucosal membrane in the sinuses . These cases have recently been classified as ecrs because they have different clinical characteristics from the more common crss that are associated with asthma, elevation of eosinophilic counts in peripheral blood, and massive invasion of eosinophils into the nasal mucosa . The diagnosis of ecrs is finally determined by the clinical findings of chronic nasal symptoms, results of imaging tests, peripheral blood tests, and histological tests.4 our case had the nasal symptoms, history of nasal polypectomy, and asthma . Ct showed pan - sinusitis, and histopathological examination of removed mucosal membranes showed intensive invasion of eosinophils . Furthermore, there was a recurrence after surgery and steroid therapy . From the findings and clinical course, our case was diagnosed as ecrs and not the purulent type of crs . Unlike the purulent type of crs, the ocular complications of ecrs have not been fully determined . Garg et al reported a case of ecrs associated with optic neuropathy.5 the mri images showed a high intensity area over the left intraorbital optic nerve without any lesions in the paranasal sinuses . They treated their case with steroid therapy and radical sphenoethmoid clearance, however the visual acuity, which was light perception before treatment, improved only slightly to finger counting . Fungi have received much attention in the united states as candidates for causing ecrs and allergic fungal rhinosinusitis (afs). The diagnostic criteria for afs include type 1 hypersensitivity to fungi, nasal polyps, and eosinophilic mucin containing fungi.7 it was suggested that fungi in the sinonasal mucosa might be the cause of non - atopic eosinophilia or local ige production.8 the clinical findings of afs overlap those of ecrs, and thus it is necessary to differentiate afs from ecrs . Generally, cases with afs have unilateral lesions, elevation of eosinophils, and ige specific to fungal antigen . The important findings for diagnosis of afs are the detection of hyphal forms of fungi and positive histopathological findings with pas or grocott staining . As with ecrs, afs is rarely associated with optic neuropathy.6 the orbital findings of afs are proptosis, ophthalmoplegia, optic neuropathy, and telecanthus . Imaging tests show hyper - attenuating foci along with expansion and destruction of the sinus walls . Most cases of optic neuropathy have an erosion of the lateral wall of the sphenoid and optic canal.6 the incidence of bony erosion in afs is more than 12 times greater than in non - afs.9 whether an erosion of sphenoid bone occurs may determine the visual prognosis . There is potential for mistaking the size of the lesion with only mri.10 mri of cases with allergic aspergillus sinusitis showed that the lesions were low intensity cystic lesions in both t1 and t2 weighted images . Thus, the lesions may appear to be smaller than the actual size unless enhanced mri is used . By contrast, ct can accurately detect the area of hyper - attenuation and bone architecture . Our case progressed to bilateral lesions, and the laboratory data were negative for ige specific to fungi . In addition, there were no hyphae in the biopsy sections with pas and grocott staining . From these findings it was not definitively determined why the visual acuity did not recover even though the ess was performed within 30 hours after the initial symptoms of optic neuropathy developed . Our case presented with pan - sinusitis and thick mucosal membrane overall of the rhinosinus including the middle meatus and osteomeatal complex . Although the inflammatory changes gradually enlarged after the polypectomy, the drainage from the parasinus might have been blocked leading to infection and inflammatory changes . These changes could then cause the internal pressure in the parasinus to increase and affect the optic canal, even though bacterial infectious changes were not detected . In addition, local ischemia of the optic nerve might also have occurred secondary to the erosion of the optic canal followed by swelling of the optic nerve because the visual loss was so rapid . An earlier case of ecrs with optic neuropathy had a different mri performed and an enhancement of the intraorbital optic nerve without extensive opacification of the rhinosinus was found . Although we did not do mri, direct invasion by inflammatory tissues might have occurred in the right optic nerve as seen in the previous case . In conclusion, we documented a rare case of ecrs complicated by optic neuropathy . Unfortunately, the visual acuity did not recover at all even though emergency ess and steroid therapy were performed . These findings indicate that it is very important to suppress the allergic reaction for the prevention of ocular complications in ecrs cases.
|
Dens invaginatus (di) is a developmental anomaly that results in a deepening or invagination of the enamel organ into the dental papilla prior to calcification of the dental tissues . This type of malformation was first described by ploquet in 1794 in a whale's tooth . Di was first described as a tooth within a tooth by salter in 1855 while socrates in 1856 reported the first case of di in a human tooth . Commonly, this anomaly occurs in the permanent maxillary lateral incisors followed by the maxillary central incisors, premolars, canines, and less often in the molars . The etiology of this anomaly is controversial and remains unclear; however, most authors conclude that di results from an infolding of the papilla during tooth development . Radiographically, di presents as a radiopaque invagination, equal in density to enamel, which extends from the cingulum into the root canal . Oehlers classification categorizes invaginations into three classes as determined by how far they extend radiographically from the crown into the root: type i: an enamel - lined minor form occurs within the crown of the tooth and does not extend beyond the cementoenamel junction . Type ii: an enamel - lined form that invades the root as a blind sac and may communicate with the dental pulp . Type iiia: the invagination extends through the root and communicates laterally with the periodontal ligament space through a pseudo - foramen . There is usually no communication with the pulp, which lies compressed within the root . Type iiib: the invagination extends through the root and communicates with the periodontal ligament at the apical foramen . The invagination allows entry of irritants into an area that is separated from the pulpal tissue by only a thin layer of enamel and dentin and is a predisposing factor for the development of dental caries . In some cases, the enamel - lining may be incomplete, and channels may exist between the invagination and the pulp, allowing bacteria and their products to gain access to the pulp . Therefore, pulp necrosis often occurs at an early stage, usually within a few years of eruption, and sometimes even before root - end closure . This article describes a rare case report of bilateral di in the mandibular second premolars that were treated nonsurgically . A 25-year - old male patient reported to the department of conservative dentistry and endodontics of our institution with a chief complaint of bilateral swellings in relation to the lower right and left posterior teeth since the last 2 months . The patient gave a history of an occasional dull aching pain in relation to the swellings . Clinical examination revealed draining sinuses in relation to noncarious 35 and 45 [figure 1]. Both the teeth were tender to percussion and failed to respond to thermal and electrical pulp testing . Radiographic examination of both 35 and 45 revealed an oehlers type i di, with incomplete root - end formation and a periapical radiolucent lesion . Incidentally, an oehlers type i di was also noted in relation to 34 and 44 [figures 2 and 3]. However, both 34 and 44 were nontender and showed a positive response to pulp testing . To obtain a detailed understanding of the root canal morphology and evaluate the type of invagination, a spiral computed tomography (ct) scan was done with a multi - detector ct scanner (16 slices / s), as per the recommendations given by christoph et al . To reduce the radiation dosage (collimation: 1 mm; pitch: 2; tube voltage, 80 kv; tube current, 40 ma). Axial images were transmitted to a commercially available dental program (denta scan, advantage windows; general electric, buc, france) to reformat panoramic and cross - sectional images in all three planes [figures 46]. (a) right mandibular second premolar region, (b) left mandibular second premolar region preoperative intra - oral periapical radiographs . (a) right mandibular premolars, (b) left mandibular premolars panoramic radiograph (preoperative) spiral computed tomography scan (sagittal view) of right mandibular second premolar spiral computed tomography scan (sagittal view) of left mandibular second premolar spiral computed tomography scan (reformatted panoramic view) a clinical diagnosis of pulp necrosis and chronic periapical abscess in relation to 35 and 45 was made . The canal was enlarged, and central hard tissue was removed using h - files and gates glidden drills with copious irrigation using 5.2% sodium hypochlorite . Apical closure was done using mineral trioxide aggregate (mta), and the teeth were obturated by the thermoplasticized technique using obtura ii (obtura spartan co., fenton, mo, usa) with vertical compaction using finger pluggers . There was no evidence of any pathology in relation to 34 and 44 and hence no treatment was needed for these teeth . (a) right mandibular premolars, (b) left mandibular premolars postoperative clinical and radiographic examination after 6 months showed satisfactory healing of the draining sinus and periapical lesion in relation to 35 and 45 [figures 810]. (a) right mandibular second premolar region, (b) left mandibular second premolar region postoperative intra - oral periapical radiographs showing healing of the periapical lesion . (a) right mandibular premolars, (b) left mandibular premolars panoramic radiograph (postoperative) di is thought to affect usually the permanent maxillary lateral incisors, with the posterior teeth less likely to be affected . While cases of di in the mandibular teeth have also been reported, only a few cases have been shown to involve the mandibular second premolars . The present case showed bilateral di in both the first and second mandibular premolars . According to hlsmann, if there is no evidence of an entrance to the invagination and no signs of pathosis are visible clinically and radiographically, no treatment is necessary, but strict observation is recommended . In our case, both the mandibular first premolars did not show any clinical or radiographic signs of pathology . Hence, no treatment was carried out for these teeth, and the patient was advised to report regularly for follow - up . Since both the mandibular second premolars were nonvital and showed periapical lesions, they were endodontically treated . Endodontic treatment of di constitutes a challenge due to the complicated root canal anatomy of the affected teeth . Nonsurgical endodontic treatment should be attempted first regardless of the size of the periapical lesion . The successful management of the present case indicates that the size of the periapical lesion does not influence the treatment procedure to be performed or its outcome . However, a major concern with the use of a ct scan is its high radiation dosage . In the present case, guidelines proposed by christoph et al . Were used, and the effective radiation dosage produced by this method was 0.56 0.06 mgy, which is roughly equivalent to that of a standard panoramic radiograph . The prognosis of nonsurgical endodontic treatment depends on a number of factors like the extent of the invaginated central mass in relation to the pulp space, continuous drainage of fluid from the canal during treatment which prevents dryness of the canals, and an open apex which may negate apical seal of the root canal filling . Mechanical debridement of the canal is difficult in many cases, but the combination of chemo - mechanical instrumentation and the use of calcium hydroxide may be sufficient without resorting to surgery . The use of mta as an apical seal for immature roots allows the immediate rehabilitation of the crown, thus increasing the resistance to fracture and enhancing the esthetic result . The present case showed the occurrence of type i di in relation to 35 and 45 with periapical lesions, which was successfully treated nonsurgically . This case illustrates that even in cases with bilateral di, open apices and an associated periapical lesion, use of nonsurgical endodontic treatment can result in satisfactory peri - radicular healing . Although di is a relatively common anomaly, it may be easily overlooked due to the absence of any significant clinical signs . This is unfortunate as the presence of an invagination is thought to increase the risk of dental caries, pulpal involvement, and periodontal inflammation . Also, the variable nature of the invagination can often mean that any required endodontic treatment may be complicated . Careful radiographic examination and knowledge of the variations in morphology of the internal anatomy of teeth are thus necessary for a successful treatment outcome.
|
Malaria is a major public health problem in tanzania causing an enormous burden to health and economy . In this country, over 95% of the 38 million people are at risk for malaria infection . The disease is responsible for more than one - third of deaths among children under the age of 5 years and for up to one - fifth of deaths among pregnant women . Malaria contributes to 39.4% and 48% of all outpatients less than 5 years of age and aged 5 years and above, respectively . In terms of hospital admissions, malaria accounts for 33.4% of children under the age of 5 years and 42.1% in children aged 5 years and above . In tanzania, most of the malaria attributable cases and deaths occur in rural villages away from effective diagnostic or treatment facilities . The main focus of malaria control measures in tanzania includes case management (early diagnosis and prompt treatment with effective drugs), vector control using insecticides treated mosquito nets (itns), malaria intermittent treatment in pregnant women, malaria epidemics prevention and control, information, education and communication, and operational research . Despite these strategies, malaria cases and deaths have been increasing in the country, mainly due to injudicious use of antmalarial drugs, delayed health seeking, and reliance on the clinical judgment without laboratory confirmation in most of the peripheral health facilities . There has been a considerable number of reports about knowledge, attitudes, and practices relating to malaria and its control from different parts of africa . These reports concluded that misconceptions concerning malaria still exist and that practices for the control of malaria have been unsatisfactory [35]. Thus, an advanced knowledge of the community beliefs and practices with respect to the disease is required to obtain and maintain its participation in surveillance and control activities . In tanzania, support for malaria control at both the national, district, and private sector levels has increased over the past few years . Here we present an example of collaboration in fighting against malaria, between the public sector, the geita district council (district health department), and private organizations (geita gold mines, anglo ashanti gold mines tanzania). The present study was conducted prior to implementation of a house - to - house indoor residual spraying (irs) program against malaria vector in selected villages of geita district . The objective was to collect baseline information concerning knowledge, attitudes, and practices of people in the study area regarding malaria . The study was conducted from september to october 2009 in geita district in northwest tanzania . The district is one of the 7 districts of mwanza region lying southwest of lake victoria . The topography of the district is characterized by hilly areas in the north and west and with a gentle slope towards the south and southeast . The area has two main rainy seasons (november - december and february - may) with a mean annual rainfall of 1264 mm . The annual minimum and maximum temperatures for the area is between 14c and 30c . The major economic activities are farming, livestock keeping, trading, fishing, and artisan mining . For the purpose of this study, nyamalembo village which is located at mtakuja ward the village is located in the rural area and has 4 vitongoji (subvillages), namely kampound, msufini, kumbayaga, and magema, with a total population of 2,670 . The communities have no health facilities, and villagers depend on the district hospital which is located about 7 km away . Malaria transmission in the nyamalembo village is seasonal, peaking from february to may during the long rain season . Estimation of sample size was based on a 95% confidence level and 80% power to detect an odds ratio of 2, assuming 10% of diseased in the unexposed group . A sample of 92 households was drawn from each of the four communities / sub - villages of nyamalembo village by systematic random sampling . Thus, a total of 368 households were eligible for the study; 2 of the selected households refused to participate in the study, resulting in a study population of 366 households . A structured questionnaire was pretested and administered by assistant researchers (eo, wm, and pm). The first part of the questionnaire included sociodemographic characteristics of the participants and the second part assessed household's head knowledge on malaria transmission, recognition of symptoms, preventive measures, and itns ownership and use . Lastly, the questionnaire assessed the participant's knowledge, perception and acceptance of irs, and treatment seeking patterns . The questionnaires were translated into swahili language and pre - tested in the same village . The head of the household was defined as the person who was perceived by household members to be the primary decision maker in the family and the household was defined as individuals living together and taking meals from a common cooking facility . In absence of the household heads, ethical clearance to conduct this study was obtained from the district health department under the district medical officer and from the research and publication committee of weill bugando university college of health sciences, mwanza, tanzania . The data were double entered in microsoft excel data sheets, cross checked and transferred, and analyzed using spss for windows version 11.5 (spss, atlanta, ga, usa). Descriptive statistics were carried out to measure relative frequencies, percentages, averages, and relative frequencies of the variables . Cross tabulations of variables were done, and chi - squared test () was used to determine the statistical significance of differences of relative frequencies . A total of 366 households heads were interviewed, including 58% females and 42% males (table 1). Tables 2 and 3 present the respondents' knowledge and practices about malaria, its transmission, and preventive measures . In total, 364/366 household heads had heard of malaria locally referred as mshana, meaning high fever . There was a significant difference between males and females on malaria transmission knowledge (p <.03). A significant association between education level and knowledge on malaria transmission was also observed (p <.001). Only 3.7% (4/106) of illiterate people associated malaria transmission with the bites of mosquito which have fed on malaria patients, as compared to 22.8% (59/259) of literate people . Stagnant water was mentioned by almost 2/3 of respondents to be the main areas for mosquito breeding (table 2). A significant relationship between education level and correct knowledge of mosquito breeding areas the major source of information about malaria was the individuals' experiences on the disease . The regular use of bed nets for prevention of malaria was mentioned by 64% of the respondents, and a similar number reported to sleep under bed nets a night before the survey (table 3). Other measures applied were using insecticide aerosol sprays, destruction of mosquito breeding and resting areas, use of mosquito coils / repellents and treatment of malaria cases . There was a significant difference between males and females on correct knowledge to prevent malaria (p <.008). More females, 57.7% (211/366) reported to use itns as compared to 30.9% (113/366) men . Symptoms of malaria such as intermittent fever and headache, fever / high body temperature and general body weakness, and fever with rigors were most frequently mentioned . Other symptoms mentioned were dizziness, abdominal pain, loss of appetite, diarrhea, body pains, and cramps (figure 1). About 77% of the respondents reported to own bed nets (itns or non itns), and 74% reported to sleep under the bed nets a night before the survey (table 4). Education level was observed to be associated with bed net usage behavior (p <.01). Only 24.7% (70/283) of illiterate were using bed nets, as compared to 75.3% (213/283) of literate people . Protection from mosquito bites was reported to be the main reasons for using bed nets (table 4). Of those not having bed nets, reported cost to be the main barrier . On the other hand, 64% of the respondents with bed nets reported to use insecticides commonly referred as ngao - pyrethroids to retreat their bed nets (ngao is a brand name which means a shield protecting from mosquitoes in swahili language). The time for retreatment is presented in table 4 . Cost of ngao was the main reason of not retreating their bed nets, and retail shops were mentioned to be the main source of ngao . About half of the respondents reported that they had heard of irs campaigns, and the main sources of information were radio programs and government campaigns (table 5). When asked if they were ready for their houses to be sprayed with insecticides, 86% accepted . Whereas the perceived main benefit of accepting irs was to kill mosquitoes, only 17% mentioned protection from malaria (table 5). The reasons of rejecting irs were mainly bad smell of the insecticides and the fear that insecticides may kill their domestic animals (table 5). The majority of the respondents reported to seek treatment for malaria from health facilities (hospital / dispensaries / health centers) (table 6). Allopathic practitioners (i.e. Medical doctors) and traditional healers were also consulted frequently for malaria treatment (table 6). Education level did not influence significantly the type of treatment respondents would select for malaria treatment (table 6). The common antimalaria drug used by respondents which were either obtained from drug stores, dispensaries / health centers, or hospitals were artemether lumefantrine (alu) (21.2%), sulfadoxine - pyrimethamine (19.3%), metakelfin (16.9%), amodiaquine (15.5%), paracetamol (13.3%), local herbs commonly referred as mbilizi, nkamba and kamuli (7.2%), quinine (4.4%), and chloroquine (1.7%). A significant association between education level and selection of the type of antimalarial drug was observed (p <.03). Illiterate people were observed to use more tradition herbs (57.7%) than literate individuals (37.7%). With regards to the knowledge and perceptions about the combination therapy, artemether + lumefantrine, 94.8% (n = 344) of the respondents had heard of the drug and the main source of information were health facilities (hospital / dispensaries / health centers; 68.3%) and radio / tv (28.7%). Other sources of information were drug shops, 1.4% (n = 5), and family members, 1.4% (n = 5). Surprisingly, only 35.3% (n = 122) of the respondents reported to have used alu . Headache and dizziness were perceived as the most common side effects of alu by 62.9% (n = 17) of the respondents . Other perceived side effects were nausea, anorexia and abdominal pain (18.5%), arthragia or myalgia (11.1%), palpitation (3.7%), and pruritis or rashes (3.7%). When asked about their personal opinions on alu, 56.4% (n = 119) of the respondents reported that the drug was good for treating malaria, 11.4% (n = 24) reported the drug did not cure malaria, 20.4% (n = 22) reported that the full dose had too many tablets, 9.5% (n = 20) said the drug was good for treating children against malaria and 10.4% (n = 22) of the respondents reported that the drug had severe side effects . Results from surveys on knowledge, attitudes, and practices are applicable to design or improve malaria control programs, and to identify indicators for a program's effectiveness . The results of our study can be incorporated into the decision - making processes, the design of sustainable interventions with active community participation, and the implementation of educational schemes . Our data show that in rural tanzania people have demonstrated a better understanding of malaria causes, symptoms, treatment and, preventive measures as observed in other reports from different parts of the world [7, 10, 11]. However, the findings revealed a poor or superficial knowledge on malaria transmission, treatment, preventions, and etiology among illiterate respondents . The majority of the respondents associated mosquito bites with malaria transmission, which is a common observation in malaria endemic areas where people suffer frequently from the disease [7, 1013]. However, in our study only few respondents mentioned a correct transmission route (the bites of mosquito which has bitten a malarial patient). About half of the respondents demonstrated a gap of knowledge on malaria transmission by stating that the bite of any mosquito could cause malaria and a quarter of respondents did not knew the mode of transmission . This observation was similar to the findings of ahmed et al . In bangladesh . Public health education interventions should always be designed to cover the existing knowledge and should be implemented for a sufficient length of time for it to be effective . Like elsewhere in africa, the study community identified malaria mainly on the basis of the symptoms of fever / high temperature and general body weakness, fever with rigors and fever with sweating [10, 11, 1517]. Despite good knowledge of malaria symptoms and signs, anaemia and convulsions lack of clear knowledge on anaemia and convulsions which are associated with malaria in children could lead to delay in seeking appropriate care from health facilities . In this study, this was consistent with findings of other studies in india and bangladesh [7, 19]. Informal allopathic providers such as drug store sales people and traditional healer were also consulted by respondents [7, 20]. Bed nets are among the most recognized methods of personal protections against mosquitoes and many studies have reported the benefits of itns [21, 22]. The majority mentioned the use of insecticidal bed nets (itns) in our study, and most of them reported to sleep under bed nets a night before the survey . Similar results have been reported from mexico, ghana, tanzania, and bangladesh [10, 12, 23]. Most of the households reported itn ownership and the majority reported that everyone in the household was sleeping under a bed net . This was an encouraging observation and can be used by malaria control programme to increase the number of itns in this community but this will not imply use of it . Statistics of 20012005 from the national malaria control programme reported that the proportion of households with at least a mosquito net has increased from 14% to 58%, while the proportion of households with at least an itn has increased from 14% to 25% . Following a mass campaign to distribute free itns to mothers of under five, pregnant women and introduction of voucher scheme to pregnant women after 2 - 3 months and the main sources of ngao was indicated to be the retail shops . Net washing is an important determinant of the effectiveness of itns, targeted efforts have to be made to sensitize the community on washing their nets after specified period of time . The cost of ngao was mentioned to be the main reason for not re - treating bed nets . Conversely, about half of respondents reported to have heard of irs program and the main sources of information on irs were radio programs and government campaign . The respondents recognized the benefits of irs in the reduction of mosquito abundance (73.5%), but only 17% related this with protection of the family against malaria . Acceptability of the spraying, in terms of house - spraying coverage, is sufficient to prevent human - vector contact and to control malaria in the study area . The causes of refusal of accepting irs were bad smell of the insecticides, poisoning of domestic animals, poisoning of children, and the insecticides may cause infertility to family members . A study in zimbabwe concluded that there is a significant relationship between people's knowledge of the causes of malaria and preventive measures taken against it, and that a household's level of understanding of the purpose of an insecticides spraying program is directly correlated with their compliance with having their house sprayed . In this study, the majority of respondents reported to have heard of the combination therapy, artemether+lumefantrine (alu) for treatment of malaria . Surprisingly, only 35% of the respondents reported to have used alu for malaria treatment . Probably, the ongoing campaign by the ministry of health and social welfare to sensitize the community to use alu to treat malaria in children may have resulted into adults to use other antimalarials . In a study by ajayi, most of the respondents reported that alu was the best treatment for malaria in children . Artemisinin combination therapy (act) with alu is currently the first line treatment policy in tanzania . Alu is an efficacious drug combination that also has the capacity to reduce malaria transmission to mosquitoes . Some of the respondents still mentioned local herbs as the first treatment for malaria at home . This was similar with previous studies in nigeria and ghana [20, 26]. The perceived side effects of alu by respondents were headache and dizziness, nausea, anorexia and abdominal pain, and arthragia or myalgia . Although this finding is similar to reports of earlier studies which reported mild adverse effect during clinical trials [27, 28] and among patients prescribed alu, but these observations cannot be used to draw conclusion on the safety of alu . On the other hand, when respondents were asked about their personal opinion on alu, the majority believed that the drug was good for malaria treatment and the best drug in treating children . However, other respondents complained that the fully dose of alu has many tablets, the drug had severe side effects, the drug do not cure malaria, and high cost of the drug in retail shops . The findings of this study indicate that rural communities in northwestern tanzania have high knowledge on malaria transmission, symptoms, and preventive measures . However, low education was detected as a major drawback for effective control, and intervention measures and information campaigns should focus on this high risk group . There is also a need for district health departments to improve availability of information about malaria through rural dispensaries and primary health centers . The use of bed nets is widespread which makes its intensive use viable for malaria control . The high community acceptance of irs is an advantage for the program to introduce irs for effective malaria vector control . Health education is needed to convince some members of the community to use artemether lumefantrine combination therapy for effective malaria treatment . There is a need for future studies to evaluate effectiveness of irs on malaria vectors, prevalence, and the community perception on irs after spraying exercise . Lastly, collaborations between the public and private sector on malaria control are encouraged because both the community and business benefit from the control activities.
|
Parkinson's disease (pd) is characterized by the selective degeneration of nigrostriatal dopaminergic (daergic) neurons, resulting in dopamine (da) depletion . While the etiology of pd is not completely clear, several pathology studies have demonstrated that, in postmortem samples of substantia nigra pars compacta (snpc), daergic neurons exhibit markers of oxidative stress, such as lipid peroxidation, dna oxidative damage, and carbonyl modifications of soluble proteins [2, 3]. The pd brain is also characterized by oxidative damage and functionally impaired and misassembled mitochondrial complex i, which affirm the involvement of oxidative stress in the pathophysiology of pd . Indeed, recent data have shown that mn - dependent superoxide dismutase (sod) level and activity are increased in pd brains [3, 5]. Further evidence implicating oxidative stress in pd comes from studies with the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp), which has been widely used as a daergic neurotoxin because it causes a severe pd - like syndrome in humans as well as in monkeys and mice . Its administration to c57bl mice leads to a decline of striatal da and tyrosine hydroxylase (th) levels in the snpc [7, 8] as well as the death of daergic neurons . Mptp crosses the blood - brain barrier and is converted into its toxic metabolite 1-methyl-4-phenylpyridinium (mpp) in astrocytes by the enzyme monoamine oxidase b. mpp is then selectively taken up by daergic neurons via the high - affinity da transporter (dat) and is actively transported into mitochondria where it interferes with mitochondrial respiration through complex i inhibition [911], elevating reactive oxygen species (ros) levels and increasing sod, catalase (cat), and glutathione peroxidase (gpx) activities in mptp - treated mice and mpp - treated neuronal cells [1214]. Also, mptp and its active metabolite mpp induce th nitration, that is associated with the degeneration of daergic neurons . On the other hand, h2o2, o2 and oh have been detected after complex i inhibition with mpp . In addition, the decrease of complex i and subsequent oxidative stress evoked by mpp administration elicit neuronal cell death by apoptosis [17, 18]. Brassinosteroids (brs) are steroidal plant growth regulators found in several vegetables, including vicia faba (broad bean) seed and pollen [1921]. Brs, considered to be a new group of plant hormones, are currently being studied intensively to understand their role in plant metabolism . Their main physiological effects in plants include the regulation of hormonal balance, activation of protein and nucleic acid synthesis, enzyme activity, growth promotion, increased size and quantity of fruits, and, most interestingly, augmented resistance to unfavorable environmental factors, stress, and disease (for review see). It has also been demonstrated that the exogenous application of natural brs to other vegetables has a specific antioxidative effect . The natural br 24-epibrassinolide (24-epi) occurring in vicia faba increases the enzymatic antioxidant activities of sod, cat, and gpx in lycopersicon esculentum (tomato) leaves and brassica juncea l. (indian mustard) plants [24, 25]. 24-epi also reduces lipid peroxidation in oryza sativa l. (rice) and indian mustard plants [25, 26]. The antioxidative properties of brs, clearly apparent in vegetables, strongly suggest that these compounds exert an antioxidant and neuroprotective role in mammals by curbing apoptosis, as reported recently for other natural molecules (for review see [13, 2734]). Indeed, in mammals, the effects of brs are just starting to be elucidated . Brs are known to exert anticancer and antiproliferative activities on human cell lines [3538]. Antiviral activity has also been identified in natural brs and synthetic analogs [3941]. Moreover, beans from vicia faba also contain l-3,4-dihydroxyphenylalanine (l - dopa) [42, 43], the amino acid precursor of da, which is nowadays the most effective symptomatic treatment of pd . Clinical reports indicate that the consumption of vicia faba has a beneficial outcome in pd patients [45, 46]. However, l - dopa concentrations in vicia faba are not sufficient to explain the magnitude of the responses observed in pd patients and raise the possibility that other compounds from vicia faba, such as brs, may complement the l - dopa effect by their antioxidative activities . The aim of our study was to examine, in detail, the influence of 24-epi, a br present in vicia faba, on mpp - induced oxidative stress in a well - known model of pd, nerve growth factor- (ngf-) differentiated pc12 cells [47, 48]. We showed that 24-epi reduces apoptotic cellular death as well as protein markers of apoptosis, modulates sod, cat, and gpx activities, and decreases intracellular ros concentrations . Overall, our findings clearly demonstrate that 24-epi is a new, efficient, protective molecule against mpp - induced oxidative stress and might thus be regarded as a novel agent in complementary and/or preventive therapies of neurodegenerative diseases . All reagents were purchased from sigma (st . Louis, mo) unless stated otherwise . Pc12 cells, obtained from the american type culture collection (rockville, md), were maintained in a controlled environment at 37c and in 5% co2 atmosphere . They were grown in rmpi-1640 medium supplemented with 5% fetal bovine serum (fbs), 10% horse serum, and gentamicin (50 g / ml). The culture medium was changed every 2 days and the cells were seeded at a density of 30,000 cells / cm . Neuronal differentiation was induced for 4 days with 50 ng / ml ngf in rpmi-1640 medium supplemented with 1% fbs . To examine the effects of 24-epi on mpp - induced cellular death and oxidative stress, neuronal pc12 cells were pretreated with 24-epi (10 m) or vehicle (culture medium) for 3 h and then exposed to mpp 5 mm for 1, 3, 15, or 24 h [49, 50] (figure 1). In apoptosis experiments, we used 500 m of mpp for 24 h, as reported elsewhere [4951]. After kinetics and dose - response studies [49, 50], the final concentration of 10 m 24-epi (see figure 2 for chemical structure) was chosen as the lowest dose capable of rescuing cells from mpp - induced cellular death (data not included). All experiments were performed in phenol red - free medium and charcoal - stripped serum to remove steroids from the medium . Cytotoxicity was evaluated by colorimetric assay based on the measurement of lactate dehydrogenase (ldh) activity released from damaged cells into the supernatant . Ldh, a stable cytoplasmic enzyme present in all cells, is rapidly released into the cell culture supernatant upon plasma membrane injury . The amount of enzyme activity detected in the culture supernatant correlates with the proportion of lysed cells [53, 54]. Ngf - differentiated pc12 cells were grown and treated in collagen - coated 96-well plates . Then, 100 l of ldh substrate mixture was added to 50 l of cell - free supernatant, as described elsewhere . Absorbance was measured at a wavelength of 490 nm in a microplate reader (thermolab system, franklin, ma). Total cellular ldh was determined by lysing the cells with 1% triton x-100 (high control); the assay medium served as a low control and was subtracted from all absorbance measurements: (1)cytotoxicity (%) = (experimental valuelow control) (high controllow control)100 . The antioxidative effect of 24-epi against mpp - induced ros was evaluated by dihydrorhodamine (dhr) 123 assay and mitosox red (invitrogen, toronto, on, canada), according to a previously - described method [13, 55]. Briefly, to detect oh, no2, co3, h2o2, hocl, and onoo by dhr [5659], ngf - differentiated pc12 cells were grown and treated on collagen - coated slides in 24-well plates . A stock solution of dhr was prepared in dimethylsulfoxide under nitrogen, to a concentration of 10 mm and stored at 80c . After 3-hour pretreatment with 24-epi, mpp was added for 3-hour or 24-hour treatment (figure 1). Then, the neuronal pc12 cells were quickly washed with pbs 0.1 m and exposed to 250 l of dhr at 37c for 20 min . Slides with live cells were immediately examined under a leitz orthoplan fluorescence microscope (leica, wetzlar, germany) and photographed with a qimaging camera (nikon, mississauga, on, canada). Then, the antioxidative effect of 24-epi against mpp - induced o2 was evaluated with mitosox red, according to the manufacturer's protocol . To show the selectivity of mitosox red, 80 m of n, n - diethyldithiocarbamate (ddc), an inhibitor of sod, was used as a positive control . After 3-hour pretreatment with 24-epi, mpp was added for 3-hour or 24-hour treatment (figure 1). Pc12 cells were washed with hanks' buffered salt solution and incubated for 10 min with mitosox red 5 m solution at 37c . They were then counterstained in blue with hoechst 33342 for 10 min at 37c, fixed for 15 min in 4% paraformaldehyde at 37c, and finally mounted with prolong antifade kits (invitrogen). The slides were examined under a leitz orthoplan fluorescence microscope (leica) and photographed with a qimaging camera (nikon). Ngf - differentiated pc12 cells were grown and treated in collagen - coated 6-well plates . After 3-hour pretreatment with 24-epi, mpp was added for 1, 3, 15, or 24 h (figure 1). Neuronal cells were harvested mechanically and collected by centrifugation at 2,000 g for 10 min at 4c . For sod and gpx activities, the pellets were homogenized in 1 ml of cold pbs and centrifuged at 2,000 g for 10 min at 4c . The supernatants were discarded and the freeze - thaw method was performed to break the cells (20c for 20 min, followed by a 37c bath for 10 min, repeated twice). The pellets were homogenized in cold pbs and centrifuged at 10,000 g for 15 min at 4c . Finally, the supernatant was analyzed according to the manufacturer's protocol (sod assay kit - wst, dojindo molecular technologies, gaithersburg, md; gpx assay kit, cayman chemical, ann arbor, mi). The reaction was monitored at 450 nm for sod activity and 340 nm for gpx activity in a microplate reader (thermolab system). For cat activity, the pellets were homogenized in 1 ml of cold buffer (50 mm potassium phosphate, ph 7.0, containing 1 mm edta) and sonicated (3 times, 5 s). The samples were centrifuged at 10,000 g for 15 min at 4c, and the supernatant was assayed according to the manufacturer's protocol (catalase assay kit, cayman chemical). The reaction was monitored at 540 nm in a microplate reader (thermolab system). Apoptotic neuronal cells were detected by both terminal deoxynucleotidyl transferase dutp nick end labeling (tunel, roche diagnostics, laval, qc, canada) and activated caspase-3 immunofluorescence . Neuronal pc12 cells were grown and treated on collagen - coated circular glass coverslips in 24-well plates (fischer scientific, ottawa, on, canada). After 3-hour pretreatment with 24-epi, mpp (500 mm) was added for 24 h (figure 1). The cells were fixed for 15 min in 4% paraformaldehyde at 37c, washed, and incubated in a blocking and permeabilizing solution (containing 1% bsa, 0.18% fish skin gelatin, 0.1% triton - x, and 0.02% sodium azide) for 30 min at room temperature (rt). They were then incubated with anticleaved caspase-3 antibody (new england biolabs, pickering, on, canada) diluted 1: 500, for 2 h at rt, followed by 90-minute incubation with a cy3-conjugated secondary antibody (medicorp, montreal, qc, canada) diluted 1: 500 for 1 h at 4c . The coverslips were then transferred to the tunel reaction mixture in a humidified atmosphere at 37c . The cells were rinsed with pbs, nuclei were counterstained in blue with dapi for 10 min at 37c, and mounted with prolong antifade kits (invitrogen). Images were acquired with a leitz orthoplan fluorescence microscope (leica) and photographed with a qimaging camera (nikon). Neuronal cells were considered to be apoptotic when they were positive for cleaved caspase-3 and their nuclei were stained by tunel . Z - devd - fmk (bachem, torrance, ca), a cell - permeable caspase-3 inhibitor, was used on specific wells of neuronal pc12 as internal control for caspase-3 activation (figure 7). The number of apoptotic neuronal cells among 300 randomly chosen neuronal cells was counted on 10 different optical fields from 3 slides per group, as already reported, with nis elements 2.2 software (nikon). In addition, dna fragmentation was assessed with single - stranded dna (ssdna) apoptosis elisa kits (chemicon international, temecula, ca) according to the manufacturer's instructions, to quantify ssdna present in apoptotic cells . This procedure is based on the ability of a monoclonal antibody to detect ssdna, which occurs in apoptotic cells but not in necrotic cells or in cells with dna breaks in the absence of apoptosis . The assay involves the binding of cells to 96-well plates and treatment of the attached cells with formamide which selectively denaturates dna in apoptotic cells . A mixture of anti - ssdna monoclonal antibody and peroxidase - conjugated secondary antibody served to specifically identify apoptotic cells . The reaction was stopped and ssdna fragmentation was quantified by measuring absorbance at 405 nm in a microplate reader (thermolab system). The amount of ssdna was calculated with reference to control conditions . To confirm assay specificity, positive (ssdna fragment) and negative (s1 nuclease - treated cells) controls ngf - differentiated pc12 cells were grown and treated in collagen - coated 6-well plates . After 3-hour pretreatment with 24-epi, mpp was added for 24 h (figure 1). Total cellular proteins were extracted with nuclear extraction kits (active motif, carlsbad, ca), diluted in 50 l of lysis solution, and their concentrations quantified by protein assay (bca protein assay kit; pierce, rockford, il). After electrophoretic separation (180 v, 1 h), the polyacrylamide gels were transferred onto nylon pvdf membranes (0.22-m pore size, biorad, hercules, ca) at 60 v for 2 h. the membranes were blocked with 5% nonfat powder milk for 1 h at rt . Rabbit anti - bax antibody (delta biolabs, gilroy, ca) was diluted 1: 1,000, and rabbit anti - bcl2 antibody (santa cruz biotechnology, santa cruz, ca), 1: 50 . The membranes were washed the following day, and antirabbit horse - radish peroxidase - conjugated secondary antibody diluted 1: 10,000 was added for 2 h at rt . Immunopositive signals were visualized by enhanced chemiluminescence with the alphaease fc imaging system (alpha innotech, san leandro, ca) and analyzed with alphaease fc software (alpha innotech). Significant differences between groups were determined by 1-way anova, followed by tukey's post hoc analysis with the graphpad instat program, version 3.06, for windows (san diego, ca, http://www.graphpad.com/welcome.htm). All data, analyzed at the 95% confidence interval, are expressed as means s.e.m . From 3 independent experiments . Asterisks indicate statistical differences between the treatment and respective control condition (* * * p <.001, * * p <.01, and * p <.05), full circles show statistical differences between the treatment and mpp condition (p <.001, p <.01, and p <.05), and diamonds denote statistical differences between the treatment and ddc condition (p <.001, p <.01, and p <.05). The ability of 24-epi to reverse mpp - induced cytotoxicity was investigated by ldh colorimetric assay [13, 51]. Cytotoxicity measurements revealed significant cell death in neuronal pc12 cells after exposure to mpp for 24 h (figure 2, mpp). Specifically, mpp induced 22% cell death whereas 24-epi, when used alone, did not cause any cellular mortality (figure 2, 24-epi). Three - hour pretreatment with 24-epi before the induction of oxidative stress significantly decreased mpp - induced cytotoxicity . Specifically, 24-epi partially protected neuronal pc12 cells against mpp toxicity by decreasing cellular death by 60% (figure 2, 24-epi + mpp). Figure 3 depicts the preventive effect of 24-epi against mpp - induced oxidative stress measured by dhr assay . Dhr, a nonfluorescent dye, is oxidized to highly fluorescent rhodamine in the presence of several free radicals (oh, no2, co3, h2o2, hocl, and onoo) [5659]. Figure 3(a) illustrates low levels of rhodamine fluorescence in control neuronal pc12 cells, treated only with vehicle (figure 3(a), ctrl), as well as in cells exposed to 24-epi alone (figure 3(a), 24-epi). In contrast, a marked signal was detected in neuronal cells treated with mpp for 24 h (figure 3(a), mpp). Pretreatment with 24-epi prior to mpp revealed a dampened signal in comparison to mpp alone (figure 3(a), 24-epi + mpp), indicating a preventive role of 24-epi in mpp - induced ros production . Semiquantitative image analysis (figure 3(b)) disclosed high levels of fluorescent rhodamine only in neuronal pc12 cells treated with mpp for 24 h and a statistically significant reduction (p <.001) when they were preincubated with 24-epi prior to the induction of oxidative stress (figure 3(b), 24 h). A modest increment of fluorescence was evident after 3 h of mpp administration (figure 3(b), 3 h), indicating that longer exposure to mpp is needed to show the presence of several free radicals, such as oh, no2, co3, h2o2, hocl, and onoo . In addition, the selective detection of o2 by the fluorogenic dye mitosox red is illustrated in figure 4(a), in neuronal pc12 cells after 3 h of pretreatment with 24-epi or vehicle (ctrl), and then 3-hour or 24-hour treatment with mpp . It should be noted that we performed complete kinetics analysis at 3, 15, and 24 h (figure 1). However, we detected considerable levels of fluorescence, that is, o2, only at 3 h of treatment (figure 4(a)). Fluorescence pictures revealed high fluorescence intensity in mpp- and ddc - treated cells after 3-hour treatment . Low levels of oxidized mitosox red were detected in control neuronal pc12 cells (figure 4(a), ctrl) as well as in cells receiving only 24-epi (figure 4(a), 24-epi). Pretreatment with 24-epi provoked a marked reduction of the red fluorescence signal induced by mpp or ddc (figure 4(a), 24-epi + mpp and 24-epi + ddc). Semiquantitative image analysis disclosed high levels of fluorescent mitosox red in neuronal pc12 cells treated with mpp or ddc and a considerable reduction (p <.001) of fluorescence intensity when these cells were pretreated with 24-epi prior to mpp or ddc (figure 4(b)) for 3 h. marginal or slightly detectable levels of fluorescence were apparent at 15 h (data not included) and at 24 h of treatment (figure 4(b), 24 h). Sod catalyzes the dismutation of superoxide anion radical by converting it to peroxide, which can be destroyed by cat or gpx [60, 61]. We, therefore, investigated the effect of mpp, 24-epi, and mpp + 24-epi on sod, cat, and gpx activities in neuronal pc12 cells . Figures 5(a)5(c), illustrating sod, cat, and gpx activities, respectively, reveal that the exposure of neuronal pc12 cells to mpp for 3 h significantly increased the levels of these 3 antioxidant enzymes, corroborating a cell stress response to mpp - induced ros production . At 15 h, mpp administration decreased sod and gpx activities (figures 5(a) and 5(c), mpp), with cat activity remaining stable relative to 3 h activity (figure 5(b), mpp) whereas at 24 h, sod activity was strongly reduced, cat activity remained stable, and gpx was increased . Our results show that the administration of 24-epi alone also induced a very significant rise of sod, cat, and gpx activities at 3 h, supporting an antioxidant role for this br (figures 5(a)5(c), 24-epi). Specifically, 24-epi elicited a significant increment of sod, cat, and gpx activities, with a maximal increase apparent after 3 h of treatment . Afterward, at 15 h and later, sod and cat activities declined when exposed to 24-epi (figures 5(a) and 5(c), 24-epi). On the other hand, figure 5(c) illustrates that gpx activity declined at 15 h and then peaked after incubation with 24-epi for 24 h. we also analyzed whether 24-epi administration prior to mpp could modulate the activities of these antioxidant enzymes . We found that exposure to 24-epi before the induction of mpp oxidative damage significantly increased sod, cat, and gpx at 3 h, to levels higher than those obtained with mpp alone but lower than those detected with 24-epi alone . At 15 h, our results demonstrate that 24-epi + mpp still elevated sod activity over control values (figure 5(a), 24-epi + mpp) while cat activity was similar to that observed with 24-epi alone (figure 5(b), 24-epi + mpp), and gpx activity declined significantly . Finally, at 24 h, sod and cat activities decreased markedly, while gpx activity increased to control levels (figures 5(a)5(c), 24-epi + mpp). To determine whether 24-epi protects neuronal pc12 cells from mpp - induced apoptosis, we undertook dna fragmentation measurement (figure 6), tunel assay, and immunofluorescence investigation with an antibody to activated caspase-3 (figures 7(a) and 7(b)). Dna fragmentation is a marker of late apoptosis, and exposure to 500 m mpp for 24 h resulted in its 60% increase in neuronal pc12 cells (figure 6). Pretreatment with 24-epi significantly (p <.01) prevented the mpp - induced increment of dna fragmentation, indicating a powerful role of 24-epi in reducing apoptosis in our cell paradigm . Next, caspases are central initiators and executioners of the complex biochemical events associated with apoptotic cell death [62, 63]. As caspase-3 activation has been shown to be one of the concluding effectors of the apoptosis process, we investigated whether 24-epi has the ability to prevent mpp - induced caspase-3 activation (figure 7). Immunofluorescence (figure 7(b)) clearly illustrated the presence of simultaneous tunel- and caspase-3-positive cells (appearing in light blue and indicated by arrows) when mpp was administered alone . Furthermore, pretreatment of neuronal pc12 cells with a cell - permeable caspase-3 inhibitor (z - devd - fmk) for 1 h prior to mpp significantly decreased mpp - induced apoptosis, demonstrating that caspase-3 activation is a key factor in mpp - induced apoptosis . As already depicted in figure 6, 3-hour preincubation with 24-epi prior to mpp revealed a considerable reduction (p <.001) in the number of apoptotic neuronal pc12 cells (figure 7(b)). These results strongly suggest an antiapoptotic effect of 24-epi and indicate that mpp - induced apoptosis is associated with caspase-3 activation . We also studied the modulation of protein expression of the proapoptotic gene bax and the antiapoptotic gene bcl-2 by 24-epi . The ratio of proapoptotic bax to antiapoptotic bcl-2 (bax / bcl-2) has been reported to be correlated with apoptosis [51, 65]. Our results reveal that the administration of 24-epi alone did not significantly modulate the bax / bcl-2 ratio (figure 8, triangles on a continuous line). Treatment with mpp alone significantly increased the bax / bcl-2 ratio, indicating that mpp - induced apoptosis of pc12 cells may be mediated by the mitochondrial pathway . The mpp - induced increase of the bax / bcl-2 ratio was considerably attenuated in cells pretreated with 24-epi (figure 8, 24-epi + mpp) to control levels, suggesting, for the first time, that the br 24-epi is a strong modulator of proapoptotic and antiapoptotic gene expression . In this paper, we demonstrated, for the first time, that 24-epi, a br found in a variety of vegetables as well as in vicia faba, can exert antioxidative and consequent antiapoptotic actions in mammalian neural cells . In particular, we studied pc12 cells, a known, reliable, and efficient model for the investigation of oxidative stress and neuroprotection of da neurons [49, 66]. After ngf administration, pc12 cells differentiate into a neuronal - like phenotype that secretes high da levels and expresses th, dat, neurofilaments as well as estrogen receptor - alpha and -beta (er and er) [49, 6668]. Recent studies have reported the powerful properties of various natural polyphenols against oxidative stress in several cellular and in vivo paradigms of neurodegenerative disease [3034]. Currently, many natural polyphenols are under intense investigation for their antioxidative effects and their possible use as complementary and/or preventive therapies of diseases [33, 34]. Our aim was to demonstrate that brs, contained in a wide variety of vegetables, indeed exert antioxidative as well as neuroprotective properties in neuronal pc12 cells, a cellular model of pd [47, 48]. At present, phytosterols are recognized antioxidants, and some of them possess antioxidative properties associated with neuroprotective effects [70, 71]. Others, such as -sitosterol, modulate sod, gpx, and cat activities, and the ginsenoside rg1, a phytosterol derived from ginseng, is also reported to be antiapoptotic in neuronal pc12 cells after oxidative stress [73, 74]. However, brs, in particular, are much less studied, even if the recent literature is pointing to their interesting potential in mammalian systems, such as antiviral, anticancer, and antiproliferative activities [3537]. At present, no data on a possible antioxidative and antiapoptotic role of brs are available in mammalian neurons in vitro or in vivo . As such, in this study, we examined, for the first time, the neuroprotective, antioxidant, and antiapoptotic consequences of low - dose 24-epi (10 m), a common br, against oxidative damage induced by treatments with mpp, the active metabolite of mptp, a known parkinsonian toxin . The positive outcomes we reported in daergic neuronal culture, using nanomolar doses of 24-epi, on parameters of neuroprotection, oxidative metabolism, and apoptosis, are supported by the fact that brs may be considered the plant equivalent of steroid hormones in vertebrates, sharing similar metabolic pathways . Thus, brs could easily pass through the blood - brain barrier and are likely to accumulate in the brain and serum, as demonstrated for plant sterol and stanol esters in watanabe rabbits . In particular, we established that 24-epi can protect da neuronal cells from mpp - induced cellular death by reducing intracellular ros production . Indeed, nonfluorescent dhr has the capacity to enter cells and, once inside them, it is oxidized by oxygen species (superoxide anion, peroxynitrite) to fluorescent rhodamine . Accordingly, our results show increased rhodamine fluorescence after mpp treatment and reduced fluorescence when 24-epi is administered to neuronal pc12 cells prior to mpp . Dhr has been deployed extensively to measure intracellular ros, but it does not quantify o2 production . Mitosox red is a selective indicator of mitochondrial o2 production and becomes highly fluorescent when oxidized by this ros but not by other oxidants . With mitosox red, we illustrated an increase of fluorescence when mpp was administered alone for 3 h, and a substantial reduction with 24-epi treatment given prior to mpp for 3 h, suggesting a potent scavenging role for 24-epi . As o2 is a highly reactive ros, we could barely detect its presence by mitosox red at 15 or 24 h of treatment . However, at the cellular level, since antioxidant enzymes are the primary defense mechanisms of protection against ros damage, sod, cat, and gpx are pivotal in preventing cellular injury and apoptosis . In our study, augmented sod activity demonstrated that 24-epi may enhance the ability to eliminate ros during various oxidative stresses and may indicate a protective role in pretreatment experiments . Besides, several other natural and synthetic molecules are reported to heighten sod activity in various cellular systems [13, 7779]. Mpp augmented sod activity in our experiments, as described in recent literature in vitro and in vivo, where mptp increased sod activity by generating superoxide ions . This apparent contrasting result should be analyzed by comparing it with those obtained by fluorescent rhodamine and mitosox red . Indeed, low ros levels, illustrated by low rhodamine and low mitosox red fluorescence (24-epi and 24-epi + mpp, figures 3 and 4), sustain the ability of 24-epi to induce sod activity, as demonstrated by our data . When mpp was administered, rhodamine and mitosox red fluorescence indicated high ros levels and, consequently, the cells responded by augmenting sod activity, as already reported [13, 14]. Our findings clearly show that sod activity may be induced by 2 different mechanisms, a protective mechanism (24-epi) and a response - to - stress mechanism (mpp). More importantly, pretreatment with 24-epi prior to mpp administration indicates low ros levels, as revealed by rhodamine and mitosox red fluorescence, suggesting that the relatively low sod activity induced by 24-epi pretreatment may have already scavenged mpp - generated ros before 24 h. cat activity is another parameter of oxidative stress . Our results point out that at 15 h and 24 h, 24-epi pretreatment reduces the mpp - induced increase in cat activity, confirming a scavenging role for 24-epi in the pretreatment experimental condition, as already reported for another natural antioxidant molecule, sesamin . Gpx is a selenium - dependent enzyme involved in antioxidant defense and intracellular redox regulation and modulation . Cardiovascular and neuroprotective effects of the trace element selenium have been observed, although long - term supplementation has a ying - yang effect . The glutathione response after mpp treatments has already been described in a daergic cell line and is in accordance with our results, demonstrating an increase in gpx activity at 24 h after toxin administration . Our data and other findings suggest a change in glutathione regulatory enzyme activities during the kinetics of mpp administration . More interestingly, our data show a significant increase in gpx activity after 24-epi pretreatment, indicating that this molecule may augment stock of the antioxidant enzyme above control levels . In addition, our results demonstrate a clear neuroprotective and antiapoptotic role of 24-epi against cellular death induced by mpp administration . We also document that 24-epi is a potent modulator of apoptosis, opposing mpp - induced dna fragmentation and decreasing mpp - evoked apoptotic / antiapoptotic protein expression, namely, the bax / bcl-2 ratio . Altogether, our data establish that oxidative stress - induced apoptosis in daergic cells can be reversed by preadministration of 24-epi . Thus, 24-epi may be accounted for by another natural molecule interacting with intracellular apoptotic pathways [51, 82]. Recent studies have reported the anticancer and antiproliferative activities of 2 brs, 28-homocastasterone and 24-epi, supporting their cytotoxic and apoptotic role . This is not the first time that natural neuroprotective and antioxidant molecules appear to act as double agents on apoptotic parameters, depending on the cell lines studied and the concentrations tested . First, it should be noted that to demonstrate the anticancer and antiproliferative activities of brs, these authors used micromolar concentrations, and toxicity was apparent at 10 m and higher dose levels . In our study, we tested nanomolar concentrations of 24-epi since micromolar levels would likely be difficult to sustain in vivo in the human brain . On the other hand, neuronal pc12 cells are differentiated cells expressing a neuronal phenotype as well as dat, neurofilament proteins, and er and er, in contrast to native mitotic pc12 cells, where 17- estradiol or several polyphenols do not counteract mpp - induced cellular death [50, 55]. It is certainly important in future work to study in vivo models of pd to better understand the role of plant steroids in mammalian neuronal systems . Finally, this is the first investigation to highlight 24-epi's powerful function in parameters of neuronal cell distress, apoptosis, and cellular death . Other studies should be performed to elucidate the possible modulation of 24-epi on the intrinsic parameters of daergic neurotransmission . In addition, we cannot completely exclude a role of 24-epi on mpp uptake, in particular via the modulation of dat and vmat expression, that could mimic downstream events . Though, altogether these results can open the way to further document, in an animal model of pd, the importance of brs as natural molecules in preventive or / and complementary strategies to control neurodegeneration.
|
The periodontal diseases are the most prevalent oral diseases worldwide especially in developing countries like india . General unawareness, infrequent dental visits, lower socioeconomic status, and illiteracy have contributed to its high prevalence . Gingivitis and periodontitis are chronic inflammatory disorders of periodontal tissues, that is, gingival, periodontal ligament, cementum, and alveolar bone surrounding the tooth . Microorganisms present in the dental plaque are the main etiologic factors responsible for initiation and progression of periodontal diseases . Gingivitis is the inflammation of soft tissue and may occur on a periodontium with no attachment loss or on a periodontium with stable and attachment loss that is not progressing . Periodontitis is the inflammation of the supporting tissues of the teeth resulting in the progressive destruction of soft and hard tissues and clinically represented by the pocket formation, gingival recession, or both . The periodontal diseases are considered as major health concern as these are also the risk factors for many systemic diseases, that is, cardiovascular disease, preterm low birth weight infants, respiratory disease, diabetes mellitus, and cerebral infarction or cerebral stroke . The community periodontal index of treatment needs (cpitn) is a type of periodontal index developed by the joint working committee of the world health organization and the federation dentaire internationale . The majority of previous surveys have used the cpitn index in the estimation of prevalence of periodontal disease and treatment needs (tns). A prevalence study is also known as cross - sectional study, a simplest form of the observational study and is more useful for chronic rather than short - lived diseases . Prevalence of a disease refers specifically to all current cases (old and new) existing at a given point of time . In india, many epidemiologic studies have been carried out to estimate the periodontal diseases but to the best of our knowledge, there is no reported prevalence study in the literature to estimate the periodontal disease and tns in varanasi in india and its proximal areas . Therefore, the present cross - sectional survey is designed with the objective to determine the distribution and severity of periodontal diseases and tns in a hospital - based population attending the dental out - patient department, sir sunderlal hospital, banaras hindu university, varanasi, india, which covers the population coming from various districts of eastern part of uttar pradesh and bihar . In the present cross - sectional study, 500 volunteer subjects in the age group ranging from 15 years to 74 years of any gender were recruited from the dental opd, sir sunderlal hospital, institute of medical sciences, banaras hindu university, varanasi, india . This is a tertiary hospital serving the population of the eastern part of northern india . Age 15 - 74 years.no periodontal therapy in the last 6 month.systemically healthy patients . No periodontal therapy in the last 6 month . Systemically healthy patients . Acute oral disease.antimicrobial therapy for 1-month prior to the study . Structure pretested schedule included the age, gender, address, medical history, history of periodontal therapy, and history of antimicrobial therapy . Periodontal status and tns of each study subject and sextant were evaluated on the basis of cpitns that was recorded by a single trained examiner using the dental chair and adequate light . The who probe has the working tip (ball) of 0.5 mm in diameter and markings at interval of 3.5, 2.0, 3.0, and 3.0 mm (total 11.5 mm) from the working tip with black color coding between 3.5 and 5.5 mm . The ball helps in the detection of calculus, rough margins of restorations or any other irregularities on the tooth surface and reduces the chances of false measurement of the pocket depth . The who probe tip is inserted between the tooth surface and lateral wall of the gingival sulcus and walked around the tooth to determine the pocket depth, subgingival calculus, and bleeding response . The examined sites per tooth were mesial, mid - line and distal on both facial and lingual or palatal surfaces . The third molars were not included except where they function in place of second molars . Ten index teeth, that is, 17, 16, 11, 26, 27, 37, 36, 31, 46, and 47 were examined in subjects aged 20 years or above . Under the age of 19 years, six index teeth, that is, 16, 11, 26, second molars were excluded as index teeth in young subjects up to the age of 19 years to eliminate the false scoring due to pseudopocket formation during eruption of teeth . A code was given to each sextant, but only highest code was recorded among the examined teeth in individual sextant . After evaluating the periodontal status, tn for each subject was categorized on the basis of the highest code recorded during the examination of all sextants in that subject . The examined sextants were also categorized into the tn groups according to their highest code number . Subjects and the sextants were categorized into the different tn groups such as tn 0= no treatment (code 0), tn 1= oral hygiene instructions (code 1), tn 2= oral hygiene instructions + oral prophylaxis and removal of plaque retentive factors (code 2 and 3) and tn 3= oral hygiene instructions + oral prophylaxis and removal of plaque retentive factors + complex treatment (code 4). Hospital - based clinical data were presented in the form of number and percentage through tables and graphs . Statistical analysis was done by spss version 16.0 which is manufactured by ibm corporation, new york, united states age 15 - 74 years.no periodontal therapy in the last 6 month.systemically healthy patients . No periodontal therapy in the last 6 month . Structure pretested schedule included the age, gender, address, medical history, history of periodontal therapy, and history of antimicrobial therapy . Periodontal status and tns of each study subject and sextant were evaluated on the basis of cpitns that was recorded by a single trained examiner using the dental chair and adequate light . The who probe has the working tip (ball) of 0.5 mm in diameter and markings at interval of 3.5, 2.0, 3.0, and 3.0 mm (total 11.5 mm) from the working tip with black color coding between 3.5 and 5.5 mm . The ball helps in the detection of calculus, rough margins of restorations or any other irregularities on the tooth surface and reduces the chances of false measurement of the pocket depth . The who probe tip is inserted between the tooth surface and lateral wall of the gingival sulcus and walked around the tooth to determine the pocket depth, subgingival calculus, and bleeding response . The examined sites per tooth were mesial, mid - line and distal on both facial and lingual or palatal surfaces . The third molars were not included except where they function in place of second molars . Ten index teeth, that is, 17, 16, 11, 26, 27, 37, 36, 31, 46, and 47 were examined in subjects aged 20 years or above . Under the age of 19 years, six index teeth, that is, 16, 11, 26, second molars were excluded as index teeth in young subjects up to the age of 19 years to eliminate the false scoring due to pseudopocket formation during eruption of teeth . A code was given to each sextant, but only highest code was recorded among the examined teeth in individual sextant . After evaluating the periodontal status, tn for each subject was categorized on the basis of the highest code recorded during the examination of all sextants in that subject . The examined sextants were also categorized into the tn groups according to their highest code number . Subjects and the sextants were categorized into the different tn groups such as tn 0= no treatment (code 0), tn 1= oral hygiene instructions (code 1), tn 2= oral hygiene instructions + oral prophylaxis and removal of plaque retentive factors (code 2 and 3) and tn 3= oral hygiene instructions + oral prophylaxis and removal of plaque retentive factors + complex treatment (code 4). Hospital - based clinical data were presented in the form of number and percentage through tables and graphs . Statistical analysis was done by spss version 16.0 which is manufactured by ibm corporation, new york, united states among the 500 subjects recruited in the present study, 295 (59%) males and 205 (41%) females were divided into seven age groups, that is, 15 - 19, 20 - 24, 25 - 34, 35 - 44, 45 - 54, 55 - 64, and 65 - 74 years . 25 - 34 years age group shows the maximum no . Of subjects to be examined [table 1 and graph 1]. Age- and gender - wise distribution of subjects age- and gender - wise distribution of subjects table 2 shows the age - wise distribution of subjects according the highest code of cpitn index among the examined sextants in a person . Of 500 subjects, 486 subjects had teeth in functional condition in a sextant and 14 subjects were either completely edentulous or not fulfill the conditions of cpitn index . Only 19 (3.9%) subjects in all age groups had healthy teeth with the highest percentage in 15 - 19 years age group and no person had healthy teeth after 44 years . 102 (20.98%) persons had shallow pockets that were increased as the age increases . 87 (17.90%) subjects had deep pockets that were maximum in 45 - 54 years age group thereafter decreased . Age - wise distribution of subjects according to the highest code of cpitn * index table 3 and graph 2 show the gender - wise distribution of subjects according to cpitn index . Males were more affected with shallow and deep pockets as compared to females who had higher scores of healthy teeth, bleeding on probing and calculus conditions . Gender - wise distribution of subjects according to the highest code of cpitn * index gender - wise distribution of subjects according to the highest code of community periodontal index of treatment need index table 4 and graph 3 show the distribution of included and excluded sextants in different age groups . 2786 (95.54%) sextants were included, and 130 (4.45%) sextants were excluded from 486 subjects in the study . Maximum sextants were excluded in the age group of 65 - 74 years, and none was excluded in the age group of 20 - 24 years . Negligible sextants were excluded in the age groups of 15 - 19 and 25 - 34 years . Distribution of included and excluded sextants in different age groups distribution of included and excluded sextants in different age groups among the 2786 sextants, calculus (code 2) was found in 1324 (47.52%) sextants as their highest score and healthy periodontium (code 0) was found in 428 (15.39%) sextants . Others codes, that is, 1, 3, and 4 had approximately equal distribution of sextants, that is, 361 (12.95%), 354 (12.70%), and 320 (11.48%), respectively [table 5 and graph 4]. Distributions of sextants according to cpitn * index distribution of sextants according to community periodontal index of treatment needs subjects and sextants were distributed in tn groups on the basis of the highest code of cpitn index . 87 (17.90%) subjects and 320 (11.48%) sextants need oral hygiene instructions, oral prophylaxis, and complex treatment (tn 3). 346 (71.19%) subjects and 1677 (60.19%) sextants need oral hygiene instructions and oral prophylaxis (tn 2). 32 (6.58%) subjects and 361 (12.95%) sextants need oral hygiene instructions . Only 19 (3.9%) subjects were healthy and needed no treatment, whereas 428 (15.36%) sextants were healthy and needed no treatment [table 6 and graph 5a and b]. Distributions of subjects and sextants according to tns distribution of subjects (a) and sextants (b) according to treatment needs the present cross - sectional prevalence study aimed to assess the prevalence of periodontal disease and the tns of the subjects those visited to the dental opd, sir sunderlal hospital, institute of medical sciences, banaras hindu university, varanasi, india, a tertiary hospital . Of the 500 subjects, 486 subjects had teeth in functional condition, and 14 subjects were either completely edentulous or not fulfill the conditions of cpitn index . Healthy periodontium was found in 19 (3.9%) subjects with the highest percentage in 15 - 19 years age group and after 44 years no person had healthy teeth . In the present study, periodontal diseases in the early stages were more prevalent in the younger age groups as compared to advanced stages that were more prevalent in older age groups . Calculus was present in 246 (50.61%) subjects that is most frequently observed periodontal condition . Deep pockets were found in 87 (17.90%) subjects that increased as the age advanced up to 45 - 54 and decreased thereafter . The reason behind this finding might be that cpitn index is based on the measurement of pocket depth and does not record the gingival recession . Although it is most frequently used index in the assessment of periodontal disease being a simple, easy, and having international uniformity for screening the population at large scale . Overall, prevalence and severity of periodontal disease increases with age that is similar with other published studies which have shown that increasing severity of periodontal diseases is due to the untreated cumulative effect of disease process over a period of time instead of ageing process . Males were more affected with moderate and severe periodontitis as compared to females that is also consistent with the other reported studies . The factors responsible for this finding may be that males are less health conscious and have poorer oral hygiene than females due to heavy deposition of plaque and calculus . There is difficulty in comparing the data of such observational studies because the results depend upon several factors such as, study designs, sample size, eligibility criteria, recording of data, criteria for assessment of disease, microbial pathogens, disease activity and multifactorial nature of periodontal diseases including age, gender, socioeconomic status, educational status, stress and genetic factors and control of these factors is challenging . A total of 2786 (95.54%) sextants was included and 130 (4.45%) sextants were excluded from the 486 subjects . Maximum sextants were excluded in the age group of 65 - 74 years due to either partially edentulism or absence of functional teeth due to periodontal disease or dental caries . Few sextants were excluded in the age group of 15 - 19, 20 - 24, and 25 - 34 years that was due to the history of trauma at a young age . Calculus (code 2) was found in the maximum number of sextants similar to subjects . In the present study, the findings suggest that only 17.90% subjects and 11.48% sextants need complex treatment . On the other hand, approximately 77.98% subjects and 73.15% sextants require either oral hygiene instructions or oral hygiene instructions or oral prophylaxis . Finally, the results indicates that majority of the population need primary and secondary level of preventive program to educate, motivate and instruct people about oral hygiene maintenance and provide the treatment in its early stages to reduce the chances of initiation or progression of periodontal diseases . Periodontal diseases were found to be 96.30% (highly prevalent) in the study population, and most participants required oral hygiene instructions and oral prophylaxis . To prevent or minimize the progression of the disease, more number of oral health surveys will help in planning of preventive health program at large scale in the beneficence of the society . Qualitative research should be done for welfare of community through systematic science and community programs and improved oral health literacy, community education, community - based interventions, and accessible dental services at the primary or community health centers should also be provided to improve the oral as well as systemic health.
|
Classical pcr - ligation strategy is the most familiar one to clone for its convenience and efficiency . In long cds cloning, pcr and sequencing are the most challenging steps . Dna is not easily amplified from complementary dna (cdna) for many reasons, e.g. Cdna may not be in good quality, primers are easier to miss - prime during long extending time, gc - rich region will stop dna polymerizing . On the other hand, fidelity is far from our satisfactory . In addition, long fragment sequencing will be troublesome for both time and money cost on intermediated sequencing and primer synthesis . That's why large gene, in many cases, have to be interrupted into several domains to imitate the whole gene function 1 . To solve the problem, somebody will turn to golden gate ligation system . Because the cutting sequences of the two enzymes are not restricted, the overhanging 4 nucleotides could give at most 256 different patterns of cohesive ends . This dramatically increases the choices for our consideration to assemble small fragments into a long one 5 - 7 . However, if our target long cds contains bbsi or bsai restriction sites, golden - gate ligation system will not work well . Besides, this strategy requires elite skills on cohesive end selecting and designing, it will not be favored by many scientists even though it is widely used in talen tandem assembly 8 . We found a strategy to clone large fragments of dna by dividing them to short pcr fragment cloning, followed by restriction digestion and ligation cloning 9 . This strategy shows dominance in amplifying efficiency, it helps overcome pcr problem, and constructs very big clones without turning to complex reagents and technologies, like red / et system10 or tar system 11, 12 . This strategy shows potential in handling long cds clones, including introducing mutation, deleting and inserting domains . Here, we name it restriction - based multiple - fragment assembly strategy . A slight modification was added to make it more compatible to sequencing system and easier for us to handle random mutation . A series of experiments were done to judge its efficiency and universality . In this modified strategy, instead of pcr - amplifying the entire cds, we amplify short fragments, which are no longer than 1,500bp, spanning the whole cds . Since sanger sequencing's read length is 800bp, 1,500bp is very friendly to bi - directional sequencing strategy . Sequence - proved fragments were released by restriction digestion and assembled into our target vectors in a ligation system . Since the digestion and ligation sub - cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (orf). In this study, mago2 (nm_153178.4) was submitted to nebcutter v2.0 (http://nc2.neb.com/nebcutter2/) 13 for restriction analysis . Results showed mago2 contains an xhoi restriction site which breaks mago2 cds into 1.4 kb and 1.1 kb two fragments . Each interrupted fragments were pcr - amplified from n2a cdna using primers mago2f1 (5'-acg gat ccg cca cca tgt act cgg gag ccg gcc ccg ttc-3'), mago2r1 (5' -act tgc ata cac agg agt t-3'), mago2f2 (5'-agc gcc agt gta cag aag tc-3') mago2r2 (5'-acg aat tca gca aag tac atg gtg cgc ag-3') by kod - fx (cat: kfx-101). Pcr was processed 28 cycles on eppendorf thermos - cycler (eppendorf ag 22331 hamburg) with the denaturing temperature at 94 for 30seconds, annealing temperature at 58 for 30seconds, followed by extending temperature at 68 for 1min / kb . Pcr product was purified (guangzhou dongsheng biotech) and ligated (fermentas #k1423) to pbluescript - ksii that had been digested with ecorv to give blunt end . Ligation product was transformed into top 10 competent e. coli . And plated onto lb agar plate supplemented with x - gal, iptg and ampicillin . Purified fragments were ligated to pcdna3.1-myc / his a that had been digested by bamhi and ecori in one ligation system . This strategy to clone long dna fragment takes advantage of the dominance of short fragment pcr . But, full - length pcr product showed smear at 500bp and 1,000bp (figure . After our analysis, hxrn1 cds would be divided into 4 short fragments (a, b, c, d) with their lengths at 0.7 kb, 1.5 kb, 1.4 kb, 1.4 kb adjoined by endonucleases aflii, hindiii, ecori . At the same time we got ksii - cd . Again, we repeated the processes above and got pcdna3.1-myc / his - hxrn1 (figure . Hxrn1 full length pcr showed no band at all; while fragments pcr shows clear and bright bands (figure . This means that short fragments are much more easily amplified and products are more accurate . Next, hxrn1 4 fragments were used to measure one round assembling efficiency of 2 fragments (a / b), 3 fragments (a / b / c) and 4 fragments (a / b / c / d). After overnight growth, 20 clones of each plated were picked for colony pcr . In 2 fragments system, 16 positive clones were checked, in 3 fragments system, 15 positive clones were checked, in 4 fragments system, only 6 positive clones were checked (figure 3). Results showed that the more fragments are tried in an assembly system; the lower success rate is checked . To overcome the efficiency problem, we recommend two or more round of assembly, as it has been processed on pcdna3.1-hxrn1 . In order to know how universal this strategy is, we searched the entire human and mouse cds in ccds database 15 to see how many of them will benefit from our strategy . Sequences were checked in our python script (supplementary material s1) if they were longer than 1,500bp, if 15 candidate restriction sites (apai, bamhi, bglii, ecori, hindiii, kpni, ncoi, ndei, nhei, noti, saci, sali, sphi, xbai, xhoi) could be found only once on a cds, and then if the distance between adherent restriction sites are no longer than 1,500nt . Our data showed 12118 in 29064 human cdss and 9479 in 23874 mouse cdss were longer than 1,500 (supplementary material s2). Further, 8304 in 12118 in human and 6678 in 9479 mouse meet our requirements (supplementary material s3). Sequences meet our requirement are good candidates for restriction - based multiple - fragment assembly strategy . This data strongly suggests our strategy is potential to solve most long cds cloning problem . Furthermore, we can increase the number by referring more restriction sites or turning to other ligation free system 16 . In this study, first, we discuss multiple - fragment assembly strategy's dominance in pcr amplifying efficiency by amplifying short fragment rather than long one . Fourth, we programmed a script to test its universality in the entire cds, and find a great number (~70%) of long cds problem will benefit from it.
|
Acute promyelocytic leukemia (apl), m3 subtype of acute myeloid leukemia (aml) is characterized in the majority of cases by proliferation of neoplastic hypergranlar promyelocytes and blast . The biological and clinical heterogenicity of apl is based on the clinical presentation of the disease and various characteristics of leukemic cells at diagnosis . Patients with apl typically present with low white blood counts, peripheral blood cytopenias and coagulopathy . We report a case of apl- hypogranular variant that poses particular diagnostic challenge because of its atypical morphology . A 30-year - old male presented with severe anemia, bilateral subconjunctival haemorrhage and petechial skin rashes . Hematological examination showed a low hemoglobin count (9.0 gm%), total leucocyte count was markedly raised (80,000 cells / cu) with predominance of promyelocytes and blasts on differential count and platelet count of 34,000 cells / cu . Coagulation studies showed prothrombin time (pt) to be 15.2 s, activated partial thromboplastin time (aptt) 27.5 s and fibrinogen 1.05 peripheral blood cytomorphology showed promyelocytes with a characteristic bilobed or reniform nucleus; with majority of the cells either devoid of granules or contained only a few fine azurophil granules (figure 1). The bone marrow aspirate was markedly hypercellular and frankly leukemic, 95% cells were blasts with bilobulated nucleus and fine dust like cytoplasmic granules . Molecular cytogenetic analysis by fluorescent in situ hybridization (fish) was used to investigate chromosomal abnormalities associated with the leukemic process and found out to be translocation of chromosome 15 and 17, i.e., t(15;17) (figure 3). Acute promyelocytic leukemia: fish technique shows chromosomal translocation, t(15;17). In view of the atypical blasts morphology, a provisional diagnosis of hypogranular variant of aml - m3v was suggested . The patient was immediately started on all trans - retinoic acid (atra) and cytarabine and is progressing well after 12 months of follow up period . This case report emphasizes the importance of a high index of suspicion for the diagnosis of acute promyelocytic leukemia, the hypogranular variant in particular . Overall, classical hypergranular and hypogranular variant constitute 58% of cases of aml in different western series, and hypogranular variant comprises 1/3 of all cases of acute promyelocytic leukemia . Both apl subtypes share a common pathogenic pathway, namely presence of t(15;17)(q21;q22) translocation and a similar clinical picture, namely consumptive coagulopathy at presentation (table 1). They are responsive to differentiation therapy with all trans - retinoic acid (atra) and compete remission in seen in> 80% cases . Quite similarly our case is progressing well after 6 months of follow of period . Grignani et al . Have asserted that fish is rapid and cost - effective when compared to classical cytogenetics, to establish diagnoses for the specific translocation t(15;17) in apl patients . Proper diagnosis of apl is critical for two reasons: i) anticipating complications due to disseminated intra - vascular coagulation (dic) and ii) treatment with tretinoin (all - trans - retinoic - acid) for complete remission in about 80% of patients . Table 1a comparison of classical hypergranular and hypogranular variant.hypergranularhypogranulardefinitionaml subtype in which maturation arrests in promyelocytic stage.clinicaldisseminated intravascular coagulation / consumption coagulopathywbclowhighnucleusround to ovalbilobedcytoplasmdensely packed large azurophilic granules, multiple auer rods, aggot cells.granules apparently absent, typical hypergranular promyelocytes exists in small numbercytochemistrymyeloperoxidase and sudan black - b strongly positiveimmunophenotypecd 33 +, cd 34/+, cd15/+; cd 56/+; hla dr positivecd 13 +, cd 34 +, hla dr negativecytogeneticst(15;17) (q22;q12) to conclude, the therapeutic option and prognostic implication in apl - variant has made early diagnosis of paramount clinical significance . Although, the cytogenetic and immunophenotypic signature should be referred to in diagnosing apl, from the practical point of view, other parameters, such as cytomorphology and cytochemistry are still important tools for rapid recognition of apl.
|
Decoy receptor 3 (dcr3) also referred to as tr6, m68, or tnfrsf6b is a family member of the tumor necrosis factor receptor (tnfr) superfamily . Dcr3 has been described in many malignant tumors, such as gastric, hepatocellular, colon, lung, cervical, ovarian, and breast cancer . A gastrointestinal cancer meta - analysis reported that overexpression of dcr3 was closely related with clinicopathological features, including tnm stage, grade of differentiation, lymph node metastasis, infiltration degree, and distant metastasis . The present study is the only meta - analysis on the relationship between dcr3 and malignancies . Female reproductive cancers are among the most common causes of cancer - related death, including breast cancer, ovarian cancer, uterine corpus cancer, and cervical cancer . Some genes and molecules are particularly useful as tracking, identifying, and validating biomarkers for diagnosis and treatment of female reproductive cancers [911]. Although some studies have explored the role of dcr3 overexpression in cervical cancer, ovarian cancer, and breast cancer, there is still no summary evidence for the association between dcr3 and overall female reproductive cancers . Therefore, we conducted the present meta - analysis to explore the relation between the level of dcr3, clinicopathological characteristics, and survival of female reproductive cancer patients . Pubmed, wiley online library, web of science, science direct, cochrane central register of controlled trials, google scholar, embase, ovid, lilacs, chinese cnki, chong qing vip, wan fang, and china biology medicine disc were searched up to 30 september 2015 with a random combination of the terms: dcr3 or tr6 or m68 or tnfrsf6b, cervical or ovarian or ovary or oophoro * or uterine or breast or endometrial or choriocarcinoma or fallopian tube and cancer or tumor or carcinoma or neoplas * or malignan*. All of the relevant literature, including review articles and potential references, were searched for additional pertinent studies . Articles were searched and screened by 2 investigators independently . In the meta - analysis, studies that met the following criteria were eligible: (1) patients in studies were clearly diagnosed with cervical cancer, ovarian cancer, or breast cancer, as well as other female reproductive cancers; (2) studies included were case - control studies and evaluated the relationship between dcr3 expression and clinicopathological features or prognosis in female reproductive cancers; (3) the definition of dcr3-positive was tested by immunohistochemistry (ihc) method; (4) sufficient information of the correlation of dcr3 with clinicopathological features or overall survival time was provided to estimate odds ratio (or) and hazard ratio (hr); and (5) articles were written in english or chinese . Two independent reviewers read full texts of all eligible studies and extracted relevant data, including author, year, country, cancer type, patient number, test method, clinicopathological parameters (age, tnm stage, grade of differentiation, and lymph node metastasis), and overall survival time . The heterogeneity between the studies was evaluated by i test . According to the results of heterogeneity analysis the software engauge digitizer 4.1 was used to extract the survival data from a k - m curve in some articles . Pubmed, wiley online library, web of science, science direct, cochrane central register of controlled trials, google scholar, embase, ovid, lilacs, chinese cnki, chong qing vip, wan fang, and china biology medicine disc were searched up to 30 september 2015 with a random combination of the terms: dcr3 or tr6 or m68 or tnfrsf6b, cervical or ovarian or ovary or oophoro * or uterine or breast or endometrial or choriocarcinoma or fallopian tube and cancer or tumor or carcinoma or neoplas * or malignan*. All of the relevant literature, including review articles and potential references, were searched for additional pertinent studies . Articles were searched and screened by 2 investigators independently . In the meta - analysis, studies that met the following criteria were eligible: (1) patients in studies were clearly diagnosed with cervical cancer, ovarian cancer, or breast cancer, as well as other female reproductive cancers; (2) studies included were case - control studies and evaluated the relationship between dcr3 expression and clinicopathological features or prognosis in female reproductive cancers; (3) the definition of dcr3-positive was tested by immunohistochemistry (ihc) method; (4) sufficient information of the correlation of dcr3 with clinicopathological features or overall survival time was provided to estimate odds ratio (or) and hazard ratio (hr); and (5) articles were written in english or chinese . Two independent reviewers read full texts of all eligible studies and extracted relevant data, including author, year, country, cancer type, patient number, test method, clinicopathological parameters (age, tnm stage, grade of differentiation, and lymph node metastasis), and overall survival time . The heterogeneity between the studies was evaluated by i test . According to the results of heterogeneity analysis the software engauge digitizer 4.1 was used to extract the survival data from a k - m curve in some articles . 393 were excluded after reviewing the titles and abstracts because these articles described non - human experiments or other cancer types . Then, due to duplication or no report of any relevant outcomes, 26 of the remaining articles were excluded (figure 1). Finally, a total of 12 eligible studies [57,1220] with 1127 participants were included in this meta - analysis . The test method of all included studies was only ihc . In this meta - analysis, we assessed the correlation between dcr3 expression and cancer risk, clinicopathological features, and overall survival time of patients with female reproductive cancers . As shown in figure 2, overexpression of dcr3 was associated with female reproductive cancer risk (or=10.69, 95% ci: 6.3318.05). Furthermore, subgroup analysis showed a consistent trend; for example, cervical cancer (or=7.97, 95% ci: 4.7013.49), ovarian cancer (or=14.03, 95% ci: 3.1662.01), and breast cancer (or=19.35, 95% ci: 4.4684.03). In analysis of female reproductive cancer patients regardless of subtype, 3 clinicopathological parameters were found to be significantly associated with overexpression of dcr3 as compared to controls: advanced tnm stage (or=5.51, 95% ci: 2.8310.71), poor grade of differentiation (or=4.16, 95% ci: 2.287.60), and lymph node metastasis (or=5.89, 95% ci: 3.1610.96). In the sub - analysis, a stronger association was found between tnm stage and patients with overexpression of dcr3 in ovarian cancer (or=6.80, 95% ci: 2.5018.50) than in cervical cancer (or=4.76, 95% ci: 1.7413.01) or breast cancer (or=3.73, 95% ci: 0.7319.09, figure 3). As shown in figure 4, for each type of cancer, a concordant relationship was also observed between dcr3 expression and grade of differentiation: cervical cancer (or=7.70, 95% ci: 1.8931.38), ovarian cancer (or=4.32, 95% ci: 1.7110.92), and breast cancer (or=3.56, 95% ci: 0.7916.00). In sub - analysis of association between patients with different cancers with overexpression of dcr3 and lymph node metastasis, cervical cancer had the highest rank (or=14.64, 95% ci: 2.4189.04), ovarian cancer was second (or=5.79, 95% ci: 1.1329.80), and breast cancer was third (or=5.10, 95% ci: 2.2511.59) (figure 5) (all p<0.05). However, as shown in figures 6 and 7, there was no association between dcr3 overexpression and the age of female reproductive cancer patients (or=0.85, 95% ci: 0.511.44, p=0.554) or overall survival time (or=1.84, 95% ci: 0.585.83, p=0.300). As shown in figure 8, begg s test suggested that there was no publication bias for risk of female reproductive cancers (p=0.097), tnm stage (p=0.559), grade of differentiation (p=0.156), lymph node metastasis (p=0.345), age (p=0.685), or overall survival time (p=0.394). 393 were excluded after reviewing the titles and abstracts because these articles described non - human experiments or other cancer types . Then, due to duplication or no report of any relevant outcomes, 26 of the remaining articles were excluded (figure 1). Finally, a total of 12 eligible studies [57,1220] with 1127 participants were included in this meta - analysis . In this meta - analysis, we assessed the correlation between dcr3 expression and cancer risk, clinicopathological features, and overall survival time of patients with female reproductive cancers . As shown in figure 2, overexpression of dcr3 was associated with female reproductive cancer risk (or=10.69, 95% ci: 6.3318.05). Furthermore, subgroup analysis showed a consistent trend; for example, cervical cancer (or=7.97, 95% ci: 4.7013.49), ovarian cancer (or=14.03, 95% ci: 3.1662.01), and breast cancer (or=19.35, 95% ci: 4.4684.03). In analysis of female reproductive cancer patients regardless of subtype, 3 clinicopathological parameters were found to be significantly associated with overexpression of dcr3 as compared to controls: advanced tnm stage (or=5.51, 95% ci: 2.8310.71), poor grade of differentiation (or=4.16, 95% ci: 2.287.60), and lymph node metastasis (or=5.89, 95% ci: 3.1610.96). In the sub - analysis, a stronger association was found between tnm stage and patients with overexpression of dcr3 in ovarian cancer (or=6.80, 95% ci: 2.5018.50) than in cervical cancer (or=4.76, 95% ci: 1.7413.01) or breast cancer (or=3.73, 95% ci: 0.7319.09, figure 3). As shown in figure 4, for each type of cancer, a concordant relationship was also observed between dcr3 expression and grade of differentiation: cervical cancer (or=7.70, 95% ci: 1.8931.38), ovarian cancer (or=4.32, 95% ci: 1.7110.92), and breast cancer (or=3.56, 95% ci: 0.7916.00). In sub - analysis of association between patients with different cancers with overexpression of dcr3 and lymph node metastasis, cervical cancer had the highest rank (or=14.64, 95% ci: 2.4189.04), ovarian cancer was second (or=5.79, 95% ci: 1.1329.80), and breast cancer was third (or=5.10, 95% ci: 2.2511.59) (figure 5) (all p<0.05). However, as shown in figures 6 and 7, there was no association between dcr3 overexpression and the age of female reproductive cancer patients (or=0.85, 95% ci: 0.511.44, p=0.554) or overall survival time (or=1.84, 95% ci: 0.585.83, p=0.300). As shown in figure 8, begg s test suggested that there was no publication bias for risk of female reproductive cancers (p=0.097), tnm stage (p=0.559), grade of differentiation (p=0.156), lymph node metastasis (p=0.345), age (p=0.685), or overall survival time (p=0.394). Overexpression of dcr3 has been found in many malignant tumors, but, as reported, dcr3 overexpression could not be detected in non - tumor tissues . Studies have shown that dcr3 regulates the activity and differentiation of immune cells, and regulates apoptosis . First, dcr3 can act as a functional fasl decoy receptor that can bind to fas ligand (fasl) and inhibit tumor cell killing . Second, dcr3 might promote tumor growth by attenuating the th1 response and suppressing cell - mediated immunity [2325]. (dcr3 fusion protein with immunoglobulin fc) is able to modulate the expression of a few macrophage markers, including cd14, cd16, cd64, and human leukocyte antigen - dr, suggesting that dcr3 fc might have potent, suppressive effects in down - regulating the host - immune system [2628]. Fourth, dcr3 can inhibit stromal cell - derived factor 1 chemotaxis of t lymphocytes, thus reducing the organization of cd4 + and cd8 + t lymphocyte infiltration . Fifth, dcr3 induces the apoptosis of dendritic cell (dc) via activating pkc - delta and jnk, then up - regulates dr5 to recruit fas - associated death domain (fadd) to propagate the apoptotic signals . The functions and mechanisms might not be completely the same in these 3 types of female reproductive cancers . In breast cancer, dcr3 may be regarded as a negative regulator of cancer aggressiveness during development and progression of certain types of breast cancer by using anti - dcr3 monoclonal antibody and anti - dcr3 hammerhead ribozyme transgenes in breast cancer cells . Studies have reported that lymphatic microvessel density (lmvd) was elevated in the cancer tissue and lymph node with metastasis, and dcr3 may promote lymph node metastasis of breast cancer by inducing the formation of new lymphatic vessels and increasing opportunities for lymph node metastasis . Wang et al . Reported that after the treatment of dcr3 neutralized with dcr3 antibody, the effect on proliferation of breast cancer cell line was decreased, while addition of fas - l and dcr3 enhanced proliferation . One of the main mechanisms may be that dcr3 blocks the fas - l - induced apoptosis . In cervical cancer, peyre et al . Reported that the number of t cells was significantly lower in peripheral blood of cervical cancer patients, and there was an obvious negative correlation between dcr3 expression and cd3 +, cd4+/cd8+t in peripheral blood . Therefore, they presumed that dcr3 is related to tumor immune escape in patients with cervical cancer . The expression and distribution of t cells in local tissues of cervical cancer can reflect immune status in the body . In ovarian cancer, lin et al . Reported that the proliferation of caov3 cells was significantly decreased by dcr3 sirna in comparison with the normal control group and negative control group, indicating that dcr3 sirna can inhibit the proliferation of ovarian cancer cell line caov3 by recognizing and degrading dcr3 mrna . It has been reported that dcr3 is expressed by epithelial ovarian cancers, concentrated in ascites, and ovarian cancer with high levels of dcr3 is associated with fas - l - induced apoptosis and platinum resistance . Several clinicopathological characteristics are known to be associated with poor prognosis, including large tumor size, advanced tumor stage, poor differentiation, deep invasion, lymph node metastasis, perineural invasion, and lymphatic and vascular invasion [3741]. A previous meta - analysis reported that overexpression of dcr3 was closely related with some clinicopathological features, including tnm stage, grade of differentiation, lymph node metastasis, infiltration degree, and metastasis in gastrointestinal cancer . Some researchers have reported close correlations between dcr3 expression and prognosis of female reproductive cancer, but no clear evidence was provided . Our analysis suggests that overexpression of dcr3 is related to risk of female reproductive cancer, advanced tnm stage, poor differentiation, and worse lymph node metastasis . After subgroup analysis, overexpression of dcr3 in cervical cancer, ovarian cancer, and breast cancer all had a consistent relationship with these clinicopathological parameters . To the best of our knowledge, the present meta - analysis is the first to explore the potential relationship between dcr3 expression and female reproductive cancers . First, we only included 12 studies (including 1127 female reproductive cancers patients), in which just 3 studies (including 290 female reproductive cancers patients) investigated the correlation between dcr3 expression and overall survival time . Therefore, the association of dcr3 expression with overall survival time still needs to be studied in a larger number of samples . Second, there could be potential country bias in our meta - analysis, because only 1 study was performed in the usa, and the patients in the other 11 studies were chinese . Third, although we aimed to study the relationships between dcr3 expression and all female reproductive cancers, only 3 types of female reproductive cancers were recently eligible: cervical, ovarian, and breast cancer . We will continue to study the relationship between dcr3 expression and other female reproductive cancer types, such as ovary, endometrial, choriocarcinoma, and fallopian tube cancer, and we will update our meta - analysis accordingly . Our meta - analysis indicates a positive association between the overexpression of dcr3 and carcinogenesis, deterioration, and progression of female reproductive cancers . In conclusion, female productive cancer risk is strongly dependent on overexpression of dcr3, and dcr3 may be used as a biomarker to predict unfavorable cancer prognosis . In addition, our group has previously proved that dcr3 neutralizing antibodies can suppress cell growth and induce apoptosis in glioma cells, which suggests that dcr3 could be a target in molecular therapy in cancers, including female reproductive cancers.
|
Anthrax, a zoonotic disease caused by bacillus anthracis (b. anthracis), primarily affects herbivores including sheep, cattle, horses, and other domestic animals.1 humans may be affected as a result of exposure to an infected animal or animal products . This organism has received recent attention as a potential agent of bioterrorism.1 three forms are described: cutaneous, inhalational, and gastrointestinal.1 we describe a patient with oculocutaneous anthrax . A 39-year - old male presented to our outpatient clinic with a 4-day history of fever and swelling of the left upper and lower eyelids associated with pain, watering, and difficulty in opening the eyelids . The patient reported that he was prescribed tablets and injections by a general practitioner, but was unable to provide details of this treatment to us . On examination, there was brawny nonpitting edema of the upper and lower eyelids of the left eye and left side of the face (figure 1). There was an ulceration and black discoloration along the left lower lid margin with serosanguinous discharge . Serous fluid from the eyelid and blood were collected and sent for conventional cultural methods and polymerase chain reaction (pcr) test . A 39-year - old male presented to our outpatient clinic with a 4-day history of fever and swelling of the left upper and lower eyelids associated with pain, watering, and difficulty in opening the eyelids . The patient reported that he was prescribed tablets and injections by a general practitioner, but was unable to provide details of this treatment to us . On examination, there was brawny nonpitting edema of the upper and lower eyelids of the left eye and left side of the face (figure 1). There was an ulceration and black discoloration along the left lower lid margin with serosanguinous discharge . Serous fluid from the eyelid and blood were collected and sent for conventional cultural methods and polymerase chain reaction (pcr) test . The patient s dna was extracted using the qia amp dna blood mini kit (qiagen, hilden, germany) according to the manufacturer s instruction . A 596-bp fragment of the protective antigen (pa) gene, pa (f)-tcc taa cac taa cga agt cg and pa (r)-gag gta gaa gga tat acg gt and a 846-bp fragment of the capsule (cap) gene, cap (f)-ctg agc cat taa tcg ata tg and cap (r)2,3 of b. anthracis were used as the target for anthrax pcr . The dna was amplified in a total volume of 50 l with the above mentioned primers, 200 m (each) deoxynucleotide triphosphates, 1x pcr buffer, 1.5 mm mgcl2 and 2.5 units of taq polymerase (amplitaq gold - applied biosystems, california, usa) and followed by the addition of 5 l of the template dna . Thermal cycling was performed at 94c for 5 minutes (initial denaturation) followed by 35 cycles at 94c for 1 minute, 52c for 1 minute (annealing), 72c for 2 minutes (extension) and the final extension at 72c for 5 minutes; cooled to 4c.4 thermal cycling was done in the gene amp pcr system 9200 (applied biosystems, california, usa). A 15 l portion of the pcr product and 5 l of 10% tracking dye (0.02% xylene cyanol, 0.02% bromophenol blue and 50% glycerol) was added to the pcr tube . Fifteen microliters of this mix were loaded into the wells in the agarose (amersham pharmacia, new jersey, usa). The pcr products were analyzed by submarine gel electrophoresis through a 1% agarose gel in 1x tae buffer . The gel was run at 120 volts for 60 minutes, stained with 0.5 g / ml of ethidium bromide (amersham pharmacia, new jersey, usa), visualized and recorded under uv4 in the gel doc 2000 system (bio - rad, california, usa). The gene ruler 100-bp (3000100bp) dna ladder plus (mbi fermentas, usa) was used as the molecular standard . The pcr from the fluid and the blood were positive for the gene encoding the protective antigen (pa gene) and the capsule (cap gene) of b. anthracis (figure 2). The patient was started on injection crystalline penicillin, 2 million international units (1250 mg) every 2 hours intravenously . No topical therapy was prescribed, however, the patient was given anti - inflammatory agents (ibuprofen). On completion of a 10-day course of intravenous antibiotics, he was discharged on oral penicillin g 500 mg every 6 hours . Although the eschar reduced in size over time, it was firmly adhered to the underlying tissue . When the eschar was removed after 1 month of the onset of illness, an ulcerated undersurface was observed (figure 4). The ulceration healed over the next 2 weeks with scarring and ectropion of the left lower lid (figure 5). The low grade lid edema and mechanical ptosis of the left upper eyelid resolved over the next few weeks . B. anthracis is commonly found in agricultural environments . It is a gram - positive, aerobic, endospore - forming bacilli that, in the vegetative form, has a poor survival rate outside an animal or human host.5 it is capable of producing fatal infection in livestock and in humans.1 anthrax is considered to be one of most dangerous biological weapons.6 humans are infected when spores are introduced into the body by contact with infected animals or animal products.1 cutaneous anthrax has been reported to occur as preseptal cellulitis in the eyelids.7,8 cutaneous anthrax, if untreated, leads to life - threatening septicemia.1 this report highlights that a high index of clinical suspicion and prompt institution of appropriate therapy are essential for a successful outcome . Since lesions can become sterile within 24 hours of antimicrobial therapy, confirmation of diagnosis can be made using pcr,24,9 as was done in our patient, when the conventional cultural methods fail to identify the etiology or when patients have already received antimicrobial therapy.
|
At present, selecting a type of prosthetic heart valve for surgical correction of acquired cardiac failure represents a topical issue for modern medicine . Biological or mechanical prosthetic heart valve are available options . In particular, xenogeneic tissue treated by fixatives and preserving solutions is applied in the former, whereas in the latter various synthetic materials were applied (plastic, polymers, etc . ). Perhaps one of the criteria for selecting type of prosthesis might be a response of immune system to implanted xenogeneic material . Indeed, a foreign body is literally placed into the blood flow, which constantly contacts with blood cells and surrounding tissues and could eventually cause inflammatory and, perhaps, autoimmune reactions . Character and intensity of such reactions are subject to thorough investigation in order to, on one hand, select proper prosthetic heart valve and, on the other hand, develop approaches for improving prostheses and preventing complications and their dysfunctions . Previously, it was found that biological compared to mechanical prostheses may cause inflammatory complications . Despite this, other data from long - term studies revealed no significant differences between biological and mechanical prostheses in terms of subsequent complications . Previously, types of immune response developed to implanted prosthesis were discussed as well . For this, a range of cells infiltrating prosthesis was examined . It was demonstrated that t cells infiltrate pannus while investigating removed biological and mechanical prostheses . Upon that, quantity of the cells found inside infiltrate differed and varied depending on intensity of local inflammatory response . Examination of the removed mechanical prostheses demonstrated that they contained more cd15, cd68, cd3, factor viii cells upon verified infectious etiology of prosthetic failure compared to infection - free samples . In case of lacking infection accompanied by a marked fibrosis similar comparative examination of the removed biological prosthetic heart valves demonstrated that profound infiltration of prosthetic tissues with macrophages (cd68) and t cells (cd3) occurs in case of any prosthetic dysfunction . By analyzing 17 removed medtronic freestyle bioprostheses with average implant duration of 71.1 35.2 months it was found that signs of chronic inflammatory reaction affecting the xenograft arterial wall were observed in 15 cases . Infiltrates consisted of macrophages and lymphocytes including b and t cells . During the study, it was concluded that t cells responded to implanted foreign porcine tissues with development of significant damage of host aortic wall . It is assumed that inadequately fixed tissues of porcine aorta resulting in subsequently retained antigenicity might be one of potential causes of developing inflammation . A hypothesis is confirmed regarding causes underlying development of immune reactions against implanted biological tissue related to residual antigens of animal origin retained despite special treatments and decellularization [7, 8]. It becomes evident that both mechanical and biological prosthetic heart valves are associated with tissue reactions developing against implanted foreign materials . Upon that, macrophages, neutrophils, and t cells are the major players of cellular immunity in this process . However, dynamic changes of their quantities in systemic blood flow, participation in pathogenesis of responses against foreign materials, and potential diagnostic importance were poorly investigated . In connection with this, our study was aimed at assessing t cell subsets of peripheral blood from recipients of long - term functioning biological and mechanical heart valve prostheses . All patients underwent replacement of mitral valve including 25 persons with biological and 7 with mechanical prosthesis . Characteristics of patients, etiology of heart defect, comorbidities, and duration of prosthesis functioning are presented in table 1 . Surgical treatment and follow - up were done at the research institute for complex issues of cardiovascular diseases (kemerovo, russia). All patients underwent follow - up examination every six months after surgical correction . In comparison group 48 samples of peripheral blood from ulnar vein were collected from patients and healthy volunteers into test tubes containing 3edta . To characterize t cell phenotypes the following combinations of monoclonal antibodies (beckman coulter, usa) were used: (1) anti - human cd45ra - fitc (cat . Im2467, clone ucht1); (2) anti - human cd45ra - fitc (cat . Briefly, 100 l of peripheral blood cells was stained with each combination of antibodies according to the manufacturer's instructions for 15 minutes in the dark, at room temperature, followed by lysing red blood cells with versalyse lysing solution (cat . The absolute number of leukocytes, lymphocytes, granulocytes, and monocytes was counted by using hematology analyzer mek-6400 (nihon kohden, japan). Stained samples were analyzed by running a four - color flow cytometry with facscalibur (becton - dickinson, usa) and navios (beckman coulter, usa). Mathematical processing of the flow cytometry data was performed by using kaluza v.1.2 (beckman coulter, usa) software . A threshold was set to a forward - scatter (fsc) parameter to exclude cell debris . The ssc and fsc settings were done with linear amplification and the logarithmic amplification scale was used for the fluorescence channels and dot plot analysis . Fluorescence - minus - one gating techniques were used to evaluate thresholds for positivity of individual antibodies . The following cd4 and cd8 t cell subsets were analyzed: nave (n, cd45racd62l), central memory (cm, cd45racd62l), effector memory (em, cd45racd62l), and terminally differentiated cd45ra - positive effector memory (temra, cd45racd62l) according to cd45ra and cd62l expression . Lymphocytic cells were gated according to forward - scatter (fsc) and side - scatter (ssc) properties . Representative bivariate dot plots of the isolated lymphocyte populations from human peripheral blood samples are presented . Cd3cd4 t helper and cd3cd8 cytotoxic t cells are shown on dot plots, respectively . Immunophenotyping was done by analyzing flow cytometry data after costaining with cd3 and cd4 or cd3 and cd8 cell surface markers on fsc / ssc gated lymphocytes, respectively (figure 1). Statistical analysis of the data was done by using statistica 7.0 and graphpad prism software . The data are presented as median () values and interquartile range (25; 75%). Significance of differences between data was evaluated by applying nonparametric mann - whitney u test and w - wilcoxon test . A stepwise analysis enumerating steps, p value significance level, and f - test were performed . Significance of an identifying criterion was determined after drawing scatterplots of canonical values and calculating classification value and mahalanobis squared distance . Parameters of hemogram (wbc total, count of neutrophils, lymphocytes, and monocytes) were shown to lack differences between patients with biological and mechanical heart valve prostheses as well as healthy volunteers (table 2). While examining t cell arm of immunity it was found that recipients with biological and mechanical heart valve prostheses did not differ in terms of both relative and absolute counts of all examined t cell subsets . At the same time, these parameters were shown to differ when compared with healthy volunteers (table 3). Recipients of both mechanical and biological heart valve prostheses were found to have reduced counts of cd3 cells compared to healthy volunteers . Patients with biological prostheses had significantly lower relative and absolute amounts of cm tcyt and nave tcyt compared to healthy volunteers; conversely, amount of temra tcyt and temra th cells was elevated . Patients with mechanical heart valve prostheses were documented to have increased relative and absolute amount of temra tcyt compared to healthy volunteers . In addition, relative amount of th (cd3cd4) cells was also found to decline compared to healthy volunteers . In contrast, no significant differences were found in examined parameters of t cell subsets from patients with biological heart valve prostheses versus healthy volunteers . Moreover, no correlation between hemogram parameters and duration of prosthesis functioning was revealed as well . Representative distribution of t cell subsets among patients with mechanical versus biological heart valve prostheses is shown in figures 2 and 3 . A discriminant analysis done using a forward stepwise model consisting of 7 steps demonstrated the highest significance level while verifying counts of temra tcyt relative, cd3 relative, nave th relative, em tcyt relative, cd3cd8 relative, nave tcyt abs, and partition of the examined groups based on the results of discriminant analysis is depicted in figure 4 . Only in group of biological prosthesis recipients it was possible to analyze the effect of comorbidities to the changes in t cell subpopulations . There were no significant changes in patients with or without chronic ischemic heart disease, diseases of the urinary system, pulmonary, and thyroid diseases . All significant differences between biological prosthesis recipients with comorbidities (diabetes, hypertonic disease, acute cerebrovascular accident, and gi - tract diseases) are presented in the tables 5, 6, 7, and 8 . Among all surface markers used in our study, various cd45 isoforms had the longest history of practical application . As early as in 1988 it was demonstrated that cd45r (now known as cd45ra) protein may be considered as a marker for nave or unprimed t cells, whereas uchl1 antibody recognizing cd45r0 binds to memory t cells . Currently, it is known that nave t cells express cd45 molecules containing all domains within its sequence; however, starting from antigen - specific differentiation maturing t cells begin to express their isoforms resulting from mrna splicing within exon a followed by exons b and c. gene product containing all these domains is known as cd45ra (molecular weight 220 kda), whereas the product derived after final rna modification and lacking all such domains is denoted as cd45r0 (180 kda). Currently, functional significance of various cd45 isoforms remains poorly investigated, which is not true for the rest of surface markers used for phenotyping main stages of maturing t cells . First described cd62l (l - selectin) as a molecule determining direction of migrating nave t cells trafficking into peripheral lymphoid tissues . Moreover, they also demonstrated that nave t cells (cd45ra / r0) mainly expressed cd62l, whereas more mature cd45ra / r0 might be separated as a cell population being both cd62l and cd62l . The latter subset bears adhesion molecules responsible for cell migration into body peripheral tissues . Currently, it is considered that both cd62l and ccr7 markers determine migration of cd3cd4 and cd3cd8 t cells from peripheral blood . By staining for ccr7 and cd62l molecules on the cell surface it allows to denote nave and central memory t cells within the pool of circulatory t lymphocytes . Effector memory and terminally differentiated effector t cells (temra)is accounted for by the fact that these cell subsets function within nonlymphoid tissues . Central memory t cells are characterized by surface expression of cd45r0 instead of cd45ra as well as cd62l, cd27, cd28, and so forth . The main difference of this t cell subset from nave t cells is that they have already passed through antigen - specific differentiation that occurred within the secondary lymphoid tissues . Presence of cd62l on the surface of these cells allows to distinguish them from effector memory t cells with phenotype cd45racd62l . This feature of tcm allows them to circulate around the body for a long period of time and determines their preferential location inside the secondary lymphoid tissues . Upon antigenic stimulation, antigen presenting cells possessing cognate surface ligands allow to rapidly activate t cells with high expression level of cd27 and cd28 followed by successful formation of antigen - specific t cell clones . Moreover, central memory t cells better secrete il-2, whereas effector memory t cells are more effective in synthesizing effector cytokines . In particular, 47 out of 185 patients with morphologically verified acute rejection reaction of transplanted kidney also compared with healthy volunteers were found to possess more differentiated t cells at terminal stage of chronic renal failure . In addition, patients with acute rejection reaction were noted to have signs of dysregulated t cell profile and bear elevated amount of total t cells including nave t cells but lowered count of terminally differentiated memory t cells . However, functional assays demonstrated that the latter subset had upregulated proinflammatory and cytotoxic capacity . In another study, 131 patients with normally functioning transplanted kidney were examined . Among them, increased amount of terminally differentiated memory t cells in 45 patients was associated with restricted tcr v repertoire (cd45raccr7cd27cd28cd8). In 47 patients graft dysfunction (median age = 15 years) was documented . A 2-fold increased risk of developing graft dysfunction was observed in patients with elevated amount of temra cd8 t cells . It was found that patients at reactive stage of kidney graft rejection had elevated relative count of memory cd4 (tem) and terminally differentiated cd8 (temra) t cells compared to patients at quiescence stage and healthy volunteers . In case of acute rejection, a significant decrease in count of cd8 temra high diagnostic significance of increased level of d8 temra and reciprocally decreased nave t cells was observed in patients after bone marrow transplantation and development of chronic graft versus host disease . Investigation of t cell subset repertoire in peripheral blood from patients with implanted biological or mechanical heart valve prostheses demonstrated that t cells strongly responded to foreign material . At that, despite the fact that no significant differences between all examined parameters of t cell immunity were found in recipients of different types of prostheses, some of them, however, significantly differed when compared to healthy volunteers . We assume that altered composition of t cell subsets, namely, decreased counts of cm tcyt, nave tcyt paralleled with elevated amount of emra tcyt, and emra th, points at development of xenograft rejection reaction against both mechanical and biological heart valve prostheses . It seems that despite special treatment of biological material in graft tissues, quite a large amount of xenogeneic tissue antigens still remains (swine valve apparatus). T cells and monocytes become stimulated by foreign antigens that also provoke their migration into donor tissues and in situ activation resulting in release of huge amounts of proinflammatory cytokines . In particular, a whole set of such biologically active molecules may display proosteogenic activity not only supporting local inflammatory reaction, but also leading to collagen degradation and deposition of hydroxyapatites . Altogether, local inflammatory and degenerative changes within prosthetic tissues may result in prosthesis dysfunction . Despite the fact that no correlation between changes in t cell subset repertoire and signs of prosthesis dysfunctioning as well as duration of prosthesis functioning was found, however, it may be assumed that immune cells are involved in developing local changes within prosthetic tissues . At the same time, results of discriminant analysis suggest that t cell subsets from recipients both of biological and mechanical heart valve prostheses display distinguishing signs of response against graft tissues . Moreover, in the future it might be possible to determine diagnostically relevant parameters of t cell subset properties to be used for early diagnostics of host - versus - graft reaction . Unfortunately there are only few articles describing peripheral t cell subset changes in heart disease as well as in other comorbidities . Nevertheless we tried to find out their impact on t cell subset compositions . Studying patients with acute myocardial infarction undergoing primary percutaneous coronary intervention has found that cytomegalovirus - seropositive patients demonstrated a greater fall in the concentration of terminally differentiated cd8 effector memory t cells in peripheral blood during the first 30 minutes of reperfusion compared with cytomegalovirus - seronegative patients . Moreover a significant proportion of temra cells remained depleted for 3 months in cytomegalovirus - seropositive patients . Hereby myocardial ischemia and reperfusion in cytomegalovirus - seropositive patients lead to acute loss of antigen - specific, terminally differentiated cd8 t cells . Type 1 diabetes is an autoimmune process and has other pathogeneses pathways compared to type 2 . Nevertheless while studying 55 patients with type 1 diabetes it was found that percentages and absolute numbers of cm and n cells were reduced, whereas those of temra cells were markedly increased . The indices of intermediate- and long - term glycaemic control were associated negatively with the number of cm and n cells while positively with the number of temra cells . Authors conclude that considerable accumulation of temra t cells suggests lifelong stimulation by protracted antigen exposure (viruses, other agents, or residual self - antigens) or a homeostatic defect in the regulation / contraction of immune responses . Studying t - lymphocyte subsets in patients with severe acute respiratory syndrome (sars) investigators found that cell count of nave cd4 (cd4cd45racd62l) remarkably decreased during the 1st week after the infection . During the 8th12th weeks, the cell counts of nave cd4 subset were still less than those of normal controls, while comparing with those of the 1st week . Authors conclude that it will take more than 812 weeks for cd4 cell and nave cd4 subset to reach to normal levels after sars . In our research all founded significant differences in patients with and without comorbidities (diabetes, hypertonic disease, acute cerebrovascular accidents, and gi - tract diseases) had the common trend . We hypothesize that any chronic diseases could lead to changes in t cell populations because of the participation of immune system . Meanwhile decreased relative and absolute number of central memory and nave cd3cd8 and increased number of cd45racd62lcd3cd8 and cd3cd4 in patients with biological prosthesis were in the common trend regardless of the presence of any comorbidities . That is why we assume that these changes are related to the development of xenograft rejection reaction . Current study contains the following limitations: the number of examined patients with implanted mechanical prostheses was low (7 persons); duration of prosthesis functioning was significantly shorter in this group compared to patients with biological heart valve prostheses . Taking together these limitations may lead to the loss of the significant differences of the patients with mechanical prosthesis comparing with recipients of biological prosthesis and healthy volunteers.
|
Approximately 24 per cent of small bowel obstructions (sbos) are caused by bezoars . In addition, presentation with features of acute surgical abdomen is extremely rare, accounting for only 1% of the patients . A bezoar is a concretion of indigestible material found in the gastrointestinal tract, which usually forms in the stomach and passes into the small bowel, where it can cause sbo . It can be classified into one of four major types: trichobezoar, pharmacobezoar, lactobezoar and phytobezoar . Trichobezoars are composed of hair and are most commonly associated with patients who have a psychiatric disorder . Phytobezoars are composed of undigested fiber from vegetables or fruits and are the most common form of bezoar encountered as a postoperative complication after gastric bypass . A 63-year - old syrian male presented to the emergency department with a 2-day history of generalized colicky abdominal pain associated with repeated vomiting and absolute constipation . There was no associated history of alteration of bowel habit, rectal bleeding, fever or dysuria . His past medical history was significant for a laparotomy in 1979 due to a peptic ulcer - related complication, but he was unaware of the details . He was also recently diagnosed with diabetes mellitus for which he was using herbal treatment consisting of boiled olive tree leaves (olea europaea). On physical examination there was a midline laparotomy scar with a reducible incisional hernia in the epigastric area . He had mild lower abdominal tenderness with no muscle guarding and his bowel sounds were exaggerated . Rectal examination revealed no abnormalities and there was a small amount of stool in the rectum . Routine blood investigation and abdominal x - rays were obtained . Apart from leukocytosis, they were unremarkable . A contrast - enhanced ct scan was arranged and it showed features of sbo with collapse of the terminal ileum . There was evidence of a previous gastrojejunostomy with suspected foreign bodies in the stomach and proximal ileum . (figs 1 and 2) figure 1:contrast - enhanced abdominal ct scan in coronal view showing evidence of gastrojejunostomy and visible foreign body in the stomach and features of small bowel obstruction . Figure 2:sagittal ct scan view showing foreign bodies in the stomach and the ileum with transition point in the small bowel .. contrast - enhanced abdominal ct scan in coronal view showing evidence of gastrojejunostomy and visible foreign body in the stomach and features of small bowel obstruction . Sagittal ct scan view showing foreign bodies in the stomach and the ileum with transition point in the small bowel . At laparotomy an obstructing hard foreign body was palpable in the ileum with dilatation of the proximal small bowel loops . 3) both foreign bodies were removed through an enterotomy and gastrotomy, respectively, and the bowel was decompressed . After limited adhesiolysis, the abdomen was closed en mass repairing the midline hernia defect . Figure 3:retrieved phytobezoars . Retrieved phytobezoars . Postoperative recovery was unremarkable except for a short duration of ileus, after which the patient made a steady recovery . He was referred to the diabetology department and dietician during admission and was discharged with outpatient clinic follow - up . A follow - up upper gi endoscopy was done and it showed evidence of a hiatus hernia with gastrooesophageal reflux disease . The incidence of bezoar formation after gastric surgery ranges from 5 to 12 per cent . The main pathogenesis of bezoar formation is believed to be the result of gastric dysmotility and decreased gastric secretions, which is very common after any gastric surgery [3, 4]. Diospyrobezoars, formed after persimmon ingestion, are a distinct type of phytobezoars characterized by their hard consistency . Coca - cola ingestion combined with endoscopic techniques has been used effectively to treat gastric phytobezoars and avoid surgery . Phytobezoar should be considered in patients with previous gastric outlet surgery who present with bowel obstruction and features of acute surgical abdomen . The presence of a well - defined intraluminal mass with a mottled gas pattern on emergency ct scan is suggestive of an intestinal phytobezoar . Guidelines include proper chewing of food, plenty of liquids with meals and avoidance of a high - fiber diet.
|
There has been an increasing interest in pharmacokinetic (pk)/pharmacodynamic (pd) analyses because they are able to optimize dosing regimens, thereby improving outcomes.1 pk / pd analyses, based on the principle reported by craig2 and other researchers to optimize dose regimens for clinical applications, are now increasing in the usa and europe . Teicoplanin is a glycopeptide antibiotic that has been used to treat serious, invasive infections caused by gram - positive bacteria.3 the area under the drug concentration time curve (auc)/minimum inhibitory concentration (mic) has been identified as a pk / pd parameter of glycopeptide antibiotics that correlated with bacteriological responses and clinical outcomes.4,5 the guidelines for therapeutic drug monitoring of vancomycin suggest that an auc / mic ratio of 400 is the pk / pd parameter associated with clinical and bacteriological responses to vancomycin therapy.6,7 although optimized dosing regimens based on pk / pd are needed, the pk / pd analysis of teicoplanin against methicillin - resistant staphylococcus aureus (mrsa) infections has not yet been performed . We herein examined patients with mrsa infections who were administered with teicoplanin in order to determine the target auc / mic ratio of teicoplanin . This study retrospectively assessed data obtained as part of our routine tdm of teicoplanin therapy in 46 patients with mrsa infections at kagoshima university hospital . This study was approved by the ethics review board of kagoshima university hospital (#273). Patients were excluded if they fulfilled any of the following criteria: children, lack of tdm data, teicoplanin mic data for mrsa and culture test data, and combination with other anti - mrsa agents . Teicoplanin was administered intravenously at an initial dose of 200 mg (n=4), 400 mg (n=30), 500 mg (n=2), 600 mg (n=8), and 800 mg (n=2) every 12 hours for three doses . Then, teicoplanin was continued at a maintenance dose of 200 mg (n=14), 300 mg (n=3), 400 mg (n=22), 500 mg (n=1), 600 mg (n=5), and 800 mg (n=1) every 24 hours . Serum samples were separated from venous blood by centrifugation at 3,000 rpm for 10 minutes, and serum concentrations of teicoplanin were determined by using a fluorescence polarization immunoassay system (tdxflx analyzer; abbott laboratories, abbott park, il, usa). Creatinine clearance (clcr) was estimated using the actual body weight value in the cockcroft gault formula.8 the serum teicoplanin concentration in each patient was used to estimate individual total clearance (cltotal) by using a bayesian estimation based on the population pk parameters of teicoplanin in the japanese patients.9 the mean population pk parameters were as follows: teicoplanin clearance (l / h) = 0.00498 clcr (ml / min) + 0.00426 body weight (kg); the distribution volume of the central compartment (l) = 10.4; the transfer rate constant from the central compartment to the peripheral compartment (h) = 0.38; the transfer rate constant from the peripheral compartment to the central compartment (h) = 0.0485 . The auc value for 24 hours under steady - state conditions was estimated as auc for 24 hours (auc24; gh / ml) = daily dose (mg)/cltotal (l / h).4 the mic for teicoplanin was determined using the standardized agar dilution method according to the clinical and laboratory standards institute guidelines.10 a suspension of bacteria equivalent to the 0.5 mcfarland turbidity standards was inoculated onto mueller - hinton agar plates . The effects of teicoplanin in terms of bacteriological responses were evaluated with a quantitative and/or semi - quantitative assessment . Eradication was defined when bacterial count was zero, decrease when bacterial count was decreased by 14 levels, and (eradication and a decrease in mrsa) or failure (persistent mrsa). A logistic regression analysis was performed to determine whether the teicoplanin auc24/mic ratio was a significant predictor of bacteriological responses (1, success; 0, failure). The time from initiation of the teicoplanin treatment to the development of microbiological efficacy was estimated using a kaplan meier curve analysis . All statistical analyses were performed using spss software (version 15.0j; spss inc ., chicago, il, usa). This study retrospectively assessed data obtained as part of our routine tdm of teicoplanin therapy in 46 patients with mrsa infections at kagoshima university hospital . This study was approved by the ethics review board of kagoshima university hospital (#273). Patients were excluded if they fulfilled any of the following criteria: children, lack of tdm data, teicoplanin mic data for mrsa and culture test data, and combination with other anti - mrsa agents . Teicoplanin was administered intravenously at an initial dose of 200 mg (n=4), 400 mg (n=30), 500 mg (n=2), 600 mg (n=8), and 800 mg (n=2) every 12 hours for three doses . Then, teicoplanin was continued at a maintenance dose of 200 mg (n=14), 300 mg (n=3), 400 mg (n=22), 500 mg (n=1), 600 mg (n=5), and 800 mg (n=1) every 24 hours . Serum samples were separated from venous blood by centrifugation at 3,000 rpm for 10 minutes, and serum concentrations of teicoplanin were determined by using a fluorescence polarization immunoassay system (tdxflx analyzer; abbott laboratories, abbott park, il, usa). Creatinine clearance (clcr) was estimated using the actual body weight value in the cockcroft gault formula.8 the serum teicoplanin concentration in each patient was used to estimate individual total clearance (cltotal) by using a bayesian estimation based on the population pk parameters of teicoplanin in the japanese patients.9 the mean population pk parameters were as follows: teicoplanin clearance (l / h) = 0.00498 clcr (ml / min) + 0.00426 body weight (kg); the distribution volume of the central compartment (l) = 10.4; the transfer rate constant from the central compartment to the peripheral compartment (h) = 0.38; the transfer rate constant from the peripheral compartment to the central compartment (h) = 0.0485 . The auc value for 24 hours under steady - state conditions was estimated as auc for 24 hours (auc24; gh / ml) = daily dose (mg)/cltotal (l / h).4 the mic for teicoplanin was determined using the standardized agar dilution method according to the clinical and laboratory standards institute guidelines.10 a suspension of bacteria equivalent to the 0.5 mcfarland turbidity standards was inoculated onto mueller - hinton agar plates . The effects of teicoplanin in terms of bacteriological responses were evaluated with a quantitative and/or semi - quantitative assessment . Eradication was defined when bacterial count was zero, decrease when bacterial count was decreased by 14 levels, and (eradication and a decrease in mrsa) or failure (persistent mrsa). A logistic regression analysis was performed to determine whether the teicoplanin auc24/mic ratio was a significant predictor of bacteriological responses (1, success; 0, failure). The time from initiation of the teicoplanin treatment to the development of microbiological efficacy was estimated using a kaplan meier curve analysis . All statistical analyses were performed using spss software (version 15.0j; spss inc ., a total of 46 patients, 36 men and ten women, with a mean age of 73.19.4 years and body weight of 53.510.8 kg, were available for retrospective analysis . The indications for teicoplanin treatment were as follows: wound infection (n=17), pneumonia (n=14), bacteremia (n=6), and others (n=9). The mics and their percentages of strains were 0.38 g / ml (2.2%), 0.5 g / ml (6.5%), 0.75 g / ml (43.5%), 1.0 g / ml (34.8%), and 1.5 g / ml (13.0%). The auc24/mic ratios with and without bacteriological responses were 926.6425.2 gh / ml (n=34) and 642.2193.9 gh / ml (n=12) (p<0.05), respectively . Figure 1 shows the relationship between auc24/mic ratios on day 3 and bacteriological responses (failure, 0; success, 1). Auc24/mic ratios of 500, 700, and 900 gh / ml gave probabilities of treatment success of 0.50, 0.72, and 0.87, respectively . The bacteriological treatment successes were evaluated in 15 patients with auc24/mic ratios of 900 and 31 patients with auc24/mic ratios of <900 using the kaplan meier curve analysis (figure 2). Patients with auc24/mic ratios of 900 had significantly stronger bacteriological responses than those with auc24/mic ratios of <900 (p<0.05). The trough concentrations of 1020 g / ml are needed to achieve an auc value of 400.6 if an auc / mic ratio of 400 is not achieved, even though an appropriate trough level is achieved, vancomycin treatment would not exhibit a good response . Similar to teicoplanin, previous studies have shown that teicoplanin trough concentrations of> 13 g / ml are effective for treating most infections.11 however, the teicoplanin treatment should be optimized using auc / mic ratios on the basis of pk / pd . Thus, this study examined patients with mrsa infections who were administered with teicoplanin in order to determine the target auc / mic ratio of teicoplanin . This pk / pd analysis determined the auc24/mic target value of teicoplanin required to cure patients with mrsa infections . The auc24/mic ratios of 500, 700, and 900 gh / ml showed probabilities of treatment success of 0.50, 0.72, and 0.87, respectively . Craig previously reported that auc / mic ratios may be an important pk / pd parameter that correlates with the efficacy of vancomycin and teicoplanin.5 hagihara et al reported that the auc24 value on the third day was significantly higher in the treatment success group (897.671.7 gh / ml) than that of the treatment failure group (652.983.4 gh / ml).12 these findings indicated that an auc24 value of at least 800 gh / ml is required to ensure bacteriological responses (mic of 1.0 g / ml for all isolates).12 kanazawa et al also showed that an increase in the probability of treatment success was dependent on auc24 values and that the target that gave a probability of 0.9 was 750 gh / ml (mic of <2.0 g / ml for all isolates).13 they could not estimate auc24/mic, because exact mics were not measured . On the other hand, ogawa et al indicated that a log[cmax, unbound / mic] of 0.30 on day 3 of teicoplanin therapy was the threshold for achieving treatment success14; however, they did not evaluate auc24/mic ratios . The mics of teicoplanin for a total of 46 mrsa strains were determined in the present study by the e - test method . Auc24/mic ratios were significantly higher in the treatment success group (926.6425.2 gh / ml) than in the treatment failure group (642.2193.9). An auc24/mic ratio of 900 gh / ml showed a probability of treatment success of 0.87 (figure 1). Meier curve analysis, an auc24/mic ratio of 900 exhibited a significantly stronger bacteriological response than that of an auc24/mic ratio of <900 (figure 2). These results suggested that an auc24/mic ratio of 900 gh / ml may be required to ensure bacteriological responses . Therefore, not only trough concentrations but also auc / mic ratios should be monitored for teicoplanin tdm . This study focused on bacteriological responses because clinical outcomes, such as relief from symptoms, reduced white blood cell count, and decrease in body temperature, are dependent on many factors.12,13,15 however, clinical outcomes are also important for the interpretation and clinical applicability of the current results . Additionally, in this retrospective study, each patient was different in teicoplanin dose, duration of therapy, severity of illness, and type of infections . Therefore, well - designed prospective studies for various types of infection in a larger number of patients are needed to validate the current findings . This pk / pd analysis revealed the target auc24/mic ratios of teicoplanin in patients with mrsa infections on the basis of pk / pd analyses . These results indicated that an auc24/mic ratio of 900 gh / ml is required to ensure bacteriological responses . However, further studies are needed to confirm these results and clarify their therapeutic implications.
|
Cystatin c is a 13.3kda protein, well known and commonly used in the clinic as a marker of kidney function.1 it is also involved in extracellular matrix remodeling2 and may be directly associated with the development of atherosclerotic cardiovascular disease (ascvd).3, 4 there is a wellestablished relation between chronic kidney disease (ckd) and ascvd,5, 6, 7 which is evident even in patients with only mild renal impairment,8 and a lowered glomerular filtration rate (gfr) is a risk factor for incident ascvd.9 like ascvd, ckd is a complex disease derived from a combination of multiple genetic and environmental factors.10 previous studies have estimated the heritability of gfr in the range between 0.36 and 0.82,11, 12 which indicates that additive genetic effects explain 30% to 80% of the interindividual variation of gfr . Although there is a phenotypical association between ckd and ascvd with pathophysiological similarities, especially regarding smallvessel disease in the kidney and brain,13 as well as common risk factors such as diabetes mellitus and hypertension, the reported genetic overlap between ckd and ascvd is low.14 however, in a recent study a possible polygenic overlap between renal dysfunction and ischemic stroke was suggested.15 some genetic polymorphisms that affect cystatin c levels independently of kidney function have been reported, but there is no evidence that these polymorphisms are related to cardiovascular risk.16 we have previously shown a moderate heritability for variations in both cystatin c and kidney function according to gfr calculated by modification of diet in renal disease and ckdepi formulas . We have also shown a genetic correlation between cystatin c and prevalent ascvd, indicating that cystatin c and ascvd share genetic influences.17 however, it has not been studied previously whether variation of renal function as measured by levels of cystatin c or creatinine predicts incident ascvd when controlling for genetic factors . Thus, it is currently unknown whether, when accounting for genetic factors, variation in kidney function caused by individual specific environmental factors remains an important predictor of incident ascvd . Twingene is a swedish populationbased cohort of twins born between 1911 and 1958, contacted and enrolled for testing between the years 2004 and 2008.18 all eligible participants had previously participated in a computerassisted telephone interview called salt (screening across the life span twin study).19 furthermore, both twins within the pairs had to be alive and provide their informed consent for study participation . The zygosity of the twins was based on selfreported childhood resemblance, or by dna markers (54% of the study sample). According to a recent independent test of the validity of similaritybased zygosity assignments among the adults in the twingene study, there is a dizygotic (dz) to monozygotic (mz) error rate of 2.56%, corresponding to an accuracy of 97.4% (95% ci: 96.698.2).18 participants who had previously donated dna for studies in the swedish twin registry and participants who had declined participation in further studies or had a record of hepatitis were excluded . During enrollment in the twingene project, participants were asked to fill out a questionnaire about common diseases such as cardiovascular disease and diabetes mellitus.18 these statements were thereafter verified through the national inpatient registry, which was the source of the data used in the study . Furthermore, the participants were asked to make an appointment at their local healthcare facility for blood sampling and anthropometry measurements.18 in total, 12 645 individuals donated blood to the study . Participants were instructed to fast from 8:00 pm on the night before the blood sampling . A total sample volume of 50 ml of venous blood was drawn from each participant . Tubes with serum and whole blood for clinical chemistry analyses and dna extraction were sent by overnight mail to karolinska institute biobank . Serum samples were aliquoted by tecanrobot into 1ml fractions and placed in 1.8ml cryotubes that were stored in liquid nitrogen tanks at the karolinska institute biobank . Clinical blood chemistry assessments were performed from fresh blood samples at baseline by the karolinska university laboratory for the following biomarkers: triglycerides, highdensity lipoprotein cholesterol, lowdensity lipoprotein cholesterol (by friedewald formula), creactive protein, glucose, apolipoprotein ai, apolipoprotein b, hemoglobin, and hemoglobin a1c18 (data regarding biomarkers relevant for this study are shown in table 1). Serum and plasma were stored frozen at 80c, or in liquid nitrogen, at karolinska institute biobank before they were thawed and sent for laboratory analysis . For this project, serum aliquots from a total of 12 570 subjects were withdrawn, thawed, and directly shipped to a laboratory for clinical blood analysis . Of these, 257 (2%) were excluded due to bad or missing sample, insufficient sample volume, hemolysis, lipemia, or missing donor i d . Also, an additional 911 (7%) subjects with prevalent cardiovascular disease (cvd) on enrollment were excluded, leaving a total of 11 402 (91%) individuals for the final analysis (see table 1 for descriptive statistics). Ckd indicates chronic kidney disease; egfr, estimated glomerular filtration rate; hba1c, glycated hemoglobin; hdl, highdensity lipoprotein; ldl, lowdensity lipoprotein . Data regarding prevalent cvd at baseline examination were collected from the swedish national inpatient register and was defined as previous hospitalization with any of the following primary diagnoses: acute myocardial infarction (mi) (icd10: i21, i22 . Icd8: 411), and stroke (icd10: i60, i61, i62, i63 . Icd8: 430, 431, 432, 433, 434) or the surgical codes: fng02, fng05 percutaneous transluminal coronary angioplasty or fnc, fnd, fne coronary artery bypass graft.these diagnoses were defined according to the primary diagnosis as recorded in the patient register . The patient register includes hospitalized cases, as well as outpatient visits, but not visits to primary care . The positive predictive value (ie, validity) of the mi diagnosis in the swedish patient register has been demonstrated to be 95% when only primary diagnoses are considered.20 a prospective followup of participants for a median time of 71 (sd16) months was made . Information regarding incident cardiovascular morbidity and mortality during followup was collected from the swedish national inpatient register records and the swedish cause of death register . End points were cardiovascular mortality, nonfatal mi, need for revascularization, and stroke . The blood tests were performed at the department of clinical chemistry and pharmacology, university hospital, uppsala, sweden . Serum samples were analyzed according to idmsstandard on abbott architect ci8200 and ci16200 instruments (abbott park, il). Reagents for the immunoturbidimetric cystatin c method, which follows the ifccstandard, were from gentian (moss, norway). The total analytical imprecision of creatinine measurements were 3% and 2% at 70 and 350 calculations of estimated glomerular filtration rate (egfr) were performed with the ckdepi formula according to levey et al21 . The predictive value per sd increase of logarithmized cystatin c for incident stroke, incident mi, and incident ascvd was studied in a coxregression survival analysis adjusted for systolic blood pressure, diabetes mellitus (yes / no), current smoking (yes / no), egfr (creatininebased ckdepi), total cholesterol, highdensity lipoprotein, and antihypertensive medication (yes / no). A robust sandwich covariance matrix estimate was incorporated into the model to account for any intracluster dependence, which otherwise may inflate precision estimates due to correlated (twinships) data . Samesexed twin pairs discordant for ascvd, mi, and stroke during followup were identified . Independent 2sample and paired t tests were performed in order to verify significant differences regarding cystatin c levels on group and pair level between twins with incident ascvd and twins without incident ascvd . Thereafter, a conditional stepwise logistic regression analysis was performed in order to verify significant differences regarding cystatin c, firstly when adjusted for the same covariates as stated above (table 2, model 2) and subsequently with creactive protein added to the model (table 2, model 3). The conditional logistic regression inherently adjusted for all variables that were the same among the twins . Hazard ratios for incident ascvd in unadjusted and adjusted cox prediction models in 11 402 twins age and sex inherent in all models . Antiht indicates antihypertensive; ascvd, atherosclerotic cardiovascular disease; ckdepi, glomerular filtration rate according to the ckdepi formula based on creatinine; crea, creatinine; crp, creactive protein; egfr, estimated glomerular filtration rate; hdl, highdensity lipoprotein; hr, hazard ratio; ldl, lowdensity lipoprotein; log, logarithmized; mi, myocardial infarction; sbp, systolic blood pressure . Adjusted model 1 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), and smoking status (yes / no). Adjusted model 2 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), adjusted model 3 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), smoking status (yes / no), egfr (ckdepi), and creactive protein . Data on selfreported intrapair contact frequency, meaning the frequency by which the twins in a pair met each other, and age at separation was obtained from the salt interviews.19 contact frequency data were coded into 4 levels; (1) twins met each other less than once a year; (2) twins met on a yearly basis; (3) twins met on a monthly basis; and (4) twins met on a weekly basis . Where both twins had reported age at separation, average value was used for further analysis . By computing the rankorder correlation (spearman) between contact frequency and the absolute intrapair difference in trait levels adjusted for age and sex and logtransformed where applicable, we explored whether contact frequency and the degree of sharedenvironment influences, such as age at separation from cotwin, were associated with similarity in trait levels (table 3). Correlation between absolute intrapair difference of adjusted trait values and (a) cotwin contact frequency and (b) age at separation from cotwin trait values are logtransformed (where applicable) and zscore standardized, age and sex adjustment inherent in model . Ckdepi indicates glomerular filtration rate according to the ckdepi formula based on creatinine; dz, dizygotic twin; mz, monozygotic twin . P values remained insignificant for opposite sex dizygotic when stratified by sex, monozygotic twins, samesex dizygotic twins . Twingene is a swedish populationbased cohort of twins born between 1911 and 1958, contacted and enrolled for testing between the years 2004 and 2008.18 all eligible participants had previously participated in a computerassisted telephone interview called salt (screening across the life span twin study).19 furthermore, both twins within the pairs had to be alive and provide their informed consent for study participation . The zygosity of the twins was based on selfreported childhood resemblance, or by dna markers (54% of the study sample). According to a recent independent test of the validity of similaritybased zygosity assignments among the adults in the twingene study, there is a dizygotic (dz) to monozygotic (mz) error rate of 2.56%, corresponding to an accuracy of 97.4% (95% ci: 96.698.2).18 participants who had previously donated dna for studies in the swedish twin registry and participants who had declined participation in further studies or had a record of hepatitis were excluded . During enrollment in the twingene project, participants were asked to fill out a questionnaire about common diseases such as cardiovascular disease and diabetes mellitus.18 these statements were thereafter verified through the national inpatient registry, which was the source of the data used in the study . Furthermore, the participants were asked to make an appointment at their local healthcare facility for blood sampling and anthropometry measurements.18 in total, 12 645 individuals donated blood to the study . Participants were instructed to fast from 8:00 pm on the night before the blood sampling . A total sample volume of 50 ml of venous blood was drawn from each participant . Tubes with serum and whole blood for clinical chemistry analyses and dna extraction were sent by overnight mail to karolinska institute biobank . Serum samples were aliquoted by tecanrobot into 1ml fractions and placed in 1.8ml cryotubes that were stored in liquid nitrogen tanks at the karolinska institute biobank . Clinical blood chemistry assessments were performed from fresh blood samples at baseline by the karolinska university laboratory for the following biomarkers: triglycerides, highdensity lipoprotein cholesterol, lowdensity lipoprotein cholesterol (by friedewald formula), creactive protein, glucose, apolipoprotein ai, apolipoprotein b, hemoglobin, and hemoglobin a1c18 (data regarding biomarkers relevant for this study are shown in table 1). Serum and plasma were stored frozen at 80c, or in liquid nitrogen, at karolinska institute biobank before they were thawed and sent for laboratory analysis . For this project, serum aliquots from a total of 12 570 subjects were withdrawn, thawed, and directly shipped to a laboratory for clinical blood analysis . Of these, 257 (2%) were excluded due to bad or missing sample, insufficient sample volume, hemolysis, lipemia, or missing donor i d . Also, an additional 911 (7%) subjects with prevalent cardiovascular disease (cvd) on enrollment were excluded, leaving a total of 11 402 (91%) individuals for the final analysis (see table 1 for descriptive statistics). Ckd indicates chronic kidney disease; egfr, estimated glomerular filtration rate; hba1c, glycated hemoglobin; hdl, highdensity lipoprotein; ldl, lowdensity lipoprotein . Data regarding prevalent cvd at baseline examination were collected from the swedish national inpatient register and was defined as previous hospitalization with any of the following primary diagnoses: acute myocardial infarction (mi) (icd10: i21, i22 . Icd8: 411), and stroke (icd10: i60, i61, i62, i63 . Icd8: 430, 431, 432, 433, 434) or the surgical codes: fng02, fng05 percutaneous transluminal coronary angioplasty or fnc, fnd, fne coronary artery bypass graft.these diagnoses were defined according to the primary diagnosis as recorded in the patient register . The patient register includes hospitalized cases, as well as outpatient visits, but not visits to primary care . The positive predictive value (ie, validity) of the mi diagnosis in the swedish patient register has been demonstrated to be 95% when only primary diagnoses are considered.20 a prospective followup of participants for a median time of 71 (sd16) months was made . Information regarding incident cardiovascular morbidity and mortality during followup was collected from the swedish national inpatient register records and the swedish cause of death register . End points were cardiovascular mortality, nonfatal mi, need for revascularization, and stroke . The blood tests were performed at the department of clinical chemistry and pharmacology, university hospital, uppsala, sweden . Serum samples were analyzed according to idmsstandard on abbott architect ci8200 and ci16200 instruments (abbott park, il). Reagents for the immunoturbidimetric cystatin c method, which follows the ifccstandard, were from gentian (moss, norway). The total analytical imprecision of creatinine measurements were 3% and 2% at 70 and 350 calculations of estimated glomerular filtration rate (egfr) were performed with the ckdepi formula according to levey et al21 . The predictive value per sd increase of logarithmized cystatin c for incident stroke, incident mi, and incident ascvd was studied in a coxregression survival analysis adjusted for systolic blood pressure, diabetes mellitus (yes / no), current smoking (yes / no), egfr (creatininebased ckdepi), total cholesterol, highdensity lipoprotein, and antihypertensive medication (yes / no). A robust sandwich covariance matrix estimate was incorporated into the model to account for any intracluster dependence, which otherwise may inflate precision estimates due to correlated (twinships) data . Samesexed twin pairs discordant for ascvd, mi, and stroke during followup were identified . Independent 2sample and paired t tests were performed in order to verify significant differences regarding cystatin c levels on group and pair level between twins with incident ascvd and twins without incident ascvd . Thereafter, a conditional stepwise logistic regression analysis was performed in order to verify significant differences regarding cystatin c, firstly when adjusted for the same covariates as stated above (table 2, model 2) and subsequently with creactive protein added to the model (table 2, model 3). The conditional logistic regression inherently adjusted for all variables that were the same among the twins . Hazard ratios for incident ascvd in unadjusted and adjusted cox prediction models in 11 402 twins age and sex inherent in all models . Antiht indicates antihypertensive; ascvd, atherosclerotic cardiovascular disease; ckdepi, glomerular filtration rate according to the ckdepi formula based on creatinine; crea, creatinine; crp, creactive protein; egfr, estimated glomerular filtration rate; hdl, highdensity lipoprotein; hr, hazard ratio; ldl, lowdensity lipoprotein; log, logarithmized; mi, myocardial infarction; sbp, systolic blood pressure . Adjusted model 1 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), and smoking status (yes / no). Adjusted model 2 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), smoking status (yes / no), and egfr (ckdepi). Adjusted model 3 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), smoking status (yes / no), egfr (ckdepi), and creactive protein . Data on selfreported intrapair contact frequency, meaning the frequency by which the twins in a pair met each other, and age at separation was obtained from the salt interviews.19 contact frequency data were coded into 4 levels; (1) twins met each other less than once a year; (2) twins met on a yearly basis; (3) twins met on a monthly basis; and (4) twins met on a weekly basis . Where both twins had reported age at separation, average value was used for further analysis . By computing the rankorder correlation (spearman) between contact frequency and the absolute intrapair difference in trait levels adjusted for age and sex and logtransformed where applicable, we explored whether contact frequency and the degree of sharedenvironment influences, such as age at separation from cotwin, were associated with similarity in trait levels (table 3). Correlation between absolute intrapair difference of adjusted trait values and (a) cotwin contact frequency and (b) age at separation from cotwin trait values are logtransformed (where applicable) and zscore standardized, age and sex adjustment inherent in model . Ckdepi indicates glomerular filtration rate according to the ckdepi formula based on creatinine; dz, dizygotic twin; mz, monozygotic twin . P values remained insignificant for opposite sex dizygotic when stratified by sex, monozygotic twins, samesex dizygotic twins . One hundred nineteen mz and 155 samesexed dz twin pairs became discordant for incident ascvd, stroke, or mi during followup . The results of cox regression analysis in the whole cohort are shown in table 2 . In univariate analysis, cystatin c was a predictor of incident stroke (hazard ratio, 95% ci 1.69, 1.561.84), mi (1.49, 1.391.60), and ascvd (1.57, 1.471.67). When adjusted for all covariates including ckdepi calculated egfr (model 2, table 2), cystatin c remained a predictor of incident stroke (hazard ratio 1.45, ci 1.251.70), mi (hazard ratio 1.16, ci 1.011.33), and ascvd (1.26, 1.131.41). When adding creactive protein to the multivariate model (model 3, table 2), the association between cystatin c and mi did not remain significant (hazard ratio 1.24, ci 0.991.32), while it remained for the other outcomes . A total of 116 mz and 155 samesexed dz twin pairs became discordant for incident ascvd during followup . In twins who became discordant for stroke, cystatin c at baseline was higher in the twin who experienced a stroke compared to the twin who remained healthy in both mz (1.110.27 mg / l versus 1.060.26 mg / l, p<0.05) and dz pairs (1.20.37 mg / l versus 1.070.23 mg / l, p<0.01). Conversely, creatinine was lower in the twin who developed ascvd compared to the cotwin who remained healthy (76.716.7 mol / l versus 80.119.4 mol / l, p=0.02) (table 4). Paired t tests in twinpairs discordant for incident stroke, ascvd, and mi data regarding bmi and blood pressure are lacking for a small group of participants, possibly because they were overlooked in the health examination at baseline . Ascvd indicates atherosclerotic cardiovascular disease; bmi, body mass index; ckdepi, glomerular filtration rate according to the ckdepi formula based on creatinine; crea, creatinine; dz, dizygotic twin; hdl, highdensity lipoprotein; mi, myocardial infarction; mz, monozygotic twin; sbp, systolic blood pressure . The results of conditional regression analysis in pairs discordant for incident ascvd are shown in table 5 . In univariate analysis, cystatin c was significantly associated with stroke and ascvd but not mi in samesexed dz twins, whereas in mz the association was of borderline insignificance (p=0.052). When adjusted for the same covariates as in the cox regression model and stratified by zygosity, cystatin c did not remain significantly associated with any outcome in mz but to stroke in samesexed dz . However, in multivariate analysis when egfr was added as a covariate, cystatin c was significantly associated with incident stroke in mz . Odds ratios per 1 sd increase for ascvd in discordant mz and samesex dz twin pairs age and sex inherent in all models . Ascvd indicates atherosclerotic cardiovascular disease; ckdepi, glomerular filtration rate according to the ckdepi formula based on creatinine; dz, dizygotic twin; egfr, estimated glomerular filtration rate; hdl, highdensity lipoprotein; log, logarithmized; mi, myocardial infarction; mz, monozygotic twin; or, odds ratio; sbp, systolic blood pressure . Adjusted model 1 includes sbp, serum cholesterol, hdl, diabetes mellitus (yes / no), antihypertensive treatment (yes / no), and smoking status (yes / no). Adjusted model 2 includes sbp, serum cholesterol, hdl, treatment for hypertension (yes / no), diabetes mellitus (yes / no), smoking status (yes / no), and egfr (ckdepi). Data on contact frequency by at least 1 of the twins in a pair was available for 11 040 (97%) of the study participants . The intrapair correlation on contact frequency was high (=0.80) for the 3954 pairs where both responded . Data on age at separation were available for 11 145 (98%) individuals, and correlation was somewhat lower compared to contact frequency (=0.65) for 3206 responding pairs . Mz twins reported a higher contact frequency and higher mean age at separation than dz twins . None of these measures was significantly related to the absolute intrapair difference in adjusted trait levels in mz, but contact level was related to intrapair difference in cystatin c and egfr levels in dz (table 3). Here we studied the association of cystatin c and creatininebased egfr to incident ascvd in a prospective cotwin control design and confirm findings from previous studies on the predictive value of cystatin c in a large subset of swedish twins . The novel findings of this study were that in identical twins a high level of cystatin c related to incident stroke, whereas a low level of creatinine was associated with incident ascvd . The association between cystatin c level and allcause mortality was first reported by shlipak et al,22 and the prognostic value of cystatin c for cardiovascular morbidity as a biomarker for ckd has also been thoroughly investigated.23, 24, 25, 26 thus, the finding of the current study that cystatin c is superior to creatinine for prediction of incident ascvd confirms findings from previous populationbased studies.27, 28, 29 however, since our study is the first of this topic in a twin cohort, it allows us to control for genetic confounding . The finding that cystatin c is related to incident stroke in identical twins is novel and indicates that individual specific environmental factors that affect cystatin c are also associated with incident stroke . However, our study design does not allow us to draw conclusions about what constitutes these unique environmental factors . Previously reported environmental factors that are associated with cystatin c or mild egfr reduction are smoking, occupational exposure to lead and arsenic, use of corticosteroids, and thyroid dysfunction.30, 31, 32, 33, 34, 35 when we adjusted for the traditional risk factors serum cholesterol, diabetes mellitus, antihypertensive treatment, systolic blood pressure, smoking, and decreased kidney function, the association between cystatin c and stroke remained . This indicates that other external factors are important for the strong association between cystatin c and incident ascvd and may also be possible to prevent if identified . Another novel and interesting finding of the current study was that in the identical twin pairs that later became discordant for cvd, a lower creatinine value at baseline was observed in the twin who developed cvd during the followup compared to the cotwin who remained healthy . Twins with previous cvd were excluded and the twincontrol study design adjusts for age and sex, all of which are determinants of creatinine on a population level.36 an important determinant of creatinine is muscle mass and in the twin model, which to a large extent adjusts for length, interindividual differences in creatinine may be even more closely related to interindividual differences in muscle mass.37 thus, the finding that the healthy twin had higher creatinine and lower creatininebased egfr may be a marker of increased muscle mass possibly due to increased physical activity, less malnutrition, and a healthier lifestyle.38 a similar relation was observed to both stroke and mi, although not significant, which may be due to power issues . Still it remains to be determined whether it is unique properties of cystatin c that are independently and causally associated with vascular remodeling and the development of ascvd . Findings from a recently performed mendelian randomization study (yet only published as an abstract) contradicts such a causal relation;39 thus it is plausible that the strong association between cystatin c and cvd primarily is a reflection of cystatin c being a better marker of early hypertensive endorgan damage in different vascular beds, that is, a more sensitive marker of early gfrreduction . Our results could also be in alignment with the hypothesis of a shrunken pore syndrome as defined by grubb et al,40 suggesting that a reduction in pore diameter of the glomerular membrane, which reduces permeability of cystatin c but not creatinine, is responsible for the increased association of cystatin c based egfr with endstage renal disease, hospitalization, mi, and premature death . In this regard cystatin c might be a marker of early vascular aging, and as such detect subclinical manifestation of features such as smallvessel degeneration, left ventricular heart load, arterial calcification, and matrix remodeling and intima alterations.41, 42 previous studies have reported on genetic overlap between kidney function and ascvd.15 although these overlaps were quite modest, ranging from 0.1% to 0.26% and associated with different stroke subtypes, they confirm earlier epidemiological studies on the matter suggesting such genetic overlaps.43 although both creatinine and cystatin c based kidney function was used in the study by holliday et al, creatinine was more commonly used . We have, in a previous study, observed a stronger genetic association between cystatin c and prevalent ascvd compared to that between creatinine and ascvd.17 since cystatin c is superior for risk prediction, further investigations on the possible genetic overlap between stroke and cystatin c are warranted . In our previous study, referred to above, we observed that nonshared environment mediates phenotypic correlation between cystatin c and prevalent ascvd . In the current study a similar association previous studies have shown that only a small fraction of stroke variance is explained by genetic overlap with renal function estimates, it is important to further investigate the other part of the association, which is related to nonshared environment and indisputably also better suited as a target for preventive measures . This is also supported by the findings of olden et al,14 who state that nongenetic factors in the causal pathway are responsible for the major part of the association between ascvd and kidney function . In this study we have also found that the intrapair contact frequency and age at separation were not significantly associated with traitlevel similarity in mz twins (table 3), lending further support to the hypothesis of a plausible unique (ie, nonshared within pairs) environmental factor . We observed a stronger association between cystatin c and incident stroke compared to incident mi . Svenssonfrbom and colleagues were able to demonstrate a significant association between cystatin c and ascvd morbidity that was not present for creatininebased egfr until egfr was below 45 ml / min, corresponding to less than 1% of the study population . However, they did not study the associations with mi and stroke separately . A plausible explanation, especially if we assume that cystatin c is a marker of smallvessel disease and hypertensive endorgan damage, is that in normal kidney function cystatin c captures the risk of ascvd through smallvessel disease but when renal function declines, this discrimination gets distorted and cystatin c instead captures the risk of ascvd due to renal dysfunction . The link to hypertension would also explain the stronger association between cystatin c and stroke compared to mi since blood pressure level is more strongly related to stroke than to mi according to previous literature.44, 45, 46 this may also explain why we did not observe a significant difference in cystatin c levels in twins discordant for mi . Variation in cystatin c relates to incident ascvd and stroke when adjusted for genetic confounding . In identical twins, cystatin c may be a sensitive marker of early hypertensive endorgan damage and smallvessel disease, whereas creatinine level may reflect nutritional status . The findings in diseasediscordant monozygotic twins indicate that unique, possibly preventable, environmental factors are important . This study was supported by karolinska institutet grants, serafimer, hospital foundation grants, the swedish heartlung foundation grants, the swedish society of medicine, and the stockholm county council.
|
Concurrent tumors are a well - known entity, at times posing diagnostic and therapeutic difficulties . They can be synchronous, independently derived, nonmetastatic tumors, or metastatic tumors . Distinguishing between them involves clinicopathologic interpretation based on multiple criteria including histologic type and grade . In general, if tumors at different sites have different histologic features, they are generally regarded as independently derived primary tumors, which generally have a better prognosis than the primary tumor with metastasis . Very few case reports of synchronous bilateral primary ovarian tumors of different histologic types have been mentioned in the literature . Here, we report a rare case of right ovarian clear cell carcinoma (ccc) with an incidental finding of left ovarian endometrioid carcinoma (ec) in a 65-year postmenopausal female . A 65-year - old postmenopausal multiparous, female presented to gynecologic outpatient department with history of pain in the right iliac fossa since 15 days . On abdominal examination, firm and tender lump was felt in the right iliac fossa . Serum ca-125 was raised to 414 u / ml (normal: 0 - 35 u / ml). Computed tomography showed 9.5 cm 6.9 cm 6.8 cm sized well - defined, heterogeneous, partly solid and partly cystic lesion in pelvis superior to the urinary bladder . Both ovaries were not seen separate from the lesion [figure 1a]. A radiological diagnosis of ovarian neoplasm was offered . Intra - operatively, there was a presence of right adnexal tumor adhered to appendix and omentum . (a) computed tomography showing 9.5 cm 6.9 cm 6.8 cm sized well defined, heterogeneous, partly solid and partly cystic lesion in pelvis superior to urinary bladder . (b) the cut surface of the left ovary measuring 3.2 cm 1.5 cm 1 cm showing whitish and yellowish areas, the cut surface of the right ovarian mass measuring 10.5 cm 7.5 cm 4.5 cm showing predominantly solid with few cystic brownish areas . Cysts varied in size from 0.5 to 2 cm the right adnexal mass measured 10.5 cm 7.5 cm 4.5 cm . Uterus cervix with left sided adnexa measured 10 cm 8 cm 4.5 cm . External surface showed two subserosal nodules measuring 2.5 cm 2 cm 1.2 cm and 1.3 cm 1.5 cm 1 cm near the left cornu, cut surface of which showed whitish, whorled and firm areas . Cut surface of the uterus showed distorted endometrial cavity with whitish, firm and whorled intramural nodule measuring 4.8 cm 4.3 cm 3 cm . The left ovary measured 3.2 cm 1.5 cm 1 cm, the cut surface of which showed whitish and yellowish areas [figure 1b]. Ccc areas showed tumor cells arranged in solid sheets, tubulopapillary and focal cribriform pattern separated by hyalinized homogenous fibrovascular septae arising in an endometriotic cyst . Sections from the left ovary showed infiltration by tumor cells at one pole with one focus of endometriosis . Histopathological diagnosis of simultaneous presence of ccc in the right ovary [figure 2a] with the presence of ec in the left ovary [figure 2c] was made . (a) photomicrograph of ccc showing tumor cells arranged in solid sheets at places separated by hyalinized homogenous fibrovascular septae; (b) the tumor cells of the right ovarian ccc showing absence of wt1 immunoreactivity; (c) photomicrograph of ec showing glandular structures lined by malignant tumor cells . Surrounding stroma is desmoplastic and shows dense chronic lymphocytic infiltrate; (d) the tumor cells of the left ovary showing strong ema membrane immunoreactivity immunohistochemistry (ihc) was performed with the following panel of antibodies viz . Wilm's tumor gene (wt1) (clone 6f - h2, dako), epithelial membrane antigen (ema) (clone e29, dako), estrogen receptor (er) (clone 6f11, novacastra), progesterone receptor (pr) (clone pgr312, novacastra) and p53 (clonedo-7, dako) on the tumors . The right ovarian tumor showed positivity for p53, nuclear immunoreactivity for er and no immunoreactivity for wt1, [figure 2b] and pr . The left ovarian tumor showed nuclear immunoreactivity for er and pr, p53 positivity, strong membrane immunoreactivity for ema [figure 2d] and no immunoreactivity for wt1 . Based on ihc studies, diagnosis of ccc of the right ovary and ec of the left ovary was confirmed . External surface was nodular . Cut surface showed predominantly solid with few cystic brownish areas . Uterus cervix with left sided adnexa measured 10 cm 8 cm 4.5 cm . External surface showed two subserosal nodules measuring 2.5 cm 2 cm 1.2 cm and 1.3 cm 1.5 cm 1 cm near the left cornu, cut surface of which showed whitish, whorled and firm areas . Cut surface of the uterus showed distorted endometrial cavity with whitish, firm and whorled intramural nodule measuring 4.8 cm 4.3 cm 3 cm . The left ovary measured 3.2 cm 1.5 cm 1 cm, the cut surface of which showed whitish and yellowish areas [figure 1b]. Ccc areas showed tumor cells arranged in solid sheets, tubulopapillary and focal cribriform pattern separated by hyalinized homogenous fibrovascular septae arising in an endometriotic cyst . Sections from the left ovary showed infiltration by tumor cells at one pole with one focus of endometriosis . Histopathological diagnosis of simultaneous presence of ccc in the right ovary [figure 2a] with the presence of ec in the left ovary [figure 2c] was made . (a) photomicrograph of ccc showing tumor cells arranged in solid sheets at places separated by hyalinized homogenous fibrovascular septae; (b) the tumor cells of the right ovarian ccc showing absence of wt1 immunoreactivity; (c) photomicrograph of ec showing glandular structures lined by malignant tumor cells . Surrounding stroma is desmoplastic and shows dense chronic lymphocytic infiltrate; (d) the tumor cells of the left ovary showing strong ema membrane immunoreactivity immunohistochemistry (ihc) was performed with the following panel of antibodies viz . Wilm's tumor gene (wt1) (clone 6f - h2, dako), epithelial membrane antigen (ema) (clone e29, dako), estrogen receptor (er) (clone 6f11, novacastra), progesterone receptor (pr) (clone pgr312, novacastra) and p53 (clonedo-7, dako) on the tumors . The right ovarian tumor showed positivity for p53, nuclear immunoreactivity for er and no immunoreactivity for wt1, [figure 2b] and pr . The left ovarian tumor showed nuclear immunoreactivity for er and pr, p53 positivity, strong membrane immunoreactivity for ema [figure 2d] and no immunoreactivity for wt1 . Based on ihc studies, diagnosis of ccc of the right ovary and ec of the left ovary was confirmed . A synchronous malignant tumor is defined as the occurrence of two tumor types within a 6 months period in the same patient . The occurrence of primary synchronous malignancies of the genital tract is rare, the incidence of which varies between 0.7% and 1.5% . Independent primary tumors of the endometrium and ovary are the most commonly encountered synchronous tumors of the female genital tract . Very few case reports of bilateral synchronous primary ovarian malignant tumors have been mentioned in the literature . First case was reported in a 58 year postmenopausal lady with left ovarian serous papillary carcinoma and right ovarian malignant mixed mllerian tumor . Second case was reported in a 38-year - female who had right ovarian serous papillary carcinoma and left ovarian ccc . Clear cell carcinoma of the ovary, now recognized as a distinct entity, is the third most common ovarian carcinoma . It usually presents in international federation of gynecology and obstetrics (figo) stage i and ii . These unilateral tumors constitute 20 - 50% of ovarian carcinomas . Endometrioid carcinoma, the second most common ovarian carcinoma, occurs in approximately 10% of all ovarian carcinomas . Like ccc of the ovary, it also presents in figo stage i and ii . Mutations in ctnnb-1 (a - catenin), pi3ca (encoding phosphatidylinositol 3-kinase), and pten have been reported to have high levels of microsatellite instability in ec . It is recognized that these tumors develop from endometriosis that is believed to develop as a result of retrograde menstruation . The oxidative stress conditions found within endometriotic lesions are likely to contribute to the transformation process . The dichotomy in the histogenesis of endometriosis associated ovarian cancer that is clear cell versus endometrioid type adenocarcinoma is further discussed in the literature . Studies with the hepatocyte nuclear factor 1- (hnf-1) by immunohistochemistry have addressed these issues . Ec and ccc arise from the hnf-1 -negative and hnf-1 -positive epithelial cells of endometriosis, respectively indicating different cells of origin . At times, it can be very difficult to differentiate ccc and moderately differentiated ec of the ovary from ovarian serous cyst adenocarcinoma on histopathology alone . However, features such as rounded papillary cores with stromal hyalinization, surrounded by one or two layers of hobnail cells with uniform, but highly atypical nuclei with prominent nucleoli favor ccc . Clinically, disseminated bilateral ovarian ccc at presentation is much less commonly encountered when compared with ovarian serous neoplasms . An endometriosis associated tumor composed of moderately atypical clear cells lining simple, back - to - back tubules helps recognizing ovarian ec . Ovarian ccc is typically hnf-1 positive, er positive and wt1, p16, and p53 negative . Ovarian ec retain er, pr positivity and are wt1, p16, p53, and hnf-1 negative . Ovarian serous neoplasms show diffuse wt1, p53, p16, and er positivity and are negative for hnf-1 . It is known that agct with pseudo papillae can mimic ccc as happened while reporting on frozen section in this case the ca 125 levels help in approach to the diagnosis, therapeutics and followup of ovarian cancer . Ovarian ccc though present at early stages have the propensity for recurrence even after primary chemotherapy . Higher stages of ccc and higher grades of ec are seen to be associated with significantly decreased survival . Findings in this case, thus highlight the role of ihc in histomorphological distinction of rare subtypes of ovarian carcinomas occurring bilaterally.
|
Corneal neovascularization (cnv) is a sight - threatening condition that is encountered in various inflammatory settings including chemical injury . Cnv can lead to corneal scarring, edema, and lipid deposition that may compromise visual function and decrease the success rate of subsequent penetrating keratoplasty . Topical corticosteroids have been the mainstay for suppressing cnv . However, the inhibitory effects of corticosteroids are limited and may be accompanied by adverse effects including delayed wound healing, infection, posterior subcapsular cataracts, and elevation of intraocular pressure . As an alternative, antibody - based anti - vascular endothelial growth factor molecular targeting therapy has recently become available for the treatment of cnv . However, this treatment also has several drawbacks, including high costs and questionable efficacy in terms of vessel regression and repair of epithelial defects . Rna interference (rnai) occurs when small interfering rna (sirna) molecules, in association with a nucleolytic cytoplasmic protein complex, mediate sequence - specific degeneration of target rna molecules . Theoretically, this mechanism can silence the expression of virtually any gene in a sequence - directed manner with high specificity . Angiopoietin - like protein 2 (angptl2) is a member of the angiopoietin - like protein family and is essential for various physiologic activities, including lipid metabolism, angiogenesis, and inflammation . Kanda et al . Have reported that angptl2 in the ocular tissue was related to acute inflammation in the retina in an endotoxin - induced uveitis model via activation of an nf-b signaling pathway, and they indicated that angptl2 could be a therapeutic target in acute inflammatory disease . In addition, we have previously found that angptl2 is a potent proangiogenic factor in mouse corneal inflammation and that subconjunctival injection of angptl2 sirna in mice dramatically suppressed local expression of angptl2 mrna and reduced the extent of cnv . This finding represents a new approach to the treatment of angiogenesis - associated corneal diseases . However, it is not ideal to perform repeated subconjunctival injections in the clinical setting, and a common problem with rnai agents has been the lack of an effective in vivo drug delivery system . Moreover, because sirnas are double stranded, they might act as ligands for toll - like receptor 3, which may induce innate immune reactions . To address these problems, we generated a single - stranded rnai that can be delivered in a lipid nanoparticle for use as a topical anti - angptl2 agent in the treatment of ocular diseases . In this study, we have examined its efficacy in terms of drug delivery and inhibition of cnv in a mouse alkali - burn model . There was no significant difference in posttreatment viability among five groups (control group, negative proline - modified short hairpin rna (pshrna) group, angptl2 pshrna group, negative pshrna wrapped with liposome (li - pshrna), and angptl2 li - pshrna group), and cell viability in all five groups was greater than that of cells treated with amphotericin b (p <0.01 for comparison, figure 1). Fluorescence - labeled sirna was distributed only in the superficial layer of the corneal epithelium, while fluorescence - labeled li - pshrna showed almost full - thickness distribution (figure 2a) and was detected in the stroma and the endothelium at 3 and 6 hours after instillation of the eye drops (figure 2b). Angptl2 mrna expression was strongly inhibited in both epithelial and stromal cells at 12 and 24 hours (p = 0.049 and <0.001, respectively) after instillation of eye drops in mice, but normal expression of angptl2 mrna was restored by 72 hours (figure 3, n = 7 for all experiments). In contrast, there was no change in angptl2 mrna expression in the corneas of control mice (figure 3). Drug delivery in the alkali model was also evaluated by fluorescence assay, which confirmed that angptl2 li - pshrna was distributed in all layers of the injured cornea, while angptl2 pshrna alone was not (figure 4a). Expression of angptl2 mrna was inhibited at 36 hours after alkali injury by topical treatment with angptl2 li - pshrna, but not by topical administration of negative li - pshrna or by pshrna alone (p = 0.043, n = 6; figure 4b). However, there was no significant difference in the levels of expression of angptl2 mrna expression between the angptl2 li - pshrna group and the control group at 48 hours after alkali injury (figure 4c). After 10 days of once - daily treatment, the area of cnv was markedly reduced in medicated eyes compared to the controls (p <0.01, n = 7; figure 5). There was no significant difference in posttreatment viability among five groups (control group, negative proline - modified short hairpin rna (pshrna) group, angptl2 pshrna group, negative pshrna wrapped with liposome (li - pshrna), and angptl2 li - pshrna group), and cell viability in all five groups was greater than that of cells treated with amphotericin b (p <0.01 for comparison, figure 1). Fluorescence - labeled sirna was distributed only in the superficial layer of the corneal epithelium, while fluorescence - labeled li - pshrna showed almost full - thickness distribution (figure 2a) and was detected in the stroma and the endothelium at 3 and 6 hours after instillation of the eye drops (figure 2b). Angptl2 mrna expression was strongly inhibited in both epithelial and stromal cells at 12 and 24 hours (p = 0.049 and <0.001, respectively) after instillation of eye drops in mice, but normal expression of angptl2 mrna was restored by 72 hours (figure 3, n = 7 for all experiments). In contrast, there was no change in angptl2 mrna expression in the corneas of control mice (figure 3). Drug delivery in the alkali model was also evaluated by fluorescence assay, which confirmed that angptl2 li - pshrna was distributed in all layers of the injured cornea, while angptl2 pshrna alone was not (figure 4a). Expression of angptl2 mrna was inhibited at 36 hours after alkali injury by topical treatment with angptl2 li - pshrna, but not by topical administration of negative li - pshrna or by pshrna alone (p = 0.043, n = 6; figure 4b). However, there was no significant difference in the levels of expression of angptl2 mrna expression between the angptl2 li - pshrna group and the control group at 48 hours after alkali injury (figure 4c). After 10 days of once - daily treatment, the area of cnv was markedly reduced in medicated eyes compared to the controls (p <0.01, n = 7; figure 5). Several researchers have evaluated the therapeutic potential of gene silencing by rnai for cnv in animal models . Kim et al ., using a corneal micro - pocket assay and herpetic stromal keratitis models in mice, reported that the subconjunctival injections and systemic administration of vascular endothelial growth factor pathway - specific sirnas inhibited cnv, and qazi et al . Reported that intrastromal injection of poly nanoparticles loaded with plasmid - expressing anti - vascular endothelial growth factor sirna also inhibited cnv in a more sustained and robust manner than the naked plasmid alone . However, the invasiveness of subconjunctival or intrastromal injections could pose a hurdle to repeated treatments ., we have shown that effective topical delivery of a modified rnai agent (angptl2 li - pshrna) can be accomplished using a lipid nanoparticle, and that this agent reduced the expression of angptl2 mrna and inhibited cnv in a mouse alkali - burn model . Rnai is generally thought to have minimal cellular toxicity because of its endogenous nature, and in a previous study, the intravitreal injection of rnai did not cause any obvious adverse effects in mouse retina . In the present study, li - pshrna did not affect cell viability (figure 1), and we believe that the highly biocompatible nature of rnai - loaded lipid nanoparticles could be ideal for clinical application . We used single - stranded rnai (pshrna) because double - stranded sirnas have been associated with adverse off - target effects due to activation of innate immunity, specifically due to toll - like receptor 3 activation . Further, annealing is mandatory for generation of double - stranded sirna, but not for pshrna, which is a single - stranded rnai in which the linker region has been replaced by amino acid derivatives . This substitution and the short hairpin construct exhibit high stability in vivo and preliminary data (not shown) suggest that pshrna is less susceptible to degeneration due to rnase activity . Because annealing is not necessary to generate the pshrna, the cost can be also reduced . Moreover, previous research showed that pshrna did not have off - target effects and it was more stable against nuclease than double - stranded rnai constructs . The corneal epithelium contains tight junctions that form a barrier to paracellular drug permeation of the inner layer of the cornea in vivo . The corneal epithelium is lipoidal in nature, which poses considerable resistance to permeation by topically administered hydrophilic agents, as demonstrated by the failure of unmodified pshrna, which is hydrophilic, to penetrate the epithelial surface in our experiments (figure 2). Positively charged molecules exhibit poor permeation, presumably because they bind to the negatively charged corneal and scleral proteoglycan matrix . To overcome this, the pshrna was loaded into lipid nanoparticles (li - pshrna) that were specifically designed to facilitate drug delivery to the retina . In this study, we showed that angptl2 li - pshrna could reduce in vivo corneal angptl2 mrna expression (figures 3 and 4). This result and others, for example, that the topical administration of edaravone - loaded lipid nanoparticles can protect against light - induced retinal dysfunction, support the potential usefulness of lipid nanoparticle - loaded topical agents in the treatment of corneal diseases . We found that the marked reduction in the level of angptl2 mrna was not sustained beyond 48 hours after alkali injury . Even in the control group, angptl2 expression dropped to the same level as that of gapdh, suggesting that angptl2 is produced in the very early stage of inflammation . As alkali damage progresses, the cells are not able to produce as much angptl2, and it becomes more difficult to detect the effects of angptl2 rnai . In conclusion, extensive corneal injuries such as chemical burns cause conjunctivalization of the corneal surface and massive neovascularization, leading to corneal opacity and severe reduction in and visual acuity . We have successfully generated a topical rnai agent (li - pshrna) that inhibits corneal inflammation and cnv by inhibiting expression of angptl2 . Li - pshrna eye drops show promise for preventing cnv and subsequent visual impairment without the side effects commonly experienced with steroids or immunosuppressive agents . All animal experiments were approved by the university of tokyo hospital animal care committee and conformed to the association for research in vision and ophthalmology statement for the use of animals in ophthalmic and vision research . All surgical procedures were performed under ketamine hydrochloride (35 mg / kg) and xylazine chloride (5 mg / kg) anesthesia, and all efforts were made to minimize suffering . The angptl2-specific single - stranded rnai segment was contained in a short hairpin structure (angptl2 pshrna) with a stem loop, which was synthesized in the solid phase . The base sequence of the angptl2 pshrna was 5-cca gaa agc gag uac uau auu cc proline modified-3, 5-gga aua uaf uac ucg cuu ucu ggu u-3 (structure shown in figure 6), and the negative control was 5-uac uau ucg aca cgc gaa guu cc proline modified-3, 5-gga acu ucg cgu guc gaa uag uau u-3. The reagents were supplied by bonac (fukuoka, japan). The linker region of the pshrna was replaced by a fluorescent pigment for drug delivery experiments . 1,2-distearoyl - sn - glycero-3-phosphocholine, cholesterol, and stearylamine (7:3:1 molar ratio, lipid concentrations: 20 mmol / l) were dissolved in a small amount of chloroform and dried in a rotary evaporator under reduced pressure at 40 c to form a thin lipid film . The film was dried in a vacuum oven overnight to ensure complete removal of the solvent . Ethylenediaminetetraacetic acid buffer containing rnai, the resultant lipid suspension was incubated in a water bath at 70 c . Sized liposomes were prepared using an extruder (lipofast - pneumatic, avestin, ottawa, ontario, canada) equipped with a polycarbonate membrane (0.1-m membrane filter pore size; whatman japan kk, tokyo, japan). The final phospholipid and rnai concentrations in liposomal suspensions were 20 mmol / l and 0.5 or 1 mol / l, respectively . Cellular viability was evaluated using a nonradioactive colorimetric assay (wst-1; takara bio, shiga, japan) according to the manufacturer's protocol . Simian virus 40-immortalized human corneal epithelial cells were cultured in dulbecco's modified eagle medium (wako pure chemical industry, osaka, japan)/f12 containing 10% fetal bovine serum supplemented with cholera toxin (100 ng / ml), human recombinant epidermal growth factor (10 g / ml), and insulin (5 g / ml). After the culture reached confluence, angptl2 li - pshrna, negative control li - pshrna, amphotericin b (0.1% fungizone, bristol - myers, tokyo, japan), or saline was applied for 30 minutes followed by wst-1 reagent in phenol red - free dulbecco's modified eagle medium / f12 medium for 1 hour at 37 c, and the dye was measured at 450 nm by a victor 3v multilabel counter model 1420 plate reader (perkin elmer, waltham, ma). The results were expressed as the mean sd of the percentage of cell viability compared with that of the control - treated controls . Drops of li - pshrna labeled with fluorescent pigment (5 l) were instilled on the corneal surface of anesthetized mice, after which the eyes were enucleated . Specimens were embedded in optimal cutting temperature compound (sakura finetechnical, tokyo, japan) after 1, 3, and 6 hours . Corneal distribution of the labeled pshrna was examined by fluorescence microscopy (bz-9000; keyence, osaka, japan). The same procedure was performed in the alkali - burn models with drops instilled 1, 3, and 6 hours after alkali burn . To examine changes in mrna expression after administration of the li - pshrna rnai agent, 5 l of angptl2 li - pshrna was instilled on the corneal surface in anesthetized mice . Eyes were enucleated at 12, 24, 48, and 72 hours after administration, and the corneal epithelium was separated from the corneal stroma using trypsin - ethylenediaminetetraacetic acid . The total rna of each sample was extracted and angptl2 expression was quantified by quantitative real - time reverse transcriptase pcr . The pcr amplifications were performed in an instrument using takara pcr thermal cycler dice (takara bio) as described previously . The mouse alkali - burn models were produced as previously described with modifications to suit our experiment . Chemical injury was induced by placing 5 l of 0.5 n sodium hydroxide (naoh) on the cornea of anesthetized mice for 30 seconds . The eyes were then washed with 20 ml saline (day 0). On day 1, the injured eyes were treated with 5 l of angptl2 li - pshrna or negative li - pshrna for 5 minutes, after which reagents were absorbed (kimwipe: nikkei products, osaka, japan) and eyes were subsequently treated with ofloxacin ophthalmic ointment (talibit, santen, osaka, japan). The rnai reagent and antibiotic treatments were repeated daily until day 10, then the mice were euthanized and the cornea with limbus was excised . Briefly, corneas were fixed in acetone for 10 minutes at 20 c, washed three times in phosphate - buffered saline, stained with rat anti - mouse cd31 antibody (bd biosciences, franklin lakes, nj), and incubated at 4 c overnight . The samples were washed again with phosphate - buffered saline and stained with the secondary antibody (alexa fluor 594 donkey anti - rat igg, invitrogen, san diego, ca) for 5 hours at room temperature . The stained samples were evaluated by fluorescence microscopy (bz-9000, keyence), and the cd31-positive blood vessels were quantified by area using image j software (http://rsb.info.nih.gov/ij/). The results are expressed as vessel area / total field . To examine changes in mrna expression in our model, the corneas were extracted 36 and 48 hours after injury, and quantitative real - time reverse transcriptase pcr of angptl2 was performed for each group (control, negative li - pshrna, and angptl2 li - pshrna) using the conditions described above . Statistical analysis . 3.1.1), and values of p <0.05 were considered statistically significant after holm's correction.
|
Uncontrolled bleeding remains major challenge, responsible for 40% trauma - related deaths, which could be prevented by timely intervention . In blunt trauma, extent of hemorrhage cannot be determined by physical examination, as vital signs may not give a clear picture in all the patients, especially young healthy once . Although abnormal vital signs does indicate shock but the absence of abnormality does not exclude hypoperfusion in trauma patients . Decision - making is difficult, regarding surgical intervention to treat injuries hidden from physical examination . These patients are intensely vasoconstricted and may suffer end organ ischemia even with normal systolic blood pressure (sbp). Although shock index (si) can be a useful parameter in acute hemorrhage, but it still needs more study in its support to be better than simple vital sign analysis . Blood ammonia has been shown to be elevated in hemorrhagic shock in animals and humans . Intestinal bacterial enzymes acting on it produces ammonia which is freely diffusible and moreover liver in not fit for detoxification of ammonia . We investigated the significance of ammonia levels estimation in blunt trauma abdomen patients to predict internal hemorrhage, complications and correlated with need of intervention . One hundred blunt trauma abdomen patients (> 12 years old) presented in trauma ward / emergency department of tertiary care hospital were included in the study . Group i required blood transfusion 2 units and/or intervention to control bleeding within 24 h following admission . It was analyzed within 20 min of sampling on autoanalyser cobas 6000 (roche diagnostics india pvt ltd). Routine investigations such as blood sugar, kidney function test, hemogram, x - ray chest, and ultrasound abdomen were done at admission . Group i comprised 62 patients, forty patients needed intervention and blood transfusion both, whereas 22 patients needed only 2 units of blood . Average age was 31.84 14.8 and 32.37 13.6 years, respectively, almost same in both the groups . Most of the patients had more than one organ system involved and most frequently injured organ was liver (40%) followed by spleen (29%). Mean si and arterial ammonia levels were significantly higher in group i compared to group ii patients [table 1]. About 88.7% patient of group i had si> 0.9 compared to only 13.1% patients in group ii [table 2]. Significantly higher number of patients developed complications in group i compared to group ii (38 vs. 7) and 8% mortality rate was noted in group i only . Patients, who developed complications or died, had higher levels of ammonia at admission [table 3 and figure 1]. Mean shock index and ammonia levels percentage of patients showing shock index 0.9/0.9 ammonia levels in patients with complications and mortality in group i receiver operating characteristic analysis of hospital stay, shock index, and ammonia levels the cutoff point for ammonia levels is> 58.85 mol / l (sensitivity 77.42% and specificity 93.37%). Positive predictive value and negative predictive value at this point are 96.7% and 78.9%, respectively . The cutoff point for ammonia levels is> 58.85 mol / l (sensitivity 77.42% and specificity 93.37%). Positive predictive value and negative predictive value at this point are 96.7% and 78.9%, respectively . Roadside accidents were a major cause of trauma (motor vehicle injury) in our study probably due to increase population and number of vehicles on the road . Similar cause has been reported by other studies also . A maximum number of patients (78%) were below the age of 40 years suggesting this age group people are more outgoing and rash drivers making them more prone to accidents . Male preponderance (93%) noted in our study is higher than earlier studies, may be reflecting indian culture where male member of the family being breadwinner, needs to travel more than females . The routine evaluation of blunt trauma abdomen patients includes various clinical parameters, physical examination, radiological and laboratory findings . Increased ammonia levels as observed in our study could itself be danger signal in these patients as it is sign of blood in abdominal cavity due to blunt trauma . Intestinal bacterial enzymes acting on it produces ammonia which is freely diffusible and moreover liver in not fit for its detoxification as hemorrhage decreases hepatic blood flow through portal vein causing dysoxia of cells . Increased ammonia levels have been reported in animal hemorrhagic shock and in few human studies as well . Cutoff value for ammonia was also calculated to maximize sensitivity and specificity in identifying patients requiring intervention . The purpose of this study was to augment the diagnostic accuracy of routine clinical assessment of such patient . High ammonia levels in bleeding patients (group i) correlated well with si as 88.7% of these patients had si> 0.9, i.e., having potentially severe trauma requiring immediate treatment . Other workers have also reported similar si in bleeding patients . Although si can be useful clinical parameter in acute hemorrhage which depicts severity of situation in heterogeneous patients presented in emergency but it still needs more study in its support to be single reliable parameter . Five patients died in group i had high ammonia levels (87.4 mol / l) at admission . High ammonia itself is toxic and can cause various complications, so it must be diagnosed and treated as early as possible . Moreover, trauma patient loses lots of valuable time in reaching trauma center, but once reached the hospital, they need to be diagnosed correctly and quickly . Biochemical marker which is time and cost effective such as ammonia estimation can predict need of intervention in these patients and best treatment can be provided in the golden hour.
|
Spondyloarthritis (spa) is one of the most common chronic immune - mediated inflammatory diseases, affecting 0.5%1.5% of the western population . Spa comprises ankylosing spondylitis (as), psoriatic arthritis, arthritis / spondylitis with inflammatory bowel disease and reactive arthritis; patients with typical features of spa not fulfilling the criteria for one of the above - mentioned subtypes have also been incorporated in the spa concept (undifferentiated forms). Spa usually involves the spine, entheses, and peripheral joints,1 and its pathogenesis is quite different from that of rheumatoid arthritis, with different major histocompatibility complex molecules,2 as well as predisposing and susceptibility factors.3 the clinical presentation of spa is characterized by the presence of active inflammatory symptoms, particularly in the early stage, with pain and stiffness; although spa can also be distinguished according to the clinical presentation as predominantly peripheral or axial, some overlap between these two subtypes often occurs . Psoriasis, uveitis, and inflammatory bowel disease frequently coexist.46 control of signs and symptoms and reduction of inflammation parameters are key treatment targets in axial and peripheral spa.1,7,8 according to the joint assessment of spondyloarthritis international society (asas)/european league against rheumatism (eular), nonsteroidal anti - inflammatory drugs (nsaids), including the selective cyclooxygenase-2 (cox-2) antagonists, are recommended as first - line drug treatment of pain and stiffness in spa;7,911 tumor necrosis factor (tnf)- blocking agents are recommended in unresponsive subjects or in patients intolerant to nsaids.7,12 unlike rheumatoid arthritis, neither conventional disease - modifying antirheumatic drugs (dmards) nor glucocorticoids (gcs) are recommended in the treatment of axial spa,7 and the evidence for their efficacy in this context is limited and controversial . However, gcs could be helpful in patients with uncontrolled peripheral joint manifestations, particularly in the absence of effective alternative first - line treatment options (ie, patients intolerant or with contraindications to nsaids). More recently, oral prednisolone 50 mg / day showed a short - term response significantly higher than placebo, but not low - dose prednisolone.13 given the complex interactions between the hypothalamic pituitary adrenal axis and the activated immune system, there are circadian variations in serum cortisol, tnf- and interleukin-6 levels; the latter two peaking early in the morning.14 conventional gcs are usually administered in the morning; such administration would be suboptimal, since peak plasma steroid concentrations occur well after the circadian inflammatory cytokines rise . On the contrary, inflammation, pain, and morning stiffness might be better controlled by anticipating the traditional administration of gcs, thus adapting the release of gcs to the rhythms of endogenous cortisol and cytokines . To these aims, a modified - release (mr) oral prednisone has been developed, and its use has been approved in rheumatoid arthritis in europe . Administered at bedtime, its timing of drug release early in the morning (at about 02.00 am) better suits the circadian rhythms of inflammation and symptoms, with a clinically relevant reduction in pain and morning stiffness compared to conventional prednisone.15 the efficacy of low - dose mr prednisolone in patients with spa is unknown . Therefore, the aim of this preliminary study was to assess the midterm clinical efficacy and safety profile of low - dose mr prednisone in gc - nave patients with axial spa refractory or intolerant to nsaids or with comorbidities limiting tnf- blocking agents . This 12-week, single - center, retrospective, observational analysis was performed using data from patients treated at the rheumatologic unit of the university of florence, florence, italy . The study was performed in accordance with italian legislation on the protection of personal data and with the approval of the institutional review board of the university hospital of florence (italy) (protocol number 2015/00 16289). All patients signed informed consent for the anonymous collection of their demographic and clinical data . Data from all gc - nave adult patients aged> 18 years who were referred to the authors specialist center with a diagnosis of axial spa according to asas criteria16 from september 2012 to december 2013 were reviewed . Patients refractory, intolerant or with contraindications to nsaids and/or with comorbidities limiting tnf- blocking agents who, in the absence of contraindications, were prescribed mr prednisone were included in this study . Patients were not included in the study if, at the time of their first mr prednisone prescription, they were already receiving other steroids . Other exclusion criteria were presence of other rheumatic diseases or chronic infections, severe mechanical axial comorbidities unrelated to spa, or neurological disorders with motor, and cognitive or sensitive impairment and active cancer . Pregnant females, patients with cognitive impairment not allowing an appropriate pain assessment, and subjects with a history of alcohol and drug abuse were also excluded . At baseline (t0), patients were visited by specialized clinicians trained in the management of as and prescribed mr prednisone 5 mg daily (lodotra tablets, bedtime administration at about 10.00 pm). Patients were seen or contacted by phone calls or email after 4 weeks (t1); if well tolerated, no dose adjustments of mr prednisone were done; otherwise it was interrupted . Thereafter, all patients were reevaluated 8 weeks later (t2), thus after 12 weeks on mr prednisone . Given the low steroid dosage prescribed, no specific bone or gastric protectors were recommended . Other medications used for the treatment of any other underlying medical conditions were continued with their dosage unchanged . Disease activity was measured at baseline and the t2 visit by the bath ankylosing spondylitis disease activity index (basdai, scores 4/10 indicating an active disease, according to eular recommendation).17 presence and severity of symptoms were evaluated on a verbally administered 010 numerical rating scale (with 0 indicating the absence and 10 an extremely severe symptom). At baseline and t2, fatigue and morning stiffness duration (min) were also measured, as well as spinal mobility, measured by bath ankylosing spondylitis metrology index (basmi score of 010).18 other serial evaluations included the entheseal pain, investigated using the maastricht ankylosing spondylitis enthesitis score (mases of 013);19 the number of swollen and tender joints (66/68-joint score) and the presence of dactylitis, sacroiliac, axial, and peripheral pain at palpation . Laboratory outcome assessments included erythrocyte sedimentation rate (esr) and crp levels at baseline and t2 . Safety evaluations were also performed with the recording of adverse drug - related reactions (adrs) that occurred after the first intake of mr prednisone or worsened in intensity and/or frequency thereafter . Adrs were collected via spontaneous reports and patient visits, and the potential correlation between the adr and the study drug was judged by the visiting rheumatologist . Only adrs of moderate degree (ie, those symptoms causing a low level of inconvenience or concern that interferes with daily activities and functioning, requiring mr prednisone dose tapering or not permitting the dose escalation) or severe degree and requiring treatment discontinuation were considered . Serious adverse events associated with the use of mr prednisone were also recorded.20 the primary efficacy measure of the study was the response rate to mr prednisone at week-12 visit, defined according to basdai values at baseline and changes in disease activity throughout the observation: in subjects with a baseline basdai score of 4, the response to mr prednisone was defined as a final basdai score of <4;21 in patients with a baseline basdai score of <4, response to therapy was defined as a 50% improvement of the basdai at t2 . To determine the size of the sample to be included in the analysis based on a fleming s design, the null hypothesis was set at a response rate of at most 32% (ie, less than one - third of the considered population); the alternative hypothesis was set at a response rate of at least 51% (more than half of the population), with a power of 80% and a significance level of 0.05, and a minimum of 56 patients were needed . The authors summarized data as mean and standard deviation for continuous variables and as the number (percentage) of study participants for categorical variables . The significance of differences between pairs of continuous variables was evaluated by the student s t - test or the wilcoxon test . A student s t - test for unpaired data or analysis of variance was used to test differences between groups, with bonferroni s correction when indicated . A cox logistic regression analysis was used to identify the variables at baseline independently correlated with response to mr prednisone among those significantly associated on univariate analysis . All tests of significance were two - tailed, and a p - value of <0.05 was considered significant . Disease activity was measured at baseline and the t2 visit by the bath ankylosing spondylitis disease activity index (basdai, scores 4/10 indicating an active disease, according to eular recommendation).17 presence and severity of symptoms were evaluated on a verbally administered 010 numerical rating scale (with 0 indicating the absence and 10 an extremely severe symptom). At baseline and t2, fatigue and morning stiffness duration (min) were also measured, as well as spinal mobility, measured by bath ankylosing spondylitis metrology index (basmi score of 010).18 other serial evaluations included the entheseal pain, investigated using the maastricht ankylosing spondylitis enthesitis score (mases of 013);19 the number of swollen and tender joints (66/68-joint score) and the presence of dactylitis, sacroiliac, axial, and peripheral pain at palpation . Laboratory outcome assessments included erythrocyte sedimentation rate (esr) and crp levels at baseline and t2 . Safety evaluations were also performed with the recording of adverse drug - related reactions (adrs) that occurred after the first intake of mr prednisone or worsened in intensity and/or frequency thereafter . Adrs were collected via spontaneous reports and patient visits, and the potential correlation between the adr and the study drug was judged by the visiting rheumatologist . Only adrs of moderate degree (ie, those symptoms causing a low level of inconvenience or concern that interferes with daily activities and functioning, requiring mr prednisone dose tapering or not permitting the dose escalation) or severe degree and requiring treatment discontinuation were considered . The primary efficacy measure of the study was the response rate to mr prednisone at week-12 visit, defined according to basdai values at baseline and changes in disease activity throughout the observation: in subjects with a baseline basdai score of 4, the response to mr prednisone was defined as a final basdai score of <4;21 in patients with a baseline basdai score of <4, response to therapy was defined as a 50% improvement of the basdai at t2 . To determine the size of the sample to be included in the analysis based on a fleming s design, the null hypothesis was set at a response rate of at most 32% (ie, less than one - third of the considered population); the alternative hypothesis was set at a response rate of at least 51% (more than half of the population), with a power of 80% and a significance level of 0.05, and a minimum of 56 patients were needed . The authors summarized data as mean and standard deviation for continuous variables and as the number (percentage) of study participants for categorical variables . The significance of differences between pairs of continuous variables was evaluated by the student s t - test or the wilcoxon test . A student s t - test for unpaired data or analysis of variance was used to test differences between groups, with bonferroni s correction when indicated . A cox logistic regression analysis was used to identify the variables at baseline independently correlated with response to mr prednisone among those significantly associated on univariate analysis . All tests of significance were two - tailed, and a p - value of <0.05 was considered significant . Two of them stopped mr prednisone early for nonclinical reasons (poor compliance) and were excluded; the remaining 57 were included in the final analysis . Table 1 summarizes the baseline demographic and clinical characteristics of the analyzed population (median age 56 years, range 2686 years; 65% females). In about one - third of patients (32.2%), the diagnosis of axial spa dated <1 year . All patients had findings of sacroiliitis on magnetic resonance imaging . At baseline, three - fourth of the authors patients (72.9%) had been treated with dmards and/or anti - tnf- drugs . According to the baseline basdai, an active or low - active disease was present in 41 (71.9%) and 16 (28.1%) patients, respectively; the demographic and clinical data of the two subgroups are also reported in table 1 . After 12 weeks on mr prednisone 5 mg daily, a significant reduction in basdai was found in the overall population (from 5.52.6 to 3.02.8; p<0.001). Axial and peripheral pain decreased from 5.23.9 to 3.43.5 (p=0.0013) and from 6.33.7 to 3.83.7 (p<0.001), respectively . The number of swollen and/or tender joints were also significantly reduced after 12 weeks on mr prednisone (from 2.87.9 to 1.35 [p=0.002] and from 4.13.7 to 2.53.4 [p=0.002], respectively). Fatigue significantly improved (from 6.23.8 to 3.63.5; p<0.001), severity of morning stiffness decreased (from 6.53.4 to 3.33.6, p<0.0001), as well as its duration (from 55.644.8 to 15.625.1 min, p<0.0001). Dactylitis, found in 14 patients (24.1%) at baseline, was still present after mr prednisone in only three patients (5.1%, p<0.05; odds ratio 0.15, 95% confidence interval: 0.640.047). On the contrary, only modest variations in basmi and mases were recorded (from 1.51.9 to 1.21.6 and from 2.94.3 to 1.93.7, respectively; nonsignificant [ns] for both variations). Axial, peripheral pain, fatigue, and morning stiffness at baseline and different time points after low - dose mr prednisone in patients with active or low - active spa are shown in figure 2 . Inflammatory markers also significantly declined after mr prednisone: esr decreased from 20.316 to 15.413 mm (p<0.001) and cpr from 1126 to 46 mg / l (p<0.05). Overall, the response rate after 12 weeks was 52.6% (figure 1): among the 16 patients who started mr prednisone with a low - active disease (basdai score of <4), the primary outcome parameter (ie, a 50% improvement of the basdai at week 12) was achieved in eight (50%). A similar response rate (n=22, 53.7%, ns) was documented in the 41 patients with active spa at baseline . With regard to the subgroup of subjects with basdai values at baseline 4, thus indicating active spa, the baseline values and absolute changes for important secondary efficacy parameters after 12 weeks on mr prednisone in responders and nonresponders are reported in table 2 . At univariate analysis, responders had a longer disease duration (p=0.03) and lower mases, sacroiliac, axial, and peripheral pain scores at baseline (p=0.03, p=0.02, and p=0.01, respectively). When the variables that significantly correlated with clinical response to mr prednisone by univariate analysis were introduced in the logistic regression model, none of them were found to be independent predictors of response (=2.2, 0.34, 2.9, 2.8, and 3.6 for disease duration, mases, sacroiliac, axial, and peripheral pain scores, respectively; all p>0.05). Overall, the new treatment was well tolerated, and no serious adverse events occurred during the 12-week observation period . Adrs after mr prednisone were reported by seven patients (11.8%): one severe adr (1.7%) occurred in a 69-year - old female complaining of aphthous stomatitis and panniculitis of the lower limbs; of note, symptoms disappeared after discontinuation of treatment, but did not reoccur after mr prednisone was reintroduced 3 months later due to disease reactivation after drug interruption . There were six other patients (10.2%) reporting adrs of moderate severity and requiring mr prednisone dose reduction (three patients with history of gastric intolerance to nsaids reported epigastric pain; two other patients reported leg tightness and one patient reported bilateral pretibial hematoma); all of them completed the 12-week drug observation . After 12 weeks on mr prednisone 5 mg daily, a significant reduction in basdai was found in the overall population (from 5.52.6 to 3.02.8; p<0.001). Axial and peripheral pain decreased from 5.23.9 to 3.43.5 (p=0.0013) and from 6.33.7 to 3.83.7 (p<0.001), respectively . The number of swollen and/or tender joints were also significantly reduced after 12 weeks on mr prednisone (from 2.87.9 to 1.35 [p=0.002] and from 4.13.7 to 2.53.4 [p=0.002], respectively). Fatigue significantly improved (from 6.23.8 to 3.63.5; p<0.001), severity of morning stiffness decreased (from 6.53.4 to 3.33.6, p<0.0001), as well as its duration (from 55.644.8 to 15.625.1 min, p<0.0001). Dactylitis, found in 14 patients (24.1%) at baseline, was still present after mr prednisone in only three patients (5.1%, p<0.05; odds ratio 0.15, 95% confidence interval: 0.640.047). On the contrary, only modest variations in basmi and mases were recorded (from 1.51.9 to 1.21.6 and from 2.94.3 to 1.93.7, respectively; nonsignificant [ns] for both variations). Axial, peripheral pain, fatigue, and morning stiffness at baseline and different time points after low - dose mr prednisone in patients with active or low - active spa are shown in figure 2 . Inflammatory markers also significantly declined after mr prednisone: esr decreased from 20.316 to 15.413 mm (p<0.001) and cpr from 1126 to 46 mg / l (p<0.05). Overall, the response rate after 12 weeks was 52.6% (figure 1): among the 16 patients who started mr prednisone with a low - active disease (basdai score of <4), the primary outcome parameter (ie, a 50% improvement of the basdai at week 12) was achieved in eight (50%). A similar response rate (n=22, 53.7%, ns) was documented in the 41 patients with active spa at baseline . With regard to the subgroup of subjects with basdai values at baseline 4, thus indicating active spa, the baseline values and absolute changes for important secondary efficacy parameters after 12 weeks on mr prednisone in responders and nonresponders are reported in table 2 . At univariate analysis, responders had a longer disease duration (p=0.03) and lower mases, sacroiliac, axial, and peripheral pain scores at baseline (p=0.03, p=0.02, and p=0.01, respectively). When the variables that significantly correlated with clinical response to mr prednisone by univariate analysis were introduced in the logistic regression model, none of them were found to be independent predictors of response (=2.2, 0.34, 2.9, 2.8, and 3.6 for disease duration, mases, sacroiliac, axial, and peripheral pain scores, respectively; all p>0.05). With regard to the subgroup of subjects with basdai values at baseline 4, thus indicating active spa, the baseline values and absolute changes for important secondary efficacy parameters after 12 weeks on mr prednisone in responders and nonresponders are reported in table 2 . At univariate analysis, responders had a longer disease duration (p=0.03) and lower mases, sacroiliac, axial, and peripheral pain scores at baseline (p=0.03, p=0.02, and p=0.01, respectively). When the variables that significantly correlated with clinical response to mr prednisone by univariate analysis were introduced in the logistic regression model, none of them were found to be independent predictors of response (=2.2, 0.34, 2.9, 2.8, and 3.6 for disease duration, mases, sacroiliac, axial, and peripheral pain scores, respectively; all p>0.05). Overall, the new treatment was well tolerated, and no serious adverse events occurred during the 12-week observation period . Adrs after mr prednisone were reported by seven patients (11.8%): one severe adr (1.7%) occurred in a 69-year - old female complaining of aphthous stomatitis and panniculitis of the lower limbs; of note, symptoms disappeared after discontinuation of treatment, but did not reoccur after mr prednisone was reintroduced 3 months later due to disease reactivation after drug interruption . There were six other patients (10.2%) reporting adrs of moderate severity and requiring mr prednisone dose reduction (three patients with history of gastric intolerance to nsaids reported epigastric pain; two other patients reported leg tightness and one patient reported bilateral pretibial hematoma); all of them completed the 12-week drug observation . The anti - inflammatory and immunosuppressive effects of gcs are well characterized, although their precise mode of action is highly complex, eliciting different types of responses and with an adverse event profile depending on the target cell, type of gc, dosage, and administration route used.2224 gcs are effective in relieving the signs and symptoms and interfering with radiographic progression in the treatment of rheumatoid arthritis and other inflammatory rheumatic diseases, either as monotherapy or in combination with synthetic dmards.17,22,25 on the contrary, there are limited data on their use in patients with spa; although steroids administered locally have been proven effective when used intravenously26 or by computed tomography - guided injections into sacroiliac joints,27 the asas / eular recommendations for the management of spa still state that the use of systemic gcs is not supported by evidence.7 modern trials have confirmed that the efficacy of gcs can be significantly improved by administration as chronotherapy.28 in particular, low - dose mr prednisone effective at 02.00 am inhibits the proinflammatory sequelae of nocturnal inflammation better than gc administration in the morning, alleviating signs and symptoms related to pathways of circadian cytokines without increasing the risk of hypothalamus pituitary adrenal axis insufficiency in rheumatoid arthritis.29 in the authors retrospective trial, the efficacy of mr prednisone was assessed under real - life conditions over a medium - term observation period of 3 months . Despite the low steroid dosages prescribed, the authors found a substantial improvement of fatigue, pain, and morning stiffness, a significant reduction in inflammatory markers, as well as in basdai scores . Interestingly, the severity and duration of morning stiffness and number of tender and/or swelling joints were more likely to benefit from low - dose mr prednisone . On the contrary, sacroiliac pain and basmi score were substantially unchanged after 12 weeks, and mases decreased only slightly after mr prednisone . Sacroiliac pain, an efficacy parameter not easy - to - use and rarely used to monitor as improvements in clinical trials, is generally more severe in early than in late stages of disease . Basmi, a parameter indicating loss of axial mobility, and indirectly, permanent damage, not surprisingly, was higher in patients with low disease activity, who also had longer disease duration . Mases encompasses the extent of enthesitis; of note, baseline masess were significantly higher in patients with active disease (basdai score of 4) and in nonresponders to mr prednisone, in whom sacroiliac, as well as peripheral pain, was also more severe, with a disease of shorter duration . Speculatively, low - dose mr prednisone might be more effective at midterm on synovitis (ie, on arthritis) rather than enthesitis - predominant disease . However, in the authors study, at multivariable analysis none of the clinical parameters investigated by univariate and multivariable analysis independently correlated with response to low - dose mr prednisone . Thus, the prediction of those subjects with active spa who will mostly benefit from low - dose mr prednisone could not be considered straightforward, based only on clinical data . Although the authors cannot exclude that it is the limited number of subjects evaluated that drive such inconclusive findings at multivariable analysis, a more likely explanation is that the clinical parameters taken into consideration are somehow related to each other . To the authors knowledge, only one placebo - controlled double - blind multicenter trial has prospectively explored the short - term (2-week) efficacy of higher dosages of gcs in patients with active as . In a small number (n=39) of patients who were younger and with a greater disease duration than the authors study cohort, haibel et al13 found that oral prednisolone 50 mg daily, but not 20 mg, significantly improved several outcome parameters (ie, basdai, morning stiffness, patient global assessment, basmi, and bath ankylosing spondylitis functional index) compared with those of placebo . In that study, the basdai score reduction after 2 weeks of 20 and 50 mg oral prednisolone was 1.19 and 2.29 points from baseline values, respectively . Notably, of the authors 42 patients with active spa at baseline, nearly half (53.7%) responded, despite the very low dosages (5 mg daily) of prescribed mr prednisone, with a basdai score reduction of 3.1 points after 3 months . Moreover, axial and peripheral pain and fatigue and morning stiffness were already significantly improved after 4 weeks (figure 2) and then remained substantially unchanged . Overall, the safety and tolerability profiles of low - dose mr prednisone treatment were good in this 12-week observation . Adrs were reported in a small percentage of patients, none was serious, and although premature drug interruption was needed in three subjects, the reported side effects had a modest clinical impact . The small number of side effects associated with low - dose mr prednisone seems in accordance with the findings from capra-2, which showed a good 3-month safety profile from mr prednisone in comparison with placebo.30 the present study is the first suggesting the efficacy and tolerability of low - dose mr prednisone in spa . This study has several limitations, including the retrospective design, the absence of a control group, and the short period of observation . However, the authors population is well representative of patients typically encountered in daily clinical practice with spa and treated by office - based rheumatologists . In this retrospective trial, a 12-week oral treatment with low - dose mr prednisone significantly reduced disease activity, fatigue, stiffness, and pain in steroid - nave patients with spa . Efficacy was accompanied by a positive safety profile . Taken together, these results suggest that low - dose mr prednisone, alone or in association with anti - tnf- agents, might be a valuable therapeutic option in patients with spa intolerant / refractory to nsaids . Despite its limitations, the authors study may provide useful information and guidance for future studies to confirm the effective use of mr prednisone in this setting.
|
Cervical radiculopathy is typically caused by lateral disc herniation or osteophytes in the intervertebral foramen . Surgical management for radiculopathy of the cervical spine includes anterior cervical discectomy and fusion (acdf), cervical foraminotomy via an anterior or posterior approach, and cervical arthroplasty with decompression . Surgeons tend to choose the surgical method that is appropriate to the patient's needs, the pathologic characteristics of the case, and the surgeon's skill . Acdf has been considered the standard access for cervical degenerative disease owing to the usefulness of exposure, wide exposure of the lesion, and reduced patient discomfort.1 however, additional complications, such as graft - site complications and pseudoarthroses, must be considered . Moreover, loss of motion and long - term consequences of cervical fusion on treated segments have been associated with increased pressure in the disc space and adjacent segment degeneration.23 artificial cervical disc replacement is advantageous for preserving segment mobility . However, long - term follow - up is needed to establish whether arthroplasty can reduce adjacent level degeneration . Posterior cervical foraminotomy can maintain the range of motion of the treated cervical segment and minimize adjacent segment degeneration . The posterior approach is especially feasible when soft disc herniation irritating the nerve root originates from the posterolateral location . It may also be feasible for patients with osteophytes originating from the facet joint and for patients who complain of more serious radicular symptoms than neck symptoms.45 however, posterior cervical foraminotomy has a relatively narrow operative window compared with anterior - approach cervical surgery . To preserve the anatomical integrity after spinal surgery, co2 laser - assisted microscopic discectomy or endoscopic discectomy has been used in a narrow surgical field in the lumbar spine.6 in this study, we report 12 cases of unilateral cervical radiculopathy that were managed by a posterior approach with a co2 laser for disc removal or foraminal decompression and discuss the clinical and radiological outcomes and efficacy of the co2 laser . We retrospectively reviewed the clinical and radiological data of 12 consecutive patients with unilateral cervical radiculopathy who underwent posterior foraminal decompression or discectomy by use of a co2 laser between january 2006 and december 2008 . The inclusion criteria for this study were as follows: unilateral cervical foraminal stenosis and unilateral posterolateral soft disc herniation as demonstrated by computed tomography or magnetic resonance imaging (mri), unilateral radicular symptoms and/or neck pain consistent with radiologic findings, and unsuccessful outcome of conservative treatment for at least 6 weeks . Institutional review board / ethics committee approval was obtained from the institutional review board of the chonnam national university hospital (irb no . Preoperative mri was performed to demonstrate either posterolateral disc herniation or foraminal stenosis caused by spondylotic osteophytes . Computed tomography was also performed preoperatively to evaluate the calcified disc . Within 1 day after surgery, the degree of spinal canal and nerve root compression was evaluated by postoperative mri in all cases . Clinical outcomes were evaluated by using visual analogue scale (vas) scores for radicular pain and odom's criteria . Plain cervical radiographs were obtained before the operation, immediately after the operation, and at the final follow - up for assessment of spinal instability and kyphotic deformity . We defined spinal instability as newly developed translation of more than 3.5 mm or angulation of more than 11 degrees in the index level . To evaluate the development of kyphotic deformity, the cobb angle of the entire segment from c2 to c7 was measured by neutral plain radiograph . The surgical procedure was as follows . With the patient in the prone position, a midline skin incision centered on the disc space first, the inferior part of the upper - level lamina and the superior part of the lower - level lamina were drilled away in the lateral third of the lamina, and then the medial half of the facet joint was drilled away . When performing facetectomy, we always tried to preserve more than half of the facet joint . Bleeding from the epidural vein and radicular plexus were controlled by bipolar coagulation, aviten, and thrombin - soaked gel foam . After carefully retracting the root in the upward direction, annulotomy was performed with a co2 laser (lumenis co, israel) connected to a microscope . When using the co2 laser, we used about 300 joules of laser energy . Subsequently, the disc fragment was removed by use of the microprobe and co2 laser . During co2 laser treatment, heating injury after we confirmed under the microscopic view that the root was properly decompressed, the wound was closed layer by layer . The patients included eight men and four women with a mean age of 53.0 years (range, 41 - 75 years) and a mean follow - up duration of 33.3 months (range, 19 - 44 months). All patients had posterior neck pain and radiating pain to the shoulder or arm that was refractory to conservative therapy . The affected levels were as follows: c5 - 6 in four patients, c6 - 7 in six patients, and c5 - 6 - 7 in two patients . Single - level foraminotomy was performed in 10 patients and two - level foraminotomies were performed in 2 patients . Radicular symptoms were more common on the left side (10 cases) than on the right side (2 cases). Postoperative vas scores for radicular symptoms improved or resolved in all patients compared with preoperative states (table 1). For odom's criteria, excellent (33.3%) or good (50%) results were obtained at discharge, and patients returned to their preoperative employment and physical activity . At the last follow - up, 11 patients (91.7%) showed excellent or good clinical outcomes with respect to odom's criteria, and 1 patient (8.3%) was fair at the last follow - up (fig . 1). His follow - up mri at 40 months after surgery showed recurrence of disc herniation . Although we recommended acdf, he refused it and wanted conservative treatment . The postoperative mri confirmed extensive decompression of the disc protrusion and widening of the cervical foraminal space . In serial follow - up with plain radiographs, the development of significant cervical kyphosis was not detected at the last follow - up . The mean preoperative segmental angulation was 12.4 degrees, and the mean postoperative segmental angulation was 12.0 degrees in our series . At the last follow - up although two patients had complained of axial neck pain postoperatively, this resolved within 3 months . As an illustrative case, we discuss a 46-year - old man who had persistent neck pain and left arm radiating pain for 3 months . The preoperative mri revealed a herniated disc to the intervertebral foramen of the c6 - 7 on the left side (fig . He had been treated conservatively in other hospitals for 2 months; however, he had difficulty in everyday life owing to his neck and left arm pain . The patient underwent a left - sided posterior foraminotomy on c6 - 7, and we initially confirmed dural sac, nerve root, and a protruding disc in an operative microscopic view (fig . 2c). After confirmation of the neural structure and disc space, disc fragments were removed via a small operative corridor by microprobe and co2 laser . Immediately after surgery, the vas score of the arm decreased from 8 to 3 . Postoperative mri demonstrated removal of the herniated disc and widening of the intervertebral foramen (fig . 3a and b). Posterior laminectomy to treat cervical disc herniation was first reported by mixter and barr.7 the technique subsequently evolved to a small keyhole foraminotomy . However, the posterior procedure is considered an indirect decompression, because it leaves the anteriorly compressed lesion on the root owing to the difficult approach.8 for direct decompression of lesions such as bony spurs and disc fragments compressing the root, robison and smith in 1955 and cloward in 1958 reported the anterior approach for discectomy and fusion . The anterior approach is recommended for central compressive lesions, especially in the clinical cases of myelopathy or bilateral symptoms . The risk of graft - site complications has been reported to be up to 18%.9 problems associated with acdf have included loss of intervertebral height, pseudoarthroses, complications related to access, and adjacent segment degenerations caused by the loss of mobility.10 the evolution of arthrodeses minimizes the progression of pseudoarthroses; however, the problem of stresses in adjacent levels and adjacent segment degeneration with symptoms remains.1011 hilibrand et al.2 reported that among patients who experienced acdf, 2.9% of patients per year had symptomatic adjacent segment disease, 25.6% of patients developed adjacent segment disease within 10 years of the operation, and 7.5% of these patients required reoperation . However, concerns remain regarding vertebral artery injury, the development of spinal instability, and recurrence.12 an excessive resection of an uncovertebral joint may cause instability of motion of the segment and lead to a second operation.13 a 2% risk of permanent superior laryngeal and recurrent laryngeal nerve injury and a 0.25% risk of esophageal perforation has been reported . Risk of horner's syndrome has also been reported.71415 the posterior approach is especially appropriate for unilateral radiculopathy caused by lateral or foraminal stenosis . Posterior foraminotomy allows decompression of the nerve root and avoids fusion and several visceral and soft tissue structures on the anterior neck . Furthermore, it can expose the involved nerve root directly and offer better visualization of the exiting nerve root.16 because of decompression without the fusion, the associated complications such as graft dislodgement, graft site morbidity, plate and implant complications, and pseudoarthroses can be avoided . This approach can avoid several complications caused by manipulation of visceral structures on the anterior neck, such as damage to the trachea and esophagus.11 there are also no risks of cerebrovascular complications caused by manipulation of the vascular structures, and there is a low risk of vertebral artery injury after posterior foraminotomy compared with anterior cervical foraminotomy . Posterior foraminotomy can be performed unilaterally or bilaterally, at a variable number of levels, or in combination with another posterior - approach surgery such as laminectomy or laminoplasty . Bilateral foraminal disease at a single level is treated by the fenestration that includes bilateral foraminotomy while preserving spinous processes and intraspinous and supraspinous ligaments . However, with a posterior foraminotomy, it is difficult to remove the ventral lesion adequately owing to the relatively narrow operative field . Therefore, indirect decompression of the nerve root in some cases, especially on the calcified lesion, could be another potential disadvantage . The primary concern should be to avoid or minimize manipulation of the root and spinal cord.1718 the surgical goal should be exact decompression under continuous visualization with concurrent minimization of surgery - related trauma and its possible consequences . The goal of posterior foraminotomy is to move the nerve root away from the ventral compressive lesions such as osteophytes . In this study, we used a co2 laser to overcome this limitation . Since the first trial of a neodymium: yttrium - aluminum - garnet (nd: yag) laser during disc surgery of the lumbar spine, many reports about the effectiveness and usefulness of several kinds of lasers for disc surgery have been published.192021 nerubay et al.21 reported that 50 patients who complained of unilateral radiating leg pain due to lumbar disc disease were successfully managed by percutaneous laser nucleolysis with a co2 laser . Lee and lee.6 reported that a co2 laser enabled sufficient removal of extraforaminal or foraminal lumbar disc herniation via a narrow surgical window without excessive loss of the facet joint or the pars interarticularis . In cervical disc disease, disc decompression with a percutaneous laser showed significant clinical benefits such as improvement of several symptoms in over 51% of patients observed during a mean period of 43 months.22 these studies strongly support that a co2 laser can be useful for removing cervical discs . Additionally, when the co2 laser is applied to a microscopic operation, it enables disc cysts to be readily removed and disc material to be easily vaporized . In this study, the lateral osteophyte of the uncinate process was decompressed adequately by using kerrison rongeurs and a high - speed drill, and the ventrally protruded disc was removed by using a co2 laser in cases of posterolateral or foraminal disc protrusion . After annulotomy with the co2 laser, the protruded disc was carefully removed by microprobe and co2 laser . This technical advance can achieve minimal manipulation of the nerve root and spinal cord during direct satisfactory decompression despite the narrow working space . The primary postoperative problem has been access - induced neck pain secondary to the subperiosteal detachment of muscle from bony structures . Some studies have reported that excessive removal of facet (more than 50%) or bilateral procedures at the same level could cause instability.2324 postoperative kyphosis has been a major concern in some reports with the presence of cervical deformity, which has been a risk factor for kyphosis on the cervical spine . In those cases, the extent of facetectomy played a major role in causing postoperative kyphosis.12526 however, the extent of facet resection required during posterior foraminotomy is typically 25% and rarely exceeds 50%.2728 particularly, the extent of laminotomy or facetectomy for decompression or disc removal can decrease if a co2 laser is adequately used through the small space . Therefore, the incidence of segmental instability after surgery can be decreased by minimizing removal of the cervical facet joint.29 in our series, we could preserve the cervical facet joint more than 50% by using a co2 laser for posterior cervical foraminotomy and discectomy, and segmental instability did not develop during the follow - up period . Therefore, minimal and unilateral paraspinal dissection and facetectomy for one- or two - level radiculopathy may not influence the development of postoperative cervical kyphosis because contralateral paraspinal muscles and midline ligamentous structures are preserved . If segmental instability is suggested in the evaluation of preoperative flexion and extension views, posterior foraminotomy should be clearly excluded from the surgical options . On imaging studies, the evidence of a central compressive lesion, preexisting kyphosis, or myelopathy could be potential contraindications . In our studies, two patients complained of transient axial neck pain without the development of postoperative segmental instability . We thought that postoperative transient axial neck pain may have developed from an approach - related problem, such as paraspinal dissection or injury to the cervical medial branch during operation . In addition to the advantage of preserving the motion of the segment, adjacent segment disc degeneration is unlikely to occur in patients undergoing posterior foraminotomy . A large - scale, well - designed, randomized clinical trial for patients in this clinical scenario will be necessary to resolve this question . In conclusion, posterior microscopic foraminotomy and discectomy using a co2 laser must be considered within the surgical methods for degenerative cervical disc diseases . This technique is a good method in patients with appropriate alignment who do not have any instability . In particular, by using a microscope and co2 laser, ventral lesions (protruding disc or osteophyte) can be decompressed with minimal manipulation of the nerve root . We consider this technique to be a sufficient and safe procedure in carefully selected cases for unilateral cervical radiculopathy . The limitation of this study was the small number of cases in a single institution . A study with a larger number and longer duration of follow - up will be required to clarify the effectiveness of this technique.
|
Leishmania spp . Lives in the gastrointestinal tract of the sand fly vector, and can be cultured using appropriate laboratory culture media as promastigotes . They can also exist in the vertebrate host macrophages in the amastigote form (13). While asexual reproduction is known to occur in this species (4), their sexual forms have not yet been discovered (5). Clonal reproduction is believed to occur among the protozoan parasites of the family trypanosomatidae (6), considering that nuclear fusion occurs in some forms of this parasite that may give rise to sexual reproduction (7, 8). Researchers have been unable to confirm sexual reproduction and identify sexual gametes of these microorganisms by using classical methods (9). It should be noted that the exchange of genetic material in trypanosomatidae has been proven (1012). Leishmania is used as an intracellular molecular model for research in microbiology, immunology, and biochemistry (1, 2, 1320). Has 32,816,678 bp organized into 36 chromosomes (21), with a total of 911 rna genes and 39 pseudo - genes (21, 22). Producer protein genes are encoded as long polycistronic genes lacking transcription factors in l. major, trypanosoma brucei, and t. cruzi (tritryp) (fig . 1). The old world leishmania spp . Has 36 chromosomes, while the new world leishmania spp . Has 34 or 35 chromosomes . L. mexicana has linkage groups of chromosomes 8 and 29 as well as of chromosomes 30 and 36, and l. braziliensis has a linkage group of chromosomes 20 and 34 (23). The general pattern of nucleotide sequences of genes in 30 leishmania spp . Organization of chromosomes of leishmania genes: clusters of genes on chromosomes 1, 2, 3, 4, and 35 are shown as thick lines . Vertical lines indicate the right side of the chromosome 1 repeated sub - telomeric sequence . Its genes have been organized into 2 converted polycistronic clusters, and mrna transcription is directed to the telomeres (2730). Chromosome 3 has about 79 genes, and is organized as 2 convergent polycistronic transcripts . They remain at the end of a gene that is transcribed in contrast to the previous clusters (28, 29, 31). This mechanism differs from the other mechanisms, although they have a chromatin remodeling process (21). In contrast to other members of trypanosomatidae, the leishmania genome does not have a sub - telomeric region (species - specific genes) and a transposable element . Genome is organized in the nucleus, which contains chromosomal and episomal dna, and in the kinetoplasts, which comprise independently replicating dna molecules . The kinetoplasts have been separated and studied by ultracentrifugation, whereas the chromosomes have been studied by pulsed - field gel electrophoresis (pfge). There are questions regarding the changes occurring in karyotype species, sexual reproduction in leishmania spp ., and the number of copies of each gene in each chromosome (33). The electrophoretic patterns of leishmania spp . Isolation by hybridization that parts of chromosomes can be common, but the genes hsp70, hsp80, adenylate cyclase, glyceraldehyde phosphate dehydrogenase, beta tubulin, phosphofructokinase, pho - sphoenolpyruvate carboxymethyl pyruvate kinase, pyruvate kinase, and ubiquitin are conserved . The chromosomes range from 400 to 900 kbp in size and contain mini - exons (5-spliced leader genes). Chromosomal changes that occurred during the evolution of leishmania spp . Have been confirmed, and the molecular karyotypes in the promastigote and amastigote forms have been found to be identical . (1) the l. major karyotype is completely conserved, even in different geographical regions, (2) the members of the l. braziliensis panamensis group have more than one karyotype, and (3) l. mexicana amazonensis has highly diverse molecular karyotypes, even among those isolated from the same clinical samples . The mechanism of chromosomal polymorphism in leishmania spp . Does not include removal or translocation . Among the genes amplified in leishmania spp . This phenomenon of increasing the number of copies of genes involved in metabolic phenomena and environmental response appears to be important . Regions of genes that are involved in drug resistance are increased by 220 folds in copy number . Two genomic regions, namely, h - dna and r - dna (encoding dihydrofolate reductase and thymidylate synthase), are chromosomal derivatives, which are surrounded by inverted repeats . The inverted repeats are involved in the supercoiling of amplified gene products (33). Methotrexate induces amplification of the r - dna and h - dna genomic regions . In a methotrexate - resistant l. tarentolae mutant, the h region the dihydrofolate reductase, thymidylate synthase, and ltdh genes in the h region are resistant to drugs (34, 35). Gene amplification in the amphotericin b - resistant l. tarentolae occurs in the circular form in different chromosomes (36). Drug resistance to sodium stibogluconate (pentostam) in l. tarentolae is due to the amplification of a gene described by haimeur and ouellett, which encodes a 770-amino acid - long protein (37). Gene expression control among the members of the parasitic trypanosomatidae family involves unusual antigenic shifts, involving dna rearrangements, generation of polycistronic transcripts from multi - copy genes, and post - transcriptional modification by trans - splicing and rna editing (38). The genetic information of most organisms has been discovered in cdna sequences known as expressed sequence tags (est) (39). It should be noted that most leishmania genes have no introns (40), and that chromosomal dna is used as the template for cloning by pcr (4145). Gene transcription to produce proteins in eukaryotes involves rna polymerase ii and transcription by rna polymerase i to produce ribosomal rna . In kinetoplastids, gene transcription involves rna polymerase i and a trans - splicing mechanism (46). This sequence is encoded by a gene duplication cluster, 1.35 kb in length, which is known as a mini - exon or a trans - splice . Mini - exon mrna was first identified as being related to the trypanosome variable surface glycoprotein (47). Analyzed the sequence of leishmania chromosome 1, which is the smallest of all the chromosomes . A total of 39 genes were transcribed from a strand of dna and 50 other genes in a polycistronic transcript (48). Also analyzed leishmania chromosome 27 and indicated that the organization of transcription of leishmania genes is a complex process . Non - coding rnas, about 300600 nucleotides long, are known to be expressed only in the amastigotes; these rnas are transcribed by rna polymerase ii . Both sense and antisense transcripts are processed by trans - splicing and polyadenylation, but the antisense transcripts are transcribed 10 folds lesser than the sense transcripts . It should be noted that these molecules are not transcribed in promastigotes, and that rna stability in promastigotes is less than in amastigotes (50). There is a 35-nucleotide - long sequence known as a spliced leader (sl) or 5-mini exon at the 5 end of leishmania mrna transcripts . The sl sequence is at the 5-end of a preliminary transcript about 85 nucleotides in length that contains a 5-exon - intron connection adjacent to the 3-spliced leader (fig . 2 and 3). Comparison of cis- and trans - splicing: in cis - splicing, pair bases u1 small nuclear ribonucleoprotein (snrnp) are in the 5 sl [?] And u2 snrnps are in the break point, while intron breaks two exons are connected . In trans - splicing, a 5-splice site on the mrna for binding to u1 snrnp is absent . Instead, a 5-splice site produced by the donor sl snrnp interacts with u2 in the 3-splice site . Cis - splicing and trans - splicing: there are 4 exons in the initial transcript, which contains both exons and introns . In the cis - splicing phenomenon, the 3 introns are removed, and the exons are connected . In trans - trans - splicing, there is a 50-nucleotide - long interval at the 3-end of sl, which is known as the sl intron sequence (slis). Density centrifugation analyses have shown that sl mrna is in the 60s rrna, but slis is in the 40s rrna . It is likely that the observed nucleoprotein particles are the same spliceosomes that can be observed in other microorganisms (51, 52). Since the discovery of trans - splicing in leishmania spp . Trans - splicing is an essential stage of eukaryotic precursor mrna and is not observed in mammals, insects, yeast, and plants (54). This phenomenon is observed in rotifera (55), dinoflagellates (56), nematodes, and protozoan parasites (5760) as shown in fig . Trans - splicing in metazoan parasites: a) transcription occurs via a polycistronic transcript and trans - splicing . B) the phenomenon of transcription and trans - splicing in metazoan genes (worms). Comparison of the characteristics of the genomes of 3 species of leishmania (22) the organization and regulation of gene expression in trypanosomatid parasites differs from that of other cells . The genes in the parasites of family trypanosomatidae are organized as long polycistronic transcripts (more than 100300 kb) on the same dna strand . The genes encoding proteins are transcribed from unknown promoters, and precursor polycistronic rna is produced . The trans - splicing mechanism includes a mini - exon containing 39 nucleotides, which is not translated . The ag is at the 3 of the splice acceptor site downstream of a polypyrimidine tract . There are no introduced polyadenylation signals in kinetoplastidae undefined and instead choose to place poly a site depends on positions upstream acceptor site (61 .) Gopta et al . Analyzed chromosomes 1 and 3 of l. major and predicted the positions of trans - splicing with 92% accuracy . The following components are present: (1) nucleotide a, (2) a polypyrimidine rich stretch of t and c, varying in size from 5 to 100 nucleotides with purine bases occasionally located between the t and c, (3) a variable spacer, and (4) a 3-acceptor site consisting of ag (62). . Generates pyrimidine nucleic acids via de novo biosynthesis, but obtains purine nucleic acids via a salvage process (6366). This study indicated that salvage activities in the amastigote stage would limit the effectiveness of chemotherapy in patients infected with leishmania spp . Salvage activities do not involve rna transcripts and likely occur via posttranscriptional modifications (67). If dna replication is inhibited in the kinetoplast by ethidium bromide, energy production will reduced in the parasite (70). The extra - chromosomal dna is located in the kinetoplast organelle in an arrangement similar to that in the mitochondria of the eukaryotes . The kinetoplast has a particular dna topology, which is not found in other eukaryotic cells (fig . 5), and is composed of large circular molecules up to about 50,000 nucleotides that are known as maxicircles . They are not present in large numbers . These circular molecules carry the genes encoding the enzymes and coenzymes involved in the krebs cycle (7174). Structure of the kinetoplast disk and the proteins involved in its replication sse1, structure -specific endonuclease 1; umsbp, universal minicircle sequence - binding protein (http://www.pnas.org/content/101/13/4333/f2.expansion.html) other dna molecules that are present in larger numbers but have fewer nucleotides (6002,500 bp) are known as minicircles . Chritidia fasciculate has 25 maxicircles (each containing 37,000 nucleotides) and 5,000 minicircles (each containing 2,500 nucleotides) (7274), some of which have been identified as free - form molecules (73). A minicircle dna sequence is conserved among all members of the family kinetoplastidae (75), and some believe that this sequence is the origin of replication of the minicircle (76). Large and small circles can exist inside each other so that each loop intercalates with 2 other minicircle loops and eventually maxicircles and minicircles become intertwined with each other (interlocked or catenated) and a heavy molecule (about 400s) is formed during the extraction of parasite dna that is distinct from the chromosomal dna sediment . When minicircles replicate, some are released (fig . When replication is completed, a replicated minicircle will become connected to the kinetoplast (75, 77, 78). The blank section of the kinetoplast is restored by dna topoisomerase ii (79). In vivo replication of a kinetoplast shown as a disk section with catenated minicircles surrounded by dna polymerase beta and dna topoisomerase ii . Two newly synthesized minicircles are shown in bold (http://www.jbc.org/content/272/33/20787.full.pdf+html) the origin of replication of the kinetoplast is recognized by a protein known as umsbp (universal minicircle sequence - binding protein). This reaction is regulated in vivo by an oxidation - reduction reaction (80, 81). The inhibition of umsbp halts the growth of the parasite (82). A zinc ion (zn) is involved in this process, and is essential for connecting umsbp to dna (83). It should be noted that replication of the members of kinetoplastidae occurs via different mechanisms (84). The functions of minicircles were not clarified until recently, and the genes of some of the enzymes involved in krebs cycle were not observed . The discovery of the rna editing phenomenon was an exciting new finding (8587). It was found that the parasites have copies of rna molecules, which are altered because of posttranscriptional modification . This is accompanied by deletion or insertion of a number of nucleotide residues (mostly uracil). Rna editing emits signals by guide rna - derived transcripts of minicircles (88, 89) or maxicircles (90) (fig . 7). A grna - binding complex is involved in the processing of a grna, which includes polyadenylation and stabilization of the edited mrna transcript (89). The kinetoplast of l. tarentolae has a 9s rrna (9194) and a 12s rrna (9295), but does not have supercoiled circles (96). Rna editing of cytochrome oxidase b of leishmania tarantula (http://dna.kdna.ucla.edu/trypanosome/index.html) the rna editing phenomenon produces deletions, replacements, and insertions in mrna transcripts (86, 87, 97). An edited transcript mrna has important effects, and sometimes half of the nucleotides are altered (fig . It should be noted that although the changes may be small, its effect is important . For example, replacement of a c nucleotide by u in the human apolipoprotein b transcript (fig . Model rna editing in the kinetoplast: addition of u (left), removal of u (center) or formation of a chimera (right) in an mrna transcript are performed by tutase (http://dna.kdna.ucla.edu/trypanosome/images/kablea.jpg) rna editing in human apolipoprotein b the tga codon (stop codon) of the leishmania spp . When the parasite glycosomal cycle is reduced, the mitochondrial (kinetoplast) volume is increased, and vice versa (99). The characteristics of kinetoplast dna has led to its choice as a target for drug therapy (99, 100). The haploid genome of leishmania spp . Has 32,816,678 bp organized into 36 chromosomes (21), with a total of 911 rna genes and 39 pseudo - genes (21, 22). Producer protein genes are encoded as long polycistronic genes lacking transcription factors in l. major, trypanosoma brucei, and t. cruzi (tritryp) (fig . 1). The old world leishmania spp . Has 36 chromosomes, while the new world leishmania spp . L. mexicana has linkage groups of chromosomes 8 and 29 as well as of chromosomes 30 and 36, and l. braziliensis has a linkage group of chromosomes 20 and 34 (23). The general pattern of nucleotide sequences of genes in 30 leishmania spp . Organization of chromosomes of leishmania genes: clusters of genes on chromosomes 1, 2, 3, 4, and 35 are shown as thick lines . The direction of mrna transcription is indicated . Vertical lines indicate the right side of the chromosome 1 repeated sub - telomeric sequence . Its genes have been organized into 2 converted polycistronic clusters, and mrna transcription is directed to the telomeres (2730). Chromosome 3 has about 79 genes, and is organized as 2 convergent polycistronic transcripts . They remain at the end of a gene that is transcribed in contrast to the previous clusters (28, 29, 31). This mechanism differs from the other mechanisms, although they have a chromatin remodeling process (21). In contrast to other members of trypanosomatidae, the leishmania genome does not have a sub - telomeric region (species - specific genes) and a transposable element . Genome is organized in the nucleus, which contains chromosomal and episomal dna, and in the kinetoplasts, which comprise independently replicating dna molecules . The kinetoplasts have been separated and studied by ultracentrifugation, whereas the chromosomes have been studied by pulsed - field gel electrophoresis (pfge). There are questions regarding the changes occurring in karyotype species, sexual reproduction in leishmania spp ., and the number of copies of each gene in each chromosome (33). The electrophoretic patterns of leishmania spp ., hsp80, adenylate cyclase, glyceraldehyde phosphate dehydrogenase, beta tubulin, phosphofructokinase, pho - sphoenolpyruvate carboxymethyl pyruvate kinase, pyruvate kinase, and ubiquitin are conserved . The chromosomes range from 400 to 900 kbp in size and contain mini - exons (5-spliced leader genes). Chromosomal changes that occurred during the evolution of leishmania spp . Have been confirmed, and the molecular karyotypes in the promastigote and amastigote forms have been found to be identical . (1) the l. major karyotype is completely conserved, even in different geographical regions, (2) the members of the l. braziliensis panamensis group have more than one karyotype, and (3) l. mexicana amazonensis has highly diverse molecular karyotypes, even among those isolated from the same clinical samples . The mechanism of chromosomal polymorphism in leishmania spp . Does not include removal or translocation . Among the genes amplified in leishmania spp . This phenomenon of increasing the number of copies of genes involved in metabolic phenomena and environmental response appears to be important . Regions of genes that are involved in drug resistance are increased by 220 folds in copy number . Two genomic regions, namely, h - dna and r - dna (encoding dihydrofolate reductase and thymidylate synthase), are chromosomal derivatives, which are surrounded by inverted repeats . The inverted repeats are involved in the supercoiling of amplified gene products (33). Methotrexate induces amplification of the r - dna and h - dna genomic regions . In a methotrexate - resistant l. tarentolae mutant, the h region the dihydrofolate reductase, thymidylate synthase, and ltdh genes in the h region are resistant to drugs (34, 35). Gene amplification in the amphotericin b - resistant l. tarentolae occurs in the circular form in different chromosomes (36). Drug resistance to sodium stibogluconate (pentostam) in l. tarentolae is due to the amplification of a gene described by haimeur and ouellett, which encodes a 770-amino acid - long protein (37). Gene expression control among the members of the parasitic trypanosomatidae family involves unusual antigenic shifts, involving dna rearrangements, generation of polycistronic transcripts from multi - copy genes, and post - transcriptional modification by trans - splicing and rna editing (38). The genetic information of most organisms has been discovered in cdna sequences known as expressed sequence tags (est) (39). It should be noted that most leishmania genes have no introns (40), and that chromosomal dna is used as the template for cloning by pcr (4145). Gene transcription to produce proteins in eukaryotes involves rna polymerase ii and transcription by rna polymerase i to produce ribosomal rna . In kinetoplastids, gene transcription involves rna polymerase i and a trans - splicing mechanism (46). This sequence is encoded by a gene duplication cluster, 1.35 kb in length, which is known as a mini - exon or a trans - splice . Mini - exon mrna was first identified as being related to the trypanosome variable surface glycoprotein (47). Analyzed the sequence of leishmania chromosome 1, which is the smallest of all the chromosomes . A total of 39 genes were transcribed from a strand of dna and 50 other genes in a polycistronic transcript (48). Also analyzed leishmania chromosome 27 and indicated that the organization of transcription of leishmania genes is a complex process . Non - coding rnas, about 300600 nucleotides long, are known to be expressed only in the amastigotes; these rnas are transcribed by rna polymerase ii . Both sense and antisense transcripts are processed by trans - splicing and polyadenylation, but it should be noted that these molecules are not transcribed in promastigotes, and that rna stability in promastigotes is less than in amastigotes (50). There is a 35-nucleotide - long sequence known as a spliced leader (sl) or 5-mini exon at the 5 end of leishmania mrna transcripts . The sl sequence is at the 5-end of a preliminary transcript about 85 nucleotides in length that contains a 5-exon - intron connection adjacent to the 3-spliced leader (fig . 2 and 3). Comparison of cis- and trans - splicing: in cis - splicing, pair bases u1 small nuclear ribonucleoprotein (snrnp) are in the 5 sl [?] And u2 snrnps are in the break point, while intron breaks two exons are connected . In trans - splicing, a 5-splice site on the mrna for binding to u1 snrnp is absent . Instead, a 5-splice site produced by the donor sl snrnp interacts with u2 in the 3-splice site . Cis - splicing and trans - splicing: there are 4 exons in the initial transcript, which contains both exons and introns . In the cis - splicing phenomenon, the mrna contains 4 exons and 3 introns . The 3 introns are removed, and the exons are connected . In trans - trans - splicing, there is a 50-nucleotide - long interval at the 3-end of sl, which is known as the sl intron sequence (slis). Density centrifugation analyses have shown that sl mrna is in the 60s rrna, but slis is in the 40s rrna . It is likely that the observed nucleoprotein particles are the same spliceosomes that can be observed in other microorganisms (51, 52). Since the discovery of trans - splicing in leishmania spp . Trans - splicing is an essential stage of eukaryotic precursor mrna and is not observed in mammals, insects, yeast, and plants (54). This phenomenon is observed in rotifera (55), dinoflagellates (56), nematodes, and protozoan parasites (5760) as shown in fig . Trans - splicing in metazoan parasites: a) transcription occurs via a polycistronic transcript and trans - splicing . B) the phenomenon of transcription and trans - splicing in metazoan genes (worms). Comparison of the characteristics of the genomes of 3 species of leishmania (22) the organization and regulation of gene expression in trypanosomatid parasites differs from that of other cells . The genes in the parasites of family trypanosomatidae are organized as long polycistronic transcripts (more than 100300 kb) on the same dna strand . The genes encoding proteins are transcribed from unknown promoters, and precursor polycistronic rna is produced . The trans - splicing mechanism includes a mini - exon containing 39 nucleotides, which is not translated . The ag is at the 3 of the splice acceptor site downstream of a polypyrimidine tract . Polyadenylation in leishmania spp . Requires trans - splicing and differs from that of other eukaryotes . There are no introduced polyadenylation signals in kinetoplastidae undefined and instead choose to place poly a site depends on positions upstream acceptor site (61 .) Analyzed chromosomes 1 and 3 of l. major and predicted the positions of trans - splicing with 92% accuracy . The following components are present: (1) nucleotide a, (2) a polypyrimidine rich stretch of t and c, varying in size from 5 to 100 nucleotides with purine bases occasionally located between the t and c, (3) a variable spacer, and (4) a 3-acceptor site consisting of ag (62). Leishmania spp . Generates pyrimidine nucleic acids via de novo biosynthesis, but obtains purine nucleic acids via a salvage process (6366). This study indicated that salvage activities in the amastigote stage would limit the effectiveness of chemotherapy in patients infected with leishmania spp . Salvage activities do not involve rna transcripts and likely occur via posttranscriptional modifications (67). If dna replication is inhibited in the kinetoplast by ethidium bromide, energy production will reduced in the parasite (70). The extra - chromosomal dna is located in the kinetoplast organelle in an arrangement similar to that in the mitochondria of the eukaryotes . The kinetoplast has a particular dna topology, which is not found in other eukaryotic cells (fig . 5), and is composed of large circular molecules up to about 50,000 nucleotides that are known as maxicircles . They are not present in large numbers . These circular molecules carry the genes encoding the enzymes and coenzymes involved in the krebs cycle (7174). Structure of the kinetoplast disk and the proteins involved in its replication sse1, structure -specific endonuclease 1; umsbp, universal minicircle sequence - binding protein (http://www.pnas.org/content/101/13/4333/f2.expansion.html) other dna molecules that are present in larger numbers but have fewer nucleotides (6002,500 bp) are known as minicircles . Chritidia fasciculate has 25 maxicircles (each containing 37,000 nucleotides) and 5,000 minicircles (each containing 2,500 nucleotides) (7274), some of which have been identified as free - form molecules (73). A minicircle dna sequence is conserved among all members of the family kinetoplastidae (75), and some believe that this sequence is the origin of replication of the minicircle (76). Large and small circles can exist inside each other so that each loop intercalates with 2 other minicircle loops and eventually maxicircles and minicircles become intertwined with each other (interlocked or catenated) and a heavy molecule (about 400s) is formed during the extraction of parasite dna that is distinct from the chromosomal dna sediment . When replication is completed, a replicated minicircle will become connected to the kinetoplast (75, 77, 78). The blank section of the kinetoplast is restored by dna topoisomerase ii (79). In vivo replication of a kinetoplast shown as a disk section with catenated minicircles surrounded by dna polymerase beta and dna topoisomerase ii . Two newly synthesized minicircles are shown in bold (http://www.jbc.org/content/272/33/20787.full.pdf+html) the origin of replication of the kinetoplast is recognized by a protein known as umsbp (universal minicircle sequence - binding protein). This reaction is regulated in vivo by an oxidation - reduction reaction (80, 81). The inhibition of umsbp halts the growth of the parasite (82). A zinc ion (zn) is involved in this process, and is essential for connecting umsbp to dna (83). It should be noted that replication of the members of kinetoplastidae occurs via different mechanisms (84). The functions of minicircles were not clarified until recently, and the genes of some of the enzymes involved in krebs cycle were not observed . The discovery of the rna editing phenomenon was an exciting new finding (8587). It was found that the parasites have copies of rna molecules, which are altered because of posttranscriptional modification . This is accompanied by deletion or insertion of a number of nucleotide residues (mostly uracil). Rna editing emits signals by guide rna - derived transcripts of minicircles (88, 89) or maxicircles (90) (fig . 7). A grna - binding complex is involved in the processing of a grna, which includes polyadenylation and stabilization of the edited mrna transcript (89). The kinetoplast of l. tarentolae has a 9s rrna (9194) and a 12s rrna (9295), but does not have supercoiled circles (96). Rna editing of cytochrome oxidase b of leishmania tarantula (http://dna.kdna.ucla.edu/trypanosome/index.html) the rna editing phenomenon produces deletions, replacements, and insertions in mrna transcripts (86, 87, 97). An edited transcript mrna has important effects, and sometimes half of the nucleotides are altered (fig . It should be noted that although the changes may be small, its effect is important . For example, replacement of a c nucleotide by u in the human apolipoprotein b transcript (fig . Model rna editing in the kinetoplast: addition of u (left), removal of u (center) or formation of a chimera (right) in an mrna transcript are performed by tutase (http://dna.kdna.ucla.edu/trypanosome/images/kablea.jpg) rna editing in human apolipoprotein b the tga codon (stop codon) of the leishmania spp . When the parasite glycosomal cycle is reduced, the mitochondrial (kinetoplast) volume is increased, and vice versa (99). The characteristics of kinetoplast dna has led to its choice as a target for drug therapy (99, 100). Leishmania is a protozoan parasite with some similarities and differences as compared to other eukaryotic cells . It shares some characteristics with prokaryotic cells, such as polycistronic transcription (31, 38). Researchers have been attracted to its unique characteristics . In recent years, leishmania spp . Has been used as a host for production of recombinant proteins . An appropriate host is an important factor in production of recombinant proteins (drugs). Prokaryotes such as escherichia coli need simple and inexpensive culture media and have a short proliferation time . However, prokaryotes do not generate posttranslational modifications such as gly - cosylation, phosphorylation, and car - boxylation . Some eukaryotic proteins are non - functional after translation in e. coli, and some of them become aggregated as inclusion bodies in the host cell cytoplasm . Replication of yeasts such as pichia pastoris, saccharomyces cerevisiae, and schizosaccharomyces pombe also requires significant culture time, and posttranslational modifications are not perfect processes . Other types of eukaryotic cell cultures tend to be expensive and require specialized culture conditions and laboratory equipment . Because leishmania spp . Is maintained easily in nnn culture medium at low cost and can multiply quickly, it is preferred over other species . This makes leishmania spp . A suitable host for production of recombinant protein drugs (101104). Efforts undertaken thus far have allowed the production of some therapeutic proteins (105108). However, more research is needed before it can be used extensively as a host for the production of recombinant proteins . Researchers in biochemistry, pharmacology, and immunology, who are engaged in new drug development as well as production and testing vaccines, need appropriate cell models . Is an appropriate model for testing such enzyme inhibitors to investigate the progression of anti - parasitic and anti - cancer drugs (111, 112). Small ubiquitin - like modifier protein (sumo) is a fusion protein that can be added as a reversible tag to n terminal recombinant proteins (eukaryotes and prokaryotes) to provide stability and solubility to proteins (113, 114). Sumo is produced by leishmania spp . And can be used as a stable and soluble factor for the production of recombinant proteins in leishmania promastigote (115). One disadvantage is that non - coding rnas act as mrna stability factors are not transcribed in the leishmania promastigote . Because mrna is not stable in promastigotes (50), this form of leishmania spp . Biosynthesis de novo: the de novo purine biosynthetic pathway produces purines which represent the building blocks for dna and rna synthesis cistron: a segment dna equivalent to gene for function (protein or enzymes) diploid; an organism with sexual cycle is diploid and has one chromosome set from each of its parents haploid: the haploid means usual number of chromosomes set in somatic cells of common organisms . Organisms that have not sexual cycle are haploid inversion: chromosome break of the two areas separated pieces is back by reversal from chromosome breakage inverted repeats: is a sequence of nucleotides that is the reversed complement of another sequence further downstream poly cistronic: there are some cistrons on one mrna polyploidy: increase in chromosome set number pseudo - genes: are copy of original gene sequence, but lacked the necessary sequences for function . These genes from genetically similar to functional genes, but they have containing multiple mutations snrnp: small nuclear ribonucleoproteins, are rna - protein complexes, they will combined with unmodified pre - mrna and various other proteins to spliceosome formation . Sub telomeric: sub telomeric is a region near the end of chromosomes composed of polymorphic repetitive dna.
|
Darier's disease is an autosomal dominant disorder of keratinization affecting the skin, mucosa, and nails that typically manifests in the first and second decade of life . We describe an elderly man with nonmetastatic gastric adenocarcinoma presenting with an acquired variant of darier's disease presumably of paraneoplastic origin . A 62-year - old muslim farmer was in otherwise good health until 2 months back when he suddenly started noticing some dark - colored, mildly itchy skin eruption . He also complained of nausea, vomiting, and loss of appetite and a single episode of passage of black, tarry stool . On examination of his skin, numerous hyperpigmented, warty papules were seen over the face, neck, trunk, and scalp . The lesions were characteristically distributed in seborrheic areas like head neck area, back, and front of chest [figure 1]. There was punctate keratoderma of palms and soles with a few palmar pits as well [figure 2]. V-like notch at the free edge of the nail plate without longitudinal streaks . On the basis of these clinical features, there was neither a past history of similar lesions nor any family history of the same . Dirty, warty papules over the back palms showing pits and keratoderma histopathology of the skin lesions revealed suprabasal acantholytic cleft and dyskeratotic cells like corps ronds and grains [figure 3a and b]. Diminution of lesions following tumor resection (a) on back; (b) on chest and palm he was referred to the gastroenterology department where after a series of investigations including endoscopic biopsy, he was diagnosed with gastric adenocarcinoma . On his next follow - up in our outpatient department (opd) 2 months later, we discovered that the skin lesions had remarkably diminished [figure 4a and b]. By that time it was then that we retrospectively considered darier's disease to be a paraneoplastic phenomenon . Histopathology showing (a) prominent hyperkeratosis and suprabasal acantholytic cleft with villi (h and e, 100); (b) dyskeratotic cells (h and e, 400) paraneoplastic dermatoses describes those benign skin changes in which there is a direct, often parallel course of a dermatosis with an underlying malignancy . There are several proposed hypotheses on the pathomechanism of paraneoplastic dermatoses, which highlight the role of various tumor - derived growth factors like transforming growth factor (tgf-), fibroblast growth factor, and so on . Regarding the pathogenesis of paraneoplastic darier's disease, it can be speculated that the tumor product interferes with keratinocyte calcium homeostasis leading to disturbances in intracellular trafficking of desmosomal proteins . The autosomal dominant variety is due to mutations in the serca2 (sarco / endoplasmic reticulum calcium atpase type 2), which regulates calcium homoestasis in the endoplasmic reticulum . Our case involves an acquired form of darier's disease whose diagnosis was supported both clinically and histopathologically . Although there are several variants of darier's disease, the paraneoplastic variety is extremely rare . There is only a single case report on its association with metastatic papillary carcinoma of thyroid . There are some sporadic reports on the occurrence of squamous cell carcinoma of skin, nail bed, esophagus, mouth, and vagina in patients with pre - existing darier's disease but paraneoplastic association is very rare . According to the criteria proposed by helen ollendorff curth, a specific dermatosis occurs with a specific neoplasm, and a high percentage of association between two conditions is noted . This does not hold true in our case . The paraneoplastic dermatoses that have been reportedly associated with gastric adenocarcinoma are acanthosis nigricans, tripe palms, and florid cutaneous papillomatoses . We consider this a paraneoplastic process due to its concurrent onset and almost parallel course with malignant neoplasm, which are also important requisites in the curth criteria . Moreover, in this case, onset of darier's disease was late, occurring in the seventh decade of life in contrast to its usual onset in the second decade of life . Also the skin changes resolved with treatment of the underlying cancer . This further served as an eye - opener for the clinical investigators of this case . Its paraneoplastic association with gastric adenocarcinoma is very unusual and not known to be mentioned in any dermatology literature so far and hence reported here . Darier's disease is an unusual paraneoplastic manifestation in gastric malignancy, not reported before.
|
Malnutrition continues to be a significant public health and development concern . Across the world, in 2015, the numbers of stunted, overweight, and wasted children under five years old were about 159 million, 41 million, and 50 million, respectively.1 this burden is not evenly distributed: three - fourths of the world s malnourished children were found in sub - saharan africa and south asia.2 malnutrition, with its serious consequences, is rampant in ethiopia; according to the 2014 mini - ethiopian demographic and health survey (mini - edhs) report, 40%, 25%, and 9% of under - five - year - olds were stunted, underweight, and wasted, respectively.3 furthermore, within the country, the magnitude of malnutrition varies from region to region . There was also interregional variation of malnutrition and its predictors owing to the type of diet, customs, beliefs, and child - rearing practices . The highest prevalence of malnutrition was reported to be in the amhara region (the region where the study was conducted), where the prevalence of stunting, at 42%, is higher than it is at the national level (40%).3 moreover, urban slum dwellers are less educated; marginalized; exposed to poor housing, overcrowding, poor quality of drinking water, and inadequate sanitation; of low socioeconomic status; and less likely to have access to basic health care facilities.4 children living under such conditions are always at a high risk of developing malnutrition and other health problems.5,6 so slum areas need special attention to prevent undernutrition . Globally, it was estimated that undernutrition is responsible for 35% of under - five mortality.7 in addition, undernutrition before age three has an adverse causal effect on physical and mental growth and development, contributing to poor educational performance, besides reducing adult size and capacity for physical work with an impact on economic productivity at the national level.8 furthermore, it increased the risk of nutrition - related chronic disease later in life.9 the cause of malnutrition is complex and multifactorial . Inadequate food intake, living standards, water and sanitation, birth weight, birth interval, parity, sex of the child, weaning practices, and mother s education are a few of the important factors that have been identified from research studies carried out on the subject.10 owing to high nutritional requirements for growth and development, infants and young children are more affected by undernutrition than other segments of the population . The federal government of ethiopia has been working to reduce undernutrition significantly through public education and by providing nutritional supplements and financial support to vulnerable families . However, the risk factors involved in undernutrition are multiple and could potentially vary in space and time . In the absence of any study on the subject pertaining to the slum areas of ethiopia, there was a need to determine the current nutritional status to review the pitfalls and design effective intervention strategies . This study was designed to assess the prevalence of undernutrition and associated factors among young children living in the slum areas of bahir dar city . The study was conducted in the slum areas of bahir dar city, which is the capital city of amhara regional state, located 565 km from addis ababa, northwest ethiopia . For administrative purposes, the town is divided into nine subcities, three of which (shumabo, gish - abay, and sefene - selam) are slums . The majority of the residents in the slum areas are daily laborers and petty traders . According to the bahir dar city administration health bureau report, the numbers of under - five - year - old children and children aged 2436 months were 4,227 and 895, respectively.11 the town has four hospitals (one public regional referral hospital, one public primary hospital, and two private general hospitals), 6 health centers, 2 nongovernmental clinics, 9 private special higher clinics, 2 private higher clinics, and 12 private clinics to deliver a range of health care services such as health promotion and preventive, curative, and rehabilitative services to the community.11 a community - based cross - sectional study was conducted from may 1 to 26, 2015 . All 2436-month - old children in the slum areas of bahir dar city were the study population . The sample size was determined using the single population proportion formula on the basis of the following assumptions: 95% confidence level, proportion of stunting 52% (as noted in the edhs 2011 report),12 marginal error of 4.75%, and 15% nonresponse rate . The final sample size was 480 . The sample frame was the list of 2436-month - old children in the slum areas registered by the urban health extension workers . Using this registration logbook, the study participants were selected by the simple random sampling technique (lottery method) in proportion to the size of each slum area . In those households that had two children aged 2436 months, one child was selected by the lottery method . Sociodemographic data were collected by a structured interviewer - administered questionnaire adapted from previous studies.12 the questionnaire was developed in english and translated into amharic, back - translated to english by an independent translator for consistency . The questionnaire was pretested in a similar setting (not included in the main study). The anthropometric data were collected following the procedure stipulated by the world health organization13 for the purpose . The equipment used to measure the anthropometric variables was calibrated each day prior to the actual data collection using a material of known weight . Four diploma nurses and two public health professionals were recruited as data collectors and supervisors, respectively . Height was measured by a vertical or horizontal measuring board and required each child to stand on the measuring board barefooted, hands hanging loosely with feet parallel to the body, and heels, buttocks, shoulders, and back of the head touching the board . The headpiece of the measuring board was then pushed gently, making contact with the top of the head . Two readings were taken for each child, and the average was recorded on the questionnaire . The levels of stunting (height for age z - scores), underweight (weight for age z - scores), and wasting (weight for height z - score) were calculated using the emergency nutrition assessment (ena) for smart 2011 software (smart tech, calgary, ab, usa). Thus, children who were below 2 standard deviations of the who 2006 reference for height for age, weight for age, and weight for height were defined as stunted, underweight, and wasted, respectively, whereas children who were below 3 standard deviations for each of the above indicators were considered severely stunted, severely underweight, and severely wasted . A child was considered undernourished if he or she was stunted or underweight or wasting . The dependent variables are stunting, underweight, and wasting, whereas the independent variables are sociodemographic characteristics of their parents (marital status of the mother and educational and occupational status of the parents), hand washing practice of the mother, and latrine utilization of the family . To ensure the quality of data, two days intensive training was given for the data collectors and the supervisors on the technique of data collection, instrument use, and how to maintain ethical standards . Pre - testing was done in a similar setting outside the study area on 5% of the sample size . The supervisor and investigators closely supervised the data collection technique on a daily basis, reviewed the completed questionnaires for completeness, and returned incomplete questionnaires to data collectors for correction . Data were entered and analyzed using statistical package for the social sciences (spss) version 20 (ibm corporation, armonk, ny, usa). Descriptive summaries such as frequencies, proportions, percentages, mean, standard deviations, and prevalence were determined . Binary and multivariable logistic regression analyses were also carried out to identify the association between the independent and the dependent variables and the predictors of undernutrition, respectively . P - value 0.2 was taken as a cut - off point to select eligible variables for the multiple logistic regression models . A p - value of less than 0.05 was considered statistically significant in the final model . Privacy and confidentiality were maintained throughout the study period by excluding personal identifiers from the data collection forms . The study was conducted in the slum areas of bahir dar city, which is the capital city of amhara regional state, located 565 km from addis ababa, northwest ethiopia . For administrative purposes, the town is divided into nine subcities, three of which (shumabo, gish - abay, and sefene - selam) are slums . The majority of the residents in the slum areas are daily laborers and petty traders . According to the bahir dar city administration health bureau report, the numbers of under - five - year - old children and children aged 2436 months were 4,227 and 895, respectively.11 the town has four hospitals (one public regional referral hospital, one public primary hospital, and two private general hospitals), 6 health centers, 2 nongovernmental clinics, 9 private special higher clinics, 2 private higher clinics, and 12 private clinics to deliver a range of health care services such as health promotion and preventive, curative, and rehabilitative services to the community.11 a community - based cross - sectional study was conducted from may 1 to 26, 2015 . All 2436-month - old children in the slum areas of bahir dar city were the study population . The sample size was determined using the single population proportion formula on the basis of the following assumptions: 95% confidence level, proportion of stunting 52% (as noted in the edhs 2011 report),12 marginal error of 4.75%, and 15% nonresponse rate . The final sample size was 480 . The sample frame was the list of 2436-month - old children in the slum areas registered by the urban health extension workers . Using this registration logbook, the study participants were selected by the simple random sampling technique (lottery method) in proportion to the size of each slum area . In those households that had two children aged 2436 months sociodemographic data were collected by a structured interviewer - administered questionnaire adapted from previous studies.12 the questionnaire was developed in english and translated into amharic, back - translated to english by an independent translator for consistency . The questionnaire was pretested in a similar setting (not included in the main study). The anthropometric data were collected following the procedure stipulated by the world health organization13 for the purpose . The equipment used to measure the anthropometric variables was calibrated each day prior to the actual data collection using a material of known weight . Four diploma nurses and two public health professionals were recruited as data collectors and supervisors, respectively . Height was measured by a vertical or horizontal measuring board and required each child to stand on the measuring board barefooted, hands hanging loosely with feet parallel to the body, and heels, buttocks, shoulders, and back of the head touching the board . The headpiece of the measuring board was then pushed gently, making contact with the top of the head . Two readings were recorded, and the computed average was used in the analysis . Weight was measured using an easily portable weighing scale . Two readings were taken for each child, and the average was recorded on the questionnaire . The levels of stunting (height for age z - scores), underweight (weight for age z - scores), and wasting (weight for height z - score) were calculated using the emergency nutrition assessment (ena) for smart 2011 software (smart tech, calgary, ab, usa). Thus, children who were below 2 standard deviations of the who 2006 reference for height for age, weight for age, and weight for height were defined as stunted, underweight, and wasted, respectively, whereas children who were below 3 standard deviations for each of the above indicators were considered severely stunted, severely underweight, and severely wasted . A child was considered undernourished if he or she was stunted or underweight or wasting . The dependent variables are stunting, underweight, and wasting, whereas the independent variables are sociodemographic characteristics of their parents (marital status of the mother and educational and occupational status of the parents), hand washing practice of the mother, and latrine utilization of the family . To ensure the quality of data, two days intensive training was given for the data collectors and the supervisors on the technique of data collection, instrument use, and how to maintain ethical standards . Pre - testing was done in a similar setting outside the study area on 5% of the sample size . The supervisor and investigators closely supervised the data collection technique on a daily basis, reviewed the completed questionnaires for completeness, and returned incomplete questionnaires to data collectors for correction . Data were entered and analyzed using statistical package for the social sciences (spss) version 20 (ibm corporation, armonk, ny, usa). Descriptive summaries such as frequencies, proportions, percentages, mean, standard deviations, and prevalence were determined . Binary and multivariable logistic regression analyses were also carried out to identify the association between the independent and the dependent variables and the predictors of undernutrition, respectively . P - value 0.2 was taken as a cut - off point to select eligible variables for the multiple logistic regression models . A p - value of less than 0.05 was considered statistically significant in the final model . Privacy and confidentiality were maintained throughout the study period by excluding personal identifiers from the data collection forms . Of the 480 children sampled, 471 participated in this study, giving a response rate of 98.1% . One - third of their mothers, and 154 (32.7%) and 101 (21.4%) of their fathers had no formal education . Nearly half, 225 (47.8%), of their mothers were housewives, and 218 (46.3%) of their fathers were daily laborers . Two hundred and six (58.6%) parents made joint decisions on the use of money in the household (table 1). Prevalence figures for stunting, underweight, and wasting among study participants were 42% (95% ci: 37.8, 46.5), 22.1% (95% ci: 18.1, 26.1), and 6.4% (95% ci: 4.2, 8.7), respectively . Prevalence of severe stunting, underweight, and wasting among the children was 16.3% (95% ci: 13.2, 19.7), 3.8% (95% ci: 2.1, 5.7), and 1.3% (95% ci: 0.4, 2.3), respectively (table 2). Binary logistic regression analysis showed that the marital status of the mother, the occupational status of the mother and father, the educational status of the mother and father, possession of television and radio, time of initiation of complementary feeding, taking prelacteal feed, being a male or female decision maker on use of money in the household, illness in the preceding two weeks, and having more than one under - three - year - old child were statistically associated with stunting (table 3). In multivariable logistic regression analysis, children who had illness in the preceding two weeks were 2.6 times as likely to develop stunting as children who were not ill (adjusted odds ratio [aor] = 2.6, 95% ci: [1.4, 4.9]); children who resided in a household that had more than one under - three - year - old child were 1.8 times as prone to developing stunting as their counterparts (aor = 1.8, 95% ci: [1.0, 3.4]); children who took prelacteal feed were 2.3 times as likely to be stunted as their counterparts (aor = 2.3, 95% ci: [1.1, 4.6]); children who started complementary food before six months of age were 2.1 times (aor = 2.1, 95% ci: [1.2, 3.4]) and those who started after six months of age were 1.8 times (aor = 1.8, 95% ci: [1.0, 3.5]) as likely to be stunted as children who started complementary food at six months; children who lived in households where their fathers decided on use of money were 2.1 times (aor = 2.1, 95% ci: [1.2, 3.4]) and children who lived in households where their mothers decided on use of money were 1.8 times (aor = 1.8, 95% ci: [1.0, 3.2]) as likely to be stunted as children who lived in households where both parents made decisions jointly (table 3). Binary logistic regression analysis showed that the following factors were statistically associated with underweight (table 4): religion, educational status of the mother, possession of television, lack of latrine utilization, caregivers / mothers who did not wash their hands after latrine use, being a male decision maker on use of money, having illness in the preceding two weeks, and having more than one under - three child . In the multivariable logistic regression analysis, children who had illness in the preceding two weeks were 3.1 times as likely to develop underweight as children who were not ill (aor = 3.1, 95% ci: [1.6, 6.2]); children who resided in households in which latrines were not used were 3.3 times as prone to developing underweight as their counterparts (aor = 3.3, 95% ci: [1.2, 8.7]); and children whose mothers / caregivers did not wash their hands after latrine use were 6.7 times as likely to develop underweight as their counterparts (aor = 6.7, 95% ci: [3.8, 11.6]) (table 4). Of the 480 children sampled, 471 participated in this study, giving a response rate of 98.1% . One - third of their mothers, and 154 (32.7%) and 101 (21.4%) of their fathers had no formal education . Nearly half, 225 (47.8%), of their mothers were housewives, and 218 (46.3%) of their fathers were daily laborers . Two hundred and six (58.6%) parents made joint decisions on the use of money in the household (table 1). Prevalence figures for stunting, underweight, and wasting among study participants were 42% (95% ci: 37.8, 46.5), 22.1% (95% ci: 18.1, 26.1), and 6.4% (95% ci: 4.2, 8.7), respectively . Prevalence of severe stunting, underweight, and wasting among the children was 16.3% (95% ci: 13.2, 19.7), 3.8% (95% ci: 2.1, 5.7), and 1.3% (95% ci: 0.4, 2.3), respectively (table 2). Binary logistic regression analysis showed that the marital status of the mother, the occupational status of the mother and father, the educational status of the mother and father, possession of television and radio, time of initiation of complementary feeding, taking prelacteal feed, being a male or female decision maker on use of money in the household, illness in the preceding two weeks, and having more than one under - three - year - old child were statistically associated with stunting (table 3). In multivariable logistic regression analysis, children who had illness in the preceding two weeks were 2.6 times as likely to develop stunting as children who were not ill (adjusted odds ratio [aor] = 2.6, 95% ci: [1.4, 4.9]); children who resided in a household that had more than one under - three - year - old child were 1.8 times as prone to developing stunting as their counterparts (aor = 1.8, 95% ci: [1.0, 3.4]); children who took prelacteal feed were 2.3 times as likely to be stunted as their counterparts (aor = 2.3, 95% ci: [1.1, 4.6]); children who started complementary food before six months of age were 2.1 times (aor = 2.1, 95% ci: [1.2, 3.4]) and those who started after six months of age were 1.8 times (aor = 1.8, 95% ci: [1.0, 3.5]) as likely to be stunted as children who started complementary food at six months; children who lived in households where their fathers decided on use of money were 2.1 times (aor = 2.1, 95% ci: [1.2, 3.4]) and children who lived in households where their mothers decided on use of money were 1.8 times (aor = 1.8, 95% ci: [1.0, 3.2]) as likely to be stunted as children who lived in households where both parents made decisions jointly (table 3). Binary logistic regression analysis showed that the following factors were statistically associated with underweight (table 4): religion, educational status of the mother, possession of television, lack of latrine utilization, caregivers / mothers who did not wash their hands after latrine use, being a male decision maker on use of money, having illness in the preceding two weeks, and having more than one under - three child . In the multivariable logistic regression analysis, children who had illness in the preceding two weeks were 3.1 times as likely to develop underweight as children who were not ill (aor = 3.1, 95% ci: [1.6, 6.2]); children who resided in households in which latrines were not used were 3.3 times as prone to developing underweight as their counterparts (aor = 3.3, 95% ci: [1.2, 8.7]); and children whose mothers / caregivers did not wash their hands after latrine use were 6.7 times as likely to develop underweight as their counterparts (aor = 6.7, 95% ci: [3.8, 11.6]) (table 4). The main aim of this study was to assess undernutrition and associated factors among 2436 month - old - children in the slum areas of bahir dar city . Stunting in children was linked with delay in motor and mental development as well as with low physical strength and economic productivity in adulthood.14 in spite of its serious consequences, the prevalence of stunting was found to be high in this study (42%, [95% ci: 37.8, 46.5]). This is comparable with the findings of previous studies in botswana (38.7%),15 cameroon (41.2%),16 mumbai urban slums (42.8),17 and the urban slums of vadodara city (46.1%).18 however, this rate of prevalence is higher than that in previous studies in the slum areas of kolkata (25%);19 west bengal, india (28%);20 and the urban slums of dhaka, bangladesh (36%).21 the discrepancy might be due to differences in the study setting and subjects; in this study, the majority of mothers and fathers were less educated and worked as petty traders / daily laborers . The findings are lower than those of studies in the slums of dibrugarh town india (53.1%)22, nepal (55.7%)23 and the informal urban settlements of nairobi, kenya (47%).24 the difference might be due to the time gap between studies; currently, nutrition education is disseminated through the mass media and by professionals . This is similar to the findings of a study in the urban slums of dhaka, bangladesh (24%).21 on the other hand, this prevalence is higher than that found by a study on botswana (15.6%).15 this study finding is lower than those pertaining to semiurban areas in kottayam, kerala,25 and urban slums of pune26 and sri lanka (27.2%).27 the prevalence of wasting was 6.4% (95% ci: 4.2, 8.7). This is similar to what was found by studies conducted in botswana (5.5%)15 and the urban slums of dhaka, bangladesh (8%).21 however, this finding is higher than that which emerged from studies in informal urban settlements in nairobi, kenya (2.6%)22 and cameroon (3.8%).16 the high prevalence of acute malnutrition might be due to low levels of parental education as well as differences in sample size and study design between studies . This prevalence is lower than that found by previous studies in nepal (18.6%)23 and sri lanka (21.5%).27 the lower prevalence of acute malnutrition compared with the case in previous studies might be a result of current nutritional programs . Children living in households with more than one under - three - year - old child were 1.8 times as likely to develop stunting as their counterparts living in households with one under - three - year - old child . This is consistent with previous studies in ludhiana and botswana.15,28 this might be due to the negative effect of the increased number of children on growth stemming from the heavy burden on the mother s reproductive and nutritional resources, as well as from greater competition for the scarce resources within the household . The prevalence of stunting was higher among children who started complementary foods after age six months, followed by children who received complementary foods before six months of age compared with their counterparts who started complementary foods at six months of age . This finding is consistent with that of previous studies in meskan district, south ethiopia, and in the urban slums of ludhiana and mumbia.17,2729 inappropriate timing of introducing complementary foods may affect the child s nutritional status negatively . Owing to the immaturity of his or her digestive and immune systems, early introduction of complementary foods, especially under unhygienic conditions, predisposed to illness . In addition, it might be due to the negative impact of early introduction of complementary foods on breastfeeding frequency and duration . If complementary food is not introduced at six months of age along with breast milk, the heightened nutritional needs of the infant go unsatisfied . Infection plays a major role in the etiology of undernutrition because of increased requirements and high energy expenditure, lower appetite, nutrient losses, utilization of nutrients, and disruption of metabolic equilibrium . Similar findings are reported from previous study findings.20,30,31 infection predisposed to malnutrition through increased metabolic reaction and nutrients lost through vomiting, diarrhea, and malabsorption . More children who lived in households in which males made decisions on the use of money were stunted than their counterparts who lived in households in which both parents made decisions jointly . This finding is supported by previous study findings.32,33 in households in which males made decisions on use of money, women lacked one component of maternal autonomy, making them unable to provide effective child nutrition and eventually impacting child growth . Female decision makers were single, daily laborers and lived in rented houses with earthen floors with no ceiling . So even if they had the freedom to purchase, they had financial constraints in doing so . The odds of being underweight were higher in children residing in households where family members did not use latrines as compared with children living in households where their family members used latrines . This finding is consistent with the findings of previous studies.3436 this is because family members who did not use latrines practiced open field defecation, which predisposed them to various diseases . Children who received prelacteal feed were more likely to develop stunting than those who did not take prelacteal feed . A similar finding is reported from previous studies conducted in many developing countries.3739 prelacteal feeding increases the risk of gastrointestinal infection, deprives the child of colostrum, and discourages exclusive breast - feeding practice and the benefits associated with it . The study may have limitations in regard to recall bias and absence of data on maternal nutrition, heights of the mothers, household food security, and parasitic infections . Factors associated with stunting included illness in the last two weeks, having more than one under - three child, taking prelacteal feed, early or late initiation of complementary feeding, and living in households where males made decisions on the use of money . Illness in the preceding two weeks, lack of latrine utilization, and lack of hand washing practice of mothers / caregivers were positively associated with underweight . Thus, health extension workers and health professionals in bahir dar city will be deployed to educate mothers / caretakers on the health impact of giving prelacteal feeding and birth interval, benefit of hand washing practice, and time of initiation of complementary feeding.
|
Academic failure is a serious problem of the students, educational system, and society . Usually the students who have experienced academic downfall during their education do nt demonstrate desired theoretical or practical capability of their lessons . Academic downfall can also result in numerous emotional, social, behavioral, and psychological problems; a study in the united states showed that the main reason for the suicide in students is downfall in education or profession . Considering the above - mentioned points, it can be said that academic downfall is one of the major problems of educational systems; hence that every year it causes the dissipation of a large number of the labor force and economic sources and has serious consequences for students, their families, and society in general . Thus, taking the suitable steps to solve this problem is fundamental . In this study, the role of personality traits and mental health were considered as determinant factors in academic failure . Having good mental health and healthy personality, are necessary for each person in order to concentrate, learn, and study . Personal characteristics such as gender, age, degree of education and field of education are also important factors in this respect . In doing so, some pieces of research that have been conducted to determine the role of psychological factors in academic downfall are introduced ., their study pointed out that the student with lower levels of achievement has a higher risk of psychological disorder . Bentez et al . In a study concluded that increased period of education comes along with the lack of health . Mc ilroy and bunting, king and bailly, they said that personal characters have a relationship with educational achievement of student . Chamorro - premuzic and furnham, gray and watson, duff and boyle, oconnor and paunonen, they said that loyalty and prepending are among the strongest and the most resistant's characters related to educational achievement . Walt and pickworth reported that those students had higher achievement who had the following characteristic loyalty, emotional stability, social skills, self - disciplined, practical and were calm or anxious to an imagination ., come to the conclusion that hopefulness and positive attribution style were the higher predictive factors in educational achievement . In separate conducted studies, revealed that there is a significant relationship between age and academic performance . Hazavehei et al ., safdari - dehcheshmeh et al ., and zare et al . In separate studies, concluded that academic performance of female students was better comparing to the males . Since mental health is regarded as a basic requirement for satisfactory performance in any field, including educational therefore investigation is so important that the national institute of mental health believes that those with mental health can satisfy their needs and have more compatibility with others . Mental health can also affect personality traits, the ability of social interaction, and adaptability to new situations . It's worth mentioning that educational status is one of the many needs that can be influenced by mental and individual features . Thus, considering the importance of medical sciences, the significant role of students personal and psychological state in their educational performance, and the consequences of academic downfall, this study aim to determine the role of personal and psychological factors in academic downfall among the students of medical sciences . Concerning the variables of mental health and personality traits, studies carried out within the country and outside of the country have investigated the roles of different variables in educational performance . For example, in order to determine personality traits, the following tests and questionnaires were used for different majors and semesters: cattell 16 personality factor (16 pf), izeng personality test, personality a and 5, minnesota multiphasic personality inventory (mmpi) long and short form and in order to evaluate the mental health gho, symptom checklist-90 (scl-90), . Were used questionnaire, neo - personality inventory revised (neo - ff - r), minnesota long and short personality test forms mmpi and for testing students mental health, scl-90, general health questionnaire (ghq), and etc ., were used . Therefore, different results were obtained all of which indicate that some of the personality traits and mental health indicators influence students academic performance . Therefore, in this study, the effect of interaction between personal factors, personality characteristics and mental health indicators of students, in statistical model analyzes . The present study attempts to answer the following hypothesis: if personality factors, the status of metal health and demographic features have any role in predicting the educational performance of the students in the isfahan university of medical sciences . The present descriptive - correlation study was conducted among 771 students who entered isfahan university of medical sciences between the years 2005 and 2007 . The students educational and clinical files were used, and psychological interviews were performed by a clinical psychologist (for communication and psychological support). The psychological data were completed using ghq test (known tool for the screening): somatic symptoms, anxiety - insomnia, social dysfunction, severe depression, and personality test minnesota short form (mmpi) (this questionnaire forms, can be used in psychological and clinical research): hypochondriasis, depression, hysteria, psychopathic deviate, paranoia, psych asthenia, obsessive - compulsive disorder, schizophrenia, hypomania . Demographic characteristics included gender, age and education . In order to access the students grade point average students (gpa) and their scores in different subjects, an agreement was reached by the department of education, to use sama software (2003, iran), which included all the students educational information . It's worth mentioning that the students information was confidentially analyzed in a group . Using (version 15, spss inc ., chicago, il) most of the participants in the present study were females (81.2%), 97% were single and 46.04% were bachelor students (27.62% undergraduate and 26.32% ph.d . The average students standardized score in all the scales of personality tests was normal and in the range of 4752 . In addition, the average students score in all the general health indices was normal . The score of social performance had a higher average compared with others . In response to the following hypothesis analysis,[tables 13]. The prediction of educational performance of the students at isfahan university of medical sciences based on personality indicators, mental health, and individual characteristics the investigation of the significance of the predictive coefficients in educational performance of the model the coefficients of variables of the predictors of educational performance if personality factors, the status of metal health and demographic features have any role in predicting the educational performance of the students in the isfahan university of medical sciences . According to the above results, the variables that are mentioned in the model could predict 11% of students educational performance (students average scores have been considered) as follows: education 4%, age 4%, gender 2%, depression (as one of the aspects of mmpi test) 1%, and hypochondria (as one of the aspects of mmpi test) 1% . As it has shown in table, the predictor coefficients of education, age, gender, depression, and hypochondria for educational performance is significant (p <0/0001). According to the results shown in table 3, five variables that could predict educational performance, in priority, are education, age, gender, depression, and hypochondria . The analysis of the results showed that education, age, gender, depression, and hypochondria are the predictive variables of educational performance (students average scores have been considered). According to the obtained results, among all the personality, general health, and demographic variables, only the variables of education, age, gender, depression, and hypochondria are significant predictors of students educational performance . Concerning the prediction of students educational performance based on their age, it should be said that the results of this study verify the results of the studies of duff and boyle no contradictory result were found . Concerning prediction of educational performance based on the depression (as one of the aspects of mmpi test), it's worth mentioning that the results of this study are verifying those of the following studies; raoofi et al ., the results of predicting based on mental health are in agreement with the results of the following studies; rafati et al . These results were in contradiction to just one study by farahbakhsh et al . In 2007, based on prediction of educational performance, according to mental health . Concerning the relationship and prediction of the educational performance based on hypochondria (as a part of the mmpi), only kahrzaei et al . Confirmed the results of the present study; but if the relationship between some of the personality features and educational performance is taken into account, the following studies could be mentioned as those that verify and recognized some personality traits as related factors in educational performance . Chamorro - premuzic and furnham, gray and watson, duff and boyle, walt and pickworth, leeson et al . The results of the present study did not confirm the results of the study done by karamimatin according to which no significant relationship was observed between personality traits and educational performance . The results of the regression test showed that the depression could predict 1% of the variance of academic performance . Depression occurs among students for many reasons, but the aim of this study is not saying about these reasons . When depression for whatever reason, was formed, academic performance of students most likely to be affected . It is not needed to mention that academic achievement requires concentration, high morale, planning, perseverance, and many other factors that can be negatively influenced by depression . Although depressed students understand the importance of academic success and feel penitent if they experience academic failure, they are unable to compensate them academic downfall . In the present study, hypochondria sometimes pressures, lack of satisfaction, and the guilty conscience appear as physical illnesses . People are differently afflicted with different illnesses or disorders based on their potential, genetic background, and the skills that can be learned . Some of these disorders overlap the others, and some can cause the others . In general, fear of getting sick can reduce solace, concentration, and accomplishment . In fact, there is no disease, but it feels odor one may have wrong feelings about the severity of illness or pain . Considering psycho - physics and the connection between body and mind, the effects of body on mind and vice versa cannot be denied . Considering the prediction of educational performance based on gender, it should be mentioned that the results of the present study are in agreement with those of the following studies; leeson et al ., and in contradiction to the following studies which have not found any relation in this area with those; raoofi et al . Research, in which each variable was analyzed separately, all variables were analyzed in a more advanced model in this study . Most of the studies have confirmed that female students have more academic achievements than male students . This difference has been probably caused by the following reasons . In terms of culture girls are expected to be less concerned with diversity, mainly concentrate on their lessons and academic achievement, and spend less time on recreational, social, and political activitiesin our society boys are disappointed in academic achievements . They feel that they should find a job as soon as possible due to the importance of financial issues and continue their education puts off their occupational success . Hence, they do nt have enough motivation to make any attempts and usually their aim is just to get an academic degree . In terms of culture girls are expected to be less concerned with diversity, mainly concentrate on their lessons and academic achievement, and spend less time on recreational, social, and political activities in our society boys are disappointed in academic achievements . They feel that they should find a job as soon as possible due to the importance of financial issues and continue their education puts off their occupational success . Hence, they do nt have enough motivation to make any attempts and usually their aim is just to get an academic degree . Courses have their own special characteristics to which the students should adapt, such as the obligation to study more, study more difficult lesson, spend more time studying (those who do nt have enough time to study will be anxious about their lessons), length of the educational period, fatigue that causes limited recreational activities, and constant involvement with lessons that leads to low - spirit, lack of energy, or losing motivation . Being unsatisfied with the future career among students who are aware of the long period that they have to spend on education can affect academic performance, too . The present study also revealed that the older the students get, the lower their academic performance will be (as a result of research dastranj et al ., 2012). The influence of age on academic performance can be viewed from different perspectives: (1) as the students get older, they are faced with some problems like entering higher semesters, more difficult lessons, more assignments, and higher expectations of their supervisors . This can lead to fatigue, impatience, or lack of motivation because of the long period of academic educations . (2) as the students get older, they approach the age at which they should accept more personal and social responsibilities, and they have to make important choices in marriage or, continuing education, job and, etc . Therefore, they have to spend some of their energy and concentration to choose the right path . Learning, gpa, and studying well are more important to the students in the first semesters . First time failed in studies, and the first conditional state, or a low gpa can cause a lot of negative feelings in person, but as time passes, these conditions become something usual and are accepted more easily . Making friends with some people who are not committed to their education can worsen this situation . We can say, if a student suffers from a physical or psychological problem, he / she has less opportunity in learning, education, and academic success . This can lead to academic failure . Performing check - up and consulting sessions for identifying students problems, especially males, older, and higher level students who are more vulnerable, according to this studycontinuous psychological intervention for the students who have a higher risk, following preventive measures in accordance to the compiled educational protocols and the target students characteristics . Performing check - up and consulting sessions for identifying students problems, especially males, older, and higher level students who are more vulnerable, according to this study continuous psychological intervention for the students who have a higher risk, following preventive measures in accordance to the compiled educational protocols and the target students characteristics . Performing check - up and consulting sessions for identifying students problems, especially males, older, and higher level students who are more vulnerable, according to this studycontinuous psychological intervention for the students who have a higher risk, following preventive measures in accordance to the compiled educational protocols and the target students characteristics . Performing check - up and consulting sessions for identifying students problems, especially males, older, and higher level students who are more vulnerable, according to this study continuous psychological intervention for the students who have a higher risk, following preventive measures in accordance to the compiled educational protocols and the target students characteristics.
|
On september 15, 2009, a 29-year - old woman, 61 kg, 1.69 m stature, caucasian, with no comorbidities, post - graduated, brazilian, from recife - pe was submitted to an elective bilateral reductive mammoplasty on a private hospital of recife - pe to remove 200 ml of each breast using the l technique for resections of excess of skin and breast tissue . Then an ampoule of adrenaline was infiltrated into her breasts, the bandage was realized using saline and polivinilpirrolidone - iodine . The patient made her bandages at home using water, soap and an antiseptic solution of chlorhexidine gluconate . One year after surgical procedure, on october 17, 2010, the patient referred edema, heat and pain on her left breast . Although left breast presented no blush and normal aspect of scar . It was requested a breast ultrasonography (usg) and it was prescribed a non - hormonal anti - inflammatory, nimesulide 100 mg, one pill a day for 5 days, with no improvement of the signs and symptoms . Usg revealed an image of a fluid collection filled by thin echoes, extending from 9 oclock to 3 oclock, with an antero - posterior diameter with approximately 2.3 cm, far around 2 cm of the skin with an increase of the echogenicity of the subcutaneous tissue on the region (figure 1). It was then prescribed treatment with cephalexin, 500 mg every six hours and nimesulide, 100 mg, one pill a day for 5 days . As there was no improvement of the clinical conditions, an aspiration of the fluid collection was performed in november 23, 2010 on patient s left breast with an entry on the intern superior upper quadrant, obtaining a greenish secretion which was sent for automatized culture and antibiogram, both negative for bacterial growth . After the procedure, it was prescribed ciprofloxacin, 500 mg, 2 pills every twelve hours for 2 days and one pill every twelve hours totaling 10 days, without improvement of the condition . On november 30, 2010, the patient was submitted to a surgery to drain the breast s abscess, maintaining ciprofloxacin 500 mg, one pill every twelve hours, diclofenac sodium, 100 mg one pill a day and dipyrone one pill every six hours for 7 days . The sample collected in this procedure was sent for automatized culture with antibiogram and for smear tests on acid fast bacilli (afb), both showing negative results . After the end of the treatment with antibiotics, on december 13, 2010 an usg showed an increase of the echogenicity on the cellular subcutaneous tissue and on the breast s fat, associated with 2 collections which presented debris in suspension and irregular and inaccurate contours, measuring: 8.83.11.7 cm (vol = 24.2 cm), located on the superior upper quadrants of the left breast and another with 2.21.20.8 cm (vol=1.1 cm); deeper than the previous one, which was located on the transition of the left lower quadrants, presenting 2 reactive lymph nodes on the left axilla, measuring 1.8 cm and the 1.4 cm, respectively . After confirming the presence of the collections, another aspiration was performed using usg, on the same breast in december 14, 2010, and it was also requested in a private laboratory of the city . Another culture and cytological exam of the collected sample, showed one inflammatory cyst and growth of afb on a specific culture medium, but the mycobacterium specie was not identified due to fungus contamination on the sample . A chest x - ray was requested, and it did nt show abnormalities, another usg was performed on january 24, 2011, which revealed a new fluid collection, homogeneous, measuring: 2.00.71.5 cm located on the internal superior upper quadrant of the left breast . It was then prescribed vibramycin, 100 mg, one pill every twelve hours and trimethropim sulfamethoxazole, 400/160, one pill every twelve hours for 6 months, and it was also requested a new drainage . The drained material was sent to the public health s central laboratory dr . Milton bezerra sobral (lacen - pe), being isolated non - tuberculous mycobacteria in the culture medium . Mycobacterium wolinskyi was identified by sequencing specific genes; this technique was performed at aggeu magalhes research center, fiocruz - pe . As the patient presented an evident improvement of the clinical conditions, the treatment scheme proceeded for more 6 months, independent on the antibiogram s result (table 1) remaining asymptomatic for almost 11 months . After this period, on january 9, 2012, the inflammatory signs and symptoms reappeared on the left breast, an usg showed 4 cystic images, the biggest at 12 oclock measuring: 0.70.6 cm; the second had slightly thick walls associated with hyperechogenicity of the cellular subjacent subcutaneous tissue at 1 oclock, measuring: 0.70.60.5 cm, far 1 cm of the skin and about 4 cm of the nipple; the third cyst presented an heterogeneous content with two adjacent cysts, located at 10 oclock and measuring: 1.41.31 cm and 1.31.10.8 cm, far 3 cm of the nipple and 2 cm of the skin; and the fourth image was located at 5 oclock measuring: 2.91.91 cm, far 1 cm of the skin and 4 cm of the nipple . The patient was then submitted to a new surgical procedure to drain the collection and to withdraw the necrotic tissue . This tissue culture revealed one more time the presence of mycobacterium wolinsky, identified by sequencing specific genes . The prescribed therapy was an association of antibiotics, initially under hospital regimen, amikacin 1 g injectable per day with ciprofloxacin 500 mg every twelve hours and doxycycline 100 mg . Amikacin was maintained for 10 weeks under domiciliary regimen, 1 g intramuscular 3 times a week . After this period the patient was released from the therapeutic scheme with complete regression of the clinical symptoms . The culture on lwenstein - jensen medium revealed afb growth on less than 7 days, suggesting rgm . The colonies did not show any coloring, they were resistant to the para - nitrobenzoic acid (pnb) and to the hydrazide of the 2-carboxilic acid (tch); they did not show rope spoilage and the test for the presence of niacin was negative . A 764-bp fragment was amplified and sequenced with primers mycof (5_-gcaaggtcaccccgaaggg-3 _) and mycor (5_-agcggctgctgggtgatcatc-3 _). A total of 5 l of each dna solution (50 g / ml) was added to 45 l of a pcr mixture containing 50 mm kcl, 20 mm tris - hcl (ph 8.4), 2.5 mm mgcl2, 200 m each dntp, 1 m primers, and 1.0 u of taq dna polymerase (promega). Pcr mixtures were heated at 95c for 1 min and then subjected to 35 cycles of denaturation at 94c for 30 s, annealing at 64c for 30 s, and extension at 72c for 90 s, with a final step of 72c for 5 min . Amplicons were purified with gfx pcr dna and a gel band purification kit (g&e) and sequenced in an abi prism 3100 sequencer with a bigdye terminator cycle sequencing kit (applied biosystems). The sequences found were edited and aligned by analyzing the sequencing electropherograms using the program bioedit v7.0.9 . The sequences obtained were compared with those deposited in the genbank database by using blast (http://www.ncbi.nlm.nih.gov/blast). The isolate had partial sequence of the rpob gene with 99% (683/689) similar to genbank accession number ay262743, which corresponds to mycobacterium wolinskyi type strain atcc 700010 . The in vitro susceptibility test to antibiotics was performed using the microdilution broth assay (mic) (table 1). The bacilloscopy performed with the samples was negative for afb . The culture on lwenstein - jensen medium revealed afb growth on less than 7 days, suggesting rgm . The colonies did not show any coloring, they were resistant to the para - nitrobenzoic acid (pnb) and to the hydrazide of the 2-carboxilic acid (tch); they did not show rope spoilage and the test for the presence of niacin was negative . A 764-bp fragment was amplified and sequenced with primers mycof (5_-gcaaggtcaccccgaaggg-3 _) and mycor (5_-agcggctgctgggtgatcatc-3 _). A total of 5 l of each dna solution (50 g / ml) was added to 45 l of a pcr mixture containing 50 mm kcl, 20 mm tris - hcl (ph 8.4), 2.5 mm mgcl2, 200 m each dntp, 1 m primers, and 1.0 u of taq dna polymerase (promega). Pcr mixtures were heated at 95c for 1 min and then subjected to 35 cycles of denaturation at 94c for 30 s, annealing at 64c for 30 s, and extension at 72c for 90 s, with a final step of 72c for 5 min . Amplicons were purified with gfx pcr dna and a gel band purification kit (g&e) and sequenced in an abi prism 3100 sequencer with a bigdye terminator cycle sequencing kit (applied biosystems). The sequences found were edited and aligned by analyzing the sequencing electropherograms using the program bioedit v7.0.9 . The sequences obtained were compared with those deposited in the genbank database by using blast (http://www.ncbi.nlm.nih.gov/blast). The isolate had partial sequence of the rpob gene with 99% (683/689) similar to genbank accession number ay262743, which corresponds to mycobacterium wolinskyi type strain atcc 700010 . The in vitro susceptibility test to antibiotics was performed using the microdilution broth assay (mic) (table 1). The bacilloscopy performed with the samples was negative for afb . The culture on lwenstein - jensen medium revealed afb growth on less than 7 days, suggesting rgm . The colonies did not show any coloring, they were resistant to the para - nitrobenzoic acid (pnb) and to the hydrazide of the 2-carboxilic acid (tch); they did not show rope spoilage and the test for the presence of niacin was negative . A 764-bp fragment was amplified and sequenced with primers mycof (5_-gcaaggtcaccccgaaggg-3 _) and mycor (5_-agcggctgctgggtgatcatc-3 _). A total of 5 l of each dna solution (50 g / ml) was added to 45 l of a pcr mixture containing 50 mm kcl, 20 mm tris - hcl (ph 8.4), 2.5 mm mgcl2, 200 m each dntp, 1 m primers, and 1.0 u of taq dna polymerase (promega). Pcr mixtures were heated at 95c for 1 min and then subjected to 35 cycles of denaturation at 94c for 30 s, annealing at 64c for 30 s, and extension at 72c for 90 s, with a final step of 72c for 5 min . Amplicons were purified with gfx pcr dna and a gel band purification kit (g&e) and sequenced in an abi prism 3100 sequencer with a bigdye terminator cycle sequencing kit (applied biosystems). The sequences found were edited and aligned by analyzing the sequencing electropherograms using the program bioedit v7.0.9 . The sequences obtained were compared with those deposited in the genbank database by using blast (http://www.ncbi.nlm.nih.gov/blast). The isolate had partial sequence of the rpob gene with 99% (683/689) similar to genbank accession number ay262743, which corresponds to mycobacterium wolinskyi type strain atcc 700010 . The in vitro susceptibility test to antibiotics was performed using the microdilution broth assay (mic) (table 1). Among the rapidly growing mycobacteria (rgm), m. wolinskyi belongs to m. smegmatis group; it was identified for the first time by brown et al . Rgm are broadly distributed on the environment, particularly on soil and water, including potable water, biofilms on water distribution piping, swimming pools, sewage and surfaces . Since its taxonomic description, 19 cases of human infections all over the world were described until now . The majority of infections are post - traumatic and post - surgical, there are no reports of infection after breast aesthetics surgery . Over the last few decades, the majority of the notified cases after infection post mammoplasty are associated with mycobacterium fortuitum (57%) and with mycobacterium abscessus (15.2%). Mycobacterium wolinskyi was isolated in only 2 notified cases, representing 2% of all breast infections . The infection caused by these microorganisms can appear weeks or months after the surgery, with no standard scheme to treat the infection by rgm due to in vitro variability and susceptibility of bacteria species . Therefore, it is necessary to identify properly every sample and to determine its sensitivity to antimicrobial agents . The choice of the most suited treatment depends on the mycobacteria species involved in the infection, on the clinical presentation and on the patient s immunological condition . These bacteria are capable of producing biofilms, which makes their resistance to antibiotics easier . In general, procedures of drainage, the typical profile of the in vitro susceptibility of mycobacterium wolinskyi is: susceptibility to amikacin, imipenem and trimethropim sulfamethoxazole; resistance to tobramycin; intermediate susceptibility to doxycyclin and ciprofloxacin; and susceptibility to cefoxitin and clarithromycin . Its resistance to tobramycin is a feature that distinguishes mycobacterium wolinskyi from the other members of mycobacterium smegmatis group . The present case is the first report of infection by mycobacterium wolinskyi after mammoplasty in brazil . There was no notification of outbreaks during this period at the hospital where the surgical procedures were performed . It is more likely that the bacteria infected the breast at the moment of the mammoplasty, since the presence of inflammatory signs (edema and pain) and abscesses were detected one year after the surgery, with no breast trauma or piercing in the region in this period . It was also observed the absence of comorbidities, presenting similar evolution with the cases which are associated with this type of mycobacterium described on literature . To achieve cure, it was necessary to perform several drainage procedures of the abscesses combined with long term therapy using antibiotics, anti - inflammatories and analgesics . This case reassures the occurrence of postsurgical infections by non - tuberculous mycobacteria which must be considered, by health professionals, an important cause of morbidity for human beings.
|
Laparoscopic cholecystectomy (lc) has been long established as a surgical procedure that typically is minimally invasive . However, lc can result in various kinds of surgical complications that are not commonly associated with open cholecystectomy . Bile duct injury is the most common lc - associated complication, with an incidence of 0.5 - 1.4%, and it is diverse in terms of extent and location.1234 isolated injury of the right hepatic sectoral or segmental bile duct is an unusual form of major bile duct injury.56 the usual causes of this injury type include direct cutting or clip clamping of the segmental duct, and thermal injury from irrelevant cauterization . Variant biliary anatomy such as a low - inserting right posterior duct and other rare variations of segmental duct union with the cystic duct are reported to be important predisposing conditions.7 isolated injury to the right anterior sector (ras) following lc is very rare, compared with that of the right posterior sector duct, and its surgical treatment is difficult due to its deep location . We herein present an unusual case of isolated injury of the ras duct following lc . This damage might be associated with accidental transection of the duct without identifying that the bile duct was a rare anatomic variant . The injury was successfully treated by induction of segmental liver atrophy through segmental portal vein embolization and segmental bile duct occlusion.89 a 48 year - old female patient was transferred from another institution due to intractable bile leak after lc . It was reported that her primary diagnosis was calculous cholecystitis and all lc procedures were completed uneventfully according to standard techniques (fig . 1). The patient discharged on the second day after lc, but 4 days later she readmitted due to abdominal pain and fever . Abdomen computed tomography (ct) revealed abnormal fluid collection in the subhepatic and subphrenic areas (fig . Endoscopic retrograde cholangiography (erc) was performed under suspicion of bile leak, but no biliary injury was recognized at the time of the erc procedure (fig . A retrospective review of the erc images indicated that one of the right sectoral ducts was not visualized, but this finding was missed at the time of the erc . Even after supportive care for 1 week follow - up ct scans showed definite accumulation of a huge amount of perihepatic fluid (fig . 2c, 3b), but pure bile of about 150 ml / day continuously drained from the abdominal pigtail catheters . Finally, she was transferred to our institution, 40 days after lc . Magnetic resonance cholangiography (mrc) was carried out to delineate the biliary anatomy of the missing duct . The ras duct had been transected close to the liver parenchyma, but there was no recognizable duct stump at the common bile duct except the cystic duct clipping (fig . This biliary anatomy implicates that the ras duct might be aberrantly inserted into the cystic duct and both cystic duct and ras duct were transected altogether (fig . 5a). There was no intrahepatic duct dilatation in the right liver, implicating that bile drained freely from the transected ras duct (fig . The morphological features of this isolated injury to the ras duct suggested that primary reconstruction using roux - en - y hepaticojejunostomy was not feasible or was technically very difficult and ras resection appeared to be very complicated . Based on our previous experience with hepatic atrophy induction therapy for lc- and hepatectomy - associated segmental bile duct injuries,89 we decided to perform portal vein embolization (pve) of the ras portal branch to induce atrophy of the ras parenchyma (fig . Thereafter, the amount of bile drained from the pigtail diminished dramatically, and the fluid color became much paler . Ct scans taken after 1 and 4 weeks showed that the ras parenchyma had atrophied markedly (fig . Thereafter, we removed the last clamp after ensuring the occurrence of heavy adhesions around the bile leak site . The pigtail was kept in place for a total of 3 months after pve, as initially planned . At 6 months after pve, 6d) and bile production disappeared completely on follow - up hepatobiliary scans (fig . She was free from any other complications during the first 12 months and to date . Although most major bile duct injuries are detected during the lc procedure or within a few days, some biliary injuries are not recognized due to the absence of significant symptoms and signs.10 present case revealed bile leak as the major sign of bile duct injury . Initially this injury had not been suspected because the records of operative fields were transparently free from abnormal findings . This lc - induced ras duct injury must be very rare because we have not encountered such an injury after about 20,000 lcs over 20 years in our institution . Erc can result in an accidental isolated injury to the segmental bile duct.56 the presence of bile leak despite normal - looking erc findings is a diagnostic dilemma . Under such circumstances, mrc should be carried out as it can disclose the whole configuration of the biliary tree even after total transection of the bile duct.1112 after a thorough review of dynamic ct, mrc, erc and hepatobiliary scan findings, we concluded that the injury site was located deep within the hepatic hilum . As this site might be deep seated and surrounding tissues would be necrotic due to biloma, primary biliary reconstruction did not appear feasible . Removal of the bile - leaking ras parenchyma can be considered, but it must be the last choice of treatment . We have reported the effectiveness and usefulness of hepatic atrophy induction treatment for isolated segmental bile duct injury following lc and central hepatectomy.89 there are two primary mechanisms associated with hepatic parenchymal atrophy, deprivation of portal blood flow and bile duct obstruction . Methods to induce both were applied sequentially to all of our reported patients, including this case . The treatment procedure consisted of three major steps, the first being embolization of the segmental portal branch, which effectively inhibited the quantity and quality of bile production.1314 the second step was closure of the leak site through induction of heavy adhesion to ensure clamping of the percutaneous transhepatic biliary drainage or pigtail drainage . The third step was inhibition of bile drainage through spontaneous occlusion of the segmental duct to accelerate atrophy of the segmental parenchyma . After these steps, the segmental intrahepatic duct became rather dilated, but no further dilatation was observed on follow - up imaging studies ., our experience from this case and others suggests that percutaneous segmental portal vein embolization followed by intentional clamping of the external biliary drainage can effectively treat intractable bile leaks caused by segmental bile duct injury of various causes, including lc.
|
The bone - anchored hearing aid (baha) is a bone - integrated implant that was introduced in clinical practice in sweden in the 1970s1 . It is a bone conduction hearing device that transmits sound directly into the inner ear, bypassing skin impedance and subcutaneous tissue . It has been used in patients with mixed or conductive hearing loss who do not benefit from conventional amplification devices . It is indicated mostly for patients with conductive hearing loss resulting from the closure of the external ear canal and other malformations of the middle and external ear; however, it can also be performed in patients with surgical mastoid cavities or those who do not adapt to conventional hearing aids . The goals of this manuscript were to review the main indications for baha, analyze the audiometric results and benefits provided to patients compared with other treatment modalities (e.g., concomitant reconstructive surgery and cosmetic surgery), and compare the data from the literature with our sample of 13 patients who underwent this procedure between 2000 and 2009 . Electronic databases (pubmed, medline, ovid, and cochrane) were searched for works in english, spanish and portuguese, with no limitations for year in which procedures were performed . The following search terms were used: (hearing loss or deafness or congenital aural or caa or external auditory canal or eac or ear canal or ear auricle) and (atresia or abnormalities or congenital) and (prosthesis implantation or prosthesis design or bone conduction or osteo - integrated bone - conduction device or baha or baha system or bone - anchored or hearing aid or hearing aids or prosthesis fitting) and ((epidemiologic methods) or (comparative study) or (prognosis / narrow [filter]) or (therapy / broad [filter])). Malformations of the external and middle ear can be associated with sensorineural or conductive hearing loss . Conductive hearing loss is common when there is atresia external auditory canal (eac) stenosis, or malformation of the ossicular chain . Baha surgery is a relatively simple procedure that was approved by the fda in 1996 for adults and in 1999 for children above 5 years of age2 10 (if a 3-mm fixer is installed, a bone density of at least 2.5 mm is necessary; this occurs at approximately 5 to 7 years of age3) and can be completed in a single session or over 2 sessions . Before the age of 5 years, patients can be rehabilitated with a bone vibrator attached to an elastic band (soft band). The children had an average age of 2 years and 3 months (1 month to 5.5 years), with hearing thresholds below 60 db that reached approximately 27 6 db with the use of the bone vibrator, suggesting that this amplified sound as well as the baha . Hol et al.5 also supported the use of the band with bone vibrator in small children after following 2 children (1 of whom had a baha bilateral soft band, which provides a binaural summation of approximately 3 to 5 db). Some authors recommend baha before 5 years of age, as this period is crucial for speech development . Davids et al.6 performed baha surgeries between 1996 and 2006 and divided the patients into 2 groups: below 5 years of age (20 patients) and above 5 years of age (20 patients). In 38 patients, the surgery was performed in 2 stages . The main difference between the age groups was a longer gap between the first and second stages of the procedure in the below-5-year - olds to ensure osteointegration . Complications included a higher incidence of skin growth or infection among the younger patients (3 in the younger group and 0 in the older group), while the incidence of traumatic loss was similar (2 in the younger group and 4 in the older group). There were no osteointegration flaws in any of the patients below 5 years of age . Mazita et al.7 performed baha surgery in a single session only in patients older than 12 years . Of the 16 patients in their study who underwent the procedure (11 of them in 2 stages), there was an average airway conduction threshold improvement from 64.9 db preoperatively to 29.7 db postoperatively, with an average functional gain of 35.2 db . The authors noted that percutaneous baha transmission is more efficient by 10 to 15 db than transcutaneous transmission, and they also advocate the use of the elastic band in children younger than 3 months old7 . Rotenberg et al.8 describe the experience of establishing a baha program, including treatment algorithms, protocols, methodology, complications, and patient satisfaction . In their program, the initial assessment occurs between birth and 4 years of age, when the parents are contacted and informed of treatment options . When there is atresia or malformation of the middle ear, hearing is also evaluated . Once the patient is 5 years old, the parents are called for a discussion about the treatment and receive information about postoperative care and follow - up . The complications included only 1 case with excessive growth of soft tissues, which can be avoided during the initial skin preparation with circumferential debridement of the tissues and application of a thin, hairless skin graft . This is highly satisfying to the patients and their parents, and the major complaints involve esthetics and the necessary care for the device required during physical activities . The conventional procedure usually requires 2 surgical sessions, and the literature suggests a gap of 3 to 6 months between the procedures . During the first session, the second session involves the removal of fat, excess subcutaneous tissue, and hair follicles, along with a skin puncture to expose the fixer . Ali et al.9 performed a study with 30 children who underwent surgery between 1997 and 2005 . Surgery conducted in a single session was associated with few complications (2 infections of the surgical site, 1 skin hypertrophy, 1 chronic infection, and 2 losses of implant after local trauma) and had the advantage of avoiding a second exposure to anesthesia . The causes of hearing loss were treacher collins syndrome3, eac atresia (9 total, 6 of which were bilateral), and mastoid cavity1 . The age of the patients ranged from 3 to 34 years (average 14.3). In preoperative audiometry, 10 patients had a gap of 30 to 40 db and 2 had mixed loss with a gap of 30 db (audiometry was not possible for 1 patient). Seven patients exhibited closure of the air - bone gap (4 with bilateral eac atresia, 2 with treacher collins syndrome, and 1 with mastoid cavity), there were 2 whose sensorineural loss persisted (they had mixed loss before the surgery), and 6 patients had a persistent 10 db gap postoperatively (3 eac atresia, 2 bilateral eac atresia, and 1 treacher collins syndrome). There were no significant differences between the audiometric results according to the cause of the hearing loss, and 1 patient who underwent a previous mastoidectomy surgery with a preoperative gap of 40 db had an excellent outcome (closure of the air - bone gap). The surgery was performed in a single procedure in all patients, except in 1 with treacher collins syndrome, and there were no postoperative complications . The incidence of aural atresia is estimated to be 1 per 10,000 births; in 25% of cases, the atresia is bilateral10 . Fuchsmann et al.10 evaluated baha results in 16 patients with an average postoperative threshold of 25.4 5.7 db (average gain of 33 7 db). The average postoperative air - bone gap was 10.5 5.9 db, and there was closure of the gap in 10 patients . The free - field speech recognition threshold improved from 63 db to 30 db . For most surgeons, a pure - tone air threshold of 30 db or less represents a good result, and 85% of the patients in this study exhibited such thresholds . Ricci et al.2 evaluated the audiometric results in 47 patients who underwent baha . In this group, 31 had bilateral congenital atresia, 9 had chronic otitis media or history of ear surgery, and 7 had osteosclerosis . There was a closing of the gap in 40 patients, and 14 had overclosure, when the baha threshold overcomes the preoperative bone conduction threshold . Carlsson and hakansson 11 related this phenomenon and stated that when the baha reaches its maximum potential, the air - bone gap can virtually close, with an additional maximum sensory compensation of 5 to 10 db at frequencies between 700 and 3000 hz . Speech perception also improved in approximately 31 patients by 64 31% at 60 db hl . Of the 9 patients with chronic otitis media, 7 exhibited improvement in the infection . Forty - five patients in their study answered a questionnaire and reported an improvement in quality of life after baha surgery . The authors reported 3 cases with complications, 2 with skin growth around the implant, and 1 with extrusion due to osteointegration failure . Mcdermott et al.11 in a retrospective study of 182 children who underwent baha implantation surgery, had success in 97% of the patients who used the implant daily . Kunst et al.13 14 implanted bahas in 20 patients with unilateral conductive hearing loss . The bone - conduction thresholds were normal in both ears, with a gap in the affected ear of 50 db . All the patients presented speech recognition and free - field thresholds better than 25 db with baha use . One unexpected finding was a good result in the ear without the baha with improvements in speech comprehension, particularly in cases of congenital hearing loss . Consistent use of the device is highly predictive of the benefit to the patient, and even in cases for which the exams did not show significant gain, patients who used the device were satisfied10 14 . The authors also evaluated subjective improvement through questionnaires and concluded that most patients seemed to benefit from baha use12 . In the largest series, the best hearing results with baha were achieved when the cochlear reserve (bone threshold) was better than 45 db . Lusting et al.1 confirmed this finding when they evaluated the first 40 patients rehabilitated with baha in the united states . Twenty - one patients had hearing loss due to chronic otitis media, 9 due to eac atresia / stenosis, 5 due to osteosclerosis or congenital hearing loss, 3 after skull base surgery, 1 for keratosis obliterans, and 1 for conductive hearing loss of unknown cause . Eighty percent of patients obtained a 10 db gap reduction, 60% achieved a 5 db reduction, and 30% presented overclosure . The best audiometric results were achieved in patients with osteosclerosis or congenital hearing loss who presented a 42 db increase with baha . The chronic otitis media patients had an average of 33 db gain, and the eac stenosis / atresia patients had an average of 22 db gain . Patients with hearing loss due to surgery at the base of the skull had the worst outcomes . Complications included a flaw in osteointegration in 1 patient and local skin reaction in 3 patients . Another modality for treating hearing loss in cases of atresia and ear malformation is reconstructive surgery, particularly canaloplasty, tympanoplasty, and stapes and ossiculoplasty, whether including or not including associated aesthetic reconstruction of the hearing pavilion . Evans and kazahaya 15 compared the results of reconstructive surgery in 29 patients versus baha in 6 patients in a pediatric population . The average hearing gain in db was 17.7 after the reconstructive surgery and 31.8 db after baha . In this study, 93% of patients required sound amplification postoperatively, even after reconstructive surgery, and there were 18 cases of late complications, most commonly recurrent eac stenosis (8 patients) and recurrent otitis externa (7 patients). In the baha group these findings encompass the main reasons why reconstructive surgery is currently discouraged in most centers . In 1993, granstrom et al.16 published a study of 111 patients, 45 with bilateral modification (156 ears total) who underwent a total of 134 reconstructive surgeries . The most common causes of malformation were treacher collins syndrome (21 patients) and hemifacial microsomia (18 patients). In 73 ears, severity of hearing loss was found to be proportional to the severity of the malformation, while the hearing gain with the reconstructive surgery was lower for the more severe malformations . The hearing improvements for 44 ears after more than 2 years of follow - up were poor (0 to 10 db) in 24 patients, moderate (10 to 30 db) in 19, and good (above 30 db) in only 5 patients . The results for the aesthetic auricular prostheses were also good, as 72 of the 73 patients were satisfied with the surgery . In this study, the authors agreed with the general consensus in the literature that ear reconstruction surgery is one of the most difficult of the otological procedures, and disappointing results for both aesthetics and hearing (in this study, only 34% of patients reached the social level of hearing), along with the increase in experimental baha use, have led to a more conservative approach toward reconstructive surgery . (2006)17 also correlated severe microtia and surgical revisions with lower audiometric gains after reconstructive surgery (15.3 db in revision surgeries versus 20 db in primary surgery, after 3 years) concluding that in these cases, baha must be offered as an alternative, as it can provide more secure and stable results . Mazita et al.7 recommend canaloplasty in patients with normal pneumatization of the middle ear and mastoid in whom the facial nerve, the ossicular chain, and middle and inner ear are normal or minimally affected . The placement of a prosthetic hearing pavilion with aesthetic finality is another alternative to reconstructive surgery . In these cases, the functional portion can be complemented with baha placement . In the study mentioned above, ganstrom et al.16 compared the results of reconstructive surgery with those of baha and the pavilion prosthesis coupled to the bone in 111 patients and 134 reconstructive surgeries, including 73 surgeries for placement of the pavilion prosthesis and 39 baha insertions . All of the patients in the baha group considered the baha superior to conventional amplification devices, and 72 of 73 pavilion prosthesis patients were satisfied with their prosthesis, while only 8 of the 37 reconstructive surgery patients were satisfied, and only 34% achieved a social level of hearing . The authors suggested that reconstructive surgery should be contraindicated for unilateral congenital atresia and took the same conservative approach to bilateral atresia in light of their disappointing results and the increasing experience with baha . In 2001, the same authors published data from the 100 patients who first underwent the surgery, 76 of whom had bahas or aesthetic anchored prostheses implanted3 . Most of the revisions occurred in patients between 5 and 11 years of age, a period during which the bone grows considerably . The authors did not indicate aesthetic surgery for patients younger than 5 years of age . Somers et al.18 compared the results of reconstructive plastic surgery with attachment of a prosthesis anchored to the bone . They studied 62 patients, among whom 35 had prosthesis placement and 27 had reconstruction . The reasons for surgery were anotia / microtia (26), trauma (6), and oncological (3). The rate of satisfaction among the prosthesis patients was high, with 34 patients who reported using the prosthesis every day . The complications included skin growth in 1 patient, skin reaction in 9 patients, and excessive subcutaneous tissue required reduction in 2 patients . The disadvantages of the prosthesis included the daily care requirements, occasional loss, and color change over time . Among the reconstructive surgeries, 21 were performed using the nagata technique (preferred by the authors, conducted in 2 surgery sessions). The authors indicated this procedure for patients up to 6 years old, which is when the ear reaches about 85% of its adult size . The results were considered very good for 9 patients, good for 12, acceptable for 5, and bad for 2 . The greatest failure rate occurred during the initial period . In cases of anotia and microtia, the authors only indicated prosthesis placement when the patient refused reconstruction, when reconstruction had already failed, when the cause was trauma or cancer, and for patients with multiple comorbidities . The authors indicate baha for patients who are undergoing reconstructive plastic surgery while awaiting functional surgery . The hearing gain from baha can change over time, as saliba et al.19 demonstrated . The authors evaluated the hearing of 17 patients preoperatively, on the day of insertion, and 6 and 12 months post - insertion . They found that the gain in speech discrimination at 1 year was better than immediately after the insertion (21.9% versus 11.7%), suggesting a learning process over time . When speech intelligibility is measured binaurally with spatial separation of the sources of speech and noise, the threshold can vary up to 10 db in individuals with normal hearing; in this study, the worst thresholds occurred when speech and noise came from the same source, while the best thresholds occurred when speech and noise sources were 90 apart . The pure - tone average after 1 year was comparable to the results immediately after the insertion . Christensen et al.20, in a pilot study, implanted bahas in 23 children with deep unilateral sensorineural hearing loss . These children usually display poor school performance in noisy environments because of their hearing disability . The procedure was performed in 2 sessions, and hearing gains were demonstrated by improved scores on the hearing in noise test (hint) and the children's home inventory for listening difficulties (child) questionnaire . Among the study patients, there was an improvement of 40%, 21%, and 4% in 0, 5, and 10 db, respectively, on the hint and improvements of 2.41 for the patients and 2.5 for the parents as shown by the child questionnaire scores . More recent studies have supported the use of baha for patients with unilateral sensorineural deafness . Between 2006 and 2008, wazen et al.21 studied 21 patients with air - conduction thresholds worse than 90 db or speech discrimination lower than 15% for the most affected side and light - to - moderate contralateral deafness . Hearing was measured with and without the baha and with 2 kinds of processor, intense and divine . There was a statistically significant postoperative improvement in both hearing thresholds and speech recognition scores versus pre - operation, and 91% of the patients reported improved quality of life on the glasgow questionnaire . A significant difference in the hint test scores favored the intense processor, which also provided a higher average functional gain (> 55 db versus 45 db). The authors concluded that the baha is effective in the rehabilitation of patients with unilateral sensorineural deafness . Hol et al.22 studied 27 patients with unilateral sensorineural hearing loss (25 acquired and 2 congenital) and evaluated the gain with baha cros (transcranial routing of sound). They found poor results for sound localization, but improved scores for speech in noise, subjective benefit, and client satisfaction among those who answered the appropriate questionnaire . The present review indicated that baha can be an excellent treatment option for patients with bilateral conductive deafness, as the literature has already established, due to its good hearing results, relative simplicity, and low rate of complications . The postoperative findings for our patients were compatible with the major published works sampled herein.
|
Over the past two decades many countries including new zealand have faced a shortage of medical practitioners willing to practice in rural areas [15]. This problem is compounded by general medical workforce shortages related to increasing demands from the combination of an ageing population and an ageing medical workforce [57]. Medical schools have some obligation to ensure that they produce graduates suited and attracted to areas of health need [810]. The two main strategies adopted by governments and medical schools worldwide to increase the supply of rural doctors have been preferential admission of students of rural origin and the use of rural undergraduate placements as part of the curriculum [1113]. The success of these medical school based strategies will in part depend on the academic status of rural health within the schools . If rural health is seen as an acceptable discipline, it will avoid being considered as a second tier option educationally and academically and as a career choice [14, 15]. If students perceive rural health as being of low status, this will negatively influence their choice of a rural clinical school for their education . New zealand has two medical schools, otago and auckland (figure 1), which offer undergraduate courses . This includes a health sciences first - year course which provides students for the differing health professional disciplines . Students selected for medicine complete a further two preclinical years at dunedin before choosing one of three otago clinical schools (figure 1) for their final 3 years of the 6-year course . The three otago clinical schools have common educational objectives but autonomy over their curriculum in how these objectives are achieved . The university of otago, dunedin school of medicine, responded to local rural health workforce need by introducing a seven - week rotation in rural health for all 5th year undergraduate students in 2000 . A survey of the first two cohorts of undergraduates going through this rotation in 2000 and 2001 showed a positive effect of the placement on attitudes to rural health of both rural and urban background students . However, at that time, the students generally felt that most of their teachers and peers did not view rural health highly as either a discipline or a career . The aim of this study was to test whether students' perceptions of faculty and peer attitudes towards rural health at the dunedin school in 2007 had changed compared to those of the original cohort . Our hypothesis was that student pre - course perceptions of faculty and peer attitudes towards rural health might be more favourable in 2007 than earlier, as a result of the increased focus on rural health within the school following the introduction of the original course . We also hypothesised that this change would not be apparent at the university of otago's two other clinical schools based at christchurch and wellington which had not introduced rural undergraduate courses by the time of the study . The study was a comparison of data from a census of the 2007 cohort of 5th year medical students at each of the three clinical schools of the otago university medical school and data from an earlier census of the cohort of dunedin 5th year medical students from 2000 and 2001 . It was a census in that all students in each cohort were approached rather than a sample from each cohort . We administered a hard copy questionnaire identical to that used in the 2000 and 2001 study . Students were informed about the study and offered the study information, consent, and questionnaire at face to face meetings at each school . Responses were identifiable by school, allowing a comparison of the dunedin group with their peers from the 2000/2001 survey . Students in dunedin were surveyed in 2007 prior to attending the 5th year rural course . The analysis was based on a comparison of the 2007 dunedin students' responses with responses from two other groups of students . We looked for differences between the 2007 cohort prior to the rural course and the 2000/2001 cohort prior to the rural course . We also compared the 2007 dunedin students with their peers at the christchurch and wellington clinical schools, neither of which had a rural undergraduate course . Analysis of cross - tabulation tables was based on modifications of the chi - square coefficient statistic . For nominal data (i.e., where respondents answered yes / no or rural / urban, etc . ), cramer's v measure was used . For ordinal data (where answers are given on a scale), kendall's tau - c measure was used . Some questions required respondents to indicate their preference on a five - point likert scale (e.g., not at all, not much, neutral, highly, and very highly). Due to a small number of responses in either extreme, the five - point scale was converted to a three - point scale (e.g., not at all and not much combine to become not; highly and very highly combine to become highly; in the 3-point scale, there were not, neutral, and highly). Ethics approval for the study was provided by the university of otago ethics committee low risk research involving human subjects category a (04/184). The overall response rate was 80% (193/240) but varied between the schools with christchurch 66% (53/80), dunedin 81% (65/80), and wellington 93% (75/80). When asked about their background, 74% of all respondents were identified as being of urban origin and 26% as being of rural origin . This proportion was consistent across all schools, with 81% urban respondents from christchurch in 2007, 72% urban respondents from dunedin (2000/2001) and 70% urban respondents in 2007, and 71% urban respondents from wellington in 2007 . We did not supply a definition of urban and rural: students self - identified into urban and rural groups (in 2000/2001, 24% of students were self - identified as rural). We analysed by dunedin, christchurch, and wellington school both students' perceptions of their teachers' (faculty) attitudes to rural practice and students' perceptions of their peers' attitudes to rural practice . Table 1 shows that when asked to what extent did you feel that rural practice was viewed positively by your teachers, students at dunedin were most likely to feel that teachers had a positive view of rural general practice, followed by students at christchurch, with students at wellington least likely to agree (= 35.432 and p <0.001). We did not define teachers leaving this open to respondents' interpretation . When asked to what extent rural practice was promoted by their teachers, dunedin students were also more likely to indicate that rural general practice was promoted by their teachers than students from christchurch and wellington (= 42.277 and p <0.001). More dunedin and christchurch students than wellington students said that rural general practice was talked about as a distinct discipline by their teachers (= 10.777 and p = 0.029). There were no differences between students in the three schools in response to the questions was rural practice discussed as a career option by your peers? And was rural practice viewed highly by your peers? When responses from dunedin students (prerural course) were compared between 2007 and 2000/2001, the 2007 group were significantly more likely than those in 2000/2001 to indicate that rural general practice was viewed positively and promoted as such by their teachers . Dunedin students were also significantly more likely in 2007 than in 2000/2001 to feel that their peers discussed rural general practice as a career option and that their peers viewed rural general practice positively (table 2). The increase in the proportion of students reporting that rural practice is promoted positively by their teachers occurred through a drop in the not promoted group and a rise in the promoted group with neutral comments remaining around 30% . However, there was no significant difference in students' stated likelihood of entering rural practice between precourse responses in 2007 and precourse responses in 2000/2001 at dunedin . Students from rural areas reported significantly higher likelihood than students from urban areas of entering rural general practice with 11% of rural students saying they were likely to enter rural general practice, compared to 4% of urban students (kendall's tau - c = 0.299, p = 0.008). This study suggests that student and faculty attitudes to rural health (as perceived by medical students) have changed favourably over the years following the introduction of the rural curriculum at the dunedin medical school . For student perceptions of faculty, this change is apparent in the dunedin school, whereas for their perceptions of their peers the change is evident at all three clinical schools . There has been a large shift in student perceptions of the attitudes of faculty at dunedin school towards a positive view of rural practice over the period studied . This change is made up of reductions in both the neutral and negative responses in 2007 compared to 2000/2001 . This may be an indicator of a decrease in negative comments (regarding rural health from faculty to students), which have been shown to affect up to 17% of student career choices [19, 20]. The student perceptions of attitudes of faculty at christchurch and wellington schools in 2007 are similar to the student perceptions of faculty at dunedin in 2000/2001 (tables 1 and 2). The fact that the change in perceptions occurred at the school which introduced a rural health course leads to the assumption that this course has been responsible for the change . However the findings of change between both 2000/2001 and 2007 at dunedin and between the three clinical schools suggest that the effect is due to the introduction of rural health as a legitimate and distinct part of the curriculum at the dunedin school . This does not imply that the addition of a rural health placement to a curriculum will always have such an effect, as we have not explored the features or qualities of such a placement, which might contribute to such a change . Nevertheless the study does show that it is possible for changes in perception to occur . At the dunedin school factors such as the regular highly positive student ratings of the rural course, the active involvement of other disciplines into the rural run by the rural faculty, and a positive contribution by rural faculty to medical school education processes are all likely to have played a part . It is possible that unrelated factors such as turnover in faculty may account for some perceived changes in attitude but unlikely that this change would be confined to a single school . We do not know how the status of rural health compares with other specialties . Ideally . This would be the most professional approach for a school to promote actively and openly amongst faculty, rather than the hidden curriculum effect and its mixed messages . The attitudes of medical school faculty towards a particular discipline have been shown to affect the career intentions of medical students [19, 20, 25, 26] in both positive and negative ways . Thus the increase in positive perceptions of attitudes of faculty at dunedin by 2007 is likely to have some influence on career intentions . There were no significant differences between students' perceptions of their peers' attitudes towards rural health at the different clinical schools in 2007 which contrasts with the difference found between those students' perceptions of faculty attitudes . However there was a difference between student perceptions of peers in 2007 from 2000/2001, with the precourse figures for 2007 being similar to postcourse figures for the original cohort (tables 1 and 2). This somewhat unexpected finding across the three schools in 2007 may in part be explained by the fact that all students at otago medical school spend their first two preclinical years at dunedin before they disperse to their clinical schools in dunedin, christchurch, and wellington providing some homogeneity of experience of the student group at the school shown to have a change in perceptions of faculty attitudes . Alternatively there may be factors external to the school environment which resulted in the findings amongst the student group, though one would expect such factors to also influence faculty . Many students formulate broad career intentions by entry to medical school or early in their undergraduate years . These career intentions have been shown to predict choice of practice [27, 28] which lends importance to factors which contribute to that early influence such as status or prestige . The relevance is highlighted by findings that 45% of students adhere to their broad career preference indicated at entry to medical school and that the most powerful predictors of a rural place of practice are rural origin combined with an intention to practice as a generalist on entry to medical school . Prestige is known to be a more significant consideration for males, students of higher socioeconomic parents, and students of asian origin [3032]. Some medical disciplines have greater status than others both within the profession and the general population . Lower status within the profession may be associated with increased difficulties in recruiting staff with possible reduction in quality as competition decreases . So arguably, raising the profile, status, or prestige of rural health as a discipline may affirmatively influence career preference of medical undergraduates from an early stage either on entry or during medical school years [34, 35]. This may assume increasing importance in new zealand given the high proportion of asian origin medical students relative to the population [36, 37]. There is a potential value in increased recognition of rural health as a discipline, unrelated to workforce numbers . This may be reflected by an increase in respect for rural health practitioners and an understanding of their work place challenges from urban doctors and medical specialists . This should lead to improved communication and teamwork with benefits for patient care . Achieving a balance in the curriculum between educational and workforce needs however it has been shown that quality of education does not necessarily decrease with a change in context from the traditional tertiary teaching hospital [38, 39]. Rural educational placement and affirmative rural origin entry policies may well change the student profile favourably for rural health, without compromising academic standards . An overall increase in medical school entry a strength of this study is that we are able to compare findings across schools and also with an earlier student cohort . Although all fifth year students at the otago university's medical schools were involved, the numbers are still relatively small, so the study does not have the power to detect subtle changes . In addition there may be changes in the student population related to factors such as change in entry criteria, so an assumption of homogeneity between 2000/2001 groups and 2007 is not necessarily valid though the proportion of rural origin students is similar . The ideal would be to utilize two parallel cohorts with baseline and follow - up measurements in both . There will always be a limit to the number and proportion of students who choose rural health as a career path . Increasing efforts to raise this proportion will inevitably have decreasing returns in terms of graduates actually in rural practice . Students' perceptions of attitudes of faculty within a medical school towards rural health may be changed positively as a result of the introduction of a rural health placement to the curriculum . These changes are important and add to the effort at undergraduate level to increase rural workforce numbers . Further research is required to identify features of rural health placements leading to such changes before these findings can be generalised.
|
A 6-year - old, 25 kg boy was scheduled for strabismus surgery in both eyes . Neither the patient nor his family had any history of neuromuscular disease or a special family history . The preoperative vital signs were blood pressure: 90/50 mmhg, heart rate: 92 beats / min, respiratory rate: 24/min and axillary temperature: 36.4. the patient received ketamine 50 mg iv for sedation before induction in the waiting room . Anesthesia was induced with sevoflurane 2.5 vol% by mask ventilation in a mixture of nitrous oxide and oxygen (fio2 0.5). About 2 min after injection of rocuronium bromide, a size 5.0 cuffed endotracheal tube was inserted without any difficulty under direct laryngoscopy . Then 1 min after intubation, the heart rate of patient was increased from 160 to 195 beats / min . At first, the tachycardia was considered to be due to stimulation by the tracheal intubation, but the end tidal carbon dioxide concentration (etco2) was concurrently increased from 35 to 65 mmhg within 5 min . The patient was hyperventilated with 100% o2 through a new anesthetic circuit, and consequently the etco2 was decreased to 45 mmhg . The patient was administered midazolam 1 mg and sufentanyl 15 g intravenously for sedation after discontinuing the sevoflurane and we started propofol infusion as maintenance because propofol is known to be a safe anesthetic agent in patients with mh . For decreasing the body temperature, active cooling was immediately initiated by ice water massage and applying ice packs on the chest, back and axillary area . Arterial cannulation was done to continuously monitor the blood pressure and for the arterial blood gas analysis . This was done via external jugular cannulation for rapid infusion of cold iv fluid and central administration of drugs for resuscitation if it was need, and we placed a foley catheter for checking the hour urine output . The arterial blood gas analysis was ph: 7.294, paco2: 41.2 mmhg, pao2: 435.2 mmhg and the base excess: -10.1 thirty minutes min after anesthetic induction, the patient showed an oral temperature of 38, a pulse of 160 beats / min, a blood pressure of 140/70 and we detected newly occurring ventricular premature beats (4 - 5/min) on the echocardiogram . But we didn't have dantrolene, so we requested dantrolene from the korea orphan drug center . Approximately 90 min after the onset of mh, the patient recovered consciousness and the tracheal tube was extubated . The patient showed an oral temperature of 37.5, a heart rate of 140 beats / min and a blood pressure of 140/80 mmhg, and he maintained the ventricular premature beats (4 - 5/min). The arterial blood gas analysis showed a ph of 7.390, a paco2 of 38.0 mmhg, a pao2 of 89.5 mmhg and a base excess of -2.5 mm / l . Thereafter, the arrhythmia disappeared, and the patient maintained an oral temperature of 36.5 - 37.4 and a normal blood pressure and heart rate . But about 2 h after the administration of dantrolene, the patient again showed arrhythmia (ventricular premature beats) and an increased oral temperature of 38, a blood pressure of 130/100 mmhg and a heart rate of 130 beats / min . After the second administration of dantrolene, the arrhythmia, oral temperature, heart rate and blood pressure were all normalized, and the laboratory data and arterial blood gas analysis were normalized 2 days after anesthesia induction . The patient was discharged from the hospital four days after the onset of mh without any problem . Many early signs of a mh episode can present in various ways and mh may be confused with other medical conditions such as an insufficient depth of anesthesia, hypoxia, hypercarbia, thyrotoxicosis, pheochromocytoma and neuroleptic malignant syndrome . A clinical grading scale helps to establish the likelihood of mh in specific problematic cases . It is based on weighted scores for muscle tone, muscle breakdown, acid - base parameters, temperature, tachycardia or other arrhythmias, and the response to dantrolene . We were able to diagnose mh on the basis of the clinical symptoms and the clinical grading scale by larach et al . . According to this clinical grading scale, when the raw score range is 35 - 48, the mh rank is 5 and the likelihood of mh is high . The patient in this case received the score of 43 because the petco2 was> 55 mmhg with appropriately controlled ventilation (15 points), there was an inappropriately rapid increase in temperature (15 points), inappropriate sinus tachycardia (3 points) and an arterial base excess more negative than -8 meq / l (10 points). In this case, we used ketamine, sevoflurane, n2o and rocuronium bromide during induction . Ketamine and n2o are not triggers for mh [6 - 8] and rocuronium bromide, which is a non - depolarizing muscle relaxant, is also safe for mh . Since shulman et al . First reported that sevoflurane triggers mh in mh - susceptible swine, there have been some reports of mh during sevoflurane anesthesia in human . Generally, sevoflurane and desflurane have been reported to be less potent triggers, they produce a more gradual onset of mh and the onset of mh with sevoflurane in humans has been reported to occur both at an early period and after prolonged anesthesia . Kinouchi et al . Reported mh emerged about 30 minutes after anesthetic induction with sevoflurane in 4-year - old girl who was without a family history of mh and the preoperative laboratory studies did not suggest she was susceptible to mh . Reported that mh emerged about 20 minutes after anesthetic induction with sevoflurane in a 56-year - old man who was undergoing cardiopulmonary bypass and moderate hypothermia . . Reported that mh emerged about 150 minutes after general anesthesia with sevoflurane in a 24-year - old man who was undergoing bilateral sagittal split ramus osteotomy . As compared with the other case reports, our patient's etco2 and body temperature were increased simultaneously within 5 minutes after anesthetic induction with sevoflurane . We know that the time of onset of a fulminant episode of mh is unpredictable, and it can vary from within minutes to within several hours of induction, and the fulminant mh episodes are apparently the result of a rapid, sustained rise in myoplasmic ca . However, we could not determine the reason for the rapid onset of mh in this case . During the preoperative evaluation, our attention was drawn to the patient' strabismus, and strabismus has been observed in mh susceptible patients . However, neither the family history nor the preoperative laboratory studies suggested the patient was susceptible to mh the halothane and caffeine contracture tests are bioassays and they currently remain the most reliable indicators, but they are not generally used in our country, and so a diagnostic contracture test was not performed . This case report demonstrates that sevoflurane can trigger mh within few minutes after exposure and so the patients who are susceptible to mh must be carefully monitored even during anesthetic induction.
|
The us food and drug administration (fda) adverse event reporting system (faers, formerly aers) is a database that contains information on adverse event and medication error reports submitted to the fda 1 - 3 . Besides those from manufacturers the faers structure adheres to the international safety reporting guidance issued by the international conference on harmonisation, ich e2b, and adverse events are coded to terms in the medical dictionary for regulatory activities (meddra) terminology 4 . The original system was initiated in 1969; however, reporting markedly increased following the last major revision in 1997 5, 6 . To date, the faers contains more than 4 million reports and is the largest repository of spontaneously reported adverse events in the world 5, 6 . The fda releases data to the general public, and this has allowed us to conduct pharmacoepidemiological studies and/or pharmacovigilance analyses . Data mining algorithms have been developed for the quantitative detection of signals 7 - 11 . A signal indicates an association between a drug and an adverse event or drug - associated adverse event, including the proportional reporting ratio (prr) 12, reporting odds ratio (ror) 13, information component (ic) given by a bayesian confidence propagation neural network 14, and empirical bayes geometric mean (ebgm) 15 . Associations with adverse events of interests were previously analyzed for 16 drugs using reports in the faers database between 2004 and 2009 16 - 22 . Whether an adverse event is detected as a signal has been shown to depend on the algorithms; however, of the 4 methods, the ror method provided the highest number of signals, while the ebgm method provided the lowest 23 . In the present study, the commonality of prr-, ror-, ic-, and data were retrieved from the public release of the faers database from the first quarter of 2004 through to the end of 2009 . Duplicated reports were deleted and arbitrary drug names were revised, resulting in a reduction in the number of reports from 2,231,029 to 1,644,220 . Signal scores, i.e., the prr, ror, ic, and ebgm values, were calculated for 16 unrelated drugs to assess associations with adverse events, including 2 antimicrobials (colistin and tigecycline), 4 hmg - coa reductase inhibitors (statins) (pravastatin, simvastatin, atorvastatin, and rosuvastatin), 2 proton pump inhibitors (ppis) (omeprazole and esomeprazole), warfarin, 2 antiplatelets (aspirin and clopidogrel), and 5 anticancer agents (cisplatin, carboplatin, oxaliplatin, 5-fluorouracil, and capecitabine). It is noted that the associations of these drugs with adverse events have already been published 16 - 22 . The unpaired student's t - test / welch's test or mann - whitney's u test was used for two - group comparisons of the values . Figure 1 shows the relationship among the prr-, ror-, ic-, and ebgm - based signals, which was commonly observed for all 16 drugs . All ebgm - based signals were included in the prr - based signals as well as ic- or ror - based ones . The prr- and ic - based signals were included in the ror - based ones . Therefore, ror - based signals could be stratified into 5 groups; signals detected by the ror only, signals detected by the ror and prr, signals detected by the ror and ic, signals detected by the ror, prr, and ic, and signals detected by the 4 methods . Table 1 lists the numbers of signals in the 5 groups . The ratio of the total number of ebgm - based signals to that of signals detected by the ror only varied from 3.9% with omeprazole to 57.3% with oxaliplatin . The ratio of the total number of ebgm - based signals to that of ror - based signals varied from 1.7% with omeprazole to 20.5% with oxaliplatin . Table 2 lists the prr scores of prr - based signals . Since prr - based signals could be divided into 2 groups based on whether adverse events were also detected as signals by the ebgm method (figure 1), the effects of additional detection by the ebgm method on prr scores was examined . As shown in table 2, the scores were significantly larger for 15 of 16 drugs when adverse events were also detected as signals by the ebgm method . The effects of additional detection by the ebgm method found for prr scores were not observed for the ror, whereas the ic scores of ic - based signals were the same as the prr scores of prr - based signals . Several studies previously compared data mining algorithms 13, 24 - 29; however, as bate and evans recently concluded 7, different algorithms have slightly different properties such that one may consequently be preferable in a particular application . If used for pharmacovigilance, data mining algorithms should be assessed from the standpoint of early and timely signal detection 30 - 33 . Recently compared the timing of early signal detection with prr, ror, ic, and ebgm using the faers database, and concluded that the ror performed better 30 . We previously reported that the ror method provided the highest number of signals, while the ebgm method provided the lowest 23 . The difference in the number of signals can be attributed to a higher rate of false positives or lower ability to detect signals . In the present study, the ebgm method was shown to be the most conservative among the 4 methods, which suggested that it was suitable for pharmacoepidemiological studies . In contrast, the ror method was shown to be the most comprehensive, indicating its usefulness for pharmacovigilance . These 4 data mining algorithms were used in our previous studies 16 - 22, and adverse events were listed as drug - associated, when at least 1 of the 4 indices met the criteria . However, the results shown in figure 1 demonstrated that lists of adverse events were only identical when the ror method was applied, which suggested that care should be taken in interpreting data when signals are not detected by the ebgm method . Based on the number of signals, 16 drugs could be classified into 4 groups . Group 1 included 2 antimicrobials, which were characterized by the lower number of signals . The total number of co - occurrences with colistin was only 1,491, and 1,906 for tigecycline . These were markedly less than those of the other 14 drugs; from 33,197 with oxaliplatin to 220,194 with atorvastatin . The lower number of signals can be explained by comparatively infrequent use, and, therefore, a smaller number of reports in the database . Group 2 included 4 statins and 2 ppis characterized by a lower number of ebgm - based signals, and group 3 included warfarin and 2 antiplatelets by a higher number of ebgm - based signals . Group 4 included 5 anticancer agents characterized by a much higher number of ebgm - based signals . The total number of ror - based signals was similar among drugs in groups 2 - 4; from 619 with rosuvastatin to 884 with cisplatin . The ror method is feasible for detecting more signals, including false positives, than the ebgm method . The difference observed in the ratio of ebgm - based to ror - based signals may reflect whether adverse events are generally found . A pilot study performed by hochberg et al . In 2009 concerning drug - versus - drug comparisons revealed that the rank - order of adverse event rates in the faers database was consistent with the results of published studies 34, which encouraged the use of the database for comparisons . In other investigations, the number of reports with or without normalization by usage or sales during the corresponding period was used to compare drugs 35; however, adverse events are underreported, which may lead to incorrect conclusions 36 - 38 . Signal scores have also been considered inappropriate for determining the rank - order of drugs in terms of risk; however, few studies have been published to date . In the present study, the ebgm method was shown to be the most conservative among the 4 methods; therefore, it is important to confirm whether this method can provide important information similar to that in well - organized clinical studies.
|
Lower frequency of sleep disturbances during the run - in period and absence of daytime and nighttime reflux symptoms during treatment were associated with a greater likelihood of resolution of reflux - related sleep disturbances in the total population.treatment with esomeprazole 20 mg was a significant predictor of sleep disturbance resolution compared with placebo.the therapeutic benefit of esomeprazole 20 mg over placebo progressively increased as the frequency of run - in sleep disturbances increased . The impact of nighttime heartburn is highlighted by the fact that approximately 5075% of individuals with heartburn experience nocturnal reflux episodes that can cause awakening [1, 2]. In fact, sleep disturbance is particularly common among individuals with frequent heartburn [16]. Those who experience nocturnal symptoms are more likely to have sleep disruptions, and the associated adverse consequences, than those who experience only daytime symptoms [7, 8]. Sleep disturbances associated with reflux symptoms can lead to daytime fatigue, as well as significant impairments in the performance of daily life activities, work productivity, mood, and overall health - related quality of life of the patients [1, 2, 5, 6, 9]. Emerging evidence from clinical and non - clinical studies supports a relationship among sleep, immune function, and inflammation . Sleep is believed to have a protective role, and conversely, decreased or dysfunctional / fragmented sleep is associated with increased levels of pro - inflammatory cytokines and greater susceptibility to infection . Given the importance of sleep disturbance in individuals with nighttime heartburn, it is important to understand clinical factors that are predictive of resolution / relief of sleep disturbances . Esomeprazole is a well - established proton - pump inhibitor (ppi) that has been recently approved in the usa and eu as an over - the - counter (otc) medication for short - term treatment (up to 14 days) of reflux symptoms such as heartburn and acid regurgitation [12, 13]. Results from two similarly designed, randomized, double - blind, placebo - controlled trials have previously shown that 4 weeks of esomeprazole treatment was significantly effective in relieving nighttime heartburn and improving sleep quality and work productivity [14, 15]. The population enrolled in these trials was selected based on the occurrence of frequent nighttime heartburn or acid regurgitation and sleep disturbance caused by these symptoms . These trials, therefore, are important to our understanding of the role of ppi treatment in the management of nighttime heartburn and its consequences, in particular, the significant negative impact of sleep disruptions in those experiencing reflux symptoms . Since information in the literature is lacking in this area, particularly in the otc ppi arena, exploring these issues may help guide healthcare professionals in their counseling of patients who suffer from heartburn - related sleep disturbances in order to establish appropriate expectations for response to treatment . Accordingly, the current analysis sought to identify predictive factors from these two trials that are associated with the complete resolution of sleep disturbance due to heartburn or other reflux symptoms in subjects with frequent nighttime heartburn or acid regurgitation and sleep disturbance related to these symptoms [14, 15]. These analyses focus on outcomes with esomeprazole 20 mg from the first 14 days to align with the dose and duration approved for otc use . Data were derived from two identical, multicenter, double - blind, placebo - controlled studies conducted in the usa (clinicaltrials.gov, numbers nct00628342 and nct00660660). The conduct of and the primary results from these studies at 4 weeks have been described previously [14, 15]. Written informed consent was obtained from all subjects, the studies were conducted in accordance with the declaration of helsinki, and each study was approved by local institutional review boards . The populations for both studies were male and female subjects aged 1885 years with histories of frequent nighttime heartburn (defined as an average of 2 times per week), histories of heartburn or acid regurgitation for 3 months or any history of erosive esophagitis, and histories of sleep disturbance associated with heartburn or other symptoms of gastroesophageal reflux for 1 month . At the screening assessment, eligible subjects were enrolled in a 7- to 15-day run - in period, during which they recorded the severity of episodes of daytime or nighttime heartburn or other gastroesophageal reflux disease (gerd) symptoms (none, mild, moderate, severe), as well as the occurrence of sleep disturbance related to gerd symptoms (yes or no) on a daily diary card . Subjects were required to have sleep disturbance associated with gerd and documented moderate - to - severe nighttime heartburn during 3 of the last 7 days of the run - in period . Sleep disturbance included, but was not limited to, trouble falling asleep, unwanted awakenings, or overall poor sleep quality . Exclusion criteria included presence of, or treatment for, conditions other than reflux that may contribute to sleep disturbance or compromise study procedures, including shift work between 12 am (midnight) and 6 am and plans to travel beyond three time zones during the course of the study; use of ppis; and drug or alcohol abuse within the past 12 months . Subjects in the original studies were treated with esomeprazole 20 mg (both trials), esomeprazole 40 mg (study 1 only), or placebo, all administered once daily in the morning before breakfast for 4 weeks . Esomeprazole 20 mg was taken orally and administered as 22.3 mg esomeprazole magnesium trihydrate (nexium; astrazeneca lp, wilmington, de, usa). For the purposes of this analysis only, esomeprazole 20 mg data from the first 14 days were utilized, which is consistent with the approved otc dosage and duration for ppis . The only medication allowed for treatment of heartburn during the run - in period was the assigned rescue medication: gelusil (alumina, magnesia, and simethicone; wellspring pharmaceutical corp, sarasota, fl, usa). Gelusil tablets were also permitted as rescue medication for heartburn during the treatment phase (up to 6 per 24-h period). The focus of the analysis presented here was on data collected during the first 14 days on study treatment . The a priori - defined primary endpoint of the 2 studies was relief of nighttime heartburn during the last 7 days of the 28-day treatment period . Although analyses at the 14-day time point were predefined in the studies statistical plans for most outcomes, post hoc analyses were required for the data reported here . All subjects attended follow - up visits 2 and 4 weeks after the start of randomized treatment . The occurrence of reflux - related sleep disturbance and severity of heartburn episodes were recorded by subjects in a daily self - assessment diary . Key endpoints of interest for the analysis presented here were complete resolution (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as no reflux - related sleep disturbance on 7 consecutive days), complete relief (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as reflux - related sleep disturbance on 1 of 7 consecutive days), and relief (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as reflux - related sleep disturbance on 2 of 7 days). Efficacy analyses were performed on a modified intention - to - treat population, which included all randomized subjects who took at least one dose of study medication and had post - treatment data . Logistic regression analyses were performed to identify predictors of the various sleep disturbance outcomes of interest following treatment with esomeprazole 20 mg or placebo through day 14 . The three endpoints were analyzed separately using a stepwise logistic regression model incorporating different variables, including treatment group assignment (esomeprazole vs. placebo), study, site, age, gender, frequency of sleep disturbance reported during the run - in period, and the occurrence (yes / no) of 24-h, daytime, and nighttime heartburn, defined as 1 episode during the 14-day treatment period . A number of models were developed for each endpoint, and results of the models with the best fit according to deviance and akaike information criteria are reported . The level of significance for variables to remain in the final model was set at 0.2 . However, variables were only considered important predictors if they were significant at the 0.05 level . Some models were generated by including and excluding the occurrence of heartburn during treatment to ensure that this factor would not impact the identification of major risk factors . Sleep disturbance frequency during the run - in period was evaluated as both a continuous and categorical variable in the different models . Body mass index (bmi) data were available for only study 2; therefore, a separate analysis was conducted of study 2 alone that took bmi into account, both as a continuous and categorical variable . The populations for both studies were male and female subjects aged 1885 years with histories of frequent nighttime heartburn (defined as an average of 2 times per week), histories of heartburn or acid regurgitation for 3 months or any history of erosive esophagitis, and histories of sleep disturbance associated with heartburn or other symptoms of gastroesophageal reflux for 1 month . At the screening assessment, eligible subjects were enrolled in a 7- to 15-day run - in period, during which they recorded the severity of episodes of daytime or nighttime heartburn or other gastroesophageal reflux disease (gerd) symptoms (none, mild, moderate, severe), as well as the occurrence of sleep disturbance related to gerd symptoms (yes or no) on a daily diary card . Subjects were required to have sleep disturbance associated with gerd and documented moderate - to - severe nighttime heartburn during 3 of the last 7 days of the run - in period . Sleep disturbance included, but was not limited to, trouble falling asleep, unwanted awakenings, or overall poor sleep quality . Exclusion criteria included presence of, or treatment for, conditions other than reflux that may contribute to sleep disturbance or compromise study procedures, including shift work between 12 am (midnight) and 6 am and plans to travel beyond three time zones during the course of the study; use of ppis; and drug or alcohol abuse within the past 12 months . Subjects in the original studies were treated with esomeprazole 20 mg (both trials), esomeprazole 40 mg (study 1 only), or placebo, all administered once daily in the morning before breakfast for 4 weeks . Esomeprazole 20 mg was taken orally and administered as 22.3 mg esomeprazole magnesium trihydrate (nexium; astrazeneca lp, wilmington, de, usa). For the purposes of this analysis only, esomeprazole 20 mg data from the first 14 days were utilized, which is consistent with the approved otc dosage and duration for ppis . The only medication allowed for treatment of heartburn during the run - in period was the assigned rescue medication: gelusil (alumina, magnesia, and simethicone; wellspring pharmaceutical corp, sarasota, fl, usa). Gelusil tablets were also permitted as rescue medication for heartburn during the treatment phase (up to 6 per 24-h period). The focus of the analysis presented here was on data collected during the first 14 days on study treatment . The a priori - defined primary endpoint of the 2 studies was relief of nighttime heartburn during the last 7 days of the 28-day treatment period . Although analyses at the 14-day time point were predefined in the studies statistical plans for most outcomes, post hoc analyses were required for the data reported here . All subjects attended follow - up visits 2 and 4 weeks after the start of randomized treatment . The occurrence of reflux - related sleep disturbance and severity of heartburn episodes were recorded by subjects in a daily self - assessment diary . Key endpoints of interest for the analysis presented here were complete resolution (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as no reflux - related sleep disturbance on 7 consecutive days), complete relief (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as reflux - related sleep disturbance on 1 of 7 consecutive days), and relief (yes or no) of sleep disturbance due to heartburn or other symptoms of gastroesophageal reflux (defined as reflux - related sleep disturbance on 2 of 7 days). Efficacy analyses were performed on a modified intention - to - treat population, which included all randomized subjects who took at least one dose of study medication and had post - treatment data . Logistic regression analyses were performed to identify predictors of the various sleep disturbance outcomes of interest following treatment with esomeprazole 20 mg or placebo through day 14 . The three endpoints were analyzed separately using a stepwise logistic regression model incorporating different variables, including treatment group assignment (esomeprazole vs. placebo), study, site, age, gender, frequency of sleep disturbance reported during the run - in period, and the occurrence (yes / no) of 24-h, daytime, and nighttime heartburn, defined as 1 episode during the 14-day treatment period . A number of models were developed for each endpoint, and results of the models with the best fit according to deviance and akaike information criteria are reported . The level of significance for variables to remain in the final model was set at 0.2 . However, variables were only considered important predictors if they were significant at the 0.05 level . Some models were generated by including and excluding the occurrence of heartburn during treatment to ensure that this factor would not impact the identification of major risk factors . Sleep disturbance frequency during the run - in period was evaluated as both a continuous and categorical variable in the different models . Body mass index (bmi) data were available for only study 2; therefore, a separate analysis was conducted of study 2 alone that took bmi into account, both as a continuous and categorical variable . Table 1 shows baseline characteristics of subjects enrolled in the two studies [14, 15], as well as the pooled dataset, which included 703 subjects from the two studies (esomeprazole 20 mg: n = 357; placebo: n = 346). Subjects were predominately white females with a mean age of approximately 47 years.table 1baseline characteristics of study populationcharacteristicstudy 1 study 2 pooled dataeso 20 mg (n = 220)placebo (n = 221)eso 20 mg (n = 137)placebo (n = 125)eso 20 mg (n = 357)placebo (n = 346)age (years), mean (sd)46.8 (14.0)46.5 (13.6)47.0 (11.7)46.8 (12.9)46.9 (13.1)46.6 (13.3)female, n (%) 132 (60.0)131 (59.3)89 (65.0)85 (68.0)221 (61.9)216 (62.4)male, n (%) 88 (40.0)90 (40.7)48 (35.0)40 (32.0)136 (38.1)130 (37.6)race, n (%) white / caucasian190 (86.4)186 (84.2)105 (76.6)104 (83.2)295 (82.6)290 (83.8) black / african american16 (7.3)17 (7.7)25 (18.2)13 (10.4)41 (11.5)30 (8.7) other14 (6.4)18 (8.1)7 (5.1)8 (6.4)21 (5.9)26 (7.5)bmi (kg / m), mean (sd)30.3 (6.9)30.9 (7.4)run - in sleep disturbance, n (%) 3 days74 (33.6)63 (28.5)48 (35.0)35 (28.0)122 (34.2)98 (28.3) 45 days89 (40.5)84 (38.0)48 (35.0)48 (38.4)137 (38.4)132 (38.2) 67 days57 (25.9)74 (33.5)41 (29.9)42 (33.6)98 (27.5)116 (33.5) bmi body mass index, eso esomeprazole, sd standard deviation baseline characteristics of study population bmi body mass index, eso esomeprazole, sd standard deviation in the best - fit logistic regression model of complete resolution of sleep disturbance due to heartburn or other reflux symptoms, treatment with esomeprazole 20 mg [adjusted odds ratio (or) 2.39; 95% confidence interval (ci) 1.703.36; p <0.0001], absence of daytime heartburn during treatment (adjusted or 3.50; 95% ci 1.597.69; p = 0.0018), and absence of nighttime heartburn during treatment (adjusted or 12.07; 95% ci 3.5341.22; p <0.0001) were found to be significant positive predictors of complete resolution in the overall population (i.e. Those receiving esomeprazole 20 mg or placebo) at 14 days (table 2), while subjects with higher frequency of sleep disturbance during the run - in period were less likely to have complete resolution of symptoms in the total population (adjusted or 0.80; 95% ci 0.720.89; p <0.0001). The frequency of sleep disturbance during the run - in period was a statistically significant predictor when analyzed as both a continuous (p <0.0001) and a categorical (p = 0.0001) variable.table 2predictors of sleep disturbance endpoints due to heartburn or other reflux symptoms at 14 days: final modellogistic regression analysis factorcomplete resolution odds ratio (95% ci); p valuecomplete relief odds ratio (95% ci); p valuerelief odds ratio (95% ci); p valuetreatmentesomeprazole 20 mg vs. placebo2.39 (1.703.36)<0.00012.28 (1.563.32)<0.00012.19 (1.483.24)<0.0001age for every 1-year increase in age1.01 (1.001.03)0.0680not kept in the modelnot kept in the modelgenderfemale vs. malenot kept in the model0.77 (0.521.12) 0.1752not kept in the modelsleep disturbance frequency, run - in for every 1-day increase in frequency0.80 (0.720.89)<0.00010.58 (0.520.66)<0.00010.56 (0.490.64)<0.0001daytime heartburn during treatment no vs. yes3.50 (1.597.69)0.00182.66 (0.937.63)0.06782.38 (0.826.90)0.1108nighttime heartburn during treatment no vs. yes12.07 (3.5341.22)<0.00014.96 (1.0822.84) 0.04004.40 (0.9420.54)0.0595 ci confidence interval defined as no sleep disturbance due to heartburn or other reflux symptoms on 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 1 of 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 2 of 7 consecutive days continuous variable presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period predictors of sleep disturbance endpoints due to heartburn or other reflux symptoms at 14 days: final model ci confidence interval defined as no sleep disturbance due to heartburn or other reflux symptoms on 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 1 of 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 2 of 7 consecutive days presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period a greater proportion of subjects treated with esomeprazole 20 mg experienced complete resolution of sleep disturbance due to heartburn or other reflux symptoms over 14 days of treatment compared with placebo, regardless of the frequency of sleep disturbance during the run - in period (fig . 1). As the frequency of run - in sleep disturbance increased, the rates of complete resolution of sleep disturbance progressively decreased in all subjects (as would be expected), while the relative difference between esomeprazole and placebo increased in favor of esomeprazole in a stepwise manner . A separate analysis was conducted for complete resolution where the interaction between run - in sleep disturbance frequency and treatment effect was added to the model, and a significant effect was observed for the interaction (p = 0.0231), confirming a greater therapeutic benefit with esomeprazole in the subgroups with higher levels of run - in symptom frequency.fig . 1effect of run - in frequency of sleep disturbance on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days . * p <0.0001 effect of run - in frequency of sleep disturbance on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days . * p <0.0001 subjects in both treatment groups without any episodes of daytime or nighttime heartburn during the 14-day treatment period had higher rates of complete resolution of sleep disturbance due to heartburn or other reflux symptoms compared with those who continued to have one or more episodes of heartburn during the treatment period (fig . 2).fig . 2effect of the presence / absence of daytime and nighttime heartburn on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days (presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period) effect of the presence / absence of daytime and nighttime heartburn on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days (presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period) consistent with the analyses of complete resolution, in the best - fit logistic regression model, treatment with esomeprazole 20 mg compared with placebo and run - in sleep disturbance frequency were found to be significantly important predictors of complete relief (treatment group assignment: adjusted or 2.28; 95% ci 1.563.32; p <0.0001; run - in sleep disturbance frequency: adjusted or 0.58; 95% ci 0.520.66; p <0.0001) and relief (treatment group assignment: adjusted or 2.19; 95% ci 1.483.24; p <0.0001; run - in sleep disturbance frequency: adjusted or 0.56; 95% ci 0.490.64; p <0.0001) of reflux - associated sleep disturbance . In separate analyses conducted for complete relief and relief where an interaction term was added to the model, significant treatment by run - in sleep disturbance frequency interaction was observed for complete relief (p = 0.0286) and relief (p = 0.0425), suggesting that the therapeutic effect of esomeprazole over placebo on these outcomes was greater in those with higher frequency of run - in symptoms . Also consistent with complete resolution, absence of nighttime heartburn during treatment was significantly predictive of complete relief (adjusted or 4.96; 95% ci 1.0822.84; p = 0.0400) and was borderline significantly predictive for relief (adjusted or 4.40; 95% ci 0.9420.54; p = 0.0595). Daytime heartburn during treatment was a borderline significant predictor (adjusted or 2.66; 95% ci 0.937.63; p = 0.0678), and gender was found not to be significantly predictive (adjusted or 0.77; 95% ci 0.521.12; p = 0.1752) of complete relief; gender was not analyzed for relief of sleep disturbances . Separate logistic regression analyses of study 2 were conducted to examine the impact of baseline bmi . Bmi as either a continuous or categorical variable was not an important predictor of outcome in any of the models . Table 1 shows baseline characteristics of subjects enrolled in the two studies [14, 15], as well as the pooled dataset, which included 703 subjects from the two studies (esomeprazole 20 mg: n = 357; placebo: n = 346). Subjects were predominately white females with a mean age of approximately 47 years.table 1baseline characteristics of study populationcharacteristicstudy 1 study 2 pooled dataeso 20 mg (n = 220)placebo (n = 221)eso 20 mg (n = 137)placebo (n = 125)eso 20 mg (n = 357)placebo (n = 346)age (years), mean (sd)46.8 (14.0)46.5 (13.6)47.0 (11.7)46.8 (12.9)46.9 (13.1)46.6 (13.3)female, n (%) 132 (60.0)131 (59.3)89 (65.0)85 (68.0)221 (61.9)216 (62.4)male, n (%) 88 (40.0)90 (40.7)48 (35.0)40 (32.0)136 (38.1)130 (37.6)race, n (%) white / caucasian190 (86.4)186 (84.2)105 (76.6)104 (83.2)295 (82.6)290 (83.8) black / african american16 (7.3)17 (7.7)25 (18.2)13 (10.4)41 (11.5)30 (8.7) other14 (6.4)18 (8.1)7 (5.1)8 (6.4)21 (5.9)26 (7.5)bmi (kg / m), mean (sd)30.3 (6.9)30.9 (7.4)run - in sleep disturbance, n (%) 3 days74 (33.6)63 (28.5)48 (35.0)35 (28.0)122 (34.2)98 (28.3) 45 days89 (40.5)84 (38.0)48 (35.0)48 (38.4)137 (38.4)132 (38.2) 67 days57 (25.9)74 (33.5)41 (29.9)42 (33.6)98 (27.5)116 (33.5) bmi body mass index, eso esomeprazole, sd standard deviation baseline characteristics of study population bmi body mass index, eso esomeprazole, sd standard deviation in the best - fit logistic regression model of complete resolution of sleep disturbance due to heartburn or other reflux symptoms, treatment with esomeprazole 20 mg [adjusted odds ratio (or) 2.39; 95% confidence interval (ci) 1.703.36; p <0.0001], absence of daytime heartburn during treatment (adjusted or 3.50; 95% ci 1.597.69; p = 0.0018), and absence of nighttime heartburn during treatment (adjusted or 12.07; 95% ci 3.5341.22; p <0.0001) were found to be significant positive predictors of complete resolution in the overall population (i.e. Those receiving esomeprazole 20 mg or placebo) at 14 days (table 2), while subjects with higher frequency of sleep disturbance during the run - in period were less likely to have complete resolution of symptoms in the total population (adjusted or 0.80; 95% ci 0.720.89; p <0.0001). The frequency of sleep disturbance during the run - in period was a statistically significant predictor when analyzed as both a continuous (p <0.0001) and a categorical (p = 0.0001) variable.table 2predictors of sleep disturbance endpoints due to heartburn or other reflux symptoms at 14 days: final modellogistic regression analysis factorcomplete resolution odds ratio (95% ci); p valuecomplete relief odds ratio (95% ci); p valuerelief odds ratio (95% ci); p valuetreatmentesomeprazole 20 mg vs. placebo2.39 (1.703.36)<0.00012.28 (1.563.32)<0.00012.19 (1.483.24)<0.0001age for every 1-year increase in age1.01 (1.001.03)0.0680not kept in the modelnot kept in the modelgenderfemale vs. malenot kept in the model0.77 (0.521.12) 0.1752not kept in the modelsleep disturbance frequency, run - in for every 1-day increase in frequency0.80 (0.720.89)<0.00010.58 (0.520.66)<0.00010.56 (0.490.64)<0.0001daytime heartburn during treatment no vs. yes3.50 (1.597.69)0.00182.66 (0.937.63)0.06782.38 (0.826.90)0.1108nighttime heartburn during treatment no vs. yes12.07 (3.5341.22)<0.00014.96 (1.0822.84) 0.04004.40 (0.9420.54)0.0595 ci confidence interval defined as no sleep disturbance due to heartburn or other reflux symptoms on 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 1 of 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 2 of 7 consecutive days continuous variable presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period predictors of sleep disturbance endpoints due to heartburn or other reflux symptoms at 14 days: final model ci confidence interval defined as no sleep disturbance due to heartburn or other reflux symptoms on 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 1 of 7 consecutive days defined as sleep disturbance due to heartburn or other reflux symptoms on 2 of 7 consecutive days presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period a greater proportion of subjects treated with esomeprazole 20 mg experienced complete resolution of sleep disturbance due to heartburn or other reflux symptoms over 14 days of treatment compared with placebo, regardless of the frequency of sleep disturbance during the run - in period (fig . 1). As the frequency of run - in sleep disturbance increased, the rates of complete resolution of sleep disturbance progressively decreased in all subjects (as would be expected), while the relative difference between esomeprazole and placebo increased in favor of esomeprazole in a stepwise manner . A separate analysis was conducted for complete resolution where the interaction between run - in sleep disturbance frequency and treatment effect was added to the model, and a significant effect was observed for the interaction (p = 0.0231), confirming a greater therapeutic benefit with esomeprazole in the subgroups with higher levels of run - in symptom frequency.fig . 1effect of run - in frequency of sleep disturbance on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days . * p <0.0001 effect of run - in frequency of sleep disturbance on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days . * p <0.0001 subjects in both treatment groups without any episodes of daytime or nighttime heartburn during the 14-day treatment period had higher rates of complete resolution of sleep disturbance due to heartburn or other reflux symptoms compared with those who continued to have one or more episodes of heartburn during the treatment period (fig . 2effect of the presence / absence of daytime and nighttime heartburn on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days (presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period) effect of the presence / absence of daytime and nighttime heartburn on complete resolution of sleep disturbance due to heartburn or other reflux symptoms by 14 days (presence of daytime and nighttime heartburn defined as 1 episode during 14-day treatment period) consistent with the analyses of complete resolution, in the best - fit logistic regression model, treatment with esomeprazole 20 mg compared with placebo and run - in sleep disturbance frequency were found to be significantly important predictors of complete relief (treatment group assignment: adjusted or 2.28; 95% ci 1.563.32; p <0.0001; run - in sleep disturbance frequency: adjusted or 0.58; 95% ci 0.520.66; p <0.0001) and relief (treatment group assignment: adjusted or 2.19; 95% ci 1.483.24; p <0.0001; run - in sleep disturbance frequency: adjusted or 0.56; 95% ci 0.490.64; p <0.0001) of reflux - associated sleep disturbance . In separate analyses conducted for complete relief and relief where an interaction term was added to the model, significant treatment by run - in sleep disturbance frequency interaction was observed for complete relief (p = 0.0286) and relief (p = 0.0425), suggesting that the therapeutic effect of esomeprazole over placebo on these outcomes was greater in those with higher frequency of run - in symptoms . Also consistent with complete resolution, absence of nighttime heartburn during treatment was significantly predictive of complete relief (adjusted or 4.96; 95% ci 1.0822.84; p = 0.0400) and was borderline significantly predictive for relief (adjusted or 4.40; 95% ci 0.9420.54; p = 0.0595). Daytime heartburn during treatment was a borderline significant predictor (adjusted or 2.66; 95% ci 0.937.63; p = 0.0678), and gender was found not to be significantly predictive (adjusted or 0.77; 95% ci 0.521.12; p = 0.1752) of complete relief; gender was not analyzed for relief of sleep disturbances . Separate logistic regression analyses of study 2 were conducted to examine the impact of baseline bmi . Bmi as either a continuous or categorical variable was not an important predictor of outcome in any of the models . Treatment with esomeprazole 20 mg was an important positive predictor of complete resolution of heartburn / reflux - related sleep disturbance in this analysis, while higher frequency of sleep disturbances during the run - in period was an important negative predictor of sleep disturbance resolution . Other factors that were significant predictors for some but not all endpoints of interest were the occurrence of nighttime and daytime heartburn after the start of treatment and study enrollment . Bmi, gender, age, and 24-h heartburn were not significant predictors of complete resolution, complete relief, or relief of sleep disturbance . These results are in agreement with those of a previous study by jansson et al ., who found a significant relationship between gerd and sleep problems, but found that age, gender, tobacco use, bmi, or socioeconomic status had no impact . In subjects who are likely to self - treat their reflux symptoms without consulting a healthcare provider, 14 days of treatment with esomeprazole 20 mg for frequent heartburn has been shown to be effective at improving both daytime and nighttime symptoms . Other studies have also demonstrated improvements in sleep quality following effective treatment for reflux symptoms [18, 19]. Previous analysis of the current dataset has demonstrated that esomeprazole was associated with rapid resolution and relief of sleep disturbance and improvement in sleep quality that was significantly superior to that seen with placebo; improvements were seen as early as the first night of treatment . The predictive nature of esomeprazole treatment with regard to resolution and relief of sleep disturbance after 14 days was, therefore, to be expected . However, the noticeable reduction in the likelihood of sleep disturbance resolution in those with persistent daytime and nighttime symptoms during treatment may reflect the more severe nature of these symptoms when they are experienced nocturnally [21, 22]. Importantly, guidelines for self - treating frequent heartburn with an otc ppi recommend that those with symptoms that persist following a 2-week treatment course with an otc ppi should be referred to a physician for further evaluation . It is likely that certain individuals who are experiencing persistent symptoms during ppi treatment may require a more aggressive treatment strategy that is provided under the direction of a physician to effectively manage these symptoms . The importance of understanding sleep disturbances in those experiencing reflux symptoms has been demonstrated in a number of trials . Although nocturnal acid reflux symptoms tend to occur less frequently than daytime symptoms, they are associated with longer acid - esophageal contact time, resulting in an increased risk of mucosal damage [21, 22]. Nocturnal acid reflux - related symptoms that are associated with sleep disturbances have also been linked to impaired health - related quality of life and decreased functioning and productivity the following day [1, 2, 5, 6]. In one study, the negative effect of sleep dysfunction on quality of life was surpassed only by the dimensions of eating and drinking problems and vitality . Improvement in sleep quality following ppi therapy has been demonstrated in a number of trials to date [14, 15, 18, 19]. These improvements have also been shown to correlate with improved work productivity and daily activities [14, 15]. A systematic review by tack et al . Of 19 studies suggested that decreased sleep quality due to nocturnal reflux symptoms impairs work productivity by causing daytime sleepiness, a phenomenon compounded by successive nights of poor sleep quality . Although the adverse socioeconomic impact of heartburn - related sleep disturbance has been well reported in the medical literature, these effects are likely not well recognized by the individuals or pharmacists who frequently counsel on the use of otc treatments . The adverse impact of heartburn - related sleep disturbance may be further compounded if the patient fails to recognize these events or report them when questioned about sleep efficiency by a clinician . Sleep has an amnestic effect, so patients who awaken from these acid reflux - related events may fail to recall them in the morning . In a 2000 mail survey, 130,000 individuals reported that they had signs of reflux disease and heartburn . Of these, 95% reported symptoms occurring for more than 1 year and half reported symptoms that had occurred for more than 5 years . Results of a us general population survey of 11,685 participants showed that gerd - related sleep disturbance was associated with a 5.5% increase in overall work impairment and a 10.9% increase in activity impairment . In their systematic review, tack et al . Compared the burden of disruptive gerd, defined as gerd with frequent and/or severe symptoms, with non - disruptive gerd and found that disruptive gerd was associated with sleep quality scores 1.5 times lower than those for non - disruptive gerd . Impaired sleep quality was found to be significantly associated with nocturnal and daytime reflux symptoms (p <0.05), as well as greater overall severity of symptoms (p <0.05). Additionally, nocturnal symptoms have been shown to be associated with a greater degree of impairment in health - related quality of life when compared with those with daytime symptoms only . Also reviewed the impact of gerd on work productivity among studies that utilized the work productivity and activity impairment questionnaire and found that the mean number of hours absent from work was 2.4 times higher in the disruptive gerd group compared with the non - disruptive gerd group . Similar to the impact of disruptive gerd on sleep, more - frequent and severe symptoms were associated with decreased work productivity . Interestingly, the mean number of hours absent from work due specifically to reflux symptoms was similar between those with frequent nocturnal symptoms and those with occasional to no nocturnal symptoms, suggesting that the sleep disruptions, not reflux symptoms, had the greatest impact on work productivity . These data emphasize the importance of effectively managing reflux - related sleep disturbances to alleviate the substantial burden that is observed among those experiencing these symptoms . The current analyses have important strengths that are worth noting, including the use of prospective data from randomized, placebo - controlled trials that performed comprehensive assessments of reflux symptoms and sleep - related endpoints beginning on the first day of treatment . Data from randomized, controlled trials evaluating the efficacy of otc ppis for these outcomes are limited in the literature, so these analyses provide important information about clinical factors that are related to resolution of reflux - related sleep disturbances . First, this was a retrospective analysis of two previously published trials [14, 15]. The primary endpoint for these trials was complete relief of nighttime heartburn during the last 7 days of the 4-week treatment period, whereas the current analysis evaluated outcomes during the first 2 weeks . Complete resolution and relief of sleep disturbance were not primary endpoints but rather secondary endpoints in these trials . Because outcomes related to sleep quality and work productivity were only collected at baseline and week 4, we were unable to include these measures in the current analysis . Additionally, the populations that were studied may have included some subjects with more serious conditions who would not be ideal candidates for self - management in the otc setting without any physician oversight . Specifically, the studies enrolled subjects with a history of heartburn for 3 months and/or a history of erosive esophagitis patients in whom consultation with a physician is recommended prior to initiating otc ppis . Despite this limitation, the frequent occurrence of nocturnal symptoms and sleep disturbances in this population, coupled with the fact that many individuals with gerd avoid or delay consulting a healthcare provider (with cost of prescription treatment being a potential barrier), underscore the importance of exploring this issue and understanding the response to treatment with an otc ppi . The current analysis was focused on treatment that was consistent in dose and duration with otc management of symptoms and thus did not include patients treated with esomeprazole 40 mg in study 1 of the original studies . However, given the lack of differences in the primary efficacy results between the two dosing groups in study 1, we did not anticipate that the results with the 40 mg dose would have differed in a meaningful way from those observed with the 20 mg dose . Finally, our analysis was not able to assess the likelihood of a recurrence following cessation of treatment . Future studies with similar endpoints in individuals with histories of chronic heartburn would benefit from inclusion of a post - treatment follow - up period to evaluate the risk for recurrence once the active treatment is withdrawn . In the overall population (esomeprazole- and placebo - treated subjects), increasing frequency of sleep disturbance during the run - in period and the persistence of nighttime heartburn during the 14-day treatment period were associated with a reduced likelihood of experiencing both complete resolution and complete relief of sleep disturbance due to heartburn or other reflux symptoms . However, analyses of treatment effects found that treatment with esomeprazole 20 mg was an independent and statistically significant predictor of successful outcome in all models; the odds of complete resolution, complete relief, and relief of sleep disturbance associated with reflux symptoms in subjects who received esomeprazole 20 mg were more than twice the odds of those treated with placebo . These therapeutic effects were consistent in those with or without continued daytime or nighttime heartburn during treatment . Treatment with esomeprazole was associated with greater improvement versus placebo across all categories of run - in sleep disturbance frequency . The magnitude of therapeutic benefit for esomeprazole 20 mg relative to placebo, however, was significantly greater in those with more - frequent run - in sleep disturbances . These findings suggest that individuals with a lower incidence of run - in sleep disturbance will be more likely to experience improvements in sleep disturbance whether they are treated with an active or inactive treatment . Those with a higher incidence of run - in sleep disturbance, however, may be more likely to benefit specifically from treatment with esomeprazole . For individuals experiencing nighttime heartburn and related sleep disturbance, esomeprazole is likely to have a significant clinical impact on their well - being, even among those with high levels of baseline sleep disturbance . David a. johnson, md, is a consultant to pfizer, medscape / webmd, and covidien (medtronic) and was a paid consultant to pfizer in connection with the development of this manuscript . Anne le moigne, jing li, phd, and charles pollack, md, are employees of pfizer consumer healthcare . All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 helsinki declaration and its later amendments or comparable ethical standards.
|
Hydatid disease (hd), also known as cystic echinococcosis, is caused by infection with the larval stage of echinococcus granulosus . The disease has the highest incidence in countries where sheep are raised with the help of dogs . In endemic regions, human incidence rates for hd can reach> 50/100,000 person - years, and prevalence levels as high as 5%10% may occur in parts of east africa, central asia china, argentina, and peru . The adult tapeworm, which inhabits the small intestine of dogs, produces eggs which contain the larval tapeworm (oncosphere). Intermediate hosts (sheeps and humans) become infected by accidental consumption of water or food that has been contaminated . Oncospheres penetrate the intestine and are carried through bloodstream where they are filtered out in various organs . The most common hydatid cyst sites in humans are the hepatic filter, 60%70% of cases, followed by lung and brain . Bone hydatid cyst presentation without hepatic affectation is infrequent and occurs in 0,5 - 2% of cases, half of which infest the spine . Primary involvement of the sacral spine, as in the current case, is very rare . The first case was described in 1951 . Since then, few cases have been reported in literature [table 1]. As a result, sacral hydatid cyst (shc) we document diagnosis and treatment of a patient with a primary shc and is compared with other cases published in literature . A 48-year - old woman from south mediterranean region was admitted at our center because of low back pain radiating to the left buttock . She had no improvement with analgesia and physiotherapy for a year . Neurological examination showed no motor, sensory, patellar, or achilleian reflexes deficits, and no bladder disorders . The magnetic resonance (mr) revealed a cystic lesion with cerebrospinal fluid - like signal in contact with left sacral roots extending through sacral holes reaching iliac muscle [figure 1]. The mr image suggested, as the first option, a neurogenic tumor (sacral neurofibroma or schwannoma), as the second, giant cell tumor (gct) or chordoma . After consultation with radiologists and pathologists, a computed tomography - guided biopsy was performed with an 11-gauge bone access needle . During biopsy, a greenish - yellow aspirate was obtained . Pathological study revealed hydatid cysts presence, with an inner germinal layer, surrounded by an outer layer of chitin [figure 2]. Specific enzyme - linked immunosorbent assay (elisa) serological tests proved negative . Before surgery, treatment with oral albendazole (400 mg/12 h) and praziquantel (100 mg/8 h) for 2 months was given to the patient . Magnetic resonance t2-short - tau inversion recovery . Cystic lesion with cerebrospinal fluid - like signal in contact with left sacral roots extending through sacral holes reaching iliac muscle hydatid cyst (cyst wall, inner germinal layer) (h and e, 200) surgical treatment was performed using a dual approach to the lumbosacral spine . First stage: ilium anterior approach, dissecting external oblique, internal oblique, and transversus abdominis . The cyst extended to the psoas muscle and left sacral foramens [figure 3]. During dissection of the cyst, the wall was broken and the operating field was irrigated with hypertonic saline (7.2% nacl). Ilium anterior approach, dissecting external oblique, internal oblique, and transversus abdominis after which the hydatid cyst was found after the anterior approach, the patient was prepared for the second posterior spine approach to remove the sacral root origin of the sacral cyst [figure 4]. Lumbopelvic instrumentation and bone grafting (femoral head) to fill the bone defect in the sacrum were added [figure 5]. (a) hydatid cyst (highlighted in blue) on top of the dural sac . (b) first and second left sacral roots, after removing the hydatid cyst (highlighted in black) lumbopelvic instrumentation and bone grafting (femoral head) to fill the bone defect in the sacrum (highlighted with black arrows) the patient continued treatment with albendazole (400 mg / two times a day) and praziquantel (40 mg / kg day) 3 months after surgery . At 12 months after surgery, the patient is free of symptoms and is complete autonomous for performing the basic activities of daily living . Misdiagnosis of sacral echinococcosis in mr is common [table 1]. In the present case, neurofibromas, or schwannomas, can grow through the neural foramens outward from the sacral canal, and a giant mass may form anterior to the sacrum . Reported a presacral schwannoma with purely cystic form with similar mr characteristics to a shc . On mr, benign schwannomas have smooth tumoral margins and are isointense with muscle on t1-weighted images and hyperintense on t2-weighted images . In shc, mr shows a cystic lesion with similar characteristics to cerebrospinal fluid with a thin peripheral enhancement after contrast administration . The sacral hydatid cyst (shc) capsule is best seen on t2- and proton density - weighted images . Anterior sacral meningocele is a protrusion of the meninges through a defect in the anterior aspect of the sacrum into the retroperitoneal space . This lesion is seen with equal signal intensities of cerebrospinal fluid on all mr sequences and is usually unilocular . The most common gcts site is distal femur and proximal tibia in 50%65%, but can affect sacrum in 4%9% of cases . The mr t2-weighted images show a heterogeneous high signal with areas of low - signal intensity (variable) due to hemosiderin or fibrosis . The sacrum is the most common location, accounting for approximately 30%50% of all chordomas . Because chordomas lie in bone, they are usually extradural and induce bone destruction . In the mr, destructive lytic lesion with expansile soft - tissue mass can help distinguish chordoma from shc . Puncture of the cyst could cause the migration of parasites to the bloodstream causing an anaphylactic shock; hence, the assistance of an anesthesiologist during biopsy is recommended . The indirect hemagglutination test and the elisa serology is 80%100% sensitive and 88%96% specific for liver cyst infection, but less sensitive for lung involvement (50%56%) or other organs (25%56%). In the present case, other tests, such as immunodiffusion and immunoelectrophoresis, provide specific confirmation after a positive elisa serology, and they were not used in this patient . Although medical treatment can decrease the size of cysts, the definitive treatment is complete surgical removal of the cyst . There are several antiparasitic treatment alternatives; however, the most effective therapy appears to be the combination of albendazole + praziquantel rather than albendazole alone . In patients originating from endemic areas of hd, with chronic low back pain and an sacral mr suggestive of neurogenic tumor, meningocele, chordoma, or gct, sacral spinal hd should be considered in the differential diagnosis.
|
However, cost, difficulty of implementation, and other barriers impede adoption of such systems, and studies have documented low rates of technology acquisition and implementation in emergency department (ed) and other settings . A study of residency - affiliated eds in 2000 found low rates of adoption, with only 7% reporting fully implemented technology for medication error checking, 18% for computerized medication order entry, and 21% for clinical documentation . A 2006 survey of health information technology in all massachusetts eds found similar results, with 11% of respondents reporting fully implemented technology for medication error checking . Another national study showed that, during 20012003, only 31% of us eds used electronic medical records in any form . Our hypothesis is that fewer than half of us eds had adopted electronic health records systems and related decision - support tools by 20052006 . We report on data collected as part of the national ed safety study (nedss). We recruited eds mainly by inviting network members . Since most members are affiliated with an emergency medicine residency program (i.e., are academic eds), we also recruited non - academic and other eds not affiliated with emnet through postings on emergency medicine list servers, by contacting sites directly, and through presentations at emergency medicine meetings . For the parent national ed safety study, each site had a site responsible investigator . The survey asked about ed attributes and adoption of the health information technology applications shown in table 1 . These applications were chosen by the authors as representative of the diverse applications available today, within the constraints of a larger survey with other goals . We performed all calculations with sas 9.12 (sas institute, cary, nc). Table 1characteristics of 68 emergency departments surveyedcharacteristicn (%) median computerization scoreemergency medicine residency affiliation yes51 (75%)9 no17 (25%)8annual census (visit per year) <10,0000n / a 10,00019,9990n / a 20,00029,9991 (1%)5 30,00039,99912 (18%)8.5 40,00049,99912 (18%)7.5 50,00043 (63%)9us region northeast30 (44%)8 midwest15 (22%)9 south10 (15%)9 west13 (19%)8we surveyed key informants at 69 us eds, as part of the national emergency department safety study, with 68 (99%) of eds surveyed respondingthe computerization score was simply a way for us to count the number of information technologies that had been acquired . We calculated the score by assigning one point for each acquired application listed in table 2 characteristics of 68 emergency departments surveyed we surveyed key informants at 69 us eds, as part of the national emergency department safety study, with 68 (99%) of eds surveyed responding the computerization score was simply a way for us to count the number of information technologies that had been acquired . We calculated the score by assigning one point for each acquired application listed in table 2 our main outcome measure is descriptive: how many eds have adopted which applications? Our secondary objective was to determine whether ed characteristics predicted adoption of health information technology . Firstly, we selected one application that seemed to represent the potential of information technology to improve health care . There is substantial debate about what constitutes meaningful use of information technology, and we felt that selecting one crucial application for analysis would be the best way to compare across eds . For the purpose of this analysis, we selected computerized medication ordering as the application . We chose this application because medication ordering represents a crucial site of potential intervention to improve adherence to recommended care and avoid error . We studied this as an outcome variable by creating a logistic regression model with computerized medication order entry as the dependent variable . We categorized eds according to emergency medicine residency affiliation (binary), annual census (continuous), and region (categorical: northeast, midwest, south, and west). We used multiple logistic regression to model these characteristics as predictors of adoption of computerized medication ordering . We used the hosmer - lemeshow goodness of fit test to evaluate for non - linearity . Secondly, we did not wish to limit our investigation to any one application or combination of applications, as was done in the analysis described above . Thus, we also compared eds by the raw number of applications they had adopted . We accomplished this by creating a computerization score, as was done in a prior study . This score is simply a count of applications, with one point assigned for each acquired application . We then used multiple linear regression to predict computerization score by the above ed characteristics and planned to consider any characteristic to be a significant predictor of the computerization score if the p - value of its beta coefficient was 0.05 . We used the sas spec option to assess for heteroscedasticity and inspected residual plots for qualitative evidence of a relationship . Of 69 eds surveyed, 68 (99%) in 23 us states completed the survey . The participants were generally large urban academic eds, with 44% located in the northeast . Table 2 shows the number and proportion of eds reporting availability of selected health information technologies . Computerized physician order entry, clinical decision support, and bar coding technology were present in fewer than 40% of eds . In contrast, some other applications were present in most of the eds surveyed, including laboratory test ordering and results, notes from prior encounters, and ecg results . The right - hand column of table 1 shows the computerization score (see methods), stratified by ed characteristics . Table 2information technology in 68 us emergency departmentsinformation technology applicationnumber (%) of eds reporting availability of each applicationcomputerized physician medication order entry26 (38%)clinical decision support for medication allergies13 (19%)clinical decision support for drug - drug interactions9 (13%)outpatient notes39 (57%)inpatient notes43 (63%)surgical notes53 (78%)prior ed visit notes54 (79%)laboratory results66 (97%)laboratory test ordering39 (57%)test ordering other than laboratory tests42 (62%)radiology results67 (99%)ekg results62 (92%)patient tracking50 (74%)bar coding for patient, medication, or sample identification14 (20%) information technology in 68 us emergency departments our analysis of ed characteristics did not reveal any significant variation in availability of electronic medication ordering or computerization score, by emergency medicine residency affiliation, annual census, or region . Businesses from restaurants to banks and airlines rely on such technology to process information that has much in common with medical information . Why, then, would our nationwide sample of eds reveal that only 19% have the capability to check a medication order to see if the patient has a documented allergy to that medication? Reasons might include apprehension . In the enthusiasm to promulgate the spread of health information technology, the downsides are often under - emphasized . The present report echoes the findings of the three prior studies of health information technology adoption in us eds only two of these prior studies assessed the adoption of individual applications, such as computerized physician order entry . One was a survey of us emergency medicine residency - affiliated eds in 2000, and the second was a survey of all massachusetts eds in 2006 . Our ability to conduct direct quantitative comparisons across time is limited, because different eds participated in the surveys . All three studies revealed that a minority of eds had computerized medication ordering: 38% in the present national study, 15% in the 2006 ma study, and 18% in the 2000 national study . Quantitatively, the increase from 18% to 38% might indicate wider dissemination of these technologies, or might be due to sampling variation . Qualitatively, it seems reasonable to conclude from these three studies that most us eds do not have electronic medication ordering, or its companion technology, medication error checking . However, this conclusion must be caveated by the fact that large academic eds were over - represented in these samples . Studies of health information technology adoption in physicians offices and hospitals throughout the country also revealed slow uptake by 2008 [8, 9]. These studies found that only 7.6% of us hospitals have a basic electronic records system, and 1.5% a comprehensive one . (these studies defined basic as including only demographic information, cpoe, laboratory and imaging results, and comprehensive as including the above, plus clinical notes, plus electronic prescribing, radiographic image display, and decision support .) Only 4% of physicians offices have a fully functional electronic - records system, and 13% have a basic system . Ed - based studies also show that some health information technology applications are widespread, including patient tracking; ordering tests; and displaying prior visit notes, ecgs, and laboratory and radiology results [2, 3, 5]. An analysis of the types of health information technology may improve our understanding of these results . One type of application is computationally simple, merely entering and extracting information from a database, and displaying it . The other type of application requires all of the above processes, plus algorithmic processing that seeks to supplement human cognition with computation . For lack of better terms, we might refer to these two types of application as passive and active applications, respectively . From a workflow standpoint, such technologies include patient tracking; ordering tests; and displaying prior visit notes, ecgs, laboratory and radiology results . Active applications add functions designed to improve outcomes by reducing error or increasing adherence to the standard of care they seek to change human behavior . These applications often embody fundamental changes in clinical processes, and implementation is intertwined with changes in workflow [6, 10]. Examples include computerized provider order entry and related error - checking functions, and decision support systems . In light of this dichotomization, we can see that the present and prior studies reveal a high rate of adoption of passive applications in us eds and a low rate of adoption of active applications [2, 3]. (we included laboratory test ordering in the passive category for historical reasons . Such systems have been present in most eds for many years and were not originally subject to behavior - modification technology .) An optimistic interpretation of our data would be to celebrate the fact that most us eds did not invest in expensive, cumbersome, and even potentially risky systems prematurely . Now that a large number of commercial and home - grown systems are available, we should take the time to study them and reach consensus on which would be best for particular environments . We should pay particular attention to the interaction of information systems with human workflows [6, 10]. The certification commission for healthcare information technology formed an ed work group in 2007, which is in the process of certifying various health information technology platforms for ed use, in concert with the health level seven project . This type of certification process may be an important first step in improving the types of systems that are available, or at least our understanding of what is available . Participating sites were generally large, urban, academic eds . Because the underlying patient safety study focused on adult illnesses, the study excluded children s hospitals . We did assess for variability in technology adoption by ed characteristics, and found no significant variation . This improves our confidence in the generalizability of our data to other eds in the us, though, again, large academic eds were over - represented in the sample . Perhaps more saliently, the present results are similar to those of prior studies, from academic eds throughout the us, and all eds in massachusetts . It remains true that we have little data on health information technology adoption in the 1/3 of us eds with an annual visit volume <10,000 . From the perspective of the individual patient, small eds have the same clinical goals as large eds . But from a systems perspective, the marginal cost of health information technology in low - volume settings will be high relative to benefit, both financially and in terms of workflow modification and associated risks . Another limitation is the fact that our assessment was part of a larger survey, and thus, we could not conduct as detailed an inquiry as would have been desirable . In particular, we did not ascertain adoption of health information technology for medication order checking or decision support . However, the low rate of adoption of medication order entry technology allows us to conclude with confidence that these technologies were not available in the majority of respondent eds . Active applications involve intertwining of technology and human workflows, and are intended to change behavior . Together with the findings of other studies, our results demonstrate that most us eds have adopted passive applications but not active applications that have been recommended forcefully [2, 3]. We view this as an opportunity, because careful analysis of available platforms and the pitfalls in their implementation may result in better outcomes and less difficulty in the implementation process . The ideal forum for such analysis remains unclear, though the certification commission for healthcare information technology ed work group is a notable effort.
|
, there is not agreement on the definition of emotion regulation, which has been inconsistently defined in the different studies . Emotion regulation has rooted in analytical psychology, stress and coping strategies (1). Some concepts of emotion regulation emphasize the ability to control emotional experience and expression of negative emotions (2, 3). Unlike other concepts, stress on the functional nature of emotions has suggested that adaptive emotion regulation involves the ability to control behaviors (e.g. By engaging in goal - directed behaviors and or inhibiting impulsive behaviors) rather than just controlling emotions in the face of negative emotions (4, 5). In fact, lack of the ability to experience and differentiate emotions and also spontaneous responses may be maladaptive similar to disability in reducing and regulating intense negative emotions (6, 7). Previous research shows that difficulties in emotion regulation (emotional dysregulations) are key factors in developing many clinical behaviors and psychological problems (8). Furthermore, emotional dysregulation have been identified in numerous forms of psychopathology, ranging from affective disorders to personality disorders (6) such as generalized anxiety disorder (gad) (9), depression (10), anxiety (11), borderline personality disorder (12), social anxiety (13), substance use (14), and psychosomatic disorders (e.g. Functional gastrointestinal disorders) (15). Study upon patients with functional gastrointestinal disorders (fgid) indicated that some factors involved in emotional dysregulation (difficulties engaging in goal - directed behavior and lack of emotional awareness) are predictors of decreased acceptance of pain (15). Experimental research has also shown that affect - based treatments and or interventions based on emotion regulation are effective in reduction severity of somatic symptoms besides emotions (e.g. Anxiety and depression) (16 - 18). Furthermore, in the domains of emotion research and in the context of interventions for clinical problems, further attention has been paid to the concept of mindfulness and its practices . It is believed that the main cause of human distress is judging events as good versus bad (19). Also, it is assumed that mindfulness has a major impact on the release of individuals from their thoughts, habits and unhealthy behaviors (20) because it implies non - judgmental and nonreactive acceptance of emotional states (21). Hence, mindfulness increases self - regulated behavior related to improvement of well - being (20). Studies have shown that mindfulness negatively correlates with psychological symptoms of distress such as anxiety and depression, and positively with various forms of psychological well - being (22, 23). The useful effects of mindfulness - based interventions, such as mindfulness - based cognitive therapy (mbct), especially mindfulness - based stress reduction (mbsr), on human well - being have been confirmed in several studies (24 - 26). Mindfulness practices can enhance functional status, well - being, and reduce physical or psychological distresses (25). (26) reported fewer symptoms of stress; fewer somatic symptoms (cardiopulmonary and gastrointestinal); less emotional irritability, depression, and cognitive disturbance; and fewer habitual patterns of stress, after mindfulness - based intervention in cancer outpatients . Since both mindfulness and emotion regulation influence different aspects of well - being, these two constructs might be related to each other and some aspects of this relationship were demonstrated during some studies (19, 21). Emotion regulation overlaps with mindfulness, in its emphasis on observing and describing emotions (without necessarily acting on those emotions), and also participating in present moment activities (i.e. Engaging in goal - directed behavior when distressed) (8). The findings of the previous studies suggest that mindfulness can conduce to better emotional condition by reducing negative affectivity and various difficulties related to emotion (21). It induces self - regulatory behaviors and increases experiences of positive emotional states (27). Because emotional disturbances are present in many patients with fgid (as psychosomatic disorders), particularly in referral population, this study aimed to evaluate relationships of emotion regulation difficulties and mindfulness with psychological and digestive symptoms in those patients . Although some aspects of the relationship between mindfulness and emotion regulation have already been investigated, some other aspects still need to be studied . For instance, the association between the factors involved in emotion regulation and mindfulness has not been investigated yet . Hence, the main goal of the study was to examine the role of difficulties in emotion regulation and mindfulness in psychological and somatic symptoms of patients with fgid . In this cross - sectional study, 167 patients with fgid referred to the psychosomatic disorders clinic of isfahan were selected by census method, according to criteria of research . Study criteria included willingness to participate in the study, age range of 18 - 70 years, lack of acute psychiatric disorders, and the diagnosis of fgid on the basis of rome iii criteria by gastroenterologists . To observe ethical considerations, the researcher assured to patients of the confidentiality of their information . In current study, demographic information included age, sex, marital status, and educational level . The difficulties in emotion regulation scale (ders) assesses difficulties in emotion regulation and can distinguish adaptive emotion regulation from emotional avoidance and expressive control . The scale is composed of 6 factors, including, non - acceptance of emotional responses (non - acceptance), difficulties engaging in goal - directed behavior (goal), impulse control difficulties (impulse), lack of emotional awareness (awareness), limited access to emotion regulation strategies (strategy), and lack of emotional clarity (clarity). Ders has 36 items that are rated on a 5-point likert - type scale, ranging from 1 (almost never) to 5 (almost always), and are recoded so that higher scores in every case indicate greater difficulties in emotion regulation . The scale has high internal consistency; cronbach = 0.93 for total ders and cronbach> 0.80 for each factors; also its test - retest equals 0.87 for total ders and ranges from 0.69 to 0.89 for all factors (28). In an iranian healthy sample, internal consistency of the scale using cronbach ranged from 0.66 to 0.88 for all factors (29). With regard to validity, studies have suggested sufficient construct and predictive validity to the scale (28). Mindful attention awareness scale (maas) is a 15-item self - report measure of the present moment attention and awareness . Items reflect in attention across several domains (e.g. Cognitive, emotional, physical, and general). Each item rates over a 6-point likert - type scale, with 6 indicating almost never and 1 indicating almost always . So, high scores reflect higher levels of present moment attention . It has been revealed a single - factor model for the scale, along with good internal consistency (= 0.82) and temporal stability (27). In this sample, the initial version of the depression, anxiety, and stress scale (dass) contained 42 phrases about negative emotional states . The scale measures the intensity of depression, anxiety, stress symptoms and can be used to assess treatment progression . Subject rates intensity (frequency) of symptom presented in each phrase which he or she has experienced over the past week over a 4-point likert scale, ranging from 0 (did not apply to me at all) to 3 (applied to me very much). Cronbach values have been reported for depression, anxiety, and stress as 0.91, 0.81, 0.89, respectively (30). The internal consistency reliability of short form of the 21-dass (each of its subscales comprises 7 items) was computed in an iranian sample and cronbach values for depression, anxiety, and stress were 0.81, 0.74, 0.78, respectively (31). The gastrointestinal symptom rating scale (gsrs) is a disease - specific instrument of 15 items, with 5 subscales (symptom clusters), including abdominal pain, reflux, diarrhea, constipation, and indigestion . The gsrs is rated on a 7-point likert - type scale, ranging from 1 (no discomfort at all) to 7 (very severe discomfort). Based on cronbach, the internal consistency validities of total gsrs and its subscales have been reported as 0.62, 0.61, 0.83, 0.80, and 0.70, respectively (32). Furthermore, in an iranian sample of patients with fgid, cronbach values of the gsrs and the subscales of diarrhea, abdominal pain, constipation, indigestion were equivalent to 0.81, 0.70, 0.70, 0.63, 0.76, respectively (33). Pearson correlation coefficient was used to test the relation between emotional dysregulation (difficulties in emotion regulation), mindfulness and symptoms . The dependent variables were psychological and somatic symptoms and mindfulness; the independent variables were emotional dysregulation and its factors and mindfulness . The spss version 15.0 (spss inc ., in this cross - sectional study, 167 patients with fgid referred to the psychosomatic disorders clinic of isfahan were selected by census method, according to criteria of research . Study criteria included willingness to participate in the study, age range of 18 - 70 years, lack of acute psychiatric disorders, and the diagnosis of fgid on the basis of rome iii criteria by gastroenterologists . To observe ethical considerations, the researcher assured to patients of the confidentiality of their information . In current study, demographic information included age, sex, marital status, and educational level . The difficulties in emotion regulation scale (ders) assesses difficulties in emotion regulation and can distinguish adaptive emotion regulation from emotional avoidance and expressive control . The scale is composed of 6 factors, including, non - acceptance of emotional responses (non - acceptance), difficulties engaging in goal - directed behavior (goal), impulse control difficulties (impulse), lack of emotional awareness (awareness), limited access to emotion regulation strategies (strategy), and lack of emotional clarity (clarity). Ders has 36 items that are rated on a 5-point likert - type scale, ranging from 1 (almost never) to 5 (almost always), and are recoded so that higher scores in every case indicate greater difficulties in emotion regulation . The scale has high internal consistency; cronbach = 0.93 for total ders and cronbach> 0.80 for each factors; also its test - retest equals 0.87 for total ders and ranges from 0.69 to 0.89 for all factors (28). In an iranian healthy sample, internal consistency of the scale using cronbach ranged from 0.66 to 0.88 for all factors (29). With regard to validity, studies have suggested sufficient construct and predictive validity to the scale (28). Mindful attention awareness scale (maas) is a 15-item self - report measure of the present moment attention and awareness . Items reflect in attention across several domains (e.g. Cognitive, emotional, physical, and general). Each item rates over a 6-point likert - type scale, with 6 indicating almost never and 1 indicating almost always . It has been revealed a single - factor model for the scale, along with good internal consistency (= 0.82) and temporal stability (27). In this sample, the initial version of the depression, anxiety, and stress scale (dass) contained 42 phrases about negative emotional states . The scale measures the intensity of depression, anxiety, stress symptoms and can be used to assess treatment progression . Subject rates intensity (frequency) of symptom presented in each phrase which he or she has experienced over the past week over a 4-point likert scale, ranging from 0 (did not apply to me at all) to 3 (applied to me very much). Cronbach values have been reported for depression, anxiety, and stress as 0.91, 0.81, 0.89, respectively (30). The internal consistency reliability of short form of the 21-dass (each of its subscales comprises 7 items) was computed in an iranian sample and cronbach values for depression, anxiety, and stress were 0.81, 0.74, 0.78, respectively (31). The gastrointestinal symptom rating scale (gsrs) is a disease - specific instrument of 15 items, with 5 subscales (symptom clusters), including abdominal pain, reflux, diarrhea, constipation, and indigestion . The gsrs is rated on a 7-point likert - type scale, ranging from 1 (no discomfort at all) to 7 (very severe discomfort). Based on cronbach, the internal consistency validities of total gsrs and its subscales have been reported as 0.62, 0.61, 0.83, 0.80, and 0.70, respectively (32). Furthermore, in an iranian sample of patients with fgid, cronbach values of the gsrs and the subscales of diarrhea, abdominal pain, constipation, indigestion were equivalent to 0.81, 0.70, 0.70, 0.63, 0.76, respectively (33). In current study, demographic information included age, sex, marital status, and educational level . The difficulties in emotion regulation scale (ders) assesses difficulties in emotion regulation and can distinguish adaptive emotion regulation from emotional avoidance and expressive control . The scale is composed of 6 factors, including, non - acceptance of emotional responses (non - acceptance), difficulties engaging in goal - directed behavior (goal), impulse control difficulties (impulse), lack of emotional awareness (awareness), limited access to emotion regulation strategies (strategy), and lack of emotional clarity (clarity). Ders has 36 items that are rated on a 5-point likert - type scale, ranging from 1 (almost never) to 5 (almost always), and are recoded so that higher scores in every case indicate greater difficulties in emotion regulation . The scale has high internal consistency; cronbach = 0.93 for total ders and cronbach> 0.80 for each factors; also its test - retest equals 0.87 for total ders and ranges from 0.69 to 0.89 for all factors (28). In an iranian healthy sample, internal consistency of the scale using cronbach ranged from 0.66 to 0.88 for all factors (29). With regard to validity, studies have suggested sufficient construct and predictive validity to the scale (28). Mindful attention awareness scale (maas) is a 15-item self - report measure of the present moment attention and awareness . Items reflect in attention across several domains (e.g. Cognitive, emotional, physical, and general). Each item rates over a 6-point likert - type scale, with 6 indicating almost never and 1 indicating almost always . So, high scores reflect higher levels of present moment attention . It has been revealed a single - factor model for the scale, along with good internal consistency (= 0.82) and temporal stability (27). In this sample, the initial version of the depression, anxiety, and stress scale (dass) contained 42 phrases about negative emotional states . The scale measures the intensity of depression, anxiety, stress symptoms and can be used to assess treatment progression . Subject rates intensity (frequency) of symptom presented in each phrase which he or she has experienced over the past week over a 4-point likert scale, ranging from 0 (did not apply to me at all) to 3 (applied to me very much). Cronbach values have been reported for depression, anxiety, and stress as 0.91, 0.81, 0.89, respectively (30). The internal consistency reliability of short form of the 21-dass (each of its subscales comprises 7 items) was computed in an iranian sample and cronbach values for depression, anxiety, and stress were 0.81, 0.74, 0.78, respectively (31). The gastrointestinal symptom rating scale (gsrs) is a disease - specific instrument of 15 items, with 5 subscales (symptom clusters), including abdominal pain, reflux, diarrhea, constipation, and indigestion . The gsrs is rated on a 7-point likert - type scale, ranging from 1 (no discomfort at all) to 7 (very severe discomfort). Based on cronbach, the internal consistency validities of total gsrs and its subscales have been reported as 0.62, 0.61, 0.83, 0.80, and 0.70, respectively (32). Furthermore, in an iranian sample of patients with fgid, cronbach values of the gsrs and the subscales of diarrhea, abdominal pain, constipation, indigestion were equivalent to 0.81, 0.70, 0.70, 0.63, 0.76, respectively (33). Pearson correlation coefficient was used to test the relation between emotional dysregulation (difficulties in emotion regulation), mindfulness and symptoms . The dependent variables were psychological and somatic symptoms and mindfulness; the independent variables were emotional dysregulation and its factors and mindfulness . The spss version 15.0 (spss inc ., in the study, 167 patients with fgid participated with the following characteristics: mean (sd) age of 33.81(10.56) years; 135 (80.8%) female; 69 (41.6%) graduated; and 14 (74.3%) married . The demographic information are presented in table 1 . Descriptive statistics (mean sd) and correlation coefficients between variables are presented in table 2 . Difficulties in emotion regulation, on the whole and in parts, except awareness factor were significantly and positively correlated with severity of psychological symptoms . They also (except awareness and clarity factors) were significantly and positively correlated with severity of digestive symptoms . Additionally, mindfulness was significantly and inversely correlated with both aspects of psychological and somatic symptoms . In addition, mindfulness was negatively correlated with difficulties in emotion regulation and its factors (except awareness). Abbreviations: a, anxiety; d, depression; ders, the difficulties in emotion regulation scale; s, stress; gsrs, gastrointestinal symptom rating scale; maam, mindful attention awareness scale . 1, maam; 2, total ders; 3, ders - non - accept; 4, ders - goal; 5, ders - impulse; 6, ders - awareness; 7, ders - strategy; 8, ders - clarity; 9, d; 10, a; 11, s; 12, gsrs . Afterwards, to examine whether the factors of difficulties in emotion regulation (ders) and mindfulness (maas) predict independent variances in the severity of both aspects of symptoms, we performed stepwise multiple regression analyses . In the first step of regression, ders (total and its factors) were entered as the sole predictors of symptoms, and in the next step, mindfulness was entered . Abbreviations: ders, the difficulties in emotion regulation scale; maam, mindful attention awareness scale; gsrs, gastrointestinal symptom rating scale . Predictors: ders - goal, ders - impulse, maas; dependent variable: gsrs . Abbreviations: d, depression; a, anxiety; s, stress; ders, the difficulties in emotion regulation scale; maam, mindful attention awareness scale . Dependent variable: a; predictors: ders - strategy, ders - impulse, ders - non - accept, maas and age . Dependent variable: s; predictors: ders, d5, maas and age . As it can be seen in table 3, the results showed that only variables of goal and impulse remained as significantly independent predictors for somatic symptoms . Mindfulness was not a significant predictor of symptoms with levels of ders controlled and did not significantly improve the model . Whereas age was correlated with psychological symptoms (especially anxiety and stress) for controlling, it was entered in regression equations . The findings showed that in addition to total ders and some of its factors, mindfulness was also a predictor for depression, anxiety, and stress . It significantly improved the models, contributing an additional 3.3%, 1.8%, 2.8% of the variance for d, a, and s, consecutively (table 4). In general, results showed that difficulties in emotion regulation played the main role in prediction of the severity of psychological and somatic (digestive) symptoms and some factors acted as independent predictors (e.g. Impulse, strategy). We performed other stepwise multiple regression analyses to examine whether the factors of difficulties in emotion regulation predict independent variances for mindfulness . As it can be seen in table 5, three factors of impulse, clarity, and non - accept acted as negatively significant predictors of mindfulness . Dependent variable: maas; predictors: ders - impulse, ders - clarity, ders - non - accept . Determination of the role of difficulties in emotion regulation and mindfulness in psychological and somatic symptoms are important . According to gratz and tull (8), the difficulties in clinical disorders and maladaptive behaviors would have important implications for the development of more targeted interventions . Although the issue of difficulties in emotion regulation and mindfulness has been assessed in some psychiatric and medical disorders, this study was the first to examine the relationship between mindfulness and especially difficulties in emotion regulation with psychological and somatic (digestive) symptoms in fgid . As predicted, the findings of the study revealed positive significant associations between emotional dysregulation and most of its factors with psychological and somatic symptoms . Regression analyses showed that some viewed variables can predict these symptoms (i.e. The relationships remained when shared variance associated with other variables and also age was accounted). In other words, difficulties engaging in goal - directed behavior, difficulties in impulsive behaviors control, limited access to emotion regulation strategies, and non - acceptance of emotional responses were the most powerful factors in relation to symptoms . Studies have shown that emotion regulation skills (e.g. Emotional acceptance, ability to engage in goal - directed behavior, adaptive strategies) are associated with lower emotional problems (34, 35). As a note, in this study psychological and somatic symptoms were not correlated with the lack of awareness factor . It is contrary to some previous research that has been revealed awareness an important factor, which has positive or negative effect on emotion regulation process and some somatic symptoms (15, 36, 37). (9) study that found all dimensions of emotion regulation difficulties (with the exception of lack of emotional awareness) were significantly elevated among individuals with gad . According to bardeen et al . (38), ders awareness may sufficiently measure emotional awareness, but lack of emotional awareness is not necessarily associated with distress or attention to emotional states does not necessarily represent a healthy response or regulation of such states . Also, our findings indicated that mindfulness were negatively correlated to both symptoms, however it was stronger for psychological symptoms . Such results highlight the obvious benefits of mindfulness among patients and confirm the results of previous studies (20, 22, 23). Mindfulness interventions can alleviate the symptoms of physical and psychiatric disorders (26, 39). Investigations have shown improvements in mental health measures, including psychological dimensions of quality of life, depression, anxiety, coping style and other affective dimensions of disability, and in some health parameters of physical well - being such as medical symptoms, sensory pain, and physical impairment (40, 41). In evaluating the relationship between difficulties in emotion regulation and mindfulness, the findings showed that desr total score and most of its factors were negatively correlated with mindfulness and this relationship remained for factors of non - accept, impulse, and clarity when controlling for variance shared with the others . (42) showed that mindfulness had significant relationships with emotion regulation on the whole and also with impulse control and goal attainment difficulties when distressed . When people experience negative emotions, they encounter problems in goal - oriented behavior (such as loss of concentration or effective problem solving) (43). Coffey et al . (44) identified clarity of internal experiences as a partial mediator of the relationship between mindfulness and negative affect regulation . However in their conceptual definitions, both mindfulness and emotion regulation difficulties included awareness and acceptance of emotional responses, but the findings showed that mindfulness was not significantly correlated with ders awareness . Awareness of or attention to emotions as assessed in emotion regulation scales may not correspond to reduced clinical problems or increased well - being (45, 46). So, should this concept be valid, self - reported lack of awareness in ders alone may not be related to awareness of the present moment in mindfulness, because mindfulness includes awareness of emotional experiences with an attitude of acceptance and nonjudging (21). Thus, in processing the relationship between mindfulness and emotional dysregulation, that ingredient of acceptance of emotional responses may be more influential . The main limitations of this study were non - random sampling (because of limited statistical population) and reliance on self - report data which may be recall bias regarding the occurrence of symptoms . Also, other social factors that may affect the relationship between variables have been overlooked . Overall, the findings of the study indicate that the constructs of emotion regulation difficulties (emotional dysregulation) and mindfulness are related to both psychological and somatic symptoms in fgid, but some factors of dysregulation have more influential role in relation to increased symptoms as well as decreased mindfulness . Patients with fgid may benefit from treatments that facilitate emotional experience, functional status, and ability to control impulsive behaviors . They can behave according to the goals when experiencing negative emotions (i.e. Emotion regulation skills). To reduce symptoms, treatments might further towards emotion regulation, and mindfulness practices can be utilized as one of the strategies or skills of emotion regulation . Although more research is needed to uphold conclusions, the study can be a thoroughfare for future research in more examination of influential factors in poor emotion regulatory ability and their roles in developing psychological and somatic symptoms in physical disorders.
|
Stent thrombosis is a rare but fatal complication of drug eluting stent (des). Although dual antiplatelet therapy with aspirin and clopidogrel significantly reduced the occurrence of stent thrombosis, late stent thrombosis still occurs; many other factors could be attributable to the occurrence.1)2) of these, clopidogrel resistance is regarded as one of the main reasons for the occurrence of des thrombosis . Therefore, new antiplatelet agents have been developed recently and are reported to have better outcomes.3) we report a case of recurrent des thrombosis with clopidogrel resistance successfully rescued by prasugrel . A 58-year - old non - smoker male who had no specific medical history visited the emergency room with typical angina on april 2006 . Percutaneous coronary intervention with 3.023 mm - sized sirolimus - eluting stent (cypher; cordis corp ., miami lakes, fl, usa) at the mid portion of the left anterior descending artery (m - lad) and 2.7518 mm - sized sirolimus - eluting stent at the distal portion of left circumflex artery (d - lcx) were performed (fig . He received triple antiplatelet drugs (aspirin 100 mg daily, clopidogrel 75 mg daily, cilostazol 100 mg twice daily). After that, cilostazol and clopidogrel were discontinued on july 2006 (3-month use) and on june 2009 (37-month use), respectively . Three weeks after clopidogrel discontinuation, he felt typical angina and was diagnosed with non - st - segment - elevated myocardial infarction (creatine kinase - mb 5.64 ng / ml, troponin - t 0.019 ng / ml). On the coronary angiography, intraluminal thrombi in the distal portion of m - lad stent and totally occluded d - lcx stent were noted (fig . Percutaneous coronary intervention with 3.020 mm - sized balloon was performed on m - lad and d - lcx stents as well as on the distal portion of lad . Thereafter, triple antiplatelet therapy, including cilostazol 100 mg twice daily, was restarted . The patient had no further chest pain and cilostazol and clopidogrel were discontinued on march 2010 (9-month use) and on june 2010 (12-month use), respectively . However, he visited the emergency room again on jan 2011 because of a severe ongoing chest pain . Electrocardiogram showed st elevation (> 1 mm) on the anterior (v 1 - 3) lead . Emergency coronary angiography was performed and both m - lad and d - lcx stents were totally obstructed on the angiogram (fig . Thrombus aspiration (thrombuster ii; kaneka medix corporation, osaka, japan) and balloon dilation with 3.015 mm - sized balloon were performed on both m - lad and d - lcx stents (fig . 2c). Because of the drop of blood pressure during the procedure (80/50 mm hg), intraaortic balloon pump (autocat2 wave - fiber optic; arrow international inc ., reading, pa, usa) and percutaneous cardiopulmonary support (capiox ebs; terumo corporation, tokyo, japan) were applied . Transthoracic echocardiogram was performed right after the procedures showed a reduced left ventricular ejection fraction of 25% with anterior and anteroseptal wall akinesis . After that, the patient was stable and all the other devices were removed; he was sent to the general ward . However, thirteen days post procedure, he experienced a severe resting pain again . The resting electrocardiogram showed a st segment elevation on v 1 - 6 leads . On the emergency angiogram, percutaneous coronary intervention with 3.013 mm - sized balloon was performed on m - lad and d - lcx stents (fig . Due to suboptimal revascularization flows, 3.030 mm - sized zotarolimus - eluting stent implantation (endeavor sprint; medtronic cardio - vascular, minneapolis, ms, usa) was performed on m - lad . The day before the last event, the platelet function test with verify - now - p2y12 rapid analyzer (accumetrics inc ., san diego, ca, usa) showed inadequate platelet inhibition results {280 p2y12-receptor reaction units (pru), 14% inhibition}. Finally, clopidogrel was switched with prasugrel 10 mg daily followed by a 60 mg loading . Six days later, the platelet function test showed an adequate platelet inhibition (9 pru, 98% inhibition). After discharge, cilostazol was discontinued on may 2011 (4-month use) and the platelet function test still showed a good response to the dual antiplatelet with aspirin and prasugrel (92 pru, 70% inhibition). After a nine - month follow - up, the coronary angiography showed a patent both in lad and lcx stents . Currently, dual antiplatelet drugs with aspirin and prasugrel were maintained without any chest pain (13-month use) (fig . Although dual antiplatelet therapy with aspirin and clopidogrel is the standard medication in patients with des implantation, the unmet needs still exist and fatal complication occurs . Particularly, clopidogrel resistance, regarded as one of the major factors for stent thrombosis, has been reported to occur in 30 - 40% of patients.4 - 7) to overcome clopidogrel resistance, a dose - up of clopidogrel or triple antiplatelet therapy with cilostazol has been recommended . However, recent clinical trials, such as gravitas (gauging responsiveness with a verifynow assay - impact on thrombosis and safety) did not show a better prognosis than the existing standard - dose dual antiplatelet.8) although some clinical trial described that triple antiplatelet therapy including cilostazol has a beneficial effect on ischemic complications, there are still many debates.9)10) under this situation, new anti - platelet agents give us a new choice . Of these, prasugrel, which is hydrolysed by esterases into an intermediate precursor and whose activation is not involved with oxidation by the enzyme cyp2c19,11) can consistently and rapidly inhibit adp - induced platelet aggregation than clopidogrel.12) prasugrel was significantly superior to clopidogrel for the reduction of ischemic events, including stent thrombosis in triton - timi 38 (trial to assess improvement in therapeutic outcomes by optimizing platelet inhibition with prasugrel - thrombolysis in myocardial infarction) analysis.3) also, some studies reported that prasugrel achieved greater inhibition of platelet aggregation in clopidogrel resistance patients.13) our case revealed the recurrent stent thrombosis events despite dual or triple antiplatelet therapy including cilostazol . In particular, new stent implantation (endeavor sprint) at m - lad could make a beneficial contribution for stent thrombosis through the hemodynamic improvement in the present case . However, d - lcx stent (cypher) with balloon - only angioplasty has also shown a good patency in a follow - up angiography . Thus, rescued clopidogrel resistance could be the main reason rather than the hemodynamic improvement . After the change of antiplatelet into prasugrel, clopidogrel resistance was successfully rescued and no thrombotic event has been observed until now . In conclusion, for the prevention of recurrent des thrombosis, dual antiplatelet with aspirin and prasugrel could be one of the potential options in patients with clopidogrel resistance.
|
The incidence and prevalence of diabetes mellitus have significantly increased worldwide in recent decades, primarily due to the increase in type 2 diabetes mellitus (t2 dm). Long - term diabetes results in vascular changes and dysfunction, and diabetic vascular complications are the major cause of morbidity and mortality in patients with diabetes . It is not a simple matter to strictly control blood glucose levels for long periods of time, even given the many antidiabetic medications that are clinically available . Therefore, the development of improved additional treatments and novel prevention strategies for t2 dm is a matter of great urgency . Aging is implicated in metabolic diseases, including diabetes; therefore, aging is recognized as a risk factor for the initiation and the development of t2 dm . Numerous studies have revealed that cr retards aging or extends the lifespans of yeast, worms, flies, and rodents . Colman et al . Also reported that 30% cr delayed the onset of numerous age - associated pathologies, including diabetes, cancer, cardiovascular disease and brain atrophy, and decreased mortality in rhesus monkeys . Moreover, fontana et al . Reported that cr for an average of 6 years improved metabolism in humans, as was indicated by levels of serum insulin, cholesterol, c - reactive protein (crp) and tumor necrosis factor (tnf)- as well as by carotid intima media thickness . This group also observed that long - term cr ameliorated the decline in left ventricular diastolic function and decreased levels of serum tumor growth factor-1, tnf-, and high - sensitivity crp . Thus, cr has a variety of beneficial effects with respect to lifespan extension and delays the onset of age - related diseases, such as cardiovascular diseases, neurodegenerative disorders, and diabetes . Cr is defined as the restriction of food intake without malnutrition in organisms that are normally fed ad libitum, and it is accepted as the only established antiaging experimental paradigm . As one of the molecules through which cr improves lifespan extension or delays age - related diseases, initial studies of aging in yeast identified silent information regulator 2 (sir2), which is a nad - dependent deacetylase . Sirt1, the sirtuin that is most closely related to sir2, is one of seven sirtuins in mammals . The beneficial effects of cr involve the function of sirt1, which is induced by cr in various tissues . The significance of sirt1 on the effects of cr has been demonstrated using genetically altered mice . Reported that sirt1 transgenic mice exhibited a cr - like phenotype, exhibiting reduced levels of blood cholesterol, adipokines, insulin, and fasting glucose and greater glucose tolerance than control mice . Additionally, a 25% reduction in calorie intake for 6 months in nonobese young adults led to the upregulation of sirt1 and peroxisome proliferator activated receptor (ppar)- coactivator-1 (pgc-1) in the skeletal muscle . This effect was accompanied by an increase in mitochondrial function and a decrease in visceral fat mass, insulin resistance, body temperature, metabolic rate, and levels of oxidative stress . Thus, sirt1 is an important regulator of energy metabolism, and appears to be required for a normal response to cr . Furthermore, recent reports demonstrate that sirt1 is downregulated in several cells and tissues in insulin - resistant or glucose intolerance states [7 - 9]. Therefore, under excess energy intake, decreased sirt1 activity may contribute to the development of obesity - related conditions, including insulin resistance and t2 dm . Diet therapy, including cr, is generally necessary for patients with t2 dm; however, it is not a simple matter for patients to strictly control their diet over the long term . Therefore, sirt1 activation, as a cr mimetic, may be a candidate therapeutic target for t2 dm . Sirt1 functions as class iii histone deacetylases, binding to nad and acetyllysine within protein targets and generating lysine, 2'-o - acetyl - adp - ribose, and nicotinamide as enzymatic products . 1). Sirt1 regulates a wide variety of cellular functions, such as metabolism related to glucose - lipid metabolism, mitochondrial biogenesis, inflammation, autophagy, and circadian rhythms, and others including, stress resistance, apoptosis and chromatin silencing (table 1). Sirt1 can act on more than a dozen nonhistone proteins, including transcription factors, transcriptional coregulatory proteins, and histones . Sirt1 participates in the control of systemic metabolism via the regulation of glucose and lipid homeostasis by deacetylating various targets . Pgc-1 is an important factor in mitochondrial biogenesis and function and is regulated by an acetylation / deacetylation reaction . The transcription factor forkhead box o1 (foxo1) is involved in the control of glucose - lipid metabolism and stress resistance . In addition, sirt1 also regulates components of the circadian clock, such as brain and muscle aryl hydrocarbon receptor nuclear translocator - like 1 (bmal1) and period 2 (per2). Sirt1 is associated with lipid metabolism through the activation of nuclear receptors, including ppar-, liver x receptor (lxr), and farnesoid x receptor (fxr) and via the negative regulation of sterol regulatory element binding protein (srebp). Furthermore, sirt1 deacetylates transcription factors, such as p53, poly - adp - ribose polymerase-1, hypoxia inducible factors (hifs)-1 and hif-2, nuclear factor (nf)-b, autophagy - related gene (atg) 5, atg7, and light chain 3 . These functions mediate stress resistance, apoptosis, hypoxia, inflammatory signaling, and autophagy as physiological responses to environmental toxicity . Thus, the sirt1 activation may lead to the induction of gene silencing, reduced apoptosis, enhanced mitochondrial biogenesis, the inhibition of inflammation, the regulation of glucose and lipid metabolism and circadian rhythms, the induction of autophagy and adaptations to cellular stress . Sirt1 may participate in the control of glucose homeostasis through the following mechanisms: regulating insulin secretion and protecting pancreatic -cells; improving insulin resistance via the modulation of postinsulin receptor signaling; decreasing inflammation, lipid mobilization, and adiponectin excretion; controlling fatty acid oxidation and mitochondrial biogenesis; and regulating hepatic glucose production and circadian rhythms, skeletal muscle, adipose tissue, monocytes / macrophages, and the liver (table 2). Therefore, sirt1 is a promising pharmacological therapeutic target for the treatment of insulin - resistance and subsequent t2 dm . Several studies have suggested that sirt1 participates in the regulation of insulin secretion from pancreatic -cells . The sirt1 overexpression in -cells enhances adenosine triphosphate (atp) production by repressing uncoupling protein (ucp) 2 . This process mediates the uncoupling of atp synthesis from glucose, and elevated atp levels lead to cell membrane depolarization and ca - dependent insulin exocytosis . -cells in sirt1-deficient mice, however, produce less atp in response to glucose than do normal mice . By deacetylating foxo1, sirt1 also promotes the activation and transcription of neurod and mafa, preserving insulin production and promoting -cell survival in vivo . Additionally, lee et al . Demonstrated that sirt1 protects -cells against various toxic stresses, such as oxidative stress and cytokines, by suppressing nf-b signaling . In -cell - specific sirt1 overexpression (besto) mice, increased sirt1 levels in pancreatic -cells improve glucose tolerance and enhance insulin secretion in response to glucose . Moreover, sirt1 activity decreases with age due to decreased systemic nad biosynthesis, resulting in the failure of glucose - sensitive insulin secretion in -cells . However, the administration of nicotinamide mononucleotide, a metabolite that is important for the maintenance of normal nad biosynthesis, restores glucose - sensitive insulin secretion and improves glucose tolerance in aged besto mice . These findings indicate that sirt1 modulates glucose - sensing atp production and insulin secretion from -cells through ucp2, foxo1, and nad metabolism, resulting in protective effects against various toxic stresses through nf-b pathway activation . Sirt1 represses the expression of tyrosine phosphatase1 b, which negatively regulates insulin signaling in skeletal muscle, primarily through dephosphorylation of tyrosine residues on the insulin receptor (ir) and insulin receptor substrate (irs)-1 . Zhang reported that sirt1 regulates the insulin - induced tyrosine phosphorylation of irs-2 through its deacetylation, which affects a crucial step in the insulin signaling pathway . In brief, the insulin - induced tyrosine phosphorylation of the ir and the activation of sirt1 deacetylase were suggested to be separate events in the insulin signaling pathway . Although irs-2 is acetylated at the basal state, insulin treatment leads to the tyrosine phosphorylation of the ir, which further recruits irss, including irs-1 and irs-2, to its kinase domain . The acetylated lysine residues in irs-2 prevent ir kinase from further phosphorylating the tyrosine residues in irs-2 . Continued phosphorylation of the tyrosine residues in irs-2 requires the removal of its acetylated lysine residues by insulin - activated sirt1, and phosphorylated irs-2 can then serve as an adaptor protein to further transmit insulin signaling to downstream targets, such as akt . Moreover, frojdo et al . Demonstrated that sirt1 protein expression was decreased in muscle biopsies and primary myotubes that were derived from subjects with t2 dm and that this effect was likely due to posttranscriptional modifications, as no differences in sirt1 mrna levels were observed between the controls and type 2 diabetic patients . Moreover, sirt1 interacts in an insulin - independent manner with the phosphoinositide 3-kinase (pi3k) adapter subunit p85 and modulates insulin signaling at physiological insulin concentrations in skeletal muscle cells . Pi3k interacts with irs following insulin - stimulated tyrosine phosphorylation of ir; insulin signaling can then continue to activate downstream molecules, such as akt . In addition, the sirt1 activator resveratrol protects muscle cells, including human primary myotubes, from tnf- or prolonged hyperinsulinemia - induced insulin resistance . Sirt1 protein can be detected in both nuclear and cytosolic fractions by cell fractionation, and interestingly, nuclear - associated sirt1 interacts with cytoplasmic proteins, such as irs-2 . Chronic low grade tissue inflammation is an important etiologic component of insulin resistance and t2 dm . Elevated levels of proinflammatory cytokines, such as tnf-, il-6, and crp, in the blood have been detected in individuals with insulin resistance and t2 dm . The activation of monocytes in the circulation and adipose tissue has been demonstrated to lead to the release of various inflammatory mediators . Additionally, it has been demonstrated that macrophages residing in adipose tissue may also be a source of inflammatory factors and that these cells may modulate the secretory activity of adipocytes . Tissue macrophages, which are derived from blood monocytes play a central role in both orchestrating and initiating obesity - related tissue inflammatory responses . Moreover, monocytes / macrophages and adipose tissue have reported to exhibit significantly increased binding to nf-b, the key proinflammatory transcription factor, and an increased levels of intranuclear expression of p65 (rel a), the major protein component of nf-b . Thus, the suppression of inflammatory cytokines overproduction in monocytes / macrophages and adipocytes may improve insulin resistance and t2 dm . Decreased sirt1 expression levels in circulating monocytes are correlated with metabolic syndrome, insulin resistance, and glucose intolerance in humans . Moreover, gillum et al . Reported that sirt1 expression was reduced in adipose tissues of obese males . In addition, mrna expression of cd14, a macrophage marker, in adipose tissue is negatively correlated with sirt1 expression . These data indicate that sirt1 may contribute to the regulation of inflammation in monocytes / macrophages and adipose tissue in humans . . Also demonstrated that myeloid cell - specific sirt1 knockout mice that were challenged with a high fat diet displayed high levels of activated macrophages in the liver and adipose tissues, thereby predisposing these animals to the development of systemic insulin resistance and metabolic derangement . Sirt1 physically interacts with the p65 subunit of nf-b and inhibits transcription by deacetylating p65 at lysine 310, leading to the suppression of inflammatory processes . Provided direct evidence that sirt1 activation reduced the tnf--induced inflammatory response, potentially via the deacetylation of nf-b (p65) in insulin - resistant adipocytes . Moreover, these authors reported that sirt1 knockdown in 3t3-l1 adipocytes increased nf-b (p65) acetylation and enhanced nf-b binding to target inflammation - related genes promoters . In addition, yoshizaki et al . Reported that sirt1 represses the activity of the ib kinase (ikk)-nf-b signaling pathway, inflammation - related gene expression, and the release of tnf- following lipopolysaccharide stimulation in macrophages . These authors reported that the pharmacological sirt1 activator srt1720 or resveratrol induced various anti - inflammatory activities . Furthermore, the treatment of obese and insulin - resistant zucker fatty rats with another sirt1 activator, srt2379, led to improved glucose tolerance, enhanced systemic insulin sensitivity, and the normalization of tissue markers of inflammation . Additionally, our recent report provided another mechanism with which to explain how sirt1 inactivation induces inflammation in thp-1 cells . Specifically, sirt1 inhibition may activate the nf-b signaling pathway through the phosphorylation of nf-b (p65) via the dysregulation of autophagy, resulting in the cellular accumulation of p62/sqstm1 . Moreover, the nutrient - sensing pathway regulates autophagy and involves sirt1, mammalian target of rapamycin (mtor) and 5' adenosine monophosphate (amp)-activated kinase (ampk). Notably, sirt1 inactivation resulted in increased mtor pathway activation and reduced ampk activation, leading to impaired autophagy . Thus, sirt1 may attenuate the inflammatory reaction in adipose tissues and monocytes / macrophages and thereby improve insulin resistance and t2 dm . Adipocytes play critical roles in the development of insulin resistance and t2 dm given that they can store excess saturated lipids and produce adipokines . Ppar- is an essential molecule for the modulation of fatty acid storage and glucose metabolism, and this factor is involved in adipose tissue differentiation . In mature white fat cells, ppar- regulates the induction of genes that are involved in free fatty acid (ffa) uptake and triglyceride synthesis, thereby increasing the lipid storage capacity of the cell . Sirt1 binds to ppar- by docking to the nuclear receptor corepressor and silencing the mediator of retinoid and thyroid hormone receptors, effects that represses the transcription - activating effects of ppar- . Furthermore, sirt1 overexpression was observed to lead to decreased fat storage and increased lipolysis, resulting in fat mobilization in response to food limitation, whereas sirt1-null mice exhibited a significant reduction in body weight . Additionally, in the adipose tissue of those sirt1-null mice, the average size of the adipocytes was smaller, the content of the extracellular matrix was lower, adiponectin and leptin were expressed at 60% of the normal level, and adipocyte differentiation was reduced . Moreover sirt1 deacetylates ligand - bound ppar- on lys268 and lys293; therefore, sirt1 and ppar- coordinately induce the browning of white adipose tissue . These data indicate that sirt1-dependent ppar- deacetylation regulates energy homeostasis, promoting energy expenditure over energy storage . Therefore, the combination of thiazolidinediones with sirt1 activator has potential as a therapy for obesity . Adiponectin exerts an antidiabetic effect, and plasma adiponectin levels are decreased in the contexts of obesity, insulin resistance, and t2 dm . The administration of adiponectin has been demonstrated to induce glucose - lowering effects and to improve insulin resistance in mice . Moreover, adiponectin - deficient mice exhibit insulin resistance and diabetes . The mechanisms by which adiponectin exerts its insulin - sensitizing effects may be mediated by an increase in fatty acid oxidation via the activation of ampk and ppar-. Additionally, sirt1 regulates adiponectin expression in adipocytes and foxo1 forms a transcriptional complex at the mouse adiponectin promoter with ccaat / enhancer - binding protein (c / ebp). Thus, sirt1 deacetylates foxo1 and enhances its interaction with c / ebp, resulting in the enhanced transcription of the gene that encodes adiponectin in adipocytes . Moreover, a study of muscle adiponectin receptor (adipor) 1ko mice demonstrated that this protein has a crucial role in the physiological and pathophysiological significance of adiponectin in muscle cells and is involved in the regulation of ca signaling as well as pgc-1 expression and activation . Adiponectin activates ampk by biding to adipor1, thereby activating sirt1 and deacetylating pgc-1 to improve mitochondrial function, oxidative stress, glucose and lipid metabolism, and exercise endurance . Sirt1 can affect glucose - lipid metabolism and insulin resistance through the modulation of mitochondrial function . The maintenance of energy and nutrient homeostasis during nutrient deprivation is accomplished through an increase in mitochondrial fatty acid oxidation in skeletal muscle . Previous studies have demonstrated a reduced rate of mitochondrial oxidative phosphorylation (oxphos) activity and increased intramyocellular lipid accumulation in the skeletal muscle of insulin - resistant patients with type 2 diabetes and elderly individuals . Specifically, these data indicate that defects in mitochondrial function may play an important role in t2 dm pathogenesis . An important component that drives this cellular oxidative process in mitochondria is the transcriptional coactivator pgc-1. Pgc-1 activation in skeletal muscle leads to efficient -oxidation of fatty acids, which is coupled to mitochondrial oxphos . In addition, pgc-1 maintains higher numbers of active mitochondria and oxphos protein, the levels of which are decreased in t2 dm . Through pgc-1 regulation, sirt1 modulates mitochondrial function and metabolic homoeostasis, increases the consumption of oxygen in muscle fibers and induces the expression of oxphos genes and mitochondrial biogenesis . Remarkably, the pgc-1-induced upregulation of genes that regulate mitochondrial fatty acid utilization was largely prevented by sirt1 knockdown . Furthermore, sirt1 can regulate ppar- activation through pgc-1 deacetylation, leading to the increased fatty acid oxidation . Thus, sirt1 activation may improve insulin resistance via accelerated fatty acid oxidation and mitochondrial biogenesis in skeletal muscle . In addition to the effect of increased lipid utilization via pgc-1-mediated mitochondrial biogenesis, pgc-1 markedly upregulates glucose transporter 4 (glut4) expression and glucose transport activity in murine c2c12 myotubes . The effects of pgc-1 on the activation of glut4 gene expression are reflected in the increased ability of myocytes to transport glucose, suggesting that the sirt1-regulated activation of pgc-1 influences insulin sensitization . The liver plays a central role in glucose and lipid metabolism in response to nutritional and hormonal signals . In a fasted state, the induction of hepatic glucose output and fatty acid oxidation is essential to sustain energetic balance . The production of glucose by the liver is controlled through a complex network of transcriptional regulators . During the early stage of fasting, glucagon induces cyclic amp (camp) response element - binding (creb) and creb - regulated transcription coactivator 2 (crtc2) to drive the expression of gluconeogenesis - related genes that supply the body with the necessary glucose . At the late stage of fasting, sirt1 is activated and deacetylates crtc2 to reduce the effects of glucagon . Moreover, at that time, sirt1 can activate pgc-1 and foxo1 through a deacetylation reaction, resulting in the induction of gluconeogenesis - related genes . Thus, sirt1 participates in the regulation of the metabolic switch that controls the shift from the early to the late phase of gluconeogenesis during fasting to maintain glucose homeostasis . Conversely, various reports using animal models have indicated that sirt1 may have an antidiabetic function . Transgenic mice with moderate sirt1 overexpression exhibited improved glucose tolerance due to reduced glucose output from the liver . Additionally, wang et al . Also demonstrated that sirt1 negatively regulates gluconeogenesis . In liver - specific sirt1-deficient mice, the reduced expression of rictor, which is a key component of the mtorc2 complex, impaired the akt - s473 phosphorylation, caused foxo1-s253 hypophosphorylation, and increased g6pase and pepck expression to establish chronic hyperglycemia . However, other liver - specific sirt1 knockout mice exhibit normal glucose levels under both fasting and fed conditions . Moreover, acute sirt1 knockdown in the mouse liver using an adenovirus system or sirt1 knockdown in the livers of type 2 diabetic rats using antisense oligonucleotides decreased basal hepatic glucose production and increased hepatic insulin responsiveness to glucose . Sirt1 has also been demonstrated to regulate gluconeogenesis through the deacetylation of signal transducers and activators of transcription (stat) 3 . Sirt1 deacetylates stat3, resulting in a decrease in stat3 activity and the subsequent inhibition of gluconeogenesis . Therefore, sirt1 induces glucose output from the liver in response to fasting via the deacetylation, and thereby inhibition, of stat3 . These results indicate that sirt1 has a complex role in the regulation of hepatic glucose metabolism under different conditions through the alteration in the expression of gluconeogenesis genes and the modulation of ctrc2, pgc-, foxo1, and stat3 activity . Dyslipidemia often coincides with t2 dm . During fasting or energy limitation, the liver increases lipid utilization and decreases lipid and cholesterol synthesis . Sirt1 enhances mitochondrial fatty acid oxidation in response to fasting by activating ppar- and pgc-1 in the liver . Moreover, sirt1 regulates srebp and lxr, both of which are involved in lipid synthesis in the liver: sirt1 deacetylates and inhibits srebp-1c activity, resulting in decreased lipid synthesis, and deacetylates and positively regulates lxr, contributing to reverse cholesterol transport from peripheral tissues . Sirt1 also activates fxr, which is involved in cholesterol catabolism . In liver - specific sirt1 knockout mice, the induction of fatty acid oxidation through ppar- and pgc-1 was reported to decrease, resulting in increased levels of hepatic ffas and hepatic steatosis . In addition, high fat diet - induced hepatic steatosis was improved in mice with overexpressed sirt1 and treatment with sirt1 activators such as resveratrol . Interestingly, recent reports have also indicated that the treatment of obese humans with resveratrol attenuates hepatic fat content and improves insulin resistance . Oxidative stress impairs the insulin signaling pathway and leads to the onset and progression of insulin resistance in t2 dm . In hyperglycemia, other metabolites, including ffa and several cytokines, such as tnf-, induce the overproduction of reactive oxygen species (ros) by the mitochondria, which are a primary source of ros . Ros trigger the activation of serine / threonine kinases, such as apoptosis signal - regulating kinase 1, c - jun n - terminal kinase, and ikk, which in turn increase the serine phosphorylation of irs-1 and decrease the tyrosine phosphorylation of irs-1 . This effect results in insulin resistance and inflammation (oxidative stress linked to inflammation). Pgc-1 deacetylation by sirt1 mediates mitochondrial biogenesis in addition to the overexpression of antioxidative enzymes, such as mn - sod, thereby reducing oxidative stress caused by the impaired mitochondria . Moreover, foxo3a is deacetylated by sirt1 and translocated to the nucleus, resulting in the upregulated catalase and protection against oxidative stress . The circadian clock, which produces physiological and behavioral rhythms, drives cycles of energy storage and utilization in the anticipation of changes during the day and night, and recent studies have revealed an association between the circadian clock and cellular metabolism . The transcription factors clock and bmal1 pay a central role in the regulation of circadian gene expression by binding to e - box elements within the promoters of clock - controlled genes (ccgs). Demonstrated that homozygous clock mutant mice exhibited a greatly attenuated diurnal feeding rhythm in addition to hyperphagia and obesity . Moreover, these mice developed a metabolic syndrome that was associated with hyperglycemia, hypoinsulinemia, and hepatic steatosis . Additionally, a high fat diet may disrupt behavioral and molecular circadian rhythms by altering the expression and cycling of clock genes, nuclear receptors and ccgs in the hypothalamus, fat and liver . These findings indicate that nutrient excess may affect the onset and progression of obesity - related diseases, such as diabetes . Moreover, sirt1 is a key modulator of the circadian clock machinery, and sirt1 expression or activity both oscillates in a circadian manner and is associated with circadian oscillations in nad levels . The clock - bmal1 complex interacts with sirt1 and binds to the promoters of circadian genes, including per, cryptochrome (cry), and nicotinamide phosphoribosyltransferase, which encodes the rate - limiting enzyme in nad biosynthesis . Recent reports have demonstrated that sirt1 participates in the regulation of circadian rhythms via the deacetylation of bmal1, per2, and histones h3k9 and h3k14 . Acetylated bmal1 recruits cry, a negative regulator of circadian - controlled gene expression, and promotes the acetylation of per2, a negative regulator of clock - bmal1 transcription, thereby enhancing its stability . Resveratrol (3,5,4'-trihydroxystilbene), a natural polyphenolic compound that is found in grapes and red wine, is a sirt1 activator . Numerous reports demonstrate the effects of resveratrol on the improvement of metabolic disorders in ob / ob, db / db, and high fat diet - induced obese mice or zucker fa / fa rats . In addition, resveratrol has exhibited beneficial effects on the longevity and metabolic abnormalities in high fat diet - induced obese mice; however, this compound exhibited no effect on lifespan extension in standard diet - fed mice . In humans, timmers et al . Reported that the administration of oral resveratrol (150 mg / day) to obese male patients for 30 days resulted in cr - like effects, such as improved insulin sensitivity, triglyceride levels, energy expenditure, hepatic lipid accumulation, and the activation of the ampk / sirt1 pathway in skeletal muscle . . Also demonstrated that treatment with resveratrol (10 mg / day) in t2 dm patients improves insulin sensitivity and oxidative stress, leading to more efficient insulin signaling via the akt pathway . However, other recent reports indicate that resveratrol has no effects on metabolism, including insulin resistance . . Demonstrated that oral resveratrol (75 mg / day) supplementation in nonobese and postmenopausal women with normal glucose tolerance does not improve metabolic function, such as insulin sensitivity . Poulsen et al . Also reported that high dose of resveratrol (500 mg / day) supplementation in obese men has no effects on the insulin sensitivity, turnover and oxidation of glucose . Thus, the efficacy of resveratrol for metabolism is controversial in humans, and further studies are required . Resveratrol is not a sirt1-specific activator, and the mechanism by which resveratrol activates sirt1 remains unclear . Although resveratrol originally directly can activate sirt1 allosterically, ampk is required upstream for the activation of sirt1 by resveratrol . Additionally, park et al . Reported that resveratrol activates sirt1 through the activation of ampk via the inhibition of phosphodiesterase 4 and the elevation of camp in cells, thereby providing a novel mechanism by which to explain sirt1 activation by resveratrol . A recent study reported by price et al . Also demonstrated a direct link between sirt1 and the metabolic benefits of resveratrol . These authors reported that a moderate dose of resveratrol first activated sirt1 and then induced the deacetylation of liver kinase b 1 and ampk activation, leading to increased mitochondrial biogenesis and function . Moreover, a high dose of resveratrol may directly activate ampk, independently of sirt1 . Synthetic compounds, such as srt1720 and srt2379, which are structurally distinct from resveratrol but have potent sirt1-activating power in vitro have been synthesized by sirtris pharmaceuticals . Among these compounds, the treatment of high fat diet - induced obese and ob / ob mice with srt1720 resulted in an improvement of insulin sensitivity, lower plasma glucose, and increased mitochondrial capacity . In addition, in zucker fa / fa rats, srt1720 treatment improved whole glucose homeostasis as evaluated using hyperinsulinemic - euglycemic clamp studies, as well as insulin sensitivity in adipose tissue, skeletal muscle, and liver . Furthermore, yoshizaki et al . Also demonstrated the efficacy of the sirt1 activator srt2379 against insulin resistance in high fat diet induced obese mice . These authors reported that this effect was related to reduced inflammation in adipocytes and macrophages . Over the last decade, our understanding of sirt1 has expanded from its initial characterization as a single nad - dependent class iii histone deacetylase that is responsible for longevity in yeast and which is associated with cr . Specifically, it has been found that sirt1 deacetylates not only histones but also many transcriptional regulators and proteins, thereby modulating diverse biological processes . Sirt1 also may exert antidiabetic effects via the modulation of insulin secretion and improvement of insulin resistance via its regulatory effects on insulin signaling, inflammation, mitochondrial function, and circadian rhythms.
|
Collected at 4 european centers, a total of 113 specimens from 105 patients were included in the present study . The material comprises 91 mpnsts, 21 neurofibromas, and 1 tumor - free sciatic nerve from a chondrosarcoma patient serving as a nonneoplastic nerve sheath control (supplementary table s1). All specimens have been examined by at least one pathologist, and in case of uncertainty of the diagnosis, the samples were excluded from the study . The mean age at diagnosis for patients with malignant disease was 48 years (range: 1179) for those with sporadic tumors (n = 47) and 33 years (range: 1470) for patients with nf1 (n = 44). The median age for patients with neurofibromas (n = 21) was 26 years (range: 1075). The patients were diagnosed during 19732008, and samples were collected from oslo university hospital, norway; skne university hospital, lund, sweden; university medical center groningen, netherlands; and the istituto ortopedico rizzoli, bologna, italy . The norwegian biobank is registered at the institute for public health, biobank registry no . The study was approved by the regional committee for medical and health research ethics south east, and patients were included following informed consent . Sampling, storage, and analysis of the swedish material were approved by the regional ethics committee of lund university, following informed consent from the patients . The dutch material was approved according to the university medical center groningen, whereas the rizzoli institute ethics committee approved the italian material, and according to institutional guidelines, adult patients or guardians for minors signed the informed consent form . Dna was extracted either by phenol / chloroform followed by ethanol precipitation as described by the manufacturer of the nucleic acid extractor (applied biosystems) or by the qiagen allprep dna / rna mini kit according to the manufacturer's protocol . Further, the dna was treated with sodium bisulfite using a previously described protocol and/or the epitect bisufite kit (qiagen), followed by qualitative and/or quantitative methylation - specific polymerase chain reaction (msp and/or qmsp, respectively). The msp reactions were carried out in a total volume of 25 l, containing 20 ng of bilsufite - treated template, 1 pcr buffer (qiagen), 0.2 mm deoxyribonucleotide triphosphate (roche diagnostics), 0.8 mm of each primer, and 0.651 u hotstartaq dna polymerase (qiagen). The sequences are listed in supplementary table s2 and a schematic drawing of the promoter region with primer locations is depicted in supplementary fig . S1 . Human placental dna (sigma - aldrich) treated with sssi methyltransferase (new england biolabs) served as a positive control for the methylated reaction, whereas bisulfite - modified dna from normal lymphocytes was used as positive control for the unmethylated reaction . The pcr products were separated using 2% agarose gels (biorad) stained with ethidium bromide (sigma - aldrich) and visualized by uv light using a genegenius gel documentation system (syngene). The results were independently scored by visual inspection by 2 of the authors, and all methylated samples were verified by a second, independent round of msp . The rassf1a gene promoter was further subjected to qmsp analysis using a protocol previously described . Primers and probe sequences are listed in supplementary table s2 and illustrated in supplementary fig . S1 . To normalize for potential variations in the amount of input dna (30 ng of bisulfite - treated template), dna methylation was calculated as percent of methylated reference (pmr) using the following equation:[(rassf1a / aluc4)sample(rassf1a / aluc4)positivecontrol]100 . Samples with pmr values exceeding the highest values among the benign neurofibromas and the nonneoplastic nerve sheath control (ie, pmr> 0) were scored as methylation positive . Total rna was isolated from 5 neurofibromas and 27 mpnsts using trizol (invitrogen) and converted to cdna using the high capacity rna - to - dna kit (applied biosystems) according to the manufacturer's protocol . Twenty nanograms of cdna was amplified in a 20-l reaction volume containing 1 taqman universal pcr mastermix (applied biosystems) and predesigned 1 taqman gene expression assays (applied biosystems; rassf1, hs 00200394_m1; rassf1 isoform a, hs 00945257_m1) using the following pcr program: 50c for 2 min, 95c for 10 min, then 45 cycles of 95c for 15 s followed by 60c for 1 min . The quantitative gene expression of rassf1/rassf1a was measured in real time using the 7900 ht sequence detection system (taqman, applied biosystems). All samples were analyzed in triplicate, and the median value was used for further data analyses . Universal human reference rna (a mixture of total rna from 10 different cell lines; agilent) was used to generate a standard curve, and the quantitative expression levels of rassf1 and rassf1a were normalized against the mean value of the endogenous controls actb (hs99999903_m1) and gusb (hs99999908_m1). Fisher's exact test was used for assessment of associations between categorical variables, while the mann - whitney - wilcoxon test was used to examine association between the methylation status of rassf1a and continuous variables . Associations to patient outcome was evaluated only for patients with available tissue from the primary tumor, and disease - specific survival was used as the endpoint where deaths of mpnst were considered events and patients who died of other causes were censored at the time of death . All mpnst cases included in the present study were monitored closely at the same institution where they were treated, thus the cause of death could be identified with great certainty . The survival curves were generated and compared using the kaplan meier method with the breslow test, and cox regression with the wald test was used to generate and test uni- and multivariate proportional hazards . Collected at 4 european centers, a total of 113 specimens from 105 patients were included in the present study . The material comprises 91 mpnsts, 21 neurofibromas, and 1 tumor - free sciatic nerve from a chondrosarcoma patient serving as a nonneoplastic nerve sheath control (supplementary table s1). All specimens have been examined by at least one pathologist, and in case of uncertainty of the diagnosis, the samples were excluded from the study . The mean age at diagnosis for patients with malignant disease was 48 years (range: 1179) for those with sporadic tumors (n = 47) and 33 years (range: 1470) for patients with nf1 (n = 44). The median age for patients with neurofibromas (n = 21) was 26 years (range: 1075). The patients were diagnosed during 19732008, and samples were collected from oslo university hospital, norway; skne university hospital, lund, sweden; university medical center groningen, netherlands; and the istituto ortopedico rizzoli, bologna, italy . The norwegian biobank is registered at the institute for public health, biobank registry no . The study was approved by the regional committee for medical and health research ethics south east, and patients were included following informed consent . Sampling, storage, and analysis of the swedish material were approved by the regional ethics committee of lund university, following informed consent from the patients . The dutch material was approved according to the university medical center groningen, whereas the rizzoli institute ethics committee approved the italian material, and according to institutional guidelines, adult patients or guardians for minors signed the informed consent form . Dna was extracted either by phenol / chloroform followed by ethanol precipitation as described by the manufacturer of the nucleic acid extractor (applied biosystems) or by the qiagen allprep dna / rna mini kit according to the manufacturer's protocol . Further, the dna was treated with sodium bisulfite using a previously described protocol and/or the epitect bisufite kit (qiagen), followed by qualitative and/or quantitative methylation - specific polymerase chain reaction (msp and/or qmsp, respectively). The msp reactions were carried out in a total volume of 25 l, containing 20 ng of bilsufite - treated template, 1 pcr buffer (qiagen), 0.2 mm deoxyribonucleotide triphosphate (roche diagnostics), 0.8 mm of each primer, and 0.651 u hotstartaq dna polymerase (qiagen). The sequences are listed in supplementary table s2 and a schematic drawing of the promoter region with primer locations is depicted in supplementary fig . S1 . Human placental dna (sigma - aldrich) treated with sssi methyltransferase (new england biolabs) served as a positive control for the methylated reaction, whereas bisulfite - modified dna from normal lymphocytes was used as positive control for the unmethylated reaction . The pcr products were separated using 2% agarose gels (biorad) stained with ethidium bromide (sigma - aldrich) and visualized by uv light using a genegenius gel documentation system (syngene). The results were independently scored by visual inspection by 2 of the authors, and all methylated samples were verified by a second, independent round of msp . The rassf1a gene promoter was further subjected to qmsp analysis using a protocol previously described . Primers and probe sequences are listed in supplementary table s2 and illustrated in supplementary fig . S1 . To normalize for potential variations in the amount of input dna (30 ng of bisulfite - treated template) dna methylation was calculated as percent of methylated reference (pmr) using the following equation:[(rassf1a / aluc4)sample(rassf1a / aluc4)positivecontrol]100 . Samples with pmr values exceeding the highest values among the benign neurofibromas and the nonneoplastic nerve sheath control (ie, pmr> 0) were scored as methylation positive . Total rna was isolated from 5 neurofibromas and 27 mpnsts using trizol (invitrogen) and converted to cdna using the high capacity rna - to - dna kit (applied biosystems) according to the manufacturer's protocol . Twenty nanograms of cdna was amplified in a 20-l reaction volume containing 1 taqman universal pcr mastermix (applied biosystems) and predesigned 1 taqman gene expression assays (applied biosystems; rassf1, hs 00200394_m1; rassf1 isoform a, hs 00945257_m1) using the following pcr program: 50c for 2 min, 95c for 10 min, then 45 cycles of 95c for 15 s followed by 60c for 1 min . The quantitative gene expression of rassf1/rassf1a was measured in real time using the 7900 ht sequence detection system (taqman, applied biosystems). All samples were analyzed in triplicate, and the median value was used for further data analyses . Universal human reference rna (a mixture of total rna from 10 different cell lines; agilent) was used to generate a standard curve, and the quantitative expression levels of rassf1 and rassf1a were normalized against the mean value of the endogenous controls actb (hs99999903_m1) and gusb (hs99999908_m1). Fisher's exact test was used for assessment of associations between categorical variables, while the mann - whitney - wilcoxon test was used to examine association between the methylation status of rassf1a and continuous variables . Associations to patient outcome was evaluated only for patients with available tissue from the primary tumor, and disease - specific survival was used as the endpoint where deaths of mpnst were considered events and patients who died of other causes were censored at the time of death . All mpnst cases included in the present study were monitored closely at the same institution where they were treated, thus the cause of death could be identified with great certainty . The survival curves were generated and compared using the kaplan meier method with the breslow test, and cox regression with the wald test was used to generate and test uni- and multivariate proportional hazards . In an initial (qualitative) msp screening study of several candidate genes (not shown), the rassf1a promoter was found methylated in 23 of 44 mpnst samples (52%), in contrast to complete absence of methylation in 9 neurofibromas and a normal sciatic nerve (supplementary table s1). No associations were found between rassf1a methylation and clinicopathological variables, including nf1 status, grade, localization, or size of the tumors, or patients' age, sex, or nationality . Due to interesting results from survival analyses, we subsequently reanalyzed the rassf1a gene promoter by qmsp and expanded the sample series to a total of 91 mpnsts, 21 neurofibromas, and the sciatic nerve . Sixty percent of the mpnsts were methylated, whereas all neurofibromas and the sciatic nerve remained unmethylated (supplementary table s1). The methylation frequency was slightly, but not significantly, higher among the nf1 patients compared with the non - nf1 patients (66% and 54%, respectively; p = .3). In concordance with the results from the qualitative analysis, no associations were found between the presence of quantitatively measured methylation of the rassf1a promoter and clinicopathological variables (supplementary table s3). For samples where rna was obtainable (n = 27), quantitative gene expression measurements of 2 assays amplifying different transcripts of the rassf1 gene were performed . For mpnsts, there was a strong association between promoter hypermethylation and reduced gene expression, p = .001 for the most specific assay, amplifying only rassf1a (fig . 1). This effect was significant both for nf1 (n = 15, p = .03) and for non - nf1 patients (n = 12, p = .003). Both mpnsts with methylated and unmethylated rassf1a promoter had lower expression than the benign neurofibromas (p = .0001 and p = .05, respectively), suggesting that additional mechanisms are involved in silencing the rassf1a gene in mpnst 1.the gene expression of rassf1a (assay hs 00945257_m1 detecting nm_007182.4, rassf1a) is significantly downregulated in mpnsts with promoter hypermethylation compared with tumors without rassf1a methylation, and also in mpnsts compared with neurofibromas independently of methylation . The gene expression of rassf1a (assay hs 00945257_m1 detecting nm_007182.4, rassf1a) is significantly downregulated in mpnsts with promoter hypermethylation compared with tumors without rassf1a methylation, and also in mpnsts compared with neurofibromas independently of methylation . For the mpnsts, a borderline significance was seen with the second assay, between promoter hypermethylation and reduced gene expression (p = .06; data not shown). In contrast to the first assay, the second assay amplified several transcript variants of the rassf1 gene . In the initial msp (qualitative) analyses, follow - up data for 36 patients with primary tumors were available, and stratification according to nf1 status suggested that rassf1a methylation could distinguish a subgroup of nf1 patients with worse disease - specific 5-year survival (n = 20, p = .011). This could be seen neither among patients with sporadic disease (n = 16, p = .68) nor in the unstratified mpnst patient cohort (n = 36, p = .11) (data not shown). Based on these initial findings, we subsequently expanded the sample series and used a quantitative and more standardized analysis, qmsp . For this analysis, long - term follow - up data were available for 60 specimens with primary tumor, out of the 90 mpnst patients included, and we confirmed that nf1 patients with rassf1a methylated tumors (n = 20) had a significantly worse prognosis than did patients with unmethylated tumors (n = 12, p = .014; fig . The mean disease - specific survival for nf1 patients with methylation was 27.3 months (95% ci: 17.237.4) compared with 47.4 months (95% ci: 37.557.2) for nf1 patients without methylated tumors . No prognostic value of rassf1a could be found for patients with sporadic disease (n = 28, p = .85; fig . 2.disease-specific survival based on rassf1a promoter methylation status for (a) patients with nf1-associated mpnsts and (b) patients with sporadic disease . Disease - specific survival based on rassf1a promoter methylation status for (a) patients with nf1-associated mpnsts and (b) patients with sporadic disease . A multivariate cox regression analysis revealed that methylation status of rassf1a was the strongest predictor of disease - specific survival (hazard ratio: 5.2; 95% ci: 1.419.4; p = .013) compared with tumor size, metastasis at time of diagnosis, and tumor location (p = .052, p = .054, and p = .076, respectively; table 2). Table 2.prognostic factors for 5-year disease - specific survival of nf1 patients with mpnstunivariatemultivariateparameterno . Of patientshr95% ciphr95% ciprassf1a2.8991.0328.143.04.013unmethylated12refmethylated205.2351.41319.397tumor size, cm301.0530.9921.118.091.0890.9991.187.05tumor location0.9360.3802.309.87.08nonextremities15refextremities170.3360.1011.121metastasis at time of diagnosis4.2991.45812.677.008.05no27refyes53.9760.97416.233abbreviations: hr, hazard ratio; ref, reference category.continuous variable . Prognostic factors for 5-year disease - specific survival of nf1 patients with mpnst abbreviations: hr, hazard ratio; ref, reference category . In an initial (qualitative) msp screening study of several candidate genes (not shown), the rassf1a promoter was found methylated in 23 of 44 mpnst samples (52%), in contrast to complete absence of methylation in 9 neurofibromas and a normal sciatic nerve (supplementary table s1). No associations were found between rassf1a methylation and clinicopathological variables, including nf1 status, grade, localization, or size of the tumors, or patients' age, sex, or nationality . Due to interesting results from survival analyses, we subsequently reanalyzed the rassf1a gene promoter by qmsp and expanded the sample series to a total of 91 mpnsts, 21 neurofibromas, and the sciatic nerve . Sixty percent of the mpnsts were methylated, whereas all neurofibromas and the sciatic nerve remained unmethylated (supplementary table s1). The methylation frequency was slightly, but not significantly, higher among the nf1 patients compared with the non - nf1 patients (66% and 54%, respectively; p = .3). In concordance with the results from the qualitative analysis, no associations were found between the presence of quantitatively measured methylation of the rassf1a promoter and clinicopathological variables (supplementary table s3). For samples where rna was obtainable (n = 27), quantitative gene expression measurements of 2 assays amplifying different transcripts of the rassf1 gene were performed . For mpnsts, there was a strong association between promoter hypermethylation and reduced gene expression, p = .001 for the most specific assay, amplifying only rassf1a (fig . 1). This effect was significant both for nf1 (n = 15, p = .03) and for non - nf1 patients (n = 12, p = .003). Both mpnsts with methylated and unmethylated rassf1a promoter had lower expression than the benign neurofibromas (p = .0001 and p = .05, respectively), suggesting that additional mechanisms are involved in silencing the rassf1a gene in mpnst . Fig . 1.the gene expression of rassf1a (assay hs 00945257_m1 detecting nm_007182.4, rassf1a) is significantly downregulated in mpnsts with promoter hypermethylation compared with tumors without rassf1a methylation, and also in mpnsts compared with neurofibromas independently of methylation . The gene expression of rassf1a (assay hs 00945257_m1 detecting nm_007182.4, rassf1a) is significantly downregulated in mpnsts with promoter hypermethylation compared with tumors without rassf1a methylation, and also in mpnsts compared with neurofibromas independently of methylation . For the mpnsts, a borderline significance was seen with the second assay, between promoter hypermethylation and reduced gene expression (p = .06; data not shown). In contrast to the first assay, the second assay amplified several transcript variants of the rassf1 gene . In the initial msp (qualitative) analyses, follow - up data for 36 patients with primary tumors were available, and stratification according to nf1 status suggested that rassf1a methylation could distinguish a subgroup of nf1 patients with worse disease - specific 5-year survival (n = 20, p = .011). This could be seen neither among patients with sporadic disease (n = 16, p = .68) nor in the unstratified mpnst patient cohort (n = 36, p = .11) (data not shown). Based on these initial findings, we subsequently expanded the sample series and used a quantitative and more standardized analysis, qmsp . For this analysis, long - term follow - up data were available for 60 specimens with primary tumor, out of the 90 mpnst patients included, and we confirmed that nf1 patients with rassf1a methylated tumors (n = 20) had a significantly worse prognosis than did patients with unmethylated tumors (n = 12, p = .014; fig . The mean disease - specific survival for nf1 patients with methylation was 27.3 months (95% ci: 17.237.4) compared with 47.4 months (95% ci: 37.557.2) for nf1 patients without methylated tumors . No prognostic value of rassf1a could be found for patients with sporadic disease (n = 28, p = .85; fig . 2.disease-specific survival based on rassf1a promoter methylation status for (a) patients with nf1-associated mpnsts and (b) patients with sporadic disease . Disease - specific survival based on rassf1a promoter methylation status for (a) patients with nf1-associated mpnsts and (b) patients with sporadic disease . A multivariate cox regression analysis revealed that methylation status of rassf1a was the strongest predictor of disease - specific survival (hazard ratio: 5.2; 95% ci: 1.419.4; p = .013) compared with tumor size, metastasis at time of diagnosis, and tumor location (p = .052, p = .054, and p = .076, respectively; table 2). Table 2.prognostic factors for 5-year disease - specific survival of nf1 patients with mpnstunivariatemultivariateparameterno . Of patientshr95% ciphr95% ciprassf1a2.8991.0328.143.04.013unmethylated12refmethylated205.2351.41319.397tumor size, cm301.0530.9921.118.091.0890.9991.187.05tumor location0.9360.3802.309.87.08nonextremities15refextremities170.3360.1011.121metastasis at time of diagnosis4.2991.45812.677.008.05no27refyes53.9760.97416.233abbreviations: hr, hazard ratio; ref, reference category.continuous variable . Prognostic factors for 5-year disease - specific survival of nf1 patients with mpnst abbreviations: hr, hazard ratio; ref, reference category . . Studies on a handful of genes have been reported (table 1) in addition to a recent paper where the methylomes of 10 pooled benign and 10 pooled malignant tumors were compared . Here, we add a detailed study analyzing the promoter methylation of rassf1a . In a large european series of mpnsts we have demonstrated rassf1a to be commonly methylated in this malignancy (60%), and at a frequency considerably higher than all normal and benign samples were unmethylated, underscoring that rassf1a promoter methylation is cancer specific . Furthermore, expression of the rassf1a gene was significantly reduced in mpnst samples with promoter hypermethylation compared with unmethylated samples . This indicates that methylation causes reduced gene activity, or gene silencing, which is in agreement with reports on other cancer types . Notably, however, also the mpnsts with unmethylated rassf1a promoter had significantly lower gene expression than in benign tumors, indicating that additional mechanisms of gene regulation are involved . Regulation of microtubules has been suggested to be one of the essential tumor suppressor activities of rassf1a, thereby ensuring and maintaining chromosomal stability . The impaired function of rassf1a in mpnst might contribute to the increased dna copy number variation and complex karyotypes that are key characteristics of mpnsts . Rassf1a methylation has been suggested to be preferentially present in the most aggressive tumors of various kinds, suggesting that it might serve as a marker for tumor progression and metastasis . In the current series of mpnsts, however, presence of rassf1a methylation was equally distributed among primary, relapsed, and metastatic lesions and between individuals with and without nf1 . It was also independent of tumor size and site (extremities or trunk), as well as the patient's country of origin, age, and gender . Interestingly, survival analyses showed that rassf1a methylation in mpnsts was a surrogate marker for poor prognosis among nf1 patients only and independently of clinical risk factors such as tumor size and metastasis . To the best of our knowledge, no molecular marker in mpnsts has previously been shown to discriminate consistently between inferior and good prognosis selectively for nf1 patients . Clinical factors such as large tumor size, incomplete resection, and distant metastasis are shown to be associated with inferior prognosis, which was also true for the present study . However, the multivariate survival analyses identified rassf1a methylation as the strongest predictor of outcome among these factors, emphasizing the clinical potential of our finding . Biomarkers that are able to predict prognosis could be valuable in decision making when considering treatment alternatives . In the case of mpnsts, one could argue that nf1 patients with methylated rassf1a, predicting inferior prognosis, would benefit from an extended follow - up protocol and adjuvant treatment . Although our study includes a large number of specimens, taking into account the rareness of the disease and the fact that the findings seem valid only for nf1 patients with mpnst, it results in quite small statistical categories . Thus, the prognostic value of rassf1a promoter methylation needs to be validated in an independent sample series . Nevertheless, since methylation of the same gene has been suggested as a prognostic marker for various tumor types, including different sarcomas, the methylation status of rassf1a holds great potential to differentiate patients with both nf and mpnst into groups of good and poor prognosis . This work was supported by grants from the norwegian cancer society (pr-2006 - 0442 to r.a.l ., financing s.a.d . As postdoctoral fellow, pr-2008 - 0163 to g.e.l ., pr-51260 - 2012 to r.a.l ., financing m.k . As a staff scientist) and the faculty of medicine, university of oslo (to r.a.l ., financing m.h . As a ph.d student).
|
Recently, serratia, pseudomonas / providencia, indole - positive proteus / acinetobacter / morganella, citrobacter, enterobacter and hafnia group of organisms (spice) were described to cause peritoneal dialysis (pd)-related peritonitis with a particularly high morbidity and mortality . Peritonitis caused by citrobacter is relatively uncommon and citrobacter freundii is the most common species involved . We report a case of pd - related peritonitis caused by c. freundii, which was successfully treated with double antibiotic coverage . A 76-year - old male with end stage renal disease due to type ii diabetes mellitus on pd for 6 months presented to the emergency room with abdominal pain and bloody peritoneal dialysate for 1 day . He was on regular maintenance automated pd using a cycler and reported no history of breakdown of aseptic technique or contamination during the catheter care . Upon examination, he was hypotensive with a blood pressure of 98/54 mm hg but afebrile and the catheter exit site was benign . A dialysate cell count and culture was obtained and the patient was started on empirical intravenous broad - spectrum antibiotic coverage with vancomycin and aztreonam (he was allergic to penicillin). Pd was continued during the hospital stay with the addition of 500 units of unfractionated heparin per liter of dialysate . His dialysate white blood cell count was> 3700 with 92% neutrophils and c. freundii was isolated upon its culture . A computed tomography scan of the abdomen showed no evidence of intestinal perforation, appendicitis or diverticulitis . Subsequently, his clinical condition stabilized with subsiding abdominal pain clearing of dialysate in 2 days . His antibiotic coverage was switched to oral ciprofloxacin along with intraperitoneal gentamycin, requiring an additional daytime manual exchange with 6-h dwell time in order to provide sustained antibiotic exposure to the infected peritoneal membrane, which is not possible with the cycler - assisted pd exchanges . The antibiotics were continued for a total duration of 14 days, and he was discharged in a stable condition . Peritonitis caused by the members of the family enterobacteriaceae is an important cause of mortality and morbidity in pd patients and accounts for up to 12% of all peritonitis episodes in some series . Citrobacter species, a part of this family, were not commonly associated with peritonitis until recently, when they were described among the spice organisms causing severe peritonitis . Most commonly, c. freundii has been associated with urinary tract infections, superficial wound infections and bacteremia especially in elderly, immunocompromised and hospitalized patients . It colonizes the gastrointestinal tract of humans and other animals and its translocation to the blood stream in dialysis patients especially in the setting of abnormal bowel habits is implicated in the development of peritonitis . Our patient had a particularly severe peritonitis with hemodynamic instability, and prompt use of intravenous broad spectrum antibiotics was life - saving . We encountered a bacterial strain that was resistant to ampicillin; a commonly described property of c. freundii and ascribed to the ampc gene, which provides high - level resistance to ampicillin and first generation cephalosporins . Indeed, the last published guidelines of the international society of pd in 2010 recommend following the sensitivity patterns in case of spice organisms and consider using double antibiotic coverage for 23 weeks . Earlier literature reports a high incidence of mortality and morbidity from catheter losses from pd - related peritonitis caused by c. freundii . Prompt institution of broad antimicrobial coverage in unstable patients and following the culture sensitivity pattern reduces mortality and catheter losses from peritonitis caused by c. freundii.
|
Recently, a group of small - molecule compounds have been identified as tyrosine receptor kinase (trk) receptor agonists that had profound pro - neuronal effects on neurogenesis and neuronal regeneration [14]. These compounds hold great clinical importance for neurodegenerative diseases as they may easily penetrate blood - brain - barrier, and have great potency with half - effective concentration (ec50) lower than 1 m . Among those small - molecule compounds, a new compound, 7,8,3-trihydroxyflavone (7,8,3-thf), was created as the derivative of 7,8-dihydroxyflavone but with better potency . In the peripheral auditory system, thf was shown to rescue noise - damaged or chemically - injured auditory nerves both in vitro and in vivo . However, the role of thf in spinal cord dorsal root ganglion (drg) neurons has not been characterized . Spinal cord drg neurons are subject to local anesthetics - induced neurotoxicity, which may contribute to various types of neurologic complications in young patients with regional anesthesia . Specifically, bupivacaine, one of the commonly used local anesthetics, is shown to induce neuronal apoptosis, growth cone collapse, and neurite retraction in drg neurons in animal models . Studies also showed that several of the neuronal signaling pathways, such as mitogen - activated protein kinase (mapk) and phosphatase and tensin homolog (pten) pathways, were closely associated with the regulation of bupivacaine - induced neurotoxicity in drg neurons . Member of the trk receptors trkb receptor, and its ligand brain - derived neurotrophic factor (bdnf) are both upregulated in drg neurons after spinal cord injury [1416], suggesting that there might be functional roles of the trkb signaling pathway in regulating drg neuron injury, but the exact role of trkb receptor in regulating local anesthetics - induce neurotoxicity remains elusive . In this study, we used an explant model to culture neonatal mouse drg neurons in vitro to mimic the biological conditions of young spinal cord sensory neurons . We first investigated the pro - neuronal effect of thf on the growth of neonatal drg neurons by examining its effect on drg neuron neurite outgrowth . The potential protective effect of thf and the involvement of trkb signaling pathways were examined by apoptosis assay, neurite outgrowth assay, and western blot assay . The results of our study may further our understanding on the possible pro - neuronal mechanisms of small - molecule trkb agonists in spinal cord sensory neurons . Doral root ganglion (drg) neurons were prepared from postnatal 23-day-(p2~p3) old c57bl/6j mice (jackson lab, usa). Briefly, drg clumps were quickly dissected into cold (4c) 1x hbss (invitrogen, usa). They were then transferred into dissociation medium with warm (37c) dulbecco s modified eagle medium (dmem, invitrogen, usa), 10% fetal bovine serum (fbs, invitrogen, usa), 1 x b27 neuronal supplement (invitrogen, usa), and 0.25% trypsin (invitrogen, usa) for 20 min . Dissociated cells were prepared by continuously triturating drg clumps in - and - out of 1 ml pipette tips for 10 min . They were then re - suspended in serum - free culture medium containing neurobasal medium (invitrogen, usa), penicillin / streptomycin (penstrep, invitrogen, usa), and 1 x b27 neuronal supplement (invitrogen, usa) in a tissue culture chamber with 5% co2 at 37c overnight . On the second day, the floating non - neuronal cells were removed . Drg neurons were maintained in culture medium for 2~7 days, depending on the requirement of designated experiments . Cultured drg neurons were fixed with 4% paraformaldehyde (pfa, sigma - aldrich, usa) and 0.3% triton (sigma - aldrich, usa) in 1x pbs (invitrogen, usa) for 30 min, then incubated with a rabbit anti - neurofilament 2000 (nf-2000) polyclonal antibody (santa cruz, usa) at 37c over night . On the second day, the culture was incubated with alexafluor 488 anti - rabbit secondary antibody at room temperature for 2 h. the green fluorescent images were viewed under an upright fluorescent microscope (bx51, olympus, japan). For each experimental condition, the averaged length of the longest 50~80 neurites were measured among at least three repeats, and then normalized to control condition . In drg neuron culture, various concentrations (2, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, 2000 nm) of 7, 8 the effect of thf on drg neuron growth was estimated by the neurite outgrowth assay . Drg neurons were collected from cultures and treated with a lysis buffer (50 mm tris at ph 7.6, 150 mm nacl, 1 mm edta, 10% glycerol, 0.5% np-40 and protease inhibitor cocktail, millipore, usa). After checking with concentrations, proteins were separated by electrophoresis on 12% sds - page gel, and transferred to pvdf membranes . The membranes were blocked with 5% non - fat dry milk and 1% bsa for 2 h, followed by incubation with primary antibodies of rabbit polyclonal anti - trkb (1:500, novus biological, usa) and rabbit polyclonal anti - p - trkb (1:200, novus biological, usa) overnight at 4c . On the second day, membranes were incubated with horseradish peroxidase - conjugated goat anti - rabbit secondary antibody (1:5,000, novus biological, usa) for 2 h at room temperature . The blots were then visualized by enhanced chemiluminescence (pierce, usa) according to the manufacturer s protocol . In drg neuron culture, briefly, 10 mm bupivacaine was added into culture for 2 h to induce substantial neuronal apoptosis . The culture was washed with fresh medium 3 times (10 min / time), and maintained for another 24 h before further evaluation . Drg culture was quickly washed with pbs, and fixed by 4% paraformaldehyde (pfa, sigma - aldrich, usa) for 30 min . The apoptosis of drg neurons was examined by a terminal deoxyribonucleotidyl transferase (tdt)-mediated biotin-16-dutp nick - end labeling (tunel) apoptosis kit (r&d systems, usa) according to the manufacturer s protocol . A mouse monoclonal neun antibody (millipore, usa) was used to identify the drg neurons . Fluorescent images were then examined under an upright fluorescent microscope (bx51, olympus, japan). Relative apoptosis was quantified as the percentage of tunel - positive cells among all neun - positive cells for each experimental condition . Statistical comparisons between means were examined by two - tailed unpaired student s t test on spss software (version 13.0, spss, usa). Doral root ganglion (drg) neurons were prepared from postnatal 23-day-(p2~p3) old c57bl/6j mice (jackson lab, usa). Briefly, drg clumps were quickly dissected into cold (4c) 1x hbss (invitrogen, usa). They were then transferred into dissociation medium with warm (37c) dulbecco s modified eagle medium (dmem, invitrogen, usa), 10% fetal bovine serum (fbs, invitrogen, usa), 1 x b27 neuronal supplement (invitrogen, usa), and 0.25% trypsin (invitrogen, usa) for 20 min . Dissociated cells were prepared by continuously triturating drg clumps in - and - out of 1 ml pipette tips for 10 min . They were then re - suspended in serum - free culture medium containing neurobasal medium (invitrogen, usa), penicillin / streptomycin (penstrep, invitrogen, usa), and 1 x b27 neuronal supplement (invitrogen, usa) in a tissue culture chamber with 5% co2 at 37c overnight . On the second day, the floating non - neuronal cells were removed . Drg neurons were maintained in culture medium for 2~7 days, depending on the requirement of designated experiments . Cultured drg neurons were fixed with 4% paraformaldehyde (pfa, sigma - aldrich, usa) and 0.3% triton (sigma - aldrich, usa) in 1x pbs (invitrogen, usa) for 30 min, then incubated with a rabbit anti - neurofilament 2000 (nf-2000) polyclonal antibody (santa cruz, usa) at 37c over night . On the second day, the culture was incubated with alexafluor 488 anti - rabbit secondary antibody at room temperature for 2 h. the green fluorescent images were viewed under an upright fluorescent microscope (bx51, olympus, japan). For each experimental condition, the averaged length of the longest 50~80 neurites were measured among at least three repeats, and then normalized to control condition . In drg neuron culture, various concentrations (2, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, 2000 nm) of 7, 8, 3-trihydroxyflavone (thf) were added for 2 days . The effect of thf on drg neuron growth was estimated by the neurite outgrowth assay . Drg neurons were collected from cultures and treated with a lysis buffer (50 mm tris at ph 7.6, 150 mm nacl, 1 mm edta, 10% glycerol, 0.5% np-40 and protease inhibitor cocktail, millipore, usa). After checking with concentrations, proteins were separated by electrophoresis on 12% sds - page gel, and transferred to pvdf membranes . The membranes were blocked with 5% non - fat dry milk and 1% bsa for 2 h, followed by incubation with primary antibodies of rabbit polyclonal anti - trkb (1:500, novus biological, usa) and rabbit polyclonal anti - p - trkb (1:200, novus biological, usa) overnight at 4c . On the second day, membranes were incubated with horseradish peroxidase - conjugated goat anti - rabbit secondary antibody (1:5,000, novus biological, usa) for 2 h at room temperature . The blots were then visualized by enhanced chemiluminescence (pierce, usa) according to the manufacturer s protocol . In drg neuron culture, treatment of bupivacaine was conducted according to the method described before . Briefly, 10 mm bupivacaine was added into culture for 2 h to induce substantial neuronal apoptosis . The culture was washed with fresh medium 3 times (10 min / time), and maintained for another 24 h before further evaluation . Drg culture was quickly washed with pbs, and fixed by 4% paraformaldehyde (pfa, sigma - aldrich, usa) for 30 min . The apoptosis of drg neurons was examined by a terminal deoxyribonucleotidyl transferase (tdt)-mediated biotin-16-dutp nick - end labeling (tunel) apoptosis kit (r&d systems, usa) according to the manufacturer s protocol . A mouse monoclonal neun antibody (millipore, usa) was used to identify the drg neurons . Fluorescent images were then examined under an upright fluorescent microscope (bx51, olympus, japan). Relative apoptosis was quantified as the percentage of tunel - positive cells among all neun - positive cells for each experimental condition . Statistical comparisons between means were examined by two - tailed unpaired student s t test on spss software (version 13.0, spss, usa). We first investigated the possible pro - neuronal effect of thf on drg neuron growth . The cultured mouse neonatal (p2~p3) drg neurons were treated with various concentrations of thf (2, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, and 2000 nm) for 2 days . Images of green - fluorescence - positive drg neuron neurites showed that thf significantly promoted neurite growth in a dose - dependent manner (figure 1a). The relative lengths of drg neuron neurites, corresponding to different thf concentrations, were compared in neurite outgrowth assay and fit with a hill equation (figure 1b). The ec50 concentration was determined to be 67.4 nm we then investigated the molecular pathway associated with pro - neuronal effect of thf on promoting drg neurite outgrowth . We used western blot assay to examine the protein level of trb receptor, as well as phosphorylated trkb (p - trkb). It showed that protein levels of trkb were unchanged by treatment of different concentrations of thf, but levels of p - trkb were significantly unregulated with the applications of higher concentrations of thf (figure 1c). Thus, our data strongly suggests that thf promoted drg neuron growth by acting as a trkb agonist . One of the commonly used anesthetics, bupivacaine, was shown to induce neurotoxicity in drg neurons in a concentration - dependent manner . As we showed thf had pro - neuronal effect on drg neuron growth, we wondered whether thf could also rescue bupivacaine - induced neurotoxicity in drg neurons . To test this hypothesis, we maintained drg culture for 3 to 5 days, followed by pre - treatment of thf for 24 h. we then used a high concentration of bupivacaine 10 mm (2 h) to induce significant neuronal apoptosis in drg neurons . Twenty - four hours after bupivacaine treatment, a tunel assay was conducted to evaluate the apoptosis among drg neurons . A neun neuronal - antibody was used alongside tunel assay to precisely identify the neuronal population in the culture . The immunohistochemical results demonstrated that while there was no thf pre - treatment (control), most of the drg neurons (neun - positive) were apoptotic (tunel - positive) due to bupivacaine - induced neurotoxicity (figure 2a, left column). However, when drg neurons were pre - treated with 50 nm or 1 m thf, bupivacaine - induced neuronal apoptosis was markedly reduced (figure 2a, right two columns). Quantified measurement of tunel assay showed that the percentage of apoptotic drg neurons was significantly reduced, from 85.34.5% with no thf pre - treatment (control), to 45.27.3% with 50 nm thf pre - treatment, then to 19.65.7% with 1 m thf (figure 2b, p<0.05). Thus, our data suggest that thf pre - treatment was effective in reducing bupivacaine - induced neuronal apoptosis in drg neurons . We then evaluated the protective effect of thf pre - treatment on bupivacaine - induced neurite retraction in drg neurons . At 24 h after bupivacaine treatment, immunohistochemical results with a neurite outgrowth assay demonstrated that there was no thf pre - treatment (control), but bupivacaine introduced significant neurite retraction in drg neurons (figure 3a, left column) however, when drg culture was treated with either 50 nm or 1 m thf, neurite retraction was markedly rescued (figure 3a, right two columns). Quantified measurement by neurite outgrowth assay indicated that drg neurite lengths were increased by 37933% with 50 nm thf pre - treatment, and by 157179% with 1 m thf, compared to the neurite length under control condition (figure 3b, p<0.05). We also evaluated whether the protection of thf on drg neurite retraction was correlated with the activation of the trkb signaling pathway . The result of western blot confirmed this hypothesis by showing that, in bupivacaine - injured drg neurons, phosphorylated trkb (p - trkb) was increased by thf pre - treatment in a concentration - dependent manner, whereas trkb protein levels were unaltered (figure 3c). Thus, our data suggest that thf pre - treatment was also effective in protecting bupivacaine - induced neurite retraction in drg neurons, very likely through activation of the trkb signaling pathway . We first investigated the possible pro - neuronal effect of thf on drg neuron growth . The cultured mouse neonatal (p2~p3) drg neurons were treated with various concentrations of thf (2, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, and 2000 nm) for 2 days . Images of green - fluorescence - positive drg neuron neurites showed that thf significantly promoted neurite growth in a dose - dependent manner (figure 1a). The relative lengths of drg neuron neurites, corresponding to different thf concentrations, were compared in neurite outgrowth assay and fit with a hill equation (figure 1b). The ec50 concentration was determined to be 67.4 nm we then investigated the molecular pathway associated with pro - neuronal effect of thf on promoting drg neurite outgrowth . We used western blot assay to examine the protein level of trb receptor, as well as phosphorylated trkb (p - trkb). It showed that protein levels of trkb were unchanged by treatment of different concentrations of thf, but levels of p - trkb were significantly unregulated with the applications of higher concentrations of thf (figure 1c). Thus, our data strongly suggests that thf promoted drg neuron growth by acting as a trkb agonist . One of the commonly used anesthetics, bupivacaine, was shown to induce neurotoxicity in drg neurons in a concentration - dependent manner . As we showed thf had pro - neuronal effect on drg neuron growth, we wondered whether thf could also rescue bupivacaine - induced neurotoxicity in drg neurons . To test this hypothesis, we maintained drg culture for 3 to 5 days, followed by pre - treatment of thf for 24 h. we then used a high concentration of bupivacaine 10 mm (2 h) to induce significant neuronal apoptosis in drg neurons . Twenty - four hours after bupivacaine treatment, a tunel assay was conducted to evaluate the apoptosis among drg neurons . A neun neuronal - antibody was used alongside tunel assay to precisely identify the neuronal population in the culture . The immunohistochemical results demonstrated that while there was no thf pre - treatment (control), most of the drg neurons (neun - positive) were apoptotic (tunel - positive) due to bupivacaine - induced neurotoxicity (figure 2a, left column). However, when drg neurons were pre - treated with 50 nm or 1 m thf, bupivacaine - induced neuronal apoptosis was markedly reduced (figure 2a, right two columns). Quantified measurement of tunel assay showed that the percentage of apoptotic drg neurons was significantly reduced, from 85.34.5% with no thf pre - treatment (control), to 45.27.3% with 50 nm thf pre - treatment, then to 19.65.7% with 1 m thf (figure 2b, p<0.05). Thus, our data suggest that thf pre - treatment was effective in reducing bupivacaine - induced neuronal apoptosis in drg neurons . We then evaluated the protective effect of thf pre - treatment on bupivacaine - induced neurite retraction in drg neurons . At 24 h after bupivacaine treatment, immunohistochemical results with a neurite outgrowth assay demonstrated that there was no thf pre - treatment (control), but bupivacaine introduced significant neurite retraction in drg neurons (figure 3a, left column) however, when drg culture was treated with either 50 nm or 1 m thf, neurite retraction was markedly rescued (figure 3a, right two columns). Quantified measurement by neurite outgrowth assay indicated that drg neurite lengths were increased by 37933% with 50 nm thf pre - treatment, and by 157179% with 1 m thf, compared to the neurite length under control condition (figure 3b, p<0.05). We also evaluated whether the protection of thf on drg neurite retraction was correlated with the activation of the trkb signaling pathway . The result of western blot confirmed this hypothesis by showing that, in bupivacaine - injured drg neurons, phosphorylated trkb (p - trkb) was increased by thf pre - treatment in a concentration - dependent manner, whereas trkb protein levels were unaltered (figure 3c). Thus, our data suggest that thf pre - treatment was also effective in protecting bupivacaine - induced neurite retraction in drg neurons, very likely through activation of the trkb signaling pathway . In the present study we discovered that, 7, 8, 3-trihydr - oxyflavone, a potent trkb agonist small molecule, had a profound pro - neuronal effect on neuronal growth, as well as protecting against local anesthetic - induced neurotoxicity in spinal cord drg neurons . We demonstrated that thf promoted neurite growth in neonatal drg neuron culture in a concentration - dependent manner . The calculated ec50 was calculated to be 67.4 nm, in line with other studies showing low thf ec50 . This finding was particularly encouraging as it suggests that thf can promote spinal cord neuronal development with great potency . We also demonstrated that the thf - activated trkb signaling pathway works by phosphorylating trkb in drg neurons, possibly acting as a trkb agonist . Recently, a relative of thf 7,8-dihydroxyflavone (dhf) was shown to promote spinal cord motoneuron embryonic development, as well as inducing functional recovery in myotrophic lateral sclerosis . Interestingly, dhf seemed to act through the akt signaling pathway rather than directly on the bdnf / trkb signaling pathway in motoneurons . Therefore, it seems that complex signaling pathways may be differentially associated with thf (or dhf) in regulating spinal cord drg neurons and motoneurons . Studies have shown that epigenetic regulation of microrna, as well as pten / akt signaling pathways, are involved in local anesthetics - induced neurotoxicity in drg neurons . In addition, p38 mitogen - activated protein kinase (mapk) was reported to be a critical component contributing to lidocaine - induced neurotoxicity in adult drg neurons . In the present study we demonstrated that thf had a protective effect on bupivacaine - induced neurotoxicity in drg neurons by rescuing neuronal apoptosis and neurite retraction . Also, we showed that the trkb signaling pathway was activated in accordance with thf treatment in bupivacaine - injured drg neurons . Although our data suggest that thf likely acts as a survival factor through a trkb - dependent manner in bupivacaine - injured drg neurons, future experiments would help to elucidate the direct involvement of the bdnf / trkb signaling pathway, as well as its association with other molecular pathways in anesthetics - induced neurotoxicity in drg neurons . Overall, in the present study we revealed new mechanism of 7, 8, 3-trihydroxyflavone as a pro - neuronal small molecule in promoting neuronal growth and protecting against bupivacaine - induced neurotoxicity in spinal cord drg neurons . The associated signaling pathway of thf in drg neurons is very likely through trkb activation . These findings may help to identify novel molecular targets to be applied in future clinical settings to benefit patients with spinal cord disorders or injuries.
|
Unilateral renal agenesis is a common associated urinary tract anomaly in high anorectal malformation . The remnant solitary functioning kidney with an intrinsic potential for hyperfiltration injury may also have varying degrees of congenital or acquired, structural, or functional affliction that compromise renal parenchymal function . Lower urinary tract factors including neurovesical malfunction and contamination from rectourinary fistula further complicate the issue . We present a critical analysis of the clinical course, management dilemmas, and outcome of a cohort of solitary renal units in high anorectal malformation . All cases of high anorectal malformation with a solitary functioning renal unit managed and followed up at a multidisciplinary pediatric nephro - urology clinic of a tertiary teaching hospital according to a protocol between 2000 and 2015 were included in the study . After a routine ultrasound confirmed the solitary renal unit, they were placed on antibiotic uroprophylaxis . A voiding cystourethrogram was carried out either during the distal cologram study or in the interim to detect vesicoureteral reflux and confirm bladder evacuation . A renal cortical scintigraphy (dimercaptosuccinic acid) evaluated the baseline parenchymal reserve and prenatal scarring / hypodysplasia . In case of urinary tract dilatation, a diuretic renogram (diethylene triamine pentaacetic acid) with a bladder catheter in situ was obtained to rule out obstruction . A panel of biochemical tests (serum creatinine, venous blood gas - bicarbonate, ph, and urinary microalbumin) evaluated renal status and the need for adjuvant renoprotective medications (calcium, bicarbonate, alpha calcidiol, and angiotensin - converting - enzyme inhibitors). Additional investigations (e.g., magnetic resonance imaging and urodynamic studies in neurovesical dysfunction) were conducted when indicated . Specific surveillance of a solitary renal unit at follow - up included tracking of hypertension, annual renal length for compensatory hypertrophy, and quantitative urinary microalbumin estimation . The management and follow - up was individualized according to the structural and functional pathology . This is a retrospective review of case records and follow - up evaluation with patient recall . Age at diagnosis of urinary malformation, sex, birth weight, consanguinity, details of antenatal diagnosis, and associated anomalies (cardiac, genital, sacral spinal) were noted . Clinical presentation, baseline investigations including biochemistry, imaging, and serial observations of these were studied . Details of clinical course, especially urinary tract infections (vur), medical and surgical management (creation and closure of urinary and bowel stoma, additional urinary tract surgical interventions), and outcome of the urinary tract malformation were collated and analyzed . Table 1 details the clinical profile and management of the cases . Of 95 cases of high anorectal malformation managed during this period out of 53 patients, 17 (32%) had a solitary functioning renoureteric unit . All but one were males, all were born at term with an average weight of 2.4 kg . Out of 17 cases, 3 (18%) were born to consanguineous parents . Seven cases were born at this center and ten elsewhere; six of the latter ten cases were transferred and managed here from the neonatal period while four reported later (4108 mos). The diagnosis of a solitary renal unit was made at birth / during infancy in 14/17 (82%) and later in 3/17 (18%). Thus, 13/17 (76%) cases were on our management protocol from the neonatal period onward . Solitary functioning kidney in high anorectal malformation - clinical profile and management the serum creatinine at presentation was normal in 13/17 (76%); 3/4 cases with elevated levels had presented later than 4 months of age . Most such renal units were structurally undetectable; three were cystic - hypoplastic while three others had dilated ureters; the latter had high - grade vesicoureteral reflux . In the solitary functioning units, 6/17 (35%) had hydroureteronephrosis, and one had a hypodysplastic kidney too . Significant urological abnormalities were noted in 10/17 (59%) including high - grade vesicoureteral reflux, ureterovesical junction (uvj) obstruction, anterior urethral hypoplasia, and neurovesical dysfunction . After initial stabilization, the renal cortical scan confirmed poor renal parenchymal function in the solitary unit in 3/17 (18%); the rest, including one with acute renal failure (case 2), had preserved function . The distal cologram showed rectourinary fistula in 12, rectovaginal fistula in the single female in this series, and no fistula in the rest four . The twelve fistula were four each in vesical, prostatic, and bulbar locations; the higher fistulas were wider with the vesical being the widest . A variety of associated anomalies were noted in this cohort, both of vacterl (8/17) and non - vacterl (2/17) nature . Despite uroprophylaxis, three had unilateral epididymo - orchitis ipsilateral to the side of the agenesis, and one of these (case 11) was complicated with a scrotal abscess . The microbiological flora in majority of the urine culture consisted of enteric gram - negative bacteria; a third of these grew multidrug resistant species in the second or third episode and required escalation of antimicrobial therapy . The initial choice of colostomy was sigmoid loop (8/17), sigmoid divided (7/17), or a transverse loop (2/17) stoma; three of these were revised . Stomal resiting from sigmoid loop to transverse divided was done in two (case 1, 2) to accommodate a left ureterostomy for uvj obstruction (case 2) or during abdominoperineal pull through for a short distal rectosigmoid length (case 1); both had multiple breakthrough urinary infections even after disconnection of the rectourinary communication at anorectoplasty . Similarly, a poorly constructed loop stoma was revised to divided in one with recalcitrant urinary infection (case 5). Imaging and ureteroscopy identified two with severely hypoplastic urethra [figure 1] that accomodated a number 7.5 fr . Two others had iatrogenic strictures at the prostatic and bulbar urethral level - postoperative or postinstrumentation . While three of these four urethral lesions were amenable to multiple scheduled dilatation, one required a perineal urethroplasty . Five cases were managed with urinary stomas - one temporary percutaneous nephrostomy and then a left sober's en - y ureterostomy for a uvj obstruction, one vesicostomy and four temporary suprapubic tube cystostomy during anorectoplasty for the management of various urethral issues . Note the right vesicoureteral reflux (straight arrow) in the ureter that was later noted to open ectopically into the prostatic urethra at cystoscopy . He also had a hypoplastic anterior urethra (curved arrow) delineated in the retrograde urethrogram other urinary tract surgical interventions included retrieval of calculi from the ureter, bladder and anterior urethra, ureterectomy, nephroureterectomy, ureteric reimplantation, scrotal debridement, and urethral dilatations . The total follow - up ranged from 11 to 123 mos (mean - 70 mos). The follow - up after anorectoplasty is 6115 mos (mean - 56 mos). The majority (14/17, 82%) are well, asymptomatic, and off uroprophylaxis; 13/14 (93%) cases have a nonobstructed, nonrefluxing solitary functioning renal unit while one with neurovesical dysfunction (case 4) is on clean intermittent catheterization (cic) to evacuate the bladder reliably . All 14 cases are normotensive and have normal urinary microalbumin; the renal units show the anticipated compensatory hypertrophy and increased renal length . Out of 17 cases, 3 (18%) have chronic renal failure (crf), are on cic, and await renal replacement therapy . Table 1 details the clinical profile and management of the cases . Of 95 cases of high anorectal malformation managed during this period out of 53 patients, 17 (32%) had a solitary functioning renoureteric unit . All but one were males, all were born at term with an average weight of 2.4 kg . Out of 17 cases, 3 (18%) were born to consanguineous parents . Seven cases were born at this center and ten elsewhere; six of the latter ten cases were transferred and managed here from the neonatal period while four reported later (4108 mos). The diagnosis of a solitary renal unit was made at birth / during infancy in 14/17 (82%) and later in 3/17 (18%). Thus, 13/17 (76%) cases were on our management protocol from the neonatal period onward the serum creatinine at presentation was normal in 13/17 (76%); 3/4 cases with elevated levels had presented later than 4 months of age . Most such renal units were structurally undetectable; three were cystic - hypoplastic while three others had dilated ureters; the latter had high - grade vesicoureteral reflux . In the solitary functioning units, 6/17 (35%) had hydroureteronephrosis, and one had a hypodysplastic kidney too . Significant urological abnormalities were noted in 10/17 (59%) including high - grade vesicoureteral reflux, ureterovesical junction (uvj) obstruction, anterior urethral hypoplasia, and neurovesical dysfunction . After initial stabilization, the renal cortical scan confirmed poor renal parenchymal function in the solitary unit in 3/17 (18%); the rest, including one with acute renal failure (case 2), had preserved function . The distal cologram showed rectourinary fistula in 12, rectovaginal fistula in the single female in this series, and no fistula in the rest four . The twelve fistula were four each in vesical, prostatic, and bulbar locations; the higher fistulas were wider with the vesical being the widest . A variety of associated anomalies were noted in this cohort, both of vacterl (8/17) and non - vacterl (2/17) nature . Despite uroprophylaxis, 7/17 (41%) cases had multiple episodes of urinary tract infections . Three had unilateral epididymo - orchitis ipsilateral to the side of the agenesis, and one of these (case 11) was complicated with a scrotal abscess . The microbiological flora in majority of the urine culture consisted of enteric gram - negative bacteria; a third of these grew multidrug resistant species in the second or third episode and required escalation of antimicrobial therapy . The initial choice of colostomy was sigmoid loop (8/17), sigmoid divided (7/17), or a transverse loop (2/17) stoma; three of these were revised . Stomal resiting from sigmoid loop to transverse divided was done in two (case 1, 2) to accommodate a left ureterostomy for uvj obstruction (case 2) or during abdominoperineal pull through for a short distal rectosigmoid length (case 1); both had multiple breakthrough urinary infections even after disconnection of the rectourinary communication at anorectoplasty . Similarly, a poorly constructed loop stoma was revised to divided in one with recalcitrant urinary infection (case 5). Imaging and ureteroscopy identified two with severely hypoplastic urethra [figure 1] that accomodated a number 7.5 fr . Two others had iatrogenic strictures at the prostatic and bulbar urethral level - postoperative or postinstrumentation . While three of these four urethral lesions were amenable to multiple scheduled dilatation, one required a perineal urethroplasty . Five cases were managed with urinary stomas - one temporary percutaneous nephrostomy and then a left sober's en - y ureterostomy for a uvj obstruction, one vesicostomy and four temporary suprapubic tube cystostomy during anorectoplasty for the management of various urethral issues . Note the right vesicoureteral reflux (straight arrow) in the ureter that was later noted to open ectopically into the prostatic urethra at cystoscopy . He also had a hypoplastic anterior urethra (curved arrow) delineated in the retrograde urethrogram other urinary tract surgical interventions included retrieval of calculi from the ureter, bladder and anterior urethra, ureterectomy, nephroureterectomy, ureteric reimplantation, scrotal debridement, and urethral dilatations . The total follow - up ranged from 11 to 123 mos (mean - 70 mos). The follow - up after anorectoplasty is 6115 mos (mean - 56 mos). All urinary and bowel stomas have been closed after completion of reconstructive procedures . The majority (14/17, 82%) are well, asymptomatic, and off uroprophylaxis; 13/14 (93%) cases have a nonobstructed, nonrefluxing solitary functioning renal unit while one with neurovesical dysfunction (case 4) is on clean intermittent catheterization (cic) to evacuate the bladder reliably . All 14 cases are normotensive and have normal urinary microalbumin; the renal units show the anticipated compensatory hypertrophy and increased renal length . Out of 17 cases, 3 (18%) have chronic renal failure (crf), are on cic, and await renal replacement therapy . Urinary tract anomalies are the most common associated anomaly in anorectal malformation and feature in 26%52% of several large series . Unilateral renal agenesis and vesicoureteral reflux comprise the majority of the urinary tract anomalies associated with high anorectal malformation . A solitary, normally functioning renoureteric units are compatible with life; however, a third develop renal injury by 1015 years of age and 20%50% decompensate to renal failure at adolescence / adulthood due to glomerular hyperfiltration - glomerulosclerosis . However, in the setting of urinary tract obstruction / vesicoureteral reflux in the unit, a vicious mix of infection - reflux nephropathy - scarring culminates in crf in early childhood . Among the gamut of anorectal malformation, the high anorectal malformation in males is at maximal risk of urinary infection because of multiple factors, including ipsilateral congenital anomalies of the kidney and urinary tract . This case series illustrates several management dilemmas; the rationale of management and lessons learned thereof . To the best of our knowledge, there has been no published report that addresses this particular subgroup of patients . It is surprising that anomaly scans did not detect the unilateral renal agenesis or cystic renal masses and testifies to the operator dependence of the investigation . The male preponderance (16/17) reflects the more common occurrence of high anorectal malformation in males . Similarly, such males are more likely to have upper urinary tract anomaly, especially renal agenesis . On close analysis, what mattered in the management was not the age at presentation at this referral center, but whether the solitary renal status and accompanying urinary flow obstruction / vesicoureteral reflux are diagnosed in the neonatal period and necessary management initiated, for example, distal stomal washes, uroprophylaxis, expedient management of interim urinary infection, and medical therapy for renal dysfunction . The accompanying high - grade vesicoureteral reflux into its dilated ureter is a source of infection and nidus for calculi formation (case 1); an ectopic ureteral opening into the posterior urethra (case 5) or vas deferens adds to the morbidity . Anomalies in the solitary functioning unit (hypodysplasia, vesicoureteral reflux, pelviureteric, or uvj obstruction) and the bladder outflow / urethra (neurovesical dysfunction - congenital or iatrogenic, urethral hypoplasia, urethral injury - stricture) are crucial in determining the clinical course and mandate individualized management . The combination of a single kidney with troublesome vesicoureteral reflux in anorectal malformation is relatively common and must be closely watched to prevent renal deterioration . A higher rectourinary fistula is linked to a greater risk of infection in two ways first, it is invariably wider and more contaminating; second, it is associated with greater neurovesical dysfunction . The described protocol for solitary renoureteric units incorporating directed imaging and cystoscopy clarifies the pathological anatomy at the earliest and ensures optimal continued surveillance, especially in the 1 year of life during renal growth . Like others, we observed that a normal renal length at birth and the anticipated compensatory hypertrophy was accompanied by preserved renal function . Unlike rectovestibular / rectovaginal fistulas in females, rectourinary fistulas predispose the male urinary tract to a relatively higher risk of infection . The common embryogenesis of mesonephric duct derivatives explains the association between structural facts such as ipsilateral renal agenesis, ectopic opening of verumontanum near the bladder neck, abnormal opening of ureter into vas and their functional implications of congenital neurovesical dysfunction, vesicoureteral reflux, and urethrovasal reflux . The proximity of the rectourinary fistulous and vasal opening in the posterior urethra and surgical instrumentation around the veru and bladder neck during surgery for anorectal malformation with prostatic or vesical fistulas adds to the risk of an epididymo - orchitis . Recurrent epididymitis in a patient with anorectal malformation warrants a comprehensive urologic investigation; it is often coexistent with or predates an ascending vur into the solitary renal unit . Urologic diagnosis in high defects assumes an equal priority as the decision for and siting of the colostomy in the neonatal period . In general, a temporary urinary diversion, tubed or otherwise, may be anticipated in the presence of a grossly dilated solitary renoureteric system, whether refluxing or obstructed . Here, the siting of the bowel and urinary diversion can be planned to be as apart from each other as feasible so as to avoid fecal contamination . Else, resiting of colostomy would be required to accommodate a later urinary stoma (case 1, 2). In our practice, a well - constructed spur of a loop stoma effectively diverts the fecal stream . In persistent urinary infection, we have electively performed divided stomas in all anorectal malformations with a single kidney at the outset . Interestingly, recent studies have indicated that loop stomas do not necessarily confer an increased risk of urinary infection than divided stomas . Despite precautions and rectourinary disconnection at anorectoplasty, a quarter of patients had ureteral and urethral issues that complicated the course and prompted additional surgical interventions to arrest urinary infections and preserve renal function . When the solitary renoureteric unit and the vesicourethral channel were normal, the timetable of managing the anorectal malformation was as expected . However, in those with compromised solitary renoureteric system, either due to anomalies in the agenetic side or the functioning side or the bladder outflow - urethra, the number of stomas / surgical interventions was increased, and stoma closure was delayed . Postoperatively, constipation and bowel bladder dysfunction are important triggers in initiating an urinary infection; in solitary renal units, the risk of parenchymal loss was real with every such episode . In high anorectal malformation with neurovesical dysfunction, strict cic and bowel enemas were helpful . Several cases in this cohort are entering the second decade of life and would need continued lifelong surveillance to identify evolving hyperfiltration injury . The presence of a solitary functioning renal unit has far reaching implications in the management of high anorectal malformation in children, especially in males . The investigations are geared to decipher the pathological anatomy of the entire upper and lower urinary tract from the neonatal period so as to facilitate strict surveillance and ensure renal parenchymal preservation . The impact of each of these factors on treatment planning and surgical management must be understood to avoid misadventures.
|
The traditional medicine (trm) of korea and china share the same cultural heritage, and the two countries are taking central role within the world health organization western pacific regional office in terms of east asian trm . East asian trm employs acupuncture and herbal medicine as its major forms of treatment, and currently enjoys an important status within the global sphere of trm along with their own domestic medical market . The korean and chinese trm have experienced influences from each other during their respective development processes in the late 19th century . They share general similarities as for the cooperative relations between the east asian trm and western biomedicine; however, they have exhibited significant differences from the social and political influences during the 19th century modernization . Although their educational systems have large variations on school years, curriculum, and accreditation system in both the national and private levels, and have been satisfactory for their nations,2, 3, 4 there still lies a need for standardization in respect to the professionalization of the trm in the world . The korean and chinese trm, which constitute the most developed forms of east asian trm, currently boast independent educational systems and programs ranging from 4 years to 8 years . The korean and chinese trm have continuously pursued the modernization and standardization of educational programs since the onset of the modern era . Although the korean and chinese trm have chased similar objectives, major discrepancies have emerged in terms of the major factors involved in the process of the modernization and standardization of educational programs . As for the korean trm, the modernized system of education and clinical practices has been implemented based on the market logic, and all the schools of the korean trm were established with a 6-year curriculum in private universities until the school of korean medicine opened at pusan national university in 2008 . During this process, the korean trm was exposed to a constant conflict with western biomedicine, and established its own standardized educational programs comparable to those of western medicine.6, 7 meanwhile, the modernization and standardization of educational programs in chinese trm were led by the chinese government with the intention of popularization and globalization of their cultural heritage . As a result, the chinese medicine has schooling systems varying from 4 years to 7 years depending on specific situations and the popularization strategy of the chinese government . As such, the educational programs associated with the korean and chinese trm have been influenced by not only internal efforts to achieve development, but also by surrounding factors of cultural, social, and political circumstances . Recently, both korean and chinese trm are actively seeking further improvement through standardization and professional specialization of their educational programs.10, 11, 12, 13 the medical education is currently focusing on the standardization as to provide essential competencies of medical professions, and has been a basis for their professional and social status . As for these, the opinions of the trm professionals, who have trained for their clinical skills and knowledge with university educational systems, would be needed, since they have examined its practicality in everyday clinical situation and would steer the future improvement of east asian trm.16, 17 we examined the attitude of korean and chinese trm doctors on their own medical education at the university level and the educational curriculums that should be emphasized for clinical competitiveness.16, 17 for this reason, we reviewed previous studies and improvised questionnaires for measuring those, including standardization of educational programs,18, 19, 20, 21, 22 professional ethics and medical humanities,21, 24 philosophical theories of trm, and its scientific approaches.25, 26, 27 this study would contribute to the understanding of the current status of the trm education at the university level, and would provide foundations for standardizing and expanding the established trm educational system in the world . As for the current situation of trm education in the university, we used five items acquired from previous studies . The five items are related to the standardization of the educational program, uniqueness of the university, philosophy of trm, sense of duty as a doctor, and professional ethics . The detailed questionnaire items are as follows: the educational contents taught by universities of trm are standardized, each university of trm has its own uniqueness, students are instilled with the sense of mission that comes from being a trm doctor, students have been taught the professional ethics that come with being medical specialists, and sufficient energy is being spent on the teaching of the philosophy of trm . Each item is scored using a 5-point likert scale from not at all (1) to very much (5). Each item is scored using a 5-point likert scale from not needed at all (1) to very much needed (5). The factors underneath the questionnaire were extracted using a factor analysis, and used for the comparison between the korean and chinese trm doctor groups . The survey was conducted from october 10, 2010 to november 15, 2010 for the korean trm doctors, and from december 2010 to january 2011 for the chinese trm doctors . The attitude on education of trm, along with sex, age, and clinical experience, was collected . After coding the required data, chi - square was used to examine the sex, age, and clinical - experience groups between the korean and chinese trm doctor groups . An exploratory factor analysis with varimax rotation was used to find the latent factors inside the questionnaire, and the cronbach was used for the test of internal consistency of the factors and items . The number of factors was determined with consideration of the eigenvalue, and a principal component factor analysis was used for the factor extraction . The varimax rotation was employed for the reason that it maintains the mutual independence between the factors . The t test with levene's test for the homogeneity of variance was used to examine the differences between the korean and chinese trm doctor groups on the recognition of the current situation and the needed curriculums as for the trm education at the university . The statistical results were presented as frequency (%) or mean and standard deviation (sd), and the levels of statistical significance were set at p <0.05, p <0.01, and p <0.001 . As for the current situation of trm education in the university, we used five items acquired from previous studies . The five items are related to the standardization of the educational program, uniqueness of the university, philosophy of trm, sense of duty as a doctor, and professional ethics . The detailed questionnaire items are as follows: the educational contents taught by universities of trm are standardized, each university of trm has its own uniqueness, students are instilled with the sense of mission that comes from being a trm doctor, students have been taught the professional ethics that come with being medical specialists, and sufficient energy is being spent on the teaching of the philosophy of trm . Each item is scored using a 5-point likert scale from not at all (1) to very much (5). Each item is scored using a 5-point likert scale from not needed at all (1) to very much needed (5). The factors underneath the questionnaire were extracted using a factor analysis, and used for the comparison between the korean and chinese trm doctor groups . The survey was conducted from october 10, 2010 to november 15, 2010 for the korean trm doctors, and from december 2010 to january 2011 for the chinese trm doctors . The attitude on education of trm, along with sex, age, and clinical experience, after coding the required data, a descriptive statistics was used to describe the demographic features of the participants . Chi - square was used to examine the sex, age, and clinical - experience groups between the korean and chinese trm doctor groups . An exploratory factor analysis with varimax rotation was used to find the latent factors inside the questionnaire, and the cronbach was used for the test of internal consistency of the factors and items . The number of factors was determined with consideration of the eigenvalue, and a principal component factor analysis was used for the factor extraction . The varimax rotation was employed for the reason that it maintains the mutual independence between the factors . The t test with levene's test for the homogeneity of variance was used to examine the differences between the korean and chinese trm doctor groups on the recognition of the current situation and the needed curriculums as for the trm education at the university . The statistical results were presented as frequency (%) or mean and standard deviation (sd), and the levels of statistical significance were set at p <0.05, p <0.01, and p <0.001 . There were significant differences between the korean and chinese trm doctors in sex (= 24.336, p <0.001) and age (= 17.355, p <0.001) groups; however, not significant in clinical experience (= 3.896, p = 0.273). A total of 312 responses were collected; however, six responses are excluded for the incomplete response, and 306 were used for the analysis . One hundred eighty - eight korean and 118 chinese trm doctors participated in the study . One hundred forty - four (76.6%) of the korean and 58 (49.2%) of the chinese trm doctors were males . As for their ages, 74 (39.3%) of the korean trm doctors were in their 40s, and 54 (45.8%) chinese trm doctors were in their 30s . As for the years of clinical experiences, there were no significant differences between the korean and chinese trm doctors . Sixty - four (34.1%) korean trm doctors had 610 years, while 34 (28.9%) of the chinese trm doctors had 1120 years . The preliminary questionnaire included item related to natural sciences, such as molecular biology and convergence and interdisciplinary research; however, it was deleted after testing its validity . The factor analysis was repetitively implemented for this, and these two items showed low cronbach and factor loading . An exploratory factor analysis with varimax rotation was performed to find three factors that explain 72.0% of the total variance . Factor 1 has 0.822 as for the cronbach, and was labeled as medical humanities . Factor 2 has 0.746 as for the cronbach, and was labeled as professionalism and scientific mind, and factor 3 has 0.528 as for the cronbach, and labeled as needed program . Five items as for the recognition of the current situation in trm education were suggested, and there were significant differences between the korean and chinese trm doctors . The chinese trm doctors showed a significantly higher score than the koreans in the standardization of educational program (3.42 0.99 and 3.09 0.91), uniqueness of the university (3.73 0.97 and 3.05 0.96), sense of duty as a doctor (3.99 0.88 and 2.88 0.87), and professional ethics (4.08 0.77 and 2.93 0.91, respectively). These results show that the chinese trm doctors consider their university education for trm more positively as for the standardization and professional ethics than the koreans . All three factors, including medical humanities, professionalism and scientific mind, and needed programs, showed significant differences between the korean and chinese trm doctors . The chinese trm doctors showed a significantly higher score than the koreans in medical humanities (4.62 0.49 and 4.31 0.59), professionalism and scientific mind (4.07 0.82 and 3.89 0.67), and needed programs (4.14 0.61 and 3.86 0.73). These results show that the chinese trm doctors are aware of the need for curriculums for medical humanities, social medicine, clinical specialist program, scientific - research methodology, complementary and alternative medicine, and medical classics than the koreans . As shown in table 4, the korean and chinese trm doctors consider the medical humanities, such as character development and professional ethics of the medical students, understanding on the traditional philosophy, and social awareness, has top priority . There were significant differences between the korean and chinese trm doctors in sex (= 24.336, p <0.001) and age (= 17.355, p <0.001) groups; however, not significant in clinical experience (= 3.896, p = 0.273). A total of 312 responses were collected; however, six responses are excluded for the incomplete response, and 306 were used for the analysis . One hundred eighty - eight korean and 118 chinese trm doctors participated in the study . One hundred forty - four (76.6%) of the korean and 58 (49.2%) of the chinese trm doctors were males . As for their ages, 74 (39.3%) of the korean trm doctors were in their 40s, and 54 (45.8%) chinese trm doctors were in their 30s . As for the years of clinical experiences, there were no significant differences between the korean and chinese trm doctors . Sixty - four (34.1%) korean trm doctors had 610 years, while 34 (28.9%) of the chinese trm doctors had 1120 years . The preliminary questionnaire included item related to natural sciences, such as molecular biology and convergence and interdisciplinary research; however, it was deleted after testing its validity . The factor analysis was repetitively implemented for this, and these two items showed low cronbach and factor loading . An exploratory factor analysis with varimax rotation was performed to find three factors that explain 72.0% of the total variance . Factor 1 has 0.822 as for the cronbach, and was labeled as medical humanities . Factor 2 has 0.746 as for the cronbach, and was labeled as professionalism and scientific mind, and factor 3 has 0.528 as for the cronbach, and labeled as needed program . Five items as for the recognition of the current situation in trm education were suggested, and there were significant differences between the korean and chinese trm doctors . The chinese trm doctors showed a significantly higher score than the koreans in the standardization of educational program (3.42 0.99 and 3.09 0.91), uniqueness of the university (3.73 0.97 and 3.05 0.96), sense of duty as a doctor (3.99 0.88 and 2.88 0.87), and professional ethics (4.08 0.77 and 2.93 0.91, respectively). These results show that the chinese trm doctors consider their university education for trm more positively as for the standardization and professional ethics than the koreans . All three factors, including medical humanities, professionalism and scientific mind, and needed programs, showed significant differences between the korean and chinese trm doctors . The chinese trm doctors showed a significantly higher score than the koreans in medical humanities (4.62 0.49 and 4.31 0.59), professionalism and scientific mind (4.07 0.82 and 3.89 0.67), and needed programs (4.14 0.61 and 3.86 0.73). These results show that the chinese trm doctors are aware of the need for curriculums for medical humanities, social medicine, clinical specialist program, scientific - research methodology, complementary and alternative medicine, and medical classics than the koreans . As shown in table 4, the korean and chinese trm doctors consider the medical humanities, such as character development and professional ethics of the medical students, understanding on the traditional philosophy, and social awareness, has top priority . The educational system for the korean and chinese trm has continuously improved during and after the 19th century modernization,30, 31 and it has also served as a pivotal element for promoting the social status of korean and chinese trm doctors . As is well known, the standardization of profession - related knowledge placed during the specialization process of professionals has been an important factor for their social recognition . In other words, professionals can obtain and maintain a higher social status for their standardized and specialized professional knowledge, and have made comprehensive efforts to achieve those . The association of american medical colleges placed the learner - oriented competency - based education at the learner level and the outcome - based curriculums at the educational organization level as their major goal . European nations have implemented the international standardization of medical education under the auspices of the world federation for medical education and the association for medical education in europe . From an international perspective, the institute for international medical education has sought the international standardization as to achieve global minimum essential requirements for medical education . The seven domains of global minimum essential requirements are (1) professional values, attitudes, behavior, and ethics; (2) scientific foundation of medicine; (3) clinical skills; (4) communication skills; (5) population health and health systems; (6) management of information; and (7) critical thinking and research.15, 35, 36 medical education has chased the globalization of medicine by implementing the standardization of essential education, and paid attention to the essential competencies that a doctor should possess to support the concept of a doctor as a global profession . And, educational contents and curriculums of medicine have been inevitably influenced by these changes . Amid the global trend of standardization of medical education, it would be interesting to see the current situation in korean and chinese trm, which are major companions in east asian traditional forms of medicine . We recruited trm doctors in korea and china with similar profiles of clinical experiences (table 1). As for the recognition of current education (table 3), chinese trm doctors are more satisfied with the standardization and professional ethics when compared to korean trm doctors, except the knowledge in philosophy . The reason for this might come from the fact that the modernization and standardization of chinese trm education were led by their government, and had not experienced conflicts with other medical professions as shown in korea . And, as for the needed curriculums, we improvised a questionnaire with nine items in three factors explaining 72% of the total variances (table 2). The three factors of medical humanities, professionalism and scientific mind, and needed programs were shown to have acceptable internal consistency in this study . Both the korean and chinese trm doctors recognized the need of medical humanities37, 38 that contributes to the character development of students as medical professionals (table 4), when compared to the complementary and alternative medicine and medical classics . And, when we compared the differences between the korean and chinese trm doctors (table 4), the korean doctors were found to be more satisfied with their educational programs from the result of many studies18, 19, 26, 27, 39, 40, 41, 42, 43 on the educational curriculum development in korea, which is required for their survival . It is quite interesting that the chinese trm doctors are satisfied with the current educational system, yet it requires more curriculums for their university education . This discrepancy might come from the fact that the chinese trm has been structured and supported by the government, which does not have flexibility for incorporating the needs from clinical practitioners and up - to - date trends in medical education . The globalization and standardization of trm are on the rise in response to the changes in the global market.22, 45 the educational system for trm has achieved a substantial standardization by itself;46, 47 however, there is also a need for mutual understanding and collaboration between the korean and chinese trm professionals along with the eastern trm and western biomedicine to achieve an established institutional framework of educational system.48, 49, 50, 51 this study would provide a foundation for understanding korean and chinese trm educational system, and establishing more efficient and standardized educational curriculums as to institute globalized medical professions.
|
Bites from venomous snakes kill more people in the developing world than some of the world's better recognized and better studied neglected tropical diseases . . Though not all bites are by venomous snakes or result in poisoning, up to 2 million of these bites result in the injection of venom, with hundreds of thousands of significant injuries and as many as 94,000 to 125,000 deaths occurring primarily in india, southeast asia, and sub - saharan africa [2, 3]. The vast majority of snakebites occur in impoverished, rural populations with limited access to medical treatment . Mortality from snakebite is unequivocally linked to socioeconomic markers of poverty and even a successful hospital treatment can cause economic ruin . A recent study from the indian state tamil nadu analyzed how patients hospitalized for snakebite paid for their expenses: 40% took loans, 20% sold stored crops, 15% sold valuables 10% sold cattle, and many reported removing their children from school all while incurring up to 12 years income worth of debt . It is estimated that around 10,000 people die from snakebite each year in tamil nadu, alone, more than twice the total number of deaths claimed by landmines each year, worldwide [4, 5]. Neostigmine is an acetylcholinesterase inhibitor (achei) that is administered intravenously and is currently recommended by the who for the treatment of neurotoxic snakebite . Acetylcholinesterase inhibiting drugs such as neostigmine and edrophonium are thought to reduce the neuromuscular block from neurotoxic snakebite by increasing the amount of acetylcholine at the neuromuscular junction as it does in the treatment of myasthenia gravis or the reversal of nondepolarizing neuromuscular blocking agents [69]. Atropine or glycopyrrolate, in intravenous (iv) form, are usually coadministered with acheis to blunt the undesirable muscarinic effects of acheis . However, coadministration is not necessary in some clinical studies, for example, in myasthenia gravis patients receiving intranasal (in) administration for up to one year [10, 11]. Interestingly, in neostigmine has been used to treat myasthenia gravis in several studies [1013] and we recently showed in a human study that it could reverse mivacurium - induced neuromuscular blockade by this route . The present study tested the hypothesis that neostigmine, given in, would be an effective initial treatment of naja naja envenomed mice . The early use of acheis leads to a considerable increase in the ld50 in mice and rats having undergone experimental envenomation [15, 16]. Our study is distinguished from those by the replacement of parenteral neostigmine with topically applied in neostigmine . The rationale for this study is that since neurotoxic snakebites often occur far from hospitals, by eliminating the need for injection (e.g., of parenteral neostigmine or intravenous antivenin), we may be able to shorten time to treatment and save lives . The study was approved by the animal research committee of a contract research laboratory in hyderabad, india, an iacuc - certified laboratory and performed by a trained technician, a full - time dvm and one of us (mrl) who performed experiments at the facility . Unfractionated n. naja venom was purchased from sigma - aldrich (st . Louis, mo, usa); neostigmine and atropine were purchased from besse medical (ann arbor, mi, usa). Polyvalent antivenom (vins bioproducts, andhra pradesh, india) was available at all times in the event of accidental envenoming of staff . A small pilot study was carried out to assess the potency of the reconstituted lyophilized n. naja venom to test if it was comparable to published reports of other commercially available unfractionated, frozen, or lyophilized n. naja venom at 0.3 mg / kg [15, 1719]. Mice were pseudorandomized in batches of 5 with tails marked 1 to 5 stripes by sharpie felt tip pen to receive intraperitoneal (ip) injections of n. naja venom (2.5 ld50, n = 20; 5 ld50, n = 10 and 10 ld50, n = 10) concomitantly with atropine, which blunts the muscarinic effects of neostigmine and has previously been shown to have no effect on ld50 when experimentally injected with snake venom . The ip agents (venom and atropine) were adjusted for the weight of each individual mouse by the facility veterinarian and injected by a single technician who was not aware of the hypothesis and who also recorded the survival times . Animals received either 5 l of 0.5 mg / ml neostigmine or 5 l of saline by in administration by mrl . Animals in the 2.5 ld50 group received treatment or control 10 minutes after venom injection . In the 5 ld50 and 10 ld50 groups, animals received in neostigmine 1 - 2 minutes after venom injection . Preliminary studies the mice were already severely disabled by 10 minutes after experimental envenomation with the higher doses of venom and neostigmine did not appear to help . Animals were observed continuously for up to 12 hours and assessed for signs of toxicity including respiratory distress, loss of spontaneous locomotor activity with the only endpoints being time to death or recovery . Dead mice were removed immediately and tail - band number was recorded on a data sheet reflecting the mouse's lot and individual band number as well as weight . Surviving animals were euthanized after 12 hours by the same technician who performed the experimental envenomation procedure . The technician, however, was blinded to knowing which mice had been treated with in neostigmine or saline control . Data were analyzed using graphpad prism (la jolla, ca) and the p values presented in the figures were as calculated by nonparametric mann - whitney test . Envenomed mice were further characterized using a survival analysis that included censoring to account for the study being terminated at 12 hours (720 minutes) after dosing . To plot survival time on a single y - axis, the survival time data was normalized within each envenomation dose to the mean survival time of each control group and then multiplied by 100 . Because snakebites in the community can result in a highly variable amount of venom being delivered to the patient, we sought to determine whether in neostigmine could be effective in improving survival at several dosages of venom in our mouse model . Figures 1(a)1(c) show the effects of neostigmine in mice envenomed with naja naja venom at various concentrations: 2.5 ld50 (a), 5 ld50 (b), and 10 ld50 (c). As described above, the rationale for using in neostigmine is to improve survival time from the moment of the snakebite . These results support our idea that early in achei therapy could improve survival even after a potentially severe neurotoxic envenomation . Higher venom dosages resulted in earlier deaths, as expected, but for all dosages of venom, neostigmine provided a substantial and persistent window of increased survival . Envenomed mice died at an average of 193 minutes compared to 553 minutes (p <0.02) for the treatment group (10/15 were euthanized after the arbitrary cutoff of 6 hours, but were behaving completely normally). At the 5 ld50 venom dosage, survival was prolonged from a mean of 45 minutes in the control group to 196 minutes in the treatment group (p = 0.01). Likewise, at the 10 ld50 venom dosage, mean survival was prolonged from 30 to 175 minutes (p <0.02). Findings reached statistical significance even after reanalysis excluding surviving outliers in the 5 ld50 and 10 ld50 groups . Most bites in humans are on the extremities, but we chose the ip route for consistency and to replicate elements of previously published mouse studies [1517]. Due to limitations of funding, we only tried one type of experimental envenomation using a curare - like snake neurotoxin; it is likely that the effects of in acheis will vary across different venom types . Venoms contain a multitude of toxic peptides and proteins and published ld50 ranges vary widely between cobra species, subspecies and route of delivery (e.g., subcutaneous, intravenous, or ip) [15, 1720]. Mice and humans differ greatly in their sensitivity to the same drugs [21, 22], and only one set of neostigmine to atropine concentrations was used . Thus, as with all transitions from preclinical to clinical usage, dosages will need to be optimized for human use . Fortunately, the development of in neostigmine for the treatment of myasthenia gravis [1013, 23, 24] provides a substantial head start for this transition . Only a single dose of in neostigmine was administered, so it is not clear if mice would have survived longer with multiple treatments and no other acheis were tested . The concentration of neostigmine was significantly lower than that has been used in human studies, though total dose was comparable and the drugs were not aerosolized but dropped on the nares [1014]. In the present study, atropine was coadministered with in neostigmine through ip route . In previous mouse studies atropine we anticipate that an anticholinergic agent such as atropine (which can be administered in) would potentially be administered with neostigmine to blunt untoward muscarinic effects of an achei should these effects be present with in achei formulations in a human study . Interestingly, in the year - long study by sghirlanzoni and colleagues, patients self - administering in neostigmine did not report any complications from in neostigmine . Broggini and colleagues tested the bioavailability of high dose in neostigmine compared to iv administration in healthy human adults without coadministration of atropine and did not note any serious adverse events . The ip - absorption kinetics of atropine are more reliable and proven than the in absorption kinetics of atropine . Thus, if we had coadministered atropine in instead of ip, we would be faced with the confoundedness that perhaps differential survival depended on intersubject differences in atropine - absorption kinetics . This confoundedness would be impossible to disambiguate from our central hypothesis in such a small study . By contrast, if survival depended on differential in absorption kinetics (of neostigmine), that simply serves to further support the central hypothesis that neostigmine is the critical variable, especially in light of gieu's results showing that ip atropine did not materially alter survival from experimental ip cobra envenomation . Similarly, we did not attempt any skin hemorrhagic or myonecrosis activity assays, though no unusual bleeding was noted . Mice were only observed for neurological manifestations of envenomation such as convulsion, hind limb paralysis, and respiratory distress after injection of reconstituted venom . Muscle - contraction - dependent respiration is a necessary condition for life amongst all mammals and virtually all vertebrates . The present finding builds on our earlier demonstration that in neostigmine could reverse paralysis in an awake, experimentally paralyzed human subject . To our knowledge, this is the first demonstration that a topically applied drug could reverse venom - induced neurotoxicity . We previously showed that nasal neostigmine could reverse mivacurium - induced paralysis in an awake human . Together, these data provide proof - of - principle that venom - induced toxicity should be treatable in the out - of - hospital setting and provide early, life - saving interventions at low cost . Anil and colleagues showed that the mean time interval between bite and arrival to hospital was 4.5 h by which point the venom would have been entrenched at presynaptic axons . Rapid death from krait bite most often comes as a result of the alpha - toxin and diaphragmatic paralysis and airway obstruction could be delayed by early achei therapy, but to our knowledge this idea has never been tested . In mouse studies, guieu showed that among the drugs they tested only acheis consistently resulted in increases in naja venom ld50s while atropine had no effect on the ld50 . Similarly, flachsenberger showed that at otherwise lethal doses, all animals survived as a result of early achei treatment following ip administration of adder (acanthophis antarcticus) venom . Flaschenberger further found that the expected survival time of animals subjected to even higher experimental venom doses was significantly extended . These animal [15, 16] and human morbidity and mortality studies suggest that if acheis can be administered during the initial, critical stage after envenomation there could be a survival benefit to human victims [16, 2732]. Surprisingly, both the efficacy and optimal uses of antivenom and achei therapies for neurotoxic snakebite remain unproven even after decades of widespread use [2, 14, 3338]. It has been argued that the development of more diverse and regionally specific antivenoms is the most cost effective means of combatting morbidity and mortality from snakebite in the developing world [3941]. We argue that investment in repurposed, low - molecular - weight pharmaceuticals would be more cost effective in the long term because of their ease of use, heat stability, and safety profiles . In administration of neostigmine has the potential to provide snakebite victims with significantly increased access to an effective treatment for neurotoxic snakebite while suggesting a strategy for the development of topically administered antidotes to hemotoxic, cardiotoxic, and other complex envenomation in the future . This type of innovation would save lives while significantly lowering the economic burden on individuals, families, communities, and governments . To date, no prospective human study has been done to analyze the effect of immediate achei administration in the setting of neurotoxic snakebite . The primary aim of this pilot study was to test if early in administration of acheis and in principal any venom - inhibiting agent is plausible . The results of this study suggest that this is the case and that significant further study of this and other strategies is warranted.
|
Although great enthusiasm exists for developing skills in laparoscopic urology in the united kingdom, training opportunities are limited . This is primarily due to a lack of approved urology / laparoscopy fellowships, as exist in the united states . It is an unfortunate fact that many interested urologists do not progress beyond the initial courses stage and indeed a number of urologists who have attended animal laboratory training as well have not proceeded to regular urological laparoscopic practice . Fellowship, enabling supervised training so that interested urologists could become comfortable and competent with laparoscopic urology . The fellowship program is available to those who have completed the 2 initial training steps, ie, basic / advanced training courses and an animal laboratory course . Prior practice on simulators using laparoscopic instruments is encouraged to enable the trainees to get the most out of their time spent with the mentor in the clinical setting . Basic training is centered on the development of familiarity with the safe handling of laparoscopic instrumentation and stereoscopic skills in the dry laboratory setting . Advanced training involves a series of formal lectures followed by practice sessions in the animal laboratory; attendees are also shown live surgery via video links . Skills training is assessed by the mentor in these phases by objectively marking the achievement of various predetermined parameters that evaluate safe acquisition of laparoscopic skills like clipping and suturing . The fellowship program steps are broadly similar thereafter, but individual variations may occur, depending on the distance that the trainee has to travel and availability of the mentor . An honorary contract is raised for the trainee at the mentor hospital; the trainee then observes the mentor perform 4 or 5 laparoscopic renal procedures and may assist with the same by acting as the camera driver for these cases . If possible, trainees then refer cases suitable for laparoscopic surgery to the mentor; this helps gestate the necessary workload . The first 4 cases that are performed by the trainee are usually hand - assisted simple or radical nephrectomies, and the aim is to perform at least a case a week at a dedicated theater session with the possibility of adding in more cases as appropriate . The trainee then goes on to perform conventional laparoscopic cases, again under mentor supervision, with the mentor initially acting as camera driver . This program duration varies but is approximately 4 to 5 months, primarily due to the paucity of clinical material available in any one unit at a time, and secondly, to fit in with other work commitments . Mentors are then awarded an honorary contract at the trainees' hospital to supervise the trainees during their first few cases therein . Trainees schedule simple cases initially and gradually increase the level of difficulty as their skills and confidence improve . Six of them are in independent laparoscopic urological practice, and the others are in phase 6 or above . Trainee one started this program in september 2000 and observed 4 simple nephrectomies and 1 radical nephrectomy before proceeding to phase 6 . Because of the distance involved, the mentor condensed stages 4 and 5 and performed 12 cases with the trainee at the trainee's hospital before the trainee entered independent practice . Since then, he has performed 14 unsupervised laparoscopic urological procedures . Trainee two started the program in may 2001 and has performed 10 procedures with the mentor; he was fortunate to obtain further hands - on training abroad, which helped shorten his training . Trainee three, four, five, and six started the program in may 2002 and performed 10 procedures each with the mentor, before commencing unsupervised practice . Trainees seven, eight, and nine are making steady progress, currently performing hand - assisted procedures with the mentor who is offering support and advice without actually being scrubbed in for the procedure . It is anticipated that over the next few months trainees seven, eight, and nine will adopt independent practice . Skills development in all cases was steady, with a progressive increase in dexterity and improvement in spatial orientation . For the neophyte laparoscopist, it is indeed a great leap of faith that has to be taken from the animal laboratory to the human arena; we perceive the main stumbling block to be a lack of direct mentor / trainee supervision . This program was designed to allow skill and confidence building under the direct supervision and guidance of experienced laparoscopic urologists, as initially suggested by shalhav . In effect, this reduces the conversion rate and complications that otherwise could be a major issue; therefore, the transition to independent urological practice appears to be smoother . We also believe that the selective use of hand assistance early in the program helps build confidence and aids in development of 3-dimensional spatial orientation; secondly, the ability to directly apply digital pressure exists in case of unexpected vascular injury . Once trainees are facile with hand - assisted laparoscopic practice, they are then encouraged to move on towards pure laparoscopic and retroperitoneoscopic procedures; all trainees agreed that the initial phase helped them make the transition more easily . The case load at one particular hospital may not be enough to enable concentrated dissemination of laparoscopic skills . As a result, sometimes trainees have had to spend up to 4 weeks on occasion without performing a single laparoscopic case; this in turn has a bearing on the length of the fellowship program . It is not easy to put a finite number onto the number of mentored cases that would have to be performed by trainees before proceeding to independent practice because this appears to depend on innate skills, but 10 cases would seem to approximate an acceptable mean . Some trainees have had to forfeit other obligations for the duration of the fellowship, which they could not have done without support from their colleagues and the management in their respective hospitals . We acknowledge unstinting support from anaesthetic colleagues, given the fact that anaesthetic / procedure time needs to be acceptable; this has obviously not always been the case when a new trainee joins the fellowship program . This program seeks to help safely relocate the teaching of laparoscopy from the lecture hall and animal laboratory to the clinical setting, and, in doing so, we hope to accelerate the training of interested, qualified urologists over the next few years . Residents and fellows are being trained in laparoscopic urology now; as a result, this fellowship may be phased out in the future; until this noticeable lacuna in training is filled, we would wish to continue to offer this training to interested consultant urologists . A one - on - one fellowship program enables rapid, safe, and effective laparoscopic skills acquisition by established urologists.
|
The worldwide incidence of strabismus varies from 3% to 5%,1,2 whereas hu and colleagues3 identified strabismus in 2% to 4% of white populations, and abrahamsson and colleagues4 reported strabismus in 0.6% of asians3 and africans.5 in a study conducted by dana and colleagues5 in sydney, the incidence of strabismus was established in 48 patients (2.8% of total population). In another study carried out by donnelly and colleagues, the prevalence was 3.98%.6 in an analysis conducted amongst afghan immigrants in pakistan, strabismus was noticed in 1.4% of patients.7 another study conducted at peshawar in 2004 confirmed that the total frequency of squint was 2%.8 the clinical treatment of squint includes evaluation and correction of multiple errors of refraction, management of amblyopia, and surgical treatment . The first surgery on squint was executed in 1839 by a general surgeon, johann dieffenbach.9 the ocular realignment of visual axis by surgical intervention becomes necessary when conservative management is unsuccessful . Surgical interventions are able to improve diplopia, rectify three dimensional (3d) vision, broaden the visual field, and improve psychological status10 and cosmesis.11 this is a retrospective clinical analysis conducted on the patients of both sexes with horizontal strabismus presenting for the first time from june 2004 to december 2007 . All patients suffering concomitant monocular horizontal squint (esotropia and exotropia), with deviation under 60 prism diopters (pd) devoid of any coupled vertical deviations were included in the study . All subjects with history of paretic or limited extra ocular muscle component, more than 60 pd angle deviations, nystagmus, past history of any squint surgical procedure, and repeated deviation, initial primary inspection of all patients was performed in our outpatient department by two qualified experienced ophthalmologists and four medical officers . After obtaining informed consent, the subjects were assessed for the following: general history: including age, sex, citizenship, occupation, any history of corrective lenses, and which eye was affected . Photos of patients at up to the age of ten years were requested from patients and assessed to rule out any congenital anomaly . Visual acuity of dominant (fixating) eye and squinting (nonfixating) eye, was evaluated with the help of snellen s chart for educated subjects and an e - chart for uneducated children . Slit lamp biomicroscopy, and applanation tonometry . The divergence was calculated in patients with fine bilateral visual acuity by a prism and cover test for near (33 cm) and far (6 m) distance using a fixation object . The modified krimsky test was used to measure deviation in patients with intense amblyopia, limited vision, or children younger than the age of five years . In children, refraction under cycloplegia using cyclopentolate 1% eye drops was undertaken and any accommodative element of more than 2.0 d was excluded preoperatively . Scheduled investigations at admission were examined thoroughly and included a complete blood picture, bleeding and clotting times, detailed urine analysis, and chest x - rays . All the patients and their attendants were fully informed of the postoperative results and probability of a subsequent surgery . A prophylactic antibiotic and ophthalmic drops, eg, ofloxacin and chloramphenicol, were administered every three to four hours the day surgery . A complete surgical procedure was carried out under general anesthesia after approval by consultation with a visiting physician and qualified anesthetist . The surgical procedure consisted of monocular recession and resection of horizontal recti muscles of the nonfixing eye . The muscle was then separated from its attachments by round - edge curved conjunctival scissors and destabilized by a muscle hook . Two 60 poly gelactin 910 absorbable sutures were used for two whip stitches; one at the upper border and other at the lower boundary of muscle in close proximity to its insertion point during recession, and far from the insertion point in the muscle cone during muscle resection . At the time of recession the muscle was incised in close proximity to its insertion point and during muscle resection, then it was incised far from its insertion point, finally the muscle was allowed to retract and draw back . Sutures were carried out of the conjunctival incision and left unfastened with one edge at the 12 oclock position with the other in the opposite position . Recession was measured with a caliper from posteriorly at the beginning of the muscle insertion point and afterwards the muscle was sutured directly on the sclera by piercing the sclera with both the upper and lower suture needles opposite each other . Both needles were passed gently up to half the width of the sclera under resistance without penetrating deeply into uveal tissue . The uveal penetration was confirmed when the needle passed very easily through the sclera without resistance . As the sutures were tied, the retracted muscle was lifted and brought forward to be fastened to the attachment site, and it was sutured at its normal anatomical insertion point in case of resection . Absorbable sutures were used to close the conjunctiva . An antibiotic / steroid eye ointment (neomycin with betamethasone) was applied and the eye bandaged for 24 hours . On every postoperative outpatient follow - up visit, a complete orthoptic assessment was performed, including visual acuity and a photograph of the patient to measure the angle of deviation . The final best - corrected visual acuity and angle of deviation was documented on a sixth month post - treatment follow up . Secondary surgical procedures in the fixating eye for consecutive squint over 15 pds were performed six months after initial surgery . Out of approximately 7000 ophthalmic patients, 87 (1.24%) patients presented with strabismus during the study period . Out of these patients, seven subjects refused to undergo surgical procedure, while the remaining 39 patients (esotropia = 24 [61.5%] and exotropia = 15 [38.5%]) were selected for surgery . The successful surgical outcome was considered as an angle deviation of 15 pds or less at the six - month postoperative follow - up . Table 2 presents group 1 (esotropia) patient data including preoperative angles of deviation (figure 1), surgical procedures and postoperative results (figure 2). Table 3 presents group 2 (exotropia) patient data including all details (figures 3 and 4). In group 1 (esotropia), five patients (19.0%) presented with residual deviation of more than 15 pds . Similarly, in group 2 (exotropia), patients presented with orthophoria (73.3%), while four (26.7%) patients demonstrated residual deviation . Three patients in both groups developed suture - related foreign body granuloma formation, which resolved within a few weeks during the course of treatment . Ocular movements, including convergence, were normal in all patients except two (13.4%) in group 2, who underwent 10 mm recession of lateral rectus and experienced limitation in ocular movements . 12 patients were lost to follow - up, while the remaining 27 completed six months postoperative follow - up . Of nine patients (23.0%) in both groups who exhibited consequent strabismus after six months, six patients did not agree to a second surgery and only three patients underwent successful secondary surgical intervention . This procedure minimizes the handling of the dominant eye, thereby reducing surgical duration.12,13 occasionally it becomes difficult to visually align the eyes by operating only on one eye because of larger deviations of more than 60 pds . At this stage, clinical circumstances for a second surgery on the fixing eye or binocular squint surgery concerning more than two horizontal rectus muscles is the main and extensive used clinical procedure . This technique also avoids limitations in ocular movement.1416 in our study, we acquired excellent outcomes through a surgical procedure carried out on the fixating eye in subjects who had developed residual deviation after the initial surgery on the nondominant, fixating eye . Monocular squint surgery can be safely performed in adults under peribulbar anesthesia, with rapid recovery and less complications.17,18 although there are some disadvantages of regional anesthesia including: retrobulbar hemorrhage, optic nerve injury, central retinal artery occlusion, and ptosis.19 in this study all the subjects in both groups were operated under general anesthesia . Scott and colleagues define the accuracy of squint surgery as a residual deviation of 10 pds or less . Scott also states that for larger angles, the surgical objective should be a small residual deviation rather than straight eyes.20 following this concept of undercorrection, the residual deviation of 15 pds and less was considered accurate in this study . Restricted ocular movements are an occasional clinical problem following huge recessions . Multiple authors strongly recommend not exceeding a 7 mm recession on medial rectus and 8 mm recession on lateral rectus muscle to avoid diminished restricted ocular movements.2123 in this study only two (13.4%) subjects in group 2, who underwent a 10 mm recession on lateral rectus muscle suffered postoperative limitation in ocular movements.
|
Carbon monoxide poisoning is the fourth most common type of poisoning in china, and is a leading cause of neurological disturbances . The psychiatric and neurological symptoms of carbon monoxide poisoning include headache, muscle weakness, drowsiness, memory disturbances, apraxia, delirium, speech disorder, epileptic seizure, ataxia, and symptoms of parkinsonism . The causes of dyslexia are poorly understood, but have been linked to damage to a reading - specific brain region in the left hemisphere known as the visual speech area . In this study, we describe a case of delayed encephalopathy with digit and letter alexia following carbon monoxide poisoning . General patient information the patient was diagnosed with delayed encephalopathy after acute carbon monoxide poisoning . Treatments included hyperbaric oxygen therapy, as well as a low dose of methylprednisolone (80 mg a day) and drugs for neurotrophy . This project was approved by the administrative regulations on medical institution, formulated by the state council of the people's republic of china . Written informed consent was obtained from the patient prior to the study . At admission, the patient complained of visual impairment, as well as digit and letter alexia after acute carbon monoxide poisoning . Other common diseases that cause acute focal cortical injury include stroke (ischemia and hemorrhage), trauma, and metabolic diseases (such as mitochondrial encephalomyopathy). Li et al reported a case of digit alexia after left parietal lobe hemorrhage . In the current study, cranial mri did not support the diagnosis of stroke and metabolism diseases (figure 2). The clinical history did not provide information indicating the development of alexia, except after the carbon monoxide poisoning . Visual field examination was performed at day 2 when the patient was admitted to the hospital . After 2 weeks of treatment, the patient's visual deficit had fully recovered (b). Brain imaging examination . T2-weighted brain magnetic resonance imaging (a) and magnetic resonance angiography (b) at 8 days after carbon monoxide intoxication revealed no abnormal findings . When the patient was discharged from the hospital, electroencephalography revealed apparent improvement, and 8 9 hz wave activity returned as the predominant background rhythm . The patient was asked to write his name, address and occupation . Before treatment, treatments included hyperbaric oxygen therapy, as well as a low dose of methylprednisolone (80 mg a day) and drugs for neurotrophy . This project was approved by the administrative regulations on medical institution, formulated by the state council of the people's republic of china . Written informed consent was obtained from the patient prior to the study . At admission, the patient complained of visual impairment, as well as digit and letter alexia after acute carbon monoxide poisoning . Other common diseases that cause acute focal cortical injury include stroke (ischemia and hemorrhage), trauma, and metabolic diseases (such as mitochondrial encephalomyopathy). Li et al reported a case of digit alexia after left parietal lobe hemorrhage . In the current study, cranial mri did not support the diagnosis of stroke and metabolism diseases (figure 2). The clinical history did not provide information indicating the development of alexia, except after the carbon monoxide poisoning . Visual field examination was performed at day 2 when the patient was admitted to the hospital . After 2 weeks of treatment, the patient's visual deficit had fully recovered (b). Brain imaging examination . T2-weighted brain magnetic resonance imaging (a) and magnetic resonance angiography (b) at 8 days after carbon monoxide intoxication revealed no abnormal findings . When the patient was discharged from the hospital, electroencephalography revealed apparent improvement, and 8 9 hz wave activity returned as the predominant background rhythm . The patient was asked to write his name, address and occupation . Before treatment, common symptoms of delayed encephalopathy include memory loss, cognitive dysfunction and neuropsychological impairment due to cerebral cortex damage, as well as pyramidal and extrapyramidal syndromes involving the globus pallidus and subcortical white matter . In a number evaluation task, the patient was unable to read eight out of ten formulas or ten out of twenty numbers in the hundreds . In addition, he could not correctly recognize the digits of any numbers in the thousands . Most of these errors were not due to simple visual spatial impairment, which is typically exhibited as mistakenly recognizing 9 as 6, or 13 as 31 . The present results indicated that our patient's condition was related to an impairment of the connection between visual identification and reading of numbers . The specific brain regions underlying the patient's impaired letter and number reading ability, but preserved chinese character reading ability, are currently unclear . The cerebral cortex is known to be susceptible to anoxia . Previous studies have reported that damage to the cortex, globus pallidus, cerebral deep white matter, putamen, caudate nucleus, thalamus and hippocampus exhibit abnormalities that are observable on magnetic resonance imaging scans in cases of delayed encephalopathy . In the current study, no abnormality was observed on magnetic resonance imaging and magnetic resonance angiography scans, which eliminates the diagnosis of stroke or metabolic diseases . Although it may not be possible to determine the nature of the disease by the appearance of the electroencephalographic signal alone, diffuse slow wave activity in a conscious person typically indicates injury to the whole cortex in varying degrees . This measure may be more sensitive than magnetic resonance imaging . In the current patient, a partial defect in the visual field and widespread low amplitude wave on electroencephalography the cause of the patient's letter and number alexia, but preserved chinese character reading, remains unclear . This pattern of performance has not been previously reported, although there have been reports of selective alexia such as hangja alexia, japanese alexia, selective alexia and agraphia sparing numbers . Some studies have suggested that the processing of ideograms and phonograms may be mediated by different brain regions . In addition, letter and number reading appear to be dependent on dissociable processes . Despite the difficulties in localizing the selective alexia exhibited by our patient, we propose that focal cortical dysfunction may account for the findings of the visual field test and electroencephalography . Functional mri revealed activation of a wide area including left inferior / middle frontal gyri, bilateral medial frontal gyri, posterior inferior temporal area, bilateral middle occipital / fusiform gyri, and the bilateral cerebellum during chinese letter reading . Previous studies have indicated that chinese characters involve more complicated neural connections compared with english letters and numbers . As such, the latter may exhibit more impairment and less compensation after brain injury, because the functional brain area is relatively limited and is more likely to suffer complete damage . Recovery of writing skill is reported to be more difficult than the recovery of listening, reading or speaking . This may explain why the patient's chinese writing ability only partially recovered after treatment, whereas his reading ability completely recovered . A less complicated and less extensive brain network is involved in the reading of numbers and letters compared with that involved in reading chinese words, so less compensation may be seen after injury . This may explain why number and letter reading were more difficult to recover in the present study.
|
The concentration of ammonium is usually more than micromolar level in mostly continental water and coastal seawater, even up to millimolar level due to environmental pollution [24]. However, it is less than micromolar level, even down to nanomolar level in ocean water and some unpolluted freshwater [5, 6]. The accurate measurement of trace ammonium natural water is essential to understand the biogeochemical cycle of nitrogen . The indophenol blue method (ipb) and o - phthalaldehyde (opa) fluorometric method were the main methods for the determination of ammonium in natural water [715]. The indophenol blue method is based on the berthelot reaction . In the catalysis of nitroprusside, ammonium reacts with hypochlorite and phenol forming indophenol blue, which has a maximum absorbance of 640 nm . The ipb method is used as the standard method to determine ammonium in water by the u.s . The technique has low sensitivity (lod 0.6 mol / l). To meet the determination of trace ammonium in ocean water and some unpolluted freshwater, the sensitivity of the ipb method was obviously improved using a long - path liquid waveguide capillary cell (lwcc) in the later reported work . However, many accompanying weaknesses such as complicated operations and a high reagent blank appeared . Opa method is based on the fluorometric reaction that ammonium reacts with o - phthaldialdehyde and sulfite producing highly fluorescent isoindole derivatives, which has the maximum excitation wavelength (ex) at 361365 nm and the maximum emission wavelength (em) at 422425 nm . The reaction was firstly reported by roth in 1971 and was modified by replacing mercaptoethanol with sulfite to provide an opa method for determination of ammonium in water in 1989 . Afterwards, the opa method was modified to improve the sensitivity and operability by much work [1115]. The lower limit of quantitation (1.67 nmol / l) of the opa method was gained by coupling with flow analysis and solid phase extraction, and the method was applied on board to analyze seawater samples collected from 65 stations in the south china sea, and a detailed ammonium profile in the seats station was obtained . However, uv led (360 nm) had to be used as the excitation light source for conforming to the excitation wavelength of the opa method, and heating device was also needed in the determination system to provide higher reaction temperature (75c). Uv led source has many defaults, such as lower light intensity, higher price, and complicated technology . Uv led source and heating device are not very suitable for developing a portable fluorescence detection system . If a new fluorescent reagent is prepared for ammonium determination and it can rapidly react with ammonium at room temperature, the determination of ammonium should become much simpler in field . In this paper, a methoxy group, an electron - donating group, was joined to benzene ring of opa molecule, producing a new fluorescent reagent, 4-methoxyphthalaldehyde (mopa). And then a novel analytical method was developed for trace ammonium in freshwater and seawater using mopa as fluorescent reagent . All of the other chemicals used for analysis were of guaranteed reagent grade, supplied by aladdin chemical reagent co., china, unless stated otherwise . All solutions were prepared in ultrapure water (resistivity 18.2 mcm at 25c). In detail, 7.8 g / l mopa solution was made by dissolving 1.95 g of mopa in 200 ml of methanol (hplc grade) and diluting to 250 ml with ultrapure water; 1.26 g / l na2so3 solution was made by dissolving 0.63 g of na2so3 in 500 ml ultrapure water and adding 0.20 ml 37% formaldehyde to prevent the solution from being oxidized; 2.0 g / l naoh solution was prepared by dissolving 1.0 g naoh in 500 ml of ultrapure water; 40 g / l naoh solution was prepared by dissolving 20.0 g naoh in 500 ml of ultrapure water; 300 g / l sodium citrate solution was made by dissolving 30.0 g sodium citrate in 100 ml of ultrapure water; 15 g / l sodium tetraborate buffer solution (r4) was prepared by dissolving 7.5 g na2b4o710h2o in 500 ml ultrapure water; 3.4 g / l opa solution was made by dissolving 0.34 g of opa in 20 ml of methanol (hplc grade) and diluting to 100 ml with ultrapure water; ammonium standard stock solution (1000 mg mmol / l) was purchased from aladdin chemical reagent co., and the ammonium salt is (nh4)2so4 in the solution; ammonium standard substock solution (10 mmol / l) was prepared monthly by diluting the stock solution with ultrapure water; the stock and substock solutions were stored at 4c in a refrigerator while not in use; ammonium working solution (0.1 mmol / l) was prepared daily by diluting 1.0 ml of the substock solution to 100 ml with ultrapure water . All vessels used in the experiments were firstly soaked with 1 moll hcl for more than 12 hours, cleaned with reverse osmosis water (resistivity 0.5 mcm at 25c), and then soaked with 1 moll naoh at least for 12 hours and cleaned thoroughly with ultrapure water before use . Synthetic route of mopa is showed in figure 1 . Compound 1 . A flask was charged with 15.2 g 3-methoxybenzoic acid and 50 ml dioxane . The mixture was stirred at room temperature and a solution of 50 ml 37% aqueous formalin solution and 50 ml 37% aqueous hcl was added . The reaction was continued at 60c for 3 days, and then it was cooled at room temperature . The contents of the flask were washed with ch2cl2 (dichloromethane / cas number 75 - 09 - 2). The combined organic layer was dried with anhydrous mgso4, filtered, and concentrated under reduced pressure to give crude white solid . This solid was recrystallized from 95% ethyl alcohol to afford 6-methoxyphtalide (compound 1) as white needle (11.42 g, 70.1% yield) a flask was charged with 11.4 g 6-methoxyphtalide and 80 ml dry tetrahydrofuran (thf), and the mixture was stirred at room temperature . A mixture of 3.4 g lialh4 and 50 ml dry thf was added slowly when a clear solution was obtained . The reaction was continued at room temperature for 30 minutes, and then it was heated at 80c for 8 hours . Subsequently, 4 ml h2o and 2 ml 15% aqueous naoh were added to the reaction mixture, respectively . The filtrate was dried with anhydrous mgso4, filtered, and concentrated under reduced pressure to give crude yellow oil (compound 2, 8.46 g, 72.2% yield). Compound 3 . A 250 ml round - bottomed flask equipped with an addition funnel was charged with 6 ml (cocl)2 (oxalyl chloride / cas number 79 - 37 - 8) and ch2cl2 (60 ml) and the mixture was stirred at 78c . After the addition of 13.6 ml dmso (dimethyl sulfoxide / cas number 67 - 68 - 5) and 20 ml ch2cl2, the mixture was stirred for 35 minutes at 78c . A solution of compound 2 (0.06 mol, 10.0 g) and 20 ml ch2cl2 and dmso (v: v = 10: 1) was added to the mixture . After the addition of 80 ml et3n, the mixture was stirred for another 10 minutes at 78c and then the mixture was allowed to warm to room temperature . The combined organic layer was dried with anhydrous mgso4, filtered, and concentrated in vacuo . The residue was purified by silica gel flash column chromatography to give the 4-methoxyphthalaldehyde as yellow needle (5.9 g, 60.1% yield), mp 7678c . H nmr (500 mhz, cdcl3) 10.61 (s, 1h), 10.29 (s, 1h), 7.90 (d, j = 8.5 hz, 1h), 7.41 (d, j = 2.6 hz, 1h), 7.19 (dd, j = 8.5, 2.6 hz, 1h), 3.92 (s, 3h); c nmr (125 mhz, cdcl3) 192.0, 191.0, 163.9, 138.6, 134.7, 129.5, 118.8, 114.8, 56.0 . Ms(esi), m / z: 165 ([m+h]). 10 ml of standard ammonium solution or sample solution with a concentration range of 0.0250.300 appropriate amounts of sodium citrate solution, mopa solution, na2so3 solution, and naoh solution were added into the bottle . The concentrations of sodium citrate, opa, and sodium sulfite in the final solution were 16.8 g / l, 0.12 after all the reagents were added, the mixed solution was tightly sealed and allowed to react for a certain time at room temperature . The fluorescence intensity was measured on a fluorescence spectrophotometer (rf-5301pc, shimadzu co., ltd ., japan) with excitation wavelength set at 370 nm and emission wavelength at 454 nm . Both the excitation and emission slits of the instrument were set as 5 nm, unless stated otherwise . 0.20 mol / l standard ammonium solution was allowed to react with mopa and sodium sulfite according to section 2.3 . The product had the maximum excitation wavelength (ex) at 370 nm and the maximum emission wavelength (em) at 454 nm . Compared with the product of opa reacting with ammonium, the maximum excitation and emission wavelength appeared as red shift phenomenon (see figures 3 and 4), and the maximum excitation and emission wavelength increased 9 nm and 32 nm, respectively . Though the maximum excitation wavelength was located in the nearly uv region, it should be noticed that the fluorescence intensity was still sizable in the wavelength range of 380410 nm . This means that visible led at which wavelength ranged from 380 to 410 nm could be chosen as excitation light source to make a portable fluorescence detection system if mopa is used as fluorescent reagent . Six solutions were separately prepared and stood for the same time, marked (a), (b), (c), (d), (e), and (f), and their components are listed in the cutline of figure 5 . 30 minutes was set as the standing time but is not necessary, more or less time is also feasible for the experiment in this section . The excitation wavelength was set at 370 nm, and the fluorescence emission spectra of these six solutions were determined, shown in figure 5 . Corresponding to the six solutions, curves in figure 5 are separately marked (a), (b), (c), (d), (e), and (f) from the bottom up . Curve (a) which has a background peak at 425 nm is the emission spectrum of ultrapure water, and curve (b) almost overlaps curve (a), illuminating that the mixed solution of ammonium, sodium hydroxide, sodium sulfite, and sodium citrate had no fluorescent properties . Curve (c) is the fluorescence emission spectrum of mopa, showing that mopa had weak fluorescence . Curve (d) is the fluorescence emission spectrum of the mixed solution of ammonium, mopa, and sodium sulfite . Compared with curve (c), the intensity of curve (d) had obviously increased, displaying that a fluorescent compound had been produced in solution (d). The difference of solution (d) and solution (e) was ph, and the ph of solution (e) is higher because of addition of sodium hydroxide . The maximum emission wavelength of curve (e) was the same as curve (d), but the fluorescence intensity of curve (e) was much higher than that of curve (d), illuminating that ph was obviously affecting the fluorescence intensity of the solution . Curve (f) almost overlaps curve (e), and the difference of solution (e) and solution (f) lies in the existence of sodium citrate, explaining that sodium citrate had no obvious effect on the fluorescent reaction of the proposed method . The maximum emission peaks of both curve (e) and curve (f) were located in 454 nm, which appeared as red shift of 29 nm in comparison with curve (a), illuminating that the interference of ultrapure water could be avoided using mopa as fluorescent reagent . All of above results had confirmed that ammonium reacting with mopa could produce strong fluorescent compound in the existence of sodium sulfite and sodium hydroxide . In this section, effects of parameters such as concentration of mopa, addition of na2so3 solution, ph in reaction, and concentration of sodium citrate solution on the fluorescence intensity (fi) of blank and 0.200 mol / l ammonium working solution were investigated based on univariate experimental design . The concentration of other reagents and experimental conditions were controlled as the described in section 2.3 . The relationship between the fluorescence intensity and the concentration of mopa in the reaction solution was investigated, shown in figure 6 . The fluorescence intensity of both blank solution and 0.200 mol / l ammonium working solution increased with an increase in the concentration between 0 and 0.12 g / l and was closed to constant when the mopa concentration was more than 0.12 the results above illuminated that mopa was an essential fluorescent reagent in the proposed method, and 0.12 g / l of mopa was enough for the fluorescence reaction . Consequently, the concentration of mopa in the solution was controlled at 0.12 g / l in the consequent experiment . Effects of the solution ph on the fluorescence intensity of blank and 0.200 mol / l ammonium working solution were investigated in the range of 9.212.2 . The results in figure 7 illuminated that the fluorescence intensity of both solutions rapidly increased when the ph ranged from 9.2 to 11.2, then closed to a constant in the ph range of 11.212.0, and decreased in the final when ph is more than 12.0 . The concentration of other reagents and experimental conditions were set as described in section 2.3 . The effect of na2so3 concentration on the fluorescence intensity of blank and 0.200 mol / l of ammonium working solution was investigated . The results were shown in figure 8 . When the na2so3 concentration in the reaction solution was between 0.041 and 0.081 g / l, the fluorescence intensity of both solutions was closed to maximum constant, illuminating that the amount of na2so3 in the range of 0.0410.081 g / l in the following experiment . According to section 3.2.2, an optimum fluorescence intensity of the reaction solution could be obtained in the ph range of 11.212.0 . However, precipitation easily occurred in this ph range due to the existence of metal ions in natural water samples . To avoid precipitation of the metal ions, appropriate amount of sodium citrate experiments testified that 19 g / l sodium citrate was an optimal choice for most of natural water samples such as seawater, groundwater, and mountain spring water . To investigate the effect of 19 g / l sodium citrate on the fluorescent reaction, different concentration ammonium working solutions in existence and in the absence of sodium citrate were allowed to react with mopa according to section 2.3, and the fluorescence intensity signals of these solutions the relationships between fluorescence intensity and concentration of ammonium (cnh4) in existence and in the absence of sodium citrate were fi = 989.3cnh4 + 132.46 (r = 0.9974) and fi = 1025cnh4 + 133.06 (r = 0.9975), respectively . The results above illustrated that 19 g / l sodium citrate had no obvious effect on the fluorescent reaction . 0.200 mol / l ammonium working solution was allowed to react with mopa in the conditions described in section 2.3 . The fi was detected in different reaction time . To control the fi signal in the range of instrument, the excitation and emission slit were set as 5 nm and 3 nm, respectively . It was obvious that the fi rapidly increased as the time ranging from 0 to 100 minutes and closed to constant in the range of 100250 minutes, illuminating that the equilibration time of the reaction was 100 minutes . According to, the reaction equilibration time of opa and ammonium was 180 minutes at room temperature . Consequently, the fluorescent reaction of mopa and ammonium was much more rapid than that of opa and ammonium . A typical calibration curve of the proposed method was determined according to section 2.3 . The regression equation of the linear curve is fi = 833.4cnh4 + 109.2 (r = 0.9946, n = 6). According to, a typical calibration curve of the opa method was determined at the same reaction time and same temperature as the proposed method . The curve regression equation of the opa method is fi = 127.2cnh4 + 16.5 (n = 5, r = 0.9989), and linearity range of the curve was ranged from 0.25 to 1.2 the slope of the proposed method was 6.56 times that of the opa method, illuminating that the proposed method was much more sensitive than the opa method . The reproducibility of the proposed method was evaluated with 4 repetitive determinations of a 0.100 mol / l ammonium working solution . Four blanks solutions were determined at the same time as the calibration curve, the average fi was 99.581, and the standard deviation was 1.621 . The method detection limit, estimated as three times the standard deviations of the blank, was 0.0058 much lower determination limit should be gained by prolonging the reaction time . A surface seawater sample collected from the south china sea mountain spring water and a groundwater were collected at yaoshan scenic area in guilin at the day of the experiment . These three samples were separately used as matrix to investigate the recovery of the proposed method . The recoveries were in the range of 93.6%108.1%, showing that both the seawater matrix and freshwater matrix had no interference in ammonium determination . Mopa was successfully synthesized and could be used as a novel fluorescent reagent for determination of ammonium . Ammonium could rapidly react with mopa at room temperature producing a strong fluorescent compound, at which maximum excitation and emission wavelength were 370 nm and 454 nm, respectively . Compared with the fluorescent product of ammonium reacting with opa, the strong fluorescent compound of this proposed reaction appeared as red shift phenomenon, and the excitation emission wavelength was closed to the visible light zone . Based on this, a novel analytical method was proposed for trace ammonium in natural water using mopa as fluorescent reagent.
|
This special issue of fungal genetics and biology describes a comprehensive effort to develop methods and expertise to tackle one of the world s most serious fungal diseases of wheat . The series of papers within this issue are designed to provide a resource for a new generation of plant pathologists who we hope will be inspired to investigate the biology of septoria blotch of wheat and develop new and durable disease control strategies . Wheat is the world s most widely cultivated crop and is responsible for providing about a quarter of the calories to humankind . Global wheat production was more than 700 million tons in 2013, with the european union and china producing the largest harvests, and wheat being cultivated across most of the temperate regions of the planet (gurr and fones, 2015; rudd et al ., 2015). As well as being the most widely grown crop, wheat is also the most traded food on the international markets indeed more wheat is traded than all other crops combined . Along with rice and maize, there are many threats to wheat productivity, including the availability of high quality land for cultivation, which is threatened by urbanisation, the sustainable use of fertilisers, which are used in enormous quantities, especially in europe, and the prevalence of diseases . Wheat diseases, such as septoria blotch, provide an ever - present threat to wheat production and if they could be controlled effectively, would provide a much - needed boost to productivity that will be required to satisfy increasing global demand for food in the next two decades (courbot et al ., 2015; what then are the essential pre - requisites to allow us rapidly to understand the biology of zymoseptoria tritici? What requirements are necessary to allow a fungal pathogen to be regarded as a model system (perez - nadales et al ., 2014) and for new insights into the underlying mechanisms of infection and virulence to be understood? The last 20 years have seen pathogens, such as the corn smut fungus ustilago maydis and the rice blast fungus magnaporthe oryzae, for example, emerge as model systems (dean et al ., 2012). In both cases, this required the development of many tools, which took many years . It is by considering these issues that this collection of reviews and primary publications has been put together . Arguably, the first pre - requisite to being able to investigate any disease is a comprehensive description of the life cycle of the organism and the spatial and temporal dynamics of the infection process . For z. tritici this means a cell biological investigation of what happens from the moment a spore germinates on the leaf surface, to its location of a stoma and invasion of underlying leaf tissue . Using live cell imaging approaches, facilitated by the tools generated and described elsewhere in this special issue, the cell biology of infection is addressed, with an emphasis on the developmental biology of the fungus, its dimorphic growth habit, its ability to perceive and respond to the leaf surface, and its ability to undertake developmental transitions during its establishment of a wheat infection (steinberg, 2015). Without a road - map of how an infection proceeds, it is difficult to identify points of disease intervention or to understand how any single gene product, or family of proteins (from the pathogen or its host), might be important in disease . The next essential pre - requisite for the model pathogen tool - kit is the ability to test the function of any gene . Without an ability to construct mutants, it is hard to carry out any reverse genetic approach to test the importance of any selected biological process . Therefore, a high frequency transformation system is essential, with a ready supply of selectable marker genes to allow multiple constructs to be expressed, and the ability to carry out targeted mutations (kilaru and steinberg, in 2015; kilaru et al ., 2015a; schuster et al ., the latter can be dramatically improved by development of a strain of z. tritici in which the non - homologous dna end - joining pathway is impaired (sidhu et al . Coupled to this, it would be advantageous to have a means by which the function of a gene could be attenuated but without complete loss of function, such as virus - induced gene silencing, and the ability to regulate genes driven by a set of highly controllable promoters by which gene expression can be predictably controlled (kilaru et al . The latter will also provide the means to over - express, or mis - time the expression of a given gene to tests its function, or requirement (cairns et al ., 2015). Next, a means by which gene products can be localised using expression of fluorescently - labelled fusion proteins is essential, preferably with optimised fluorescent markers, calibrated and tested for the pathogen and in amenable vectors, with easy cloning strategies for ready construction (kilaru et al ., 2015c; mehrabi et al ., 2015; schuster et al ., 2015a; sidhu et al . This provides the means to carry out live cell imaging of a pathogen undergoing infection and directly observing the position, fate and turnover of a gene product, which is absolutely pivotal to understanding its function . But this will make no sense without some context, so having the ability to unequivocally identify organelles, such as nuclei, er, golgi bodies, peroxisomes, and mitochondria is essential (schuster et al ., 2015b; kilaru et al ., 2015b; guo et al ., 2015a, b). Also, to understand intracellular trafficking it is necessary to be able to identify and track the movement of endosomes, secretory vesicles and the associated components of the actin and microtubule cytoskeleton and their corresponding motor proteins, so that the transport of proteins and the regulation of such processes can be studied (guo et al ., 2015a, b; kilaru et al ., 2015c; schuster et al . When considered together, these tools will therefore allow rapid elucidation of gene function in z. tritici, as rapidly as in any fungal pathogen studied today . So far, of course, we have only considered addressing the functions of individual genes as opposed to gene families and the function of the whole genome and the corresponding, context - dependent proteomes that are expressed during pathogenesis . To address these requires first of all a detailed understanding of the genome (goodwin et al ., 2011; testa et al ., 2015) and its inherent, strain - to - strain variation, and how this correlated with pathotype . Understanding the role, for example, of accessory, or supernumerary chromosomes, as opposed to the core, invariant gene repertoire of the genome will be key (mcdonald et al ., 2015). An ability to analyse global patterns of gene expression, proteomic and metabolomics data sets during infection, will also be necessary so that the total expressed proteome can be defined and sub - sets associated with the effector repertoire of the pathogen, proteins required for symptom development and those necessary for fungal proliferation can be readily classified, define and then functionally analysed (ben mbarek et al . Methods to define transcriptional networks by chromatin immuno - precipitation coupled to next generation sequencing to define targets genes downstream of transcription factors, will also allow networks of gene expression to be distinguished readily (soyer et al ., protein interactions between fungal proteins, but also between fungal proteins that act upon host plant proteins, is also essential, with the ready availability of yeast two - hybrid libraries and associated bespoke protocols to z. tritici (ma et al ., 2015) finally, of course we need to consider the plant host and within this context, transgenic wheat lines expressing organelle - specific markers are already available and being constructed to augment host - pathogen cell biological analysis, while detailed analysis of sources of resistance can guide plant breeding strategies such that durable combinations of resistance genes can be identified and introduced into elite, high yielding commercial wheat cultivars (brown et al ., 2015). With wider knowledge of the fungal pathogen population and prevailing virulence specificities, should some the ability to breed for exclusion of the most prevalent, prevailing pathotypes of the fungus (vallet et al ., 2015), providing a direct route to disease control at least in the medium term . The new methods and resources presented in this special issue mean that the z. tritici research community now has, arguably, the same level of research tools as any fungal model system . This is remarkable, because it has happened in a very short period of time in response to an acute need, articulated by growers and the agricultural biotechnology industry . An integrated programme has been funded and undertaken to carry out this method development and to begin to apply the newly acquired expertise to understanding this disease . Many research questions immediately present themselves . What is the purpose of the morphogenetic plasticity exhibited by z. tritici and how are these dimorphic transitions regulated how is long - distance control of pathogenesis - associated gene expression achieved and how does the fungus perceive and respond to the internal plant tissue environment during infection? How is sporulation triggered and correctly regulated? All of these questions can now be addressed and the answers provided will result not only in many of the fungicide targets of the future, but also perhaps to some longer - term strategies for broad spectrum disease control . So, to those of you reading this commentary who have never previously considered studying z. tritici, or perhaps not even considered studying a fungal pathogen before, think of the obstacles that have just been removed.
|
Numerous causes have been attributed to low back pain (lbp). A long list exists, but the enlistment of sacralization as one of the causes has resulted in a lot of controversy . Sacralization is a congenital vertebral anomaly of the lumbosacral spine (fusion between l5 and the first sacral segment). Several studies have described the occurrence of this anomaly in a back pain population [27]. Some authors have stated that sacralization is incidentally diagnosed and has no clinical impact [7, 8], whereas others claim that this anomaly may predispose patients to certain clinical disorders [911]. This controversy has been quite intriguing and has been the stimulus for carrying out this present study . The intention was to examine in detail the incidence of this anomaly in the lbp population . Our study aimed to use the incidence of this congenital anomaly to establish a relationship between it and lbp . After institution review board approval for this prospective study, 500 lumbosacral radiographs of lbp patients and 500 radiographs of control group were collected over a one - year period . The ages ranged between 16 years and 73 years, and both sexes were involved . Exclusion criteria consisted of any radiologic evidence of previous lumbosacral surgery that would obstruct our measurements . A total of 1000 lumbosacral films were examined and identified as being adequate for measurement of the desired parameters . Data collection consisted of the subject's age at the time of imaging, gender, number of lumbar vertebral bodies, and bilateral height measurement of the lowest lumbar transverse process . Three orthopedic spine fellows performed all the measurements, using a systemized approach to decrease variability; in addition, consultations between reviewers took place . Subjects without transverse process dysplasia were classified as normal (type 0), and those with dysplastic transverse process were classified according to the castellvi radiographic classification system (table 1). The incidence of sacralizations in the two groups was reported, and the anomaly was compared according to the groups . Statistically significant differences were evaluated by using contingency tables with fisher's exact test for categorical variables . This test was used to compare statistically the differences between the two groups according to having sacralization . In g1, the average age was 39.03 15.9 years (1673 years). Of these patients (281 women, 219 men), 106 were classified as positive for sacralization, with a gender distribution of 54 (19.22%) women and 52 (23.74%) men . Of the total number of patients (500) seen, 12 (2.4%) had lumbarization . According to sacralization classification, the most common anatomical variant was castellvi type ia (6.8%), followed by type ib (5.4%), type iia (1.6%), type iib (1.8%), type iiia (1.4%), type iiib (3.4%), and type iv (0.8%). In g2, of these cases (297 women, 203 men), 84 were classified as positive for sacralization, with a gender distribution of 39 (13.13%) women and 45 (28.48%) men . Of the total number of cases (500) seen, 13 (2.6%) had lumbarization . According to sacralization classification, the most common anatomical variant was castellvi type ia (6%), followed by type ib (4.2%), type iia (2%), type iib (1%), type iiia (0.8%), type iiib (1.6%), and type iv (0.8%). No statistically significant difference was found between the groups according to the presence of sacralization (p = 0.09) (table 4). The incidence of sacralization has been reported as 4% to 36% in the general population [1, 6, 9, 1317]. Its frequency in the low back pain population ranges from 6% to 37% [4, 5, 10, 12, 1821]. Numerous studies have found no significant correlation between sacralization and low back pain [3, 5, 7, 13, 22], while others have [912, 21, 23]. Authors who found no significant correlation [7, 8, 16] have concluded that the incidence of transitional vertebra is equal in those with and without back pain, rendering it only an incidental finding on imaging . Frymoyer et al . Have determined similar rates of radiological abnormalities in three groups of patients: no lbp, moderate lbp, and severe lbp . Have reported the incidence of sacralization to be 13% in patients with lbp and 11% in their control group . Our study found an incidence rate of 21.2% for sacralization in patients, 16.8% in control group . Demonstrated that the abnormal vertebra does not constitute a risk factor for spine degenerative changes but, when degeneration occurs, it focused on the suprajacent level of the transitional vertebra . Many of the authors with lower estimations used more stringent criteria to count a vertebra as transitional, while other authors did not clearly state all of the inclusion criteria . While elster and hsieh et al . Reported prevalence as low as 7% and 5.9%, respectively, and delport et al . Observed a rate of 30%, they were based on articulation or fusion of at least one transverse process and presence of an intervertebral disc caudal to the transitional segment, ultimately failing to recognize our most common subtype type i. this leaves the current estimates of those with a transitional vertebra in the range of 6%37% in those seeking healthcare for low back pain, either slightly or significantly higher than the range of 4%36% commonly reported as the number with sacralization in the general population . This large fluctuation in estimates for the general population amplifies the difficulties in determining the significance of the percentage that we found in our patients . Castellvi et al . Reported a 30% prevalence on his low back pain population . Apazidis et al . Found 35.6% prevalence of sacralization in their studies of 211 lumbar spine subjects who had no pain . Their most commonly found pathology was type ia (14.7%), as in our study . A great deal of the controversy surrounding the association of sacralization and lbp is the result of an incomplete understanding of the variation present at the lumbosacral junction, as well as the lack of a comprehensive classification scheme that can be used to differentiate lumbosacral variation according to morphological, developmental, and clinical variants . Therefore, a comprehensive understanding of normal and abnormal variations at the lumbosacral junction and a precise classification system are needed to investigate more thoroughly the association between sacralization and lbp . Differences between the classification systems are likely the cause of much of the disagreement; small sample size may also contribute . The controversy in the literature centers on the issue of whether or not sacralization cause low back pain . First, an understanding of the variation present must be achieved, complete with a standard, convenient way to categorize that variation . Second, the possible connections among the categories and both frequencies and intensities of low back pain must be investigated as thoroughly as possible.
|
Sepsis has been classically considered the archetypal clinical condition with molecular links between inflammation and coagulation . Both inflammation and thrombosis can be orchestrated by the interactions between circulating cells, such as lymphocytes, platelets, and vascular cells, which under activation or apoptosis lead to the release of circulating microparticles (mps). In the previous issue of critical care, prez - casal and colleagues hypothesized that circulating mps may retain their anti - inflammatory and cytoprotective properties in septic patients during recombinant human activated protein c (rhapc) infusion in vivo and probably participate in its clinical benefit . The same group has previously shown that activated protein c (apc) can generate mps in vitro from endothelial cell protein c receptor (epcr)-expressing cells, which retain anticoagulant and protease - activated receptor-1 (par-1)-dependent anti - inflammatory properties . Apc binding to epcr at the endothelial cell surface and apc on mp - epcr could cleave and activate par-1, sphingosine 1-phosphate receptor and kinase insert domain receptor . Rhapc treatment for severe sepsis can induce the generation and release of mps in vivo, with a clinical correlative trend towards improved outcome . Circulating mps from patients during rhapc treatment express apc, epcr and cd13 . These mps interact with endothelial cells and induce changes in gene expression to inhibit apoptosis and reduce endothelial permeability . These effects require par-1 activation by apc in an epcr - bound conformation, confirming the evidence for the assembled epcr - apc complex on in vivo - derived mps . The present work suggests that mps could disseminate apc function and activate endothelial par-1 at distal vascular sites . The mps represent an additional circulatory form of apc receptor in human plasma, which is different from soluble epcr . Mp - associated apc is stable in measurable levels, and activities would point to physiological and clinical relevance as bioactive effectors in rhapc - treated patients and contribute to the effectiveness of rhapc in severe sepsis the authors did not analyze the subpopulation of cd13 mps upon rhapc treatment, whether they are from endothelial or leukocyte origins . Indeed, they have shown that apc induces mp - associated epcr formation from monocytes and human endothelial cells . Furthermore, whether such mps contribute to the ability of rhapc treatment to improve cardiovascular function - including arterial contractility and endothelial dysfunction by decreasing tissue inflammation and oxidative stress as reported in an experimental model of sepsis - remains to be determined . A fragile balance between the harmful and helpful effects of mps especially during severe sepsis should be underlined . Circulating mps from septic patients might exert a protective role at the vascular level by compensating hyporeactivity, but they might also contribute to the cause of multiorgan failure in sepsis and induce deleterious protein changes in target tissues . It would be of interest to test the hypothesis that rhapc via increased certain subtypes of mps bearing epcr / apc would contribute to the correction of multiple organ failure, which would lead to increased survival . The clinical relevance of rhapc treatment via increased apc / epcr - mps requires further exploration, especially in larger numbers of patients with septic shock and higher mortality . In conclusion mps could potentially be developed as new therapeutic tools to transfer biological vectors of cellular communication and are able to modulate important cellular regulatory functions at a distal site of its production in response to pharmacological agents such as rhapc . Apc: activated protein c; epcr: endothelial protein c receptor; mp: microparticle; par-1: protease - activated receptor-1; rhapc: recombinant human apc.
|
Maxillary constriction can cause posterior crossbite, dental crowding, and abnormal muscular function . In the orthodontic field, maxillary expansion is performed to correct maxillary transverse constriction and the tooth axes of the posterior teeth, alleviate dental crowding, and establish a favorable maxillomandibular relationship.1 however, according to melsen,2 responses to orthopedic maxillary expansion differ depending on the age and maturation of the patient . The interlock of the midpalatal suture increases as it matures, making skeletal expansion even more difficult . As a result, expansion of a matured maxilla leads to a tipping movement of the teeth, which increases the risk of relapse because the extent of dental expansion is greater than that of orthopedic expansion . It is possible to expand the maxilla using a removable or fixed appliance in young patients because the structure of the suture is simple . However, with increased complexity of the suture, as occurs in adults, different treatment methodssuch as surgically assisted rapid palatal expansion (sarpe)should be used.1 however, sarpe can cause postoperative side effects, discomfort, and psychological and economic burdens on patients.3 recently, a new method that can load orthopedic pressure directly to the bone (i.e., miniscrew - assisted rapid palatal expansion, marpe) has been introduced in clinical practice . Marpe also can be considered at a certain level of maturation.45 generally, various indices of maturation have been used to make decisions about treatment timing and method in orthodontics . An evaluation of skeletal age is one of the most important pieces of information in the diagnosis of growing children . The hand and wrist method (hwm)67 and cervical vertebrae method (cvm)8 are the most commonly used maturation indices . Hellman's index also is a popular method for assessing dental age.9 it is now possible to observe images of the midpalatal suture by using cone - beam computed tomography (cbct); this is impossible with conventional radiography . Angelieri et al.10 suggested that maturation of the midpalatal suture can be classified into five stages (stages a, they found it possible to minimize the failure of rapid maxillary expansion in adolescent and young adult patients . However, it is impossible to obtain routine cbct radiography of every patient, and especially those without any diagnostic need (e.g., impacted tooth, cyst, and skeletal asymmetry). The aim of this study was to classify the maturation degree based on the morphology of the midpalatal suture by using cbct images and to investigate relationships with conventional developmental age indices (indices of maturation). In doing so, we sought to determine whether using conventional developmental age indices can predict the morphology of the midpalatal suture and be used for maxillary expansion treatment planning . Before the study commenced, we estimated the sample size needed to reach statistical significance . A power analysis with g*power 3.1.9.2 (universitt dsseldorf, germany) showed that 93 subjects would be needed for a statistical power of more than 85% to detect significant differences with a 0.5 effect size and a significance level of = 0.05 (actual power = 0.851; critical chi - square = 31.41; noncentrality parameter = 23.25). Institutional review board approval was granted by the wonkwang university daejeon dental hospital (daejeon, korea) to conduct this study (irb no . W1404/004 - 001). From august 2009 to february 2014, patients between the ages of 7 and 20 years who visited the department of orthodontics, wonkwang university sanbon dental hospital (gunpo, korea) for orthodontic treatment and who underwent cbct were selected . Among 319 patients in this group, 99 patients without any exclusion factors the average ages of the sample groups were 14.3 3.27 years (ages 818 years) and 13.56 3.12 years (ages 620 years) for male and female subjects, respectively . We collected data that had been obtained from each patient for orthodontic diagnosis including cbct images for assessment of the midpalatal suture, hand - wrist and cephalometric radiographs for bone age, and panoramic radiographs for dental age . The exclusion criteria were as follows: any experience with orthodontic treatmentdisease or medicine intake affecting bone metabolismomission of any diagnostic data, including cbct imagespoor - quality images that were difficult to distinguish (e.g., blurry images)more than 2 months' difference between the dates when cbct and other radiographs were acquired any experience with orthodontic treatment disease or medicine intake affecting bone metabolism omission of any diagnostic data, including cbct images poor - quality images that were difficult to distinguish (e.g., blurry images) more than 2 months' difference between the dates when cbct and other radiographs were acquired cbct (pax - zenith3d; vatech korea ind . Co., gyeong - gido, korea) images were taken using the following parameters: 105 kvp, 6.2 mas, 1524 second scan time, 0.2 and 0.3 mm voxel sizes, and field - of - view, 16 cm 14 cm . The images were converted to digital imaging and communication in medicine (dicom) format . Dicom files were reconstructed into a three - dimensional image by multiplanar reformatting and volume rendering using imaging software (invivodental 5.0; anatomage, san jose, ca, usa). Cephalometric radiographs, panoramic radiographs, and hand - wrist radiographs were evaluated by using an exclusive imaging program (piviewstar; infinitt, seoul, korea). A screen capture of every slide and image was taken and saved in jpeg file format for this study . Every slide and image was arranged on a black background and assessed on a 27-inch high - resolution (1,920 1,018 pixel) monitor using a viewer program (acdsee pro 6.2; acd systems international inc ., there was no modification made on the monitor or to the saved images, such as changing the brightness or contrast . To standardize the cbct images, the vertical line of the cursor (green line) was matched to the axis of the palatal plane line (anterior nasal spine - posterior nasal spine; ans - pns) on an axial view (figure 1a). At the same time, on a coronal view, the vertical line of the cursor was matched to the nasal septum, and the horizontal line of the cursor (orange line) was oriented parallel to the palatal plane (figure 1b). To facilitate observation of the axial cross - sectional planar view of the midpalatal suture, it was established that the horizontal line of the cursor would intersect the middle of the palate in the sagittal plane (figure 1c). To evaluate the morphology of the midpalatal suture more accurately than in a previous study,10 a new axial cross - sectional plane was established as follows: four points that divide the ans - pns into fifths in the midsagittal plane were defined as point a, point b, point c, and point d, starting at the nearest pns point (figure 1d). A vertical line was drawn from point a to the horizontal line of the cursor, and the points at which the extension of the vertical line met the upper and lower borders of the palatal bone were defined as point a' and point a ", respectively . The midpoint of point a' and point a " was defined as point a. point b and point c were defined using the same method (figure 1d). Point d was excluded from measurement because images of the nasopalatine canal and midpalatal suture showed a high tendency to overlap . The horizontal line of the cursor was matched to a virtual line connecting point a, point b, and point c (figure 1d). The horizontal cross - sectional image that showed the midpalatal suture most evidently and seemed longest was selected by moving the horizontal line up and down in a 1-mm range . If it was impossible to find a line connecting all three points, the shape of the palate was considered a curve, and two horizontal cross - sectional images going through point a point b and point b point c were observed . Cbct images of the midpalatal suture were assessed on an axial plane view from stage a to stage e according to the classification scheme of angelieri et al.10 the morphology of the midpalatal suture was regarded as an indicator of maturation, similar to a previous study . Additionally, we defined " cbct stage " as the determined morphological stage of the midpalatal suture . To make the assessment more accurate, maturation of the midpalatal suture was reconfirmed on a horizontal cross - sectional image by additionally investigating its morphology and fusion on a coronal cross - sectional planar view and on volume - rendered images . When the coronal cross - sectional image was observed as showing fusion at all three points (point a point c), it was categorized as stage e. if only some points showed fusion, it was judged as stage d. if the suture was open at all three points, it was judged as " before stage c "; if there were two high radiopaque lines with low density in the middle of the suture, or if the suture was not fused, it was considered as stage c. if only some points showed " stage c conditions, " it was judged as stage b. if there was no stage c condition and a mixture of opacity was observed at all three points, or if only one weak radiopaque line was observed, it was judged as stage a. then, the volume - rendered computed tomography image was clipped with a minimum unit of a 5-mm thickness, including the midpalatal suture . Opacity, brightness, and contrast were adjusted to maximize visibility on an axial plane view . Among the rendering modes in the software, only three modes (i.e., gray scale mode, inverse mode, and soft tissue 2 mode) that clearly visualized the midpalatal suture were used . Final maturation of the midpalatal suture was determined by reconfirming the result from each volume rendering mode (figure 2). The skeletal maturation indicator (smi) proposed by fishman67 the cvm was used on cephalometric radiographs, as suggested by hassel and farman.8 dental age was assessed by applying the hellman's index to a panoramic radiograph.9 the chronological age and sex of each patient were investigated . After measurement, 30 samples were selected randomly from the same patient group after 2 months and re - assessed with the same method . The intra - class correlation coefficient (icc) was calculated to test the reliability of the cbct stage, and developmental age indices were determined by one investigator . Icc values were 0.995 (p <0.05) for cbct stage, 0.996 (p <0.05) for the hwm, 0.991 (p <0.05) for the cvm, and 0.992 (p <0.05) for hellman's index . To observe correlations between cbct stages and each maturation index, a crosstab analysis by contingency coefficients was performed to determine associations between cbct stages and each maturation index . Assessment was performed by using gamma () and kendall's tau - b (-b) as association measures . Before the study commenced, we estimated the sample size needed to reach statistical significance . A power analysis with g*power 3.1.9.2 (universitt dsseldorf, germany) showed that 93 subjects would be needed for a statistical power of more than 85% to detect significant differences with a 0.5 effect size and a significance level of = 0.05 (actual power = 0.851; critical chi - square = 31.41; noncentrality parameter = 23.25). Institutional review board approval was granted by the wonkwang university daejeon dental hospital (daejeon, korea) to conduct this study (irb no . W1404/004 - 001). From august 2009 to february 2014, patients between the ages of 7 and 20 years who visited the department of orthodontics, wonkwang university sanbon dental hospital (gunpo, korea) for orthodontic treatment and who underwent cbct were selected . Among 319 patients in this group, 99 patients without any exclusion factors the average ages of the sample groups were 14.3 3.27 years (ages 818 years) and 13.56 3.12 years (ages 620 years) for male and female subjects, respectively . We collected data that had been obtained from each patient for orthodontic diagnosis including cbct images for assessment of the midpalatal suture, hand - wrist and cephalometric radiographs for bone age, and panoramic radiographs for dental age . The exclusion criteria were as follows: any experience with orthodontic treatmentdisease or medicine intake affecting bone metabolismomission of any diagnostic data, including cbct imagespoor - quality images that were difficult to distinguish (e.g., blurry images)more than 2 months' difference between the dates when cbct and other radiographs were acquired any experience with orthodontic treatment disease or medicine intake affecting bone metabolism omission of any diagnostic data, including cbct images poor - quality images that were difficult to distinguish (e.g., blurry images) more than 2 months' difference between the dates when cbct and other radiographs were acquired cbct (pax - zenith3d; vatech korea ind . Co., gyeong - gido, korea) images were taken using the following parameters: 105 kvp, 6.2 mas, 1524 second scan time, 0.2 and 0.3 mm voxel sizes, and field - of - view, 16 cm 14 cm . The images were converted to digital imaging and communication in medicine (dicom) format . Dicom files were reconstructed into a three - dimensional image by multiplanar reformatting and volume rendering using imaging software (invivodental 5.0; anatomage, san jose, ca, usa). Cephalometric radiographs, panoramic radiographs, and hand - wrist radiographs were evaluated by using an exclusive imaging program (piviewstar; infinitt, seoul, korea). A screen capture of every slide and image was taken and saved in jpeg file format for this study . Every slide and image was arranged on a black background and assessed on a 27-inch high - resolution (1,920 1,018 pixel) monitor using a viewer program (acdsee pro 6.2; acd systems international inc ., there was no modification made on the monitor or to the saved images, such as changing the brightness or contrast . To standardize the cbct images, head reorientation was performed . After making the position indicator visible, the vertical line of the cursor (green line) was matched to the axis of the palatal plane line (anterior nasal spine - posterior nasal spine; ans - pns) on an axial view (figure 1a). At the same time, on a coronal view, the vertical line of the cursor was matched to the nasal septum, and the horizontal line of the cursor (orange line) was oriented parallel to the palatal plane (figure 1b). To facilitate observation of the axial cross - sectional planar view of the midpalatal suture, it was established that the horizontal line of the cursor would intersect the middle of the palate in the sagittal plane (figure 1c). To evaluate the morphology of the midpalatal suture more accurately than in a previous study,10 a new axial cross - sectional plane was established as follows: four points that divide the ans - pns into fifths in the midsagittal plane were defined as point a, point b, point c, and point d, starting at the nearest pns point (figure 1d). A vertical line was drawn from point a to the horizontal line of the cursor, and the points at which the extension of the vertical line met the upper and lower borders of the palatal bone were defined as point a' and point a ", respectively . The midpoint of point a' and point a " was defined as point a. point b and point c were defined using the same method (figure 1d). Point d was excluded from measurement because images of the nasopalatine canal and midpalatal suture showed a high tendency to overlap . The horizontal line of the cursor was matched to a virtual line connecting point a, point b, and point c (figure 1d). The horizontal cross - sectional image that showed the midpalatal suture most evidently and seemed longest was selected by moving the horizontal line up and down in a 1-mm range . If it was impossible to find a line connecting all three points, the shape of the palate was considered a curve, and two horizontal cross - sectional images going through point a point b and point b point c were observed . Cbct images of the midpalatal suture were assessed on an axial plane view from stage a to stage e according to the classification scheme of angelieri et al.10 the morphology of the midpalatal suture was regarded as an indicator of maturation, similar to a previous study . Additionally, we defined " cbct stage " as the determined morphological stage of the midpalatal suture . To make the assessment more accurate, maturation of the midpalatal suture was reconfirmed on a horizontal cross - sectional image by additionally investigating its morphology and fusion on a coronal cross - sectional planar view and on volume - rendered images . When the coronal cross - sectional image was observed as showing fusion at all three points (point a point c), it was categorized as stage e. if only some points showed fusion, it was judged as stage d. if the suture was open at all three points, it was judged as " before stage c "; if there were two high radiopaque lines with low density in the middle of the suture, or if the suture was not fused, it was considered as stage c. if only some points showed " stage c conditions, " it was judged as stage b. if there was no stage c condition and a mixture of opacity was observed at all three points, or if only one weak radiopaque line was observed, it was judged as stage a. then, the volume - rendered computed tomography image was clipped with a minimum unit of a 5-mm thickness, including the midpalatal suture . Opacity, brightness, and contrast were adjusted to maximize visibility on an axial plane view . Among the rendering modes in the software, only three modes (i.e., gray scale mode, inverse mode, and soft tissue 2 mode) that clearly visualized the midpalatal suture were used . Final maturation of the midpalatal suture was determined by reconfirming the result from each volume rendering mode (figure 2). The skeletal maturation indicator (smi) proposed by fishman67 was used on hand - wrist radiographs to evaluate bone age . The cvm was used on cephalometric radiographs, as suggested by hassel and farman.8 dental age was assessed by applying the hellman's index to a panoramic radiograph.9 the chronological age and sex of each patient were investigated . 22.0 (ibm co., armonk, ny, usa). The distribution and percentage of each measurement and age were calculated . After measurement, 30 samples were selected randomly from the same patient group after 2 months and re - assessed with the same method . The intra - class correlation coefficient (icc) was calculated to test the reliability of the cbct stage, and developmental age indices were determined by one investigator . Icc values were 0.995 (p <0.05) for cbct stage, 0.996 (p <0.05) for the hwm, 0.991 (p <0.05) for the cvm, and 0.992 (p <0.05) for hellman's index . To observe correlations between cbct stages and each maturation index, a crosstab analysis by contingency coefficients was performed to determine associations between cbct stages and each maturation index . Assessment was performed by using gamma () and kendall's tau - b (-b) as association measures . The distribution of the total sample and the sexes related to each developmental age index according to cbct stage (maturation of the midpalatal suture) are presented in tables 2, 3, 4, 5, 6 . Correlations between cbct stage and developmental age indices (hwm, cvm, and hellman's dental age) or chronological age were investigated . The hwm and cbct stage showed an especially strong correlation (0.904) and the cvm and cbct stage showed a strong correlation (0.874). Correlations between cbct stage and hellman's index for chronological age were relatively weak (0.777 and 0.774, respectively). In male subjects, a strong correlation was observed between cbct stage and the hwm (0.857). The cvm also showed a strong correlation (0.813), and this result was similar in female subjects (0.887 and 0.862, respectively). The results of the crosstab analysis between cbct stage and the hwm, cvm, hellman's index, and chronological age are presented in table 8 . Crosstab analysis by contingency coefficients showed that the hwm and cvm had the highest and kendall's -b values . When compared, the hwm and cvm both showed significantly high values, but the hwm showed a slightly higher value (= 0.924> 0.905, kendall's -b = 0.087> 0.784). The association between hellman's index and chronological age also reached a significant level, but the contingency coefficient values were lower than those for the hwm and cvm (= 0.809 and 0.741; and kendall's -b = 0.673 and 0.635, respectively). The crosstab analysis according to sex also showed that the hwm and cvm were significantly higher, while hellman's index and chronological age were relatively lower (table 8). The distribution of the total sample and the sexes related to each developmental age index according to cbct stage (maturation of the midpalatal suture) are presented in tables 2, 3, 4, 5, 6 . Correlations between cbct stage and developmental age indices (hwm, cvm, and hellman's dental age) or chronological age were investigated . The hwm and cbct stage showed an especially strong correlation (0.904) and the cvm and cbct stage showed a strong correlation (0.874). Correlations between cbct stage and hellman's index for chronological age were relatively weak (0.777 and 0.774, respectively). In male subjects, a strong correlation was observed between cbct stage and the hwm (0.857). The cvm also showed a strong correlation (0.813), and this result was similar in female subjects (0.887 and 0.862, respectively). The results of the crosstab analysis between cbct stage and the hwm, cvm, hellman's index, and chronological age are presented in table 8 . Crosstab analysis by contingency coefficients showed that the hwm and cvm had the highest and kendall's -b values . When compared, the hwm and cvm both showed significantly high values, but the hwm showed a slightly higher value (= 0.924> 0.905, kendall's -b = 0.087> 0.784). The association between hellman's index and chronological age also reached a significant level, but the contingency coefficient values were lower than those for the hwm and cvm (= 0.809 and 0.741; and kendall's -b = 0.673 and 0.635, respectively). The crosstab analysis according to sex also showed that the hwm and cvm were significantly higher, while hellman's index and chronological age were relatively lower (table 8). There have been many attempts to determine whether surgical procedures are necessary to expand the maxilla . Sarpe has been recommended by timms and vero11 for patients aged 25 years and older and by epker and wolford12 for those aged 16 years and older . Moreover, many other studies recommended various ages from 14 to 20 years and older.131415 however, accurate clinical guidelines regarding treatment timing for maxillary expansion are not available . Additionally, existing studies have shortcomings in that they suggested appropriate treatment timing in chronological age; however, it is generally known that chronological age is not a precise index in predicting skeletal maturation, and these studies did not assess the midpalatal suture itself.1617 therefore, the aim of this study was to investigate the relationship between various developmental age indices including skeletal age and the morphology of the midpalatal suture . To evaluate the morphology of the midpalatal suture according to maturation, cbct images were assessed by conventional methods.1018 however, conventional methods have limitations, including the possibility of the images appearing different depending on the position of the cross - sectional slice . If the cross - sectional slice is not positioned properly in the middle of the midpalatal suture, the practitioner can misjudge the cbct stage . Therefore, in this study, it was established that the cross - section slice would intersect the middle of the palate, and maturation of the midpalatal suture also was evaluated based on a coronal cross - sectional planar view and on various volume - rendered images (figures 1 and 2). Angelieri et al.10 reported that stage a was observed mostly in the early childhood period from 5 to 11 years of age (four of five subjects), and stage b was observed mostly up to 13 years of age (50 of 57 subjects). Stage a was observed mostly in ages 5 to 10 years, and stage b was observed mostly in ages 10 to 12 years (table 6). In this study, fusion of the midpalatal suture below age 11 was not seen; compared with angelieri et al.,10 stage c had a relatively more dense distribution from 9 to 14 years of age in the current study, probably because of differences in the experimental method and race (table 6). The female subject sample was distributed somewhat more toward the upper side in table 6 than the male sample at the same cbct stage in this study, meaning that maturation occurred earlier in female subjects than in male subjects (tables 3, 4, 6). These findings were similar to those in a prior study.10 this coincides with the fact that pubescent growth begins and is completed 2 years earlier in females than in males.19 however, because the number of samples in this study was not sufficient and the female sample showing stage d or e was larger than in the male sample, it was difficult to conclude if there was a difference between the sexes . The correlation analysis in this study showed statistical significance for all index values (table 7). Among them, the hwm and cvm showed strong correlations with cbct stage (0.904 and 0.874, respectively), while chronological age and hellman's dental age showed relatively weak correlations (0.774 and 0.777, respectively). This result was similar to the findings of other studies showing strong correlations between facial skeletal growth and skeletal age.1920 a difference is that previous studies evaluated facial size by linear growth of the mandible, but the current study evaluated maturation of the midpalatal suture . Because of statistical weakness, it was impossible to compare relative usability among each index with values from the correlation analysis . Thus, a crosstab analysis using a contingency coefficient was performed additionally (table 8).21 when the crosstab analysis was performed with cbct stages, the hwm (= 0.924, kendall's -b = 0.807) and cvm (= 0.905, kendall's -b = 0.784) showed higher values than chronological age (= 0.741, kendall's -b = 0.635) and hellman's dental age (= 0.809, kendall's -b = 0.673). This means that maturation based on the morphology of the midpalatal suture was more consistent with skeletal age than with chronological age or dental age . This further demonstrates that when predicting the morphology of the midpalatal suture, it can be expected that skeletal age (hwm and cvm) is a more useful index than either chronological or dental age . There has been no study comparing developmental age indices and cbct findings in the manner of the current study; only studies about the clinical usability and predictability of the hwm and cvm have been performed.8172223 as presented in table 8, the crosstab analysis between the hwm and cbct stage showed higher values than the analysis between the cvm and cbct stage in both sexes . This illustrates that the hwm is more suitable for predicting maturation based on the morphology of the midpalatal suture, reflecting a result similar to those of other studies . Recently, beit et al.24 and mellion et al.25 reported that the cvm offered no advantage over chronological age in assessing skeletal age or predicting the pubertal growth spurt . However, mellion et al.25 reported that although the hwm is not accurate, it nonetheless is useful in predicting the maximum growth period and in assessing skeletal age because of the repeatability of measurements and least inter - observer error . Beit et al.24 also suggested that the hwm has more reproducibility, sensitivity, and accuracy in predicting the maximum growth period because the sesamoid bone serves as a certain landmark . It is notable that before stage 6 of the hwm, stage d or e (i.e., fusion of the suture) was not observed in either the male group or female group (table 3). There was no fusion before stage 3 of the cvm in the female group or before stage 4 in the male group (table 4). Only when stage 10 or 11 of the hwm and stage 5 or 6 of the cvm appeared did stage e become evident, meaning that there was total fusion of the suture (tables 3 and 4) therefore, nonsurgical maxillary expansion may be recommended before stage 6 in the smi and before stage 3 in the cvm, and a surgical approach may be considered after these stages are recognized; direct assessment of the midpalatal suture using cbct may be recommended . An issue that must be considered in maxillary expansion is other anatomical structures that resist expansion force . It is well known that resisting anatomical structures include not only the midpalatal suture, but also the zygomaticotemporal suture, zygomaticofrontal suture, and zygomaticomaxillary suture, among others.262728 only the midpalatal suture was considered in this study . Another issue that must be considered in this study is that the morphology on the radiographic image can differ from the actual structure of the midpalatal suture itself.29 histological assessment and micro computed tomography may be needed to evaluate maturation of the midpalatal suture with greater accuracy.10 in this study, we evaluated maturation stage based on the morphology of the midpalatal suture on cbct images, and investigated correlations and associations between the maturation stage of the midpalatal suture and developmental age indices . Among developmental age indices, the hwm and cvm showed strong correlations and high associations with the maturation stage of the midpalatal suture on cbct images, meaning that these methods can be used to speculate on the maturation of the midpalatal suture according to its morphology.
|
The posts are commonly used to restore endodontically treated teeth when the remaining coronal tissue is insufficient or inadequate, to provide adequate support and retention for the restoration . The rationale of using dual cured resin cement is to have a material with extended working time, which is capable of polymerization by both chemical and light activation . However, many studies have proved that autopolymerizing alone does not provide the adequate degree of conversion for the dual cure resin cement. [13] some dual cure resin cements are primarily dependent on light activation, so an inadequate degree of conversion is expected when light for initiation is not available . The property of translucency of light transmitting posts proves favorable for luting purposes, as the transmission of light through the post, into the depths of the root canal, allows adequate polymerization of the dual cure resin cement . However, light intensity declines rapidly as the distance from the light source increases, because of light scattering within the resin cement and shadowing produced by both the tooth structure and post . Therefore, light intensity may be insufficient for the complete curing of resin cement at the apical end, which might lead to inferior physical and biological properties . There are very few studies that have evaluated the light transmitting properties of fiber posts and the degree of conversion of resin cements cured through these posts simultaneously . Moreover the methodology is different and the standardization of the shape and size of the posts has not been taken into consideration . Therefore, this study was taken up to measure light transmission through similar shaped dt light and dt white posts and also to evaluate the degree of polymerization of al cure resin cement cured through these posts, by using fourier transform infrared spectroscopy (ftir). The translucent quartz fiber dt light post (rtd, france) and dt white post (rtd, france) were used in this study . Both the fiber posts were 20 mm long, double tapered and identical in shape and size, having a diameter of 2.2 mm cervically and 1.2 mm apically . For the control group, customized metal posts of identical the posts were divided into two experimental groups, that is, group a (dt light post), group b (dt white post), and control, that is, group c (metal post). Ten posts from each group were used for evaluating light transmission and the same ten posts from each group were used for evaluating the degree of polymerization of the dual cure resin cement around different posts . A light box was constructed, to ensure light - proof surroundings and to measure the intensity of the transmitted light . Posts of each group were placed in the light box through a silicon stopper and were illuminated with curing light (mini l.e.d . Pictures of all samples of each group were taken with the camera (dslr d80, nikon u.s.a), in a dark room . A straight line was drawn in the center of the photograph of each post and then 1200 values of intensity were obtained from one end (coronal) to the other (apical), through each photograph . The first 300 values corresponding to 5 mm, which would be outside the post space, were not taken into consideration . The first 300 values were assigned to the cervical, the next 300 to the middle, and the last 300 to the apical third of the post . An average of 300 values was calculated as intensities, at different levels for all the posts . Thirty molds (10 for each group), with a simulated post space 15 mm long and a diameter of 2.5 mm, were prepared in a separable hollow metal jig using polyvinyl siloxane impression material . Dual cure resin cement (relyx unicem, 3 m espe, germany) was mixed according to the manufacturer's instruction and placed in the prepared post space of the mold with the help of a capsule applier . The post of the respective group was placed in the center of the prepared post space using the centring hole of the lid of the jig as the guide . The resin cement was light cured for a standardized time of 40 seconds, with the tip of the light curing unit (mini l.e.d, satelec) touching the extruded post . The output intensity of the curing unit was consistent throughout the experiment, as measured by the radiometer . After light curing, the molds with cemented posts were kept in a light proof container for 24 hours to allow for complete polymerization . The top extruded 5 mm of every post was discarded, and the remaining 15 mm of cured cement, along with the post, was sectioned into three equal parts of 5 mm each (coronal, middle, apical). This sample was put into a hydraulic press model, to make pellets of 13 mm diameter under a seven - ton hydraulic pressure . The degree of conversion% (dc) was calculated according to the following formula: where r is the peak height at 1,638 cm peak height at 1,608 cm . The mean value of dc% was calculated as a mean of ten readings corresponding to ten samples . The data obtained was subjected to statistical analysis using one - way analysis of variance (anova) with post hoc analysis (bonferroni), for comparison of the means . The pearson correlation test was applied to see the correlation between the transmission of light and degree of polymerization . A light box was constructed, to ensure light - proof surroundings and to measure the intensity of the transmitted light . Posts of each group were placed in the light box through a silicon stopper and were illuminated with curing light (mini l.e.d . Pictures of all samples of each group were taken with the camera (dslr d80, nikon u.s.a), in a dark room . A straight line was drawn in the center of the photograph of each post and then 1200 values of intensity were obtained from one end (coronal) to the other (apical), through each photograph . The first 300 values corresponding to 5 mm, which would be outside the post space, were not taken into consideration . The first 300 values were assigned to the cervical, the next 300 to the middle, and the last 300 to the apical third of the post . An average of 300 values was calculated as intensities, at different levels for all the posts . Thirty molds (10 for each group), with a simulated post space 15 mm long and a diameter of 2.5 mm, were prepared in a separable hollow metal jig using polyvinyl siloxane impression material . Dual cure resin cement (relyx unicem, 3 m espe, germany) was mixed according to the manufacturer's instruction and placed in the prepared post space of the mold with the help of a capsule applier . The post of the respective group was placed in the center of the prepared post space using the centring hole of the lid of the jig as the guide . The resin cement was light cured for a standardized time of 40 seconds, with the tip of the light curing unit (mini l.e.d, satelec) touching the extruded post . The output intensity of the curing unit was consistent throughout the experiment, as measured by the radiometer . After light curing, the molds with cemented posts were kept in a light proof container for 24 hours to allow for complete polymerization . The top extruded 5 mm of every post was discarded, and the remaining 15 mm of cured cement, along with the post, was sectioned into three equal parts of 5 mm each (coronal, middle, apical). This sample was put into a hydraulic press model, to make pellets of 13 mm diameter under a seven - ton hydraulic pressure . The degree of conversion% (dc) was calculated according to the following formula: where r is the peak height at 1,638 cm peak height at 1,608 cm . The mean value of dc% was calculated as a mean of ten readings corresponding to ten samples . The data obtained was subjected to statistical analysis using one - way analysis of variance (anova) with post hoc analysis (bonferroni), for comparison of the means . The pearson correlation test was applied to see the correlation between the transmission of light and degree of polymerization . The light intensity decreased from cervical to apical for both the dt light post and the dt white post, but there was insignificant difference between the middle and apical third of the dt white post group . Graphic representation of mean light transmission of a different post at the cervical, middle and apical third the highest degree of polymerization was shown by the dt light post group . The degree of polymerization decreased significantly from the cervical to the apical for the dt light post group, but the dt white post and metal post group showed insignificant difference between the middle and apical third [figure 2]. Graphic representation of the mean percentage of the degree of polymerization of dual cure cement at the cervical, middle, and apical third of different posts in this study there was no light transmission at any level of the metal post in the control group because of its non - light transmitting property . The light transmission for dt light post was found to be significantly greater (p <0.05) than that of the dt white post at all levels . The quantity of light that would be absorbed, reflected, and transmitted seemed to depend on the resin matrix and on the fiber composition of each post . The light transmission of the dt white post was extremely low due to its opaque nature and the presence of a large number of white quartz fibers embedded in an epoxy resin matrix . The difference was in the agreement of the results of kim, who showed that the dt light (translucent) and frc postec (translucent) posts revealed higher light transmission than snowpost (opaque) post . The intensity of light decreased from cervical to apical for both the dt light post and the dt white post . The difference was significant for the dt light post at all the three levels (p <0.05). This difference in light transmission at the three levels could be attributed to the decrease in intensity of light as the distance from the light source increased . It was found by felix and price that light intensity decreased as the distance increased for all types of light, and this effect was due to the dispersion of light . Our results were consistent with the findings of other studies, which reported a decrease in light transmission in the fiber post from the coronal to the apical. [810] for the dt white post, the light transmission at the middle third was not significantly different from that in the apical third, which showed negligible light transmission . This finding was in agreement with friedrich and patyk, who demonstrated that the para post fiber white (opaque) post resulted in total lack of light emission in the middle and apical thirds . This study demonstrated that there was a positive correlation between the extent of light transmission and the degree of polymerization of resin cement . The highest degree of polymerization was shown by the dt light post group at all levels as compared to the dt white and metal post groups . This difference could be attributed to the capacity of dt light post to transmit light to the deeper depths, to activate the light cured component of the polymerization system, as shown by the results of this study . Several studies have reported greater depth of cure with light transmitting posts, as compared to opaque posts . The dt white post showed a better degree of polymerization at the cervical third as compared to the metal post, but the difference at the middle and apical third was statistically insignificant . This was because the dt white post transmitted light in the cervical third only, thus both the dt white and metal groups relied on the self - curing component of the polymerization system at the middle and apical thirds . This finding concurred with the results of sigemori and others, who demonstrated that the self - curing mode alone was unable to provide the optimal hardness value of relyxx arc . Several studies have reported superior mechanical properties of resin cements cured through dual curing compared to self - curing alone . This difference in the degree of polymerization at different levels may be attributed to the difference in light transmission of the post at different levels . The more intense the light source, the more are the photons accordingly available for absorption by the photo sensitizers . This help to form free radicals, to initiate and propagate the polymerization process . Also, at the surface of the resin, polymerization is more efficient because of the ample number of photons provided directly from the light source . The decrease in the degree of conversion of dual cure resin cement from coronal to apical is in agreement with the other studies . Teixera and others have found that vickers hardness number, which indirectly reflects the degree of polymerization of dual cure resin cement and cures through a translucent fiber post (dt light) is highest in the coronal third, followed by the middle, and then by the apical third regions of the root canal . The mean values of the degree of conversion obtained in the current study ranged from 26.01 to 62.3%, which was in accordance with the results of kumbuloglu and others . They reported a higher degree of polymerization of relyxx unicem for the dual cured (56%), as compared to the autopolymerized (26%), using ftir . The difference in values could be because of the method of ftir, that is, the kbr method used in our study, as compared to the film technique used by kumbuloglu and others . Ferracane and greener compared the methods of ftir and suggested that the kbr method gave slightly greater values for a degree of polymerization than those obtained by the film technique . An important finding of our study was the fact that although the mean degree of polymerization achieved in dt light at the apical third (38.96%) was greater than the dt white and metal, it was still not adequate for the optimum mechanical properties . The difference in the diameter of the post at three levels resulted in a different thickness of cement around it . Caughman and others, in their study, found a maximum degree of conversion of dual cure cement when the thickness of composite restoration above it was 3 mm . In our study the maximum thickness of dual cure resin cement was 1.3 mm and it was in direct contact with the post . Thus, it is expected that a difference in thickness of 1 mm of dual cure cement will not have any impact on the degree of polymerization . As only one dual cured resin cement was evaluated in this study, although there is a relationship between the extent of resin cement, degree of polymerization of resin cement, and physical property improvement, care must be taken not to attribute clinical success to conversion values . The degree of polymerization of dual cure cement around the esthetic post is dependent on the intensity of light transmitted through these posts.
|
About 50% of patients admitted to the intensive care unit (icu) have systemic inflammatory response syndrome (sirs). Of these, 30% have or eventually develop sepsis . Mortality rates in critically ill patients with sirs are high, ranging from 10% to 20% . . This will assist clinicians in reevaluation and intensification of therapy, which could prevent progression of organ failure and the associated increased in mortality . Neutrophil gelatinase - associated lipocalin (ngal) is a small molecule of 25 kda, which is covalently bound to gelatinase from neutrophils and expressed at low concentrations in several human tissues, including kidneys, lungs, stomach, and colon . Ngal binds to iron through its siderophores; it can deplete bacterial iron and plays an important role in immunity to bacterial infection . Ngal expression is markedly induced by inflammation, such as in acute bacterial infections, severe sepsis and septic shock, asthma or chronic obstructive airway disease, or emphysematous lung . The limitation of that study was that we only analyzed on admission plasma ngal concentration . Of interest is how the dynamic of ngal changes as a tool of mortality prediction as has been shown previously that single measurements of biomarkers were not predictive; however, their dynamic concentrations were predictive . A further analysis looking at the dynamic of ngal over several days for prediction of mortality may be of interest . This was a secondary analysis of a single - center, prospective, observational study of hospital tengku ampuan afzan, kuantan, pahang, malaysia . The study was an extension of the boss - icu study, registered under the national medical research register (nmr-11 - 1102 - 9248). Only patients with available ngal data measured serially for the first 3 days were included in this analysis . All consented patients aged above 18 years with established sirs based on the criteria defined by the american college of chest physician / society of critical care medicine (accp / sccm) were recruited in the study . Sirs is defined by the presence of at least two of the following four indicators: (1) a body temperature above 38.0c or below 36.0c; (2) a heart rate above 90 beats / min; (3) a respiratory rate above 20 breaths / min; (4) a white blood cell count higher than 12,000 or lower than 4000 cells/l or more than 10% immature (band) form . Consent from legally accepted representative was taken as the patients were mostly unconscious or undergoing resuscitation . Patients with age <18 years, no written consent, or who had received antibiotics for more than 24 h before screening were excluded from the study . Blood samples were collected within 24 h of icu admission and daily for 3 consecutive days . The samples were centrifuged at 3600 rpm for 15 min and the plasma were stored at 80c . Plasma ngal was analyzed using the triage ngal test (biosite, san diego, usa). Plasma electrolytes were analyzed using the olympus au2700 chemistry - immunoanalyzer (olympus, philadelphia, usa). Ngal at 24 and 48 h (ngal-24 and ngal-48) was defined as 24 and 48 h ngal minus day 1 ngal . Ngal clearance (ngalc) at 24 and 48 h (ngalc-24 and ngalc-48) was defined as the percentage of ngal-24 and ngal-48 to day 1 ngal . Statistical analysis was performed using pasw version 18.0 (ibm, somers, new york, usa), and prism 5.0 (graph pad, la jolla, california, usa). Results are presented as mean standard deviation for normally distributed variables or median (interquartile range) for nonnormally distributed variables . Comparison of variables between the two groups was analyzed using independent t - test for normally distributed variables or mann whitney test for nonnormally distributed variables . Differences between three groups were analyzed using one - way analysis of variance, with post hoc least significant difference analysis . The diagnostic and predictive performance of ngal were assessed by area under the curve (auc) of receiver operating characteristic (roc) curve of the sensitivity versus 1-specificity . The optimal cutoff point was defined as the measured quantity, which maximized sensitivity and specificity . Survival analysis was performed using kaplan meier and cox regression survival analyses for calculation of hazard ratios (hrs). All auc, hr, and integrated discrimination improvement were presented with 95% confidence intervals . Statistical analysis was performed using pasw version 18.0 (ibm, somers, new york, usa), and prism 5.0 (graph pad, la jolla, california, usa). Results are presented as mean standard deviation for normally distributed variables or median (interquartile range) for nonnormally distributed variables . Comparison of variables between the two groups was analyzed using independent t - test for normally distributed variables or mann whitney test for nonnormally distributed variables . Differences between three groups were analyzed using one - way analysis of variance, with post hoc least significant difference analysis . The diagnostic and predictive performance of ngal were assessed by area under the curve (auc) of receiver operating characteristic (roc) curve of the sensitivity versus 1-specificity . The optimal cutoff point was defined as the measured quantity, which maximized sensitivity and specificity . Survival analysis was performed using kaplan meier and cox regression survival analyses for calculation of hazard ratios (hrs). All auc, hr, and integrated discrimination improvement were presented with 95% confidence intervals . A total of 151 patients were included in the study . Of these, 53 (35.1%) died in the hospital . Mortality increases with increasing number of sirs criteria (chi - square test, p = 0.05; table 1). Comparing between each stage, the differences in mortality were significant only between 2 and 4 sirs criteria (p = 0.04). Table 2 compares the baseline demographic, clinical characteristics, and outcome between patients survivors and nonsurvivors . Nonsurvivors were older and had higher sequential organ failure assessment (sofa) and simplified acute physiology score ii (saps ii) scores as compared to survivors . Mortality with number of systemic inflammatory response syndrome criteria demographics and clinical characteristics between survivors and nonsurvivors the temporal profile of ngal between survivors and nonsurvivors is shown in figure 1 . Ngal concentrations were consistently higher in nonsurvivors compared to survivors from day 1 to day 3 (mann whitney test, p <0.04). Ngal and ngalc at 48 h (ngal-48 and ngalc-48) were higher in nonsurvivors compared to survivors . In contrast, there were no differences in ngal kinetics at 24 h [table 3]. Temporal profiles of plasma neutrophil gelatinase - associated lipocalin concentration between survivors and nonsurvivors within the first 3 days of intensive care unit admission . Mann whitney test, p = 0.04 (day 1), p = 0.02 (day 2), and p = 0.007 (day 3). Repeated measures analysis of variance showed the difference between subjects, p <0.0001, and within subjects, p = 0.28 . Neutrophil gelatinase - associated lipocalin concentrations and neutrophil gelatinase associated lipocalin between survivors and nonsurvivors the auc of the roc curve for prediction of mortality is shown in figure 2 and table 4 . Ngal kinetics at 48 h (ngal-48 and ngalc-48) but not 24 h was predictive of mortality . The differences of the auc between static and dynamic ngal are presented in table 5 . Of these, the differences between day 1 and day 3 ngal were significant (0.05 [0.10.001], p = 0.04). For dynamic ngal, the differences were significant for ngal kinetics at 24 versus 48 h, with p = 0.03 for both . When comparing static versus dynamic ngal, differences were only shown for day 3 ngal versus ngal-24 (p = 0.04). The area under the curve of the sensitivity over 1-specificity curve for static and dynamic neutrophil gelatinase - associated lipocalin concentration . Area under receiver operating characteristics curve for prediction of mortality the differences in the area under curve between static and kinetic of neutrophil gelatinase - associated lipocalin the utility of ngal and its kinetics for prediction of mortality were further evaluated after adjusting for other covariates . After adjusting for age, presence of acute kidney injury (aki), and severity of illness (saps ii), only day 3 ngal, ngal-48, and ngalc-48 were independently predictive of mortality [table 6]. Multivariate analysis for prediction of mortality survival analysis of ngalc-48 at a cutoff point of 24% was analyzed [figure 3]. There was lower survival in patients with ngalc at 48 h of more than 24% compared to those with lower cutoff point (log mantel cox, p = 0.03). After adjusted for age and severity of illness, patients with ngalc-48 more than 24% were twice more likely to die at 30 days compared to those less than the cutoff point (cox regression analysis, odds ratio 2.10 [1.054.18], p = 0.03). Survival analysis of neutrophil gelatinase - associated lipocalin clearance at 48 at a cutoff point of 24% . Patients with neutrophil gelatinase - associated lipocalin clearance at 48 h of more than 24% were more likely to die within 30 days compared to those with lower cutoff point (log mantel cox, p = 0.03). Ngal concentrations were consistently higher in nonsurvivors compared to survivors from day 1 to day 3 (mann whitney test, p <0.04). Ngal and ngalc at 48 h (ngal-48 and ngalc-48) were higher in nonsurvivors compared to survivors . In contrast, there were no differences in ngal kinetics at 24 h [table 3]. Temporal profiles of plasma neutrophil gelatinase - associated lipocalin concentration between survivors and nonsurvivors within the first 3 days of intensive care unit admission . Mann whitney test, p = 0.04 (day 1), p = 0.02 (day 2), and p = 0.007 (day 3). Repeated measures analysis of variance showed the difference between subjects, p <0.0001, and within subjects, p = 0.28 . Neutrophil gelatinase - associated lipocalin concentrations and neutrophil gelatinase associated lipocalin between survivors and nonsurvivors the auc of the roc curve for prediction of mortality is shown in figure 2 and table 4 . Ngal kinetics at 48 h (ngal-48 and ngalc-48) but not 24 h was predictive of mortality . The differences of the auc between static and dynamic ngal are presented in table 5 . Of these, the differences between day 1 and day 3 ngal were significant (0.05 [0.10.001], p = 0.04). For dynamic ngal, the differences were significant for ngal kinetics at 24 versus 48 h, with p = 0.03 for both . When comparing static versus dynamic ngal, differences were only shown for day 3 ngal versus ngal-24 (p = 0.04). The area under the curve of the sensitivity over 1-specificity curve for static and dynamic neutrophil gelatinase - associated lipocalin concentration . Area under receiver operating characteristics curve for prediction of mortality the differences in the area under curve between static and kinetic of neutrophil gelatinase - associated lipocalin the utility of ngal and its kinetics for prediction of mortality were further evaluated after adjusting for other covariates . After adjusting for age, presence of acute kidney injury (aki), and severity of illness (saps ii), only day 3 ngal, ngal-48, and ngalc-48 were independently predictive of mortality [table 6]. Survival analysis of ngalc-48 at a cutoff point of 24% was analyzed [figure 3]. There was lower survival in patients with ngalc at 48 h of more than 24% compared to those with lower cutoff point (log mantel cox, p = 0.03). After adjusted for age and severity of illness, patients with ngalc-48 more than 24% were twice more likely to die at 30 days compared to those less than the cutoff point (cox regression analysis, odds ratio 2.10 [1.054.18], p = 0.03). Survival analysis of neutrophil gelatinase - associated lipocalin clearance at 48 at a cutoff point of 24% . Patients with neutrophil gelatinase - associated lipocalin clearance at 48 h of more than 24% were more likely to die within 30 days compared to those with lower cutoff point (log mantel cox, p = 0.03). In this prospective study, we showed that day 3 ngal and ngal kinetics at 48 h were independently predictive of mortality in critically ill patients with sirs . In contrast, plasma ngal measured on icu admission was not independently predictive of mortality . Patients with ngalc at 48 h at a cutoff point of 24% were twice more likely to die compared to those at a lower cutoff point . It is common in intensive care settings, occurring in more than 50% of patients admitted to the icu, higher in surgical icu . About one - third of sirs patients have or eventually develop sepsis, and about 10%20% died . In our study, similarly, we showed that mortality occurred in 58% of patients with 4 sirs criteria compared to 42% in those with 3 sirs criteria and 28% with 2 sirs criteria . The differences in mortality were significant between 2 and 4 sirs criteria (p = 0.04). This could alert an intensivist for reevaluation or intensification of therapy, for example, early dialysis, modification of antimicrobial therapy, or the need for additional diagnosis measures, which could prevent progression of organ failure and the associated increased in mortality . It has been investigated as a biomarker of sepsis and aki and prediction of mortality . This may be of limited value due to variability of biomarker secretion at different phases of critical illness and unknown time lapsed between insult and icu admission . We showed that plasma ngal measured on icu admission was not predictive of mortality after adjusting for age, presence of aki, and severity of illness . In contrast, plasma ngal measured after 48 h was independently predictive with an odds ratio of 2.58 (1.265.29). We showed that day 3 ngal and ngal kinetics at 48 h were moderately predictive of mortality with auc of> 0.60 . The auc is a measure of discrimination that is how well a given test (e.g., a new biomarker) separates those with and without disease as determined by the gold standard . Hence, auc of day 3 ngal and ngal kinetics at 48 h of 0.64 is not assumed to be predictive of mortality . In addition, differences between the auc of static versus dynamic ngal was only significant between day 3 and ngal-24 . However, the main limitation of the auc is that its calculation is based on rank, merely considering the comparative rank between those with and without the disease . It does not take into account the extent of change of the biomarker or its distribution . Any change of rank in those at low distribution will have the same impact in those at high distribution . The additional value of a new biomarker to an available clinical diagnostic or predictor assessment (the reference model) may be better assessed by the multivariate logistic regression analysis . Ngal kinetics has an added value in reference to the saps ii for prediction of mortality . This is shown in the multivariate logistic regression analysis which showed that ngal kinetics at 48 h predicted mortality even after adjusted for saps ii . We did not include both sofa and saps ii as both contain almost similar parameters and are strongly correlated (r = 0.718, p <0.0001). Dynamic changes of biomarker had been shown to better predict outcome such as mortality compared to a single time point collection . The added value of calculating the dynamic changes of biomarker is that it integrates change over time, which captures function of both severity and duration of injury . Dynamic changes of creatinine, procalcitonin, and urinary cystatin c had been shown to be predictive of outcome . The extent of changes in ngal may be influenced by its baseline concentration as has been shown previously that ngal was higher in patients with sepsis compared to sirs . To adjust for this, we calculated the relative changes of ngal in relation to day 1 plasma ngal . We showed that both the actual and relative dynamic changes of ngal after 48 h were independently predictive of mortality . The cutoff point of ngalc or its dynamic changes is of interest as this could assist clinicians in identifying at - risk patient . We showed that patients with 48 h ngalc of more than 24% were twice more likely to die compared to those with clearance of less than the cutoff point . From this, we suggest that ngal could be measured on admission and repeated 48 h later to assist in identifying at - risk patients who may benefit from reevaluation and intensification of therapy . Second, the strict inclusion criteria of patients with sirs in this study limit generalizability of the finding to other patient groups in the icu . Finally, ngal was measured within 24 h of icu admission . Measurement within 24 h may capture earlier changes that occur with the kidney cellular injury . However, a study had shown that there was no difference in ngal performance when measured earlier at the emergency department or later in the icu . Second, the strict inclusion criteria of patients with sirs in this study limit generalizability of the finding to other patient groups in the icu . Finally, ngal was measured within 24 h of icu admission . Measurement within 24 h may capture earlier changes that occur with the kidney cellular injury . However, a study had shown that there was no difference in ngal performance when measured earlier at the emergency department or later in the icu . Ngal kinetics and its dynamics over 48 h were independently predicted mortality in critically ill patients with sirs . Patients with ngalc at 48 h at a cutoff point of more than 24% were twice more likely to die compared to those at a lower cutoff point . This could assist clinicians in risk stratification of this group of high - risk patients . This study was funded by the ministry of higher education fundamental research grant scheme (frgs/1/2015/skk02/uiam/02/3). This study was funded by the ministry of higher education fundamental research grant scheme (frgs/1/2015/skk02/uiam/02/3).
|
Aplastic anemia is characterized by bone marrow failure and marked decrease in all marrow elements . In severe form of aplastic anemia, rapid bone marrow transplantation after primary workup is life saving; however, protected environment and prevention of opportunistic infections may be difficult in these cases . Gram positive (predominantly gram - positive cocci) and gram negative organisms (especially multi - drug resistance (mdr) negative bacilli) are the most common causes of infections, but ifis remain the main cause of death and increase the mortality among respective patients, . Aspergillosis and mucormycosis are the most common mold infections in patients with aplastic anemia . In reported case series by valera (2011), in 32 patients with acute invasive fungal rhinosinusitis, all deaths were reported among patients with aplastic anemia despite surgical debridement and systemic antifungal therapy . Severe neutropenia predisposes these patients to more severe forms of ifis with a wide range of clinical manifestations . Gastrointestinal, upper air way, musculoskeletal cardiac, renal, disseminated infection and rhinocerebral / sino - orbital / rhinosinusitis among the most common reported manifestations of ifis in patients with aplastic anemia . Of these conditions we report on a serious fungal infection in a case of aplastic anemia and offer an appropriate strategy for the treatment and prevention in such patients . An 18 year old boy, known case of aplastic anemia since 7 years ago, admitted with severe headache and fever in emergency ward . He was a candidate for bone marrow transplantation because of standard treatment failure that included corticosteroid, anti - thymocyte globulin (atg) and cyclosporine, and put on in transplant waiting list . He had frequently received blood and platelet transfusion due to low hemoglobin (hb) level and often nose bleeding . On admission, he had severe leukopenia [white blood cell count (wbc): 100 (without cell differentiation)], anemia (hb: 6.5) and severe thrombocytopenia (platelet count: 6000). Erythrocyte sedimentation rate (esr) and c - reactive protein (crp) were 130 and 48, respectively . After initial assessment, broad spectrum antibiotics (piperacillin - tazobactam) were started for him . Two days later, he developed pain, swelling and redness of the right side of face . Gradually, the patient exhibited high grade fever, chills, intolerable headache and periodic disorientation, so due to poor clinical response, an antifungal agent (amphotericin - b deoxycholate) was added to his antibiotic regimen on fifth day of admission . In serial physical examination (after primary unilateral face swelling and cellulitis), he developed necrotic lesions in soft and hard palate followed by nasal septum, right alar groove and right nasolabial fold necrosis . Tomography scan (ct scan) was requested, which revealed right maxillary and ethmoidal sinus involvement (fig . Surgical consult has been also requested for diagnostic aspiration and evaluation for surgical debridement . Despite low platelet count, after receiving single donor platelet transfusion, after primary aspiration, right maxillary sinus debridement was performed during single donor platelet transfusion and samples were sent for pathology . Upon early surgical debridement and short time clinical improvement caspofungin was added and second surgical debridement planned 10 days after the first one, and has been organized for short interval surgical sinus debridements during platelet transfusion, till it becomes completely clear . In the next surgical debridement tissue samples were cultured on sabouraud dextrose agar (merck, darmstadt, germany) and also examined for aspergillus and candida dna by real time polymerase chain reaction (pcr) and mucoral by nested pcr, . Bacterial culture and specimen finally, all involved sinuses, nasal cavity and overlying soft tissue were completely removed by anterior and posterior ethmoidectomy and sphenoidectomy . Also, posterior part of septum was removed . Adjuvant therapy with gamma interferon 100 gr / day in combination with granulocyte - colony stimulating factor (g - csf) [300 gr / day primarily and then with full dose of 600 gr / day in two divided doses] was added to the broad antibacterial and antifungal treatments . Other assessments including blood culture and urine culture were negative and chest x - ray, abdominal ultrasonography and echocardiography were normal in primary evaluations . However in serial chest x - rays, early possible signs of pulmonary involvement detected in about 3 weeks after his admission (fig . 2). Bilateral well - circumscribed ground - glass gray opacities were detected in these chest x - rays confirmed by spiral chest ct scan (fig . 3). Our further investigation into fungal infection revealed positive mucormycosis, aspergellosis and candidiasis by pcr and positive fungal culture for aspergillus flavus and candida albicans in repeated debridement (fig . Sinus debridement during antifungal treatment was done in four times, but the patient's condition gradually worse and eventually expired . Frequent episodes of profound and prolonged neutropenia, aggressive chemotherapy, exposure to fungal spores in non protected environment and consequently preadmission colonization with fungal agents and high risk condition such as aplastic anemia and acute myeloid leukemia (aml) are some of typical examples that increase the risk of ifis . Along with high clinical suspicions, early diagnosis and treatment; multidisciplinary approach against ifis significantly reduced mortality . Constantly low absolute neutrophil count (anc), lack of standard and secure control measures such as high - efficiency - particulate - air (hepa) in many centers and progressive nature of certain fungal infections such as mucormycosis; all are important obstacles to our attempts toward controlling fungal infections in these patients . Despite very low platelet count (less than 610/microliter), our patient underwent four times of successful surgical debridement, during continuous single donor platelet transfusions, without any hemostatic complications . In each times he was referred to operation room after preparation of donor platelet for infusion during surgical debridement (fig . Along with severe neutropenia, prolonged hospital stay and broad spectrum antibiotic therapy with damaged skin and mucosal barriers and presence of indwelling catheters predisposed our patient to colonization and infection with hospital acquired multidrug resistant organisms . Such patients are at greater risk for acquisition of mdr gram positive and gram negative organisms such as acinetobacters, methicillin - resistant staphylococcus aureus (mrsas) and vancomycin - resistant enterococcus (vres). This is an important point in management of these patients that should also take into consideration such as our patient which finally complicated by vre bacteremia . Diagnostic misconception based on primary clinical presentation is one of the other important challenges in the management of ifis in severe neutropenic patients . Although rhinocerebral / sino - orbital / rhinosinusitis ifis are frequently considered as clinical manifestation of mucormycosis, it is critical to obtain proper tissue specimens for culture and biopsy, whenever possible; given the similar clinical presentations of aspergillosis . Mucoral family is difficult to cultivate and sensitivity of culture for this family was reported around 50% and thus other diagnostic modalities (histopathological carachtristics and molecular test) should be considered, if needed . Co - detection of multiple fungi also is not an uncommon event in severe neutropenic patients and accurate diagnosis can help correct decision making in choosing proper antifungal regimen . Although fever - driven approach for empirical antifungal therapy; based on existing guidelines is currently applied in many hematology oncology centers worldwide, but this issue continues to be a challenge and ifis still is one of the leading causes of mortality and morbidity in neutropenic patients with persistent fever . Other different treatment approaches either pre - emptive (diagnostic - driven approach) or targeted therapy also may be used, according to radiological findings, clinical symptoms and mycology test results . These approaches have been tested by researchers in different populations and in various settings in neutropenic patients . Despite the fact that implementation of these strategies substantially has reduced the burden of ifis in high risk patients, antifungal currently, there is no recommendation about starting antifungal prophylaxis for patients with aplastic anemia (as a one of the high risk groups) in the latest guideline of infectious diseases society of america (idsa, 2011) and 4th european conference on infections in leukemia (ecil-4, 2011), . Although prompt diagnosis and early transplantation seem to be the only reliable modality in the protection of such patients against serious infectious complications (mainly ifis), but based on our experience and also other similar reports we recommend that patients with aplastic anemia receive anti - mold prophylaxis during the period of profound and prolonged neutropenia (anc less than 500/ microliter) instead of other proposed strategies for the management of patients within pre - transplantation period . It should be noted that in the case of aspergillosis indirect tests such as galactomannan and moleculer tests have been improved our diagnostic power for early detection of ifis due to aspergillosis . Yet, there is no standard diagnostic test for early detection of mucormycosis except histopathology and culture . Also, in centers with high incidence of mucormycosis, it seems better to better that use an agent which is active against both mucormycosis and aspegillosis for prophylaxsis . The authors did not have any financial or other relationships, which could be regarded as a conflict of interest.
|
Menopause is defined as generally cessation of periods for 12 months or a period equivalent to three previous cycles or as time of cessation of ovarian function resulting in permanent amenorrhea . It is a stage when the menstrual cycle stops for longer than 12 months, and there is a drop in the levels of estrogen and progesterone, the two most important hormones in the female body (world health organization [who], 1996). The onset of this physiological development not only marks the end of women's reproductive function but also introduces them to a new phase of life . In the western world, the most typical age range for menopause (last period from natural causes) is between the ages of 40 and 61 and the average age for the last period is 51 years . The elderly population is increasing every year, and it is projected that it would increase to about 12% of the total population by the year 2025 . The average age of menopause is around 48 years, but it strikes indian women as young as 3035 years . Due to the increase in the life expectancy women will have to face longer periods of menopause . During menopausal transition, there is a lot of fluctuation in the hormone levels, and thus women may experience many symptoms and conditions . Some of the important and common symptoms women can experience during menopausal transition are changes in periods, hot flushes and night sweats, problems with vagina and bladder, changes in sexual desire, sleep problems, mood changes / swings, changes in the body, etc . There are also some serious medical concerns related to menopause as, first the loss of bone tissue that cause osteoporosis and second, heart disease risk may grow due to age - related increases in weight, blood pressure, and cholesterol levels . Some women have severe symptoms that profoundly affect their personal and social functioning, and quality of life (qol). Qol has been defined by the who as the individual's perceptions of their position in life in the context of the cultural and value systems in which they live and in relation to their goals, expectations, standards, and concerns . As it is well known today that sociocultural factors can alter women's attitude and experience of menopausal symptoms . These symptoms are found to be less common in societies where menopause is viewed as positive rather than negative event . This cultural aspect of menopausal symptoms has been described in number of studies among asian women, including japanese and chinese women . There is considerably lack of awareness about the effects of the menopausal symptoms in women in india . Studies on issues relating to menopause, especially among rural women, are lacking in india . With this background, the current study has been carried out in a rural area of west bengal . To find out the sociodemographic and behavioral characteristics of the study populationto assess the qol of the study population by menopause - specific quality of life questionnaire (menqol)to find out the variations in the menopausal symptom domains within the various sociodemographic variablesto elicit the association, if any, between menopausal symptoms and the sociodemographic and behavioral characteristics of the respondents . To find out the sociodemographic and behavioral characteristics of the study population to assess the qol of the study population by menopause - specific quality of life questionnaire (menqol) to find out the variations in the menopausal symptom domains within the various sociodemographic variables to elicit the association, if any, between menopausal symptoms and the sociodemographic and behavioral characteristics of the respondents . To find out the sociodemographic and behavioral characteristics of the study populationto assess the qol of the study population by menopause - specific quality of life questionnaire (menqol)to find out the variations in the menopausal symptom domains within the various sociodemographic variablesto elicit the association, if any, between menopausal symptoms and the sociodemographic and behavioral characteristics of the respondents . To find out the sociodemographic and behavioral characteristics of the study population to assess the qol of the study population by menopause - specific quality of life questionnaire (menqol) to find out the variations in the menopausal symptom domains within the various sociodemographic variables to elicit the association, if any, between menopausal symptoms and the sociodemographic and behavioral characteristics of the respondents this descriptive cross - sectional study was conducted among all peri - menopausal women (4060 years) in dearah village, hooghly district of west bengal which is the rural field practice area of all india institute of hygiene and public health for 2 months from february to march 2014 . The study population comprised all the peri - menopausal women (4060 years) of that area . Women with induced menopause, simple hysterectomy, receiving any kind of hormone therapy, presence of medical conditions such as diabetes, hypertension, cardiac disease, and thyroid disorderslocked houses or the women who did not give the consent were not included in the study . Women with induced menopause, simple hysterectomy, receiving any kind of hormone therapy, presence of medical conditions such as diabetes, hypertension, cardiac disease, and thyroid disorders locked houses or the women who did not give the consent were not included in the study . Using the formula, n = 4pq / l where, p = proportion in the population processing the characteristic of interest q = (p 1) and l = acceptable error taking 36.7% prevalence of vasomotor symptoms (flushing and night sweat) with acceptable error of 10% at 95% confidence interval (ci) the sample size, n = 4 0.367 0.633/0.1 0.1 = 92.92 considering 10% nonrespondents sample size came 102 . Dearah village was randomly selected from all four villages under nuhc, dearah, the rural field practice area of aiihph . The participants were assured that any information, obtained will be treated with utmost confidentiality . The women of age 4060 years were interviewed in the presence of female health workers until the required sample size was achieved . The participants were interviewed after obtaining informed consent from each participant using a predesigned, pretested questionnaire adopted from menqol and later modified by the researcher . For using it in bengali vernacular, at first, one forward and one backward translations were done parallel by one medical and one language expert so that the meaning, content, and grammatical correctness of the items remained unaltered . The internal consistency of the scale was assessed with cronbach's alpha, which was 0.782 for the scale . Part 1: sociodemographic characteristicspart 2: about qol due to menopausal symptoms based on four domains (vasomotor, psychosocial, physical, and sexual) using the 29-item menqol questionnaire . The responses to the questions were adapted to a 2 point scale consisting of yes and no options from a 6 point severity scoring pattern in the original version considering the difficulty to answer on a 6 point scale due to low level of education of the respondents . Part 1: sociodemographic characteristics part 2: about qol due to menopausal symptoms based on four domains (vasomotor, psychosocial, physical, and sexual) using the 29-item menqol questionnaire . The responses to the questions were adapted to a 2 point scale consisting of yes and no options from a 6 point severity scoring pattern in the original version considering the difficulty to answer on a 6 point scale due to low level of education of the respondents . The menqol was introduced in 1996 as a tool to assess health - related qol in the menopausal period . An inherent assumption of the menqol is that disease states and conditions such as menopause, which produce symptoms, may disrupt emotional, physical, and social aspects of an individual's life, which must be considered concomitantly with treatment decisions . The menqol improves on several instruments used to assess the impact of menopausal symptoms on qol, including the kupperman index and the general well - being scale . Each item assesses the impact of one of four domains of menopausal symptoms, as experienced over the last month: vasomotor (items 13), psychosocial (items 410), physical (items 1126), and sexual (items 2729). Items pertaining to a specific symptom are rated as present or not present, and if present, how bothersome on a zero (not bothersome) to six (extremely bothersome) point scale . Means are computed for each subscale by dividing the sum of the domain's items by the number of items within that domain . One mark was awarded for every correct answer and 0 mark for every wrong answer . All scores were added and the mean score calculated . In each domain of menqol, respondents who scored equal and below the mean value were categorized as having good qol while those that scored above the mean value were categorized as having poor qol . The study population comprised all the peri - menopausal women (4060 years) of that area . Women with induced menopause, simple hysterectomy, receiving any kind of hormone therapy, presence of medical conditions such as diabetes, hypertension, cardiac disease, and thyroid disorderslocked houses or the women who did not give the consent were not included in the study . Women with induced menopause, simple hysterectomy, receiving any kind of hormone therapy, presence of medical conditions such as diabetes, hypertension, cardiac disease, and thyroid disorders locked houses or the women who did not give the consent using the formula, n = 4pq / l where, p = proportion in the population processing the characteristic of interest q = (p 1) and l = acceptable error taking 36.7% prevalence of vasomotor symptoms (flushing and night sweat) with acceptable error of 10% at 95% confidence interval (ci) the sample size, n = 4 0.367 0.633/0.1 0.1 = 92.92 considering 10% nonrespondents sample size came 102 . Dearah village was randomly selected from all four villages under nuhc, dearah, the rural field practice area of aiihph . The participants were assured that any information, obtained will be treated with utmost confidentiality . The women of age 4060 years were interviewed in the presence of female health workers until the required sample size was achieved . The participants were interviewed after obtaining informed consent from each participant using a predesigned, pretested questionnaire adopted from menqol and later modified by the researcher . For using it in bengali vernacular, at first, one forward and one backward translations were done parallel by one medical and one language expert so that the meaning, content, and grammatical correctness of the items remained unaltered . The internal consistency of the scale was assessed with cronbach's alpha, which was 0.782 for the scale . Part 1: sociodemographic characteristicspart 2: about qol due to menopausal symptoms based on four domains (vasomotor, psychosocial, physical, and sexual) using the 29-item menqol questionnaire . The responses to the questions were adapted to a 2 point scale consisting of yes and no options from a 6 point severity scoring pattern in the original version considering the difficulty to answer on a 6 point scale due to low level of education of the respondents . Part 1: sociodemographic characteristics part 2: about qol due to menopausal symptoms based on four domains (vasomotor, psychosocial, physical, and sexual) using the 29-item menqol questionnaire . The responses to the questions were adapted to a 2 point scale consisting of yes and no options from a 6 point severity scoring pattern in the original version considering the difficulty to answer on a 6 point scale due to low level of education of the respondents . The menqol was introduced in 1996 as a tool to assess health - related qol in the menopausal period . An inherent assumption of the menqol is that disease states and conditions such as menopause, which produce symptoms, may disrupt emotional, physical, and social aspects of an individual's life, which must be considered concomitantly with treatment decisions . The menqol improves on several instruments used to assess the impact of menopausal symptoms on qol, including the kupperman index and the general well - being scale . Each item assesses the impact of one of four domains of menopausal symptoms, as experienced over the last month: vasomotor (items 13), psychosocial (items 410), physical (items 1126), and sexual (items 2729). Items pertaining to a specific symptom are rated as present or not present, and if present, how bothersome on a zero (not bothersome) to six (extremely bothersome) point scale . Means are computed for each subscale by dividing the sum of the domain's items by the number of items within that domain . One mark was awarded for every correct answer and 0 mark for every wrong answer . All scores were added and the mean score calculated . In each domain of menqol, respondents who scored equal and below the mean value were categorized as having good qol while those that scored above the mean value were categorized as having poor qol . In the present study, 39% of the women to the age group of 4650 years which was the maximum [table 1]. The mean age was 49.55 4.69 years with a minimum age of 40 years and maximum age of 60 years . Eighty - four percent of the study population were hindu, and the majority of them were illiterate (67%). Ninety - four percent were housewives and were currently married, and 62% of them belonged to joint families . Forty - six percent of them had an abortion, 33% had> three children and 80% had attained menopause while 20% were in menopause transition . Distribution of the participants according to socio - demographic characteristics (n=100) the occurrence of vasomotor symptoms in the study population was average with 60% of them reporting hot flushes, 47% reporting sweating, and 41% complaining of night sweats . Most prevalent psychosocial symptoms reported were feeling of anxiety and nervousness (94%) and feeling depressed (88%). Among other psychological symptoms such as accomplishing less than i used to do was 79%, experiencing poor memory was 57%, dissatisfaction with personal life was 55% [table 2]. Assessment of quality of life by menopause specific quality of life questionnaire (n=100) physical symptoms were quite varying in occurrence with some symptoms such as feeling tired or worn out, decrease in physical strength and lack of energy each of these occurring in 93% followed by decrease in stamina 88%, aching in muscles or joints and difficulty in sleep each 84%, flatulence or gas pains 81% to very low as 5% occurrence of facial hair . Other physical symptoms were prevalent in varying such as aches in back of the neck or head 76%, low backache 69%, frequent urination 63%, drying skin and changes in appearance, texture, tone of skin each was 40% in prevalence . Among sexual changes reported by participants were 49% reporting of avoiding intimacy, 40% changes in sexual desire and 26% of them complaining of vaginal dryness . There is a significant difference of variance between two age divisions with regards to vasomotor, psychological and physical domain as shown in anova analysis . . Marital status does not seem to have any difference in the four domains of menopausal symptoms . There is a significant difference of variance in history of abortion with vasomotor symptoms and menopause with regard to vasomotor, psychological, and physical domain [table 3]. Anova of different sociodemographic variables according to the menopause specific quality of life questionnaire domains (n=100) multivariate logistic regression analyses indicate that vasomotor symptoms was significantly associated with age - adjusted odds ratio (95% ci = 10.33 (3.5430.17), type of family 0.06 (0.020.19), and menopause 7.03 (2.1523.05). Physical symptoms were associated with caste 0.20 (0.080.53), education 0.38 (0.160.91), and marital status 4.74 (1.2717.65). Sexual symptoms were associated with the number of children 2.97 (1.257.04) [table 4]. In the current study, mean age of menopause was found 45.93 (8.37) years and median age was 43 years which similar to some previous studies done elsewhere by sagdeo and arora in nagpur, poomala and arounassalame in puducherry, sarkar et al . In jamnagar, but lower than that found by nisar and sohoo in sindh pakistan where mean age was 52.17 6.019 years . Sagdeo and arora in a comparative study in rural and urban women showed that most common problem was joint and muscular symptoms (60.4%) followed by hot flushes and night sweats (36.7%). In the current study, most prevalent symptoms reported were feeling of anxiety and nervousness (94%) and feeling tired, decrease stamina (93%). The occurrence of vasomotor symptoms was average with 60% of them reporting hot flushes and 47% reporting sweating . Madhukumar et al . In rural bengaluru and nayak et al . In coastal areas of karnataka, india showed that physical and psychosocial symptoms were reported more (56.92% of the menopausal women felt firmly that they were affected by menopause in negative manner) than vasomotor and sexual symptoms which is similar with this current study . Poomala and arounassalame in puducherry and sarkar et al . In jamnagar showed that low back ache (79%) and muscle - joint pain (77.2%) and least frequent symptoms were increase in facial hair (15%) and feeling of dryness during intimacy (10.8%) which is similar with the current study . In a study among rural middle - aged women of punjab found that headache (94.1%) and dizziness (81.5%) was the most commonly reported vasomotor complaint . Regarding the urogenital problems, most frequently reported was decreased libido (81.5%). In this study, the occurrence of vasomotor symptoms was average with 60% of them reporting hot flushes and 47% reporting sweating . Most prevalent psychosocial symptoms reported were feeling of anxiety and nervousness (94%) and feeling depressed (88%). In a study by nisar and sohoo showed that most prevalent symptom within study subjects was body ache 165 (81.7%). 139 (68.8%) and 134 (66.3%) reported lack of energy and decrease in physical strengths respectively . In the current study, most prevalent symptoms reported were feeling of anxiety and nervousness (94%) and feeling tired, decrease stamina (93%). The occurrence of vasomotor symptoms was average with 60% of them reporting hot flushes and 47% reporting sweating . In a study by vijayalakshmi et al . In rural women of amritsar reported that more prevalent symptoms were feeling tired (92.90%), headache (88.80%), joint and muscular discomfort (76.20%), physical and mental exhaustion (60.09%), sleeplessness (54.40%), depressive mood (37.30%), irritability (36%), dryness of vagina (36%), hot flushes and sweating (35.80%), and anxiety (34.50%). The high percentage and scores of menopause rating scale were observed in peri- and post - menopausal women . In a study in jammu by sharma and mahajan revealed that somatic, psychological, and urogenital symptoms were high in rural women than in urban women . Mohamed et al . In egypt showed that the most severe symptoms of vasomotor, psychosocial, physical and sexual domains were hot flushes (29%), experiencing poor memory (48.3%), being dissatisfied with their personal life (44.8%), low backache (41.9%), and change in sexual desire (36.8%). The current study showed that 60% reported hot flushes, feeling depressed (88%), experiencing poor memory 57%, and dissatisfaction with personal life was 55% . Physical symptoms were decrease in physical strength and lack of energy (93%), decrease in stamina 88%, aches in neck or head 76%, low backache 69%, frequent urination 63%, drying skin and changes in appearance, texture, tone of skin each was 40% in prevalence . Among sexual changes reported by participants were 49% reporting of avoiding intimacy, 40% changes in sexual desire and 26% of them complaining of vaginal dryness . The results support the popular belief that menopause causes both physical and psychiatric problems . Almost all areas or domains evaluated were impaired in menopausal women . A large number of women all over the world suffer from menopausal symptoms, and the problem cannot thus be ignored . Education, creating awareness and providing suitable intervention to improve the qol are important social and medical issues which need to be addressed.
|
Obesity is the most frequent metabolic disease worldwide and can progressively lead to a spectrum of comorbidities, including type 2 diabetes, hypertension, dyslipidaemia, cardiovascular disease, liver dysfunction, and osteoarthritis [13]. Preventing obesity - related co - morbidity relies on effective weight loss interventions; however, it is becoming evident that there is also a further need to focus on the daily living and well - being of obese patients . Obesity is still associated with high early mortality, but advances in the treatment of cardiovascular risk factors and acute coronary syndromes are now offering better cardioprotection options and prolong life expectancy . Current data support the notion that in developed societies an increasing number of obese patients are expected to live more than previously estimated, despite failing to reduce their body weight [4, 5]. Furthermore, demographic and epidemiological projections predict growing and progressively ageing obese populations in the western world [68]. These populations are expected to exhibit an escalating burden of obesity - related disease, particularly regarding complications which were previously underestimated or underexpressed due to earlier mortality, such as mobility problems and disability . Longstanding and/or progressive obesity can eventually impair the physical ability of the patient to function in everyday life . Obesity - associated disability has been shown to correlate with body mass index (bmi) and the presence of comorbidities [4, 1013]. Difficulty to perform simple everyday tasks (e.g., walking, climbing steps, driving, and dressing) may complicate the daily life of obese patients to the extent of inability to engage in usual social activities and employment . The consequent impact on quality of life is devastating and may lead to a vicious cycle where obesity progressively causes physical inactivity, functional limitations, and mental distress (e.g., anxiety, depression) and vice versa [14, 15]. Furthermore, the economic burden posed by obesity - related disability on healthcare systems is alarming with reports suggesting that relative medical spending for the obese may be up to 100% higher than for normal - weight adults [1618]. Evidence from the world health report shows that overweight and obesity is responsible for 815% of disability - adjusted life years lost in europe and north america . Notably, data from the national longitudinal survey of youth in the usa indicate that being obese raises the probability of receiving disability income by 6.92 percentage points for men and by 5.64 percentage points for women, which is the equivalent to the effect of losing 15.9 and 16.7 years of education, respectively [16, 20]. Investigating the relationship between obesity and disability, identifying individuals at greater risk and improving their functional capacity we present an observational study aimed to explore associations between increasing bmi and self - reported disability in adults with severe obesity . The study cohort was recruited from adults with bmi 35 kg / m followed at specialist outpatient obesity clinics at the warwickshire institute of diabetes, endocrinology and metabolism (wisdem, university hospitals of coventry and warwickshire nhs trust) and at the birmingham heartlands hospital (heart of england nhs foundation trust). Exclusion criteria included obesity secondary to endocrine or systemic disease (e.g., cushing's syndrome) and disability attributed to systemic disease other than obesity (e.g., rheumatoid arthritis, neurological disorders) or to previous injuries / accidents . Patients with disability due to further secondary complications of cardiometabolic disease (e.g., diabetic foot ulcers, symptomatic diabetic neuropathy, charcot's arthropathy, symptomatic ischemic heart disease, and heart failure) were also excluded . The study was approved by the local ethics committee, and all participants provided informed consent . A total of 262 patients (183 females/79 males; mean age: 44.9 10.5 years) completed the study questionnaire, and all data were collected according to protocol, including demographic and comorbidity data obtained from reviewing the patients' medical charts . Body weight and height weight was measured to the nearest 0.5 kg using a digital platform scale suitable for morbidly obese patients with a capacity of 300 kg (seca 675, seca, hamburg, germany). Bmi was calculated as body weight in kilograms divided by the square of the height in meters . For the purposes of this study participants were categorized into three bmi groups: group i: 3539.99 kg / m; group ii: 4044.99 kg / m; group iii: 45.0 kg / m . The stanford health assessment questionnaire (haq) was used as a validated self - report measure of functional ability in daily life [21, 22]. The haq has been widely applied in research, and, although initially developed for use in rheumatology, it is considered a generic instrument rather than disease specific [2224]. Briefly, disability is assessed by the haq disability index through 20 questions regarding the degree of difficulty in performing two or three specific activities in eight distinct categories . These categories are (1) dressing and grooming; (2) arising; (3) eating; (4) walking; (5) hygiene; (6) reach; (7) grip; (8) common daily activities . Four possible grades of difficulty are provided for answering each question, which are rated as without any difficulty, with some difficulty, with much difficulty, and unable to do and are assigned a score of 0, 1, 2, and 3, respectively . In addition, each category has a companion variable for aids / devices that documents if any type(s) of assistance is required for the respective daily activities . For these variables the patient is also asked to report whether he / she (1) needs no assistance; (2) uses a special device in his / her daily activities; (3) usually needs help from another person; or (4) usually needs both a special device and help from another person . A complete copy of the instrument and instructions on its use can be downloaded from http://aramis.stanford.edu . Provided that the participant has given answers for at least six categories, the average score of the completed categories determines the final haq score (standard haq disability index score) which ranges from 0 to 3 (0: no functional disability; 3: worst functional disability). Because healthy individuals consistently score zero on the haq, for the purposes of this study participants were also divided based on their final haq score to patients with no disability (haq score: 0) and patients with at least some degree of disability (haq score> 0). Independently of the haq, participants were also asked about having difficulty: (1) in standing unaided for 2 to 3 minutes and (2) in walking more than 100 metres (if necessary with aids). Four possible grades of difficulty were provided for each of these two questions: without any difficulty, with some difficulty, with much difficulty, and unable to do, assigned a score of 0, 1, 2, and 3, respectively . For the purposes of this aspect of the study participants were dichotomised based on their responses regarding difficulty in standing and in walking more than 100 metres to either having no difficulty (score = 0) or having at least some difficulty (score> 0). The statistical package for the social sciences, spss, version 17.0 (spss inc, chicago, il, usa) was used to analyze data . Results are expressed as percentage, mean standard deviation or median (range). The kolmogorov - smirnov and the shapiro - wilk tests were used to determine whether each study variable had a normal distribution . Based on these tests, bmi and haq score distributions in this study were nonparametric . Thus, comparisons between study groups were performed with the mann - whitney u - test or the kruskal - wallis test, and correlations were tested by the spearman's rank correlation coefficient . Prevalence rates of disability between patient groups were compared and tested for statistical significance by chi - square test . A total of 262 obese patients consented to participate in the study out of 434 patients that were invited to participate, representing a 60% response rate (183 female (f) and 79 male (m) patients; with approximately 61.5% and 58% response rate in women and men, resp . ). Mean age of the study participants was 44.9 10.5 years (women: 44.2 10.5 years; men: 46.7 10.4 years), with a mean bmi of 46.84 8.5 kg / m (women: 46.4 8.1 kg / m; men: 47.8 9.2 kg / m). Approximately 35% of the participants had type 2 diabetes (t2 dm), 37% metabolic syndrome (metabolic syndrome as defined by the international diabetes federation definition, idf,), and 29% a diagnosis of clinical depression . Patient characteristics and distribution of participants by bmi group, gender and presence of comorbidities are presented in table 1 . A non - parametric distribution was noted for bmi and haq score in the study cohort . Haq scores by bmi group, gender, and comorbidities are presented in table 2 . The median value of the haq score for the entire study cohort was 0.375 (range: 02.65) and an increase in the haq score was noted with increasing bmi . The kruskal - wallis test revealed statistically significant difference in the haq score between the three bmi groups (p <0.001). The mann - whitney test was used to compare haq scores between the different pairs of bmi groups showing that (1) group ii had a significantly higher haq score compared to group i (p = 0.004); (2) group iii had a significantly higher haq score compared to group i (p <0.001); (3) group iii had a significantly higher haq score compared to group ii (p <0.001) (figure 1). Spearman's correlation showed that there was a significant correlation between haq score and bmi (r = 0.420, p <0.001), as well as between haq score and age (r = 0.208, p = 0.001). After controlling for age, the correlation between haq score and bmi remained significant (p <0.001). Healthy individuals consistently score zero on the haq, thus, an analysis was performed by dichotomizing the study cohort based on the haq score to patients with no disability (haq score: 0) and patients with at least some degree of disability (haq score> 0). Of all study participants, 72.5% had haq scores higher than zero, reporting at least a mild degree of difficulty in activities of daily living . The prevalence rates of this degree of disability (haq score> 0) between the different patient groups were compared and tested for statistical significance by chi - square test . Based on pearson chi - square test, the prevalence rate of disability (haq score> 0) was related to bmi and to the presence of t2 dm, metabolic syndrome, and depression, while it was not related to gender . Indeed, the prevalence rate of disability (haq score> 0) was significantly higher: (1) among participants with a higher bmi (51.7% for group i versus 66.2% for group ii versus 85.5% for group iii, p <0.001, table 3); (2) among participants with t2 dm (81.5% versus 67.6% in nondiabetic participants, p = 0.016); (3) among participants with metabolic syndrome (79.6% versus 68.3% in participants without metabolic syndrome, p = 0.047); (4) among participants with clinical depression (85.75% versus 67% in nondepressed participants, p = 0.002). Table 3 also presents the distribution of participants across the three bmi study groups when the haq score is categorized into 4 grades: (1) haq: 0 (no disability); (2) haq: 0.10.99 (mild to moderate difficulty); (3) haq: 11.99 (moderate to severe disability); (4) haq: 2 - 3 (severe to very severe disability). Logistic regression modelling in this study cohort showed that bmi was associated with an odds ratio (or) of 1.128 (95% ci: 1.0751.184; p <0.001) for disability (haq score> 0) adjusted for age and with an or of 1.127 (95% ci: 1.0731.185; p <0.001) adjusted for both age and depression . T2 dm and metabolic syndrome when entered as covariates into the logistic regression model did not have a statistically significant effect to the model . These obesity - related comorbidities were considered intermediaries in and not confounders to the association between increased bmi and disability, since based on the exclusion criteria of this study, patients with disability attributed to further secondary complications of cardio - metabolic disease (e.g., diabetic foot ulcers, symptomatic diabetic neuropathy, charcot's arthropathy, symptomatic ischemic heart disease, and heart failure) were excluded . Finally, the prevalence rates of having at least some difficulty in standing (score> 0) and in walking more than 100 meters (score> 0) between the different patient groups were also compared and tested for statistical significance . Based on pearson chi - square test, the prevalence rate of difficulty in standing (score> 0) was related to bmi and to the presence of t2 dm, while it was not related to gender, metabolic syndrome, and depression . Thus, the prevalence rate of having at least some difficulty in standing was significantly higher: (1) among participants with a higher bmi (8.3% for group i, 27.1% for group ii, 24.8% for group iii, p = 0.016); (2) among participants with t2 dm (30.8% versus 16.7% in non - diabetic participants, p = 0.008). Furthermore, the prevalence rate of difficulty in walking more than 100 meters (score> 0) was related to bmi and to the presence of depression, while it was not related to gender, t2 dm, and metabolic syndrome . Indeed, the prevalence rate of having at least some difficulty in walking more than 100 meters was significantly higher: (1) among participants with a higher bmi (18.6% for group i, 44.1% for group ii, 53.2% for group iii, p <0.001); (2) among participants with depression (58.6% versus 36.5% in nondepressed participants, p = 0.001). The primary objective of this study was to explore associations between obesity and self - reported disability in adults with bmi 35 kg / m . The data from our cohort of patients with severe obesity showed that self - reported disability, as expressed by the haq score, correlated with bmi, age, and the presence of t2 dm, metabolic syndrome, and clinical depression . This finding agrees with data from the literature that have documented the burden of disability in general and obese populations, as well as in various other patient groups [2639]. The mean haq score for our study population was 0.607 (95% ci: 0.5280.686) with a median value of 0.375 (range: 02.65). Krishnan et al . Have reported normative values for the haq disability index in the general population in finland, documenting a population mean haq score of 0.25 (95% ci: 0.220.28), with 32% of respondents having at least some disability (haq score> 0). Given that healthy individuals consistently score zero on the haq and that the haq score distribution is not gaussian, we also applied zero as a cut point for the haq score in order to dichotomize our study cohort into patients without disability and patients with at least some difficulty in activities of daily living . In this analysis, 72.5% of our study participants had haq scores higher than zero . This is in accord with the analysis of the data from finland showing that within the studied general population, which included approximately 20% obese participants (bmi> 30 kg / m), individuals with bmi 30 kg / m had a significantly lower prevalence rate of disability compared with obese individuals (haq score> 0: 28.4% versus 51.7% for nonobese and obese individuals, resp . ). Of note, in our study the prevalence rate of disability (haq score> 0) was 51.7% in group i, 66.2% in group ii, and 85.5% in group iii, further documenting a gradient of increasing self - reported disability as bmi increases over 35 kg / m . Indeed, comparing the haq score for the three study bmi groups, we found that group iii had significantly higher haq score compared with the other two groups, while group ii had also significantly higher haq score compared with group i. the recognition of this gradient may be useful in clinical practice for identifying obese individuals with greater difficulty in performing everyday tasks and could also allow further stratification of patients in order to intensify interventions and prioritize the use of available healthcare resources . It must be noted that different cut points can be used to define or categorize disability based on the haq disability index score [40, 41]. Haq scores up to 1 are generally considered to reflect mild to moderate difficulty in daily life activities, while scores between 1 and 2 represent moderate to severe disability, and scores of 2 to 3 indicate severe to very severe disability . A study by walter et al ., exploring the effects of obesity on mortality and disability in the older population in the netherlands, has used a cut point of 0.5 to define a participant as at least mildly disabled, as previously applied for participants in the rotterdam study cohort . The results of this study in older adults (age 55 years and older) also documented that bmi was related to self - reported disability, with more years lost to disability with increasing body weight, supporting our study findings . Of note, applying zero as a cut point for the haq score in the context of obesity provides a distinct measure to dichotomize patients for the presence of disability, which is not affected by the dispersion of the haq score within different bmi categories and hence may be suggested as a less controversial method than using any other cut - off value . Furthermore, this cut point can also be regarded as a treatment goal for weight loss interventions . Thus, a notion of recovery from obesity - related disability could be advocated similarly to remission / resolution of t2 dm with weight loss . Interestingly, studies in patients with rheumatoid arthritis have documented that haq disability index scores needed to improve by approximately 0.22 units before participants stopped rating themselves as about the same (minimally clinically important difference). In patients with severe obesity, further research is required to evaluate at what extent weight loss is associated with clinically meaningful differences in physical functioning / disability scores and whether certain weight loss interventions (e.g., diet, exercise, cognitive behavioral therapy, pharmacotherapy, bariatric surgery, and their combinations) might differ regarding such functional / health status outcomes . In addition to bmi, the haq score in our study also correlated with age, which is consistent with available data from the general population [26, 39]. However, in this study cohort no relation was noted between the haq score and gender, contrary to published evidence indicating that activities of daily living may be more affected in women, especially in older populations [27, 4345]. This could be partly attributed to a referral bias of obese patients with higher disability independently of gender . Krishnan et al . Also reported that disability among women increased at a faster rate compared to that among men and that women had a higher estimated mean haq score (0.28 versus 0.18 in men). Yet, also in this study, which included 1530 adults, this gender difference was no longer statistically significant after adjustment for age . Finally, in our cohort of severely obese patients the haq score was related to the presence of t2 dm, metabolic syndrome, and clinical depression . Central obesity is a prerequisite for the idf metabolic syndrome definition, and t2 dm is pathogenetically linked to obesity . In addition, for the purposes of this study patients with disability due to secondary complications of t2 dm and/or metabolic syndrome (e.g., diabetic foot ulcers, symptomatic diabetic neuropathy, charcot's arthropathy, symptomatic ischemic heart disease, and heart failure) were excluded . Hence, these comorbidities were regarded as intermediaries in and not confounders to the association between increased bmi and disability and when entered as covariates into the logistic regression models of this study did not have a statistically significant effect . Contrary, the published data regarding the association between obesity and depression is less strong and mixed [4751]. Therefore, depression was entered as a covariate in the applied logistic regression model which showed that, adjusted for both age and depression, bmi was associated with an or of 1.127 (95% ci: 1.0731.185; p <a limitation of this study is that the functional ability of participants was self - reported . However, the haq is a well - validated instrument, which is considered to accurately document the existing degree of disability and is widely applied in research . Furthermore, the haq can be regarded as a generic measure to quantify functional impairment, rather than disease specific for obesity . A similar validated and established obesity - specific instrument for self - reporting difficulty in daily life activities is currently lacking . On the other hand, a relative advantage of applying a generic measure is that it allows a degree of comparability between obtained results and available data from the general population and from patient groups with other diseases associated with disability . In this study, a random sample of the outpatient population followed at our specialist obesity clinics was obtained, and the overall response rate was considered adequate . However, the nonresponse behaviour of severely obese patients attending an obesity clinic may not be random but, rather, informative . In this case, the group of nonresponders may have had either lower or higher haq scores compared with respondents, resulting in an overall disability rate for the study cohort, which would be either an over- or underestimation, respectively . Overestimation of the disability prevalence among patients followed at an obesity clinic may also result from a referral bias due to higher referring rates of patients with more complications from primary to secondary care . Conversely, under - estimation could result from a different referral bias due to earlier / prompt referrals of obese patients to secondary care in order to prevent obesity - related complications . Such limitations are relatively common in this type of research; however, among the strengths of our study is the accurate assessment of bmi for all participants, since these study data were not self - reported, but were obtained through standardized clinical measurements of body weight and height at the included clinics . Finally, a cause and effect relationship between obesity and disability cannot be determined from this cross - sectional study, and large, prospective studies are required to establish such a relationship . Our study focuses on associations between severe obesity and functional limitations in activities of daily living . This aspect of the disease has not received adequate attention, despite robust evidence showing a growing burden of obesity - related disability . Almost three quarters of our study population reported at least some difficulty in performing daily life activities, and higher disability was documented with increasing bmi, age, and presence of t2 dm, metabolic syndrome, and clinical depression . Such data can compliment current systems of obesity classification which are mainly based on anthropometric measures and do not offer direct information on comorbid disease . Indeed, clinical and functional staging systems for obesity are required to describe the morbidity and functional limitations associated with increased bmi in order to improve decision making in the clinical practice . For this purpose, disability assessment should be an integral part of obesity management, including patients that have failed to achieve significant weight loss . Thus, healthcare providers would be able to provide recommendations based on the functional status of patients in order to increase regular physical activity according to their abilities and avoid complete inactivity . For instance, exercises that mainly promote flexibility and functionality could be recommended to severely obese individuals in order to improve their ability to perform common daily life activities and accommodate their work - specific functional needs (e.g., focus on improving coordination, balance, motion rage, cardiovascular, and muscle fitness). Furthermore, data on obesity - related disability could support practical strategies to create an obese friendly workplace (e.g., appropriate chairs and personal protective equipment) and built environment (e.g., easy access and use not only of medical facilities but also of services such as public transportation systems, community centres, parks, and green spaces) in order to encourage physical activity, work, and social engagement . Finally, potentially contributing factors such as depression, anxiety, low self - esteem, and social exclusion should be also identified and addressed in the context of a holistic approach to combat obesity - related disability and advance the care of obese patients.
|
Adult - onset still's disease (aosd) is a rare inflammatory disease of unknown etiology, which commonly affects young adults . It is usually characterized by high spiking fevers, arthritis, and an evanescent, nonpruritic, macular and salmon coloured rash, appearing on the trunk and the extremities . Important laboratory findings include leukocytosis, with predominance of neutrophils, negative testing for rheumatoid factor (rf), and antinuclear antibodies (ana) as well as high serum ferritin levels and low serum glycosylated ferritin levels [13]. Severe disease complications include pericarditis, endocarditis, haemolytic anaemia, and macrophage activation syndrome (mas). The latter is characterized by thrombocytopenia, markedly elevated ferritin levels, hypofibrinogenemia, and elevated aspartate amino - transferase (ast). Aosd diagnosis can be safely established, after important mimickers including infections, malignancies, and autoimmune diseases are excluded . Treatment of patients with aosd includes nonsteroidal anti - inflammatory drugs (nsaids), corticosteroids, and disease - modifying antirheumatic drugs (dmards), while our better understanding of disease pathophysiology allowed the identification of biological agents as important targeted therapies [1, 4]. Recent studies have added valuable information in regard to the underlying pathogenetic mechanisms of aosd . Besides, the exact pathogenesis remains largely elusive, with genetic, environmental, and immunologic contributors being implicated . In the present paper, we aimed to summarize recent advances in pathophysiology and potential therapeutic strategies in the setting of aosd . We also used rheumatology textbooks with chapters relevant to aosd and abstract database from acr and eular meetings at 2010 and 2011 . Aosd or still's disease pathophysiology, aosd or still's disease therapy, still's disease or aosd treatment, still's disease or aosd and inflammasome . Several small case studies have previously reported associations with distinct hla alleles in patients with aosd, with often conflicting results . In an early small study of 25 aosd patients, wouters et al . Reported an increased frequency of the hla - dr4 allele in 29 patients with aosd compared to normal controls, with the presence of hla - drw6 being linked to root joint involvement . In a subsequent study, a strong disease association with hla - b17, b18, b35, and dr2 has been documented . In japanese populations, an association between a chronic articular form of aosd and hla - drb1 * 1501 (dr2), drb1 * 1201 (dr5), and dqb1 * 0602 (dq1) was previously reported, while hla- and dqb1 * 0602 (dq1) have been also associated with the systemic form of the disease . Data from a korean report, supported an association between hla - drb1 * 12 and drb1 * 15 and aosd, while hla - drb1 * 04 seemed to be protective . On the other hand, hla - drb1 * 14 alleles were more commonly present in patients with the monocyclic systemic type of aosd . The shared clinical and laboratory findings observed in aosd and infections are highly suggestive of a putative role of infectious agents in disease pathogenesis . Several anecdotal reports so far indicate a temporal relationship between bacterial and viral triggers prior to disease onset . Several viruses such as rubella, echovirus 7, mumps, cytomegalovirus (cmv), and others, as well as bacterial pathogens including yersinia enterocolitica, chlamydophila pneumoniae, brucella abortus, and borrelia burgdorferi, have been so far implicated in disease pathogenesis [1013]. A hallmark of aosd is neutrophil and macrophage activation possibly under the effects of the proinflammatory interleukin-18 (il-18) signalling . Neutrophil (pmn) cd64 a marker of neutrophil activation has been recently found to be upregulated in patients with active aosd . A calcium - binding protein named calprotectin, secreted by activated neutrophils and macrophages, as well as macrophage migration inhibitory factor (mif), is useful markers of disease activity and severity [15, 16]. Intercellular adhesion molecule-1 (icam-1) upregulated by il-18- has been also proposed as a potential clinical marker, as its expression typically reflects the level of disease activity . Furthermore, activation and differentiation of macrophages appears to be orchestrated by macrophage - colony stimulating factor (m - csf), a cytokine which is substantially elevated in acutely ill aosd patients . The role of cd4 t helper (th) cells in the pathogenesis of aosd has been recently appreciated, with th1 subset predominating over that of th2 cd4 cells and being associated with disease activity . Accordingly, interferon - gamma (ifn-) mrna expression was found to be significantly higher than that of interleukin-4 (il-4) in skin and synovial tissue biopsies . The role of th17 lineage in aosd pathogenesis is also emerging, as evidenced by increased number of peripheral th17 cells in 24 patients with untreated and active aosd compared to healthy controls . Th17 cells are a subset of t helper cells, named after their ability to produce interleukin-17 (il-17). This subset of cells is derived from the differentiation of naive cd4 t cells, under the influence of transforming growth factor (tgf), interleukin-1 (il-1), and interleukin-6 (il-6) [20, 21]. Interestingly, heightened levels of t - cell receptor -positive (tcr+) t cells, mostly of the v9/v2 subset have been previously associated with active disease and correlated with inflammatory markers . Since, it has been recently appreciated that t/ cells are also represent an important source of il-17 production, the role of these cells in the pathogenesis of aosd requires further attention . Interleukin-18 (il-18), interleukin-23 (il-23), and inteleukin-21 (il-21)found to be elevated in active aosd patients seem also to ensure the proliferation / maintenance of th17 cells . Circulating th17 cells correlated with disease activity and ferritin as well as il-1, il-6, il-17, il-18, il-21, and il-23 levels . Of interest, additional t cell populations actively involved in aosd pathogenesis include the cd4 cd25 (high) t regulatory (treg) cells found to be low in these patients compared to healthy controls and inversely associated with disease activity . Furthermore, higher levels of cd4 cd25 (high) treg cells have been associated with a more favourable prognosis, as patients with monocyclic disease, a mild form of aosd, typically have higher concentrations of circulating cd4 cd25 (high) treg cells than those with polycyclic or chronic articular form . It should be, however, pointed out that according to recent findings, cytokine profile has not been proven useful in differentiating patients with aosd from those with sepsis, limiting their potential use in clinical practice . Increased tnf- levels were detected in sera and tissues from aosd patients compared to healthy controls independently of disease activity . On the other hand, serum levels of soluble tumor necrosis factor - receptor-2 (stnf - r2) correlated with serum crp levels, implying its potential use as a disease activity marker [8, 26, 30]. Il-1 appears to be implicated in aosd pathogenesis as its serum concentration is elevated in these patients compared to healthy controls . Further evidence for the contribution of il-1 in aosd pathophysiology came from the pioneering work by pascual et al . Reporting that incubated peripheral blood mononuclear cells (pbmcs) with serum from patients with systemic form of juvenile idiopathic arthritis (sjia), led to increased expression of innate immunity genes and release of large amounts of il-1 . However, plymorphisms in the il-1 and il-1 receptor (il-1r) genes have not been associated with aosd susceptibility, at least in a korean population . Recent findings suggest activation of the protein complex nucleotide - binding oligomerization - domain-(nod-) like receptor family, pyrin domain containing 3 (nlrp3) inflammasome, as an important source of il-1; this activation can occur by recognition of pathogen - associated molecular patterns (pamps) and danger - associated molecular patterns (damps). Although it seems to contribute at least in one subset of sjia the pediatric counterpart of aosd with a favorable response to il-1 blockade, further studies are required to fully explore its exact role in the pathogenesis of aosd [3840]. Taken together, these observations may suggest that susceptibility to sjia and aosd might be conferred by an interplay with exogenous pathogens - triggers of inflammasome with genetically determined inflammasome responsiveness resulting in dysregulation of il-1 production . Heightened sil-2r levels, a marker of t - cell activation, were also reported in two distinct studies of aosd patients, serving as a potential marker of disease activity [8, 29]. Il-6 levels have been found to be elevated in aosd patients compared to their healthy counterparts in association with disease activity, fever spikes, and crp levels . Of interest, skin lesional biopsies from individuals presenting with the characteristic salmon coloured rash revealed heightened il-6 levels [2931]. In addition, il-6 may contribute to the increased levels of ferritin as it stimulates its production along with crp and other acute - phase proteins by the liver . Finally, prolonged exposure to high levels of il-6 may be associated with severe growth impairment, especially in patients with sjia . Il-8, a proinflammatory cytokine, which mobilizes, activates, and degranulates neutrophils at the site of inflammation has been also found to be raised in aosd patients compared to healthy controls, independently of activity status . Given that elevated levels of serum il-8 typically characterize the chronic articular form of aosd, they can be used as a marker to predict the persistence of arthritic complaints . As previously mentioned and in line with previous observations in other autoimmune diseases, serum il-17- proinflammatory cytokine derived by th17 cells was higher in patients with aosd and correlated with th17-circulating cells . The fact that th17 cells and il-17 levels were both abated upon therapy administration implies a potential therapeutic role of th17 targeted therapies in the management of those diseases . Il-18- member of the il-1 family, which induces th1 cytokine production-, has been shown to be higher in the serum synovial tissue and lymph nodes in patients with aosd than in healthy individuals, serving as a marker of disease severity, possible response to corticosteroids and of aosd - related hepatitis [29, 32, 33, 45]. The latter is evidenced by the demonstrated association of il-18 serum levels with active liver disease . Locally rather than systematically produced il-18 by liver activated macrophages (cd68) seems to contribute to this complication [30, 34]. Associations of il-18 with serum ferritin, c - reactive protein (crp), and neutrophil count have been also demonstrated [8, 34, 35]. Several polymorphisms of the il-18 gene have been associated with aosd in japanese and chinese populations [4648]. Another function attributed to il-18 is that of lymphocyte apoptosis possibly through induction of fas ligand (fasl) and p53 pathways, both implicated in the programmed cell death . This hypothesis is also supported by raised fas and fasl levels in untreated aosd patients compared to healthy controls . Finally, in a more recent report, il-18 levels were found to be significantly elevated in patients of aosd complicated by mas compared to m - csf levels; an opposite observation was made in patients with lupus - associated mas . Although ifn- levels were also found to be raised in aosd patients compared to healthy individuals, no study so far demonstrated association of this cytokine with disease activity [26, 29]. The contributory role of chemokines in the pathophysiology of aosd was supported by a recent study reporting elevated levels of cx3cl1, cxcl8, cxcl10, ccl2, and ccl3 in serum of aosd patients compared to healthy controls . Of interest, only cx3cl could be used as a marker of disease activity as it was correlated well with serum crp, ferritin, il-18, and sil-2r levels . Furthermore, markedly elevated concentration of cx3cl1 and ferritin was able to predict the onset of mas, indicating its value in predicting aosd - related complications . Treatment of patients with aosd has been empirical for a long time, given the lack of solid data from well - designed double - blinded randomized clinical trials with the majority of evidence deriving from small case series and retrospective studies . Recent advances in better understanding of disease pathophysiology allowed the designation of targeted therapies leading to effective disease control . Conventional immunosuppressants and new biologics are the main agents included in our therapeutic armamentarium against aosd . While nonsteroidal anti - inflammatory drugs (nsaids) have been previously considered as a first - line medication for the treatment of aosd, they have been replaced by corticosteroids, as they are effective as monotherapy only in 715% of patients [66, 68]. The steroid therapy is efficacious in approximately two thirds of patients and more pronounced among those without chronic articular disease . Disease - modifying antirheumatic drugs (dmards) such as methotrexate (mtx), cyclosporine, hydroxychloroquine, gold, penicillamine, and azathioprine, [7072] have been proven efficacious in steroid - resistant or -dependent aosd cases, with methotrexate being the most commonly used dmard in clinical practice with response rates up to 60% . In regard to sulfasalazine, reduced efficacy along with some previously raised safety issues given the reported associations with mas development discourages its use in aosd cases [7375]. In patients refractory to treatment with steroids and/or dmards, biological agents seem to achieve a better control of disease activity . Despite the lack of solid evidence of tnf implication in the pathogenesis of aosd as opposed to rheumatoid arthritis, anti - tnf agents have been used in aosd refractory cases with modest success, particularly in the chronic articular form of the disease lagging in efficacy behind il-1 and il-6 inhibitors . In a small case series of twelve aosd cases refractory to dmards, administration of etanercept, a soluble tnf receptor, led to arthritis improvement in 7 patients with nonsignificant adverse events . Infliximab, a monoclonal antibody against tnf, as a treatment of eight multidrug - resistant aosd cases led to full response in 87.5% (7/8) of patients . Five of these patients remained in remission even after the discontinuation of infliximab and one of them switched to etanercept due to infusion reactions . Only one of the responders required chronic therapy to control its arthritis and only one patient did not respond to these biological agents . In two additional cases series, infliximab was administrated along with corticosteroids and dmards in a small number of patients with remission of systemic features, normalization of inflammatory markers, and without serious adverse reactions [52, 55]. Further information regarding the safety and the efficacy of anti - tnf agents derives from a study published by fautrel et al . In which infliximab or etanercept was administrated to twenty aosd patients, five with systemic and fifteen with polyarticular form, whose response to mtx and corticosteroids was considered inadequate . The majority of patients responded partially to therapy (64%, or 16 of 25 patients) and only five in twenty patients achieved complete remission . Anti - tnf--induced cutaneous adverse effects in the setting of sjia have been reported including cutaneous vasculitis and lichen planus, as well as psoriatic palmoplantar pustulosis accompanied by plaque - type psoriasis localized to the scalp . In view of the central role of il-1 in pathogenesis of aosd as previously reported, administration of interleukin-1 receptor antagonist (anakinra) in these patients, it has been shown that patients (84%) receiving anakinra either as monotherapy or as adjunct therapy responded completely within a few days and only one of them had its disease relapsed during the subsequent followup . The remaining patients experience a partial clinical (12%) and laboratory (16%) response and only three patients discontinued the drug because of adverse effects . In general, the need for corticosteroids during treatment with anakinra greatly diminished in every patient . The corticosteroid - sparing effect of anakinra along with its effectiveness was also noted in a case series reported by kalliolias et al . In 2007 . Furthermore, fitzgerald et al . Demonstrated that anakinra is an effective agent to treat aosd patients refractory to corticosteroids, mtx and etanercept, as this drug rapidly resolves the inflammatory response and leads to normalization of laboratory markers ., in a study including both aosd and sjia patients, suggested anakinra as an effective alternative in the treatment of patients with aosd, with somewhat limited efficacy in sjia population . In contrast, in a retrospective chart review of 46 sjia patients, receiving initially anakinra either as monotherapy or together with additional disease - modifying antirheumatic drugs revealed that in 60% of these patients the clinical activity resolved completely and laboratory markers were normalized . The authors concluded that anakinra should be considered a safe and an effective way not only to treat systemic sjia but also to prevent the emergence of intractable arthritis . In addition, according to a case report published by raffeiner et al ., anakinra could be successfully used in the treatment of a patient with aosd and myocarditis . On the other hand, ruiz et al . Reported that anakinra could not prevent the progression of aosd - associated cardiac disease despite the excellent control of noncardiac symptoms of a patient, without excluding the possibility that anakinra may be implicated in cardiac events of this patient . Although anakinra seems to be an effective treatment of aosd patients regarding the rapid resolution of their clinical and laboratory markers, a recent case report published by lahiri and teng has shown that joint damage may progress despite the administration of this drug . A second generation il-1 inhibitor, the il-1 trap rilonacept, has been used in 3 patients who had failed treatment with glucocorticoids, immunosuppressors, and biologics, including anakinra with promising results . Canakinumab, a fully human monoclonal antibody against il-1 with a long half - life, successfully controlled disease flares in aosd patients refractory to dmards, anakinra (short - acting il-1 blockade), and rilonacept (moderate - acting il-1 blockade). In addition, the efficacy and safety of canakinumab in the treatment of sjia, the pediatric counterpart of aosd, has been demonstrated in a phase ii, multicenter, open - label study, with 60% of patients achieving an acr pediatric 50 response . Given the emerging role of t - cells in the pathogenesis of aosd, administration of abatacept, a t - cell costimulation modulator, in these patients seems to be a logical approach . Abatacept (ctla4igfc), a fusion protein which consists of the extracellular domain of the cytotoxic t - lymphocyte antigen 4 (ctla-4) and the fc portion of immunoglobulin g1 (igg1), inhibits t - cell activation by binding to cd80 and cd86 receptors on antigen - presenting cells (apcs) and preventing their interaction with cd28 receptor on t cells . Recent findings support a potential role of the latter in aosd cases refractory to conventional dmards, anti - tnf- agents, and even to il-1 receptor antagonists [81, 82]. Given that il-6 shares an important pathogenetic role in aosd, as mentioned above, the interleukin-6 (il-6) antagonist, tocilizumab (toc), has recently been proposed as a potential treatment for these patients . Indeed, it seems to be an effective drug even against aosd cases refractory to anakinra and tnf- antagonists in anecdotal cases, even as monotherapy [8391]. Tocilizumab was also able to control disease activity in a patient with diffuse intravascular coagulation (dic) and aosd, refractory to cyclosporine and high - dose glucocorticoids . In addition, the dose of corticosteroids was greatly reduced as toc was added on maintenance therapy . On the other hand, mas seemed to follow toc administration in a patient with intractable aosd, implying that caution should be taken in very active forms of the disease . In the first case series of tocilizumab in fourteen patients with intractable aosd at a dose 58 mg / kg every two or four weeks, eleven patients completed the 6-month followup and the remaining three discontinued the drug due to adverse effects, including necrotizing angiodermatitis, infusion - related chest pain, and systemic flare . Over the course of 6 months, the clinical activity resolved completely in 57% of patients (8/14) and corticosteroid maintenance dose was dramatically reduced, suggesting that toc may be an effective alternative treatment, when dealing with multidrug - resistant cases of aosd . Toc has also been approved for the treatment of sjia patients, as it is associated with substantial clinical and laboratory responses . Of interest, administration of this drug in sjia patients led to improvement of reduced serum cartilage oligomeric matrix protein (comp), further supporting the concept of contribution that high levels of il-6 in the suppression of growth cartilage turnover [42, 94]. Taken together, these findings support the contributory role of several immune mediators in aosd pathogenesis allowing the determination of rational treatment approaches . While current evidence identifies il-1 blockade as a major therapeutic strategy in patients with refractory aosd, inhibition of il-6, il-17, or il-18 molecules holds significant promises . Given the complex and multifaceted nature of aosd, carefully designed clinical studies aimed to associate distinct clinical phenotypes with specific pathogenetic pathways would allow the designation of tailored therapies for distinct disease aspects.
|
Micropigs are considered as the optimal transplant donor animals because their organs have a similar anatomy and physiology to human organs . Therefore, the selection of the normal healthy micropigs and the survey of vessels supplying the organs for transplantation are important . However, there are no baseline studies on the doppler flow velocity parameters and waveform pattern in the major arteries of the micropigs . Spectral waveform analysis of blood flow by doppler ultrasonography is a simple and noninvasive method to investigate blood hemodynamics . The evaluation of blood flow velocity with spectral waveform analysis by doppler ultrasonography becomes the most routine and useful technique in many vascular diseases in humans and animals [2 - 4,6 - 9,13 - 15]. The purpose of this study is to determine the baseline blood flow values of the major arteries in immature micropigs using spectral analysis of doppler ultrasound . For this, we determined the peak systolic velocity (psv), early diastolic velocity (edv), peak systolic velocity - to - end diastolic velocity (s: d) ratio, resistive index (ri), and pulsatility index (pi), and evaluated blood flow waveform patterns in the major arteries of normal conscious immature micropigs . Six healthy micropigs (4-month - old male; pwg genetics korea, korea) were used in this study . Before doppler ultrasonography, all micropigs were fasted for 24 h to reduce abdominal pressure and ultrasound artifacts from ingesta and feces in their gastrointestinal tracts . Blood pressure was recorded indirectly using vet - dop doppler (vmed technology, usa). Recordings in the left dorsal pedal artery were taken as an average of three time measurements at five - minute intervals under stable and conscious state just prior to the doppler examination . Doppler ultrasonography was performed using a 5 - 12 multifrequency linear - array transducer (sonoace 9900; medison, korea). Each micropig was placed in dorsal or right oblique lateral recumbency under conscious state without anesthesia . The probe was smoothly positioned without compression on the clipped skin over the neck and abdomen to prevent the introduction of artificial errors in vascular resistance . With initial two - dimensional gray - scale images and color doppler mapping, arteries of interest the size of the sample volume was set at 2 mm and positioned in the center of the vessel by the maximum velocity method using a small sample volume (approximately half of the diameter of the vessel). The angle of insonation was set at the lowest possible angle under 60 degrees to gain the closest estimation of velocity . Spectral doppler tracings were recorded from the representative waveform in the common carotid artery, abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery . The common carotid artery was imaged along the long axis of the mildly extended neck in dorsal recumbency, and three parts, cranial, middle, and caudal, were evaluated . The cranial part of the common carotid artery was measured caudal to the bifurcation of the internal carotid artery in the cranial deep aspect of the jugular groove . As the caudal part of the common carotid artery, the sample volume was located cranial to the thoracic inlet . The middle part of the common carotid artery was evaluated between the cranial and caudal part of the common carotid artery . The abdominal aorta was evaluated in two parts approximately 2 cm cranial and caudal to the left renal artery in the right oblique lateral recumbency . The left renal arcuate artery, external iliac artery and femoral artery were selected and traced in the dorsal recumbency with the mild right oblique rotation because the left side arteries are easier to approach than the right side for the right handed operator . Spectral doppler parameters include psv, edv, s: d ratio, ri (peak systolic frequency shift - lowest diastolic frequency shift / peak systolic frequency shift), pi (peak systolic velocity - minimum diastolic velocity / mean velocity), and doppler waveform pattern . The diameters of the major arteries except the renal arcuate artery were also determined . The spectral doppler analysis and the diameter measurements were repeated three times in the same recording sites of each artery under the same scan conditions . Statistical analysis was performed using the spss statistical computer program (version 12.0; spss, usa). One way anova (post hoc scheffe) was used to compare the velocities among the vessels . Six healthy micropigs (4-month - old male; pwg genetics korea, korea) were used in this study . Before doppler ultrasonography, all micropigs were fasted for 24 h to reduce abdominal pressure and ultrasound artifacts from ingesta and feces in their gastrointestinal tracts . Blood pressure was recorded indirectly using vet - dop doppler (vmed technology, usa). Recordings in the left dorsal pedal artery were taken as an average of three time measurements at five - minute intervals under stable and conscious state just prior to the doppler examination . Doppler ultrasonography was performed using a 5 - 12 multifrequency linear - array transducer (sonoace 9900; medison, korea). Each micropig was placed in dorsal or right oblique lateral recumbency under conscious state without anesthesia . The probe was smoothly positioned without compression on the clipped skin over the neck and abdomen to prevent the introduction of artificial errors in vascular resistance . With initial two - dimensional gray - scale images and color doppler mapping, arteries of interest the size of the sample volume was set at 2 mm and positioned in the center of the vessel by the maximum velocity method using a small sample volume (approximately half of the diameter of the vessel). The angle of insonation was set at the lowest possible angle under 60 degrees to gain the closest estimation of velocity . Spectral doppler tracings were recorded from the representative waveform in the common carotid artery, abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery . The common carotid artery was imaged along the long axis of the mildly extended neck in dorsal recumbency, and three parts, cranial, middle, and caudal, were evaluated . The cranial part of the common carotid artery was measured caudal to the bifurcation of the internal carotid artery in the cranial deep aspect of the jugular groove . As the caudal part of the common carotid artery, the sample volume was located cranial to the thoracic inlet . The middle part of the common carotid artery was evaluated between the cranial and caudal part of the common carotid artery . The abdominal aorta was evaluated in two parts approximately 2 cm cranial and caudal to the left renal artery in the right oblique lateral recumbency . The left renal arcuate artery, external iliac artery and femoral artery were selected and traced in the dorsal recumbency with the mild right oblique rotation because the left side arteries are easier to approach than the right side for the right handed operator . Spectral doppler parameters include psv, edv, s: d ratio, ri (peak systolic frequency shift - lowest diastolic frequency shift / peak systolic frequency shift), pi (peak systolic velocity - minimum diastolic velocity / mean velocity), and doppler waveform pattern . The diameters of the major arteries except the renal arcuate artery were also determined . The spectral doppler analysis and the diameter measurements were repeated three times in the same recording sites of each artery under the same scan conditions . Statistical analysis was performed using the spss statistical computer program (version 12.0; spss, usa). One way anova (post hoc scheffe) was used to compare the velocities among the vessels . Psvs of the cranial, middle, and caudal parts of the common carotid artery, cranial and caudal parts of the abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery were 97.97 14.04, 107.56 11.97, 97.87 13.58, 95.65 17.62, 107.55 19.45, 85.52 10.01, 93.84 14.35, and 53.92 7.25 cm / sec, respectively (table 1). The psv of renal arcuate artery was significantly lower than the other arteries (p <0.05). The psv of external iliac artery showed a significantly lower value than the common carotid artery or abdominal aorta (p <0.05). There were no significant differences observed among the three parts of common carotid artery and the two abdominal aorta parts . Edvs of the cranial, middle, and caudal parts of the common carotid artery, cranial and caudal parts of the abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery were 25.25 6.97, 28.28 7.43, 21.25 5.36, 20.04 5.66, 22.62 7.53, 27.79 5.72, 18.85 4.03, and 22.57 4.15 cm / sec, respectively (table 1). The lowest edv was observed in the femoral artery, which was significantly lower than the external iliac artery (p <0.05). There were no significant differences observed among the three parts of common carotid artery and the two parts of abdominal aorta . The s: d ratios of the cranial, middle, and caudal parts of the common carotid artery, cranial and caudal parts of the abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery were 4.14 1.30, 3.99 0.85, 4.92 1.56, 5.61 1.22, 4.50 1.03, 5.79 2.25, 4.77 1.39, and 2.43 0.31, respectively (table 1). The s: d ratio of renal arcuate artery was significantly lower than the other arteries (p <0.05). The ris of the cranial, middle, and caudal parts of the common carotid artery, cranial and caudal parts of the abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery were 0.74 0.06, 0.74 0.05, 0.76 0.07, 0.78 0.06, 0.80 0.05, 0.81 0.03, 0.79 0.03, and 0.58 0.05, respectively (table 1). The ri of renal arcuate artery was significantly lower than the other arteries (p <0.05). The pis of the cranial, middle, and caudal parts of the common carotid artery, cranial and caudal parts of the abdominal aorta, external iliac artery, femoral artery, and renal arcuate artery were 1.47 0.26, 1.51 0.27, 1.71 0.35, 1.95 0.28, 1.77 0.36, 2.06 0.24, 1.82 0.24, and 0.88 0.11, respectively (table 1). The pi of renal arcuate artery had the lowest result compared to the other measured arteries (p <0.05). All arteries presented a plug velocity profile and high resistance flow patterns except the renal arcuate artery, which had a parabolic velocity profile and low resistance flow pattern (fig . The size order from largest to smallest was the two parts of the aorta, caudal part of common carotid artery, external iliac artery, cranial and middle parts of common carotid artery, and femoral artery . Systolic blood pressure, diastolic blood pressure, and mean arterial pressure by an indirect blood pressure monitor were 107 9, 62 20, and 74 17 mmhg, respectively . Doppler ultrasonography and spectral waveform analysis has previously been used to assess both anatomic and dynamic information of blood flow in various vascular diseases [2 - 4,6,9,13 - 15]. This is due to each vessel having its specific doppler signature, and the physiological and pathological changes of the vessels can be recognized by the evaluation of the doppler spectrum . Pulsed wave doppler is used to identify vessel and assess the direction, velocity and pattern of blood flow . The common indices include psv, edv, s: d ratio, ri, and pi . In particular, the knowledge of psv threshold is the most useful parameter for vascular stenotic diseases . During ultrasonographic examination of the common carotid artery, it was necessary to extend the neck because of its short length and the large volume of fat in the micropig neck scanning region, although there would be mild artificial changes of blood flow spectrum . From the caudal to the cranial part, the common carotid artery of pigs separate into the right and left artery near the thoracic inlet, ascend along the medial aspect of internal jugular vein, and terminates into the internal carotid, lingual, and external carotid arteries in the cranial deep aspect of the jugular groove . However, there were no significant differences observed among the three parts of common carotid artery in all blood flow velocity parameters and waveform pattern . To scan the abdominal aorta, the transducer was placed on the caudodorsal part of the abdomen in the right oblique lateral recumbency . Micropigs had intestines filled with gas and ingesta in spite of fasting because of their unique, coiling intestinal structures . Therefore, the renal artery was used as an only reference point to separate into the cranial and caudal parts of the abdominal aorta . The two parts of the abdominal aorta showed no significant differences in all blood flow velocity parameters and waveform pattern (p> 0.05). The external iliac artery arises from the abdominal aorta, ventral to the last lumbar vertebra . It passes caudolaterally along the medial face of the iliopsoas muscle and courses along the deep face of the sartorius muscle ventrocaudally through the femoral ring . This external iliac artery continues to the femoral artery, which crosses the medial surface of the femur . The external iliac and femoral arteries were easy to trace on b - mode ultrasound . However, the doppler angle needed to be maintained at almost 60 degrees because of the superficial location of both arteries . The femoral artery was evaluated in the region caudal to the femoral ring to minimize the doppler angle . The lowest psv was recorded in the external iliac artery and the lowest edv was observed in the femoral artery compared to other arteries measured except the renal arcuate artery in this study . All major arteries, including common carotid, abdominal aorta, external iliac, and femoral, showed plug flow velocity profiles with a narrow range of frequencies / velocities . These waveforms had high pulsatility and high resistance flow patterns with one sharp systolic peak, large and clear spectral windows, and a narrow velocity distribution . These results are similar to previous human and other animal studies because all measured arteries are major large arteries . The psv, s: d ratio, ri, and pi of the left renal arcuate artery showed the lowest values compared to other arteries in this study (p <0.05). And the renal arcuate artery showed a parabolic velocity profile with a wide range of frequencies / velocities, low pulsatility, low - resistance flow with broad and continuous systolic peaks, a gradually decreasing velocity, and continuous high velocity flow in diastole as previous study . This waveform is found in arteries of the solid organs, in particular, the kidneys, testes and prostate . The low resistance waveform has a characteristic of continuing high flow during diastole, which is 20 - 50 percent of the peak systolic velocity . The ratio of systolic to diastolic flow may be useful measurable parameter in this waveform . In this study, the diastolic velocity of renal arcuate artery was about 41 percent of the peak systolic velocity and showed the lowest s: d ratio . This study investigated blood velocity parameters of major arteries in the normal conscious immature micropigs using doppler ultrasonography . The number of micropigs is a study limitation and further study is necessary to compare these data with another age group or other species . However, the results of this study may be useful as a baseline data for future investigations, including vascular disease models and transplantation of organs.
|
Plant traits such as leaf shape, trichomes, leaf surface waxbloom, and chemical compounds can affect the animals associated with the plant (hare 2002; whitham et al . Plant traits may affect both herbivores and predators, and interactions between predators and their prey may be altered to produce indirect ecological effects (hare 2002). Studies of hybrid plants and their parent species indicate that traits affecting community structure can have a genetic basis (whitham et al . Species associated with hybrid plants can have idiosyncratic responses and may increase or decrease in abundance (fritz et al . 1994; messina et al . The responses of each associated species to hybrid genotypes can change the species richness and evenness of the associated community . For example, leaf - galling aphid survival on individual poplar trees within a hybrid zone varies 75-fold (whitham 1989). The subsequent decrease in aphid density reduces associated arthropod species richness by 31% (dickson and whitham 1996). The pattern of community structures of associated arthropods on two eucalyptus species and their f1 and f2 hybrids is comparable to patterns expected from inherited quantitative traits (dungey et al . 2000). However, many traits differed between the hybrids and their parents (dungey et al . Studies of isoline or near - isoline plants that vary in only one trait may help pinpoint genetic mechanisms that affect community structure . Knowledge of genetic mechanisms that affect community structure in a crop - based system may improve pest management (bottrell et al . All else being equal, a crop variety with a trait that reduced pest density would be clearly preferable to a variety without that trait . However, even recognizing traits that increase one pest but decrease another may aid in developing integrated pest management strategies (smith and van den bosch 1967; pedigo 2002). In peas, pisum sativum l., single gene mutations can change the amount and composition of waxy bloom that the plant produces (marx 1969; holloway et al . 1977). The other line is homozygous for the allele wel and has reduced wax crystals over its stems, leaves, stipules, and pods (eigenbrode et al . 1998b). Foraging predators can walk more effectively on peas with reduced wax, thereby increasing predation on the pea aphid (acyrthosiphon pisum harris) (eigenbrode et al . 1998a; white and eigenbrode 2000). The convergent lady beetle (hippodamia convergens guerin - meneville), a green lacewing (chrysoperla plorabunda fitch), and a parasitoid wasp (aphidius ervi haliday) all cause greater pea aphid mortality on peas with reduced wax than on normal wax peas (eigenbrode et al . Such enhanced predation is partly responsible for consistently lower field densities of the pea aphid on peas with reduced wax than on normal peas (white 1998; white and eigenbrode 2000; rutledge et al . For example, interactions between a carabid (poecilus scitulus leconte) and the pea aphid and convergent lady beetle do not appear to be altered on peas with reduced wax (chang and eigenbrode 2004). Visual canopy sampling of arthropods found 12 unambiguous morphospecies that responded differently to peas with reduced wax (rutledge et al . For example, predatory syrphids are more abundant on normal peas, while coccinellids are more abundant on peas with reduced wax (rutledge et al . . However, information on the effects of wax on the broader community of arthropods is lacking . We used pitfall sampling to complement and extend the information on community effects of peas with reduced wax . One advantage is that many more morphospecies, over 200 taxa at our site, could be counted and identified from pitfalls than from visual canopy sampling . However, a limitation of pitfalls is that they will only capture individuals that walk or fall into them . Thus, mostly ground - dwelling species are collected, although some foliage - dwelling and flying insects may fall into the traps . We used pitfall trap data to address two related questions: 1) does wax expression of peas alter the structure of the arthropod community, and 2) which taxa show the greatest disparity in abundance between normal and peas with reduced wax? The arthropods associated with peas were assessed at the university of idaho (u.s.a .) Plant science research farm (4643 n, 11657 w) in 1998 and 1999 . The peas are near isolines differing in expression of the mutation wel (marx 1969), which reduces wax crystals over the stems, leaves, stipules and pods (eigenbrode et al . Four pairs in 1998, and five pairs in 1999, of 5 5 m plots were located on the farm . One plot in each pair was planted with normal peas, while the other was planted with peas with reduced wax . The assignment of normal and reduced - wax pea plots within a pair was random . With the exception of the line of peas planted, identical cultivation practices were used on all of the plots . One pitfall trap (8-cm diameter plastic cups) was placed in the center of each plot buried flush with the soil surface . Collected arthropods were identified in the laboratory to order, and when possible, to family, genus, or species . Therefore, a morphospecies in this study refers to the finest taxonomic level at which individuals could be classified and is our best estimate of a single species . The number of individuals collected in the pitfall traps is our best estimate of the abundance of a morphospecies, although pitfall trap captures are influenced by density and activity level (thomas et al . 1998). The individuals collected in pitfalls from each of the two types of peas were the effective arthropod communities for our analyses of the diversity of community structure . The number of individuals was plotted versus abundance rank for the total samples ranked within plots with normal peas and plots with reduced - wax peas . A randomization test for difference in community structure was performed according to solow (1993). For the randomization test, the shannon and simpson diversity indices were calculated for both normal and reduced - wax peas . The shannon index is more sensitive to species richness, while the simpson index is more sensitive to species evenness (magurran 1988). Simulated datasets were generated by randomly partitioning the total number of observed individuals into two sets equal in size to the observed numbers of individuals in normal and reduced - wax plots . For each simulation, shannon and simpson diversity indices were calculated for both types of peas, and the difference between the diversity indices from normal peas and peas with reduced wax were calculated . The number of simulations producing a difference in the diversity indices greater than or equal to that observed from the pitfall traps estimates the probability that any observed difference was due to chance . The advantage of using a randomization test on the pooled data is that it retains information from species that occurred only once in our samples . The number of morphospecies collected per plot over each sampling period was tallied as the measure of species richness . A 2-way anova was performed with species richness as the dependant variable and wax level and year as factors and plots as replicates . Wardle's (1995) index v was modified to calculate the disparity between captures in normal and reduced - wax pea plots for each taxon: mr being captures in peas with reduced wax, mn being captures in normal pea plots . As we have defined it, the value of v increases when relatively more individuals of a morphospecies were collected from normal peas, and decreases when relatively more individuals were collected from peas with reduced wax . The observed values of v were tested for whether morphospecies with 20 or more individuals in our total collection differed from what would be expected from chance . An expected distribution of v was generated based on chance by calculating v for each morphospecies with 20 or more individuals in each of 10 simulated datasets (the random partitions of the observed individuals, as described above). The fit of the observed distribution of v to the simulated distribution of v was then assessed . The observed absolute values of v were grouped into categories of 0.05 increments, with v> 0.2 lumped into a single category to eliminate sparse cells for a g - test (sokal and rohlf 1981). The number of captures of the selected morphospecies from 1998 and 1999 was tested using manovas with wax level as a factor . Manova can detect a difference in situations where species have traded places in terms of relative abundance, without changing the species richness or evenness of the community . Such a change in community structure cannot be detected by a randomization test based on a diversity index (solow and costello 2001). Furthermore, inspection of univariate anovas within a manova can reveal which species changed in response to the difference in wax . First, the statistical power of manova decreases with the inclusion of more dependant variables (scheiner 2001). Second, the number captured of many of the morphospecies in our data set deviate too much from the normal distribution to meet the assumptions of manova . Deviation from normality is particularly problematic in our data because several morphospecies occur in one year but not the other (or were extremely abundant in one year and not the other). Therefore, two separate manovas were applied, one to data from 1998, and one to data from 1999 . The 3 most abundant morphospecies in both 1998 and 1999 were analyzed (appendix 1). A total of 12,737 individual arthropods were recovered in the pitfall traps, 6,657 in the reduced - wax and 6,080 in the normal peas . Of those individuals, 12,113 were identified to one of 229 morphospecies, with 171 taxa in reduced wax and 186 in normal plots . Eleven taxa were identified to species and 21 others were identified to genus (appendix 1). Of the remaining morphospecies, the randomization test suggested an effect of wax reduction on the overall community structure (table 1). In particular, the simpson index was lower in normal pea plots than in peas with reduced wax . Inspection of the rank abundance curves revealed greater species evenness in the reduced - wax plots than in the normal pea plots, particularly among the eight most abundant taxa (figure 1). The most captured taxon on both normal and reduced - wax peas was the pea aphid, which constituted 27% of all individuals collected in normal peas and 19% in peas with reduced wax . The next 7 highest ranked taxa collectively constituted 35% of all individuals in normal peas but made up 46% in peas with reduced wax . The difference between the shannon index obtained from plots of the two pea varieties was not significantly greater than what was expected from chance . The distribution of wardle's index v for morphospecies represented by 20 individuals in the total sample indicated that arthropod taxa in peas responded idiosyncratically to the peas with reduced wax . Several taxa illustrate apparent preference for normal or reduced - wax peas, as well as species that were about evenly divided between the two lines (appendix 1). The observed and simulated distributions of v (figure 2) were significantly different (= 43.556, df = 16, p <0.001, n = 53). In particular, the observed distribution of v had a higher frequency of morphospecies with large disparities in captures in one pea variety versus the other (a higher absolute value of v; note the flatter distribution of observed frequencies of v compared to the simulated frequencies). The mean (se) number of morphospecies per plot in 1998 was 74.3 3.8 and 73.8 3.6 in reduced - wax and normal peas, respectively; in 1999, 55.8 2.3 and 54.4 3.2 morphospecies were captured in reduced - wax and normal peas . The number of morphospecies captured in 1998 was significantly greater than in 1999 (f1, 14 = 34.76, p <0.0001), but wax type and its interaction with year were not significant (p> 0.05). Manova of each year's 3 most abundant taxa did not find a significant overall effect of pea variety in 1998 (hotelling - lawley trace = 3.083, f3,1 = 1.03, p = 0.6033; figure 3). Pea variety did have a significant effect on the 3 most abundant taxa in 1999 (hotelling - lawley trace = 38.871, f3,2 = 25.91, p = 0.0374; figure 4). Univariate f - tests within the 1999 manova revealed that pea leaf weevil (sitona lineatus) were strongly influenced by wax reduction . The pea leaf weevil was three times more abundant in peas with reduced wax than in normal peas in 1999 (figure 4). . Communities of arthropods often differ depending on the plant species they are associated with (ehrlich and raven 1964; price 1984). For example, changes in pubescence among species in the genus arctostaphylos correspond to changes in their associated arthropod communities (andres and connor 2003). Other similar plants such as hybrids, their parental species, and backcrosses between those hybrids and parental species, can also harbor different communities of arthropods (whitham et al . Peas with the wel homozygous genotype have a reduced - wax phenotype, which increased the evenness of the associated arthropod community . Species richness, another component of diversity, was not significantly different between normal and peas with reduced wax . The change in evenness was driven by changes in the capture frequency of particular species, and responses of insects to peas with reduced wax were idiosyncratic (appendix 1). For example, two herbivores of agronomic importance had contrasting responses to peas with reduced wax . Pea aphid capture frequency was greater from normal peas whereas the pea leaf weevil was much more frequently captured from peas with reduced wax . The pitfall data are consistent with data on pea aphid densities and pea leaf weevil damage obtained from visual surveys of the canopy of peas (white 1998; white and eigenbrode 2000; rutledge et al . 2003 for example, in 1996 and 1997, normal wax peas were associated with higher populations of pea aphids, but peas with reduced wax suffered greater damage from adult pea leaf weevils (white and eigenbrode 2000). Predators decrease pea aphid densities on peas with reduced wax relative to normal peas because they are able to walk and thus forage more effectively when less wax is on the plant surface (white and eigenbrode 2000). All of the pea leaf weevils captured were adults, which are highly mobile and probably able to choose to forage upon peas with reduced wax . Apparent preferences of predatory arthropods for either normal or reduced - wax peas may be a function of both prey abundance and prey accessibility in each habitat (stephens and krebs 1986). Although pea aphids are more abundant on normal peas than on peas with reduced wax, greenhouse experiments in which pea aphids were presented in equal densities on the two types of peas have found that aphids on peas with reduced wax are more accessible to certain predators (eigenbrode et al . Therefore, all else being equal, it can be predicted that the ratio of predators to pea aphids will be higher on peas with reduced wax than on peas with normal wax, although no clear prediction can be made regarding the absolute densities of predators . Indeed, several predators had higher ratios to pea aphids on peas with reduced wax . This group includes h. convergens, coccinellid larvae which were probably mostly h. convergens, geocoris sp ., spiders (as a group), and green lacewings (two morphospecies combined; appendix 1). Other predators had higher ratios to pea aphids in peas with normal wax; namely, adult coccinella (two species combined), nabidae (two morphospecies combined), and syrphidae (six morphospecies combined). Some of the apparent preferences of predators for peas with normal wax may be an artifact of low capture rates of the taxa involved, but ecological factors may also explain some of the apparent paradoxes . For example, some syrphids prefer to oviposit on normal brassicas to those with reduced wax (chandler 1968). The syrphids in our study may have had a similar preference for peas with normal wax . Finally, the greater slipperiness of peas with normal wax may have increased the number of active insects such as coccinellids captured in the pitfall traps located in those plots . The relative abundances of arthropods might be affected by changes in the environment that extend beyond the foliar surfaces of the plant but are ultimately due to differences in plant wax . For example, peas with normal wax typically grow faster than peas with reduced wax (chang and eigenbrode 2004), probably because greater amounts of cuticular wax improve the ability of plants to cope with water shortages (fitter and hay 2002). The amount of vegetative cover can affect abiotic conditions such as soil temperature and soil moisture (daubenmire 1974). Certain taxa may be responding to habitat differences that are an indirect consequence of the difference in wax, while predators or competitors may mediate the responses of other species . Scitulus was over three times more frequently captured on peas with reduced wax (v = 0.52), while pt . Melenarius was nearly three times more frequently captured on normal peas (v = 0.44). Future work might determine whether their contrasting responses are caused by different preferences in abiotic conditions or some degree of competitive exclusion . We also suggest that differences in the arthropod communities captured in 1998 versus 1999 are also largely due to differences in abiotic conditions . During the 1998 sampling period, mean monthly temperatures were higher and more rain fell than in 1999 (idaho state climate services 2004). The comparison between normal peas and peas with reduced wax illustrates considerations for rational crop design . The greater evenness of the arthropod community in peas with reduced wax may also be desirable if a crop is being managed for biodiversity in addition to yield (hails 2002). Furthermore, the greater growth rate of peas with normal wax under water - limited conditions (chang and eigenbrode 2004) will be an important practical consideration in many environments . Knowledge of the relative advantages and disadvantages of different crop varieties may improve the match between specific cultivars and particular geographic regions . Rank abundance curves for arthropod morphospecies found in pitfall traps within plots of normal and reduced wax peas . Species rank is determined within a variety; in other words, the rank order of a morphospecies in reduced wax peas is different from that in normal peas . Histogram of observed and simulated values of wardle's (1995) index v. observed v's were calculated for 53 morphospecies that were represented by 20 or more individuals in our total sample . V = 0 for morphospecies with equal numbers of individuals collected from reduced wax and normal pea plots . Positive values of v indicate that more individuals were collected from normal wax peas, while negative values indicate that more individuals were collected from reduced wax peas . Greater absolute values indicate a greater disparity in collections from the two types of peas . Mean abundances of the 3 most abundant morphospecies in pitfall collections from peas, 1998 . The taxa on the x - axis are listed in descending order of abundance in all plots . Bars represent the standard error of the mean abundance of each morphospecies per plot (n = 4). Mean abundances of the 3 most abundant morphospecies in pitfall collections from peas, 1999 . The taxa on the x - axis are listed in descending order of abundance in all plots . Bars represent the standard error of the mean abundance of each morphospecies per plot (n = 5).
|
Increasing evidence indicates that aberrant activation of the embryonic programme epithelial mesenchymal transition' (emt) promotes tumour cell invasion and metastasis (berx et al, 2007). Emt allows detachment of cells from each other and increases cell mobility, both of which are necessary for tumour cell dissemination . Metastases often recapitulate the differentiated phenotype of the primary tumour; therefore, emt seems to be transiently activated by the inductive tumour environment at the invasive tumour edge, but is reversed in growing metastases (brabletz et al, 2001, 2005). Activators of emt, such as transforming growth factor (tgf), tumour necrosis factor (tnf) and hepatocyte growth factor, are produced by infiltrating cells or the tumour cells themselves, and trigger expression of emt - inducing transcriptional repressors (thiery & sleeman, 2006). Helix family, goosecoid and members of the zfh family (zinc - finger e - box binding homeobox (zeb)1 and zeb2; barrallo - gimeno & nieto, 2005; hugo et al, 2007; peinado et al, 2007). Recently, we described that zeb1 is a crucial emt activator in human colorectal and breast cancer, and suppresses expression of basement membrane components (spaderna et al, 2006) and cell polarity factors (aigner et al, 2007; spaderna et al, 2008). Expression of zeb1 promotes metastasis of tumour cells in a mouse xenograft model, indicating a role of zeb1 in invasion and metastasis of human tumours (spaderna et al, 2008). Micrornas (mirnas) are small non - coding rnas that can silence their cognate target genes by specifically binding and cleaving messenger rnas or inhibiting their translation (bartel, 2004). Mirnas regulate diverse cellular processes and some mirnas have been shown to function as either tumour suppressors or oncogenes (esquela - kerscher & slack, 2006). Recent important examples are the oncogenic mir-10b, which promotes metastasis (ma et al, 2007), and mir-335/mir-126, which suppress metastasis in breast cancer (tavazoie et al, 2008). Owing to these important regulatory functions of mirnas, it is of prime interest to know how their expression is regulated by upstream factors . Here, we address this point and focus on the activation and stabilization of emt in cancer cells . We investigated whether aberrant expression of the crucial emt activator zeb1 and the control of potential emt - regulatory mirnas are linked and can synergize to promote malignant tumour progression . Tgf and tnf have been shown to induce an emt in differentiated colorectal cancer cells (bates et al, 2005). We observed activation of emt in differentiated pancreatic (hpaf2), colorectal (dld1) and breast cancer (mcf7) cell lines by tgf/tnf. Thus, zeb1 was a crucial intracellular transmitter of this emt, as its expression was upregulated by both cytokines and its knockdown partly prevented emt (supplementary fig 1a, b online). Direct epithelial target genes suppressed by zeb1, such as e - cadherin, cell polarity factors and basement membrane components, have been described previously (grooteclaes & frisch, 2000; aigner et al, 2007; spaderna et al, 2008). Here, we investigated whether zeb1 also affects expression of mirnas and if detected mirnas themselves are candidate regulators of emt . A mirna expression microarray screen was used to analyse sw480 and hct116 colorectal and mda - mb231 breast cancer cell clones with stable short hairpin rna - mediated knockdown of zeb1 (shzeb clones) in comparison with control knockdown (shctl) clones . We have shown previously that stable knockdown of zeb1 in these clones led to a reversal of the fibroblastoid phenotype towards an epithelial differentiation in the sense of a mesenchymal epithelial transition (spaderna et al, 2008). Out of 743 human, rat and mouse mirnas included on the microarray screen, we detected average upregulation (> 1.75-fold) after zeb1 knockdown of 79 mirnas (10.59%) in at least one cell line, 17 mirnas (2.27%) in two cell lines and only 4 mirnas (0.53%) in all three cell lines (fig 1; supplementary table 1 online). The strongest effect was observed for the undifferentiated breast cancer cell line mda - mb231 . Notably, three of the four mirnas upregulated in all cell lines (mir-141, mir-200b and mir-200c) belong to the highly conserved mirna-200 family, which was recently linked to the induction of epithelial differentiation (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). Further analyses focused on mir-141 and mir-200c, which showed strongest upregulation after knockdown of zeb1 in all three cancer cell lines . The array data were validated by using real - time pcr for mir-141 and mir-200c, which showed a strong increase after knockdown of zeb1 in undifferentiated pancreatic, colorectal and breast cancer cell lines (supplementary fig 1c online). Next, we investigated whether zeb1 directly suppresses transcription of the mir-141 and mir-200c mirna genes . Both mirnas map closely on human chromosome 12p13.31 and the stem loop sequences are separated by only a 338-base - pair spacer sequence (fig 2a). This spacer and the putative promoter 600 bp upstream from the hsa - mir-200c stem loop contain six putative binding sequences for zeb1, two of which were restricted to zeb factors (z - box 1 and 2, caggta). The remaining four were perfect e - boxes (e - box 14, caggtg), which, in addition to zeb1, represent putative binding sites for other emt activators, such as snail factors . Note that the overall mirna gene structure and the two z - boxes, as well as e - box 2, are highly conserved in evolution from zebrafish to human (fig 2a). All the conserved zeb1-binding sequences are located within the putative promoter, whereas the two e - boxes in the spacer sequence are not conserved . After cloning of the putative promoter (683 to 67 relative to first nucleotide of the mir-200c stem loop) and the spacer (+ 66 to + 338) into a luciferase reporter vector, zeb1-dependent activity was assessed . Shrna - mediated knockdown of zeb1 in all undifferentiated colorectal, breast and pancreatic cancer cell lines tested resulted in an enhanced promoter activity when compared with shctl cell clones (fig 2b, left). On the contrary, the promoter activity was suppressed by zeb1 overexpression in a dose - dependent manner . Similar effects, although to a lesser extent, were also observed after snail1 overexpression, which can bind to only two of the four potential zeb1-binding sites within the putative promoter (fig 2b, middle). The expression level of zeb1 had no significant effect on the transcriptional activity of the spacer sequence . Mutation of the two highly conserved z - boxes showed that z - box 2 confers the strongest repressive function by zeb1 (fig 2b, right) and also made the promoter activity insensitive to stable knockdown of zeb1 (supplementary fig 1d online). A direct binding of zeb1 to the two conserved zeb1 sites (z - boxes) was shown by electromobility shift assay by using recombinant dna - binding domain of zeb1 and nuclear extracts from sw480 colorectal cancer cells (fig 2c). By applying chromatin immunoprecipitation (chip) with chromatin from sw480 or hct116 colorectal cancer cells, we could show that endogenous zeb1 binds to the native promoter region (fig 2d). These data indicate that the transcriptional repressor zeb1 can directly suppress expression of both mir-141 and mir-200c by binding to their putative common promoter . Next, we investigated whether the two mirnas suppressed by zeb1 represent direct emt regulators . We showed that mir-200c and mir-141 are strong inducers of an epithelial phenotype, which was also recently reported by other groups during the course of our work (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). Transient overexpression of both mir-141 and mir-200c resulted in the induction of epithelial differentiation of undifferentiated cancer cells (fig 3a; supplementary fig 2a, b online). In particular, the overall effect of mir-200c was comparable with the strong effect of zeb1 knockdown . Notably, mir-200c, and to a lesser extent mir-141, also led to increased e - cadherin expression and cell cell adhesion, as well as reduced spreading of normal human fibroblasts (supplementary fig 2c online). Overexpression of mir-200c strongly reduced cancer cell migration and invasion into matrigel, indicating a potential inhibitory role in malignant tumour progression (fig 3b; supplementary fig 2d online). On the contrary, treatment of differentiated cancer cell lines hpaf2 and dld1 with inhibitors of mir-200c, and to a lesser extent of mir-141, resulted in a mesenchymal transition as indicated by cell scattering, upregulation of vimentin and reduced expression of e - cadherin (fig 3c). Knowing that the breast cancer cell line mda - mb231, which almost completely lost both mirnas, is derived from a basal type of breast cancer, we analysed various types of human breast cancer . As predicted from using cancer cell lines, we confirmed that basal types of breast cancers, characterized by an undifferentiated phenotype and poor clinical prognosis, show reduced expression of both mirnas compared with the common ductal invasive type of breast cancer (supplementary fig 2e online). To explain further the mechanisms by which both mirnas induce epithelial differentiation, we searched for putative target genes on the basis of the predicted mrna recognition sequence of the conserved stem loop sequences by using the targetscan search programme (lewis et al, 2003). Notably, among the highest scored target genes for mir-200c were zeb1 and zeb2, which confirms recent findings published during the course of our work (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). In addition, a putative target of mir-141 is tgf2, indicating that both mirnas are functionally linked by affecting different members of the same emt - inducing pathway . We further selected the putative target factors leptin receptor and cofilin 2 because they are known promoters of malignant tumour progression (attoub et al, 2000; wang et al, 2007). The predicted mirna binding sites in the 3 untranslated region (utr) were highly conserved during evolution (fig 4a; supplementary fig 3a online). We could show that overexpression of mirnas led to reduced expression of zeb1, tgf2 and the other candidate genes in undifferentiated cancer cells (fig 4b, c; supplementary fig 3b online). As predicted, mir-141 had the strongest inhibitory effect on tgf2 and mir-200c on zeb1 expression, as shown by rna and protein levels . On the contrary, treatment of differentiated cancer cell lines hpaf2 and mcf7 with inhibitors of mir-200c or mir-141 resulted in a change in the expression of characteristic genes, including an increase in zeb1 and tgf2 expression (supplementary fig 3c online). A negative regulation of zeb1 and tgf2 expression by mir-200c and mir-141 was indicated after cloning of their highly conserved, putative mrna 3utr target sequences in a luciferase reporter vector . After transfection into sw480 shzeb1 clones with reduced zeb1 and enhanced expression of both mirnas, both reporters showed reduced luciferase activity in two independent shzeb1 clones compared with shctl clones (fig 4d). Overexpression of mir-141 and mir-200c in sw480 cells led to a reduced activity of tgf2 - 3utr and zeb1 - 3utr constructs, respectively (fig 4e). On the contrary, selective inhibition of mir-141 and mir-200c in sw480 shzeb1 cells by specific anti - mirnas resulted in a selective increase in the activity of tgf2 - 3utr and zeb1 - 3utr constructs, respectively (supplementary fig 3d online). Tgf and tnf have been shown to induce an emt in differentiated colorectal cancer cells (bates et al, 2005). We observed activation of emt in differentiated pancreatic (hpaf2), colorectal (dld1) and breast cancer (mcf7) cell lines by tgf/tnf. Thus, zeb1 was a crucial intracellular transmitter of this emt, as its expression was upregulated by both cytokines and its knockdown partly prevented emt (supplementary fig 1a, b online). Direct epithelial target genes suppressed by zeb1, such as e - cadherin, cell polarity factors and basement membrane components, have been described previously (grooteclaes & frisch, 2000; aigner et al, 2007; spaderna et al, 2008). Here, we investigated whether zeb1 also affects expression of mirnas and if detected mirnas themselves are candidate regulators of emt . A mirna expression microarray screen was used to analyse sw480 and hct116 colorectal and mda - mb231 breast cancer cell clones with stable short hairpin rna - mediated knockdown of zeb1 (shzeb clones) in comparison with control knockdown (shctl) clones . We have shown previously that stable knockdown of zeb1 in these clones led to a reversal of the fibroblastoid phenotype towards an epithelial differentiation in the sense of a mesenchymal epithelial transition (spaderna et al, 2008). Out of 743 human, rat and mouse mirnas included on the microarray screen, we detected average upregulation (> 1.75-fold) after zeb1 knockdown of 79 mirnas (10.59%) in at least one cell line, 17 mirnas (2.27%) in two cell lines and only 4 mirnas (0.53%) in all three cell lines (fig 1; supplementary table 1 online). The strongest effect was observed for the undifferentiated breast cancer cell line mda - mb231 . Notably, three of the four mirnas upregulated in all cell lines (mir-141, mir-200b and mir-200c) belong to the highly conserved mirna-200 family, which was recently linked to the induction of epithelial differentiation (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). Further analyses focused on mir-141 and mir-200c, which showed strongest upregulation after knockdown of zeb1 in all three cancer cell lines . The array data were validated by using real - time pcr for mir-141 and mir-200c, which showed a strong increase after knockdown of zeb1 in undifferentiated pancreatic, colorectal and breast cancer cell lines (supplementary fig 1c online). Next, we investigated whether zeb1 directly suppresses transcription of the mir-141 and mir-200c mirna genes . Both mirnas map closely on human chromosome 12p13.31 and the stem loop sequences are separated by only a 338-base - pair spacer sequence (fig 2a). This spacer and the putative promoter 600 bp upstream from the hsa - mir-200c stem loop contain six putative binding sequences for zeb1, two of which were restricted to zeb factors (z - box 1 and 2, caggta). The remaining four were perfect e - boxes (e - box 14, caggtg), which, in addition to zeb1, represent putative binding sites for other emt activators, such as snail factors . Note that the overall mirna gene structure and the two z - boxes, as well as e - box 2, are highly conserved in evolution from zebrafish to human (fig 2a). All the conserved zeb1-binding sequences are located within the putative promoter, whereas the two e - boxes in the spacer sequence are not conserved . After cloning of the putative promoter (683 to 67 relative to first nucleotide of the mir-200c stem loop) and the spacer (+ 66 to + 338) into a luciferase reporter vector, zeb1-dependent activity was assessed . Shrna - mediated knockdown of zeb1 in all undifferentiated colorectal, breast and pancreatic cancer cell lines tested resulted in an enhanced promoter activity when compared with shctl cell clones (fig 2b, left). On the contrary, the promoter activity was suppressed by zeb1 overexpression in a dose - dependent manner . Similar effects, although to a lesser extent, were also observed after snail1 overexpression, which can bind to only two of the four potential zeb1-binding sites within the putative promoter (fig 2b, middle). The expression level of zeb1 had no significant effect on the transcriptional activity of the spacer sequence . Mutation of the two highly conserved z - boxes showed that z - box 2 confers the strongest repressive function by zeb1 (fig 2b, right) and also made the promoter activity insensitive to stable knockdown of zeb1 (supplementary fig 1d online). A direct binding of zeb1 to the two conserved zeb1 sites (z - boxes) was shown by electromobility shift assay by using recombinant dna - binding domain of zeb1 and nuclear extracts from sw480 colorectal cancer cells (fig 2c). By applying chromatin immunoprecipitation (chip) with chromatin from sw480 or hct116 colorectal cancer cells, we could show that endogenous zeb1 binds to the native promoter region (fig 2d). These data indicate that the transcriptional repressor zeb1 can directly suppress expression of both mir-141 and mir-200c by binding to their putative common promoter . Next, we investigated whether the two mirnas suppressed by zeb1 represent direct emt regulators . We showed that mir-200c and mir-141 are strong inducers of an epithelial phenotype, which was also recently reported by other groups during the course of our work (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). Transient overexpression of both mir-141 and mir-200c resulted in the induction of epithelial differentiation of undifferentiated cancer cells (fig 3a; supplementary fig 2a, b online). In particular, the overall effect of mir-200c was comparable with the strong effect of zeb1 knockdown . Notably, mir-200c, and to a lesser extent mir-141, also led to increased e - cadherin expression and cell cell adhesion, as well as reduced spreading of normal human fibroblasts (supplementary fig 2c online). Overexpression of mir-200c strongly reduced cancer cell migration and invasion into matrigel, indicating a potential inhibitory role in malignant tumour progression (fig 3b; supplementary fig 2d online). On the contrary, treatment of differentiated cancer cell lines hpaf2 and dld1 with inhibitors of mir-200c, and to a lesser extent of mir-141, resulted in a mesenchymal transition as indicated by cell scattering, upregulation of vimentin and reduced expression of e - cadherin (fig 3c). Knowing that the breast cancer cell line mda - mb231, which almost completely lost both mirnas, is derived from a basal type of breast cancer, we analysed various types of human breast cancer . As predicted from using cancer cell lines, we confirmed that basal types of breast cancers, characterized by an undifferentiated phenotype and poor clinical prognosis, show reduced expression of both mirnas compared with the common ductal invasive type of breast cancer (supplementary fig 2e online). To explain further the mechanisms by which both mirnas induce epithelial differentiation, we searched for putative target genes on the basis of the predicted mrna recognition sequence of the conserved stem loop sequences by using the targetscan search programme (lewis et al, 2003). Notably, among the highest scored target genes for mir-200c were zeb1 and zeb2, which confirms recent findings published during the course of our work (hurteau et al, 2007; gregory et al, 2008; park et al, 2008). In addition, a putative target of mir-141 is tgf2, indicating that both mirnas are functionally linked by affecting different members of the same emt - inducing pathway . We further selected the putative target factors leptin receptor and cofilin 2 because they are known promoters of malignant tumour progression (attoub et al, 2000; wang et al, 2007). The predicted mirna binding sites in the 3 untranslated region (utr) were highly conserved during evolution (fig 4a; supplementary fig 3a online). We could show that overexpression of mirnas led to reduced expression of zeb1, tgf2 and the other candidate genes in undifferentiated cancer cells (fig 4b, c; supplementary fig 3b online). As predicted, mir-141 had the strongest inhibitory effect on tgf2 and mir-200c on zeb1 expression, as shown by rna and protein levels . On the contrary, treatment of differentiated cancer cell lines hpaf2 and mcf7 with inhibitors of mir-200c or mir-141 resulted in a change in the expression of characteristic genes, including an increase in zeb1 and tgf2 expression (supplementary fig 3c online). A negative regulation of zeb1 and tgf2 expression by mir-200c and mir-141 was indicated after cloning of their highly conserved, putative mrna 3utr target sequences in a luciferase reporter vector . After transfection into sw480 shzeb1 clones with reduced zeb1 and enhanced expression of both mirnas, both reporters showed reduced luciferase activity in two independent shzeb1 clones compared with shctl clones (fig 4d). Overexpression of mir-141 and mir-200c in sw480 cells led to a reduced activity of tgf2 - 3utr and zeb1 - 3utr constructs, respectively (fig 4e). On the contrary, selective inhibition of mir-141 and mir-200c in sw480 shzeb1 cells by specific anti - mirnas resulted in a selective increase in the activity of tgf2 - 3utr and zeb1 - 3utr constructs, respectively (supplementary fig 3d online). By applying a mirna expression array screen for various human cancer cells, we detected several mirnas suppressed by the emt inducer zeb1 . Zeb1 directly suppressed transcription of two members closely linked on human chromosome 12, mir-141 and 200c, by binding to at least two highly conserved sites in their putative promoter . In confirmation with the data published during the course of our work (hurteau et al, 2007; gregory et al, 2008; park et al, 2008), the detected mirnas induced a mesenchymal to epithelial transition (met) and inhibited emt, migration and invasion of undifferentiated cancer cells . We further identified putative target genes, which are known promoters of emt and malignant tumour progression . One target of mir-200c is zeb1 itself, indicating an emt - enhancing feedforward loop in invading cancer cells . This regulatory loop might be stabilized further by downregulation of mir141, as one of its putative targets is tgf2 . There is increasing evidence that zeb1 has crucial effects on various processes of malignant tumour progression (peinado et al, 2007) and promotes metastasis (spaderna et al, 2008). In the light of the important role of zeb1 and other emt inducers, such as snail (olmeda et al, 2007), twist (yang et al, 2004) and of emt as a whole in tumour progression, our data, indicating that zeb1 promotes an emt - stabilizing feedforward loop by suppressing specific mirnas, add functional evidence for the molecular mechanisms underlying these processes . Our work addressed the clinically relevant question of how putative tumour - suppressive mirnas can be inactivated in cancer progression . The fact that both the zeb1 binding sites and the overall structure of the mir-200c and mir-141 genes are highly conserved in vertebrates from zebrafish to human suggests that the tumour cells use a long - established regulatory mechanism of mirna expression . Moreover, the second mirna cluster of the mir-200 family on human chromosome 1p36 also contains highly conserved putative zeb1 binding sites in the upstream sequence, indicating that the whole mir-200 family can be suppressed by zeb1 (supplementary fig 3e online). In addition, both the strong transcriptional inhibition of the two mirnas by zeb1 and their putative tumour - suppressive effect were detected in tumour cell lines of various important cancer entities, namely pancreatic, colorectal and breast cancer . A clinical relevance is indicated by the fact that both mirnas are lost in the highly aggressive basal type of breast cancer, which, in contrast to the luminal and ductal invasive type, is poorly differentiated, shows no expression of oestrogen and progesterone receptors, and has a worse clinical prognosis (sempere et al, 2007). Both mirnas affect the expression of different molecules, which all work in the same proinvasive manner, as is known for tgf2, zeb1, cofilin and leptin receptor . The differential function of the two mirnas can synergize, as they are coexpressed, possibly through coactivation by a common promoter . The intriguing fact is that both mirnas inhibit members of their own repressing pathway: mir-200c targets zeb1 and mir-141 targets tgf2 . Thus, zeb1 becomes a crucial regulator, as its aberrant expression in cancer might start a self - enhancing feedforward loop by downregulating its own inhibitors mir-141 and mir-200c (fig 4f). Moreover, if the initial signal breaks down (for example, tumour environmental tgf), such a loop might as well re - enforce expression of the mirnas, thereby re - inducing an epithelial phenotype . Recently, liu et al (2008) showed that zeb1 is crucial for tgf-mediated emt in various steps of organ development . This important role of zeb1 points out that the predicted regulatory loop might also have a physiological role in separating mesenchymal from epithelial tissue in development and organogenesis . In conclusion, we suggest that zeb1 is a crucial promoter of tumour progression by reducing transcription of both mrnas and mirnas . Thus, zeb1 is a central molecular regulator of a mirna - mediated feedforward loop, which can re - enforce emt . A 50 g portion of total rna including small rnas isolated from 4 10 cells using the trizol reagent (invitrogen, carlsbad, ca, usa) was shipped to capital bio (beijing, china). An expression screening was carried out using capitalbio mammalian mirna array v2.0 containing 743 human, rat and mouse non - redundant mirna probes . The microarray data have been deposited on arrayexpress (http://www.ebi.ac.uk/arrayexpress/) with the accession code e - tabm-461 . Dna constructs . For the hsa - mir-200c promoter reporter plasmid nucleotides 683 to 67, and for the spacer reporter nucleotides + 66 to + 403 (relative to first nucleotide of mir-200c stem loop) were cloned into pgl3basic (promega, mannheim, germany). For the 3utr reporter plasmids, nucleotides + 3,399 to + 3,953 of human zeb1 complementary dna and nucleotides + 1,427 to + 1,695 of human tgf2 cdna were amplified and cloned downstream of the luciferase gene in the pmir - report vector (ambion, austin, tx, usa). Standard cell culture, transient transfections, reporter assays, electromobility shift assays, immunoblots, transient short interfering rna (sirna)-mediated knockdown and quantitative real - time reverse transcription pcr were carried out as described previously (brabletz et al, 1999, 2004; hlubek et al, 2001). For tgf/tnf stimulation 3 10 cells per well were seeded in a 12-well plate, transfected at day 1 as indicated, and stimulated with 2 ng / ml tgf and 10 ng / ml tnf for 5 days . Mirna modulation: a total of 5 10 cells per well were seeded in a 12-well plate . After 24 h, cells were transfected with 30 pmol oligonucleotides for mir-141, mir-200c or control mirna-16 (ambion, austin, tx, usa) using oligofectamine reagent (invitrogen, carlsbad, ca, usa) for overexpression, or with 420 nm of specific anti - mirs (ambion) for inhibition . Cell invasion was evaluated using the chemicon cell invasion assay kit as described previously (chemicon international, millipore, schwalbach, germany), using 20,000 transiently (mirna or sirna) transfected cells . Cell migration assay: cells were transfected with mirnas and controls as described (spaderna et al, 2006). After reaching confluence, cells were scratched with a pipette tip and the migration potential was observed for up to 50 h. quantitative real - time pcr for mirnas: rna from cultured cells was extracted using the mirvana paris kit (ambion, austin, tx, usa). Total rna of formalin - fixed, paraffin - embedded samples of breast carcinomas retrieved from the archives of the department of pathology, university of erlangen was extracted after microdissection using the total nucleic acid isolation kit for ffpe (ambion, austin, tx, usa). Specific quantitative real - time pcr experiments were carried out using taqman microrna assays for mir-141, mir-200c and control mirna-16 (applied biosystems, foster city, ca, usa) on a roche lightcycler 480 . Chip analysis: the chip it kit (active motif, carlsbad, ca, usa) was applied according to the manufacturer's instructions . A 3 g portion of control rabbit antiserum or antisera against zeb1 was used for immunoprecipitation . For oligonucleotide sequences, plasmids and antibodies used in this study,
|
The nuclear receptor corepressors were initially identified as nuclear proteins recruited by the thyroid hormone receptor (tr) and retinoic acid receptor (rar) isoforms to mediate ligand - independent repression . More recently, they have been shown to modulate the transcriptional activity of a wide variety of transcription factors . The two main nuclear receptor corepressors are the nuclear receptor corepressor protein (ncor) [horlein et al ., 1995] and the silencing mediator of retinoid and thyroid hormone receptors (smrt) [chen and evans, 1995]. Nuclear hormone receptors (nhrs) generally bind ncor and smrt in the absence of ligand or the presence of antagonists . These interactions are mediated by cornr box sequences (i / l - x - x - i / v - i) in the interacting domains of ncor and smrt [hu and lazar, 1999; nagy et al ., 1999; perissi et al ., 1999]. Sequences within and outside these cornr box motifs the binding of ligand to the nhr results in a conformational change in the receptor, leading to loss of corepressor binding and subsequent recruitment of coactivators . Ncor and smrt are expressed ubiquitously, and they function in vitro as corepressors of gene transcription . However, their exact physiologic roles in distinct tissues remain relatively undefined, in part due to a lack of suitable animal models . An ncor knock - out mouse has been developed, but ncor deficiency was found to cause embryonic lethality [jepsen et al ., 2000]. The use of cortical progenitor cells from ncor -/- mice showed that ncor was important in inhibiting the differentiation of neural stem cells into astrocytes [hermanson et al ., however, the ability of ncor and smrt to modulate differentiation in other tissues remains relatively unexplored . Recently, we and other groups have found that ncor and smrt play an important role in the adipocyte . We have focused on the role of these corepressors in inhibiting adipocyte differentiation, which appears to occur via repression of peroxisome proliferator - activated receptor (ppar) activity . Ppar is a member of the nuclear hormone receptor (nhr) superfamily of transcription, and exists as two isoforms which differ only in their a / b domains: ppar1 and ppar2 . Ppar2 is specifically expressed in adipocytes, and ppar response elements are found in a number of adipocyte - specific genes, including ap2, phosphoenolpyruvate carboxykinase, acyl - coa synthetase, and lipoprotein lipase . Similar to other nhrs, the ppar ligand - binding domain binds multiple classes of coactivators . Ppar, particularly the ppar2 isoform, is considered to be the key regulator of adipocyte differentiation [rosen et al ., knock - out of ppar in adipose tissue results in decreased adipocyte number, and decreased plasma levels of leptin and adiponectin [he et al . Interestingly, these mice exhibit insulin resistance in fat and liver, but not in muscle, and have normal glucose tolerance and systemic insulin sensitivity in the basal state . Mice develop excess adiposity and systemic insulin resistance [hevener et al ., 2003; norris et al ., these data suggest that ppar action is more complex than previously understood, and that ppar plays important roles in tissues other than the adipocyte . However, the adipocyte represents a target tissue that is uniquely dependent on ppar action; ppar is required for adipogenesis, and the differentiated adipocyte appears to depend on ppar for its survival [imai et al ., there have been limited studies of corepressor recruitment by ppar, and early results were conflicting . Some studies suggested that ppar might not recruit ncor or smrt in the presence of dna response elements [zamir et al ., another report suggested that ppar could recruit the corepressor smrt, but mainly in the presence of epidermal growth factor (egf) [lavinsky et al ., later work showed that ppar was able to recruit nuclear receptor corepressors in cells [gurnell et al ., 2000; wang et al ., 2004] and that overexpression of ncor or smrt repressed ppar-mediated gene transcription in certain cell types [krogsdam et al ., interestingly, mutant ppar receptors have been found in patients with ppar resistance that release corepressors aberrantly in the presence of exogenous ligands [agostini et al ., recently, we have shown that ncor and smrt down - regulate ppar-mediated transcriptional activity in 3t3-l1 cells, a fibroblast cell line that retains the ability to differentiate into adipocytes in the appropriate hormone milieu [yu et al ., 2005]. We used rna interference to down - regulate ncor or smrt levels in 3t3-l1 cells, and examined the ability of these cells to undergo adipogenesis . Interestingly, when stimulated with insulin, dexamethasone, and isobutylmethylxanthine, these cells exhibited increased expression of adipocyte - specific proteins as compared to wild - type cells . Moreover, these cells exhibited enhanced lipid droplet formation, as measured by oil red o staining . The cells were next stimulated to differerentiate in a thiazolidinedione (tzd)-dependent differentiation cocktail . Tzds serve as ligands for ppar, and are used clinically to increase insulin sensitivity in the treatment of type 2 diabetes mellitus [olefsky, 2000]. Interestingly, cells deficient in ncor or smrt expressed an increased level of adipocyte - specific proteins when stimulated by tzds [yu et al ., 2005]. Thus, these data show that ncor and smrt modulate adipogenesis, most likely via their ability to repress ppar action . Moreover, the relative cellular levels of corepressors and coactivators affect the ability of ppar ligands to induce adipocyte differentiation . Other groups have also recently examined the ability of ncor and smrt to repress ppar transcriptional activity in 3t3-l1 cells . Guan et al ., showed that ncor and smrt are both recruited to ppar, but this process is promoter - specific [guan et al ., when ppar is recruited to the ap2 promoter, it does not recruit corepressors; instead ppar is bound to coactivators even in the absence of ligand . In contrast, when ppar is recruited to the glycerol kinase promoter, it recruits nuclear receptor corepressors and represses gene transcription in the absence of ligand . While the presence of ligand does not cause a shift in cofactor recruitment by ppar on the ap2 promoter, ligand results in release of corepressors and recruitment of coactivators on the glycerol kinase promoter . These data suggest that corepressors affect only a fraction of ppar-responsive genes . An area of active research is to identify which ppar-responsive genes are corepressor - dependent and which are not . The standard view of ppar-mediated transcription involves an increase in gene transcription in the presence of ligands such as tzds . However, there are many genes that are negatively regulated by ppar ligands . Negative regulation by ppar and other nhrs is poorly understood . Early work into negative regulation by ppar focused on leptin gene regulation, as it is known that ppar agonists down - regulate leptin mrna levels [zhang et al ., interestingly, it was found that the putative ppar response element in the leptin promoter was not involved in negative regulation and it was hypothesized that ppar functionally antagonized c / ebp to decrease transcription in response to tzds [hollenberg et al ., more recently, pascual et al ., investigated the ability of ppar to down - regulate the inducible nitric oxide synthase (inos) gene in macrophages [pascual et al ., 2005]. These authors found that ppar ligands cause sumoylation of the ppar ligand - binding domain . This process targets ppar to ncor - containing complexes, and decreases the ability of p50 and p65 complexes to recruit coactivators . Thus, dna - associated ncor may recruit sumoylated ppar to down - regulate gene transcription in response to tzds on promoters that do not contain classical ppar / rxr binding sites . Interestingly, while ncor was important in negative regulation of the inos promoter, smrt was ineffective, suggesting there may be corepressor specificity in terms of negative regulation by ppar [pascual et al ., 2005]. While this work was performed in macrophages, these results shed insight into potential ways that corepressors might also influence ppar mediated negative regulation in adipocytes . Tzds serve as high affinity ligands for ppar receptors, and their effects on insulin sensitivity are thought to be dependent on this activity . Since ppar -/- tzds might increase insulin sensitivity via the recruitment of coactivators, whereas a decrease in ppar number would increase insulin sensitivity via a decrease in corepressor action [miles et al ., as noted above, knock - out of ppar in adipose tissue results in decreased adipocyte number [he et al . Interestingly, adipocyte - specific ppar knock - out mice exhibit normal systemic insulin sensitivity in the basal state, but are susceptible to insulin resistance induced by high - fat feeding [he et al . Mice exhibit systemic insulin resistance even in the basal state [hevener et al ., 2003; norris et al ., the in vivo function of ppar is complex, and further work will clarify the role of ppar in distinct tissues, including its relationship with ncor and smrt . Increasing evidence suggests that the corepressors ncor and smrt play an important role in adipocyte differentiation and ppar transcriptional activity . It appears that only a subset of ppar-responsive genes is corepressor - dependent (see figure 1). In addition, corepressors may also mediate negative regulation by ppar. Future work will delineate the roles of ncor and smrt in the adipocyte and determine which genes are regulated by corepressor activity . Currently, modulation of ppar transcriptional activity by tzds is used as a mainstay of treatment for type 2 diabetes mellitus [olefsky, 2000]. However, tzds are associated with side effects such as weight gain and edema . We hypothesize that alterations in corepressor activity might also allow for the modulation of ppar activity in the adipocyte and may represent an alternative or complementary therapeutic approach to the tzd class of medication . Nuclear receptor corepressors (cors) are recruited to ppar on a subset of ppar-responsive positively - regulated genes (a). On these genes, corepressors repress ppar activity in the absence of ligand . The presence of ligands such as tzds causes release of corepressors and recruitment of coactivators (coas). On other genes (b), ppar does not recruit corepressors, and these genes are transcriptionally active even in the absence of ligand . Still other genes are negatively regulated by ppar ligands (c). On these genes ppar
|
They are present in 10 to 55% of cases trotter, konarik, reaching 23% of cases in the free part of the limb - valsecchi . The brachial artery begins at the distal border of the tendon of the teres major muscle and ends close to the elbow joint . Frequently the brachial artery divides more proximally into radial, ulnar and common interosseous arteries . Some of the common variations of the brachial artery are present in the superficial brachial artery of the arm . This artery moves together with the median nerve and continues as the radial artery twice as frequently, when compared to the ulnar artery; less frequently it continues as both arteries - bergman et al . . The brachial artery is used in routine procedures, such as blood pressure recordings and arteriography of different parts of the body . Variation in the proximal and distal branching pattern of brachial artery is important for vascular surgeons . The superficial palmar arch is formed predominantly by the ulnar artery, with a contribution from the superficial palmar branch of the radial artery . According to the classic description (goss, bouchet & cuilleret, anastomosis among the ulnar and radiopalmar arteries form the superficial palmar arch . Adachi thinks that the superficial palmar arch has an ulnar - predominant formation, which he calls the ulnar - type (59% of cases). Coleman & anson developed a classification, in which the superficial palmar arch is formed in 78.46% of cases . The hand surgeon needs to know about the existence and healthy functioning of the palmar arch and the types of variations . This is very important before surgical procedures such as arterial repairs or a vascular graft . The main purpose of this case report is to describe the blood supply variations in the upper limb and to analyze the actual formation of the superficial palmar arch in the palm region . The case was described after a routine dissection during the anatomy class with students from the department of anatomy, histology and pathology at the medical faculty of the university of sofia . The 75 years old male cadaver was fixed with the formaldehyde method . At the left upper limb were observed and documented vascular variations of the brachial artery and composition of the superficial artery arc . It became possible to trace the brachial artery after the removal of subcutaneous adipose tissue and venous branches . This division was approximately at 10.4 cm from the beginning of brachial artery (figure 1). This superficial brachial artery became radial and was not involved in the formation of the palm arch . The superficial brachial artery pathway was closer to the median nerve in the first several centimeters, but after that it strayed on the lateral position and passed through the lateral sulcus of the cubital region . In this region, the brachial artery together with the ulnar and median nerve passes along the medial sulcus . The brachial artery on the forearm gives the beginning of median, common interosseous and ulnar branches approximately 4 cm after the cubital region (figure 2). The pathway of the median artery is accompanied by the median nerve and on the distal forearm part composes the superficial artery arch . This structure is an anastomosis between the median and ulnar artery (figure 3). The brachial artery persisted in the brachial region without the superficial branch and on the proximal forearm was divided by the common interosseous, ulnar and radial artery . The superficial palmar arch was the connection between the ulnar and the radial artery in this case . At the time of embryo development, the deep artery system of the upper limbs originates from the primitive axial artery and superficial brachial artery (muller, senior, rodriguez - baeza a, et al . ). The axillary, brachial and interosseous arteries are the main branches of the primitive axial artery . The brachial and axillary arteries merge with the help of the superficial brachial artery in the proximal region of the arm . Distally, the superficial brachial artery anastomoses with the brachial artery by medial branch of the superficial brachial artery . The derivatives of the forearm artery are median (colligate with the deep branch of the radial artery, the branch of the primitive avail artery) and the ulnar artery, which anastomoses with the terminal trunk of the primitive axial artery (ulnar system). According to singer, because of these anastomoses, there is an increase in the local blood flow and involution of the proximal segment of the superficial brachial artery . In this case it is possible for the ulnar artery to arise directly from the primitive axial artery . This is one of the common morphological and genetic alterations found in the variations of the upper limb blood supply . Changes in the origin or involution of these segments are the cause of morphogenetic alterations found in the anatomy of the arteries of the upper limbs . The position of the high bifurcation of the brachial artery relative to the biepicondylar line of the elbow and the pathway of median nerve are observed very well . Most significant research of detailed arterial variations of the upper limb are articles by adachi, bouchet & cuilleret coleman & anson; according to these authors summative of more than a thousand cases, 18.5% are anatomical variations, 77% being cases with high origin of radial artery, while the ulnar artery was a persisting 12.2% of the variations . Described a case of arterial malformation in an old female cadaver, whereby the radial artery was formed in the axillary artery with a superficial path in an anterior region of the arm, converging deeply at the brachial artery in the cubital fossa . According to pelin et al . The high origin of the radial artery is 14.27% in dissections of cadavers and 9.75% in an angiographic study . In some cases described one case of triple branches of brachial artery on the 4.9 cm, which began at the brachial artery and formed the radial, ulnar and superior collateral ulnar arteries . Another interesting case described the trifurcation of the brachial artery occurring in the proximal third of the forearm and composing the radial, ulnar and common interosseous branches, which passed into the pronator teres muscle . The presence of the superficial brachial artery originating in the axillary artery was observed in 12.2% of 304 korean cadavers . The superficial palmar arch (spa) is the main vascular structure of the palm region and is localized beneath the same name aponeurosis . Coleman ss, anson bj found a 37% chance occurrence of a complete arch, formed entirely by the ulnar artery . They observed more than 650 specimens, while exploring the spa, and found out that the ulnar artery joined a large vessel from the deep palmar arch at the base of the thenar region . The median artery (ma) of the antebrachial forearm region is the most important vessel at the time of embryo development . It maintains the superficial palmar arch (spa), while the radial and ulnar arteries are developing . When the main arteries of this region are fully developed (radial and ulnar arteries), the median artery disappears . In very rare cases, after that the ma may form the spa (claassen h, schmitt o, wree a . Due to its close proximity to the median, the median artery nerve can be involved in several clinical disorders such as carpal tunnel syndrome, anterior interosseous nerve syndrome and pronator syndrome . In view of the described variations, we believe that the knowledge of this unusual blood supply is extremely important, especially for the clinical or surgical practice.
|
Neuroimaging studies have shown that patients with major depression display differences in the function and structure of brain regions involved in emotion identification and reactivity, including the amygdala, hippocampus, striatum, and orbitofrontal cortex, as well as areas involved in emotional regulation, such as dorsolateral prefrontal cortex and anterior cingulate cortex (stuhrmann et al ., 2011). It is unclear, however, whether these differences reflect the clinical state of major depression or neurobiological traits that predispose individuals to be at risk for major depression . Such neurobiological traits are important to identify because they could serve as neural biomarkers of risk for major depression in children and could improve the identification of a subgroup of children at very high risk for major depression that could be targeted for early intervention . One approach to identifying such neurobiological traits is to examine brain function and structure in children who are not themselves depressed but are at familial risk for major depression by virtue of having a parent with a history of major depression, which increases the risk of major depression by three to five fold (williamson et al ., 2004). Here, we compared brain function and structure between children ages 814 with versus without familial risk for major depression . Perhaps the most consistent functional brain difference in acute adult major depression has been hyperactivation of the amygdala to faces with fearful (peluso et al . Zhong et al ., 2011) or sad (fu et al ., 2004 in contrast, depressed adults often exhibit hypoactivation for happy facial expressions in variable regions including anterior cingulate cortex, amygdala, and fusiform gyrus (surguladze et al ., 2005; suslow et al ., 2010; victor et al ., 2010), although hyperactivation has also been reported (gotlib et al ., 2005; keedwell et al ., 2005). Increased activation to emotional faces has also been found in adolescents (roberson - nay et al ., 2006; yang et al ., 2010) and 46 year olds (gaffrey et al ., 2013) with major depression . One approach to distinguishing the clinical state of major depression from predisposing neurobiological traits has been to examine remitted patients who had major depression but who are not currently depressed, but this approach has yielded mixed findings . A number of studies reported that remitted patients (usually treated with antidepressants) do not exhibit amygdala hyperactivation to negative facial expressions (fu et al ., 2004; norbury et al ., 2010;, 2011; victor et al ., 2010), suggesting that amygdala hyperactivation is associated with the state and not the trait of major depression . Other evidence, however, favors the idea that amygdala hyperactivation is associated with trait predisposition to major depression . First, two studies of unmedicated patients with remitted major depression found amygdala hyperactivation to emotional faces that did not differ from patients in acute episodes (neumeister et al ., 2006; victor et al ., 2010). Second, healthy individuals with clinical traits thought to predispose for major depression, such as high neuroticism or pessimistic cognitions, also showed increased amygdala responses to emotional faces (chan et al ., 2009; zhong et al ., 2011). However, the complexity of variable histories of major depression and treatment for major depression may make it difficult to distinguish state versus trait characteristics of major depression in patients with a history of major depression . Several studies have examined children or adolescents with familial risk for major depression but without depression themselves . One study using this approach focused on the amygdala and nucleus accumbens as regions of interest (rois), and found that subjects (1018 years of age) at familial risk for major depression exhibited amygdala hyperactivation to fearful facial expressions and nucleus accumbens hypoactivation to happy facial expressions relative to subjects without familial risk for major depression (monk et al ., 2008). Another study of older adolescents, however, found no differences in amygdala activation between those with or without family history of major depression (although those at risk adolescents had reduced dorsolateral prefrontal cortex responses to emotional faces) (mannie et al ., 2011). In addition to functional abnormalities, volumetric abnormality in amygdala structure (volume) has been found in studies of major depression, although the findings have been inconsistent (frodl et al ., 2003; hastings et al ., 2004 a meta - analysis suggested that these inconsistencies may be attributed to differences in medication status (hamilton et al . Unmedicated patients tend to have smaller amygdala volumes, whereas medicated patients tend to have larger amygdala volumes compared to controls . However, as with functional differences in depressed patients, it remains unclear whether smaller amygdala volume represents a state or trait correlate of major depression . Resolving the contradictory findings in the neuroimaging literature as to whether functional and structural brain findings reflect state or trait neurobiological underpinnings of major depression has important clinical and scientific implications . If they were to be found to represent neurobiological underpinnings of risk for major depression, they may help identify children at very high risk for major depression who may be targeted for prevention or early intervention to avoid developing a serious illness such as major depression . In the present study, we compared neuroimaging findings in children at familial risk for major depression who were offspring of parents with well - characterized major depressive disorder (at - risk group) with age - matched children who were offspring of parents who had no lifetime history of any mood disorder (control group). We performed whole - brain voxel - wise fmri analyses, and focused additional a priori analyses on the amygdala, a limbic area that often had shown differences in neuroimaging studies of major depression . The children, while being scanned, viewed fearful (negative) and happy (positive) facial expressions, and also neutral facial expressions as a baseline . Given the behavioral attention bias towards negative facial expression in at - risk children and bias towards positive facial expression in controls (gibb et al . ; kujawa et al ., 2011), we hypothesized that at - risk children would show greater brain responses to negative - valenced emotional faces, and lesser brain responses to happy faces compared to control children . Thirty - eight offspring ages 814 years of parents with lifetime history of unipolar depression (at - risk group) and 23 age - matched offspring of parents with no lifetime mood disorder (control group) participated in the study . Eligible participants were right - handed, had normal or corrected - to - normal visual acuity, had average or higher iq (iq> 90) and had a working command of the english language . Exclusion criteria included the presence of acute psychosis or suicidality in a parent or a child; the presence at any point in the lifespan of bipolar disorder in the parent, autism in the child, or a lifetime history of a traumatic brain injury or neurological disorder in the child . Children were also excluded if they had conditions incompatible with mri (e.g., metal implants, braces, electronically, magnetically, or mechanically activated devices such as cochlear implants, or claustrophobia). Children were not excluded on the basis of personal history of major depression but could not have current major depressive disorder or dysthymia . Participants were recruited from among participants in longitudinal studies of offspring at risk, conducted in the clinical and research program in pediatric psychopharmacology at the massachusetts general hospital, supplemented with participants responding to advertisements to the community . The sample included 43 children from a study of offspring at risk for major depression and/or adhd or neither disorder (31 at - risk and 12 controls); 3 children from a study of offspring at risk for major depression and/or panic disorder or neither disorder (2 at - risk and 1 control); and 6 control offspring of parents without mood disorders from a study comparing offspring of parents with and without bipolar disorder . Children from each of these studies had been recruited when the children were preschool - age from advertisements to clinical psychiatry departments and to the community calling either for adults who had been treated for depression and who had preschool - age children or for families in which neither parent had been treated for mood disorder (see e.g., rosenbaum et al ., 2000). Both parents in each family had been assessed in the course of these studies using the structured interview for dsm - iv (first et al ., 1995). The sample was supplemented with 5 additional children at - risk, one of whom was a child from a study of siblings of children with bipolar disorder who was found on parental interview to have a parent with unipolar depression, and 4 of whom answered community advertisements for controls but were found to have a parent with major depression . Four additional control children were enrolled based on advertisements to the community calling for children in the age - range 814 whose parents had never been treated for depression . Each of the prior studies from which we recruited had been approved by the institutional review board at the massachusetts general hospital, and the present study was approved by the institutional review boards at the massachusetts general hospital and at the massachusetts institute of technology . Parents provided written informed consent for their and their child's participation, and youths provided written assent . At enrollment for the present study, each child and both parents in each family were assessed for current and lifetime mood disorders (major depression, bipolar disorder, and dysthymia) in the interval since they had last been interviewed (or, for those recruited anew from the community, across their lifetime), using structured clinical interviews in which the mother was the informant . Interviews about parents used the depression, mania, dysthymia modules, and psychosis modules from the structured interview for dsm - iv (first et al ., 1995) and those about the child used the depression, mania, dysthymia, and psychosis modules from the schedule of affective disorders and schizophrenia for school - aged children epidemiological version (ksads - e) for dsm - iv (orvaschel, 1994). To compare cognitive function across groups, we used the kaufman brief intelligence test-2 (kbit-2), a 20-minute screen for verbal and nonverbal cognitive functioning (kaufman and kaufman, 2004). To assess current behavioral and emotional symptoms in the children, we asked mothers to complete the child behavior checklist (cbcl) (achenbach and rescorla, 2001) about their child . The cbcl records, in standardized format, behavioral problems and competencies of children ages 618 years . Normed on a nationally representative sample of 1753 youths, it includes a total problems score, as well as scores reflecting internalizing (affective and anxiety) and externalizing symptoms (attentional problems and disruptive behavior). T - scores of 70 and above have been shown to clearly discriminate clinical - range from non - clinical range children . The cbcl also includes a subscale measuring specific symptoms relevant to major depression, the affective problems scale . In addition, because emotional dysregulation may place children at risk for major depression, we also administered the emotion regulation checklist (erc) (shields and cicchetti, 1998, 1997). This 24-item parent - report measure assesses children's emotional regulation capturing aspects like emotional lability, intensity, valence, flexibility, and appropriateness to situation . In school - age children (through age 12) it yields two factors, lability / negativity (mood swings, reactive anger, emotional intensity and dysregulated positive emotions) and emotion regulation (understanding emotions, equanimity, and empathy). To assess current depressive symptoms by self - report, we administered the child depression inventory (cdi) (kovacs, 1985) to all children . This is a 27-item self - report questionnaire that measures total depression, and five factors: negative mood, interpersonal problems, ineffectiveness, anhedonia, and negative self esteem . Because this was a non - clinical sample including young children, we omitted the item asking about suicidal ideation . Two participants from the at - risk group and 8 participants from the control group were excluded from the functional analysis due to excessive head movement during the functional scan (greater than 3 mm displacement in x, y or z direction). One additional control participant was excluded due to chance - level task performance in the face - match task . Structural analysis included 37 at - risk and 18 control participants after excluding participants with substantial movement during the structural scan that resulted in poor structural image quality . The final sample of 36 at - risk children included for functional analysis consisted of 32 children with no current or prior symptoms for depression (33 of the 37 at - risk children included in the structural analysis had no previous or current depression symptoms), two children with previous history of major depression that had remitted, and two children with current clinical - range cbcl internalizing scores . To determine if our results were driven by participants with past or current symptoms for depression, we performed two additional analyses: 1) we repeated the between - group whole - brain fmri analysis after excluding the two participant with previous depression and the two participants with clinical - level cbcl internalizing scores; and 2) we repeated the between - group whole - brain fmri analysis after including total cbcl scores as a covariate, since the average total cbcl score differed between the at - risk and control groups . Participants viewed a trio of images on the screen and were asked to select one of the two images on the bottom that was identical to the target image (on the top). There were four different types of stimuli: fearful faces, happy faces, neutral faces, and objects . There were 2 runs, with 2 blocks of each type of stimulus per run . Each block consisted of 6 trials, each presented for 3 s. each run lasted 3 min and 18 s (99 tr). Face stimuli were presented via 72 unique actors (36 from each set, half male, half female from each set). Each actor presented a happy, neutral, and fearful expression, for a total of 216 unique face stimuli . All actors were facing directly forward and images were cropped to contain only the actors' heads . Twenty - four unique object stimuli consisting of fruits and vegetables were used in the study . Stimulus sequence was randomized within each block for every run . Left and right responses were counterbalanced across conditions . Data were acquired on a 3 t triotim siemens scanner using a 32-channel head coil . T1-weighted whole - brain anatomical images (mprage sequence, 256 256 voxels, 1 1.3-mm in - plane resolution, 1.3-mm slice thickness) were acquired . Functional mri images were obtained in 3-mm - thick transverse slices, covering the entire brain (interleaved epi sequence, repetition time = 2 s, 3 3 3 mm voxels). Pace tracks the head of the subject and updates the position of the field - of - view and slice alignment during acquisition . The parameters for each time point are updated based on motion correction parameters calculated from the previous two time points . Two dummy scans were included at the start of the sequence . Before the mri scanning session, all participants completed a mock - scanner training session where they practiced lying still in a mock scanner . Participants watched a cartoon movie of their choice in the mock scanner while their head motion was monitored by a motion detector . The movie would be temporarily shut off if their head moved more than 3 mm . Recordings of the actual scanner sounds were played in the mock scanner during the training . Functional imaging data were analyzed using nipype, a python - based data processing framework that incorporates several neuroimaging data analysis packages (gorgolewski et al . Standard functional image preprocessing (realign, smoothing with 6-mm kernel, coregistration to structural) and analysis were done using spm8 (http://www.fil.ion.ucl.ac.uk/spm/). Advanced normalization tools (ants) (avants et al ., 2009) was used for warping functional data into mni space . First - level analysis was performed with a general linear model (glm) with regressors for each of the four trial types (fearful, happy, neutral faces and objects). Additional regressors accounted for head movement (3 translation, 3 rotation parameters) and artifact / outlier scans (see section 2.5.2: head motion and artifact detection). Each outlier scan was represented by a single regressor in the glm, with a 1 for the outlier time point and 0 s elsewhere . Contrast images from the first - level analysis were spatially normalized to a pediatric brain template in mni space (ghosh et al ., 2010) using ants . Normalized contrast images were entered into a group - level analysis in spm8 using a random - effects model . We examined two contrasts of interest: fearful faces> neutral faces and happy faces> neutral faces . All reported clustered survived the threshold of p <.05, corrected using a false discovery rate (fdr) error correction for multiple comparisons implemented in spm8, with a voxel level significance of p <because the two groups differed in cbcl total scores, we repeated the between - group analysis with cbcl total score as a covariate, to test if group differences in brain activations could be accounted for by differences in cbcl scores . To further examine activations in the amygdala under different facial expression conditions, we defined an amygdala roi from bilateral amygdala masks in wfu pickatlas tool (maldjian et al ., 2003). Activations from the amygdala roi were extracted for the fearful face, happy face, neutral face, and object conditions separately for each participant . Participant head motion during the functional scans did not differ between the at - risk group (mean = .27 mm .19) and controls (mean = .30 mm .14; p = .5). We identified problematic time points during the scan using artifact detection tools (art, http://www.nitrc.org/projects/artifact_detect/). Specifically, an image was defined as an outlier (artifact) image if the average intensity deviated more than 3 sd from the mean intensity in the session, or composite head movement (combining translation and rotation) exceeded 1 mm from the previous image . The number of outlier images did not differ between at - risk (mean = 10.2 11.6) and control (mean = 8.9 7.3; p = .7) participants . Anatomical images were processed in freesurfer v5.0 (dale et al ., 1999). Each participant's anatomical image was processed using an automated segmentation and probabilistic region - of - interest (roi) labeling technique (freesurfer, http://surfer.nmr.mgh.harvard.edu). Relative amygdala volume and hippocampal volume were calculated by dividing raw amygdala or hippocampal volume by total cranial volume in each participant . Children in the at - risk and control groups did not differ significantly in age, gender distribution, or iq . The two groups did not differ significantly for total cdi scores or on any cdi subscale (negative mood, interpersonal problems, ineffectiveness, anhedonia, and negative self esteem, ps>.2). Although the at - risk group had significantly higher cbcl total scores compared to the control group, none of the children had clinical - range cbcl total scores . Because total scores differed between groups, we covaried cbcl total scores in further analyses to determine whether they affected the results . Both groups performed near ceiling on the face - match task table 2 . The groups did not differ in reaction times in any of the test conditions (ps>.2), or accuracy for the happy face, neutral face, and objects conditions (ps>.3). Accuracy for the fearful faces was lower in the control than the at - risk group (t(48) = 2.24, p = .03), although accuracy for both groups was above 97% . Compared to the control group, the at - risk group showed increased activation in widespread regions with a right anterior medial temporal lobe cluster including the amygdala, superior temporal gyrus, posterior cingulate cortex and precuneus, middle prefrontal cortex, and superior parietal lobule when processing fearful faces compared to neutral faces (fig . These activation differences between at - risk and control groups remained when the cbcl total score was included as a covariate . When the two at - risk participants with previous history of depression and the two at - risk participants with clinical - range cbcl internalizing scores were excluded, the group difference pattern remains highly similar (table s1). Within - group analysis revealed that the at - risk group exhibited activations in bilateral amygdala, fusiform gyrus, superior temporal gyrus, posterior cingulate gyrus, and middle frontal gyrus when processing fearful faces compared to neutral faces (fig . The control group exhibited activations in the superior temporal gyrus, inferior and middle frontal gyrus (fig . 2b). The total number of active voxels for each group for fearful versus neutral faces is shown in fig . 3 (left 2 bars). Compared to the at - risk group, the control group showed greater activations in anterior cingulate gyrus, superior frontal gyrus and supramarginal gyrus when processing happy faces compared to neutral faces (fig . When the two at - risk participants with previous depression and the two at - risk participants with clinical - range cbcl internalizing scores were excluded, the group difference pattern remains similar with slightly reduced statistically significance (table s2). Within - group analysis revealed that the at - risk group only exhibited activations in a left super temporal gyrus cluster, extending into the amygdala when processing happy faces compared to neutral faces (fig . The control group showed widespread activations in the superior temporal gyrus, supramarginal gyrus, posterior cingulate gyrus, middle frontal gyrus and insula (fig . The total number of active voxels for each group for happy versus neutral faces is shown in fig . Defined anatomically, at - risk children and controls showed opposite pattern of activation levels for fearful faces compared to neutral faces or objects (fig . The control group did not show any difference in activation for fearful faces compared to neutral or happy faces or objects (ps>.4). In contrast, at - risk children showed greater activations for fearful faces compared to neutral faces (t(35) = 2.54, p = .016) and compared to objects (t(35) = 3.07, p = .004). We also examined the relationship between activations in the amygdala cluster from the between group test for fearful> neutral faces contrast and clinical scores . Measures of depressed symptoms (total cdi, total cbcl, cbcl affective problems score, and erc scales) did not correlate with activations from the amygdala (all ps>.2). Similarly, the cbcl anxiety problems score did not correlate with activations from the amygdala cluster (p = .18). Compared to the control group, the at - risk group had a smaller right amygdala volume (adjusted by total brain volume) (t(53) = 3.05, p = .003, fig . 7). The left amygdala volume (adjusted) was marginally lower in the at - risk group compared to control group (p = .06). Hippocampus volumes did not differ between the at - risk and control groups (ps>.6). The group difference in amygdala volume remained after excluding the two at - risk children with previous depression and the two at - risk children with clinical - range cbcl internalizing scores (left: t(48) = 3.15, p = .003; right, t(49) = 2.20, p = .03). We found significantly different patterns of neural responses to fearful and happy faces in unaffected children at familial risk for major depression relative to children without such familial risk . Specifically, the at - risk children exhibited hyperactivation of the amygdala and multiple cortical regions to fearful compared to neutral faces, and hypoactivation in multiple cortical regions to happy compared to neutral faces . The atypical amygdala activations, previously found in adults with major depression, in unaffected at - risk children supports the hypothesis that they may not represent the state of depression but rather represent trait neurobiological underpinnings of risk for major depression in the young, but these group differences extended far beyond the amygdala . While the present findings about altered activations for emotional facial expressions in unaffected children at familial risk for major depression are in noteworthy accord with a prior study (monk et al ., 2008) first, the present study involved younger children (mean age 11 vs. 14) and therefore likely includes more children who will progress to major depression (biederman et al . Second, the prior study found differential amygdala activation only during passive viewing of faces (when attention to the stimuli cannot be validated behaviorally) and not during active tasks . Here, we validated each child's perception and attention to the stimuli through their behavioral accuracy and found the activation differences . Third, the prior study only examined activations in the amygdala and nucleus accumbens as a priori rois, leaving it unknown as to whether any other brain regions, including the entire neocortex, were functionally different in at - risk children . Indeed, we found that both the hyperactivations for fearful faces and hypoactivations for happy faces extended to large neocortical regions which have shown abnormal activations in depressed adult and adolescent patients during emotional face processing, such as anterior cingulate cortex (zhong et al ., 2011), posterior cingulate cortex (fu et al ., 2004), superior frontal gyrus (gotlib et al ., 2005), ventral lateral prefrontal cortex (ba10/47) (keedwell et al ., 2005), and superior / middle temporal gyrus (hall et al ., 2014; our findings provide evidence that abnormalities in these neocortical regions predate the onset of major depression and might reflect neurobiological traits that predispose individuals to major depression . For children at familial risk for major depression, there is a noteworthy convergence between the pattern of (1) attentional biases to faces in behavioral studies and (2) brain activations in response to faces . Behaviorally, at - risk children showed greater attention to negative facial expressions and lesser attention to positive facial expressions relative to control children (gibb et al ., 2009; joormann et al ., 2007; kujawa et al ., neurally, at - risk children also showed greater activation for negative facial expressions and lesser activation for positive facial expressions relative to control children (present study; monk et al ., 2008). It would be expected that greater and lesser psychological attention to facial expressions would reflect, respectively, greater and lesser neural processing of specific emotional facial expressions . A future study may directly relate these behavioral and neural biases in emotion processing . At - risk children in this finding suggests that reduced amygdala volume previously reported in neuroimaging studies of adult major depression (hamilton et al ., 2008) may represent a trait - marker of risk for major depression that predates its onset . This interpretation is consistent with previous findings showing that patients with remitted and current major depression did not differ in amygdala volume (caetano et al ., 2004). Although it is well established that the amygdala is activated by fearful faces in adults (e.g., breiter et al ., 1996; morris et al ., 1996), and appears necessary for adult recognition of fearful facial expressions (adolphs et al ., 1995), the development of specific amygdala activation for fearful faces appears to occur over an extended age range . A specialized response of the amygdala to fearful expressions is not evident through at least age 12 years (pagliaccio et al . At - risk children appear to have an accelerated development of the selective amygdala response to fearful faces . This finding converges with the observation that children who were exposed to early life stress had elevated amygdala activations to fearful faces whereas a control group did not show differential responses for fearful faces and neutral faces (tottenham et al ., 2011). It is unknown whether risk for major depression and elevated early life stress share a mechanism by which there is accelerated development of amygdala specialization for response to fearful facial expressions . That the present finding was not simply accounted for by elevated anxiety in the at - risk children is suggested by the fact that the amygdala activation to fearful faces was not significantly associated with cbcl - measured anxiety problems . A complete interpretation of these functional and structural brain differences in at - risk children will require additional research . First, because a parental history of major depression more than triples the risk for major depression, and because the pattern of brain differences is similar to that seen in adults with major depression (who would exhibit both the state and trait of major depression), these brain differences are presumed to indicate vulnerability to major depression . There is not, however, direct evidence whether the brain differences observed here could also indicate sources of brain resilience by which these at - risk children are avoiding major depression . Only a longitudinal study that follows at - risk children with both behavioral and brain measures can resolve this question . Scientifically and clinically, second, the mechanisms of familial influences on brain function and structure related to major depression are unknown . One possible mechanism is shared intergenerational genetic influences on the development of brain structure and function . A second possibility is the environmental influence of a parent with depression upon the development of a child in the home . Both genetic and environmental influences, as well as their interactions, ought to be reflected in future neuroimaging studies examining brain structure and function . The findings were well aligned with neuroimaging studies of adult major depression and behavioral studies of children at familial risk for major depression . Although levels of current anxiety did not correlate with brain activations in the children, parents were not assessed for anxiety disorders and other disorders that frequently comorbid with major depression, such as adhd (meinzer et al ., 2014; mcintyre et al . Similar to other studies of children with a parent with documented depression (joormann et al . Monk et al ., 2008), such frequent comorbidities were not defined as an exclusion criterion . Conversely, current research approaches, such as the research domain criteria initiative of the nimh (morris and cuthbert, 2012) suggest that such comorbidities are a natural part of psychiatric disorders with possible common neural and genetic underpinnings, rather than impure versions of pure taxonomic diagnoses . Also, because the sample was largely caucasian, findings may not generalize to other ethnic groups . Future studies ought to more fully evaluate the role of comorbid parental disorders of major depression, such as anxiety disorders and adhd, in accounting for these findings and expand the study population to more diverse ethnic groups . Despite these considerations, our findings showing that unaffected at - risk children exhibited patterns of atypical amygdala activations, previously found in adults with major depression, support the hypothesis that they represent trait neurobiological underpinnings of risk for major depression in the young . Further, differences between at - risk children and controls extend to activations associated with both fearful and happy facial expressions, and in many neocortical regions . If confirmed in future studies, this knowledge could promote the development of preventive and early interventions aimed at helping children avoid the development of major depression . Longitudinal follow - up studies of at - risk children could help determine whether these brain differences reported here could improve the identification of children who will actually develop major depression or other major psychiatric disorders.
|
High - throughput biochemical screens, used to identify pharmacologically active small - molecule compounds, are a staple of modern drug discovery . In these screens, hundreds of thousands to even millions of compounds are tested in highly automated assays . Although robotics and miniaturization have led to increased efficiency, traditional high - throughput screens are nevertheless expensive and labor intensive . With a few notable exceptions, the financial and labor requirements of such screens place them beyond the reach of most academic institutions . Consequently, academic researchers, as well as some in industry, are increasingly turning to virtual screens . Virtual screens rely on computer docking programs to position models of potential ligands within target active sites and predict the binding affinity . Precise physics - based computational techniques for binding - energy prediction, such as thermodynamic integration, single - step perturbation,(3) and free energy perturbation,(4) are too time- and calculation - intensive for use in virtual screens . Instead, researchers have developed simpler scoring functions that sacrifice some accuracy in favor of greater speed . Because of these accepted inaccuracies, scoring functions are unable to explicitly identify ligands in silico; rather, they serve only to enrich the pool of candidate ligands with potential hits . The compounds with current scoring functions fall into three general classes. (8) the first class, based on molecular force fields, predicts binding energy by estimating electrostatic and van der waals forces explicitly . Docking programs using force - field - based scoring functions include autodock,(1) dock,(9) glide, icm,(12) and gold (goldscore). (13) a second class of empirical scoring functions include those used by glide and ehits (sfe empirical scoring function), as well as the chemscore(16) and piecewise linear potential (plp)(17) functions . These functions estimate binding energy by calculating the weighted sum of all hydrogen - bond and hydrophobic contacts . A third class of scoring function, called knowledge based, pairs of atom types that are frequently found in close proximity are judged to be energetically favorable . Examples include the astex statistical potential (asp)(18) and the sfs statistical scoring function used by ehits . These approaches to binding - affinity prediction have proven very useful; virtual - screening efforts routinely identify predicted ligands that are subsequently validated experimentally (see, for example, refs (19) and (20)). However, modern scoring functions produce many false - positive and false - negative results . Surprisingly, a human being with the proper training can often analyze a docked structure visually and correctly assess inhibition with greater accuracy. (8) remarkably, the human mind can characterize ligand binding without employing physical or chemical equations and without requiring the explicit calculation of affinity constants . Although any computational model pales in comparison to the complexity of the brain, the mind s ability to categorize proteinligand complexes nevertheless suggests that a neural network, a computer model designed to mimic the microscopic organization of the brain, might be at least as suited to the prediction of proteinligand binding affinities as equation- and statistics - based scoring functions . Herein, we describe a fast and accurate neural - network - based scoring function that can be used to rescore the docked poses of candidate ligands . The function is in some ways knowledge based, as it draws upon protein - structure databases to however, the use of neural networks in this context is largely unprecedented. (21) although useful in its own right, the neural - network approach to affinity prediction is also orthogonal to existing physics - based and statistics - based scoring functions and, so, might prove useful in consensus - scoring projects as well . Neural networks are computer models designed to mimic, albeit inadequately, the microscopic architecture and organization of the brain . In brief, various neurodes, analogous to biological neurons, are joined by the behavior of the network is determined not only by the organization and number of the neurodes, but also by the weights (i.e., strengths) of the connections . The first, called the input layer, receives information about the system the network is to analyze . Additionally, optional hidden layers receive input from the input layer and transmit it to the output layer, allowing for even more complex behavior (figure 1). All neural networks have an input layer, through which information about the system to be analyzed is passed, and an output layer, which encodes the results of the analysis . Optional hidden layers receive input from the input layer and transmit it to the output layer, allowing for even more complex behavior . In designing a neural network to analyze a complex data set, the specific formulas that describe the relationships between data - set characteristics need not be explicitly delineated; rather, the designer need only provide the network with an adequate description of the system so that the network can infer those relationships on its own . In the current context, creating neural networks to characterize the binding affinity of proteinligand complexes does not require that we implement or even understand the specific formulaic relationships that describe van der waals, electrostatic, and hydrogen - bond interactions, though the energies calculated by these formulas can in theory be included in the network input. (21) rather, we must determine what characteristics of a proteinligand complex the network needs to see in order to correctly analyze and characterize the complex on its own . Specific atomatom interactions, including electrostatic, hydrogen - bond, van der waals,, and cation interactions, contribute to the enthalpic component of the binding energy . In contrast, the entropic contribution is determined in part by the number of ligand rotatable bonds and the challenges of disordering and rearranging the ordered hydration shells surrounding the unbound ligand and the apo active site . The entropic penalty related to hydration is difficult to calculate explicitly and is likely a function of many factors, including the hydrophobicity and volume of the ligand, the number of buried but unsatisfied hydrogen - bond donors and acceptors upon binding, and the proteinligand contact surface area . In the current work, we therefore sought to identify the characteristics of proteinligand complexes that might affect these enthalpic and entropic factors . First, the proximity of ligand and protein atoms likely contributes to the binding affinity by affecting enthalpic factors (i.e., electrostatic, van der waals, hydrogen - bond,, and cation interactions), as well as entropic factors (i.e., buried but unsatisfied hydrogen bonds and the size of the proteinligand contact area). In the current context, this proximity information is stored in a proximity list . The distances between the atoms of the ligand and the protein are considered; atoms that are close to each other are subsequently grouped by their corresponding autodock atom types, and the number of each atom - type pair is tallied . Second, electrostatic interactions contribute to the enthalpic component of the binding energy through salt bridges and hydrogen bonds . The electrostatic energy is certainly dependent on proximity, but it is also dependent on partial atomic charges . Consequently, for each of the atom - type pairs in the proximity list described above, a summed electrostatic energy is also calculated from the assigned gasteiger charges . Third, certain ligand characteristics related to the quantity and identity of ligand atom types, such as ligand hydrophobicity and volume, could affect the entropy of binding as well . Consequently, all of the atoms of the ligand are categorized by their corresponding atom types . Finally, the number of rotatable bonds in the ligand is explicitly counted, as ligand flexibility can also have an important impact on entropy . When all of these atom - type pairs, ligand atom types, and other metrics are considered separately, a given proteinligand complex can be characterized across 194 dimensions; thus, we created neural networks with input layers containing 194 neurodes . As output, only two neurodes are needed to distinguish between good and poor binders: (1, 0) indicates that a given proteinligand complex has a dissociation constant kd <25 m, and (0, 1) indicates that a given complex has kd> 25 m . Although somewhat arbitrary, our experience with virtual screening has led us to believe that 25 m is a reasonable cutoff for distinguishing between inhibitors that warrant further study and optimization and poor inhibitors that are best not pursued further . To train candidate neural networks, 4141 proteinligand complexes were downloaded from the protein data bank(22) and characterized across the 194 dimensions described above . These 4141 complexes included 2695 unique, diverse protein structures mapping to over 600 uniprot primary accession numbers . Of these 4141 complexes, 2710 had kd values that had been experimentally measured; 2022 of these were good binders (kd <25 m), and 688 were poor binders (kd 25 m). Recognizing that the poor binders were underrepresented, additional complexes of poorly binding ligands were obtained by docking compounds of the nci diversity set ii into the same protein receptors as used previously . One thousand four hundred thirty - one of these dockings into 571 unique pdb structures had highest - ranked ligand poses with predicted binding energies between 0 and 4 kcal / mol . These were also included in the database of proteinligand complexes as examples of weak binders . Multiple neural networks were trained to study the influence of network architecture and training - set size on accuracy and to judge the robustness of the network output . Ultimately, a network architecture consisting of a single hidden layer of five neurodes was selected . Training sets of 1, 10, 25, 50, 100, 250, 500, 1000, 2000, 3000, and 4000 proteinligand complexes were generated by randomly selecting complexes from among the 4141 complexes previously characterized . Random training sets were generated for each network to ensure that network accuracy was independent of the complexes chosen for inclusion . In all cases, the remaining complexes were used as a validation set to verify that the networks had not been overtrained and to judge training effectiveness . Each individual network has its own unique strengths and weaknesses; to obtain consistent results across multiple proteinligand complexes, it is better to take the average prediction of multiple networks rather than to trust the prediction of any single network . For each training - set size described above, we therefore trained 10 independent neural networks and averaged the corresponding outputs (figure 2). The x axis shows the size of the training set, and the y axis shows the percent accuracy . Each data point represents the average accuracy of 10 independent neural networks with one hidden layer of five neurodes . Are shown the accuracies with which the various networks were able to characterize the binding constants of the proteinligand complexes in their respective training sets . In green are shown the accuracies with which the various networks were able to characterize the binding constants of the complexes in their respective validation sets . In purple is shown the likelihood that a given proteinligand complex has a kd value less than 25 m given that the network predicts high - affinity binding (i.e., the true - positive rate when the respective validation sets were analyzed). In red is shown the likelihood that a given proteinligand complex has a binding affinity greater than 25 m given that the network predicts poor binding (i.e., the true - negative rate when the respective validation sets were analyzed). Figure 2 depicts the accuracy of these neural networks, that is, the frequency with which they accurately characterized the proteinligand complexes of their respective training and validation sets as either having high affinity (kd <25 m) or low affinity (kd> 25 m). Although trained to give a binary response [(1, 0) for strong binding, (0, 1) for weak binding], network output was in fact continuous [(a, b), where a + b = 1.0 because network outputs were normalized]. To evaluate each proteinligand complex if n> 0, the network output was interpreted to predict kd <25 m; otherwise, it predicted kd> 25 m . The accuracy with which the networks were able to characterize the binding constants of the proteinligand complexes in their respective training sets (i.e., those complexes to which the network had already been exposed) is shown in figure 2, in blue . Interestingly, training - set accuracy was good regardless of training - set size . The networks ability to correctly characterize the proteinligand complexes of their respective validation sets, sets comprising complexes that had never been seen before, was far more indicative of true predictive ability . The accuracies of these predictions (figure 2, in green) clearly demonstrate that overtraining had not occurred, as accuracy consistently improved with exposure to larger training sets . After having been exposed to only 1000 examples, the networks were already quite good at characterizing proteinligand complexes; however, additional examples did result in moderate improvements in accuracy . We note also that, for training - set sizes greater than 1000, the standard deviation of the outputs of the 10 networks associated with each training - set size was relatively small, suggesting that network output was largely independent of the training set selected . The single best network of all those tested correctly characterized the proteinligand complexes of its training and validation sets with 94.8% and 87.9% accuracy, respectively . The true - positive rate (figure 2, in purple) indicates the likelihood that a given proteinligand complex has a kd value less than 25 m given that the network predicts high - affinity binding . The true - negative rate (figure 2, in red) indicates the likelihood that a given proteinligand complex has a binding affinity greater than 25 m given that the network predicts poor binding . The true - positive and true - negative rates of these networks are roughly equal regardless of training - set size; these networks are just as good at identifying true inhibitors as they are at identifying poor ones . Having confirmed that the networks were not overtrained and that network output was robust regardless of the composition of the training sets, we next sought to train additional networks to determine whether accuracy could be improved . Ten networks with training sets of 4000 randomly selected complexes were generated in the preliminary studies described above . To determine whether even more accurate networks could be trained, we generated an additional 1000 independent neural networks with similar training sets of 4000 randomly selected proteinligand complexes . In each case, the remaining 141 complexes were again used as a validation set . Three of these 1000 networks emerged as the most accurate (89.4% accuracy on the validation set); 24 had validation - set accuracies greater than 87.5% . Recalling that each network is unique and that consistent results are best obtained when the average prediction of multiple networks is considered, we defined a single score, called an nnscore (n), obtained by averaging the outputs of these 24 networks . To assess how the nnscore (n) varied according to the experimentally measured kd values, we considered the scores of the 2710 characterized proteinligand complexes with known kd values described above . To facilitate visualization, moving averages of both the log10(kd) values and the associated n values were calculated over 100 points and are plotted in figure 3 . It is interesting to note that the data - averaged function crosses the x axis at roughly 25 m [log10(25 10) = 4.60], as expected . So remarkable is this result that one again wonders whether the networks were overtrained; however, as figure 2 demonstrates, these networks were consistently able to predict the binding of ligands to which they had never been exposed, suggesting the development of a genuine inductive bias . Average score (n) over 24 networks as a function of the experimentally measured kd value . To facilitate visualization, the data were ordered by log10(kd) value . Moving averages of both the log10(kd) values and the associated n values this data - averaged function (shown in black) crosses the x axis at 25 m [log10(25 10) = 4.60, shown as a dotted line]. Despite the fact that the networks were trained to answer what is essentially a yes - or - no question, figure 3 demonstrates that they can nevertheless perceive certain shades of gray, that is, they can distinguish not only between good and poor binders, but, to a certain extent, even between good and better binders . Given that n decreases somewhat monotonically as log10(kd) increases, it might therefore be possible to use n as a scoring function . A good scoring function should be able to distinguish between ligands that are well docked and ligands that are poorly docked . To determine whether or not the nnscore could make this distinction, we generated a database of poorly docked ligands separate from the training / testing database described above . Selected ligands from the 4141 previously characterized proteinligand complexes were redocked back into their corresponding receptors using autodock vina. (23) in 287 cases, the predicted binding energy of the worst - docked pose was greater than 4 kcal / mol . These 287 worst - docked poses, together with their associated protein receptors, were included in the poorly docked database . The top three neural networks of the 1000 generated were each used to characterize these 287 poorly docked binding poses . These three networks correctly identified the ligands as poor binders 94.1%, 88.9%, and 95.5% of the time . Thus, despite the fact that these three networks characterized the proteinligand complexes of their respective validation sets with the same accuracy, they were somewhat less consistent when presented with new data . Under most circumstances, it is not possible to know a priori which network is best suited for a given database of proteinligand complexes; a more consistent result can be obtained by considering the average score over multiple networks (n). Indeed, when the average score over the top 24 networks was used to characterize these proteinligand complexes, an accuracy of 94.1% was achieved . Although the networks were successful at identifying poorly docked ligands, the ability to distinguish between true high - affinity binders and poor binders when both are well docked is far more challenging . To test the networks abilities, we docked 103 small - molecule compounds into the active site of influenza n1 neuraminidase (n1, pdb i d: 3b7e)(24) using autodock vina. (23) three of these compounds were known neuraminidase inhibitors: oseltamivir, peramivir, and zanamivir . The remaining 100 ligands were decoys selected at random from the nci diversity set ii . We note that, of the 4141 proteinligand complexes used in the training and validation sets, one consisted of zanamivir bound to n1, and two consisted of oseltamivir bound to n1 . However, no examples of peramivir bound to n1 were present in the protein data bank;(22) the networks had never been exposed to this proteinligand complex . The results of this small virtual screen are shown in table 1 . When the autodock vina scoring function(23) was used to rank the compounds, the known inhibitors ranked 5th, 10th, and 55th . When the docked poses were rescored using each of the top three individual neural networks, the known inhibitors fared substantially better, with the predicted poorest binder ranking 24th, 31st, and 9th, respectively . One of the individual neural networks performed particularly well, ranking the known inhibitors second, eighth, and ninth . However, this network could not have been identified a priori . When the compounds were ranked by the average score over the top 24 networks (n), the known inhibitors performed equally well . Had the top 10 compounds from this virtual screen been subsequently tested experimentally, only the network - based scoring functions would have permitted the identification of all three inhibitors . Five scoring functions compared: autodock vina score, predictions of the top three individual neural networks (nn1, nn2, and nn3, respectively), and average prediction of the top 24 networks (n). Rank of the known inhibitor peramivir . To further validate the predictive potential of these neural networks, we repeated the above virtual - screening protocol using a crystal structure of t. brucei rna editing ligase 1 (tbrel1), a protein that was not included in the 4141 proteinligand complexes used in the training and validation sets . As three positive controls (i.e., known inhibitors), we chose atp, the natural substrate, and compounds v1 and s5, tbrel1 inhibitors recently identified by amaro et al. (19) when the compounds were ranked by the average nnscore score over the top 24 networks (n), two of the three known inhibitors ranked in the top ten, giving an enrichment factor of 6.87 . This enrichment was equal to that obtained when the compounds were ranked by the vina scoring function (table 2). Five scoring functions compared: autodock vina score, predictions of the top three individual neural networks (nn1, nn2, and nn3, respectively), and average prediction of the top 24 networks (n). First, as mentioned above, each of the individual networks has its own unique strengths and weaknesses . For example, the network labeled nn1 was far better at identifying compound v1 than was vina, nn2 was better at identifying atp, and nn3 was better at identifying both atp and v1 (table 2). As we could not have known a priori which network is best suited for this system, it is wise not to trust the results of any single network . When the compounds were ranked by the average output of the top 24 networks, atp and v1 still ranked in the top 10 compounds, but the result was not dependent on a single network output . A second point of interest illustrated by this screen is that, for at least some systems, the networks unique approach to binding - affinity prediction might be orthogonal to more traditional approaches . For example, in this second screen, vina identified s5 as a true binder, but the networks did not; in contrast, the networks tended to be better at identifying v1 and, with the notable exception of nn1, atp . By using the networks in conjunction with vina, perhaps a useful consensus score could be developed . To test this hypothesis, a consensus score for each compound was calculated by averaging the ranks obtained when the vina score and the nnscore score were used . When the compounds were reranked by this consensus score, atp, v1, and s5 ranked first, second, and eighth, respectively . Assuming that the top 10 predicted inhibitors were subsequently tested experimentally, ranking by this consensus score would yield an enrichment factor of 10.3, superior to the enrichment obtained when the compounds were ranked by the vina scoring function or the network outputs alone . We recommend using positive controls (i.e., known inhibitors) to determine whether a single scoring function or a consensus score is best suited to a given virtual - screening project . The research presented here demonstrates that neural networks can be used to successfully characterize the binding affinities of proteinligand complexes . Not only were these networks able to distinguish between well - docked and poorly docked ligands, they were also able to distinguish between true ligands and decoy compounds when both were well docked . A user - friendly scoring function based on these networks has been implemented in python and can be downloaded from http://www.nbcr.net/software/nnscore . Although the networks success with the neuraminidase and tbrel1 systems was promising, predictive accuracy might be system dependent . Regardless, one strength of the neural - network scoring function is that it is largely orthogonal to other kinds of functions based on force fields, linear regression, and statistical analyses . Thus, in many cases, it could be useful to rank by consensus scores that combine neural - network scoring functions with other more traditional functions . To build a database of proteinligand complexes of known binding affinity, we identified x - ray crystal and nmr structures from the protein data bank (pdb)(22) that had kd values listed in the moad(25) and pdbbind - cn databases . Where multiple similar kd values were present in these databases, kd values were averaged to give one value per proteinligand complex . Where multiple differing kd values were present, the corresponding complex was discarded . Additionally, complexes with peptide or dna ligands, ligands with rare atom types (e.g., gold, copper, iron, zinc), receptors with rare ligand - binding atom types (e.g., copper, nickel, cobalt), and complexes with kd values greater than 0.5 m were likewise discarded . Ultimately, 2710 complexes remained . Hydrogen atoms were added to the ligands of these complexes using schrdinger maestro (schrdinger). All protonation states were verified by visual inspection . For those complexes with ligand - binding metal cations, the partial charge of each metal atom the geometries of the hydrogen bonds between the ligand and the receptor were optimized using an in - house script . Autodocktools 1.5.1(28) was used to add hydrogen atoms to the receptors, to merge nonpolar hydrogen atoms with their parent atoms, and to assign atom types and gasteiger charges . Most of the proteinligand interactions listed in the moad and pdbbind - cn databases were high - affinity; of those used in the current study, for example, only about 25% had kd values greater than 25 m . To include adequate examples of weak - binding ligands, 20 randomly selected ligands from the nci diversity set ii, a set of freely available, diverse compounds provided by the developmental therapeutics program (nci / nih), were docked into each of the receptors described above using autodock vina. (23) in all, 1431 ligands with best predicted binding energies between 0 and 4 kcal / mol were identified and included in the database as examples of weak - binding ligands . In addition to the database of crystallographic and well - docked poses described above, we also generated a separate database of poorly docked proteinligand complexes . Some of the ligands of the training / testing database described above were docked back into their corresponding receptors using autodock vina. (23) rather than identifying the ligand pose with the best predicted binding energy, the pose with the worst predicted binding energy was considered . In 287 cases, this worst predicted binding energy was greater than 4 kcal / mol; these 287 proteinligand complexes were included in the poorly docked database . To create a database of compounds docked into influenza neuraminidase, three known neuraminidase inhibitors (oseltamivir, peramivir, and zanamivir) were docked into a neuraminidase crystal structure obtained from the pdb (pdb i d: 3b7e). (24) additionally, 100 compounds were randomly selected from the nci diversity set ii to serve as decoys . All 103 compounds were docked into the neuraminidase active site using autodock vina. (23) a database of compounds docked into tbrel1 was similarly generated . Three known ligands (atp, v1, and s5(19)) were docked into a tbrel1 crystal structure (pdb i d: 1xdn). (29) as before, 100 compounds were randomly selected from the nci diversity set ii to serve as decoys . All proteinligand complexes were characterized in four ways . Pairs of ligand and protein atoms within 2 of each other were first identified . These proteinligand atom pairs were then characterized according to the autodock atom types of their two constituents, and the number of each of these close - contact atom - type pairs was tallied in a list . Fourteen proteinligand atom - type pairs were permitted: (a, hd), (c, hd), (c, oa), (c, sa), (fe, hd), (hd, hd), (hd, mg), (hd, n), (hd, na), (hd, oa), (hd, zn), (mg, oa), (na, zn), and (oa, zn). A similar list of close - contact atom - type pairs was tallied for all proteinligand atom pairs within 4 of each other . Eighty - three atom - type pairs were permitted: (a, a), (a, br), (a, c), (a, cl), (a, f), (a, fe), (a, hd), (a, i), (a, n), (a, na), (a, oa), (a, p), (a, s), (a, sa), (a, zn), (br, c), (br, hd), (br, n), (br, oa), (c, c), (c, cl), (c, f), (c, fe), (c, hd), (c, i), (cl, hd), (cl, n), (cl, oa), (cl, sa), (c, mg), (c, mn), (c, n), (c, na), (c, oa), (c, p), (c, s), (c, sa), (c, zn), (fe, hd), (fe, n), (fe, oa), (f, hd), (f, n), (f, oa), (f, sa), (hd, hd), (hd, i), (hd, mg), (hd, mn), (hd, n), (hd, na), (hd, oa), (hd, p), (hd, s), (hd, sa), (hd, zn), (i, n), (i, oa), (mg, na), (mg, oa), (mg, p), (mn, n), (mn, oa), (mn, p), (na, oa), (na, sa), (na, zn), (n, n), (n, na), (n, oa), (n, p), (n, s), (n, sa), (n, zn), (oa, oa), (oa, p), (oa, s), (oa, sa), (oa, zn), (p, zn), (sa, sa), (sa, zn), and (s, zn). Second, the electrostatic - interaction energy between protein and ligand atoms within 4 of each other was calculated and summed for each of the atom - type pairs described above: where qr is the partial charge of receptor atom r, ql is the partial charge of ligand atom l, and d is the distance between the two . The same atom - type pairs permitted for close - contact proteinligand atoms within 4 of each other were again used . Third, a list of ligand atom types was likewise tallied, and the number of atoms of each type was counted . Thirteen ligand atom types were permitted: a, br, c, cl, f, hd, i, n, na, oa, p, s, and sa . Finally, the number of ligand rotatable bonds was likewise counted . In all, each proteinligand complex was thus characterized across 194 (14 + 83 + 83 + 13 + 1) dimensions . All neural networks were feed - forward networks created using ffnet(30) with 194 inputs and 2 outputs . All nodes in the hidden and output layers had log - sigmoid activation functions of the form where t is the input sum of the respective node . Network inputs and outputs were normalized with a linear mapping to the range (0.15, 0.85) so that each variable was given equal initial importance independent of its scale . There were no direct connections between the input and output layers; all nodes of the hidden layer were connected to all nodes of the input layer, and all nodes of the output layer were connected to all nodes of the hidden layer . The networks were trained to return (1, 0) for proteinligand complexes with experimentally measured kd values less than 25 m, and (0, 1) for complexes with kd values greater than 25 m . To train each network, the weights of the connections between neurodes were first randomly assigned; these weights were subsequently optimized by applying 10000 steps of a constrained truncated newton algorithm(31) as implemented in scipy. (32) training sets of varying sizes were employed . In all cases, training sets consisted of proteinligand complexes picked at random from the 4141 complexes of the training / testing database described above . The remaining complexes constituted the validation set, used to judge the network s predictive accuracy . Abbreviations: ef, enrichment factor; nci, national cancer institute; nih, national institutes of health; pdb, protein data bank.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.