Split (1)

train · 133k rows

text stringlengths 0 868k
Chronic suppurative otitis media (csom) is an inflammatory disease of the middle ear and mastoid air cell system, which can result in irreversible changes not only in the middle ear structures but also in the inner ear.1) dysfunction of the eustachian tube and the bacterial infection are important factors in the multifactorial pathogenesis of csom . In order to eradicate inflammation, prevent recurrence and restore middle ear structures and hearing, both medical and surgical treatment modalities are important in csom . It has been emphasized that selection of appropriate antibiotics should be based on the bacteriologic studies to identify the pathogens and determine sensitivities.2,3) recent bacteriologic studies of the middle ear discharge in csom in korea have reported increasing prevalence of methicillin - resistant staphylococcus aureus (mrsa).2,4,5) in addition, staphylococcus aureus (s. aureus) and pseudomonas species were most predominant from the postoperative otorrhea cultures.3) higher rates of postoperative otorrhea and reperforation after tympanomastoid surgeries were reported in csom patients with mrsa cultured from preoperative ear discharge.6) in addition to intrinsic mrsa infection of the mastoid air cell system, nasal colonization of mrsa may pose increased risk of postoperative infection . Nasal colonization rate of mrsa and it is a known predictor of postoperative surgical site infection.7,8) previous studies have identified bacterial pathogens from the middle ear and the mastoid air cells, or nasopharynx as a bacterial reservoir in csom.4,5,9 - 12) however, few studies have focused on the effect of nasal mrsa colonization in the otologic surgery . The aims of this study are to examine the prevalence of nasal mrsa colonization in patients undergoing otologic surgeries and to determine the association between mrsa colonization and the pathogens identified from perioperative culture studies . The study included 66 consecutive patients (25 males and 41 females) undergoing tympanomastoid surgeries from may 2010 to december 2011 at the yonsei university college of medicine gangnam severance hospital . Patients with intracranial or extratemporal complications of csom, known history of external radiation, known history of corticosteroid therapy preoperatively, or those undergoing emergency operations were excluded . The mean age at operation was 51.715.7 years (range 34 - 74 years), and the right ear was operated in 34 ears, the left in 32 ears . Upon the initial visit in the outpatient department, the external auditory canal was cleaned, and the middle ear discharge was collected with collected with cotton swabs through sterile otoscopes, taking care not to touch the external auditory canal skin . To assess nasal colonization of s. aureus, the nasal samples were obtained by cotton swab from the anterior vestibular of the nares by the physician . During the operation, intraoperative culture specimens were taken in cases with overt discharge in the middle ear cavity . During postoperative period of 1 month, postoperative culture specimens were again taken in cases with otorrhea through the external auditory canal . All culture samples were in stuart transport medium and transported to the laboratory, where the samples were inoculated onto blood agar, macconkey's agar, and chocolate agar plates . All plates were incubated at 37-c aerobically under 5% (v / v) co2 and examined 24 and 48 hours later . Susceptibility testing was performed using disk diffusion . Identified pathogen species and antimicrobial susceptibility were compared between nasal swab and perioperative (preoperative, intraoperative and postoperative otorrhea) cultures . Statistical analysis was performed with fisher's exact testusing spss statistical software (version 15.0; spss inc ., among the 67 patients undergoing operation for csom, nasal swab confirmed bacterial colonization in 37 (55.2%) patients (table 1). Clinically importantly, nasal cavity colonization of s. aureus was noted in 10/67 (14.9%) of patients, and 4/67 (6.0%) patients were positive for mrsa . Also, methicillin - sensitive staphylococcus aureus (mssa) was identified in 9/37 (23.4%) and methicillin - resistant coagulase - negative staphylococcus (mrcns) in 11/67 (13.4%) of patients . Preoperative ear culture studies identified pathogens in 39/67 (58.2%) of the patients: the most commonly identified species was staphylococcus [mrcns 26.9%, methicillin - sensitive coagulase - negative staphylococcus (mscns) 1.5%, mrsa 13.4% and mssa 11.9%]. Mrsa was found in 3/40 (4.5%) ears, mssa in 2 ears (3.0%), mrcns in 2 ears (3.0%) and mscns in 1 ear (1.5%). After the surgery, 11 of the 67 patients developed otorrhea within 1 month postoperatively . The postoperative culture studies identified mrsa in 3/11 (27.3%) and acinetobacter species in 1/11 (9.1%) and fungus in 2/11 (18.1%) patients (table 2). Preoperative ear culture results and nasal swab culture results showed significant difference (p=0.001), as well as intraoperative middle ear cultures and postoperative otorrhea culture results showed significant difference (p=0.023). However, no significant difference was noted between preoperative ear and postoperative otorrhea culture results (p=0.493). Then we compared the culture results according to the presence of bacterial growth and reports of no growth (fig . No significant difference was noted between preoperative ear culture, and nasal swab culture results (p=0.055), between preoperative ear and postoperative otorrhea culture results (p=0.068), or nasal swab and postoperative otorrhea culture results (p=0.094). Lastly, the culture results were compared according to the presence of antibiotic resistance (fig . No significant difference was noted between the antibiotic - susceptible and resistant strains identified between preoperative ear culture and nasal swab cultures (p=0.098), or between preoperative ear and postoperative otorrhea cultures (p=0.053). Then we analyzed the correlation of isolated organisms from the nasal swab and other cultures in patients with nasal colonization of antibiotic - resistant strains (fig . 4). Among 4 patients with identified with nasal mrsa colonization, preoperative ear cultures were also positive for mrsa in 3 patients (75.0%). However, intraoperative culture identified mrsa in only one patient, and none of the patients developed mrsa infection postoperatively . Preoperative ear cultures reported mrsa in 1, mrcns in 1, and mscns in 7, ciprobay - resistant pseudomonas in 1, and no growth in 2 patients . Increasing incidence of antibiotic - resistant bacterial strains in csom patients poses a challenge to not only the selection of appropriate antibiotics therapy, but also to prevent the emergence of resistance to glycopeptides, the main drugs chosen for mrsa . It has been reported that patients who are colonized with s. aureus are the main source of s. aureus in hospitals, and that nasal carriage of mrsa increases the risk of postoperative infection . Since the rate of methicillin resistance is higher in korean csom patients compared to other countries, we examined the rate of nasal mrsa colonization . The rate of nasal carriage of mrsa in csom patients was higher than among healthy individuals reported as 0.2 - 2.8% of the united states population.7) although this study was limited to small number of patients, the finding may suggest that in addition to nosocomial infection, community - acquired mrsa infection may contribute partially to the relatively higher rate of mrsa in csom patients in korea . On the other hand, the rates of bacterial isolation from preoperative ear discharge, intraoperative middle ear discharge, or postoperative otorrhea cultures in our patients were lower . Also, the perioperative culture studies frequently reported no growth of pathogens . Given that the patients were prescribed with antibiotics prior to surgery, it may signify that current antibiotics are effective in infection control during the tympanomastoid surgery . Furthermore, the interpretation of the culture results from postoperative otorrhea is limited since antibiotics were routinely used postoperatively in all patients and culture samples were taken from the external auditory canal in cases with overt otorrhea or from wet surface of the grafted tympanic membrane immediately after removal of the packing material at 2 weeks postoperatively . The culture results can only reflect that mrsa infection that could not be controlled by routine antibiotics, which may be clinically significant . Mrsa has been identified not only in csom patients,2,3,5,13) but also in patients with external otitis.14) s. aureus has been implicated in biofilm formation complicating cochlear implants.15 - 17) nasal mrsa colonization deserves attention since transmission from nasal carriage to surgical site infections or bacteremia is possible, and it is associated with increased morbidity and mortality . Previous studies have reported that elimination of nasal mrsa colonization reduces the risk of postoperative infections.8,18,19) application of 2% mupirocin calcium ointment to the nares has been proven to be effective, and chlorhexidine - based solutions is used to reduce the density of skin colonization of mrsa preoperatively.18 - 20) a recent study compared the rates of mrsa infection in otolaryngology surgeries, before and after implementation of preoperative screening and treatment of nasal mrsa carriage.21) further studies are warranted to investigate the possible benefit of preoperative treatment of mrsa colonized patients undergoing middle ear surgeries . The rate of nasal mrsa colonization among patients with csom was higher than among the general community . Further studies are warranted to investigate the possible benefit of preoperative treatment of mrsa colonized patients undergoing middle ear surgeries.
Although fatigue has been increasingly recognized over the past two decades as one of the most frequent and most debilitating symptoms in patients with ms, there are still no insights into its neurobiological mechanisms, and current treatment options are highly frustrating [14]. In clinical practice, ms patients complaining about fatigue are usually first scrutinized for additional and potentially treatable comorbidities, such as depression, pain, anemia, or sleep - wake disturbances . If there is no such cause of fatigue, the patient is considered to suffer from ms - related fatigue, that is, a disease - inherent symptom related to the underlying neuroimmunological and neurodegenerative processes, and off - label symptomatic treatment with stimulants of the central nervous system may be recommended . Recently, the need to search for sleep - wake disorders in ms patients has been reemphasized, as several groups observed a significant correlation with fatigue [610]. Specifically, sleep - disordered breathing (sdb) has been proposed as a potential risk factor for fatigue in ms . In the last year, a cross - sectional study in 48 ms patients suggested a predisposition for sdb, and two studies found that severe fatigue in ms was significantly associated with sdb and respiratory - related arousals [9, 12]. Conducted the first controlled, nonrandomized clinical treatment study and reported a significant improvement of fatigue following treatment of sdb and other sleep disorders . Very recently, veauthier et al . Were able to identify treatment of sleep disorders in ms patients as independent predictor of fatigue reduction . Taken together, there is increasing amount of data suggesting that sdb should be routinely screened for in all ms patients with severe fatigue . We therefore prospectively assessed the presence and severity of fatigue in consecutive, unselected ms patients seen in a tertiary center and suggested overnight respirography to ms patients with severe fatigue . Patients with sdb were offered cpap therapy . The main purpose was to elucidate whether routine respirography can be recommended as a screening method in ms patients with severe fatigue and whether long - term cpap therapy leads to a clinically meaningful improvement of fatigue . In addition, we aimed at examining potential predictive factors of sdb in ms patients with fatigue . This prospective study was conducted at the neurological department of the kamillus - klinik in asbach, germany, from october 2010 until march 2011 . The study protocol has been reviewed and approved by the local institutional review boards, and all patients gave written informed consent before inclusion . During the above - mentioned period, we prospectively evaluated 258 consecutive patients with multiple sclerosis (ms). The diagnosis of ms was definite in each patient and was made according to standard criteria . The majority of patients suffered from secondary progressive ms (87%) (spms), and 13% had a relapsing remitting (rrms) form . We measured fatigue severity with the fatigue severity scale (fss), a self - administered questionnaire with nine items which has been validated for various neurological disorders including ms [16, 17]. A final score greater than 4.0 is widely accepted to indicate the presence of fatigue . For the purpose of our study the rationale for including only patients with severe fatigue is given by the observation that beneficial treatment effects of cpap therapy are usually most pronounced in patients with high levels of fatigue . We used the epworth sleepiness scale (ess) to assess sleepiness, with scores 10 indicating excessive daytime sleepiness (eds) [19, 20]. We estimated the severity of disease disability using the kurtzke expanded disability status scale (edss). Overnight (from 10 p.m. to 6 a.m.) respirography was performed using a portable device (easyscreen 4.0, respironixs, germany), which measured nasal airflow, pulse rate, arterial oxygen saturation (finger pulse oximetry), and thoracic and abdominal movements . Apnea was defined by a cessation of nasal airflow 10 seconds and hypopnea by a reduction of nasal airflow by 50% or 30%, when associated with an oxygen desaturation 4% . Apnea - hypopnea index (ahi) was defined by the mean number of apneas and hypopneas per hour . Sdb was classified as mild (ahi 515/h), moderate (ahi 1530/h), and severe (ahi 30/h). Apneas were differentiated in obstructive, mixed, and central apneas according to standard criteria . Apneas were obstructive if accompanied with continuous respiratory effort, central if unaccompanied by evidence of respiratory effort, and mixed if a central apnea developed respiratory effort with evidence of obstruction later in the apneic interval . A diagnosis of central sleep apnea was made in patients, in whom> 50% of all respiratory events were central . The optimal therapeutic pressure was determined to eliminate snoring, apneic events with arousals, and oxyhemoglobin desaturations in all body positions and sleep stages . Patients received conventional cpap therapy (remstar m series, philips respironics or somnocomfort2, weinmann). Reevaluation of fss and ess scores was scheduled after a 6-month period of cpap therapy, although significant short - term relief of both fatigue and sleepiness can be expected already after 36 weeks of cpap therapy . Continuous data were expressed as means and standard deviation (sd) and categorical variables as numbers and percentage . All analyses were performed with the statistical package for the social sciences (spss, version 17.0). For univariate analysis we used student's t - test (for numerical scale variables) and -test (for nominal scale variables). To identify predictors of sdb severity, we performed stepwise multiple linear regression analysis for multivariate analysis, with ahi as dependent variable and the following independent variables: age, sex, disease duration, disease subtype, edss, bmi, fss, and ess scores . The majority were female (70%); mean age was 49.8 9.2 years (range: 2175 years). Most patients were severely affected by the disease, as reflected by a mean edss of 5.8 1.4 (range: 1.08.5) and mean disease duration of 13.7 8.8 years (range: 133 years). The patient group that declined respirography (n = 28) showed similar demographic and clinical characteristics (data not shown). Overnight respirography revealed a mean ahi of 9.3 16.9/h and a mean odi of 10.5 14.7% . Sdb was found in 28 ms patients (41%) and was mild in 18 patients (26%), moderate in 3 patients (4%), and severe in 7 patients (10%). Ms patients with sdb were significantly older (p = 0.01) and tended to be more often male (p = 0.06). Likewise, ahi correlated with age (rho = 0.33, p = 0.006) but not with edss, disease duration, or bmi . The overall prevalence of excessive daytime sleepiness in our patient group was high (51%). The presence of excessive daytime sleepiness, however, was similar between patients with and without sdb (61% versus 44%, p = 0.13). Even when comparing patients with moderate - severe sdb and those without sdb, we did not detect any differences in the prevalence of sdb (70% versus 44%, p = 0.30). Similarly, there was no correlation between ess scores and ahi (r = 0.05, p = 0.66). The gender ratio (f: m) was 3.6: 1 in patients without sdb, but the male proportion significantly increased with more severe sdb (p = 0.005): the ratio was 2.6: 1 in mild sdb, 0.5: 1 in moderate sdb, and 0.4: 1 in severe sdb . Bmi was similar in both male and female patients (25.3 3.8 versus 26.3 5.2, p = 0.12), but ahi was significantly higher in male patients (18.5 24.7 versus 5.2 9.9, p <0.001). Multiple regression analysis confirmed that male sex was an independent associate of sdb severity (p = 0.003). Otherwise, the clinical characteristics were similar in both sex groups (table 2). We recommended cpap therapy to all patients with an ahi 10/h (n = 14). The remaining 6 patients (2 with rrms, 4 with spms) revealed a cpap daily average adherence of 5 hours per night during the 6-month treatment . In these patients, 3.6/h (p = 0.02), and the minimal sao2 improved from 71.5 11.7% to 88.2 1.9% (p = 0.02). Edss remained stable (6.3 1.3 versus 6.3 1.2). At followup after 6 months, cpap therapy was associated with a significant decrease of fss scores (5.8 0.5 versus 4.8 0.6, p = 0.04), whereas ess scores did not change (9.8 3.5 versus 9.5 3.0, p = 0.61) (figure 2). However, despite the significant reduction of fatigue severity during cpap therapy, fss scores remained pathologic (4.0) in all treated patients . Considering the increasing interest in sdb as a potential risk factor for fatigue in ms, the primary goal of this prospective investigation so far the largest respirography study on sdb in ms was to understand whether routine overnight respirography should be done in all ms patients with severe fatigue . We found a sdb frequency of 41% among ms patients with severe fatigue and demonstrated that cpap therapy was associated with a significant improvement of fatigue severity, while sleepiness remained unchanged . Furthermore, only male sex could be identified as an sindependent predictor of sdb in ms patients with severe fatigue . Taken together, these findings indicate that routine respirography should be considered in this specific patient group, but future work is needed to confirm our results and establish the exact benefit of sdb treatment also in terms of quality of life . Although the observed sdb frequency was rather high, our study was not designed to estimate the prevalence of sdb in ms or to compare its prevalence between ms patients with and without fatigue, as we did not perform respirography in ms patients with fss scores <5.0 and did not include a control group . Moreover, comparison to other studies is hampered by disparities of included patient cohorts, methodological and technical differences, and heterogeneous definitions of sdb . In this line, two recent studies on sdb and fatigue in ms differed with regard to the applied polysomnographic scoring criteria: one group used the rechtschaffen and kales criteria and the other study scored according to the 1999 american academy of sleep medicine task force [9, 12, 24]. The two methods use different placement of eeg electrodes, which may affect the scoring of respiratory arousals . Thus, several reasons may account for the large discrepancy of reported prevalence of sdb in ms patients with or without fatigue . For instance, two earlier studies did not find any cases with sdb, as defined by an ahi 5/h, among 37 and 10 ms patients, respectively, although the majority of these patients suffered from fatigue [25, 26]. On the other hand, kaminska et al . Performed polysomnography in 37 ms patients with severe fatigue, as defined by the same criteria as in our study, and found severe sdb (ahi> 30/h) in 32%, relative to 8% among 25 ms patients without severe fatigue . Using another fatigue questionnaire, veauthier et al . Reported a sdb prevalence of 27% and 2.5% in 26 ms patients with fatigue and 40 ms patients without fatigue, respectively . Finally, braley et al . Reported a mean ahi of 17.0 18.8/h in 48 ms patients, a much higher number than in our study . Overall, these studies illustrate our uncertainty regarding prevalence and severity of sdb in ms and its relationship to fatigue . Six ms patients with sdb and severe fatigue showed significant reduction of fatigue severity after 6 months of cpap therapy: fss scores decreased from 5.8 0.5 to 4.8 0.6 . In other words, long - term cpap therapy resulted in a 17% fatigue reduction . Our results are in line with the recent study of ct et al . Who treated 17 ms patients with sdb and fatigue, reporting a decrease of fss scores from 5.0 1.7 to 4.3 1.7, corresponding to a 13% amelioration . In addition, the reduction of mean fss scores in both studies was> 0.6, which has been suggested by putzki et al . Clinical significant improvement . On the other hand, however, the final fss score was still above 4.0, which is a widely accepted cut - off for fatigue . Considering the high burden of ms - related fatigue, any alleviation would certainly be desirable, even if only marginal . However, by now we do not really know to what extent the observed reductions of the fss score represent a benefit to affected patients, especially in terms of quality of life . . Failed to detect any improvement of quality of life after cpap therapy, as examined by the physical and mental component summary scale of the short form (36) health survey (sf-36). The number of studies on health - related quality of life in ms patients is very large, and fatigue has been identified as an independent predictor [2830]. Thus, the lack of improvement in quality of life challenges the significance of cpap therapy in ms - related fatigue . A possible explanation could be that the level of depression, which is an ever stronger predictor of quality of life in ms, did not improve during cpap therapy, thereby obscuring a potential benefit [2830]. Second, and closely related to the first point, a possible placebo effect cannot be ruled out . As evidenced by a recent randomized, double - blind controlled trial, the placebo effect of sham cpap therapy may be quite considerable: ess scores decreased in the placebo group from 15.2 4.0 to 11.9 5.9 (p = 0.001), corresponding to an effect size of 0.82, but results of the osler test did not change . Furthermore, the placebo group showed also a significant improvement of several items of the sf-36 . Other groups confirmed this substantial placebo effect of cpap therapy on sleepiness and quality of life . A few groups studied fatigue response to cpap therapy in sdb patients without underlying neurological disease, generating similar results [3335]. While most groups uniformly reported a significant improvement of fatigue during cpap therapy, the findings from 2 double - blind, randomized controlled trials observed significant reductions of fatigue scores also during placebo cpap therapy [34, 35]. Recently, tomfohr et al . Confirmed that long - term cpap therapy leads to a benefit on fatigue beyond placebo effects . In summary, these studies clearly illustrate the importance of a randomized, placebo controlled trial in order to demonstrate that the observed improvement of fatigue in ms after cpap therapy is more than a mere placebo effect . An intriguing finding of our study is the lack of correlation between sleepiness and sdb . Other groups made similar observations in ms patients, regarding both subjective and objective measures of sleepiness [12, 36]. In general, sleepiness is regarded as the main daytime consequence of sdb, caused by repeated apnea - induced arousals, sleep fragmentation, and reduced slow - wave sleep, and a marked reduction of sleepiness has been demonstrated following cpap therapy . The high prevalence of sleepiness in our cohort and its persistence under cpap therapy suggest that sdb is not the main etiology of sleepiness in ms patients with fatigue . The prevalence of most sleep - wake disturbances in ms has been shown to be increased in ms compared to the general population and may thus account for the observed high prevalence of sleepiness . On the other hand, sleepiness and fatigue in ms generally regarded as two distinct symptoms may share a common pathophysiology . The observation that the correlation between fss and ess scores in ms is much stronger than in subjects with various sleep disorders is also supportive of this hypothesis [38, 39]. Finally, our study demonstrates that sleepiness, bmi, and disease severity are not useful predictors of sdb in ms patients with severe fatigue . Conversely, male and elder ms patients are more likely to present moderate - severe sdb . This illustrates that the presence of sdb among ms patients with severe fatigue may clinically not appear as obvious as it is in subjects with first of all, the number of treated patients was small, making general conclusions difficult . Second, we did not assess possible confounders, such as mood disorders, and did not measure the effects of cpap therapy on quality of life . Furthermore, the additional presence of other sleep - wake disturbances has not been assessed . The prevalence of most sleep disorders is increased in ms patients, and effective improvement of fatigue in ms patients may require tailored therapies of more than only one sleep disorder [13, 14]. In particular, a recent meta - analysis indicated that restless - legs syndrome is frequent in ms, with reported prevalence of 1258%, and restless - legs syndrome appears to be associated with fatigue in ms . Finally, future studies should prefer polysomnography instead of respirography, as the latter does not allow detecting apnea - induced eeg arousals, and they might use additional fatigue scales such as the modified fatigue impact scale (mfis), which has been shown to assess cognitive and psychosocial functioning more accurately than the fss . Nevertheless, we believe that our study provides an additional piece of clinical experience to the current discussion on the role of sdb in ms patients with fatigue . In conclusion, our study confirms that sdb and fatigue are associated features in ms and that sdb treatment leads to a small yet statistically significant reduction of fatigue . However, well - designed studies are needed to substantiate the clinical relevance of this association, by proving that fatigue reduction following cpap therapy has a meaningful impact on quality of life that goes beyond a mere placebo effect.
In february 2013, a novel avian influenza a (h7n9)virus emerged in eastern of china and quickly spread to other areas. Up to may 2, 128 human infections have been confirmed, with 26 deaths . Transmission may occur through direct or close contact or through exposure to environments that are contaminated with infected poultry . Even though no human - to - human transmission has been reported, it raises serious concerns for public health . Influenza a viruses, belonging to the family orthomyxoviridae and possessing 8 negative - sense rna segments encoding 11 known proteins, are divided into subtypes, based on the nature of their surface glycoproteins, hemagglutinin (ha) and neuraminidase (na). Currently, 16 ha and 9 na subtypes have been identified in wild water birds, the natural host for all influenza a viruses and the reservoir from which viruses emerge to infect domestic poultry and occasionally mammals . Only some of these subtypes have been identified in humans, specifically the h1n1, h2n2, and h3n2 viruses, corresponding to the three major pandemics of the last century . Influenza a viruses are known to also infect a variety of other mammals, including pigs, horses, mink, felids, and so on . Influenza a viruses infecting poultry can be divided into two distinct groups on the basis of their ability to cause disease in chickens . The very virulent viruses cause highly pathogenic avian influenza [hpai], in which mortality may be as high as 100% . These viruses have been restricted to subtypes h5 and h7 (e.g. H5n1and h7n7), although not all viruses of these subtypes cause hpai . All other viruses cause a much milder, primarily respiratory disease designated low pathogenicity avian influenza [lpai]. Due to its rapid spread and high mortality, hpai is classified as a list a disease by the world organization for animal health (oie) and type a disease by the chinese ministry of agriculture, respectively . In recent years, several avian influenza outbreaks caused by the h7 subtypes in poultry were reported in such countries as the usa, north korea, south korea, bulgaria, japan, denmark, germany, and the netherlands. In march and april 1997, there were outbreaks of h5n1 avian influenza in hong kong, . Due to host restriction, avian influenza a viruses are generally difficult to cross the species barrier and are not efficiently transmitted among humans . According to the current literature available, most of human infections with avian influenza h7 is the most common pathogen of human infection, and human infections with avian h7 subtype virus (e.g., h7n2, h7n3, and h7n7) have been reported occasionally in north america and europe in recent years . The first reported case of direct transmission of a sub - type h7 virus from an avian to a human host occurred in 1996, when conjunctivitis developed in a woman who kept pet ducks 1 day after she experienced a possible eye abrasion while cleaning her duck house, . An outbreak of subtype h7 infections in humans occurred in the spring of 2003, when an hpai (h7n7) virus was detected in commercial poultry farms in the netherlands and necessitated the culling of> 30 million birds, . Eighty - six persons involved in the culling operation and 3 of their family members who had not been in contact with infected poultry had virologically confirmed subtype h7 illness, which suggests that limited human - to - human transmission of the avian virus also had occurred . Most recently, multiple h7 viruses have resulted in human infections in the united kingdom . In 2006, an lpai virus (h7n3) was isolated from a poultry worker with conjunctivitis . In 2007, h7n9 virus discovered in february 2013 in china is a novel avian influenza a virus, which has not been detected in humans or animals previously and is prevalent and causing an emerging fatal infectious disease in several provinces in china now . This human h7n9 virus is the product of reassortment of viruses that are of avian origin only, with the ha genes and na genes from h7 and n9 subtypes, respectively, and 6 internal genes from the h9n2 subtype . To date, a total of 128 laboratory - confirmed cases of human infection with avian influenza a(h7n9) virus including 26 deaths have been reported to the who, which are distributed in 39 cities of 10 provinces, such as zhejiang, shanghai, and jiangsu . In these reported cases, males were nearly two times more than females, and most of them were above 50 years of age . In jiangsu province, the onset of illness of the first confirmed case was on march 19, 2013 . Sporadic cases occurred in succession and 27 confirmed cases including 4 deaths had been accumulatively reported till may 2, 2013, just slightly lower than those reported for zhejiang province (46 cases, including 6 deaths) and shanghai city (33 cases, including 13 deaths). The cases were concentrated in the southern regions of jiangsu province, 11 in the city of nanjing, 6 in suzhou and 4 in wuxi . In addition, changzhou, zhenjiang, yangzhou, xuzhou, suqian and yancheng had 1 case, respectively . The average age of the infected cases in jiangsu was 54.0 years, and the youngest and the oldest were 21 and 85 years old, respectively . There were 19 males and 8 females, and the male to female ratio was 2.38:1 . Only five of these contacts developed fever, cough or sore throat, but were at last excluded from h7n9 infection by laboratory tests . The cases were concentrated in the southern regions of jiangsu province, 11 in the city of nanjing, 6 in suzhou and 4 in wuxi . In addition, changzhou, zhenjiang, yangzhou, xuzhou, suqian and yancheng had 1 case, respectively . The average age of the infected cases in jiangsu was 54.0 years, and the youngest and the oldest were 21 and 85 years old, respectively . There were 19 males and 8 females, and the male to female ratio was 2.38:1 . Only five of these contacts developed fever, cough or sore throat, but were at last excluded from h7n9 infection by laboratory tests . According to the latest research results, the prevalence of human infection with the avian influenza a (h7n9) virus has the following characteristics: base on the information available, so far it is still inferred that the source of human infection with avian influenza a (h7n9) was originated from poultry . It means that the most important source of human infection would be exposure to environment contaminated by infected poultry or directly touching the infected poultry . In addition, trading of freshly slaughtered poultry in the wet markets in cities may be a confirmed risk factor to human infection . Analysis of population distribution and medical history of the human cases indicated that human infection with h7n9 subtype virus mainly occurred in older people, or people with chronic diseases or who were immunocompromised . Clinical studies suggested that most of the infected human cases presented acute onset and progressive deterioration . So far, there is no evidence of sustained human - to - human transmission . However, two confirmed cases have been associated with possible family cluster . At present, there is no evidence that the international animal trade or population flow would provoke a pandemic risk . However, due to the limited knowledge about the source of infection and the animal reservoirs, specific control and prevention measures cannot be taken . Therefore, it is foreseeable that the affected area would be further expanded in the recent future . In summary, it is impossible that a pandemic or outbreak of human infection with avian influenza a (h7n9) virus will happen in jiangsu province in the near future . The cases of human infection with avian influenza a (h7n9) virus should be timely detected, diagnosed and given proper treatment through the following prevention and control measures: strengthen the routine surveillance of influenza like illness (ili) and severe acute respiratory infection (sari), and screening cases of human infection with avian influenza a(h7n9) virus (especially clusters of such cases) throughout the province . Take full advantage of the china infectious disease automated alert and response system (cidars) which will immediately send a warning message as soon as a confirmed case or a surveillance case of human infection with avian influenza a (h7n9) virus was reported through the internet to the database of the infectious disease direct reporting system . Once receiving such a message, the district cdc staff must carry out on - site verification within 2 hours . Workers of all the medical institutions should enhance their sense of responsibility in the diagnosis and treatment of suspected cases of human infection with avian influenza a (h7n9) virus . Develop an integrated control and prevention system based on the coordination between different ministries, departments and agencies: the most important task is to treat patients and track close contacts to carry out medical observation conscientiously . Hospitals with admitted patients should pay attention to self - protection of health workers and disinfection of the environment and isolation of cases or suspected cases so as to prevent the occurrence of nosocomial infections . The management of live and slaughtered poultry trade in wet markets should be enhanced and sick or dead birds or animals should be disposed properly . Carry out a wide range of health education activities about human infection with avian influenza a (h7n9) virus via the media, such as the internet, newspapers, and television, which may make the public understand this emerging disease correctly, reduce unnecessary worries about it, and most important of all, improve self - awareness of infection prevention . Clinical researches and epidemical studies are urgently needed to understand this novel virus and the emerging disease caused by it: identify the source of human infections and the animal reservoirs of this novel virus . Ascertain the mode of infection and the risk of human to human transmission . Actively study the specific preventive vaccine and efficient drugs or therapies for this novel disease.
Investigating factors that influence the stability of the secondary structure of peptides and proteins, such as confinement, competitive solvation in a heterogeneous environment, and peptide functional group modifications, is important to our understanding of why proteins misfold and aggregate . Reverse micelles (rms) are a convenient environment in which to encapsulate and probe biological molecules . The water cores of rms are similar to cavities found in biological systems, such as water molecules near the water membrane interface of a cell . Because the size of rms is determined by the water to surfactant ratio (water loading, w0 = [h2o]/[surfactant]), rms represent a environment for the study of the effects of limited hydration and confinement on protein folding, aggregation, and function . A significant effort has been made to explore the properties of rms using computer simulation, beginning with the influential work of ladanyi and coworkers . That work provided the foundation for subsequent studies of rms employing all - atom and coarse - grained models . Subsequent studies explored the nature of water dynamics in rm environments, where it has been shown that water rotational relaxation is dramatically slowed relative to water in the bulk . The seminal experimental work of mukherjee et al . Explored the structure of capped alanine - rich peptides akan (ace - ygakaaaa-(kaaaa)ng - nh2) in aot rms (using nonpolar solvent isooctane = 2,2,4-methylpentane) and in bulk water . Sodium bis(2-ethylhexyl) sulfosuccinate (aot) is a widely used anionic surfactant that forms monodisperse rms in nonpolar solvents . Using cd and ir spectroscopy, they observed that upon encapsulating the peptides in rms of low w0 the helical content increased significantly as compared with that measured in bulk water or a buffer . Tian and garcia performed molecular dynamics simulations of self - assembling rms and encapsulated zwitterionic aka4 peptides . They observed nonspherical shape fluctuations of the rms and also found that the peptides preferred to reside at the water abel and coworkers obtained similar results for previous simulations of zwitterionic octa - alanine peptides in rms . Martinez and coworkers performed simulations on capped aka2 peptide in bulk water and in rms of w0 = 6 that were both spherically restrained and unrestrained . For reference rms of w0 = 6, the results indicated that the peptides were more helical in rms than in bulk water . Additionally, the shape of unrestrained rms fluctuated significantly from an initial spherical geometry, facilitating interaction between the dehydrated peptide and the aot aliphatic tails that appears to be important in stabilizing the peptide s partial helical character . These results are in agreement with experiments as well as previous computational studies . It is known that the treatment of n- and c - termini with neutral caps can influence the peptide structure . However, while experimental studies of alanine - rich peptides in rms were performed with capped peptides, simulations studies by abel and coworkers and tian and garcia have employed zwitterionic termini, and those by martinez and coworkers have employed capped termini . The experimental observables in the original studies of mukherjee et al . Were cd and ir spectra . However, no simulation studies have computed spectra to be directly compared with experiment . This study explores the effects of capped versus zwitterionic n- and c - termini on the helix stability of these same peptides in rms using two force fields . We performed simulations of the aka2 peptide in two forms, capped (ace - ygakaaaa-(kaaaa)2g - nh2) and zwitterionic (nh3 + -ygakaaaa-(kaaaa)2g - coo), in spherically restrained and unrestrained rms of w0 = 6 . The results demonstrate that capped aka2 peptides form more stable helices than zwitterionic aka2 peptides . The ir spectra of the amide i bond of the peptides were computed and directly compared with experiment . The computed peptide amide i ir spectra and water rotational anisotropy decay were found to be largely insensitive to the treatment of the peptide termini, while showing a distinct dependence on shape fluctuations in the rm environment . Overall, our results provide insight into the nature of peptide confinement and hydration in a rm environment and the importance of considering shape fluctuations in characterizing the rm ensemble . The rms each contained a peptide monomer, and the starting structure for the peptides was an -helix . Table 1 contains a summary of the simulation details for all systems, including the number of all molecules (surfactant, ions, water, and solvent) used and simulation times . The composition of the rms was determined from the saxs experiments of amararene et al . This composition differs from that suggested by the experiments of eicke and rehak . In a separate study, we have explored the structure and dynamics of alternative interpretations of the water loading for comparison . Rm systems were generated using the charmm32 package with the charmm27 all - atom force field for proteins and lipids and the tip3p water model for charmm . Charmm parameters for aot and isooctane were taken from the work of abel et al . To construct the rms the helical structure generated for the peptide was solvated with a sphere of water, and random water molecules were replaced with 76 sodium cations (one for each aot molecule to be added) and three chlorine anions (one for each lys) to create a neutral system . A spherical aot shell was added to the rm and was centered in a truncated octahedron of isooctane . For the spherically restrained rms, a massless dummy atom was fixed in the center of the rm, and a harmonic restraint was placed on the sulfur atom of each aot molecule to keep it within 11.25 and 15.25 of the dummy atom . The distance restraints were chosen to agree with experimental measurements of the solution density . The cutoff for the short - range electrostatics calculations was set to be 12, and particle - mesh ewald was used to treat the long - range electrostatics . The temperature was held constant at 300 k, and the pressure was held constant at 1 atm using the langevin piston . Each trajectory was run for 50 ns using a 1 fs time step and saving data every 0.1 ps . The same systems were also run using gromacs and the gromos96 53a6 united atom force field . The electrostatics were treated as in the charmm simulations . The temperature was held constant at 300 k, and the pressure was held constant at 1 atm using the berendsen piston . Each trajectory was run for 50 ns using a 2 fs time step and saving data every 0.1 ps . Analysis of all systems was performed using charmm, gromacs, mdanalysis, and vmd . Consistent with experimental observations by halle and theoretical considerations by chandler, recent results from simulation and experiment suggest that unrestrained rms showed significant shape fluctuation . Figure 1 shows representative structures taken from unrestrained charmm simulations after 50 ns of simulation time . The water and aot molecules are found to pucker around the peptide, allowing for significant interaction of the aot tail groups and at times the isooctane with the nonpolar surface of the peptide . These observations of nonspherical rm shape fluctuations and contacts between the peptide and the environment were also observed by tian and garcia in their simulations of similar systems . To characterize these structural fluctuations, we calculated the average elliptical radii and the radius of gyration for each rm system . The results (not shown) indicate an elliptical geometry for the unrestrained rms that are consistent with the results of previous experimental and simulations studies . Helical peptides form dipoles with a partial positive charge at the n - terminus and a partial negative charge at the c - terminus . Capping the termini eliminates the charge repulsion present when the terminal residues are charged and tends to stabilize the helix . Figure 2 shows the secondary structure progression with respect to time for the residues of each of the aka2 peptides in rms for the charmm trajectories . The structure of the capped aka2 peptides changes very little during the simulation with the peptides remaining almost entirely -helical . The structure of the terminal residues of the zwitterionic aka2 peptides shows significant fluctuations, especially in the case of the unrestrained rms, suggesting that the zwitterionic termini contribute to the destabilization of the helical secondary structure . Similar results were found for the gromacs trajectories (data shown in supporting information). The secondary structure definitions used are those of kabsch and sander s dssp method . Charmm unrestrained reverse micelles with capped (left) aka2 and zwitterionic (right) aka2 peptides . The components of the rm are colored as follows: aot tail groups, white surface; sulfonate head groups, yellow and red; sodium ions, dark green; water molecules, blue; peptide, bright green . Secondary structure progression with respect to time of aka2 peptides in unrestrained (top) and spherically restrained (bottom) reverse micelles for the charmm systems: capped aka2 (left) and zwitterionic aka2 (right). The secondary structure is indicated as helix (blue), turn (yellow), and coil (white). Another way to evaluate secondary structure stability is the root - mean - square deviation (rmsd) with respect to time . Figure 3 presents a histogram of the observed peptide rmsd, demonstrating that the two capped aka2 peptides have a more stable backbone structure and undergo smaller fluctuations compared with the zwitterionic peptides . Comparison of the dssp and rmsd plots suggests that fluctuations in rmsd for the capped aka2 peptide, in the unrestrained rm, in particular, result from the changes in the secondary structure in the terminal residues . Significant interaction of the aka2 peptides with the surrounding environment of the rm is observed in all systems studied . In the unrestrained rms, however, in addition to the interaction between the peptides and water molecules, there is significant contact between the peptides and the surfactant molecules, especially the aliphatic aot tail groups . Distribution of the peptide backbone rmsd for the last 30 ns of simulation for the aka2 peptides in rms for the charmm systems . Data are shown for capped / zwitterionic peptides in restrained (blue / yellow) and unrestrained (pink / green) rms . Fluctuations of the capped peptides are substantially smaller than for the zwitterionic peptides . Figure 4 shows the average number of aot tail groups and water molecules within 4 of each residue of the aka2 peptides in rms for the charmm systems . The core residues of the peptides in the restrained rms are significantly more hydrated than the residues of the peptides in the unrestrained rms, which are in contact with more aot tail groups . Average number of aot tail groups (top) and water molecules (bottom) within 4 of each aka2 residue in the charmm rms . Data are shown for capped / zwitterionic peptides in restrained (blue / yellow) and unrestrained (pink / green) rms . Figures 5 and 6 show the number of aot tail groups and water molecules within 4 of each of the aka2 peptides . The distributions show good agreement between peptides in the same environment (restrained or unrestrained rm) regardless of nature of the n and c termini . The distribution of the hydration values of the two peptides in the restrained rms is almost identical . Peptides in the unrestrained rms have more contact with the tail groups than peptides in the restrained rms . Data are shown for capped / zwitterionic peptides in restrained (blue / yellow) and unrestrained (pink / green) rms . Data are shown for capped / zwitterionic peptides in restrained (blue / yellow) and unrestrained (pink / green) rms . The level of hydration of the peptides is similar in each environment with peptides in the restrained rms being more hydrated than peptides in the unrestrained rms . Figure 7 shows snapshots of charmm aka2 in restrained and unrestrained rms with the surrounding water and aot tails after 50 ns of simulation . The peptide in the restrained rm is almost completely hydrated, while the peptide in the unrestrained rm is in contact with aot aliphatic tails . Tian and garcia noted similar behavior in their simulations of aka4 peptides in rms . They observed significant contact between the nonpolar peptide core and the aot / water interface as well as some contact with isooctane molecules . Water molecules bound to the interface and may increase the entropy of the system . The lysine residues, in particular, were either well - hydrated or in contact with the aot head groups . Similar results were obtained for systems modeled using the gromos force field with the exception that, in general, the aka2 peptides in the rms are less hydrated than those for the charmm systems . Capped aka2 in a restrained (left) and unrestrained (right) rm . The snapshot on the left shows the peptide in pink, and the snapshot on the right shows the peptide in green . Each peptide is shown with the surrounding water molecules in blue and aot tails groups in gray . Infrared spectra for the amide i modes of capped and zwitterionic aka2 peptides encapsulated in rm were calculated and compared with experimental data measured for capped aka2 peptides in rms of w0 = 6 at room temperature . Simulated spectra were computed using a vibrational exciton model, in which the fundamental frequencies (ffs) and couplings are expressed as a function of electric field and van der waals forces on the atoms of the peptide bonds . In that recently developed approach, the ff for a particular amide i mode is derived from a map parametrized as1 in terms of the components of the electric field, ei, and van der waals force, fi, at atom i (which includes the o, c, n, and h atoms of the peptide bond), where 0 is a static frequency (which may be taken to be the gas phase value) and ci and di are fitting coefficients as a function of the sum over parameters . All forces were computed using the full interaction between peptide bonds and the surrounding environment, the same forces that inform the molecular dynamics . The proposed maps successfully reproduced experimental data for a set of proteins with a wide range of sizes and secondary structures as well as model peptides in polar and nonpolar solvents . This broad range of applicability is essential for any method that aspires to compute accurate amide i vibrational spectra for peptides in the heterogeneous rm environment such as a rm, that includes polar, nonpolar, and charged domains . The carbonyl stretch makes the primary contribution to the amide i vibration, with minor contributions from the c -helices typically display a peak at 1655 cm, which shifts to lower frequency with increasing helix length . Several other factors, including hydrogen bonding and solvation, contribute to the peak location . Typically, hydrogen bonding lowers the frequency of bond stretching, and solvated helices may have peaks up to 20 cm lower than nonsolvated helices . Calculated ir spectra for capped and zwitterionic aka2 peptides in restrained and unrestrained reverse micelles, with w0 = 6 at room temperature, compared with experiment . In our simulations, we observed that systems with more helical structures were associated with red - shifted spectra . We further observed that capped systems exhibited red - shifted spectra when compared with zwitterionic systems . The most helical peptide, capped aka2 in a restrained rm, was associated with a main peak at 1637 cm, while the peptide with the least helical content, zwitterionic aka2 in an unrestrained rm, produced a major peak with the highest frequency at 1646 cm . In fact, in our simulated spectra the positions of the main peak for all systems, with the exception of capped aka2 in a restrained rm, were nearly identical . Additionally, the two peptides in the restrained rms were observed to be more hydrated than those in the unrestrained rms . As a result, the amide i spectra were found to be broader and peaked at lower frequencies, 1637 cm for the capped aka2 and 1645 cm for the zwitterionic aka2 . Other features present in our calculations include additional small peaks, both red- and blue - shifted with respect to the main peaks . To explain the origin of these peaks, we examined the ffs of each peptide bond and included contributions from peptide, water, counterions, and aot surfactant molecules . Figure 9 shows histograms of ff for each peptide bond, sums of the ffs, and the calculated spectra . Our analysis demonstrates that the small peak at 1610 cm for the capped aka2 in a restrained rm can be associated with the 18th peptide bond, resulting from strong interactions with counterions . Similarly, the appearance of a small peak at 1613 cm for zwitterionic aka2 in an unrestrained rm resulted from strong interactions of the fourth peptide bond with counterions . For the same system, the peak at 1663 cm is associated with large couplings of the 13th peptide bond with the nearest peptide bonds . Histograms of the environmentally induced ff shift contributions provide additional insight into the role of the environment in inducing spectral heterogeneity . Comparison of histograms of ffs of each peptide bond (low lying histograms), sum of ffs (green lines), and the calculated spectrum (orange lines) for each studied system . Red - shifted ffs are shown as thin lines, and blue - shifted ffs are shown as dotted lines . The orientational dynamics of water confined in rms has been shown to be qualitatively different than the dynamics of bulk water . However, in an rm environment there are clear signs of stretched exponential and power - law decay resulting from the heterogeneous environment of water molecules under nanoscale confinement, as observed in other nanoconfined water systems . Less is known about the how the presence of peptide in a rm influences the water dynamics, through direct interactions with the peptide, disruption of the water nanopool, and impact on the water h bond can be described through the autocorrelation function2where p2 is the second legendre polynomial and u(t) is the unit vector along the o h bond at time, t. figure 10 shows c2(t) reorientational correlation functions for water in six distinct rm environments, including restrained and unrestrained rms with capped aka2 peptide, aka2 peptide in a zwitterionic form, and rms without peptide . Data for rms in the absence of peptide show faster relaxation than either peptide system . It is likely that this is due to the fact that the water rotational anisotropy decays faster for bulk water, and there is the largest percentage of bulk - like water in the rm with no peptide . Table 2 contains parameters for fits of the rotational anisotropy decay to a piecewise continuous function formed from a short - time stretched exponential decay and long - time power - law decay . These parameters provide further evidence that the rotational anisotropy decay of water is slowed by the presence of peptide . Rotational anisotropy decay autocorrelation functions for restrained and unrestrained rms with capped aka2 peptide, aka2 peptide in a zwitterionic form, and rms without peptide . For rms encapsulating aka2 peptide, water in the restrained rm systems shows slightly faster relaxation than water in the unrestrained rm up to 30 ps . This may be due to the fact that the aka2 peptides are more hydrated in the restrained rm system than in the unrestrained rm . Peptides in the unrestrained rm are found to be in contact with only half the number of water molecules compared with water in the restrained rm simulations . In the unrestrained rm, there is a corresponding increase in the contact between the peptide and aot tail groups . However, this observed difference in the rotational anisotropy decay may not be statistically significant . At longer times, the difference in dynamics for these systems is on the order of the noise . For the aka2 peptide solvated in aot rms, no significant difference is observed in the rotational anisotropy decay of water interacting with the capped or zwitterionic peptides . This is consistent with the observation that the treatment of the n- and c - termini of the aka2 peptide does not dramatically impact interactions of the peptides with the water or surfactant environment . We have studied the effects of capped versus zwitterionic termini on the secondary structure of aka2 peptides encapsulated in spherically restrained and unrestrained rms . Our results using two force fields demonstrate that capped aka2 peptides form more stable helices than zwitterionic aka2 peptides . We found that the cap employed on the peptide termini did not significantly alter the interactions between the peptides and their environment . Calculation of the ir spectra of aka2 peptides in the charmm systems also suggests that our results are in agreement with the work of mukherjee et al ., with all four systems exhibiting a major peak in the amide i vibrational spectra within a few wavenumbers of the experimental peak . The observed rotational anisotropy decay shows distinct differences in water dynamics induced by the presence of the aka2 . This difference may be detectable in experiment, providing a means of assessing the differing dynamics of water directly involved in peptide solvation . Overall, our results provide support for the presence of significant fluctuations in the rm structure away from an ideal spherical geometry as well as the importance of surfactant surface fluctuations in facilitating hydrophobic and hydrophilic interactions . The existence and potential significance of such shape fluctuations away from an idealized spherical geometry continue to be debated, with computational predictions forming a consensus view that is only dependent on force field and interpretations of water loading in terms of absolute numbers of water and surfactant molecules in a characteristic rm . Ultimately, these questions must be resolved by experimental studies that directly assess rm structure and allow for direct, critical comparison of observables with the predictions of simulation studies . Our simulation results demonstrate the amide i vibrational spectral lineshapes as well as the rotational anisotropy decay of water are sensitive to differences in restrained spherical rms and rms undergoing significant nonspherical fluctuations . As such, measurement of these experimental observables provides one way to critically assess the structure of rms, in both the absence and presence of solvated peptide.
Once believed to be rare, trichotillomania is now thought to affect as much as 4% of the population . Usually beginning in early childhood or adolescence, most patients with trichotillomania do not seek treatment until 17 years of age . Patients with trichotillomania often hide their hair - pulling behavior, and the disorder is often suspected by typical dermatological findings, such as alopecia . Eating the part of hair pulled out is a common practice and trichorhizophagia is a new term to denote the habit of eating the root of hairs pulled out, associated with trichotillomania . Here we report a case of trichotillomania with trichorhizophagia in schizophrenia and discussed the various treatment options . A 58-year - old, married, hindu, unemployed male, a confirmed case of schizophrenia of 30 years duration with no family or past history of psychiatric illness, no history of any medical or surgical illnesses, presented in our opd with pulling hair and eating the hair root for the last 5 years . Prior to the consultation in our hospital, he was on irregular treatment with haloperidol . He used to pluck hair from the scalp and eyebrows and developed patches of hair loss in these areas . Usually he plucks one or two hairs at a time and plays with hair for some time or rubs the root of the hair along the lips and then discards it . At times he bites the hair and swallows the bitten part containing the root of hair discarding the rest . The patient admitted hair - pulling behavior and reported a kind of pleasure in doing this activity . He has not attempted to resist this habit and it was not a concern for him . There were patches of alopecia on the scalp and right eyebrows with no local inflammation, itching, or pain . He was started on olanzapine and the doze was titrated to a maximum dose of 20 mg per day over a period of 1 month . He showed significant improvement of schizophrenic symptoms except hair pulling behavior . Since behavior therapy was not possible at this stage as the patient was not cooperative, escitalopram 10 mg was added to the previous regime for controlling the hair pulling behavior . After 3 months of combined therapy he almost completely stopped the hair pulling behavior, subsequent biting, and eating hair roots without any exacerbation of psychotic symptoms . There was regrowth of scalp hair as well . Till date, the patient is maintaining improvement and is attending our opd with regular follow up . Trichotillomania is considered to be a rare disorder encountered in clinical practice . Although trichotillomania was reported to occur with many psychiatric disorders, the exact prevalence rate was not reported . Other comorbid conditions reported include dissociative experiences, dementia, parkinson's disease, partial seizures, and prader- willi syndrome . Possible hypothesized causes include a biological basis, as well as hair pulling in response to life stresses . Some of the ssris especially escitalopram, fluoxetine, and fluvoxamine are found to be effective . Recently, there was a report of resistant trichotillomania treated with risperidone augmented with fluoxamine . The index case had compulsive plucking of hair and eating the hair root for the last 5 years, which was not part of any delusions or hallucinations . Although olanzapine has shown efficacy as monotherapy against psychosis, addition of escitalopram only produced marked improvement in compulsive behavior . This case points to the efficacy of combination of olanzapine and escitalopram particularly in patents showing psychotic symptoms along with trichotillomania . Moreover, in patients with hair pulling behavior, it is prudent to inquire about trichophagy because it can lead on to rare but potentially life - threatening condition called trichobezoar.
The ap-2 family of transcription factors (ensembl family ensf00000001105) consists in humans and mice of five members, ap-2, ap-2, ap-2, ap-2 and ap-2; frogs and fish have some of these proteins, and homologs are also known in invertebrates . The chromosomal locations and accession numbers of the family all mammalian ap-2 proteins except ap-2 are encoded by seven exons and share a characteristic domain structure (reviewed in; for ap-2 see and for ap-2 see). Orthologs show a similarity between 60 and 99% at the amino - acid level, whereas paralogs show a similarity between 56 and 78% . Analysis of the phylogenetic tree (figure 1) reveals that the vertebrate ap-2 proteins are grouped together and are divided into five groups . The single xenopus ap-2 is most closely related to mammalian ap-2 proteins . As the genes ap-2 and ap-2 are found on the same chromosome in chickens, rodents and humans (table 1), it is likely that they are the result of an internal duplication . According to the phylogenetic tree, ap-2 genes appear to have separated from the rest of the family early in the vertebrate clade and to have evolved separately (figure 1). A blast search of the puffer fish fugu rubripes fourth genome assembly database suggests that there are orthologs of ap-2, ap-2, ap-2 and ap-2 but not ap-2 genes in bony fish, although only orthologs of ap-2 and ap-2 have been found in zebrafish . In the genome of the protochordate ciona intestinalis a single ap-2 gene has been predicted; the phylogenetic tree shows that the protein evolved before the split of the ap-2, ap-2, ap-2 and ap-2 proteins, with the highest sequence similarity with the ap-2 group, suggesting that ap-2 might be most similar to the ancestor of ap-2 proteins . This hypothesis is further supported by the conserved epithelial expression patterns of murine ap-2, xenopus ap-2 and the amphioxus and lamprey ap-2 genes . As expected, the two caenorhabditis elegans and the single drosophila melanogaster ap-2 proteins show the weakest phylogenetic relationship with vertebrate and protochordate ap-2 transcription factors; they form an outgroup to the other ap-2 family members (figure 1). Given that no ap-2 gene has been identified in yeast, the family probably originated late in evolution and expanded considerably in the vertebrates . All ap-2 proteins share a highly conserved helix - span - helix dimerization motif at the carboxyl terminus, followed by a central basic region and a less conserved domain rich in proline and glutamine at the amino terminus (figure 2). The proteins are able to form hetero- as well as homodimers . The helix - span - helix motif together with the basic region mediates dna binding, and the proline- and glutamine - rich region is responsible for transactivation . Ap-2 has been shown to bind to the palindromic consensus sequence 5'-gccn3ggc-3', found in various cellular and viral enhancers (reviewed in); a binding - site selection assay in vitro also revealed the additional binding motifs 5'-gccn3ggc-3', 5'-gccn4ggc-3' and 5'-gccn3/4ggg-3' . Other binding sites differing from these sequence motifs, for example, the sv40 enhancer element 5'-ccccaggc-3', indicate that ap-2 proteins may bind to a range of g / c - rich elements with variable affinities . Target genes with ap-2-binding sites in their promoter sequences are involved in biological processes such as cell growth and differentiation and include, for example, those encoding insulin - like growth factor binding protein 5 (igf - bp5) with the binding site 5'-gccaggggc-3', prothymosin- (5'-gccggtgggc-3') and the estrogen receptor (5'-gcctgcgggg-3'). Most ap-2 proteins have a py motif (xppxy) and other highly conserved critical residues in the transactivation domain; by contrast, the py motif is missing in ap-2 but the amino- and carboxy - terminal ends of the core sequence of the transactivation domain are still conserved . In addition, the binding affinity of ap-2 to conserved ap-2-binding sites is much lower than that of other ap-2 proteins . This suggests that ap-2 might transactivate genes in vivo by a different mechanism from that used by other ap-2 proteins, probably through interactions with a novel group of coactivators and through a different affinity for ap-2-binding sites . Alternatively, ap-2 might act as a negative regulator, inhibiting or modulating the transactivation capability or dna - binding affinity of the other ap-2 family members . Ap-2 transcription factors are localized predominantly in the nucleus, where they bind to target sequences and regulate transcription of target genes . Ap-2 proteins have also been shown to interfere with other signal transduction pathways; for example, it has been proposed that they modulate the pathway downstream of the developmental signaling molecule wnt by associating with the adenomatous polyposis coli (apc) tumor suppressor protein in the nucleus . The activity of ap-2 proteins can be controlled at multiple levels: their transactivation potential, their dna binding, their subcellular localization [17 - 19] and their degradation can all be modified . Mechanisms of regulation include post - translational modifications, such as protein kinase a - mediated phosphorylation, sumoylation and redox regulation, as well as physical interaction with various proteins (see table 3 for a comprehensive list). Interacting proteins either modulate the activity of ap-2 proteins or are influenced in their function by binding to ap-2 proteins . The tissue distribution and developmental functions of ap-2 transcription factors have been studied extensively in several species . Drosophila ap-2 (dap-2) is expressed in the maxillary segment and neural structures during embryogenesis, and in the central nervous system (cns) and the leg, antennal and labial imaginal disks during larval development . Mutation of the dap-2 gene leads to defects in proboscis development and leg - joint formation . The multiple overlapping and diverging expression patterns of ap-2 family proteins suggest that, following the expansion of the family during vertebrate evolution, redundant and non - redundant functions of the individual ap-2 family members evolved . Although the single ap-2 protein in the cephalochordate amphioxus is expressed mainly in non - neuronal ectoderm, in the lamprey, a primitive vertebrate, ap-2 has co - opted a second expression domain, the neural crest . The single ap-2 homolog described so far in xenopus is expressed in the epidermis and neural crest and has been shown to be critical for the development of these structures [7,31 - 33]. In zebrafish, the two ap-2 family members, tfap2a and tfap2b, are coexpressed in the neural tube, the ectoderm and the pronephric ducts of the developing kidney, but only tfap2a is expressed in neural crest cells . Positional cloning revealed that the zebrafish point mutants named mont blanc and lockjaw encode tfap2a; the mutant animals display impaired development of neural - crest derivatives, such as the facial skeleton, the peripheral nervous system and pigment cells . It is also interesting to note that ap-2 proteins are expressed in the primitive ectoderm of both invertebrates and vertebrates, suggesting an evolutionarily conserved role for the family in the formation of this tissue . In mice, three of the five ap-2 family members (ap-2, ap-2 and ap-2) are coexpressed in neural - crest cells, the peripheral nervous system, facial and limb mesenchyme, various epithelia of the developing embryo and the extraembryonic trophectoderm [2,39 - 41]. Ap-2 expression is restricted mainly to the developing heart, cns and retina, whereas ap-2 expression is detected in cells of the olfactory bulb . Despite the overlapping expression patterns of ap-2, ap-2 and ap-2, disruption of these ap-2 genes reveals non - redundant roles during development . Mutation of ap-2 predominantly affects the cranial neural crest and the limb mesenchyme, leading to disturbances of facial and limb development in a manner reminiscent of the defects described in dap2 mutant flies . Ap-2 and ap-2, on the other hand, are essential for kidney development or placentation of the embryo, respectively . In humans, mutations generating a dominant negative allele of ap-2 have been shown to be the cause of char syndrome (online mendelian inheritance in man (omim) i d 169100); the hallmarks of this syndrome are patent ductus arteriosus (abnormal persistence of a normal fetal heart structure after birth) with facial dysmorphism and abnormal fifth digits . Comparing all mutant phenotypes, it can be seen that loss of ap-2 transcription factor activity generally impairs proliferation and induces premature differentiation and/or apoptosis in various cell types during development . This conclusion is further substantiated by results from a screen for ap-2 target genes and supported by gain - of - function studies in xenopus and mice . As uncontrolled proliferation leads to malignancies, ap-2 transcription factors are not only implicated in normal development, but also seem to be involved in cellular neoplasia, and enhanced ap-2 levels have been reported in various types of cancer [19,54 - 60]. In a murine breast - cancer model, tumor progression thus, ap-2 proteins can be viewed as gatekeepers controlling the balance between proliferation and differentiation during embryogenesis . The lethal phenotypes of the ap-2 mutants generated so far have precluded an analysis of the roles of ap-2 transcription factors in adult tissues . We and others are currently exploiting the power of conditional mouse mutants to overcome these restrictions [61 - 63]. Such approaches will not only shed light on normal ap-2 functions but will probably also lead to unique insights into human disorders . Complementary approaches currently include the identification of ap-2 target genes; this might give a better understanding of developmental disturbances and pave the way to novel treatment options . At the molecular level, one major challenge will be the identification of specific ap-2 homo- or hetero - dimeric complexes bound to a particular promoter and the identification of the specific properties of each complex with respect to gene regulation . Also, the signaling pathways responsible for induction of ap-2 genes are currently under investigation . A cross - species comparison of the various ap-2 promoters may give insights into the evolution of tissue specificity and help to determine important enhancer elements . Moreover, given that cpg islands are present in ap-2 promoters, epigenetic regulation such as dna methylation also needs to be considered . Ap-2 transcription factors are currently being studied extensively in human cancer, and they may be of diagnostic value, as has been demonstrated for mammary or testicular carcinoma . It is tempting to speculate that ap-2 transcription factors might not only be molecular markers for certain types of cancer, but could also be causally involved in their etiologies and would therefore represent a potential target for therapeutic intervention . We thank roland dosch and michael pankratz for critical reading of the manuscript . This work was supported by funding from the deutsche forschungsgemeinschaft (#503/6 and 503/7) that was awarded to h.s . Amino - acid sequence alignments were performed using clustalw implemented in sequence data explorer of the mega3 software . The phylogenetic tree was created using the neighbor - joining method (gaps setting: pairwise deletion; distance method: number of differences). Numbers at selected nodes indicate the percentage frequencies of branch association on the basis of 1,000 bootstrap repetitions . Species: caenorhabditis elegans (nematode); ciona intestinalis (sea squirt); drosophila melanogaster (fruit fly); danio rerio (zebrafish); gallus gallus (chicken); homo sapiens (human); mus musculus (mouse); pan troglodytes (chimpanzee); rattus norvegicus (rat); xenopus laevis and xenopus tropicalis (frog). A schematic representation of the protein structure of an ap-2 dimer, showing the proline- and glutamine (p / q)-rich transactivation domain (89 amino acids, red), the py motif within this domain (5 amino acids, green), the basic domain (20 amino acids, yellow) and the helix - span - helix motif (131 amino acids, blue). The helix - span - helix motif is responsible for dimerization of the proteins and mediates dna binding together with the basic domain . Chromosomal locations of ap-2 genes from selected species * the ap-2 genes of c. elegans and d. melanogaster are not orthologous to any of the five mammalian genes . Accession numbers for ap-2 proteins from selected species * the ap-2 genes of c. elegans, d. melanogaster and c. intestinalis are not orthologous to any of the five mammalian genes . Proteins that physically interact with ap-2 transcription factors * abbreviations: dbd, dna - binding domain; dd, dimerization domain; n.d ., not determined . It is currently not entirely clear whether rb binds ap-2 only via the amino terminus, or whether the dna - binding domain is also necessary.
A 56-year - old man was referred for biliopancreatic diversion with a duodenal switch (bpd - ds) for intractable complications associated with morbid obesity . He had been unable to lose weight with orlistat 120 mg three times a day for three months . The patient had diabetes mellitus for twenty years associated with hypertension, " mal perforant " and hepatic steatosis . He had all features of the metabolic syndrome and was treated for sleep apnea with a nocturnal continuous positive airway pressure device (c - pap). His body mass index (bmi) at the time of the surgery was 48.7 kg / m, weighting 157.7 kg . The patient's blood tests showed normal electrolytes and a creatinine of 110 mol / l . The glycated hemoglobin was 7.1% (normal range 4.46.5%) with fasting glucose values ranging from 7 to 11 mmol / l with ldl - cholesterol and hdl - cholesterol levels of 2.63 and 0.99 mmol / l respectively . Rest and exercise electrocardiograms were normal as well as a cardiac dobutamine stress echocardiography . A pseudonormalized pattern of left ventricular filling was present on a standard echocardiogram and a 24-hour holter was normal except for a slight decrease in heart rate variability . His medications before surgery consisted of metformin 850 mg tid, rosiglitazone 8 mg daily, irbesartan 300 mg daily, diltiazem 120 mg daily, orlistat 120 mg tid and furosemide 20 mg every other day . He was on insulin humalog tid (4246 u) with insulin nph 90 u at bed time, for a total of> 200 u of insulin daily . He underwent a modified scoparino's biliopancreatic diversion with a duodenal switch [1 - 5]. The patient had an hemodynamically stable pulmonary emboli on the day 12 after surgery and was anticoagulated . Anthropometric measurements before and eleven months after the surgery are presented in the table 1 and figure 1 and metabolic improvements and echocardiographic findings are depicted in tables 2 and 3 respectively . Eleven months after the surgery, the medication consisted of metformin 850 mg tid, irbesartan 150 mg daily, 50 000 u of vitamin d2, ferrous sulfate 300 mg daily, 25 000 u of vitamin a, calcium 500 mg and one tablet of vitamins and mineral supplements daily (centrum forte). Anthropometric variables before and after biliopancreatic bypass surgery anthropometric variables before and after biliopancreatic diversion surgery anthropometric measurements were assessed using a bioimpedance balance (tanita tbf 350) metabolic profile before and after biliopancreatic diversion surgery blood pressure and echocardiographic variables before and after biliopancreatic diversion surgery bp: blood pressure ef: ejection fraction from obesity is associated with an increased risk of coronary artery disease (cad) and mortality [6 - 8]. Morbidity and mortality rates rise proportionally to the degree of obesity in men and women and the impact of excess body fat is more significant in younger subjects than older ones [9 - 12]. In a 10-year follow - up, men and women with a bmi 35.0 kg / mhad a relative increased risk of developing diabetes of ~23 and ~17 fold respectively compared to a control group with a bmi between 18.5 and 24.9 kg / m . Independently of the bmi, the relative risk of developing diabetes mellitus increases with weight gain as shown in the nurse's health study . Moreover, in that study, women who voluntary lost more than 5.0 kg reduced their risk of diabetes by 50% . Weight loss also lowers blood pressure . In a 3-year follow - up of non - morbidly obese patients with a mean bmi of 31 kg / m, patients who maintained a 4.5 kg weight loss had a relative risk of hypertension of 0.35 or, a reduction of 0.45 mmhg in systolic blood pressure and 0.35 mmhg in diastolic pressure per kg of weight lost . In addition to higher cardiac output in obese patients, left ventricular volume and filling pressures are higher than normal . This usually results in the development of left ventricular strain, which leads to hypertrophy, often of the eccentric type . Left ventricular diastolic function is thus frequently impaired . Weight loss has a beneficial impact on the functional and the structural cardiac status . In a study of obese patients with a mean bmi of 32.7 kg / m, weight loss of 8 kg over a period of 25 weeks was associated with a significant decrease in left ventricular mass . Weight loss lowers oxygen consumption at any given work rate, decreases cardiac output and blood pressure while left ventricular filling pressures decreased as left ventricular stroke volume diminishes . In a study of obese patients with a bmi> 40 kg / min whom surgical weight loss with vertical gastric banding (vgb) induced a decrease in body weight of 20% at six months, left ventricular wall thickness, particularly the septal and posterior walls, decreased . The national institutes of health (nih) suggested that surgical therapy be proposed to those patients with a bmi level> 40 kg / mor> 35 kg / mwith serious medical conditions including hypertension and obstructive sleep apnea . Surgical intervention, when indicated, brings significant improvement such as a decrease in excess weight and comorbidities; these include hypertension, diabetes, dyslipidemia [3,14,25 - 28] and sleep - related disorders . One can expect a mean reduction of 60 to 75% of excess body weight with biliopancreatic diversion which can persist for 4 to 8 years after surgery [3 - 5,30,31]. The duodenal switch operation, introduced by hess in 1988, variant of the biliopancreatic diversion of scopinaro, helps in preserving normal eating habits, and the majority of patients undergoing the procedure will have normalization of glucose levels, triglyceride levels and blood pressure early weeks after the surgery [3 - 5]. Indeed, in a review of 440 obese patients (mean weight of 183 kg) who underwent biliopancreatic diversion with duodenal switch, all of the 36 type 2 diabetic patients discontinued their medication over a 7-year follow - up period . Operative mortality is between 0.5% and 2% and early complications include pulmonary embolus (0.5%) and anastomotic leaks (12.5%). Late complications presents in the form of anemia, anastomotic ulcerations, bone demineralization, neurological complications and protein malabsorption; all of which can be addressed with appropriate supplements . Moreover, significant nutritional and metabolic complications may be less frequent than previously thought . Eleven months after the surgery, our patient had lost 40% of his body weight, and body fat mass was reduced by 41% (figure 1). The medication was greatly lightened while the patient maintained fasting glucose values ranging from 5 to 7 mmol / l and a blood pressure less than 130/80 mmhg (table 2). Indeed, rosiglitazone was discontinued, the insulin that averaged> 200 u daily was no more necessary, diltiazem was discontinued and the dose of irbesartan was halved . The 25% decreased in waist circumference is probably clinically significant albeit waist circumference may be less reliable in patients with a bmi> 35 kg / m . Finally, sleep apnea syndrome improved as the patient was no longer on c - pap . Left ventricle hypertrophy is recognized as a strong independent risk factor for cardiovascular morbidity and death and changes in cardiac structure following surgical weight loss have been observed . In the present case, the left ventricle mass index decreased by 15% and the thickness of the septal and posterior walls of the left ventricle were reduced (table 3). Moreover, using doppler mitral flow velocity with the e / a ratio, we demonstrated that left ventricular diastolic dysfunction actually improved . Before the operation, the e / a ratio was higher than 1 with a significant decrease during the valsalva maneuver which corresponds to a pseudonormal ventricular filling or grade 2 filling pattern . After the operation, the e / a ratio was smaller than 1 indicating a delayed relaxation of grade 1 filling pattern, representing an improvement in the diastolic function (table 4). Mitral doppler at rest and during the valsalva maneuver before and after biliopancreatic diversion surgery e wave: early transmitral filling velocity a wave: transmitral atrial filling velocity e / a: early / atrial transmitral filling velocity this case report emphasizes the improvement in cardiovascular parameters, including the diastolic function (demonstrated by a pseudonormal ventricular filling or grade 2 filling pattern) and sleep apnea syndrome, following weight loss - induced by the biliopancreatic diversion with duodenal switch . Pp envisioned the paper and pw, pp prepared the initial draft of the article . Bpd - ds: biliopancreatic diversion with a duodenal switch c - pap: continuous positive airway pressure device vgb: vertical gastric banding nih: national institutes of health e / a ratio: early / atrial transmitral filling velocity the authors want to express their gratitude to suzie laroche, louise marois and claudette fortin for the quality of their intervention and the work on this particular population.
Medulloblastoma, a primitive neuro - ectodermal tumor (pnet) arising in the posterior fossa, is one of the most common malignant tumor of the central nervous system (cns) in children . Overall survival for children with non - disseminated and non - anaplastic medulloblastoma can approach 80%.1 radiologic and histopathologic features include hyperattenuation on unenhanced computed tomographic scans that reflects the high nuclear - cytoplasmic ratio seen at histological analysis.2 medulloblastoma can also occur in late middle age with identical histopathologic findings to those found in childhood . Studies of chromosomal abnormalities, genetic syndromes, and individual genes have contributed to the understanding of medullblastoma biology.3 an infectious association with medulloblastoma was proposed in 2002 . Del valle et al demonstrated the presence of the human polyoma virus (jcv) t antigen (tag), and agnoprotein dna in 65% and 69% of 20 and 16 medulloblastoma ffpe specimens, respectively.4 in an accompanying editorial polyomavirus and medulloblastoma: a smoking gun or guilt by association? Howard a. fine5 cautioned only through well - controlled epidemiological case - control studies evaluating large numbers of both normal and tumor - associated brains for the presence of jcv, will we have a chance of determining the relative contribution of the virus toward tumor promotion . Over the years pcr findings have not confirmed a viral association with medullolastoma.6 - 9 brucellosis is caused by an intracellular gram - negative coccobacillus and produces lesions in multiple organs including the brain . Exposure to brucella species occurs through drinking or eating unpasteurized milk products, meat, or contact with infected animals . Cns brucellosis is rare . In a study of 19 patients in 1987, 8 patients had meningoencephalitis, 6 had proximal polyradiculoneuritis, and 5 had diffuse cns involvement (including one with cerebellar involvement).10 in a study of 301 brucellosis patients in 1992, 18 had neurobrucellosis, two patients exhibited cerebellar dysfunction.11 in 2009 a 14 year - old girl presented with double vision . On mri examination a 5x3 cm mass resection of the mass revealed a small blue cell tumor forming scattered homer - wright rosettes, characteristic of classic medulloblastoma . Initial igm for brucella was 0.78 (<0.50 neg) and igg was negative . Repeat igm was negative . In response to the parents who believed the mass was actually neurobrucellosis, the afip performed pcr testing for brucella sp dna in the tumor tissue . Surprisingly dna extracted from two formalin - fixed, paraffin - embedded (ffpe) tissue blocks contained a 62 base pair (bp) sequence of dna found only in the outer membrane protein gene (omp31) of brucella species . Specific primers / probes for b. melitensis, b. abortus, and b. suis did not produce a dna product from the two tumor blocks . In order to assess if brucella may have any association with medulloblastoma, we retrieved ffpe blocks from brains of patients who died of medulloblastoma as well as blocks of brains from patients who died with other malignancies in the cns, and brains of patients without evidence of cns tumors . This study showed an unexpected presence of brucella sp in ffpe cns tissues from patients who died from malignancy in the brain . A total of 52 ffpe autopsy samples of brain tissues were collected from the pathology archives of the armed forces institute of pathology . Of the 31, 20 were diagnosed as medulloblastomas, 5 as glioblastoma, 4 as metastatic carcinoma and 2 with leukemia . Fifty - two ffpe blocks were cut with a microtome (5 m in thickness, 3 sections per block). All cut - sections were collected into separate dnase - free eppendorf tubes and processed for dna retrieval as follows: (i) de - paraffinized by treatment with 800 l of xylene (twice) followed by removing xylene with 800 l of pure ethanol treatment (twice); (ii) tissue digestion and nucleic acids separation were carried out following a modified protocol of a qiagen kit (cat #51106); (iii) rna cleaning by incubation samples at 37c for 30 minutes with rnase a (100 mg / ml, qiagen) and (iv) dna was purified by qiaquick column (washing buffer 1 and 2, qiagen). The final dna samples were eluted off the columns in 30 l of elution buffer (qiagen), followed by quantification with nd-1000 spectrophotometer (nanodrop). Four sets of taqman primers and probes were designed for identification of brucella at species level (set 1 - 3) or at genus level (set 4). Brucella species - specific assays for b - m, b - a and b - s targets were determined by selecting the insertion sequences (is711 elements)12 in the genome of brucella melitensis (region 1209562 1209713, ae008917.1), b. abortus (701208 701381, am040265.1), and b. suis (1618822 1618948, ae014291.4), respectively . The amplicon length in each primer set ranged from 127 to 174 bp, and each amplicon was checked in silico by blast alignment program . The omp31 primer set (set 4) was developed to amplify brucella omp31gene target (31 kda outer membrane protein) (locus: bruab1_1608; region 1586489 1587274; ae017223). All primers were designed with primer express software (v 3.0, applied biosciences, abi). The 62-bp nucleotides in the omp31 gene fragment was amplified with primer ggctcggttgccaatatc (f) and gactgcgtaaagccggactc (r). A taqman hydrolysis probe fam - tgcgatcaagtcgggcgctct - tamra, designed by using the same software, hybridizes with the specific amplicon as shown by an in silico pcr amplification.13 the 62-bp fragment demonstrated a broad range of alignment with brucella species . All primer oligos were ordered from integrated dna technology (idt), and taqman probes from abi . Validation tests of each assay were carried out by testing standard brucella dna, extracted from culture of b. melitensis 16 m strain . Standard dna serial dilutions (10-fold) were from 200 picogram (pg) to 200 femtogram (fg) per microliter . A specificity dna panel was prepared by collecting dna samples from cultures of brucella sp (table 1), near neighbors and other bacteria (not shown). The validation results demonstrated that the limitation of detection (lod) of these real - time pcr assays is around 50 fg, equivalent to 5 brucella genomes . The calculation was performed according to brucella genome size (b. melitensis, 16 m str ., 2.12 mb) and a real - time pcr standard amplification curve (data not included). Specificity tests confirmed no cross - species amplification among primer set 1 to 3; omp31 primers amplified all brucella dnas in the dna panel . Taqman real - time pcr reaction was carried out in a lightcycler (software 4.1, roche). In pcr assay, each capillary (20 l) contained 10x buffer (with 50 mm mgcl2, it), dntps (2 mm each, it), taqman primers (300 nm each), probe (50 nm), taq polymerase (1 unit, invitrogen) and 5 l of dna samples . Cycle conditions were as follow: reaction capillary was incubated at 95c for 2 minutes, followed by 40 cycles of two - step amplification: 95c for zero seconds and 60c for 20 seconds . A total of 52 ffpe autopsy samples of brain tissues were collected from the pathology archives of the armed forces institute of pathology . Of the 31, 20 were diagnosed as medulloblastomas, 5 as glioblastoma, 4 as metastatic carcinoma and 2 with leukemia . Fifty - two ffpe blocks were cut with a microtome (5 m in thickness, 3 sections per block). All cut - sections were collected into separate dnase - free eppendorf tubes and processed for dna retrieval as follows: (i) de - paraffinized by treatment with 800 l of xylene (twice) followed by removing xylene with 800 l of pure ethanol treatment (twice); (ii) tissue digestion and nucleic acids separation were carried out following a modified protocol of a qiagen kit (cat #51106); (iii) rna cleaning by incubation samples at 37c for 30 minutes with rnase a (100 mg / ml, qiagen) and (iv) dna was purified by qiaquick column (washing buffer 1 and 2, qiagen). The final dna samples were eluted off the columns in 30 l of elution buffer (qiagen), followed by quantification with nd-1000 spectrophotometer (nanodrop). Four sets of taqman primers and probes were designed for identification of brucella at species level (set 1 - 3) or at genus level (set 4). Brucella species - specific assays for b - m, b - a and b - s targets were determined by selecting the insertion sequences (is711 elements)12 in the genome of brucella melitensis (region 1209562 1209713, ae008917.1), b. abortus (701208 701381, am040265.1), and b. suis (1618822 1618948, ae014291.4), respectively . The amplicon length in each primer set ranged from 127 to 174 bp, and each amplicon was checked in silico by blast alignment program . The omp31 primer set (set 4) was developed to amplify brucella omp31gene target (31 kda outer membrane protein) (locus: bruab1_1608; region 1586489 1587274; ae017223). All primers were designed with primer express software (v 3.0, applied biosciences, abi). The 62-bp nucleotides in the omp31 gene fragment was amplified with primer ggctcggttgccaatatc (f) and gactgcgtaaagccggactc (r). A taqman hydrolysis probe fam - tgcgatcaagtcgggcgctct - tamra, designed by using the same software, hybridizes with the specific amplicon as shown by an in silico pcr amplification.13 the 62-bp fragment demonstrated a broad range of alignment with brucella species . All primer oligos were ordered from integrated dna technology (idt), and taqman probes from abi . Validation tests of each assay were carried out by testing standard brucella dna, extracted from culture of b. melitensis 16 m strain . Standard dna serial dilutions (10-fold) were from 200 picogram (pg) to 200 femtogram (fg) per microliter . A specificity dna panel was prepared by collecting dna samples from cultures of brucella sp (table 1), near neighbors and other bacteria (not shown). The validation results demonstrated that the limitation of detection (lod) of these real - time pcr assays is around 50 fg, equivalent to 5 brucella genomes . The calculation was performed according to brucella genome size (b. melitensis, 16 m str ., 2.12 mb) and a real - time pcr standard amplification curve (data not included). Specificity tests confirmed no cross - species amplification among primer set 1 to 3; omp31 primers amplified all brucella dnas in the dna panel . Taqman real - time pcr reaction was carried out in a lightcycler (software 4.1, roche). In pcr assay, each capillary (20 l) contained 10x buffer (with 50 mm mgcl2, it), dntps (2 mm each, it), taqman primers (300 nm each), probe (50 nm), taq polymerase (1 unit, invitrogen) and 5 l of dna samples . Cycle conditions were as follow: reaction capillary was incubated at 95c for 2 minutes, followed by 40 cycles of two - step amplification: 95c for zero seconds and 60c for 20 seconds . The association of brain tumors, medulloblastoma as an example, with the presence of a brucella species dna has not been previously addressed . Parents of a patient with medulloblastoma however, insisted that brucella was associated with their child's brain tumor . This prompted us to investigate the presence of brucella sp dna in medulloblastoma tumor tissues . These samples represent different histologic presentations, classic, anaplastic, nodular, large cell, and included samples with the more general terminology primitive neuro - ectodermal tumor (pnet). After finding the child's medulloblastoma did contain brucella sp dna, we asked members of the department of neuropathology to retrieve brain tumors, especially medulloblastoma from the archives . In table 2, 20 brain specimens diagnosed as medulloblastoma were tested for brucella sp dna . Five (25%) patients' tissues were positive only for the outer membrane protein gene (omp31). These 15 patient's ages ranged from 6 months to 27 years, average 12.5 years . None of the 20 cases contained specific sequences related to b. melitensis, b. abortus, or b. suis . In order to determine if brucella sp dna is present in the brain of patients dying of non - malignant disorders, 21 brain samples were retrieved and tested for brucella sp specific dna sequence (omp31 gene fragment). One patient (4.8%) (#15 table 3) who died with changes consistent with his diagnosis of spinocerebellar ataxia had brucella sp dna in his brain tissue . The male to female ratio of the 21 patients was 4:1, average age 53.3 years . Brain tissues from 11 patients diagnosed with other malignancies were also examined using the omp31 primer / probe set (table 4). Four of 11 contained brucella sp dna sequences, in which three of five (60%) of brains diagnosed as glioblastoma, 1 of 4 brains (25%) with the histologic diagnosis of metastatic carcinoma, and neither of the two brains with a diagnosis of leukemia demonstrated brucella sp dna sequences . In summary, 10 of the 52 (19%) brain tissues retrieved from the archival files of afip contained brucella sp dna (outer membrane protein -omp31 gene fragment). Specific brucella sp dna was identified in 25% of the medulloblastomas, 60% of the glioblastomas, and 25% of the metastatic carcinomas . The idea of a brucella species or the disease brucellosis being associated with brain tumors, specifically medulloblastoma or glioblastoma must be addressed with caution . Well - controlled epidemiological case - control study evaluating large numbers of both normal and tumor - associated brains in the suggestion that jc virus was associated with medulloblastoma formation exactly outlines the tasks necessary to affix any role of brucellosis in patients who develop medulloblastomas or other brain tumors . Sensitive and specific pcr primers are crucial for accurate characterization of disease biomarkers in ffpe tissue . In primer designing, if amplicon size is longer than 200 bp, pcr is often unsuccessful.14,15 we used primer express software (v 3.0) for designing all taqman assay primers and probes . The software generates amplicons of smaller size, usually between 60 to 150 bp, that just fits the amplification of ffpe dna fragments . As shown in table 1, the resulting pcr amplicon [ggctcggttgccaatatcaatgcgatcaagtcgggcgctctggagtccggctttacgcagtc] only aligned with brucella species (100% identity) on blast search . The third problem is the necessity to guard against dna contamination in the cutting, extraction, and real - time pcr amplification processes . The ideal study would be conducted at separate sites using identical primer / probe sets . Is there any evidence that bacteria or bacteria - like agents can be implicated in cancer formation? Gastric cancer develops in persons infected with helicobacter pylori but not in uninfected persons.16 one bacteria - like agent mycoplasma fermentans has been shown in the laboratory to induce a mycoplasma - mediated multistage malignant transformation of cultured mouse embryo cells (c3h).17 positive dna findings for brucella species in our index patients focused our attention on studying medulloblastomas, as shown in this index patient, serological examination and cultures for brucellosis were non - contributory . This might mean that live brucella sp organisms are not present, only brucella sp dna . In the united states, people drink pasteurized milk and milk products and eat meats from antibiotic treated animals . Is it possible that the source of the detected brucella sp dna was denatured dna from diet, not from an active brucella sp infection? More studies would be needed to further investigate any true association between brucella sp dna positivity and cns tumor formation.
Prostate cancer is the most commonly diagnosed cancer and the second leading cause of cancer - related deaths amongst men in the united states . Brachytherapy is an effective treatment modality that can be utilized either alone or in combination with external beam radiation therapy (ebrt) for patients with localized prostate cancer of all risk groups [25]. The combination of ebrt with brachytherapy can improve prostate cancer outcomes by allowing meaningful dose escalation while minimizing dose to organs at risk . Predictors of psa progression free survival following prostate brachytherapy have been extensively evaluated, whereas fewer studies have characterized predictors of distant metastases [2, 7]. The bulk of the data on predictors of distant metastasis are from external beam radiation therapy and low dose rate brachytherapy [2, 79]. Data with respect to predictors of distant metastasis outcomes following high - dose - rate brachytherapy are more limited . Higher gleason score has been a significant predictor of distant metastasis in most series, whereas total dose has not always been [1113]. Determining predictors of metastatic disease following combination therapy is important, because it identifies men who could benefit from additional treatment . We reviewed the clinical outcomes on our single institution experience treating localized prostate cancer with high - dose - rate brachytherapy boost (hdr - b), and ebrt to identify predictors of distant metastases . An institutional review board approved retrospective study that was performed on men with clinically localized biopsy - proven prostate cancer who were treated between 1991 and 2002 at a single center with hdr - b, and ebrt with at least one year of follow - up . Pretreatment evaluation included history and physical examination, digital rectal examination (dre), transrectal ultrasonography (trus), prostate biopsies with gleason score, and psa determination . Staging procedures, such as bone scan and ct of the abdomen and pelvis were performed for intermediate and higher risk patients . Hdr - b and ebrt were administered with a 2 week interval in between (most commonly hdr first followed by ebrt). Two implants were performed 1 week apart with each implant used to deliver 2 hdr fractions (i.e. Total of 4 fractions). The procedure consisted of transperineal interstitial implantation of 17 - 18 flexiguides directed by trus, cystoscopy, and fluoroscopy . Simulation radiography, during the period of study, was based on plain film simulation, and dosimetry was computed using nucletron, versions 10 through 11.4 (nucletron, an elekta company, elekta ab, stockholm, sweden). The 100% isodose was normalized to a 5 - 6 mm margin anterior and lateral to the prostatic capsule to include microscopic disease extension, but the margin was limited to approximately 2 - 3 mm posteriorly to prevent rectal injury . The urethral dose limits were 120%, except for cases of prior transuretheral resection of the prostate, where the maximum urethral dose constraint was reduced to 105% . Fluoroscopic verification of the brachytherapy catheter position was performed prior to the second treatment delivery . Dosimetric quality was determined by evaluation of dose volume histograms, analysis of clinical target volume coverage (d90 dose to 90% prostate, v100 prostate volume receiving 100% prescription dose, and v150 prostate volume receiving 150% of the prescription dose) and normal tissue dose constraints . Pelvic ebrt was delivered using 3d conformal treatment planning, and was delivered in 1.8 - 2.0 gy per fraction initially to 36 gy and later to 39.6 gy . When adt was utilized, it consisted of a luteinizing hormone releasing agonist usually with an antiandrogen . It was typically initiated 3 months before ebrt and consisted of a short course (6 months). Indications for adt were quite variable over the course of the study . In the early years, it was widely administered by referring physicians regardless of risk group . Over time, the use of adt was less commonly prescribed for favorable disease . In some cases, it was used, without regard to risk group, to reduce the prostate volume prior to brachytherapy . Follow up consisted of office visits with digital rectal examination, psa testing and search of patient medical records for evidence of distant metastasis . Psa measurements were done for 3-month intervals for the first 2 years following completion of treatment, every 6 months for years 2 - 5, and then yearly thereafter . A cox proportional hazards model was employed to examine the risk of developing dm by several patient disease and treatment parameters, including age at diagnosis, t stage, gleason score, use of adt, and bed (an / ratio of 1.2 gy was assumed). Beds were also converted to an equivalent 2 gy dose (eqd2) for ease of interpretation, and are presented in the discussion section [14, 15]. A two - sided p value <0.05 was considered significant for all tests . We identified 768 men with localized prostate cancer who were treated at our institution with hdr - b and ebrt (table 1a). According to nccn risk stratification criteria, the distribution of patients was 26% low, 50% intermediate, and 24% high risk . Adt was administered to 380 patients (49%) for a median duration of 4.5 months (maximum 6 months). The mean pre - treatment psa standard deviation was 10.2 7 ng / ml . The mean ebrt dose was 37.5 gy (range: 30.6 - 45 gy) and hdr - b dose 22 gy for 15%, and 24 gy for 85% of patients . The median bed for hdr - b plus ebrt was 234 gy (range: 212 - 249 gy). Sd standard deviation, bed biologically equivalent dose, ebrt external beam radiation therapy, hdr high dose rate the median follow - up time for the entire patient population was 4.2 years (range: 1.0 - 11.2 years). The median follow - up for patients with low, intermediate, and high risk disease was 3.9, 3.6, and 3.8 years . Three percent (22/768) of patients developed distant metastases with a median time to a diagnosis of metastatic disease of 4.1 years (range: 1.0 - 7.2 years). All but one patient who developed metastatic disease had high (n = 17) or intermediate (n = 4) risk disease . All distant metastasis, except for one, occurred in patients who received bed 234 gy (table 1b). Actuarial curves for freedom from distant metastasis for low, intermediate, and high risk prostate cancer patients are shown in figure 1 . Kaplan meier actuarial survival curve for psa progression free probability stratified by risk groups patient characteristics grouped by distant metastasis dm distant metastases, bed biologically equivalent dose psa failure (phoenix definition) developed in 7% of men with a median time to failure of 3.8 years (range: 1.0 - 9.8 years). By nccn risk group psa failure developed in 3%, 5%, and 14% of men with low, intermediate, and high risk disease (table 2). Actuarial curves for psa progression free survival for low, intermediate, and high risk patients are shown in figure 2 . Local tumor control (i.e. Failure to manifest clinical disease progression in the prostate) kaplan meier actuarial survival curve for distant metastasis free probability stratified by risk groups patient characteristics grouped by psa failure bed biologically equivalent dose on univariate analysis, t stage, gs, and use of adt were significantly associated with developing dm (table 3). Multivariate analysis showed increasing gs was associated with an increased risk of developing distant metastasis (p <0.05) (table 3). Multivariate analysis also showed an increased risk of developing distant metastasis with the use of adt . This lead us to compare the makeup of patients treated with adt to those without adt to determine if patient selection bias could explain this finding . We found that patients selected for adt had significantly higher gs, t stage, and pre - treatment psa (all p <0.0001) compared to those who did not receive adt (table 4). Univariate and multivariate analysis for predictors of psa failure (phoenix definition) and distant metastasis bf biochemical failure, dm distant metastasis patient characteristics based on androgen deprivation therapy (adt) bf biochemical failure, dm distant metastasis most clinical reports following definitive treatment of prostate cancer use psa control as a primary endpoint, but it is clear from longitudinal studies that biochemical failure does not always lead to other evidence of disease progression . Such an observation was made in a series of 1997 men with clinically localized prostate cancer treated with radical prostatectomy, of whom 15% (n = 315) developed psa progression . After a median follow - up of eight years only, 30% of men of those with psa failure went on to developed metastasis . This discordance between psa failure and the development of distant metastases underscores the need to identify factors that predict for a higher likelihood of developing clinically meaningful events such as the occurrence of distant metastasis which can impact quality of life and survival . One of the largest series looking at predictors of distant metastasis was performed on 8669 men with clinically localized or locally advanced non - metastatic prostate cancer, treated with either ebrt alone or surgery . They found that a post - treatment psa doubling time of less than 3 months predicted a 20-fold increase in the risk of dying from prostate cancer . Combining gleason score with psa doubling time further improves predicting prostate cancer - specific mortality . Other studies in patients treated definitively with ebrt have identified t stage, gleason score, pretreatment psa, adt use, and higher radiation dose as other significant predictors of distant metastasis free survival . While some information is known regarding predictors of distant metastasis following ebrt, less is known following brachytherapy . In two of the largest low dose rate (ldr) brachytherapy series forsythe et al . Showed gleason score and psa doubling time as significant predictors, whereas taira et al . Found that metastasis free survival was most closely related to gleason score and year of treatment . Hdr is significantly different from ldr with respect to dose rate, and technique suggesting there may be differences in predictors of outcomes between the two modalities . In terms of hdr, the largest published study of predictors of distant metastasis following hdr and ebrt comes from the experience at william beaumont hospital (wbh) by martinez et al ., who reported on 472 men with intermediate and high risk disease . They performed a dose escalation investigation starting with hdr doses of 5.5 gy x 3 and ending with 11.5 gy x 2 for the hdr component of treatment . They found that when the bed (/ ratio 1.2) was 268 gy (which corresponded to 9.5 gy x 2) there was less biochemical failure, better local control, and fewer cases of distant metastasis . They also observed that gleason score predicted biochemical and overall clinical control, but did not independently correlate with freedom from distant metastasis . In another series from memorial sloan kettering cancer center (mskcc), kotecha et al . Reported on the outcomes of 229 patients with clinically localized prostate cancer treated with a hdr brachytherapy boost (5.5 gy x 3 to 7.5 gy x 3) followed by ebrt (most patients were treated to 50.4 gy). Amongst high risk patients a higher bed (> 190 gy, / ratio of 2) resulted in improved biochemical control and distant metastases free survival . In a final large series from prada et al . That included outcomes of 313 patients with localized prostate cancer with 46 gy of ebrt, and hdr brachytherapy boost of 11.5 gy x 2, gleason score was the only factor significantly associated with developing distant metastasis . Our data is consistent with the published literature demonstrating the importance of gs in predicting the risk of developing distant metastasis, however we did not find that bed was significant on multivariate analysis . Our early standard treatment consisted of 36 gy ebrt plus 6 gy x 4 fractions of hdr . In 1999 we increased the ebrt dose from 36 gy to 39.6 gy without changing the hdr program . If we convert the doses used in this series (ebrt 39.6 gy + 6 gy x 4 hdr), the wbh series over which they saw improved outcomes (ebrt 46 gy + 9.5 gy x 2 hdr), the mskcc series over which they saw improved outcomes in high risk patients (ebrt 50.4 gy + 7.5 gy x 3 hdr), and the prada series (ebrt 46 gy + 11.5 gy x 2) to a bed assuming an / ratio of 1.2 gy we get 243 gy, 292 gy, 289 gy, and 366 gy . Converting these beds to eqd2s we get 203, 243, 241, and 305 gy . While there is variation in the total bed; the bed from the hdr component of treatment for the four series are similar at 144 gy, 169 gy, and 163 gy . It is speculative whether this suggests the hdr component of treatment is more critical to treatment outcomes than the ebrt dose . Differences in dosimetry policies between institutions may also affect the actual biologically significant dose delivered that is not manifest in the hdr prescription alone . For example, the dose was prescribed to the prostate plus a several millimeter margin beyond the prostate (except where it was immediately adjacent to the bladder and rectum). The bed dose to the prostate was then ebrt 39.6 + hdr 6.6 gy x 4 (bed 99 + 172 = 271). Ultimately one explanation for why we did not find a significant relationship in our cohort of 768 patients between developing distant metastasis and bed could be because the total ebrt plus brachytherapy dose, and range of total dose delivered was lower than the thresholds seen for improved outcomes in the wbh series . Patients who received adt had significantly higher risk features such as gleason score, t stage, and pre - treatment psa that we believe explains the higher incidence of distant metastases as opposed to a negative interaction between hdr - b and adt . In addition, the median duration of hormone therapy was 4.5 months which is much shorter than is now commonly recommended for high risk patients, and as a result some men may have been undertreated . This analysis has shortcomings that include its retrospective design and a short median follow - up . Despite these issues, our overall clinical results are consistent with other published studies reporting outcomes of hdr brachytherapy in combination with external beam radiation therapy [13, 1923]. This report on a very large group of patients strengthens the evidence regarding the importance of gs in predicting outcomes even after delivering high doses of local radiation . In men treated with hdr - b and ebrt, gs is a significant factor on multivariate analysis for developing distant metastasis.
Understanding transport properties of fluid molecules in microporous materials is of great importance due to intriguing features of fluidic phenomena at the nanoscale . Many industrial and scientific applications such as gas storage and separation, petroleum refining, electrochemical energy storage, nanofluidics and materials screening require fundamental understanding of fluid properties in confined spaces . In recent years, there has been rapid development of a variety of new microporous materials such as carbide derived carbons (cdc), carbon nanotubes, and metal organic frameworks (mof), and enhanced interest in the complexity of the fluid transport in such nanostructures . Nevertheless, the transport properties of fluid molecules in such tight confinements are not very well understood . Established approaches such as the dusty gas model (dgm) or knudsen model have limited applications in nanoscale confinements, while maxwell - stefan type models disregard the effect of fluid inhomogeneities in mixture adsorption, and more rigorous models based on the boltzman equation rely on approximations that may not be accurate in narrow nanopores . On the other hand, molecular dynamics simulation can in principle provide exact results for prediction of fluid properties in confined spaces based on appropriate potential models . Nevertheless, this type of simulation can potentially suffer from inadequacy of the force field used, lack of a realistic adsorbent model and requirement of large computational resources for capturing slow diffusion processes . This is particularly true in the case of disordered microporous materials, where diffusion of gas molecules takes place at considerably slow rates . The use of realistic structures is, however, now within reach, with the development of the hybrid reverse monte carlo (hrmc) simulation method . There are relatively few diffusion studies based on realistic disordered adsorbent models in the literature . Notable among these is the work of moore et al . Who studied diffusion of argon in a disordered bpl carbon model, and those reported earlier by gubbins and co - workers on diffusion of argon and nitrogen in structural model of saccharose based porous carbons, as well as a more recent study conducted by nguyen and bhatia on anomalies of water self - diffusion in the disordered structure of activated carbon . A key advance achieved by using realistically constructed models of disordered materials, as opposed to idealized slit pore or crystalline models for diffusion studies of fluid molecules, is to address the significant influence of surface and structural heterogeneity on transport properties of adsorbed molecules . The effect of energy distribution arising from the micropore size distribution is already shown to be the source of system heterogeneity in activated carbon materials . Moreover, the surface roughness of the adsorbent is known to have influence on surface diffusion of microporous solids . Both of these features, that is, surface roughness and micropore size distribution, have been found to exist in the amorphous structure of silicon carbide derived carbon (sic - dc), and may be expected to be inherent to carbide derived carbons in general . It is therefore important that effects of structural heterogeneities on transport properties of fluid molecules be examined in new studies of this class of adsorbents . In very narrow pores, frictional resistance arises from both intermolecular and wall molecule collisions, with the wall fluid events dominating transport of adsorbate molecules . However, due to lattice abnormalities, including surface roughness and corrugation of pore walls, existence of dead - ends and bottle necks, as well as other structural defects in disordered microporous materials, fluid molecules experience a very heterogeneous potential energy surface (pes) and a variety of different energy barriers along their diffusion paths within the solid matrix . Therefore, investigation of structural heterogeneity and the significance of the associated energy barriers is critical to the understanding of fluid transport in microporous materials . Here, we use an experimentally validated atomistic model of disordered microporous sic - dc developed in this laboratory, to perform lengthy molecular dynamics simulations and to determine self - diffusivities of different gases over a broad range of loadings at various temperatures . The results are important to the understanding of transport properties of industrially important gases including carbon dioxide and methane in the disordered structure of sic - dc, suggested to be promising for adsorption and gas storage applications due to its narrow pore size distribution and high pore volume . We investigate the effect of structural heterogeneity on the internal resistances to the diffusion of methane and carbon dioxide in the microporous structure of sic - dc, comparing the results from md simulation with experimental measurements of gas diffusion using both microscopic quasi elastic neutron scattering (qens) and macroscopic volumetric adsorption methods . We also investigate heterogeneity of the energy landscape in our carbon model, which is an important consequence of structural disorder and internal resistances, impacting diffusion rates and molecular accessibility in the system . In addition to the use of molecular dynamics simulation and experimental methods for calculation of molecular diffusion, we analyze the free energy landscape of the system based on the computational method of sarkisov to provide more insights into structural heterogeneity and internal constrictions in the sic - dc carbon, which have rate limiting effects on gas diffusion . We also employ the nudged - elastic band (neb) technique to case study anomalies of molecular transition through ultranarrow pores . We have employed an atomistic model of silicon carbide - derived carbon, developed in our laboratory, based on experimental structure factor data obtained from neutron scattering using 50 nm particle size sic - derived carbon, using the hybrid reverse monte carlo modeling technique . The model (illustrated in figure 1a c) provides the spatial positions of 3052 carbon atoms in a 40 cubic simulation cell representing the disordered structure of sic - dc . Details of the modeling technique, as well as validation procedure of the hrmc constructed model is discussed in our recent publication . This model provides a solid matrix with topology and morphology consistent with that of the experimental sample and has been used for the entire simulations reported in this paper . All simulations performed for this study have made use of all - atom molecular models and force field parameters, detailed in the supporting information, as well as our recent work on hrmc modeling of sic - dc structure . Investigation of the energy landscape of a microporous system is crucial for understanding fluid transport properties in this class of materials . In very narrow pores, frictional resistance arises from both intermolecular and wall - molecule collisions, however due to tight confinement, diffusion of fluid molecules is predominantly affected by wall fluid interactions . Under this condition, significantly narrow pores provide highly energetic adsorption sites, which can potentially act as restrictive energy barriers during fluid diffusion . Distribution of such barriers is dictated by steric restrictions of the system associated with geometry and interconnectivity of its pore network . Hitherto, different computational methods have been employed to elucidate transport properties and diffusion behavior of fluid molecules in a variety of zeolites and mofs, based on determination of the local or overall energy landscape of the system; nevertheless, this type of calculation is overwhelmingly limited to noncarbonaceous materials . Here, we have employed the helmholtz free energy analysis method of sarkisov to determine energy heterogeneity of the disordered sic - dc carbon and to estimate important properties such as overall energy barriers of the system for different adsorbate molecules, as well as their henry constant at infinite dilution . This method is a direct extension of the method developed earlier by haldoupis et al ., which performs its calculation based on determination of potential energy surface rather than helmholtz free energy of binding . Assuming the simulation is performed at infinite dilution, atomic interactions are reduced to solid fluid interactions . Under such conditions the helmholtz free energy changes associated with transferring a single molecule of adsorbate from the ideal gas system of volume vs to a sample of porous structure of the same volume, as described by sarkisov.1 in this equation, r and t are gas constant and temperature, s is the density of porous solid, kh is the henry constant, a is the helmholtz free energy of binding, and z is the configurational integral of a single adsorbate molecule in the porous structure, while s and i.g . The configurational integral zs follows2where k is the boltzmann s constant and us is the interaction potential energy between a fluid molecule and the solid structure . The integral is over all possible orientations and positions of the center of mass of the molecule within the adsorbent matrix . In practice, the simulation cell is divided into a large number of cubelets and the configurational integral is calculated for each cubelet . If the cubelet is small enough, the calculation is reduced to an integration taken solely over orientational configurations of the molecule . We have used 0.5 size cubelets to construct the grid network for calculation of free energy . The calculation is performed at every cubelet allowing us to obtain the free energy map of the solid structure . This approach also facilitates calculation of local properties such as local henry constant or selectivity at different parts of the adsorbent model . To construct a plausible percolation path based on the energy map obtained from computation of free energy of bindings at every individual cubelet (ai), we need to seek the threshold energy, at which one single molecule can traverse the system this is in fact a combination of percolation path analysis and free energy calculation . For a molecule traveling from one side of the simulation cell to the other side through a pattern of interlaced cubelets, interaction energies vary at every different spots . Thus, an estimation of limiting free energy barrier can be obtained from difference of the energy of the most attractive site along this path with the percolating free energy threshold explained above . A central problem in diffusion studies of adsorbate molecules through confined spaces is estimation of transition rate (hopping rate) between two sides of an energy barrier within harmonic approximation of the transition state theory (htst). This cannot be achieved unless the activation energy barrier of the system is already known, following3where k is the transition rate constant, e is the energy of the saddle point, e is the local potential energy minimum corresponding to the initial state, and vi are the corresponding normal - mode frequencies . The determination of the potential energy maximum (e) along the minimum energy path (mep), the lowest energy pathway between two stable configurations, is important for calculation of transition rates of rare events . It also provides interesting information on magnitude of local energy barriers, as well as roughness and heterogeneity of the transition pathway . Several computational techniques have been developed to accurately determine the activation energy barrier of a system or, in other words, to determine the highest saddle points along the mep . One of the most promising approaches is the so - called nudged elastic band (neb) technique, a class of chain of states methods in which a chain of several connected intermediate states are defined between two end points of a transition path, which are located at two local minima of the potential energy surface (pes). These intermediate replica are then simultaneously optimized during simulation in such a way that the forces acting on the replica are minimized . Feature to guarantee no competition between true forces and spring forces, as explained by henkelman and jonsson . Although the neb method is able to properly estimate position and magnitude of the saddle point between two given initial and final stable configurations, the method is likely to fail in search for the highest saddle point along mep, considering there might be several minima and saddle points due to heterogeneity of the energy surface . As emphasized by henkelman and co - workers, in order for the neb method to find the highest saddle point, it is essential to have an accurate estimate of the shape of the mep . To address this issue, they have slightly modified the neb algorithm, so that after regular neb has converged to its mep, the image with highest energy is selected to climb up to the top of the barrier in such a way that the climbing image moves up the potential energy surface along the elastic band and down the potential surface perpendicular to the band . In this work, transition path and saddle - points of two ultranarrow pore entries in the rigid hrmc constructed model of sic - dc have been investigated using implementation of neb in lammps (large - scale atomic / molecular massively parallel simulator) package based on the discussion and improvements of the algorithm by henkelman et al ., the minimization procedure has been performed using the fire style damped dynamics method, as described by bitzek et al . And implemented in lammps . Except initial configurations of initial and final replica at the two ends of the transition path, which are explicitly defined, initial configurations of the intermediate replica the initial configurations of the initial and final replica at the two ends of the transition path, in addition to the configurations of non - neb fluid molecules have been obtained using grand canonical monte carlo (gcmc) simulation . The non - neb fluid molecules have been considered as fixed molecular bodies merely to provide an appropriate background force field for the neb molecule, while it crosses the barrier . We have performed equilibrium molecular dynamics (emd) simulations for co2 and ch4 in a periodic sic - dc model over a wide range of loadings at 323 k, 600 and 1000 k using lammps simulation package . The simulations were performed in the canonical (nvt) ensemble, in which translational and rotational degrees of freedom of rigid bodies were both thermostated using the nose hoover algorithm with chains, as originally described by hoover and martyna et al . Short - term intermolecular interactions were modeled using the 126 lennard jones potential with a cutoff distance of 18 . The standard ewald formalism was employed for electrostatic interactions with cutoff distance of 18 in such a way that pairwise interactions within this distance were computed directly and those outside this distance were calculated in reciprocal space . This way the cutoff distance became effectively infinite . Depending on the loading, md simulations were run for 30 ns in average in the production phase so that displacement of the center of mass of the molecules was a multiple of the simulation cell dimension . To calculate self - diffusivity of co2 and ch4, mean - squared displacements (msds) of the center of mass of the molecules were collected in the fickian regime, in which log log dependence of msd with time is linear . Self - diffusivity was then obtained using the well - known einstein equation:4where ri(t) is the center of mass position vector of molecule i at time t, n is the number of molecules, and d is dimensionality of the system . From the self - diffusion coefficients obtained at various temperatures, we have also estimated the arrhenius activation energy following5where d and d0 are diffusivity and temperature - independent pre - exponential factor, respectively . As briefly discussed in the previous section, the free energy landscape of a disordered system can be obtained at certain temperatures through calculation of the free energy of binding of a guest molecule inserted in every cubelet of a fine grid network, superimposed on a three - dimensional atomistic model of the adsorbent structure . The most useful information that can be extracted from this type of calculation is the percolating free energy threshold and limiting free energy barrier of diffusing molecules . This information is summarized in table 1 for different adsorbate molecules in the hrmc constructed model of sic - dc at 300 k. as presented in this table, methane and carbon dioxide are the most favorable adsorbates . These two molecules also experience the highest limiting free energy barrier, when traversing the system . Information given in table 1 is visualized in figure 2a for co2 and figure 2b for ch4, where the percolation paths of adsorbate molecules are compared with most energetically favorable pore spaces (areas with free energy of binding between 40 and 20 kj / mol). As illustrated here, the most favorable pore spaces are widely scattered across the system and do not span a continuous percolation path . This implies that molecules adsorbed in these regions cannot easily leave the cavity to diffuse through the system unless they overcome the corresponding activation energy barriers for diffusion . Based on the information obtained from analysis of free energy landscape of the system, the position and strength of the most favorable and unfavorable pore spaces for the adsorption of a particular molecule can be identified . This information can be linked to the geometry of the pore space to provide further insight on the adsorption behavior of fluid molecules in confined spaces . C visualizes repulsive and attractive pore spaces for a co2 probe molecule across the model based on free energy of binding at 300 k. as depicted here, visual observation reveals that repulsive regions (pore spaces with very high positive energy values) consist of either extremely confined spaces inside highly narrow pores or the areas that are very close to the pore walls . On the contrary, attractive regions, which can favorably accommodate guest molecules, mainly occupy the inner part of the pore spaces . Percolation path of (a) co2 and (b) ch4 compared to high energy pore - spaces at 300 k. dotted blue area represents percolation path of each molecule, while solid volumes (red or gold) refer to the high energy pore spaces . Visualization of repulsive and attractive pore spaces for co2 at 300 k, with the red volumes representing repulsive area (having free energy of binding between + 1000 to + 1766.8 kj / mol) and the blue volumes representing pore spaces with negative free energy of binding (attractive interactions). We note here that our analysis has considered a rigid structure, neglecting the effect of vibrations . In the literature there have been conflicting views on the extent of difference on transport properties due to the flexibility of the host lattice . For example, jakobtorweihen et al . Report some reduction of the low - density transport coefficient for ch4 and c2h6 in a carbon nanotube when vibrations are considered through a boundary thermostat, with only a small reduction in the value at high densities . In contrast, bernardi et al . In their study of couette flow, find that the use of a boundary thermostat leads to a larger slip at the wall in comparison to the rigid wall . While not considered here, the effect of such vibrations will be investigated in subsequent studies . According to the correlation between free energy of binding and the henry constant given by eq 1, the free energy map of the system can also provide useful information on affinity of adosorbate molecules toward disordered carbon structure at infinite dilution . This information can be calculated from the henry constant of the molecule or from interpretation of differential heat of adsorption, following6where h is differential enthalpy of adsorption and n denotes adsorbed quantity . Values of the henry constant for different adsorbate molecules, as well as corresponding differential heat of adsorption, are summarized in table 2 . In this table, we compare the henry constant and differential heat of adsorption obtained from free energy analysis of the system with the henry constant and isosteric heat of adsorption calculated from the widom insertion method and gcmc simulation at infinite dilution . Figure 4 illustrates the variation of the logarithm of the henry constant with respect to the reciprocal temperature showing the temperature dependence of this property . Affinities of different adsorbate molecules for the adsorbent structure can be inferred from this plot . As depicted here, carbon dioxide and methane possess the highest affinity for adsorption in the disordered structure of sic - dc, as the logarithm of their henry constants is distinctly larger than those of argon and water at the same temperature . It is important to note that ch4 has a smaller limiting free energy barrier compared to co2, despite its somewhat larger geometry . Moreover, adsorption of this molecule over different temperatures is less exothermic compared to carbon dioxide, indicative of lower affinity . These two properties together can potentially facilitate higher mobility of ch4 compared to co2 . This is shown to be true in the following sections; where the self - diffusivity of the two adsorbate molecules is calculated using md simulation . The lowest affinity (the least exothermic adsorption process) according to figure 4 belongs to water . This information in addition to the fact that minimum free energy of binding for water is much higher than other molecules across the system (given in table 1) is an indication of hydrophobicity of the microporous structure of sic - dc, which is consistently reported in the literature for similar carbonaceous materials . Variation of logarithm of the henry constant with reciprocal temperature for different adsorbate molecules . In this section, transition path and position of local saddle points for two nominated pore entries have been studied, solely to demonstrate how heterogeneity of pore structure, as well as molecular geometry can dictate different scenarios for diffusion path of a single molecule independent of its kinetic energy . This information can be used to calculate the local potential energy barrier at each pore entry, as opposed to the overall energy barrier of the system obtained from analysis of the free energy landscape . The former is a local potential energy barrier that an individual adsorbate molecule has to overcome, when it tries to cross a chosen pore entry, although the latter is an estimation of overall free energy barrier that a molecule experiences, while traversing the simulation cell from one side to the other . The method for calculation of local energy barrier is the nudged elastic band (neb) technique, as explained earlier in this paper . Two ultranarrow pore entries (named pore entry a and b) were selected for this calculation . Each pore entry provides a limited access to the cavity behind it through a narrow window, as illustrated in figure 5 . Pore entry a (figure 5a) is a 13.30 long and 5.54 wide window (center to center distance). Pore entry b (figure 5b), however, has almost a circular geometry with an average diameter of 7.0 . To ensure that initial configurations of the transiting molecules are closely located to the mean energy pathway at two ends of the transition path, grand canonical monte carlo (gcmc) simulation were used at similar thermodynamic conditions (8.2 mmol / g solid and 323 k) for both co2 and ch4 molecules . The same temperature and pressure were applied to obtain positions of the non - neb (background) molecules . During the neb calculation, framework and background molecules were held fixed and only one neb molecule at a time was allowed to move . Figure 6 depicts energy profiles of individual co2 and ch4 molecules hopping through pore entries a and b. the potential energy in this figure is relative to the potential energy of the neb molecule at the start of its transition path . Here, we note that for the noncircular pore entry a, the energy profile of the methane molecule is very smooth compared to that of carbon dioxide, showing only one maximum (figure 6a). As indicated earlier, a molecule can face multiple saddle points along its transition path, which is the case for co2 here . As a linear molecule, co2 is able to adjust itself according to the geometry of the pore mouth by rotating around its symmetry axis, while hopping through the window . This is shown in figure 7, as well as a movie provided in the supporting information . As shown here, the o o angle is nearly parallel to the pore entry cross - section at the starting and final points of the transition path (figure 7a and c, respectively), while its orientation is perpendicular to the pore entry at the pore mouth (figure 7b). Such adjusting rotations help the molecule to find a pathway with the smallest energy barrier, which in this case is obtained when the orientation of co2 is perpendicular to the pore mouth, as illustrated in the snapshot in figure 7b . In comparison, the spherical geometry of methane makes no difference among different possible orientational configurations of this molecule, thus leading a less noisy energy profile . A similar comparison for pore entry b is even more insightful (figure 6b). In this case, not only ch4 holds a smooth diffusion energy profile, but co2 also shows analogous behavior . Such similarity can be explained based on circular geometry of pore entry b, so that orientational movements of co2 cause limited differences in the interaction potential energy of the molecule with its surrounding pore wall atoms . Geometry of the pore entries a (a) and b (b) selected for neb calculations . Transition energy profile of co2 and ch4 for pore entries a and b under the effect of background molecules (a, b), as well as pore entry b without any background molecule (c). Transition of co2 molecule through pore entry a at reaction coordinates (a) 0, (b) 0.73, and (c) 1 . Snapshot (b) illustrates the orientation of the linear molecule around its symmetry axis at the highest saddle point in order to adjust itself with the limiting geometry of the pore mouth . Figure 6 reveals further information on the effect of structural heterogeneity on the dynamics of fluid molecules in confined spaces . The local energy barrier for ch4 is larger than that of co2 in pore entry a (figure 6a), as may be expected from the larger molecular size of methane . However, our neb simulations indicate that this may not be the only possible scenario . According to the energy profiles of ch4 and co2 in pore entry b, co2 may experience a larger energy barrier despite its smaller and more adjustable molecular geometry (figure 6b). Considering co2 adsorbs stronger (compared to ch4) due to its higher potential strength, a larger repulsive energy will be imposed on the molecule in ultranarrow pores, where atoms interact over distances smaller than their equilibrium distance, as for pore entry b. similarly, when the neb co2 molecule is inside the cavity and outside the pore mouth, it will be attracted more strongly by the surrounding solid atoms, thus, having a lower level of energy compared to ch4 . Consequently, a higher energy barrier for co2 molecule is expected, since the difference between energy levels of the molecule inside the cavity and at the pore entry is larger . However, in pore entry a, where the pore mouth is larger, co2 will face a less severe repulsive barrier . Here, it is also important to study effect of the fluid we have repeated our neb calculations for pore entry b in the absence of background fluid molecules (figure 6c). This way, we have been able to solely investigate interactions of the solid structure with a single neb molecule without any interference from surrounding sources . The result signifies no dramatic change in magnitude of the energy barrier, as well as shape of the energy profile, although saddle - points are seen to be slightly shifted along the reaction coordinate axis, as illustrated in figure 6c . According to this figure, co2 still has to overcome a larger energy barrier compared to ch4, due to its higher potential strength and tight geometry of the pore entry as postulated above . Consequently, it is evident that in the limit of narrow pores, the magnitude of the energy barrier is largely dictated by the solid atoms at the pore mouth and the effect of fluid fluid interactions is insignificant . Our finding of the possibility of co2 molecules being hindered more severely by ultramicropores, together with other evidence from analysis of the limiting free energy barrier at infinite dilution, discussed in the previous section, provides a basic explanation for the question that why ch4 can diffuse faster compared to co2 in microporous materials, especially since existence of such ultramicropores has been theoretically and experimentally confirmed in this class of materials . Higher mobility of ch4 in the microporous structure of sic - dc is demonstrated in the subsequent section of the current paper, based on the diffusivity results obtained from molecular dynamics simulation . Nevertheless, the implication of our neb results on this issue should be considered inadequate for a definite conclusion, and need to be further investigated using methods such as transition path sampling (tps) to obtain hopping rates of the fluid molecules at the pore entry, taking into account effect of entropy on molecular diffusion . In summary, our neb simulations indicate that transition behavior of fluid particles, including shape of the energy profile, as well as quantity and magnitude of saddle points are very sensitive to the heterogeneity of the pore structure, arrangement of the neighboring atoms, molecular geometry, and energetic characteristic of the fluid molecule, in which heterogeneity of the pore structure plays a significant role . To investigate dynamics of co2 and ch4 in the amorphous structure of sic - dc, the loading and temperature dependence of self - diffusivities of these gases have been studied by tracing spatial positions of molecular configurations over time trajectories from multiple md simulations . Starting from initial configurations obtained using gcmc, md simulations were performed at 323, 600, and 1000 k and self - diffusion coefficients were determined using eq 4 . The results for the self - diffusivity of co2 and ch4 at these temperatures are shown in figures 8 and 9, respectively . The error at the highest loading is 11%, while it increases to 20% at low loading . Loading dependence of self - diffusivity of co2 at three different temperatures . Loading dependence of self - diffusivity of ch4 at three different temperatures . It is known that fickian diffusion behavior of gases can be only detected in long time runs, when molecules have escaped their initial local environment and traversed the entire lattice length . This is associated with the residence time, which is the time a particle is moving around inside a cage - like confinement before it can leave the cage to the next repeating part of the simulation cell . At very short time scales, on which intermolecular collisions are negligible, molecules are in the ballistic (free - flight) regime with a quadratic time dependence . This regime is hard to detect in microporous materials, requiring md simulation to be run at very small time steps . This is because of extremely limited spaces available to fluid molecules inside the micropores, so that molecular collisions occur shortly after simulation starts . An intermediate regime is also detectable in nanoporous materials, where fluid molecules start colliding with each other, as well as with the pore wall in a local neighborhood . At longer time steps, fluid molecules experience either a subdiffusive or a fully diffusive regime depending on the pore size and the level of confinement . A subdiffusive regime occurs when molecular diffusion is dominated by the confinement effect of a small pore space or by the traffic of molecules passing through a narrow window at high pressures . A slope of 0.51 is usually measurable on logarithmic coordinates for a single - file subdiffusive regime, in which the molecules are unable to pass each other . However, when molecules enter the diffusive (fickian) regime, the slope will approach unity . Due to the highly heterogeneous structure of amorphous carbon in the sic - dc model, lengthy md simulations were performed to ensure the required residence time is met and the adsorbate molecules have explored the entire lattice length . Moreover, since the fickian diffusion is at the focus of this study, the calculation of self - diffusivity has been performed in the region in which msd is linearly related to the simulation time . Hence, md trajectories were only collected after 1 ps of the simulation time in the production phase to avoid nonlinearity, as well as other anomalies associated with the ballistic and intermediate regimes . Nevertheless, as an exception to this convention, figure 10 depicts the time dependence of the mean square displacement for co2 and ch4 molecules after 0.1 ps of the simulation time at 323 k for both infinite dilution and 8.0 mmol / g loading . As illustrated here, a subdiffusive regime is observed at the beginning of the simulation before the slope of the msd approaches unity . This has been constantly observed for both gases in this study, indicating the effect of confinement in the microporous structure of sic - dc . At low loading, tight confinement of small pores dictates the subdiffusive regime; however, occurrence of this phenomenon at higher pressures suggests strong effect of pore confinement in addition to the tight molecular packing after start of the pore filling at intermediate loadings . Mean - squared displacement of ch4 and co2 as a function of simulation time at 323 k, infinite dilution, and 8.0 mmol / g loading . Our simulation reveals nonmonotonic behavior of molecular diffusion with a maximum in the loading dependence of the diffusion coefficient, as shown in figures 8 and 9 . This behavior is similar to diffusion of argon in disordered bituminous coal - based bpl carbon and ordered carbon replica of faujasite zeolite (c - fau) studied by gubbins and co - workers . Self - diffusion coefficients of both methane and carbon dioxide are smaller at infinite dilution of lower temperatures; however, they increase at slightly higher loadings showing a maximum at intermediate densities . With further increase in the loading the self - diffusivity decreases again . Experimental evidence for diffusion of gases in active carbons and zeolite materials has shown the existence of such maxima in the concentration dependence of gas diffusivity at the level of pore filling . Pfg - nmr studies of disordered nono - porous materials have also confirmed this phenomenon . Two competing mechanisms are postulated to be involved; a site - blocking entropic mechanism, as well as an energetically favored diffusion process . Slow diffusion of fluid molecules at infinite dilution is due to the existence of highly favorable adsorption sites in the amorphous structure of sic - dc . At slightly higher concentrations most of these high affinity sites are already occupied by adsorbed molecules with increasing contribution from sites of weaker adsorption, where mobility is higher . With further increase in loading, fluid molecules fill up the bulk of the large pores, leading to significant increase in molecular collisions and steric interactions, which in turn leads to the decrease in self - diffusion coefficients . This is very similar to what bonilla and bhatia have recently shown in connection with the effect of pore size distribution on diffusion in pore networks . Moreover, according to karger and ruthven, intracrystalline self - diffusivities can demonstrate different patterns of concentration dependence, ranging from constantly descending or ascending self - diffusivities to a pattern yielding a self - diffusivity variation with a maximum, which occurs in the presence of heterogeneity . Heterogeneity of sic - dc structure is evident in our simulation results of the isosteric heat of adsorption, shown in figure 11a c . Here, fluid contributions are depicted separately along with the total heat of adsorption calculated using the fluctuation formula7where n refers to the number of molecules, u is the energy and indicates the average over the simulation run . As depicted in figure 11a, b, the total heat of adsorption has a minimum at intermediate loadings at 323 k and a weaker one at 600 k; this indicates that isosteric heat is higher at infinite dilution due to stronger adsorption of molecules in narrow micropores, where fluid molecules are tightly packed . It is also the low loading region where molecules show smaller mobility (low diffusivity at infinite dilution). The adsorption process becomes less exothermic with increase in loading, because favorable adsorption sites are progressively occupied as loading increases . This trend steadily continuous until it reaches a minimum at intermediate loadings, and then increases again, due to stronger fluid fluid interactions at elevated pressures, evident from the rising fluid fluid contribution to the heat of adsorption in figure 11 . The effect of heterogeneity becomes less significant at very high temperature (1000 k), as demonstrated by the steadily increasing variation of the isosteric heat (figure 11c) and decreasing trend of self - diffusivity with loading at this temperature (figures 8 and 9). At 1000 k moreover, the maximum observed for ch4 at the intermediate loading is still lower than the self - diffusivity of this molecule at infinite dilution, and could also be due to statistical scatter of the md . This behavior is consistent with the monotonically increasing trend of isosteric heat at this temperature, illustrated in figure 11c . It should be noted here that isosteric heat of adsorption is always dominated by the wall fluid contribution, which is an obvious indication of pore confinement . Figures 8 and 9 also demonstrate that, while self - diffusion coefficients of both co2 and ch4 increase with temperature as expected, at high loadings the effect of temperature on enhancement of self - diffusivity is much weaker in comparison to that at infinite dilution or intermediate loadings, an indication of tight molecular packing under these conditions . Variation of isosteric heat of adsorption with loading for ch4 and co2 at (a) 323, (b) 600, and (c) 1000 k. a series of molecular dynamics simulation studies based on reconstructed models of carbonaceous materials have demonstrated similar behavior in diffusion of simple gases . Have shown a similar nonmonotonic behavior of the self - diffusion coefficient for the adsorption of argon in bpl carbon . Gubbins and co - workers observed an analogous trend for diffusion of nitrogen and argon in a reverse monte carlo (rmc) constructed model of saccharose - based carbon . Find similar behavior for their hrmc constructed model of saccharose - based activated carbon, based on the investigation of the self - diffusivity of argon and nitrogen . The results from our md simulations demonstrate anisotropic diffusion of fluid molecules within the sic - dc pore network; so that self - diffusivities of co2 and ch4 in the x direction are always larger than those in other directions (figures 12 and 13). On the other hand, the self - diffusivities in the y and z directions are very close . Such behavior indicates anisotropic structure of amorphous sic - dc, which may be a consequence of unidimensional propagation of the c - sic interface during synthesis . Our finding for anisotropic diffusion of methane and carbon dioxide is in line with our previous studies on structural characterization of silicon carbide - derived carbon, demonstrating a disordered structure with percolation paths propagating anisotropically across the system . Loading dependence of self - diffusivity in different directions for co2, at (a) 323 k, (b) 600 k and (c) 1000 k. loading dependence of self - diffusivity in different directions for ch4 at (a) 323, (b) 600, and (c) 1000 k. in this section, we report on our investigations of the diffusion of ch4 in silicon carbide - derived carbon (sicdc), comparing microscopic molecular dynamics simulation with experimental quasi - elastic neutron scattering (qens) and macroscopic uptake - based kinetics data at low densities . Among a variety of experimental techniques suitable for the measurement of different ranges of the mean length of the diffusion path, the quasi - elastic neutron scattering (qens) technique is known to be consistent with predictions of md simulation . While zero length column (zlc) and uptake - rate measurements can only provide information on long - range diffusion, pulsed - field gradients nuclear magnetic resonance (pfg - nmr) offers more flexibility in measuring distances from a few hundreds of nanometers up to a few micrometers . In contrast, the qens technique is able to measure diffusion distances of the order of a few nanometers, similar to md simulation within current computational capabilities . The results from microscopic measurements such as qens and molecular dynamics simulation do not account for rate limiting internal resistances and structural defects that are usually observable for the mean diffusion path at larger length scales, thus, measuring diffusivity that is a few order of magnitudes larger than those from macroscopic or long - range methods . Volumetric uptake kinetics measurements of ch4 on the sic - dc samples have been carried out at different temperatures using a micromeritics asap 2020 adsorption analyzer, in which the transient pressure variation during small uptake steps was monitored . The corresponding uptake - time curve was interpreted using the model of diffusion in a bidisperse solid to yield a particle scale collective diffusivity, and a slow diffusivity in grain - scale ultramicropores . The details of the experimental study will be provided elsewhere . Here, the low density particle scale diffusion data is compared with the results of qens and md simulation, since self - and collective diffusivities of gases are identical in the limit of infinite dilution . The diffusivities used here have been obtained from uptake data at 400 mmhg using 22.8 m diameter particles and were similar to those at lower pressures . Consequently, they are expected to represent the low density self - diffusivity of methane . In effect, the volumetric uptake - rate method measures the flux through the porous structure of adsorbent material under well - defined boundary conditions, based on the transient pressure change in the sample cell . The diffusivity is then calculated by matching the experimental flux to the solution of the fick s law - based diffusion equation . Measurement of self - diffusivity using qens experiment is, however, based on broadening in the elastic peak of the energy distribution of an incident neutron beam . In practice, interaction of neutrons with diffusing particles gives rise to the doppler shift, which in turn accounts for the broadening of the elastic peak . In this study, the qens experiments were carried out using the time - of - flight spectrometer in6, at the institut laue - langevin (ill). The energy of the incident neutron beam was taken as 3.12 mev, corresponding to a wavelength of 5.12 . The elastic energy resolution could be fitted by a gaussian function, whose half - width at half - maximum (hwhm) varies from 40 ev at small wave vector transfer (q) to 50 ev at large q. the sic - dc sample was first equilibrated at 480 mbar and 300 k and the actual neutron scattering measurement was performed at constant loading (0.85 mmol / g solid) over a range of temperatures from 150300 k. for methane, one follows the mobility of individual ch4 molecules, since the scattering is dominated by the large incoherent cross section of hydrogen . Subtraction of the signal of the degassed material modifies the elastic intensity, as shown in figure 14, because of the large small - angle scattering of the carbon . Spectra obtained at the different q values could be fitted individually with a model consisting of isotropic diffusion, convoluted with isotropic rotation and with the instrumental resolution (figure 14). Several spectra obtained at low q could be fitted simultaneously using a jump diffusion model with a distribution of jump lengths . Figure 15 compares the temperature dependence of the diffusion coefficients for ch4 obtained from md simulation at a loading of 1.2 mmol / g, with that from qens at 0.85 mmol / g and macroscopic uptake - based data at low density . As seen in this figure, the qens - based diffusion coefficients are as much as 1 order of magnitude larger than those based on the md simulation . . This is because the length scale probed by this qens measurement is not large enough: the lowest q value, 0.29, corresponds to a distance in real space of 2/q 22 . This is smaller than the size of the unit cell used in the md calculations . However, what is remarkable here is the excellent agreement between predictions of the md simulation with the macroscopic uptake - based data at low density . Since long - range diffusion of fluid molecules is considerably retarded by internal barriers arising from structural constrictions and disorder, macroscopic diffusivities are almost always several orders of magnitude smaller than microscopic diffusivities, usually measured by molecular dynamics simulation or qens experiments, which probe much smaller length scales . Interestingly, our md results are close to the macroscopic - based diffusivities within a factor of 23 . This kind of agreement is remarkable and indicative of the ability of our hrmc constructed model of sic - dc to accurately capture the key internal constrictions and barriers arising from the disorder in this material, so that it can successfully reproduce both equilibrium and dynamics of gas adsorption based on the results provided here and in our previous publication . Nevertheless, the higher activation energy of the macroscopic measurements, of 14.2 kj / mol, in comparison to that from simulation, of 7.05 kj / mol, seen in figure 15 does indicate the presence of additional barriers not captured by the hrmc model . Further, the difference between the simulation - based activation energy and that of the uptake experiment may in part be due to the fact that experimental measurements were carried out over a narrow temperature range while our sampling in md covers a much broader range . The self - diffusivities of ch4 and co2 obtained from md simulation are also compared in figure 16, showing slightly higher activation energy of carbon dioxide (10.28 kj / mol) compared to methane (7.05 kj / mol). Comparison between experimental and fitted qens spectra obtained for ch4 at 300 k at different wave vector transfers: (a) 0.29, (b) 0.36, and (c) 0.41 . The negative elastic intensity is due to the subtraction of the empty sic - dc . Comparison of temperature dependence of emd diffusion coefficient with qens and uptake - based data, for ch4 at 400 mmhg . Arrhenius plot of self - diffusivities of ch4 and co2, obtained from emd simulation . We have investigated the heterogeneity of the energy landscape of the amorphous structure of microporous silicon carbide derived carbon using a representative atomistic hrmc model of the sic - dc . The limiting free energy barrier, the percolating free energy threshold, henry constant, and differential heat of adsorption of water, carbon dioxide, methane, and argon have been determined in the limit of infinite dilution using analysis of free energy landscape . Hydrophobicity of carbon structure is shown based on high minimum free energy of binding of water, as well as low heat of adsorption of this molecule compared to other adsorbates . It is shown that both methane and carbon dioxide are more favorably adsorbed compared to water . We have demonstrated how structural heterogeneity of the disordered system generates an inhomogeneous energy landscape, which in turn gives rise to the formation of high energy cluster - like adsorption sites for ch4 and co2 . The limiting free energy barrier of the system for each gas was computed from the difference between the most energetic energy sites and the percolating free energy threshold . This barrier is directly related to the existence and distribution of the above - mentioned high energy adsorption clusters, which affect mobility and diffusion of fluid molecules . With the use of nudge - elastic band (neb) method, we have provided tangible evidence that molecular geometry, surface roughness, and structural disorder of the pore wall influence diffusion through ultranarrow pore entries . Our neb calculations confirm that the diffusion of single molecules can be quite sensitive to structural heterogeneity and associated barriers . We find that the co2 molecule can face a larger energy barrier compared to ch4 in ultramicropores, despite its linear and smaller molecular geometry . This is confirmed not only by our neb calculations, but also by analysis of the free energy map of the system at infinite dilution . We have also investigated self - diffusion of methane and carbon dioxide over a wide range of densities and temperatures using both simulation and experimental techniques . Anisotropic diffusion of ch4 and co2 is found, and considered to be related to structural heterogeneity and pore size distribution of sic - dc, arising from unidimensional motion of the reaction interface during chlorination of the sic precursor . The structural heterogeneity and disorder of the sic - dc is evident from the initial increase of self - diffusivity and decrease of the isosteric heat of adsorption with increase in loading . This observation is shown to be consistent with other investigations on heterogeneous carbonaceous materials . A comparison of our simulation results with experimental qens and low density macroscopic uptake - based data shows remarkable agreement between md - based and the macroscopically measured diffusivities . Such agreement indicates adequacy of our hrmc constructed model of sic - dc in capturing the internal heterogeneity and barriers affecting transport in the structure . Nevertheless, from the difference between the activation energies obtained from md simulation and qens with that from macroscopic uptake, we conclude that there are some long - range internal barriers and structural constrictions, which are not captured by md or the qens experiment.
Down syndrome is caused by trisomy 21 and is frequently associated with cognitive impairments . Based on the partial triplication of chromosome 16, the mouse homologue of human chromosome 21, a mouse model (ts65dn) has been developed that shows behavioral abnormalities, including deficient hippocampus - dependent learning and memory [1, 2]. Although most studies regarding the neurobiology of down syndrome have been focused on neurodevelopment, recent evidence suggests that pathophysiological processes in the adult brain significantly contribute to cognitive impairments in this disorder [38]. In ts65dn mice, enhanced inhibitory synaptic transmission suppresses proper induction of hippocampal synaptic plasticity, an important cellular mechanism for learning and memory formation . Strikingly, using a variety of different gabaa receptor antagonists to suppress the abnormally increased level of inhibition in adult ts65dn mice fully restored their learning and memory impairments without affecting wild - type controls . These beneficial effects were not evident, however, with only acute administration of gabaa receptor antagonists but instead became clear only with a more prolonged (2 - 3 weeks) treatment . This prolonged treatment was then sufficient to cause improvements in cognitive function lasting well beyond the actual treatment period, suggesting that treatment triggered lasting neurobiological changes . The neurobiological basis of these nonacute gabaa receptor antagonist treatment - induced behavioral modifications is currently unknown . Key insights into potential mechanistic aspects, however, may be provided by a brief review of brain development . During postnatal brain development, inhibition plays an important role in regulating the temporal extent of critical periods (i.e., developmental time windows during which sensory input can substantially shape brain structure and function) [9, 10]. Remarkably, several experimental manipulations that lower inhibitory synaptic transmission have been found to reinstate high levels of plasticity in the adult brain resembling those found in critical periods [1113]. It is possible that high levels of plasticity, characteristic of critical periods, are actively suppressed in adults by mechanisms including increased inhibition . Therefore, one strategy to enhance plasticity in the adult brain could be the removal of these constraints by lowering inhibition [14, 15]. One pharmacological manipulation particularly interesting from a translational point of view reported that ocular dominance plasticity is reinstated in the mature rat visual cortex by chronic treatment with the widely prescribed antidepressant fluoxetine, presumably also via a decrease in inhibitory synaptic transmission . Used brain in vivo microdialysis to show reduced levels of extracellular gaba in the visual cortex of fluoxetine treated animals . White matter ltp, a form of synaptic plasticity that is normally absent in the adult brain due to matured intracortical inhibition, was present in fluoxetine - treated animals . Bdnf expression was increased as a consequence of fluoxetine treatment, and intracortical bdnf administration was sufficient to cause an ocular dominance shift in response to monocular deprivation . To test if reduced inhibition underlies the effects of fluoxetine on ocular dominance plasticity, the gabaa receptor agonist diazepam was administered intracortically in fluoxetine - treated mice, which fully occluded the effect of fluoxetine on ocular dominance plasticity . Translation of the preclinical gabaa receptor antagonist findings in ts65dn mice (see above) [4, 8] to clinical populations is hampered by the fact that none of the employed gabaa receptor antagonists is currently in clinical use . Gabaa receptor antagonists have narrow therapeutic windows and harsh side effect profiles and therefore have limited potential for translational applications, warranting the search for novel treatment approaches . We note that other strategies safer than gabaa receptor antagonists have been proposed for the treatment of down's syndrome - related cognitive impairments, including gabaa receptor 5-selective inverse agonists and other compounds [1619]. Here, we followed up on the finding that chronic fluoxetine treatment induced reduced levels of inhibition and enhanced plasticity, suggesting that chronic fluoxetine administration may have beneficial effects on cognitive dysfunction in ts65dn mice, similar to gabaa receptor antagonists . Treatments with selective serotonin reuptake inhibitors (ssris), such as fluoxetine, influence the serotonin system and also have complex effects on gabaergic neurotransmission [2023], including pre- and postsynaptic effects, which may include an inhibition of evoked inhibitory postsynaptic potentials due to elevated extracellular serotonin levels . In the hippocampus, the serotonergic system has been proposed to be involved in shifting inhibition from dendritic to perisomal areas, which should allow for greater dendritic excitation and synaptic plasticity . We tested if an oral fluoxetine treatment regime has therapeutic effects on cognitive impairments (spatial learning in the morris water maze) in the ts65dn mouse model of down syndrome . There were no beneficial effects of fluoxetine treatment on behavioral impairments in ts65dn mice but, instead, unexpected side effects including seizures and death due to treatment that appeared to be genotype specific . Experimental animals were generated by crossing c57bl / ejeij c3sn.blia-pde6b + f1 hybrid wild - type males with b6eic3sn.blia-ts(17)65dn/dnj females (breeders were purchased from the jackson laboratories). A 1 - 1 mating scheme was used, and males were left in the mating cage with the female and her litter . Mice received water and food ad libitum . Experiments were carried out during the light period of the cycle . Male and female animals used for experiments were between 149 and 227 days of age at completion of the study (sex and age were approximately balanced across groups). Fluoxetine hydrochloride (sigma) was administered to the animals through the drinking water at a concentration of 0.2 mg / ml as previously described . Animals were treated for 4 weeks before behavioral assessment commenced and were sacrificed after 6 weeks of treatment . Initially, mice were handled for 7 days (for approximately 2 min / animal / day) to habituate the animals to investigator contact and procedural elements associated with the task . Following handling, mice were trained on the hidden version of the water maze . During water maze training, the escape platform was hidden underneath the water surface in a constant location of the pool . The pool (med associates) had a diameter of 1.2 m and was filled with opaque water (temperature: 2224c). Behavior of the animals was recorded using an automated tracking system (ethovision xt, noldus). During training trials, accordingly, intertrial intervals were approximately 1 min between trials 1 and 2, as well as trials 3 and 4, and were approximately 90 min between trials 2 and 3 . Training trials were completed when mice climbed on the escape platform or when 1 min had elapsed, whichever came first . Animals were given 15 s posttrial interval on the escape platform after completion of training trials . To evaluate the accuracy with which the animals had learned the position of the escape platform, we performed a probe trial once training was completed . During the probe trial, we removed the escape platform from the pool, and animals were released into the pool from the starting position within the opposite quadrant (oq). We determined the time that mice spent searching in the target quadrant (which previously contained the escape platform) or the other quadrants during the probe trial . Additionally, we analyzed the number of crossings of the exact target location (i.e., where the platform was during training) and compared it to crossings of analogous positions in the other quadrants . As an additional probe trial measure, we determined the average distance (proximity) to the target location and compared it to the average distance to corresponding locations in the other quadrants . To assess if the probe trial measures differed across genotypes and/or treatment groups, we performed a three - way anova with genotype and treatment as between - subjects factors and quadrant as a within - subject factor . Additionally, to assess for spatial selectivity of searching during the probe trial, we performed t - tests to compare target quadrant measures to the corresponding average values of the other quadrants . Escape latencies during training were analyzed by two - way anova with genotype and treatment as between - subjects factors . Swim speed during training and probe trial was analyzed by two - way anova with genotype and treatment as between - subjects factors . Also, distance travelled during the probe trial was analyzed by two - way anova with genotype and treatment as between - subjects factors . Mice were placed for 10 min in a square open field made of acrylic (footprint 27.5 cm 27.5 cm); activity was recorded and analyzed using an automated system (ethovision xt, noldus). Light levels were set to 100 lux in the center of the open field . Mice were anesthetized and perfused transcardially with 0.9% saline and 4% paraformaldehyde in cold 0.1 m phosphate buffer (ph 7.4). Brains were extracted, postfixed in 4% paraformaldehyde over night, and subsequently transferred into 30% sucrose . Forty micrometer coronal section series were then created using a sliding microtome (leica). Sections were stored in cryoprotectant solution (25% ethylene glycol, 25% glycerine, and 0.05 m phosphate buffer) at 20c . Every sixth section of the coronal section series mentioned above (i.e., sections 240 m apart) was used for free - floating immunohistochemistry . Sections were rinsed in tbs, incubated in a solution containing 0.6% h2o2 in tbs to inhibit residual endogenous peroxidase, and blocked for 30 min in tbs with 3% donkey serum and 0.1% triton x-100 . Sections were then incubated for 48 h at 4c in a primary antibody solution (rabbit anti - choline acetyltransferase (anti - chat), millipore, 1: 100) containing tbs, 3% donkey serum, and 0.1% triton x-100 . Subsequently, sections were rinsed in tbs, blocked in tbs with 3% donkey serum and 0.1% triton x-100, and incubated for 1 h at room temperature in secondary antibody (biotinylated donkey anti - rabbit igg, dianova, 1: 500). Next, sections were washed with tbs and subjected to 1 h incubation in avitin - biotin peroxidase complex in tbs (abc elite, vector). Sections were mounted, air - dried, dehydrated with a graded series of ethanol, and mounted with permount . Stereological analyses of cell number and cell size of choline acetyltransferase - immunostained cells were performed on section series stained against choline acetyltransferase with sections 240 m apart, covering the entire fronto - occipital extension of the hemisphere . Analyses were carried out using a nikon eclipse 90i microscope equipped with stereo investigator (microbrightfield). Quantitative analysis of the total number of chat - positive neurons in the basal forebrain including ventral diagonal band nuclei (vdb) and medial septum nuclei (msn) was performed in an unbiased fashion using the optical fractionator method as described previously [24, 25]. This method allows for a systematic random sampling of the region of interest (roi). The landmarks outlining the roi (msn and vdb) were taken from the mouse brain atlas . Rois were manually marked, and pictures from every roi were taken using the stereo investigator software . With a sampling grid of 90 m 90 m systematically moving through the outlined roi, we counted chat - positive neurons that were either within the dissector counting frame (60 m 60 m) or that were touching its right / upper edge . Cell size of chat - immunoreactive neurons was determined on the same section series using the nucleator probe within the stereo investigator software . Six rays extending from the nucleus were used to mark the boundaries of the cells, allowing an estimation of cell surface area . To test if adult - onset fluoxetine treatment has a beneficial effect on behavioral features associated with the ts65dn mouse model of down syndrome, we initiated fluoxetine or vehicle control treatment in ts65dn mice and 2n (diploid) littermate controls (2n / vehicle: n = 9 mice; 2n / fluoxetine: n = 11 mice; ts65dn / vehicle: n = 7 mice; ts65dn / fluoxetine: n = 9 mice). Body weight measurements were taken after 1 month of treatment with fluoxetine or vehicle control (figure 1; 2n, vehicle: n = 8 mice; 2n, fluoxetine: n = 11 mice; ts65dn, vehicle: n = 7 mice; ts65dn, fluoxetine: n = 7 mice). Two - way anova with genotype and treatment as between - subjects factors revealed significant main effects of genotype (anova genotype f(1,29) = 7.37, p = 0.01) and treatment (anova treatment f(1,29) = 5.42, p = 0.03), while there was no significant interaction between the factors (f(1,29) = 0.85, p = 0.77). Fluoxetine treatment reduced body weights in ts65dn mice relative to ts65dn vehicle controls (fisher's plsd ts65dn / fluoxetine versus ts65dn / vehicle, p = 0.04). Fluoxetine had no significant effect on body weight within 2n littermate controls (fisher's plsd 2n / vehicle versus 2n / fluoxetine, p = 0.19). Unexpectedly, during the approximate 6-week treatment period, 4 out of 9 ts65dn mice treated with fluoxetine died (table 1). There were no deaths among the vehicle - treated ts65dn mice (0 out of 7 mice) and the fluoxetine - treated wild - type animals (0 out of 11 mice). In the vehicle - treated wild - type group, 1 out of 8 mice was found dead during the treatment period (fisher's exact test, ts65dn / fluoxetine group versus collapsed data from the other groups, p = 0.01). We started our behavioral assessment of fluoxetine - treated and vehicle - treated ts65dn mice and their respective wild - type control groups by testing general exploratory activity in an open field assay (figure 2; 2n, vehicle: n = 8 mice; 2n, fluoxetine: n = 11 mice; ts65dn, vehicle: n = 7 mice; ts65dn, fluoxetine: n = 7 mice). There was no effect of genotype on total distance travelled in the open field (two - way anova with genotype and treatment as between - subjects factors: f(1,29) = 0.73, p = 0.4). Statistical analysis showed a significant effect of drug treatment on activity levels (two - way anova with genotype and treatment as between - subjects factors: f(1,29) = 5.24, p = 0.03) and suggested a possible genotype treatment interaction (two - way anova with genotype and treatment as between - subjects factors: f(1,29) = 3.35, p = 0.08). Activity levels were significantly reduced in fluoxetine - treated ts65dn mice relative to vehicle - treated trisomic mice (fisher's plsd, p = 0.04). Corresponding post hoc analysis did not show a significant effect of treatment in wild - type animals (fisher's plsd, p = 0.5). To determine if fluoxetine treatment restores spatial learning and memory deficits in ts65dn mice, we tested ts65dn mice and wild - type littermate controls, either treated with fluoxetine or vehicle, in the hidden platform version of the morris water maze (figure 3; 2n, vehicle: n = 8 mice; 2n, fluoxetine: n = 11 mice; ts65dn, vehicle: n = 7 mice; ts65dn, fluoxetine: n = 7 mice). Escape latencies decreased during training in all groups (figure 3(a)), although to a more limited extent in ts65dn mice (both vehicle and fluoxetine treated). Statistical analysis revealed a significant main effect of genotype with higher escape latencies in ts65dn mice compared to 2n controls (two - way anova with genotype and treatment as between - subjects factors: f(1,29) = 20.11, p = 0.0001). There was no significant main effect of treatment (two - way anova: f(1,29) = 0.07, p = 0.79) and no genotype treatment interaction (two - way - anova: f(1,29) = 2.07, p = 0.16). We analyzed swim speed during all training sessions and the probe trial using repeated - measures two - way anova with genotype and treatment as between - subjects factors (figure 3(b)). Swim speed was significantly decreased in ts65dn mice relative to 2n controls (repeated - measures two - way anova: f(1,29) = 9.15, p = 0.005). There was no significant effect of treatment on swim speed (repeated - measures two - way anova: f(1,29) = 2.258, p = 0.144) and no significant genotype treatment interaction (repeated - measures two - way anova: f(1,29) = 0.529, p = 0.473). To evaluate how accurately the mice had learned the escape platform position during training, we performed a single - probe trial (no platform in the water tank) after completion of training (figures 3(c), 3(d), and 3(e)). We analyzed several probe trial measures that report spatial selectivity of searching and, hence, indicate the extent of spatial learning that occurred . First, we measured the time that the animals spent in the target quadrant (which previously contained the escape platform) and the other quadrants during the probe trial (figure 3(c)). Statistical analysis of the quadrant occupancy data showed significant genotype quadrant and treatment quadrant interactions (three - way anova with genotype and treatment as between - subjects factors and quadrant as within - subjects factor: genotype quadrant interaction, f(3,116) = 5.24; p = 0.002, treatment quadrant interaction: f(3,116) = 5.48, p = 0.002), indicating that genotype and treatment had significant effects on quadrant occupancy . Vehicle - treated 2n controls spent significantly more time in the target quadrant than the other quadrants (t - test, target quadrant occupancy versus average occupancy of the other quadrants: p = 0.001), indicating memory for the platform location . In contrast, in the other groups, target quadrant occupancy was not significantly different from average occupancy of the other quadrants (t - test, target quadrant occupancy versus average occupancy of the other quadrants: 2n / fluoxetine, p = 0.292; ts65dn / vehicle, p = 0.267; ts65dn / fluoxetine, p = 0.241). We also recorded the number of target crossings (i.e., crossings of the exact target location, where the platform was located during training) during the probe trial, which was compared to the number of crossings over corresponding locations in the other quadrants (figure 3(d)). With respect to target crossings, anova analyses yielded a significant effect of genotype (three - way anova with genotype and treatment as between - subjects factors and quadrant as within - subjects factor: f(1,116) = 17.3, p <0.0001), reflecting an overall reduced number of crossings in ts65dn mice and, additionally, a possible genotype quadrant interaction (three - way anova with genotype and treatment as between - subjects factors and quadrant as within - subjects factor: f(3,116) = 2.25, p = 0.09). To further probe for spatial selectivity of searching, we asked whether animals showed significantly more crossings over the target location than over corresponding locations in the other quadrants . Fluoxetine - treated 2n mice showed significantly more crossings of the target location than the other locations (t - test, target crossings versus average crossings of corresponding locations in the other quadrants: p = 0.010), while this was not the case for the other groups (t - test, target crossings versus average crossings of corresponding locations in the other quadrants: 2n / vehicle, p = 0.100; ts65dn / vehicle, p = 0.362; ts65dn / fluoxetine, p = 0.784). As a third measure for spatial selectivity of searching, we looked at proximity to the target (i.e., average distance to the target location, where the platform was located during training) and compared it to the average distance to corresponding locations in the other quadrants (figure 3(e)). Three - way anova with genotype and treatment as between - subjects factors and quadrant as within - subjects factor showed a significant main effect of genotype (f(1,116) = 7.10, p = 0.009), which was reflective of the overall larger distances that ts65dn mice had to the target position and corresponding positions in the other quadrants . This anova also revealed a significant genotype quadrant interaction (f(3,116) = 4.10, p = 0.008) and a significant treatment quadrant interaction (f(3,116) = 5.25, p = 0.002), showing that the search pattern was influenced by genotype and treatment, such that target - preferential searching was less pronounced or absent in ts65dn mice / fluoxetine - treated mice . Vehicle - treated 2n mice showed significantly lower proximity values to the target than average distance to the other positions (t - test, proximity to target versus average proximity to corresponding locations in the other quadrants: p = 0.005), again indicating preferential searching in the relative vicinity of the target in this group . This comparison yielded nonsignificant results for the other groups (t - test, target crossings versus average crossings of corresponding locations in the other quadrants: 2n / fluoxetine, p = 0.550; ts65dn / vehicle, p = 0.442; ts65dn / fluoxetine, p = 0.077). As expected based on the slower swim speed in ts65dn mice (see above), total distance travelled during the probe trial was significantly reduced in ts65dn mice (figure 3(f); two - way anova with genotype and treatment as between - subjects factors: genotype effect, f(1,29) = 10.98, p = 0.003; treatment effect, f(1,29) = 3.21, p = 0.084, genotype treatment interaction, f(1,29) = 0.14, p = 0.706). Taken together, the probe trial revealed indications of spatially selective searching and, hence, successful spatial learning and memory in vehicle - treated (see quadrant occupancy and proximity to target) and fluoxetine - treated (see target crossings) 2n mice, but not in ts65dn mice, irrespective of treatment group . These data show clear behavioral abnormalities of ts65dn mice in the water maze, which are consistent with published data [2, 8, 27] and reflect motor impairments (see swim speed) and spatial learning and memory difficulties (see probe trial measures) in ts65dn mice . Neither motor impairments nor spatial learning deficits in ts65dn mice were improved by fluoxetine treatment . During behavioral experimentation, we incidentally witnessed tonic - clonic seizures triggered by handling in a few animals (a total of 3 mice) (table 2). Seizures were not observed in the other groups (fisher's exact test, ts65dn / fluoxetine group versus collapsed data from the other groups, p = 0.01). One of the neuropathological hallmarks of both down syndrome and alzheimer's disease is the age - dependent loss of basal forebrain cholinergic neurons (bfcns) [24, 28]. Previous studies pointed to a correlation between bfcn degeneration and abnormalities in memory and learning in aging ts65dn mice . To probe whether fluoxetine is able to ameliorate or prevent early bfcn degeneration in ts65dn mice, we performed unbiased stereological cell counts of choline acetyltransferase (chat) antibody - stained sections in fluoxetine - treated animals and vehicle controls . We determined the cholinergic cell number and size (figure 4) in the medial septal nuclei (msn) and ventral diagonal band (vdb) of each group (2n, vehicle: n = 8 mice; 2n, fluoxetine: n = 11 mice; ts65dn, vehicle: n = 7 mice; ts65dn, fluoxetine: n = 5 mice). No clear differences with regards to cholinergic cell number were evident between trisomic and euploid mice (two - way anova with genotype and treatment as between - subjects factors: f(1,27) = 0.04, p = 0.84). Treatment also had no obvious effects on the number of chat - positive cells in basal forebrain cholinergic nuclei (two - way anova with genotype and treatment as between - subjects factors: f(1,27) = 0.61, p = 0.44). Since neuronal atrophy precedes cell loss, we analyzed cell size of chat - positive cells in bfcn of fluoxetine-/vehicle - treated ts65dn mice / wild - type controls . Cholinergic neurons of euploid mice were insignificantly larger than those in trisomic mice (two - way anova with genotype and treatment as between - subjects factors: f(1,27) = 2.2, p = 0.15). Fluoxetine treatment had no significant effect on cell size, although there was a trend towards increasing cell size in ts65dn mice (two - way anova with genotype and treatment as between - subjects factors: treatment effect, f(1,27) = 3.08, p = 0.091; genotype treatment interaction, f(1,27) = 3.14, p = 0.08). In the present study, we set out to test whether a 4-week, adult - onset fluoxetine treatment is effective against behavioral alterations in the ts65dn mouse model of down syndrome . In particular, we did not observe a treatment effect on the clear ts65dn behavioral phenotype in the water maze, which included slower swim speed and effects on probe trial measures indicative of spatial learning and memory impairments . Adverse side effects due to fluoxetine treatment of ts65dn mice, however, appeared to be profound in our cohort . Four out of 9 ts65dn mice died while on fluoxetine treatment during which time there were no deaths in the other groups (with the exception of 1 dead wild - type / vehicle animal). These results suggest that fluoxetine may have a genotype - specific adverse effect and warrant further experimentation in larger animal cohorts that also assess the cause of death in fluoxetine - treated ts65dn mice . We observed handling - induced seizures in a few mice, all of which were fluoxetine - treated ts65dn mice, suggesting interactive effects of ts65dn genotype and fluoxetine treatment on seizure susceptibility . Seizures represent a relatively rare side effect of therapeutic fluoxetine regimens in general clinical populations but are a more common feature of fluoxetine intoxications [2931]. Several epilepsy paradigms in animal models also illustrate a proconvulsive effect of fluoxetine; for instance, fluoxetine pretreatment potentiates the convulsive effects of pentylenetetrazol (ptz) and electrically evoked seizures [32, 33]. Collectively, these reports show that treatments with selective serotonin reuptake inhibitors, including fluoxetine, can lower seizure thresholds in humans and animal models . Epilepsy is not uncommon in down syndrome and may affect 113% of all individuals with trisomy 21 [34, 35]. Although spontaneous seizures are not a feature of the ts65dn model, ts65dn mice are more prone to audiogenic seizures than controls, suggesting reduced seizure thresholds in this model . In sum, the data raise the possibility that behavioral convulsions in ts65dn mice, described above, may result from an interaction between fluoxetine and the lowered seizure thresholds in ts65dn mice . Future studies should examine these effects in larger animal cohorts and include electrophysiological assessments of seizure activity . For the present study, we adopted a fluoxetine treatment regime used previously, that is, administration of 0.2 mg / ml fluoxetine via the drinking water . This treatment regime was found to lower intracortical inhibition and to reinstate ocular dominance plasticity in the adult visual cortex . The fluoxetine dose is higher than rodent equivalents of clinically used doses (i.e., clinically employed doses converted into equivalent surface area doses for mice / rats) but is within the range of fluoxetine dosing schemes generally used in mice and rats (e.g., [20, 37, 38]). In future work, it will be important to establish a dose - response function with respect to the side effects in ts65dn mice . Based on our present data, we cannot rule out the possibility that lower fluoxetine doses exert beneficial effects in the ts65dn model of down syndrome . It will also be important to determine if drug genotype interactions are caused by genotype - dependent differences in cns effects of fluoxetine or, possibly, different pharmacokinetic profiles in ts65dn mice and wild - type controls (e.g., metabolism of fluoxetine, tissue distribution, etc . ). The animals used in the present study were partly in the age range in which neurodegenerative processes may slowly begin in ts65dn mice (i.e.,> 6 months of age). We assessed neurodegeneration via stereological quantification of basal forebrain cholinergic neurons and did not observe significant differences between trisomic and euploid animals (figure 4), showing that neurodegenerative changes were not a prominent feature in our ts65dn cohort (consistent with other reports showing that first signs of degenerative changes affecting the cholinergic system in ts65dn mice emerge between 6 and 12 months; [28, 39]). Nevertheless, we cannot rule out the possibility that subtle degenerative changes were already present, yet not measureable in our cohort . Therefore, it remains possible that adult - onset fluoxetine treatment has beneficial effects in 36 months old ts65dn mice (i.e., in the narrow time window during adulthood, wherein ts65dn mice are thought to be free of degenerative changes). A prior study had assessed the effect of fluoxetine treatment on hippocampal neurogenesis in 25 months old ts65dn mice . And treatment was shorter (15 days) and involved lower dosing (5 mg / kg) than treatment in the present study . Fluoxetine treatment increased neurogenesis in ts65dn mice and wildtype controls, which is in agreement with earlier reports regarding the effects of chronic fluoxetine treatment on adult hippocampal neurogenesis . Behavioral results were not reported and, hence, it remains unclear whether there was a behavioral effect associated with fluoxetine treatment of ts65dn mice in this study . Another more recent study reported beneficial effects of fluoxetine, administered early postnatally, in the ts65dn mouse model . In this study, fluoxetine was administered from p3 to p15 (s.c . Injections of 5 mg / kg from p3 to p7 and 10 mg / kg from p8 to p15) followed by a brdu injection at p15 to label proliferating cells . Fluoxetine increased cell proliferation and generation of new neurons in the dentate gyrus and subventricular zone of ts65dn mice and wild - type controls . Fluoxetine treatment increased the number of dentate gyrus granule cells at p45 in ts65dn mice to wild - type control levels, while granule cell numbers were reduced in vehicle ts65dn mice . Limited behavioral assessment was performed in the context of this study in juveniles (at p43). Context fear - conditioning impairments in juvenile ts65dn mice were improved by early postnatal fluoxetine treatment, while fluoxetine had no effects on wild - type controls . In the present study we did not find beneficial effects of fluoxetine treatment on behavioral impairments of adult ts65dn mice in the morris water maze . It is possible that early postnatal and adult - onset fluoxetine treatments have different effects on behavioral impairments in ts65dn mice . The protocols in our study, however, differ also in a number of other respects from the published paper (e.g., fluoxetine dose, route of administration, and duration of treatment; behavioral paradigm: here, we assessed learning in the water maze; bianchi et al . Assessed fear conditioning), which may also account for the different findings . In future studies, it will therefore be important to further explore this parameter space, that is, to establish dose - response relationships for fluoxetine treatment in ts65dn mice at different ages and to conduct comprehensive behavioral assessments that cover impairments of ts65dn mice in a range of behavioral tasks . Here, we determined the impact of an adult - onset, chronic treatment with the antidepressant fluoxetine on behavioral alterations in the ts65dn mouse model of down syndrome . We did not find a beneficial effect of fluoxetine treatment on ts65dn behavioral phenotypes, but instead our findings suggest the presence of genotype - dependent fluoxetine side effects; we observed seizures and mortality in treated ts65dn mice, but not wild - type controls . Future studies should reevaluate these findings in larger animal cohorts, determine what the nature of the possible drug genotype interaction is (e.g., genotype - dependent differences in drug metabolism, tissue distribution, or truly differential effects of equivalent drug tissue concentrations on cellular / tissue functions), and establish dose - response relationships for these possible side effects.
Infection belongs to the most common complications after human stem cell transplantation (hsct) and constitutes one of the major causes of transplantation - related mortality . Immune deficiency, which persists after hsct for over a year, can be the cause of an atypical and sometimes abrupt course of infectious diseases, characterized by rapid multi - organ spread of pathogens and their resistance to treatment . Severe infections at later stages after transplantation (100 days after hsct) are observed in 4080% of patients . Infections caused by atypical intracellular opportunistic bacteria (including listeria spp ., nocardia spp . Or bartonella spp . ), which are usually responsible for late post - transplantation infections, pose a diagnostic challenge . Since their culture is difficult, the results are usually negative . Serological tests are not suitable due to insufficient antibody production, and molecular assays are of limited sensitivity which additionally decreases with the duration of infection . This article presents the crucial role of ultrasound imaging in the establishment of a clinical diagnosis of bartonellosis (i.e. Cat scratch disease) and implementation of effective therapy in a patient after allogenic hsct with severe atypical infection involving multiple organs . A seven - year - old girl received hsct from an unrelated donor due to severe aplastic anemia . After five months, during which the patient received immunosuppressive therapy, she was admitted to hospital due to fever with no other significant signs . Multiple bacterial cultures, microbiological and parasitological tests as well as molecular tests for infections with pneumotrophic viruses, cytomegalovirus or epstein - barr virus were negative . Imaging examinations of the chest, abdomen and paranasal sinuses (us, ct, mri) revealed no changes . Empirical broad - spectrum antibiotic therapy, which was modified several times, and anti - fungal treatment were ineffective . Hectic fever with 34 peak episodes up to 3940c daily persisted for 4 weeks and crp reached 195 mg / l . Repeated microbiological and molecular tests extended to detect atypical pathogens were still negative . In the fourth week of hospitalization, abdominal us, ct and the lesions were round or oval, homogeneously hypoechoic / hypodense with the size from several to several dozen millimeters; they were not found to be vascularized . Us showed deformation of vessels around the foci and hyperechoic contrasting intrusions within the lesions, which grew and multiplied over time (fig . Exclusion of other infections, no response to antibacterial and antifungal treatment, information about pet exposure provided by the parents as well as a typical radiological image of the lesions led to a probable diagnosis of bartonellosis . Ultrasound image of the splenic manifestation of suspected bartonellosis: a. disseminated, oval, anechoic and non - vascularized lesions 4 weeks after the onset of fever; b. more numerous lesions, most of which contain hyperechoic intrusions; some neighboring lesions fuse 16 day of treatment; c. regression of the lesions with residual irregular calcifications after 12 months of treatment long - term combined treatment was implemented: azithromycin and amikacin, followed by doxycycline and amikacin as well as ciprofloxacin and co - trimoxazole . Fever subsided, crp was observed to normalize and the lesions within organs regressed gradually . Within the subsequent weeks, the patient developed similar painless and non - inflammatory nodules in the cervical lymph nodes, subcutaneous tissue of the arm and thyroid gland (fig . Us revealed that lesions in the organs and soft tissues showed a typical evolution pattern: their size increased to 1020 mm and sometimes they fused with one another . Subsequent treatment with azithromycin alternately with cotrimoxazole, which lasted for approximately a year, led to the regression of all organ and subcutaneous foci leaving multiple calcifications . After a year from the conclusion of the therapy, the girl was healthy and remained in a very good physical condition ultrasound image of thyroid involvement in the course of suspected bartonellosis: a. a single oval, anechoic lesion that alters the outline of the gland in the 15 week of treatment; b. presence of a hyperechoic intrusion in the center; no new lesions 28 day of treatment; c. calcification of the lesion after 12 months of treatment cat scratch disease, caused by bartonella henselae, is typically manifested by localized skin lesions, enlarged regional lymph nodes and fever . In immunocompromised patients, the disease can have a severe, systemic course and affect internal organs, usually the liver, spleen and subcutaneous tissue . The multi - focal proliferation of capillary endothelia with the formation of cavernous spaces filled with blood and necrotic tissue results in the development of multiple disseminated nodular lesions in affected organs, which is referred to as peliosis hepatis / lienalis . In imaging, these lesions are multiple, homogeneous and hypoechoic / hypodense, and resemble abscesses or granulomas . The detectability of bartonella infection in immunocompromised patients can be significantly underestimated, which is indicated by the common occurrence of this pathogen . Antibodies against b. henselae are found in 81% of cats and in 1948% of people in the general european population . Life - threatening multi - organ infection after hematopoietic stem cell transplantation requires rapid therapeutic intervention even when the microbiological confirmation of its etiology is not possible . A probable infection with bartonella can be suspected if at least two of four criteria are met: 1) history of cat exposure; 2) detection of antibodies against bartonella; 3) presence of multiple hypoechoic/ hypodense hepatic lesions in imaging; 4) granulomatous or angiomatous lesions with additional positive staining for bartonella . A certain diagnosis requires isolation of bartonella from cultures or detection of its genetic material . These patients presented disseminated organ lesions with similar features to those observed in our patient . B. henselae infection was confirmed in only 13 cases . In the remaining 16 patients, rostad et al . Have reported the presence of the same ultrasound image of hepatic or splenic involvement in bartonellosis in 24 organ transplant recipients . Moreover, other authors have also presented a similar manifestation of multi - organ bartonellosis . We have not found comparable descriptions of hepatic and splenic imaging that could be observed in the course of other bacterial or parasitic infections . Such lesions could be present in candidiasis, which was unlikely in our patient considering the progression of the disease despite intensive anti - fungal therapy, negative microbiological tests and effective treatment targeted to atypical bacteria . Since it is difficult to conduct microbiological tests in the course of infections caused by atypical pathogens in immunocompromised patients, repeated ultrasound examinations are useful in the diagnostic process of infective changes in organs . In the case presented above, a clinical diagnosis of bartonellosis was established on the basis of an ultrasound image, which enabled effective therapy.
As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.
Arthritis affects around 0.51% of the world population with more women being affected than men . The deregulation of the immune system may lead to the development of autoimmune diseases such as rheumatoid arthritis (ra) which is a prototype of the groups of illnesses with chronic systemic disorders with destructive inflammatory polyarticular joint potentially resulting in progressive destruction of articular and periarticular structure . Persistent inflammation produces swollen joints with severe synovitis, decreased nociceptive threshold, and massive subsynovial infiltration of mononuclear cells, which along with angiogenesis leads to pannus formation . Expansion of the pannus induces bone erosion and cartilage thinning, leading to the loss of joint function in due course . This results in a high degree of morbidity and disturbed daily life of the patient . Corticosteroids have not been able to fully control the incidence because of its limitations and risk of side effects . Many patients and practitioners are seeking alternative approach to provide an effective cure in the treatment of arthritis and to overcome the serious drawbacks such as gastrointestinal bleeding on treatment with corticosteroids . Hence, there is an urgent need to find safer drugs for the management of rheumatoid arthritis which is linked to inflammation of joints . Many herbal formulations in the form of a single drug or compound drugs have been used for the treatment of joint pain, fever, and inflammation since ancient times as per the indian system of ayurvedic medicine . Saraca asoca has been traditionally used in the indian system from time immemorial for the treatment of uterine, genital, and other reproductive disorders in women, ailments of urogenital tract, fever, pain, and so forth . Its properties have been mentioned in the ancient ayurvedic text charak samhita under the vedanasthapan (analgesic, antipyretic, and anti - inflammatory) category [25]. The legumes of saraca asoca are 610 inches long containing 48 grey dicotyledonous seeds like a chest nut . The seeds are 35 cm long with average diameter of 8 - 9 cm, smooth surface, ellipsoid - oblong, and compressed . The seed coating is brown or slightly black in colour while sun - dried seeds are dark brown coloured having a smooth surface with hard texture . The stem bark part of this plant contains tannin, catechol, sterol, organic calcium compounds, essential oil, haematoxylin, a ketosterol, a crystalline glycosidal constituent, saponin, organic iron compound, leucocyanidin, and quercetin . The pharmacological activities of stem bark are uterogenic, antibacterial, oxytocic, antitumour, anticancer, and antiprogestational . Saracin, a seed integument lectin from saraca indica, is highly specific for binding n - acetylneuraminyl - n - acetyllactosamine [neu5ac--(26)/(2 - 3)-d - gal--(14)-d - glcnac]. This lectin has been found to be mitogenic for human lymphocytes, and this mitogenic activity could be inhibited in presence of fetuin . Further, treatment with saracin could induce secretion of il-2 in a culture of resting human peripheral blood mononuclear cells (pbmc) after 48 h. saracin has a higher affinity for the cd8 + than cd4 + t cells as revealed by facs analysis . The medicinal plant extracts exhibiting inhibitory activity on cell proliferation should undergo analysis for possible antitumor activity, while extracts displaying inhibition of tfs / dna interactions without effects on cell growth kinetics might be employed to control tfs - dependent gene expression without cytotoxic effects, including the case of inflammatory processes involved in relevant human pathologies, such as rheumatoid arthritis and cystic fibrosis . The scientific pharmacological evaluation of the analgesic, antipyretic, and acute anti - inflammatory activities of the acetone extract of seeds of saraca asoca has given significant and positive results during animal experimentation . Therefore, its antiarthritic pharmacological action was evaluated on animals following the adjuvant test to find out its chronic anti - inflammatory effect which could validate the possible usage of these seeds as an effective nonsteroidal anti - inflammatory antiarthritic drug having the property of antioxidant, immune modulator, analgesic, and so forth . The pharmacognostical, chemical, and experimental studies were carried out in the laboratory of the department of dravyaguna (medicinal plant pharmacology) at the institute of post graduate ayurvedic education & research, kolkata . The acute and subacute toxicity and adjuvant antiarthritis studies of acetone extract of the seeds of saraca asoca were done on rodent animals after getting approval from the institutional animal ethical committee (iaec) in the animal house of ipgae&r kolkata (registration number 1180/ac/08/cpsea dated 27.03.2008 of cpcsea) according to the guidelines of cpcsea . The seeds of saraca asoca were collected from the medicinal plant garden of narendrapur ramakrishna mission, kolkata, and the state government herbal garden at kalyani, west bengal, india, in the month of july . The identification of seeds was done by the botanist at the botanical survey of india, howrah, india, vide ref . An authentic herbarium specimen was deposited in the herbarium museum of the department of dravyaguna at ipgae&r, kolkata, for future reference . The cfa reagent was purchased from m / s sigma aldrich, usa, while hydroxyproline and quercetin were purchased from m / s srl, india, and indomethacin was purchased from m / s jagsonpal pharmaceuticals ltd ., the macroscopic and microscopic examination of the seeds were done for the purpose of standardization . Coarse powder (number 40 mesh) was used for extraction and fine powder was used to ascertain the macroscopic and microscopic pharmacognostical characteristics under high resolution microscope (dewinter, italy) at the department of dravyaguna of ipgae&r according to established procedures [9, 10]. The seeds were washed and cleaned thoroughly to remove any extraneous matter and kept initially under sunlight covered with fine net for 5 hours . They were dried under shade for 10 days taking all precautions to prevent them from any contamination and other foreign matters . The completely dried whole seeds were powdered with a grinding machine (hammer mill), passed through a number 40 mesh sieve, and stored in airtight containers for experimental purposes . The powder of research drug was subsequently extracted sequentially in petroleum ether (6080), chloroform, acetone, methanol, and water in a soxhlet's extractor and then filtered . The acetone extract was concentrated under vacuum in a rotary evaporator to yield semisolid mass . This was further dried under a vacuum oven drier to give solid residue and preserved in refrigerator below 10c for experimental work . The various important physiochemical parameters such as ph value, extractive values, moisture content, ash values, total flavonoid and phenol content, seed oil properties, and fluorescence of the powdered seeds were estimated using standard methods . The presence of important phytochemical constituents such as phenols, flavonoids, tannins, and saponins was assessed using standard techniques [11, 12]. Swiss albino mice of either sex, weighing about 2030 gm, and albino (wistar) rats of either sex, weighing about 120130 gm, were used for different in vivo evaluation . All animals were procured from the government of west bengal approved breeder, m / s satyacharan ghosh, kolkata, and housed under standard environmental conditions with fixed 12 h light / dark cycles and a temperature of approximately 25c in animal house of ipgae&r . The animals were kept in standard polypropylene cages and provided with food (standard pellet diet) and water ad libitum . These animals were acclimatized for a period of 14 days prior to performing any experiments . Acute toxicity study was carried out on healthy swiss albino mice following oecd guideline 423 . The animals of both sexes were selected by random sampling technique and divided into 5 groups of 3 animals each . A single oral dose of the extract was administered orally at the level of 100 mg, 300 mg, 500 mg, 700 mg, and 1000 mg / kg body weight, respectively . All the animals were observed for appearance of toxic symptoms including muscle spasm, loss of righting reflex, tremors, behavioural changes, locomotion, convulsions, and mortality for 1, 2, 4, 8, and 24 h. long - term supervision was continued for a period of 14 days for observing any occurrence of toxic symptoms and mortality . The six wistarrats were dosed daily, starting at 300 mg / kg body weight (the expected therapeutic level) and increased stepwise every two to three days on to 400, 500, 600, 700, 800, 900, and 1000 mg / kg dosage, respectively, until toxic signs were observed . Hematological and biochemical monitoring were carried out and blood level of the compound was checked to ensure its absorption . The animals were maintained at the maximum tolerated dose for a period of two to three weeks to allow development of any pathological changes, killed thereafter, and subjected to full pathological and histological examination . The purpose of this test was to determine the maximum tolerated dose and to ascertain the nature of toxic reactions, so that suitable chronic toxicity studies can be designed to fully evaluate the toxic potential of the compound . The clinical symptoms of each animal in terms of behavioral patterns detailed in the acute toxicity section mentioned above were also observed in all groups [15, 16]. Fca - induced arthritis model in rats is suggested as the most suitable model of chronic and subchronic inflammation . Rat adjuvant arthritis is an experimental model of polyarthritis which has been widely used for preclinical testing of numerous antiarthritic agents which are either under preclinical or clinical investigation or are currently used as therapeutics in this disease [1719]. Animals like wistar rats were randomly divided into four groups of six animals each (n = 6). The control group received 10 ml / kg of vehicle in which the extract was going to be suspended while the standard group received indomethacin (2.5 mg / kg p.o) as the reference standard . The third and fourth groups of animals were administered acetone extract of saraca asoca (ae) at a dose of 300 mg / kg and 500 mg / kg, respectively . Arthritis was induced by a single subplanter injection of 0.1 ml of complete freund's adjuvant (cfa) containing 1.0 mg dry heat - killed mycobacterium tuberculoi per ml sterile paraffin oil into foot pad of left hind paw of male wistar rats . Drug treatment was started in all the groups from the day of adjuvant injection (0 day) 30 min before adjuvant injection and continued till 21st day . The swelling in hind paw (oedema) and paw ankle joint of left foot was periodically examined using screw gauge . The arthritic effect and other clinical symptoms it was observed during the experiment that rats of standard group expired within a week when administered indomethacin at the dose of 10 ml / kg daily due to gastric ulceration and other toxicities in the body . Therefore, the dose of indomethacin was lowered and after several rounds of trial, the dose of 2.5 mg / kg body weight was selected which provided highly significant results and no mortality of animals . The diameter of left paw and left ankle joint was measured in mm on 0, 2nd, 5th, 7th, 9th, 11th, 14th, 18th, and 21st days by using screw gauge and the body weight of animals was measured by digital balance . The mean changes in weight and diameter of paw oedema and ankle joint as well as their percentage inhibition with respect to control group were calculated on the 7th day, 14th day, and 21st day, respectively . The rats were anaesthetized under light ether anaesthesia and blood was collected by retroorbital puncture for estimation of serum parameters such as hb, rbc, wbc, esr, and prostaglandin (e2 eia kit monoclonal cayman chemical item number 514010) by using various diagnostic kits on the 14th day and 21st day which were compared with the data obtained from untreated rats before injection of adjuvant to the rats . This procedure is used to assess the urinary excretion of connective tissue metabolites such as hydroxyproline and glucosamine during the antiarthritic analysis of the test drug . Hydroxyproline is produced by hydroxylation of the amino acid proline by the enzyme prolyl hydroxylase following protein synthesis (as a posttranslational modification). Although it is not directly incorporated into proteins, hydroxyproline comprises roughly 4% of all amino acids found in animal tissue, an amount greater than seven other amino acids that are translationally incorporated . Glucosamine (c6h13no5) is an amino sugar and a prominent precursor in the biochemical synthesis of glycosylated proteins and lipids . Glucosamine is part of the structure of the polysaccharides chitosan and chitin, which compose the exoskeletons of crustaceans and other arthropods, cell walls in fungi, and many higher organisms . Glucosamine is one of the most abundant naturally occurring amino monosaccharides that has been used to treat or prevent osteoarthritis in humans . The effect of adjuvant - induced arthritis on the urinary excretion of hydroxyproline and glucosamine was investigated in rats on the 2nd, 14th, and 21st days of the treatment after the injection of cfa . The rats were kept overnight in metabolic cages on the 14th and 21st days to collect urine samples for the estimation of hydroxyproline and glucosamine . The hydroxyproline and glucosamine content in urine was also calculated in mg / ml from the absorbance at 540 nm calibration curve which was generated with different concentrations of these two compounds, respectively . The radiographic examination of animals of all groups was done using dental x - ray plate in the probe diagnostic laboratory, kolkata, by performing x - ray images of left and right paws on 28th day to assess swelling or other changes in the cartilages or destruction and irregular margin of the bone and cartilage in the paws . This test is done to find out the degree of chronic inflammation which has occurred in the affected parts . All the animals were sacrificed at the end of the experiment on the 28th day . The left hind paws of all the animals were removed, fixed in formal saline for 7 days, and then decalcified in 5% formic acid . Joints were then trimmed and embedded and sections were cut just above the ankle joint having a thickness of 6 m by microtome . These sections were stained with haematoxylin and eosin and mounted on the slide permanently for histopathological observation to ascertain the presence of dense inflammatory infiltrate in the joints, arthritis with destruction of cartilage, pannus formation, and so forth under microscope (dewinter, italy). Since use of nsaids on long - term basis has been known to be associated with toxicity, this experiment was done to assess the pharmacological effect or any toxicity of the prescribed drugs upon the stomach, liver, and kidney of the rats in all groups after the end of the experiment . Fresh portions of lateral lobes of the liver, stomach, and kidney from each sacrificed rat were cut rapidly, fixed in neutral buffered formalin (10%), and then dehydrated with varying grades of ethanol (70, 80, 90, 95, and 100%) followed by clearing of the samples in xylene . These samples were then impregnated with 2 changes of molten paraffin wax, embedded, and blocked out . Paraffin sections (4 - 5 m) were stained with hematoxylin and eosin, the conventional histological stainer according to pearse . Stained sections of control and treated rats were examined for alterations in the architecture, portal triads, hepatocytes, and sinusoids and for the presence of degeneration, necrosis, fatty change, and portal fibrosis . The data were statistically analyzed using one - way anova followed by dunnett's t - test for individual comparison of groups with control . The powder of the seeds is light brown in colour with an aromatic odour and has a slightly sweet taste . The microscopic structure of the powder showed the presence of cells containing tannins, stone cells, crystals, endospermic cells, starch grains, and vessels . The values of various important physiochemical parameters for the purpose of quality control and standardization such asmoisture content, ash value, and extractive value were evaluated following methods prescribed in the ayurvedic pharmacopoeia as detailed in table 1 . The animals tested in acute toxicity tests up to the dose of 1000 mg / kg showed no significant toxic symptoms like sedation, convulsion, diarrhoea, irritation, and so forth and no signs of behavioural changes . No mortality was reported up to 24 hrs and even later during the subsequent 14 days at 1000 mg / kg dose . It is observed that one rat at the dose of 900 mg and 1000 mg / kg out of 6 rats died due to some other factors during daily dose pattern toxicity . This was confirmed since no pathological changes occurred in the histopathological slides of the liver, stomach, and kidney shown below . The assessment of physical changes and behaviour activities was also recorded in the subacute toxicity test like acute toxicity analysis of this research drug (table 2). No noticeable changes were noticed in the values obtained during the haematological test of the blood sample of treated groups up to the dose of 1000 mg / kg as compared to the normal values . The histopathological images of the stomach, liver, and kidney of the rats administered the highest dose of 1000 mg / kg showed normal internal structure of mucosal lining, hepatic cells, kupffer cells, and cell content as shown in figures 1(a)1(c). The values of mean body weight and left paw oedema and diameter of left paw ankle joint after daily administration of the prescribed dose were calculated over time following the adjuvant arthritis model in case of all groups . The size of right paw oedema was measured and the clinical features of inflammation were observed after 14th day and 21st day of this study because these changes may occur in this test as per protocol of the cfa reagent . The changes in body weight of rats were monitored up to 21 days and the results are shown in table 3 . The significant decrease in mean body weight of control group rats from 119.8 gm on day 0 to 110.8 gm on the 21st day may be due to decrease in their immune response and increased symptoms of inflammation, pain, fever, and swelling due to subplantar administration of cfa . On the other hand, the other groups showed appreciable increase in body weight during this period, ranging from 5.57% in case of the standard group to 3.68% in case of the 300 mg / kg group and 4.53% in case of the 500 mg / kg drug group (figure 2), which may be attributed to the response of the treatment drug against the induced inflammation . The paw volume was measured in terms of the diameter in mm for all the groups and compared with the control group on the 7th, 14th, and 21st days . In case of the control group, the paw oedema increased consistently from 4.37 mm to 6.77 mm over this period . The group which was administered 500 mg / kg drug exhibited inhibition of 48.85%, 67.88%, and 93.75% as compared to the control group on the 7th, 14th, and 21st days (table 4). These results are very close to the figures of 55.72%, 88.21%, and 99.58% obtained over the same period in case of the standard indomethacin group, signifying very strong and significant anti - inflammatory activity . Strong and sustained anti - inflammatory action was also noticed in case of the lower dose of acetone extract (300 mg / kg) where the observed inhibition values were 38.93%, 45.52%, and 53.33% after 7, 14, and 21 days (figure 3). The left ankle joint oedema in the control group increased significantly over the 21-day period, while substantial inhibition was observed in case of the other research groups . In case of the drug extract group at higher dose, 50.75%, 91.96%, and 98.63% inhibition was noticed after 7, 14, and 21 days, respectively, as compared to the control group, indicating significantly high anti - inflammatory activity which is quite close to the corresponding values of 51.49%, 92.77%, and 98.97% in case of the standard drug group (table 5). The drug group extract at the lower dose (300 mg / kg) also exhibited significantly high activity especially on the 14th and 21st days (figure 4) when 67.06% and 89.11% inhibition was noticed . The hydroxyproline and glucosamine content in urine was calculated in mg / ml from the calibration curve which was generated with different concentrations of these two compounds on the 2nd, 11th, and 21st days . These parameters were found to exhibit an increasing pattern in the control group due to excessive passing of connective tissues in the form of amino acid proline and amino monosaccharide in the urine which indicated that there is no anti - inflammatory effect on the induced inflammation of the body parts . However, these two metabolites showed a decreasing pattern in the other groups; the standard group exhibiting the highest decrease followed by the higher drug dose group and the lower drug dose group, respectively (table 6). There was a significant decrease in the values of rbcs along with hb% and significant increase in wbcs and esr in the control group rats as compared to normal rats after 21 days of treatment which indicated that the second stage of inflammation had occurred in the body . However, the haematological parameters of the blood of rats treated with acetone extract (300 mg / kg and 500 mg / kg) and the standard drug indomethacin showed a lower decrease in the red cells counts and hb% and also a lower increase in the wbc count and esr values (table 7). In comparison, it can be seen that the highest impact was seen in case of the standard group, while the lowest impact was seen in the lower dose of the acetone extract, even though significant and sustained impact was noticed in all the three groups as compared to the control group . The anti - inflammatory effect of these three groups on the basis of the above haematological results was confirmed by the changes observed in the various groups after 21 days in the level of the prostaglandin which was found to be lower in the standard and higher drug dose treated groups as compared to the control group . The x - ray image of the tibia - tarsal joints of left and right paw of adjuvant - induced control group showed marginal bone swelling and a slight destruction of the cartilage bone in the left and right paw after 28 days of treatment . The radiographic images (figures 5(b) and 5(c)) of the adjuvant - induced standard indomethacin drug group and higher dose (500 mg / kg) of acetone extract after 28 days (figures 5(a)5(c)) showed no callus formation, deformity, or irregular margins of cartilage and bone, which indicated the significant pharmacological anti - inflammatory action as compared to the control group . The results of the histopathological analysis of the left ankle joints after 28 days as seen under the microscope are shown in figures 6(a)6(c) which reveal signs of mild bone destruction by synovial proliferation, cellular infiltration, and cartilage erosion in the control group, while no such changes are seen in the other two groups . The histopathological analysis of the three important internal organs of the body, namely, the kidney, liver, and stomach, was done in order to evaluate the changes that may have occurred in their internal structure after 28 days of this study in respect of the adjuvant - induced treated rats administered with standard drug indomethacin and acetone extract at 300 mg / kg and 500 mg / kg dosage . It was observed from the obtained results shown in figures 7(a)7(i) that no changes or abnormal features were noticed in the slides of kidney and liver in respect of all the three groups . However, the slide of stomach of the standard drug indomethacin showed the irregular and broken margins of the endothelium of stomach, possibly indicating the initial stage of the production of ulcer because usage of nsaid drugs has been shown to be associated with such side effects in some cases . On the other hand, the slides of both doses of the acetone extract of the research drug showed the features of normal structure of the stomach of rat which indicated its safety and nontoxic effect . The saraca asoca bark has a stimulating effect on the endometrium and ovarian tissue and is useful in menorrhagia during uterine fibroids . Flowers of this tree are used to treat cervical adenitis, biliousness, syphilis, hyperdipsia, burning sensation, hemorrhagic dysentery, piles, scabies in children, and inflammation in a traditional system of medicine . Fca - induced arthritis has been used as a model for assessing subchronic or chronic inflammation in rats and is of considerable relevance for the study of pathophysiology and pharmacological control of inflammatory processes . During the study, the initial inflammatory response was developed within few hours, but more critical clinical signs were seen during the 1st week of postinoculation and thereafter for several weeks [19, 23]. The chemical analysis of acetone extract of the seed exhibited the presence of high concentrations of phenolic compounds such as flavonoids, tannins, carbohydrates, and acetyl salicylic acid after following the standard pharmacognostical methods . During the acute and subacute toxicity assessment of the acetone extract, there was no mortality and no other severe symptoms were observed up to the dose of 1000 mg / kg body weight of mice . During the antiarthritis studies, the body weight of the rats after 21 days of treatment increased appreciably ranging from 5.57% in case of the standard group to 3.68% in case of the 300 mg / kg group and 4.53% in case of the 500 mg / kg drug group . At the same time, there was a decrease of 7.51% in body weight in case of the control group which may be due to the nonsubsidence of the clinical symptoms and pathological changes in the induced paw edema . The changes in the left paw oedema volume as compared with the control as measured on the 7th, 14th, and 21st days showed that the inhibition of inflammation in case of the drug - treated group at higher dose (500 mg / kg) was comparable to that in case of the standard group and a little lower in case of the lower drug dose (300 mg / kg) group . Measurements of the ankle joint size over the same time period in case of the different groups were also compared with the control group and similar results were obtained, with the lower drug group also exhibiting very high inhibition of inflammation after 21 days . The similarity in the pattern of inhibition of the oedema in the paw and the ankle joints of the acetone extract (500 mg / kg) as compared to the standard group could be attributed to the presence of high concentrations of flavonoidic phenolic compounds in the extract which are known to exhibit antimicrobial, antiviral, antiulcerogenic, cytotoxic, antioxidant, antihepatotoxic, antipyretic, and anti - inflammatory activities . Mild oedema in the right paw and the other clinical features were noticed in the control group after 21 days, but no similar changes were noticed in the drug and standard groups which also indicated the positive effect of drug . The amount of hydroxyproline and glucosamine in urine as measured on the 2nd, 11th, and 21st days was found to have an increasing pattern in the control group indicating absence of any anti - inflammatory effect upon the induced inflammation . However, their concentrations showed a decreasing pattern in the other groups; the standard group exhibiting the highest decrease followed by the higher drug dose group and the lower drug dose group, respectively . The results of the changes in the haematological parameters such as hb%, rbc count, wbc count, and esr levels as well as the level of prostaglandin also indicated that the maximum anti - inflammatory effect and mechanism of the action of the drug were observed in case of the standard group, but a comparable significant impact was seen in case of the 500 mg / kg drug group followed by the lower drug group . Indomethacin inhibits the catalytic activity of the cox enzymes, the enzymes responsible for catalyzing the rate - limiting step in prostaglandin synthesis via the arachidonic acid pathway . The radiographic images obtained during the x - ray of experimental animals showed that none of the changes, namely, bony swelling, destruction of the cartilage, articular meniscus, and so forth, were exhibited in the acetone extract 500 mg / kg treated and the standard groups, while the erosion in synovial membrane and cartilage was found in the control group . The histopathological images of the stomach, liver, and kidney showed no adverse impact upon the liver and kidney in any of the groups, while some ulcerogenic effect was noticed in the stomach in case of the standard group . The test drug showed no toxic effect upon the three main organs of the body, stomach, liver, and kidney, when administered orally for a long time (up to 21 days). This is particularly important because it is well known that nsaids can produce some toxic effect on these organs when used for a long time or in high doses . Inflammation defined as a biological process characterized by redness, oedema, fever, and pain can result in locally increased production of free radicals by inflammatory enzymes, as well as the release of inflammatory mediators that promote cell proliferation and angiogenesis and inhibit apoptosis . As per the modern pathophysiology concept, fever and inflammation are produced due to exogenous pyrogens which are generally a form of microorganism such as bacteria and virus . These exogenous pyrogens act on the host cells and produce endogenous pyrogens in the form of cytokines, which are regulatory polypeptides . The endothelial cells of anterior hypothalamus release arachidonic acid metabolites when exposed to these endogenous pyrogenic cytokines . One of the arachidonic acid metabolite prostaglandins e2 (pge2) is a very potent fever producing autacoid and also inflammation in the body . In fact, interleukin-6 is a cytokine not only involved in inflammation and infection responses but also in the regulation of metabolic, regenerative, and neural processes . The medicinal plant extracts exhibiting inhibitory activity on cell proliferation should undergo analysis for possible antitumor activity, while extracts displaying inhibition of tfs / dna interactions without effects on cell growth kinetics might be employed to control tfs - dependent gene expression without cytotoxic effects, including the case of inflammatory processes involved in relevant human pathologies, such as rheumatoid arthritis and cystic fibrosis . Several transcription factors (tfs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes, and inflammation . As far as inflammation, tfs playing pivotal roles are nuclear factor kappa b (nf-b), activator protein (ap-1), signal transducer and activator of transcription (stats), camp response element binding protein (creb), and gata-1 factors . All these tfs regulate the expression of proinflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component . The findings indicate that the acetone extract of saraca asoca possesses antiarthritic pharmacological action similar to the nonsteroidal anti - inflammatory drug indomethcin due to the presence of flavonoidic compounds quercetin and gallic acid in the test drug which may be responsible for decreasing the level of cytokine and interleukin (responsible for inflammation in the body) by measuring the responsible prostaglandin in serum . Indomethacin is a nonsteroidal anti - inflammatory drug (nsaid) that reduces fever, pain, and inflammation by reducing the production of prostaglandins . Prostaglandins are autacoids that the body produces to cause fever and pain that are associated with inflammation . The decreased level of prostaglandin in the blood and other changes in the hematological parameters have also confirmed the pharmacokinetic action of the acetone extract during this study . Indomethacin blocks the enzymes that make prostaglandins (cyclooxygenases 1 and 2) and thereby reduces the levels of prostaglandins leading to reduction in fever, pain, and inflammation . A similar mechanism of action probably exists in the research drug at the dose of 500 mg / kg acetone extract due to the presence of flavonoidic compounds that are well known to possess antipyretic, analgesic, and anti - inflammatory properties . The research effort makes a detailed and comprehensive assessment of the antiarthritic efficacy of the seeds of saraca asoca by evaluating the impact on various diverse parameters employing standard techniques of scientific analysis associated with freund's adjuvant - induced arthritic rat model . The findings confirmed the significant nontoxic, antiarthritic, and anti - inflammatory pharmacological effect of saraca asoca's acetone extract which is comparable to the standard drugs in a dose - dependant manner, possibly due to the presence of flavonoidic chemical compounds and the resultant lowering in the level of prostaglandin in the blood . However, further research is required for isolation and identification of the specific chemical compounds responsible for the antiarthritic effect.
Kaposi's sarcoma (ks) is a highly angioproliferative neoplasm etiologically linked to infection with kaposi's sarcoma - associated herpesvirus (kshv), also formally known as human herpesvirus 8 (hhv-8) [1, 2]. Four epidemiological forms of ks have been described and distinguished based on age, sex, geographical location, socioeconomic status, previous exposure to parasitic infections, coinfection with hiv, and the extent of iatrogenic organ transplant - associated immune suppression [35]. Although the precise trigger(s) for ks are currently not known, all forms of the lesion display histopathological characteristics consistent with a shared requirement for chronic inflammation, leading to the notion that a preexisting or virus - induced state of inflammation is essential for creating the physiologic conditions necessary for ks development and progression . Indeed, at the early patch stage, the lesion produces and/or paracrinally responds to pro - inflammatory cytokines and growth factors including interferon- (ifn-), tumor necrosis factor- (tnf-), interleukin-1 (il-1), il-2, and il-6 [69] that support expression of adhesion molecules and chemokines that mediate recruitment of circulating monocytes to the lesion . The early stage is also associated with secretion of protumorigenic mediators such as vascular endothelial growth factor (vegf) that drives the angiogenic increase in hyperproliferating spindle cells, which in turn form the basic slit - like framework for erythrocyte extravasation, neovascularization, and plasma cell infiltration; together, these biologic processes are believed to contribute to the complex cellularity found in ks lesions [6, 7, 1014]. Generally, expression of pro - inflammatory proteins within and around the ks lesion is primarily controlled by the nuclear factor--b (nf-b) transcription factor, an important mediator of inducible gene expression during cellular growth, immune reactivity, and pathological inflammation . Although the list of molecules that comprise the definitive nf-b signaling axis is rapidly expanding, the classical transactivating form of nf-b is comprisesd of rela (p65)/p50 heterodimers which, in unstimulated cells, are sequestered in an inactive form in the cytoplasm via physical association with one of several inhibitors, designated ib . Upon extracellular stimulation, signal transduction events rapidly lead to activation of the ib kinase (ikk) complex composed of two catalytic subunits (ikk and) and a regulatory nf-b essential modulator subunit (nemo). Activated ikk (mainly ikk) phosphorylates ib, triggering its polyubiquitination and proteasomal degradation; this liberates the active nf-b homo- or heterodimers, which subsequently translocate to the nucleus where they drive transcription of nf-b - responsive genes . The role of nf-b in kshv pathogenesis was brought into focus by the observation that sustained, virus - induced activation of nf-b following infection is required not only for establishment and maintenance of latency [17, 18] but also for oncogenic transformation [19, 20]. Accordingly, kshv commits a large portion of its coding potential towards nf-b activation, primarily via the functions of the viral fadd - like interleukin-1--converting enzyme [flice / caspase-8]-inhibitory protein (vflip), the viral g - protein - coupled receptor (vgpcr) [22, 23], k1, k13, k15, the viral tegument protein encoded by open reading frame-75, as well as a cluster of micrornas, many of which are linked to regulation of immune reactivity, cell survival, and the tumorigenic potential of kshv [2729]. Ironically, nf-b activation is associated with viral latency, whereas its inhibition results in viral entry into the lytic cycle [17, 18]. It was recently reported, for example, that nf-b not only activates expression of kshv latent genes including lana, v - flip, and v - cyclin, but also negatively regulates the transactivating potential of the kshv major lytic switch regulator, rta [17, 30, 31]. Nf-b inhibits rta recruitment to viral promoters either through direct competition with rbp - j (which cooperatively enhances rta transactivation by binding dna adjacent to low - affinity rta - binding sites within rta - responsive genes [3234]) or by sequestering rta from rbp - j, both of which were shown to depend on the relative amount and activation status of nf-b . Clearly, the pro - inflammatory function of nf-b controls the balance between viral latency and lytic replication by regulating accessibility of the kshv genome to transactivating factors, and is therefore a fundamental determinant of ks development in skin and other target sites . Given this regulatory control, it is intriguing that the host anti - inflammatory mechanisms that are normally activated to attenuate inflammation in skin somehow fail to control disease induction in this target organ . To explore the molecular basis for this paradoxical outcome, we tested the hypothesis that kshv infects and subverts the local anti - inflammatory processes of skin cells so that they are unable to overcome the virus - induced pro - inflammatory reactions that support ks histogenesis . We now present the first evidence that melanocytes can be infected by kshv and in turn may be co - opted as an important cellular determinant of kshv pathogenesis in skin . Importantly, we have identified two cell lines that displayed dichotomous properties with respect to their ability to support the kshv latency program and mapped these cytologic attributes to (a) differences in the state of virus - induced nf-b activation immediately following primary infection and upon establishment of latency, (b) expression of unique lana isoforms associated with lytic replication, and (c) susceptibility of persistently infected cells to viral impairment of key components of the endogenous anti - inflammatory response pathways . Together, our findings represent the first delineation of the important role that skin cells may play in kshv pathogenesis and reveal both the cellular correlates for maintenance of viral latency and the nature of interactions between kshv and the host anti - inflammatory axis that could serve as predictive markers for cutaneous ks . Vero cells (atcc; manassas, va) and rkshv.219-infected vero cells (a kind gift from jeffrey vieira, university of washington, seattle, wa) were cultured in dmem (quality biological, inc ., gaithersburg, md) supplemented with 10% fetal bovine serum (fbs; hyclone laboratories, logan, ut) and puromycin (10 g / ml; calbiochem, emd chemicals, inc ., gibbstown, nj). As described previously, rkshv.219 expresses enhanced green fluorescent protein (gfp) under the control of the strong cellular elongation factor 1- promoter and the ds - red fluorescent protein (rfp) from the kshv lytic polyadenylated nuclear (pan) rna promoter, in addition to the gene for puromycin resistance as a selectable marker for maintenance of the viral episome in rkshv.219-infected cells . Normal human adult epidermal primary melanocytes (nhem - ad; lonza walkersville, inc ., walkersville, md) were cultured in 254cf media supplemented with 0.1 mm cacl2 and human melanocyte growth supplement with pma (cascade biologics, invitrogen, carlsbad, ca). Mewo, a highly - pigmented cell line derived from a nodular lymph node metastasis in a patient with malignant melanoma, was obtained from atcc and cultured in emem (quality biological, inc .) Mel1700, a benign human melanoma - derived cell line, was provided by maurice zauderer (vaccinex, inc ., rochester, ny) and cultured in rpmi-1640 (quality biological, inc .) Supplemented with 20% fbs . Rkshv.219-infected mewo and mel1700 cells were derived in our laboratory and maintained under selection with puromycin at concentrations of 0.5 g / ml and 1 g / ml, respectively . The immortalized human keratinocyte cell line, hacat, was cultured in dmem supplemented with 10% fbs . Rkshv.219-infected hacat cells were also maintained in dmem supplemented with 10% fbs and puromycin (0.5 g / ml). The body cavity - based lymphoma cell line, bcbl-1, that is persistently infected with kshv, was obtained from michael mcgrath and don ganem via the nih aids research and reference reagent program, division of aids (niaid, nih, bethesda, md), and was cultured in rpmi-1640 supplemented with 10% fbs . For infection studies, cultures of rkshv.219-infected vero cells were induced with 6 mm sodium n - butyrate (nab; sigma, st . Four days after induction, cells were scraped, resuspended in spent media, and collected by centrifugation at 4c, as previously described . The supernatant containing concentrated kshv particles was maintained on ice while the cell pellet was resuspended in 2 mls of dmem and frozen and thawed two times to release cell - associated viral particles . The resulting lysate was centrifuged at 2500 rpm for 10 minutes at 4c to remove debris and the clarified supernatant was combined with the original culture supernatant, sterile - filtered through a 0.45 m membrane filter, and stored at 80c . Uninfected vero cells were treated with 6 mm nab and harvested in parallel to be used for mock infection . To generate chronically rkshv.219-infected cells, uninfected cells were plated in t-25 flasks in their respective growth media supplemented with 10% fbs . At 70% confluency, media were removed from each flask and 2 mls of the vero - derived rkshv.219 supernatant was added . After one hour of incubation at 37c, 3 mls of media (with 5% fbs) was added and further incubated at 37c and monitored for the expression of gfp . Subsequently, a progressively increasing concentration (0.110 g) of puromycin / ml was added to the culture in order to enrich for rkshv.219-infected cells over time . Mock infections were performed in parallel using uninfected vero cell supernatant and cells were harvested for further analysis at the time of puromycin addition for rkshv.219-infected cells . For infection of hacat cells, a t-75 flask of rkshv.219-infected mel1700 cells was induced with 6 mm nab for two days to achieve optimal amounts of rfp positive cells (reactivation conditions were determined empirically). Cell supernatants containing reactivated kshv were collected, spun at 2500 rpm for 10 minutes at 4c to remove floating cells and other debris, sterile - filtered through a 0.45 m membrane filter, and added to uninfected hacat cells . Hacat cells infected with mel1700-derived rkshv.219 were monitored for the appearance of gfp and selected with puromycin (0.5 g / ml starting at day 3 postinfection). (santa cruz, ca): polyclonal anti - gapdh (l-20), monoclonal anti - trp-1 (h-90), anti - melan a (fl-118), anti - mc1r (h-60), and hrp - labeled goat anti - rat secondary antibody . Rat anti - lana monoclonal antibody ln35 was purchased from abcam (cambridge, ma). Alexafluor-647-labeled chicken anti - rat igg secondary antibody (cat no . A11077) were purchased from molecular probes (invitrogen, carlsbad, ca). Unless otherwise indicated, all rabbit monoclonal antibodies against key components of the nf-b pathway, as well as a polyclonal rabbit antibody to phosphorylated nf-b p65, were purchased from cell signaling technology (danvers, ma). Additional antibodies to total nf-b p65 were purchased from biosource international (camarillo, ca) and used in western blot assays with hrp - labeled sheep anti - mouse (amersham biosciences, ge healthcare life sciences, piscataway, nj) or hrp - labeled donkey anti - rabbit (chemicon, millipore, billerica, ma) secondary antibodies, respectively . Western blot analysis or human xct was carried out using a previously described polyclonal rabbit antibody to the n - terminal peptide of human slc7a11 (xct), or with polyclonal anti - xct antibody nb300 - 318 from novus biologicals, (littleton, co). Recombinant alpha - msh was purchased from emd - calbiochem (la jolla, california). Images were captured using an axiocam mrm digital camera (carl zeiss, inc .) Attached to a zeiss axio observer.a1 inverted fluorescent microscope (carl zeiss, inc . ). Cells were washed, trypsinized, resuspended in facs buffer (sterile filtered 1% fbs in pbs without ca or mg), and counted . 1 10 cells were fixed with 2% paraformaldehyde (electron microscopy sciences, fort washington, pa) and transferred into 12 75 facs tubes (falcon, #352063) for analysis by flow cytometry . Total dna was extracted from 5 10 rkshv.219-infected or uninfected cells using the dneasy blood and tissue kit (qiagen, valencia, ca), and pcr amplification was performed with platinum pcr supermix high fidelity (invitrogen), as recommended by the manufacturer . For detection of viral dna by pcr, the ks330 primer pair derived from kshv orf26 (table s1) was used to amplify a 232 bp (nt 9871218) fragment using the following conditions: 94c for two minutes, then 35 cycles of 94c for one minute, 58c for one minute, and 72c for one minute, followed by 72c for five minutes, as previously described . Total rna was extracted from cell pellets using trizol reagent (invitrogen), digested with the rnase - free dnase set (qiagen) and quantified using a nd-1000 nanodrop spectrophotometer supported by the associated software, version 3.1.2 . Rt - pcr was performed on 0.5 g dnase - digested rna using the superscript one - step rt - pcr with platinum taq kit (invitrogen) with primer sets specific for viral or cellular genes (table s1). Amplification products were analyzed by gel electrophoresis on 1% agarose gels stained with ethidium bromide . Cells were seeded in eight - well chamber slides (lab - tek chamber slide system, nalge nunc) at a concentration of 1 10 cells per well and allowed to adhere overnight at 37c . For direct immunofluorescence, the cells were fixed the next day in 2% paraformaldehyde (electron microscopy sciences, fort washington, pa) in pbs for 30 minutes and then permeabilized in 2% paraformaldehyde and 0.1% triton x-100 (calbiochem, la jolla, ca) in pbs for an additional 30 minutes . After fixation, the cells were washed once with pbs and incubated in blocking buffer (2% fbs in pbs) for one hour at 37c . Blocking buffer was then removed and the cells were further incubated with anti - lana primary antibodies in fresh blocking buffer for one hour at 37c . Cells were washed five times with pbs and then incubated with fluorescently - labeled secondary antibodies for one hour at 37c . After five washes with pbs to remove unbound antibody, coverslips were mounted onto the slides using vectashield mounting medium for fluorescence with dapi (vector laboratories, burlingame, ca) and cells were visualized using fluorescence microscopy . Cell pellets (1 10 cells per pellet) were lysed in ripa buffer (0.1% sds, 1% np-40, 150 mm nacl, 1 mm edta, 50 mm tris - hcl ph 7.5, 0.5% deoxycholate, 50 g / ml bsa) and electrophoresed under reducing conditions on a nupage 412% bis - tris gel with mes sds running buffer (invitrogen). Resolved proteins were transferred from the gel to a pvdf membrane (invitrogen) and blocked overnight in pbs containing 5% nonfat powdered milk and 0.1% tween-20 . Primary and secondary antibodies were each diluted in blocking buffer and incubated with the blots for one hour, rocking at room temperature . Blots were washed three times (0.05% np-40 in pbs) for 15 minutes after incubation with each antibody and developed using supersignal west femto substrate (thermo scientific, rockford, il). We determined the susceptibility of skin cells to kshv by innoculating primary adult melanocytes (nhem - ad) and two melanoma - derived cell lines (mewo and mel1700) with rkshv.219 and then analyzed: (i) postentry expression of virus - encoded gfp, (ii) viral genome content by pcr, (iii) viral gene expression by rt - pcr, and (iv) productive release of infectious virus upon lytic reactivation . Compared to controls, infected melanocytes (nhem - ad) and mewo cells lost their elongated morphology and acquired a stubby, dedifferentiated phenotype (figures 1(b) and 1(c)). Persistently infected mewo cells also formed large, multinucleated syncytia (figures 1(c) and s1a; yellow asterisks), possibly induced by viral glycoprotein - mediated cell fusion . On the other hand, persistently infected mel1700 cells did not become stubby but instead expressed outgrowths of elongated dendritic spines (figures 1(d) and s1c; arrows). These morphologic changes are reminiscent of the neuroendocrine - like features characteristically associated with subskin lesions [4143] and may be the first indication of hitherto unexplored aspects of virus - host interactions that contribute to pathology in skin . After a series of a selective passage of infected cells in the presence of puromycin, we were able to generate long - term cultures (almost 100% infection rate) of persistently infected kshv - infected cells (see figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2014/246076), allowing us to further characterize the virologic outcomes of kshv infection in these cells . Long - term infection of skin cells was confirmed by pcr amplification of viral dna isolated from cells treated with increasing amounts of n - butyrate (nab), a histone deacetylase inhibitor known to induce viral reactivation . As shown in figure 2, the template from uninduced mel1700-kshv cells produced a more intense viral dna product compared to the target template from uninduced mewo - kshv cells (figures 2(a) and 2(b); compare lane 2 in each case), implying that mel1700-kshv cells may harbor more viral genome copies than mewo - kshv cells, which we confirmed by dilutional analysis against preset standards of viral dna from kshv bcbl-1 cells previously determined to contain approximately 100 genome copies per cell . To determine whether the putative difference in viral genome content reflected a difference in the replicative potential of the virus in these cells, we used epifluorescence to analyze spontaneous or nab - induced virus reactivation based on expression of rfp, which is transcribed under the control of a strictly lytic viral pan promoter . As shown in figure 2(c), rfp was virtually undetectable in untreated mewo - kshv cells, but increased slightly after treatment with 2 mm nab . In contrast, the already high level of spontaneous rfp expression in mel1700-kshv cells was further increased by nab (figure 2(d)), further suggesting that mel1700 cells may have a higher propensity for supporting viral lytic reactivation . However, we were mindful of the fact that differences in cell density could also influence the timing and/or robustness of viral reactivation in confluent cultures of infected cells, so we used flow cytometry to more accurately quantitate the time - dependent increase in rfp+ cells following nab treatment . As shown in figure s2a, approximately 0.9% of untreated mewo - kshv cells were rfp+, compared to 7.9% of untreated mel1700-kshv . At each time point after nab treatment, the number of rfp+ cells in mewo and mel1700 cells increased to approximately 30% versus 36% after 1 day, 41% versus 45% after 2 days, and to 46% versus 57% after 2 days, respectively . This temporal change in rfp expression is also illustrated in various formats (figures s2b s2d), all of which reveal that mel1700 cells support a higher level of spontaneous and/or drug - induced kshv reactivation than mewo cells . Furthermore, virions from the highly inducible mel1700-kshv cells were infectious for human hacat keratinocytes, which subsequently maintained gfp expression (figure s3a) and viral dna after more than 48 days of continuous culture in presence of puromycin (figure s3b). Moreover, infected hacat - kshv cells could also support viral lytic replication, as evidenced by foci of rfp - expressing cells upon treatment with a low dose of nab (figure s3c). To determine whether differences in viral lytic replication in mewo and mel1700 cells (figure 2) also reflected patterns of viral gene expression in these cells, we analyzed the transcriptional profile of selected viral genes belonging to each of the three previously described classes of viral transcription in kshv - infected cells [4648]. Thus, class i genes include lana, v - flip, and v - cyclin that are constitutively expressed, while class ii genes include the immediate early master switch regulator of the kshv viral lytic cycle, rta, as well as orf74 (v - gpcr), and k2 (v - il-6), which are constitutively expressed but highly inducible regulators of viral gene expression and the host microenvironment . On the other hand, class iii genes include strictly lytic genes such as gb, gh, and k8.1 that encode viral structural proteins . Viral gene transcription was assessed by semiquantitative rt - pcr; all rna samples were treated with dnase i prior to the rt - pcr reaction, and as a consequence no amplification product was detected in a pre - rt - pcr control experiment in which reverse - transcriptase (rt) was omitted from the reactions (figure s4a). In addition, no viral dna was detected in dnase i - treated rna samples (figure s4b), confirming that we had successfully removed contaminating viral dna . As shown in figure 3, all genes tested were expressed in both cell lines, especially following nab treatment . However, an important distinction was evident in the expression of key markers of stage - specific replication, most notably the immediate early rta, the early / late vgpcr, and the strictly late k8.1 . While these transcripts were expressed only in nab - treated (but not in uninduced) mewo - kshv cells, they were abundantly expressed in untreated mel1700-kshv cells (figure 3, compare lanes 2 and 5). Given that rta transactivates the promoters of several lytic kshv genes including its own [4648], the difference in rta expression in the absence of drug induction could explain the higher level of spontaneous viral reactivation and virion output in infected mel1700-kshv cells compared to their mewo - kshv counterparts . Kshv lana maintains viral latency in part by tethering episomal dna to the host chromosome and by suppressing rta - controlled lytic genes . Consistent with this function, lana is often detected as punctate nuclear speckles depicting discrete foci of lana - mediated tethering of viral episomes to host dna . In light of our finding that rta is robustly expressed in mel1700-kshv cells even in the absence of drug induction, we speculated that deregulated expression of lana might relieve rta repression, resulting in the relatively higher level of virus reactivation in mel1700, but not in mewo cells . Consistent with this prediction, all infected mewo - kshv cells exhibited punctate nuclear lana staining that is also typically seen in latently - infected endothelial cells and pel - derived cell lines, whereas lana staining was predominantly diffuse in mel1700-kshv cells (figure 4 and supplementary figure s5). Distinction was not due to antibody cross - reactivity or artifacts associated with the ifa, because similar results were obtained in a parallel experiment in which we used a goat anti - rat secondary igg conjugated to a different fluorophore (figure s6). Moreover, no background fluorescence was seen in control experiments in which only primary or secondary antibody was used (figure s7), and, in this case the rfp signal is a result of nab treatment, which induces a higher level of rfp expression in mel1700-kshv cells compared to mewo - kshv cells (as illustrated in figure 2). To confirm whether diffuse lana staining directly correlates with lytic replication, we treated both mewo - kshv and mel1700-kshv cells with nab and then attempted to simultaneously capture both punctate (unreactivated) and diffuse (reactivated) lana images in the same cell population . Figure s8 is a representative set of rfp, gfp, dapi, and lana images from two separate visual fields i and ii (panel a, for mewo - kshv) and iii and iv (panel b, for mel1700-kshv). In mewo - kshv cells, diffuse lana staining was detected only in reactivated (rfp+) cells nos.10, 11, and 12 that are surrounded by apparently nonreactivated (rfp) cells nos.19 in which lana is indeed punctate (figure s8a). On the other hand, cells nos.16 in the mel1700-kshv fields appear to be reactivated, and accordingly exhibit diffuse lana staining (figure s8b), confirming that diffuse nuclear lana staining may be a marker for lytic replication, while punctate lana expression may reflect viral genomes in a predominantly latent state . Surprisingly, we also detected cytoplasmic lana staining in a small number of reactivated cells (e.g., mewo - kshv cells #1012) and mel1700-kshv cells (#1 and 3). Although the molecular basis for extranuclear lana staining in reactivated cells is not known, it reveals important new perspectives on hitherto unrecognized regulatory functions for novel lana isoforms that may control the timing, robustness, and molecular threshold for the mechanisms that control viral reactivation . Since the lana genome - tethering function depends on its ability to bind host dna, and since entry into the viral lytic cycle may disrupt these interactions in a manner that could, in theory, result in delocalized (diffuse) lana staining, we tested the hypothesis that diffuse lana staining during lytic replication reflects a disproportionate accumulation of c - terminally truncated lana isoforms that lack the capacity to bind dna and are, therefore, diffusely expressed throughout the nucleus and possibly the cytoplasm as well . Interestingly, kshv lana (1,162 aa) has a predicted molecular weight of 135 kda, yet various studies have often detected the protein as a doublet of approximately 220230 kda in addition to two nab - inducible 150180 kda and 130 kda bands, underscoring the potential for multiple posttranscriptional regulation . In the current study, we also detected the 220 kda band in uninduced mewo - kshv lysates (figure 5(a), lane 1), in addition to a 130 kda band that was induced by nab (figure 5(a), lane 2) but became clearly visible in uninduced mewo - kshv samples only after a 30 min . Mel1700-kshv cells also contained the ~220 and 130 kda bands in addition to three more bands at ~180, 160, and 90 kda (figure 5(a), lane 3), all of which were expressed in absence of nab induction . Although the -actin control band suggests that less total protein may have been loaded for the mewo samples, additional repeats and longer exposures confirmed that the mewo samples expressed the ~180, 160, or 90 kda bands only after nab treatment (figure 5(b), compare lanes 1 and 2), in contrast to mel1700-kshv cells in which they were clearly present even in absence of nab induction, giving us reason to believe that the ~180, 160, and 90 kda lana bands may be uniquely associated with lytic replication . We note that the reduction in lana - specific bands in nab - treated mel1700-kshv cells (figure 5(a), lane 4) may be either due to nab cytotoxicity or cell lysis potentially associated with infectious virus release . Another insightful finding was that the pattern of lana expression in infected mewo cells was analogous to bcbl-1 cells in which lana is often detected as punctate speckles, a fact that is even more demonstrable in the side - by - side western blots (figure s9a) and lana ifa images (figure s9b). Together, these results imply that punctate lana staining marks strong latency, whereas the switch to diffuse staining may represent entry into the viral lytic phase . A number of studies have shown that a preexisting state of inflammation or direct kshv - mediated activation of the nf-b pathway early following infection may be necessary for successful establishment of viral latency [50, 51]. To examine this concept in skin cells, we analyzed the activation status of key components of the classical nf-b pathway in relation to intrinsic cellular attributes that support specific virologic outcomes during both de novo (or acute) and persistent (or chronic) infection . Similar to previous reports, kshv rapidly induced phosphorylation of nf-b p65 and ikb within 20 minutes of infection (figures 6(a) and 6(b)), an effect that correlated with changes in expression of the nf-b - controlled intracellular adhesion molecule 1 (icam-1). Interestingly, while phosphorylated p65 remained relatively unchanged for several hours postinfection of mewos, it was short - lived and in fact began to decline within one hour postinfection of mel1700 cells (figure 6(c)). Since nf-b activation represses rta while its inhibition relieves rta repression [17, 18], the fact that nf-b activation is curtailed in kshv - infected mel1700 cells implies that mel1700 cells likely express endogenous mechanisms that function in an adaptive manner to attenuate nf-b activity, a process that could explain the relatively higher propensity for virus reactivation in these cells . Consistent with this view, we found that after several days of selective passage in presence of puromycin (designed to maintain stable replicative viral genomes in persistently infected cells), key components of the nf-b signaling axis were differentially impacted by the virus, even though both mewo and mel1700 cells retained their melanoma phenotype, as indicated by sustained expression of melan - a (figure 6(d)). For example, while phosphorylated p65, ikb, and ikk were elevated in persistently infected mewos, the level of phosphorylated p65 was dramatically reduced, and the relative increase in phosphorylated ikb and ikk was also much more modest in long - term cultures of infected mel1700 cells (figure 6(d), compare lanes 2 and 4, resp . ). Therefore, we have found that, in comparison to mewo cells, mel1700 cells (a) support a more robust viral lytic replication program (figure 2), (b) express higher levels of rta (figure 3), (c) display diffuse nuclear lana staining (figure 4(b)) that correlates with stage - specific expression of specific lana isoforms including the 180 kda band that is associated with lytic replication (figure 5), and (e) have reduced nf-b activation (figure 6). These dichotomous properties are consistent with a model whereby sustained activation of nf-b (as in mewo cells) correlates with maintenance of latency whereas a reduction in activated nf-b p65 (as in mel1700) correlates with a higher propensity for viral reactivation, a paradigm supported by findings in other cell types as well [17, 18, 50, 51]. The control of inflammation within the epidermal unit of skin is orchestrated by anti - inflammatory responses primarily initiated by alpha - melanocortin stimulating hormone (-msh), a potent peptide derived from pro - opiomelanocortin (pomc) by posttranslational proteolytic processing . The effects of -msh are transduced through the melanocortin 1 receptor (mc1-r), which is expressed by skin - resident melanocytes, keratinocytes, microvascular endothelial cells, and other monocytic infiltrates . Upon binding to mc1-r, -msh triggers a signaling cascade that effectively blunts inflammatory reactivity by preventing activation of nf-b and the associated expression of pro - inflammatory cytokines and adhesion molecules that mediate infiltration of pro - inflammatory cells into the vascular endothelial environment [53, 5557]. -msh also regulates pigment production and deposition through activation of tyrosinase, the enzyme that catalyzes synthesis of dopaquinone, the first step in melanogenesis; in turn, dopaquinone reacts with intracellular cystine (supplied by the cystine / glutamate transporter, xct) to produce cysteinyl - dopa, a rate - limiting step in the synthesis of pheomelanin during inflammation . Since establishment of a persistent state is determined by the overall inflammatory status of infected cells, we asked whether establishment of strong kshv latency (in mewo and not in mel1700) is controlled by differential deregulation of endogenous anti - inflammatory mediators that would otherwise be expressed to prevent establishment of latency in these cells . We measured the temporal changes in nf-b activation in relation to key components of the anti - inflammatory -msh / mc1-r signaling axis, and found that within the first 1 hr of infection kshv induced a rapid increase in phosphorylated nf-b p65 in mewo cells (figure 7(a)). This was in contrast to mel1700 cells in which the increase in nf-b activation did not occur until at least 3 hrs postinfection (see figure 7(b) and the imagej quantitation of phosphorylated p65 band intensities in figure 7(c)). During the rapid increase in nf-b activation in mewos cells, mc1-r was not expressed while there was a progressive abrogation of endogenous tyrosinase - related protein-1 (trp-1), which is involved in pigment synthesis and deposition during inflammation (figure 7(a)). By contrast, mc1-r protein was induced almost immediately after infection of mel1700 cells, but there was no appreciable impact on the already high baseline level of trp-1 (figure 7(b)); instead, there was a virus - induced increase in mrna for mc1-r, pomc (the precursor of -msh), and xct (gene name slc7a11) (figure 7(d)). This effect correlated with the amount of virus used, as marked by the correspondingly dose - dependent expression of viral gpcr, lana, and vflip (figure 7(e)). When infection was monitored over a longer period of time, it was evident that phosphorylated p65 remained high in mewos, whereas in mel1700 cells it was consistently detected much later (figure s10a). Moreover, the kinetics of phosphorylated p65 in both cell lines overlapped with expression of xct (figure s10b), which not only forms a receptor complex that mediates kshv entry, but also supplies cystine for the manufacture of glutathione (gsh), a potent anti - inflammatory mediator . Interestingly, we recently discovered that kshv micrornas target a transcriptional inhibitor of xct in infected cells, ostensibly to promote virus dissemination while protecting infected cells from inflammatory stress . Therefore, the fact that the kinetics of nf-b activation overlap with xct expression in kshv - infected skin cells is consistent with cellular induction of anti - inflammatory responses as an adaptive response to inflammation during the latent state . In accordance with this link, we detected a significant reduction in the expression levels of xct, mc1-r, and trp-1 in persistently infected mewos, but in mel1700 cells expression of mc1-r and trp-1 was sustained in conjuction with an increase in xct (figure 7(f)). Together, these findings suggest that the differential influences of kshv in mewo and mel1700 that we observed following de novo infection are also maintained after establishment of latency . To determine the biological significance of the impact of kshv on mediators of the endogenous melanogenic response, we treated both uninfected and kshv - infected mewo or mel1700 with -msh and assessed the cellular redistribution of trp-1, a known downstream marker for the effector function of mc1-r activity . Trp-1 is expressed exclusively in melanosomes where it plays a role in the maintenance of melanosome structure . As shown in figure 8, untreated mewo cells express weak but detectable levels of trp-1 that is predominantly associated with the er / golgi network (figure 8(a), top - left quadrant). However, treatment with -msh resulted in a slight change in the distribution of the trp-1 from being exclusively associated with the er / golgi to other aspects of the cell (figure 8(a), lower - left images), indicating that these cells are capable of responding to the anti - inflammatory effects of -msh . However, in kshv - infected mewos, the basal expression of trp-1 was abrogated (figure 8(a), top - right image), consistent with western blot data in figure 7(a). Remarkably, treatment of kshv - infected mewo - kshv cells with -msh restored trp-1 expression to levels analogous to those in uninfected samples (figure 8(a), white arrows), revealing a direct influence of kshv on the mc1-r/-msh axis in these cells . On the other hand, we found that unlike mewo and their infected counterparts in which not all cells expressed trp-1, mel1700 cells expressed high basal levels of trp-1 (figure 8(b), top - left image), and in this case kshv actually did not abrogate but instead induced a noticeable increase in trp-1 expression (figure 8(b), top - right image; also see trp-1 blot in figure 7(b)). Moreover, -msh treatment of mel1700-kshv cells resulted in a dramatic alteration in trp-1 expression from being primarily associated with the supranuclear er / golgi network to what appeared, at higher magnification, to resemble melanogenic vesicles arrayed along dendritic spines (figures 8(b) and s11b, green arrows, and additional data not shown). At a functional level, it is reasonable to conclude that in mewos that fail to express the necessary anti - inflammatory mediators in the context of infection, viral latency is the more likely outcome, whereas the rapid increase in expression of mc1-r and other anti - inflammatory molecules in infected mel1700 cells blocks nf-b [53, 5557], which would consequently limit establishment of a latent state and/or result in a greater propensity for mel1700 cells to support lytic replication . In this study, we investigated the infectious process of kshv in skin - derived cells in order to identify pathogenetic themes that underlie the ability of kshv to induce cutaneous ks lesions in skin, a highly specialized site whose endogenous anti - inflammatory processes presumably fail to overcome this pathologic outcome . Using primary melanocytes as well as established melanoma - derived cells, we examined key markers of virus / host interactions that control kshv tropism and pathogenesis in skin and identified important correlates that link the replicative program of kshv with the underlying inflammatory status of infected cells . Specifically, we identified two cell lines mewo and mel1700that consistently displayed differences in (a) susceptibility to productive infection, (b) timing and robustness of virus replication, (c) expression of kshv latency - associated nuclear antigen, lana, (d) replication phase - specific expression of viral genes, and (e) susceptibility to virus - induced perturbation of the anti - inflammatory melanogenic response . We found that underlying these differences are cell - type specific markers that operate at the level of kshv interactions with the host genome, chief among them being differential expression of kshv lana . Lana maintains viral latency in part by tethering episomal viral dna to host chromosomes and by blocking rta expression . We found that diffuse nuclear lana staining was associated with lytic replication, whereas punctate staining marked a state of latency, leading us to hypothesize that diffuse lana staining reflects the accumulation of untethered lana isoforms that are unable to block rta . Consistent with this view, nab induced a switch from punctate to diffuse lana staining; moreover, rta expression was higher in spontaneously reactivated mel1700-kshv cells in which lana staining was diffuse, in contrast to mewo - kshv cells in which rta was expressed only after nab treatment, further supporting our hypothesis . Although the mechanisms that control nuclear lana expression at different stages of the virus life cycle are not fully known, it was recently observed that when the n- and c - termini of lana (that contain nuclear localization signals, nls) were expressed individually in kshv - infected cells, the c - terminus (which binds terminal repeats of kshv dna) formed discrete nuclear speckles, whereas the n - terminus (which binds host chromosomes) exhibited diffuse nuclear staining [6264]. However, when full length lana was expressed by itself in uninfected cells, it exhibited diffuse nuclear staining that became speckled when a bacterial artificial chromosome containing the kshv terminal - repeat region was introduced . Furthermore, a naturally occurring lana isoform (with a 76 amino acid truncation at the c - terminal end) was detected in kshv - infected primary effusion lymphoma (pel) cell lines, bcp-1 and bc-3, but this isoform was incapable of binding to kshv episomes and therefore exhibited diffuse nuclear staining . Together, these findings support the conclusion that diffuse lana staining reflects the accumulation of lana isoforms that may still be associated with host chromatin but are not tethered to viral genomes presumably undergoing a state of lytic replication . Surprisingly, we also detected diffuse lana staining in the cytoplasm of a few reactivated mel1700-kshv cells, and although there is currently no published evidence for nucleo - cytoplasmic shuttling of functional lana in kshv - infected cells, one study showed that the lana amino acids 1323 region, which lacks a nls, is retained in the cytoplasm . Whether this short form of lana is generated and shuttled to the cytoplasm in some lytically replicating cells remains to be determined . Various studies have consistently shown that depending on the cell type and the state of viral reactivation, the lana - specific ln35 antibody used in this study can detect at least five distinct lana bands at approximately 220, 180, 160, 130, and 90 kda, that are potentially generated by alternative initiation, truncations, or post - translational modifications [6971]. Because the epitope recognized by ln35 has not yet been mapped, the identity and amino - acid sequence(s) of each of these bands requires systematic proteomic analysis beyond the scope of the current study . Nonetheless, we and others have now shown that appearance of the ~180, 130, and 90 kda lana - specific bands correlates with lytic replication [72, 73], which leads us to believe that the ~220 kda band likely corresponds to full - length lana, while the ~180 kda band may be the c - terminally truncated form associated with diffuse lana staining because it is present only in lytically replicating cells . One prediction from these findings is that the ratio of the 180 kda band relative to full length lana regulates the switch from the latent to the lytic phase . Recently described complex lana isoforms analogous to those that we have detected and proposed that these bands may result from noncanonical translation initiation . While these independent findings reveal an emerging new perspective on the complexity of lana function(s), they also raise several new questions . (a) what factors trigger non - canonical translation initiation and/or differential processing of lana into products that may be shuttled to the cytoplasm? (b) do cells such as mel1700 that display a higher propensity for supporting lytic replication express host restriction factors that induce the generation of cytoplasmic lana isoforms that are unable to mediate host chromosomal tethering to the virus genome? (c) what regulatory mechanisms control the accumulation of specific lana isoforms in relation to full length lana? Clearly, the pathogenetic implications of these regulatory themes cannot be over - emphasized, but they are not unprecedented among the gammaherpesviruses . For example, during infection with epstein - barr virus (ebv), a gammaherpesvirus closely related to kshv, at least eight different transcripts of the ebv latency - associated nuclear antigen (i.e., ebna-1, 2, 3a, 3b, 3c, 4, 5, 6), are expressed to control various states of the ebv latency program . Since ebna is the functional homolog of kshv lana, it is conceivable that lana analogs of the various ebna isoforms may also be expressed at specific stages of the kshv life cycle, although further investigation will be required in order to isolate replication phase - specific functions of the protein in a given cellular context . Our study also revealed a direct link between the nf-b activation status and virus reactivation, consistent with previous findings that nf-b activation early following kshv infection is required for establishment and maintenance of latency [17, 18] and for oncogenic transformation [19, 20]. Interestingly, the kshv latency program in mewo cells was accompanied by sustained activation of nf-b, coincident with reduced expression of key markers of the endogenous anti - inflammatory response . Conversely, in mel1700 in which the virus readily undergoes spontaneous lytic replication, phosphorylated nf-b p65 remained low, concomitant with sustained expression of anti - inflammatory proteins, leading us to conclude that kshv may persist in skin cells both by regulating its replicative program through activation of nf-b, while also exerting virus - induced subversion of the anti - inflammatory axis . Therefore, it would be reasonable to speculate that in order for kshv to persist and cause cutaneous disease in skin, it must infect and then either directly or paracrinally overcome the endogenous anti - inflammatory reactions of skin - resident cells in favor of conditions that support development of ks . Indeed, we found that kshv can indeed infect and induce cytologic reprogramming in melanocytes, the key cellular sensors of inflammatory injury in skin . Prior to this study, melanocytes were not known to be targets for kshv infection, which might have led some to question their relevance during kshv pathogenesis . However, it can be argued that the anatomical location and function of melanocytes as sentinels of inflammation at the interface of microbial offense and host immunity [58, 75] support the expectation that these cells might regulate kshv pathogenesis in skin . In response to infections and other pro - inflammatory cues, melanocytes express a wide range of signaling peptides including -msh . Upon binding to mc1-r, -msh transduces signals that prevent activation of nf-b and the associated expression of pro - inflammatory cytokines, tumor growth factors, and adhesion molecules that mediate transmigration of inflammatory cells through the vessel wall during angiogenic neovascularization [56, 58]. Given the fundamental role of inflammation in kshv pathogenesis, and the fact that -msh antagonizes nf-b [56, 58], the ability of kshv to infect melanocytes may have profound implications for ks development in skin . If impairment of the expression of anti - inflammatory molecules (such as mc1-r, trp-1, and xct) represents an important virologic correlate for establishment of kshv latency in skin cells, it is likely that settings in which sustained inflammation cannot be overcome would support virus - associated disease, whereas approaches that enhance the anti - inflammatory response (e.g., via -msh - dependent disruption of nf-b activation) may disfavor viral persistence in skin and should, therefore, be explored as a potential new option for clinical management of cutaneous ks or other virus - induced dermatologic conditions that may depend on chronic inflammation . Specifically, chronic inflammation in skin may trigger increased vascular permeability, upregulated expression of cell - adhesion molecules on vascular endothelium, and chemokine - mediated recruitment of kshv - infected cells from the underlying blood vessels to the site of inflammation where seeding of ks might occur (figure 9), and the fact that monocytes, macrophages, and activated dendritic cells make up a large proportion of the inflammatory infiltrate often present in cutaneous ks lesions [6, 7] supports this model . Additionally, our finding of efficient transmissibility of mel1700-derived virions to keratinocytes in vitro underscores the high probability of a pathophysiologic framework for virus dissemination in and out of skin, which is plausible given the close proximity and dynamic communication networks that naturally exist between melanocytes and keratinocytes in the human epidermal unit . Ironically, such a framework could be exploited by the virus since the anti - inflammatory melanogenic processes of melanocytes that are generally induced as an adaptive response to virus infection could be co - opted for virion transfer . Melanosome hijacking, has already been described for varicella - zoster virus, another herpesvirus that displays tropism for human skin . Inherently persistent viruses such as kshv must manipulate infected host cells to support mechanisms that favor either long - term infection within the target organ or inducible productive lytic replication that promotes viral dissemination to other permissive aspects of the host . Consequently, understanding mechanisms that control the balance between viral latency and lytic replication is an important goal that should guide development of strategies for limiting the pathogenesis of ks and other virus - associated diseases that emerge during the persistent state . Here, we found that the balance between underlying inflammation and lytic replication is a fundamental correlate of kshv latency and, by extension, kshv - associated pathology . Although the specific cellular and molecular determinants that control the intrinsic ability of certain cell types to support kshv latency are not fully defined, our study represents an important first step in our understanding of the nature and biologic impact of kshv - mediated impairment of the anti - inflammatory function in skin cells, with implications for pathologic outcomes such as cutaneous ks whose progression relies on inflammatory reactivity . Unfortunately, we cannot fully explain why the cell lines used in this study displayed such profound differences in the outcomes of kshv infection . One clue may be revealed by the fact that unlike mel1700, mewo is a highly - pigmented cell line with a high level of underlying inflammation, which is consistent with their ability to support a strong latency program . Alternatively (or in addition), it is possible that mechanisms for virus reactivation such as virus - induced apoptosis [79, 80] may be expressed in mel1700 cells and not mewo cells, an interesting concept that should be the focus of follow - on studies beyond the scope of the current study . In addition, isolation and characterization of correlates that control the timing and aggressiveness of ks at a population level may provide predictive power with respect to stratification of individuals at high risk for development of the lesion based on differential exposure to pro - inflammatory cofactors that foment inflammation, including toxins, uv radiation, allergens, trauma, or persistent infections . We note, for example, that in kshv / hiv coinfected individuals who are generally at a greater risk of developing the most aggressive form of ks, hiv serves as a cofactor for ks not only through establishment of an immunosuppressed environment but also through upregulation of the kshv receptor, xct, to facilitate kshv dissemination . Interestingly, hiv replication also requires nf-b activity, while the anti - inflammatory activity of xct is directly linked to the balance between the nf-b and -msh / mc1-r signaling pathways, which this study has revealed to be important for the kshv life cycle . Therefore, the ability of kshv to overcome -msh - mediated inhibition of nf-b activity in mewos (in which the virus establishes strong latency), would not only promote hiv replication but could also establish conditions that support cutaneous ks development . Future evaluation of these indicators in high - risk individuals with ks compared to those who are kshv seropositive but never develop ks may provide insight into which cellular dynamics predispose an individual to cutaneous ks and which host responses to infection could be harnessed to help prevent lesional histogenesis.
Optical coherence tomography (oct), since its introduction in the late 90s, has become an indispensible imaging technique for evaluation and management of retinal and optic nerve disorders . As a non - invasive test, enhanced depth imaging (edi)-oct enables cross sectional imaging of the retina with resolution approaching histologic sections . Current spectral domain (sd)-oct devices are empowered by software capable of measuring retinal thickness and constructing retinal maps; these features are particularly useful in evaluating and comparing retinal structures in pathologic conditions such as macular edema and vitreoretinal interface disorders . The choroid is a vascular compartment which provides oxygen and nourishment to the outer retina; it seems to play a pathophysiologic role in many disorders affecting the retina, such as age - related macular degeneration (amd), central serous chorioretinopathy (csc), polypoidal choroidal vasculopathy and vogt- koyanagi - harada (vkh) disease . Light scatter by the retinal pigment epithelium (rpe) and choroidal vasculature degrades the quality of images obtained from the choroid in conventional oct methods.1 nevertheless, in vivo cross - sectional visualization of deeper choroidal layers is now achievable with the recent introduction of edi - oct.2,3 we obtained edi - oct images in eyes with dry and wet type amd and compared them to that of normal eyes (fig . 1). The novelty of our approach is to provide choroidal mapping and choroidal volume measurement in retinochoroidal disorders . To obtain the choroidal image, we positioned the combined heidelberg spectralis device (spectralis hra+oct, heidelberg engineering, heidelberg, germany) sufficiently close to the eye, obtaining an inverted image of the fundus; an alternative method was employing the automatic edi mode of the apparatus . By applying these methods, the choroid approximates the zero - delay line, positioning the most sharply focused portion of the oct scan at the level of the choroid . We selected a high resolution 19 line raster scan protocol to encompass the macula within a 2020 area (fig . The automatically plotted boundary lines of the retina were adjusted to choroidal boundaries; internal limiting membrane (ilm) to rpe / choroid junction, and rpe to choroid/ sclera junction). The resultant images were viewed and measured with the heidelberg eye explorer software (version 5.3) to produce a color coded topographic map of choroidal thickness and volume (fig . The subfoveal area had the largest choroidal thickness (ct) in normal eyes (248.9350.92 m; mean subject age, 65.81 years; sample size, 32). Mean total choroidal volume (cv) in the central 3.45 mm macular zone was 2.32 l in the normal group ., subfoveal ct was found to decrease 17.39 m per each decade of age in normal subjects . Mean ct and cv measurements within the etdrs layout profile showed gradual nasal thinning of the choroid . These observations are similar to the results of previous edi - oct studies in normal eyes which have revealed highest ct at the fovea decreasing on both temporal and nasal sides, but more so nasally (fig . We observed that mean subfoveal ct in wet amd eyes was greater than that in dry amd eyes (233.1372.95 m versus 217.8274.52 m) despite similar mean age in both groups . This pattern of difference was demonstrated at all measured locations across the macula, but was only statistically significant 1 mm temporal to the fovea . Similarly, measured cv values in wet amd eyes were higher than dry amd eyes; the differences were statistically significant at all locations except nasal sectors . Mean total cv in the central 3.45 mm macular zone in dry amd eyes was 1.8 l, the corresponding value was 2.32 l in wet amd eyes which is still larger than normal eyes . In another subset of patients, we employed the 31 raster line pattern to generate a choroidal map in csc . Subfoveal choroidal thickness in these subjects was 45479 which is significantly larger than normal . Comparing the area of increased ct on choroidal maps with the area of hyper - permeability on indocyanine green angiography, we demonstrated that in 91% of patients the hyper - permeability region resides within the area of increased ct on choroidal maps (fig . Ocular and systemic disorders associated with vascular changes can affect the choroid which itself contains rich vascular networks . Previous studies employing sd - oct for choroidal evaluation measured ct at limited points.2 - 8 however, choroidal mapping can provide topographic and volumetric information in the entire macular area and in each subfield as defined by the etdrs layout pattern . These measurements may more accurately exhibit choroidal structure . In a study including 80 eyes of 40 healthy volunteers, shin et al used sd - oct applying a high resolution 6 radial scan protocol to obtain choroidal images.9 each radial line averaged 8 b - scan images . The authors failed to reconstruct maps in 16.2% of cases because of obscure choroidal boundaries limiting accurate segmentation . We were able to create topographic maps in all cases even in wet amd eyes in which posterior shadowing of retinal lesions made the segmentation process somehow difficult in some cases . Because each section was composed of an average of 100 scans, image clarity was enhanced . The eye - tracking technology, which is a specific feature of heidelberg devices, also improved image quality . Moreover, a 6-radial scan protocol cannot represent the entire macular area and encounters a higher probability of interpolation errors . We used the 19 line raster protocol, a denser scan in the macula which is more representative and valid for choroidal measurements, however, this required more effort and time for the segmentation process . It seems that choroidal vascular changes play certain roles in the development of chorioretinal disorders . Figure 4 demonstrates increased ct in an eye with csc, which is evident by the presence of hot colors in the choroidal map . Quantification of choroidal thickness and volume by edi - oct can help clinicians evaluate the efficacy of therapeutic intervention for pathologic features of the choroid such as choroidal hemangiomas (fig . 5).10 normal reference values for ct and cv can be established by various sd - oct devices . This normative database can be used to analyze choroidal changes due to various pathologic states . We detected an increase in ct and cv in wet amd eyes in comparison to dry amd eyes, which approximated values in our normal control group . Subfoveal ct has been reported to be increased in csc and vkh disease, but reduced in high myopic chorioretinal atrophy and idiopathic macular hole.11 - 16 the importance of choroidal measurements may emphasize the necessity of creating automated segmentation algorithms similar to the retinal map analysis protocols for faster and more precise evaluation of choroidal structure . In conclusion, choroidal mapping and quantitative analysis of the choroid seem to be a valuable method for evaluating chorioretinal disorders and monitoring the effect of therapeutic interventions . Further investigations are warranted to better establish the use of topographic ct and cv mapping in various chorioretinal disorders and to provide a normative database.
Paracoccidioidomycosis is a systemic fungal infection caused by the thermally dimorphic fungus paracoccidioides brasiliensis . This disease is endemic in certain south and central american countries with the highest prevalence observed in brazil (approximately 80%). People who work in agriculture and live in rural areas are at a particularly high risk for infection . Due to its specific geographical distribution, paracoccidioidomycosis is only observed in patients who have lived or travelled in endemic regions . An increase in migration and travel activities might contribute to a higher prevalence of paracoccidioidomycosis and other systemic mycoses also in europe . The thermally dimorphic fungus paracoccidioides brasiliensis grows as a filamentous fungus at 2026 c and as yeast at 37 c . Diagnosis is based on the direct identification of the fungus with microscopy, culture or histology from clinical specimen . In addition, molecular biological techniques such as polymerase chain reaction (pcr) demonstrate high sensitivity suitable for diagnosis and monitoring of treatment, . Paracoccidioidomycosis clinically appears in two different forms: an acute / subacute juvenile form and a chronic adult form . More than 90% of cases are chronic forms predominantly affecting men 3060 years old and are characterized by slow progression over months or even years . This form can occur either as unifocal if only the lungs are affected (approximately 25%) or multifocal with extrapulmonary dissemination to oral or nasal mucosa, skin, lymph nodes or adrenal glands . Less frequently, involvement of the eyes, central nervous system (cns), bones, vascular system and genital lesions may occur . Similar to other systemic mycoses, paracoccidioides brasiliensis enters the host via the respiratory tract and is usually inhaled during agriculture - related activities . Depending on the patient's immune status, it may stay inactive or spread by lymphatic and haematogenous dissemination to various secondary sites, . The choice of treatment with azole derivatives, amphotericin b and sulfonamides depends on the severity of the disease . First, the latency period between inoculation of the pathogen and manifestation of overt symptoms may be very long . Second, physicians in non - endemic countries have limited clinical experience with endemic systemic mycosis . Third, clinical and histopathological presentation of this fungal infection resembles several other infectious and non - infectious diseases . We report on a rare case of paracoccidioidomycosis in europe that was initially misdiagnosed and treated as tuberculosis . Aim of this case report is to strengthen awareness for imported endemic systemic mycosis - in particular paracoccidioidomycosis - and emphasize the similarities to tuberculosis and importance of travel history . A 62-year - old man was transferred from a community hospital to our department due to suspected diagnosis of reactivated tuberculosis of the lungs and adrenal glands in february 2015 (day 0). He reported left - sided chest and abdominal pain, weight loss of 12 kg during the last 3 weeks as well as night sweats and cough . The punctum maximum of the abdominal pain was located at the left costal margin and aggravated at inspiration . Past medical history revealed several episodes of tuberculosis with involvement of the lungs, testes and adrenal glands (fig . The patient reported that tuberculosis was diagnosed for the first time at the age of 7 years, followed by reactivations in the lungs with dissemination to the testes at the age of 14 and 21 ., he underwent ct - guided biopsy of a suspicious pulmonary nodule in the right lower lobe and left adrenal gland due to considerable enlargement of adrenal glands . Based on the histopathological finding of epithelioid cell granuloma with central necrosis, the diagnosis of tuberculosis of lungs and adrenal glands was made . At that time, sputum smear, pcr and culture for acid fast bacilli were negative . Due to increasing size of the adrenal glands the patient underwent a second biopsy in the same hospital in 2012 . Histopathological finding were similar to previous biopsy and again considered to be tuberculosis . From the year 1997 until 2001 he made yearly visits each for several weeks - to a village in regio de pasco (peru), a rural area located next to the rainforest of the amazonas . He lived there in a house with a garden for approximately three years (20022004) and helped to construct a hospital . Except for two days in arica (chile) he did not visit any other south or central american regions or countries . In addition, he reported that one day he recognized bats in the ceiling of his house and inhaled their excrements during cleaning . In addition to tuberculosis our patient had a past medical history of chronic bronchitis, billroth ii surgery due to peptic ulcer disease, cholecystectomy and prostate cancer treated with radiation therapy approximately 10 years ago . He was a current smoker with a history of 45 pack years, reported occasional alcohol consumption and no known allergies ., the patient appeared in a good general condition with normal body temperature and a blood pressure of 120/70 mmhg . There was a mild eosinophilia (6%) and monocytosis (16%), but total white cell count (8.1 g / l), hemoglobin (13.9 g / dl), and platelet count (366 the concentration of serum gamma glutamyltransferase (ggt, 193 u / l), alkaline phosphatase (224 u / l), and c - reactive protein (9.0 mg / dl), plasma fibrinogen (560 mg / dl), and erythrocyte sedimentation rate (esr, 54/81 mm) were elevated . Serum albumin (3.4 g / dl) and sodium (135 mmol / l) were slightly decreased while other electrolytes were normal . Myocardial biomarkers such as high sensitive troponin - t (hs - tnt), creatine kinase (ck) and muscle - brain type creatine kinase (ck - mb) were within normal range . Compared to previous examinations, abdominal ct (day + 0) revealed an increasing inhomogeneous enlargement of the adrenal glands (4.06.3 cm) (fig . Subsequently performed positron emission tomography (pet) (day + 18) revealed an increased metabolic activity in bilaterally enlarged adrenal glands . Interferon - gamma release assay (quantiferon) (day + 7) was positive but ziehl - neelsen smear, polymerase chain reaction (pcr) and culture of the sputum were negative for mycobacterium tuberculosis . Serological tests for human immunodeficiency virus (hiv), lues and adrenal autoantibodies were negative . Symptoms such as tremor, disturbance of sensitivity and weakness of the extremities, triggered a neurological work - up . Brain magnetic resonance imaging (mri) (day + 31) revealed a round temporo - parietal located lesion with perifocal edema, suspicious for infection or metastasis (fig . 3). Cerebrospinal fluid (csf) obtained by lumbar puncture (day + 34) was unremarkable without any sign for infection, inflammation or neoplasm . Hence, ct guided biopsy of the left adrenal gland and extirpation of a right cervical lymph node (day + 42) were performed for histopathological and microbiological work - up . Neither in the biopsy specimens of left adrenal gland nor the right cervical lymph node, ziehl - neelsen and pcr revealed any evidence for mycobacterium tuberculosis infection (day + 45). Serology for various systemic fungal infections and broad spectrum pcr from blood and aspirate fluids from biopsy (day + 49) were negative as well . Histology of lymph node and left adrenal gland biopsy showed granulomas with central necrosis (day + 48). In addition, in the left adrenal gland periodic acid schiff (pas), mcmanus, and methenamine silver stain (grocott) revealed evidence of fungal pathogens . Giemsa stain of the left adrenal gland biopsy specimen (day + 49) showed characteristic yeast elements with multipolar budding of variable size thus indicating the presence of paracoccidioides brasiliensis (fig . Cultures of the left adrenal gland biopsy specimen, were positive after incubation for 5 days (day + 54) at 37 c and 28 c on columbia agar (with 5% sheep blood; biomrieux, austria), 2% sabouraud dextrose agar (oxoid, austria) and brain - heart infusion agar (bhi agar, merck, austria). Sequence similarity was assessed by a search of homology not only with genbank sequences, but also with the isham its database . Thus, we diagnosed paracoccidioidomycosis with dissemination to adrenal glands and highly suspicious involvement of cervical lymph nodes and the brain . When paracoccidioidomycosis was suspected, the specimen and all cultures were processed in a special laboratory for biosafety level 3 (s3-laboratory). This laboratory has all the equipment and safety features required for biosafety level 3 with controlled air flow and filtered ventilation systems . All personnel wore personal protective equipment (specialized clothing, gloves whenever handling the specimens or cultures). In accordance to this, personnel had the utmost protection against accidental infection . In addition, replacement therapy with fludrocortisone and hydrocortisone was prescribed . Due to the evidence of cerebral involvement the patient was initially treated with intravenous liposomal amphotericin b. the patient's general clinical condition improved and the antifungal therapy was switched to oral itraconazole . However, itraconazole never reached therapeutic level - neither with capsule nor liquid formulation, most probably due to the previous billroth ii resection . After deterioration of the patient and an increase in inflammatory parameters, liposomal amphotericin b was restarted . Associated with worsening of the systemic inflammation, hypotension, prerenal kidney failure and subsequent addison crises occurred, so that hydrocortisone and fludrocortisone doses had to be adapted and high volume intravenous (iv) fluids substituted . Several ultrasound imaging studies showed a continuous decrease in size of the bilateral adrenal gland enlargement and a follow - up mri of the brain revealed a shrinking size of the cerebral lesion . After consultation of an infectious disease specialist, our patient was switched to oral posaconazole . Finally, the patient was discharged in a good general condition on oral posaconazole . Our case report describes the complex journey from presentation to diagnosis and treatment of a patient with paracoccidioidomycosis in a non - endemic area and a history of tuberculosis . Evidence of paracoccidioidomycosis in non - endemic regions such as europe is based on case reports, case series and reviews . Numerous cases were observed in spain and other european countries, . To the best of our knowledge the first case of chronic paracoccidioidomycosis in a cuban female living in austria was published in the year 2004 . Initially, this case was misdiagnosed and treated as tuberculosis . Since paracoccidioides brasiliensis is endemic in several countries of south- and central america, the patient was most likely infected by inhalation during one of his stays in peru . The first manifestation in the lung obviously remained undiagnosed and therefore - in agreement with the literature - it seems that there has been a latency period of several years from infection to first clinical presentation already with dissemination to lymph nodes, brain and adrenal glands . Various conditions such as smoking, previous tuberculosis with tuberculostatic treatment and prostate cancer with radiation therapy may have facilitated infection by altering the patient's immune status . The finding of bilateral adrenal enlargement with primary adrenal insufficiency and the history of tuberculosis revealed reactivation and dissemination of tuberculosis as the most likely diagnosis upon presentation to our center . However, no available report from the past five years showed clear evidence of infection with mycobacterium tuberculosis and no detailed medical information was available regarding the first episodes of tuberculosis . Diagnosis and therapy of the last episodes labeled as tuberculosis reactivations three and five years before presentation to our hospital was based solely on histopathological findings of adrenal epithelioid cell granuloma with central necrosis . Despite long - term tuberculostatic therapy, the clinical and histopathological presentation not only of paracoccidioidomycosis, but also of other systemic fungal infections, may resemble tuberculosis . Both tuberculosis and systemic mycosis induce formation of granulomas . Decreased cellular immunity and production of certain cytokines and their receptors facilitate both infections . Paracoccidioidomycosis and tuberculosis may be present concomitantly, occur sequentially or might be misdiagnosed due to similar clinical presentations . Previous studies have reported a rate of coexistence of both diseases ranging from 5.5% to 19% . Another common cause of adrenal enlargement and insufficiency are metastases in cancer patients, ranging from 20% to 45% in autopsy studies of lung cancer patients . In our patient with a history of prostate cancer a variety of pathogens (fungi, bacteria, viruses and parasites) may affect adrenal glands . Particularly in the presence of bilateral adrenal enlargement, infections caused by mycobacterium tuberculosis, paracoccidioides brasiliensis, histoplasma capsulatum, blastomyces dermatitidis or cryptococcus neoformans must be considered for differential diagnosis . Due to the high affinity of paracoccidioides for adrenal glands, adrenal gland involvement in paracoccidioidomycosis an autoimmune process is the most common reason for primary adrenal insufficiency (addison's disease) in western countries, whereas tuberculosis and other infectious diseases, metastatic cancer, adrenal hemorrhage, infarction or drugs are less frequent . In conclusion, paracoccidioidomycosis is rare in europe and can mimic more familiar diseases like tuberculosis . Depending on the patient's clinical presentation, travel history, and treatment success, endemic systemic fungal infections should be considered for differential diagnosis . With an increase in migration and travel activities this research did not receive any specific grant from funding agencies in the public, commercial, or not - for - profit sectors.
Polycyclic aromatic hydrocarbons (pahs) are a large group of organic compounds that are included in the european union (eu) and us environmental protection agency (us epa) priority pollutant list due to their mutagenic and carcinogenic properties . The most important sources of pahs have been identified as coke ovens in the production of aluminum, iron, and steel; heating in power plants and residences; cooking; motor vehicle traffic; environmental tobacco smoke; and the incineration of waste material . Cooking and food processing at high temperatures have been shown to generate various kinds of genotoxic substances or cooking toxicants including pahs . A number of pahs are known for their carcinogenic, mutagenic, and teratogenic properties like benzo(a)anthracene, benzo(b)fluoranthene, benzo(k)fluoranthene, benzo(g, h, i)perylene, benzo(a)pyrene, chrysene, dibenzo(a, h)anthracene, and indeno(1,2,3-cd)pyrene . Pahs containing up to four fused benzene rings are known as light pahs and those containing more than four benzene rings are called heavy pahs . Light pahs are more volatile, water soluble, and less lipophilic than the heavy pahs, so pahs migrate through the food chain into hydrophobic compartments and thus accumulate in lipid components due to their lipophilic nature [68]. Seven of the pahs have been classified by the us epa as compounds of probable human carcinogens . These are benzo(a)anthracene, benzo(b)fluoranthene, benzo(k)fluoranthene, chrysene, benzo(a)pyrene, dibenzo(a, h)anthracene, and indeno(1,2,3-cd)pyrene . With the aim of minimizing harmful effects on human health, recently, the european union established a maximum level of 2 ng / g wet weight for benzo(a)pyrene (the marker used for carcinogenic risk of pahs) in muscle meat of fish . In 2008, a scientific opinion adopted by the european food safety authority (efsa, 2008) concluded that benzo(a)pyrene alone is not a suitable indicator for the occurrence and toxicity of pahs in food and that eight specified pahs (pah8), for which oral carcinogenicity data are available, and/or a subgroup of these, pah4, are more suitable markers . It was further concluded that pah8 would not provide much added value compared to pah4 (the sum of benzo(a)pyrene, chrysene, benz(a)anthracene, and benzo(b)fluoranthene). In september 2012, benz(a)anthracene, benzo(b)fluoranthene, and chrysene were included in the assessment and recorded together with benzo(a)pyrene as a sum parameter (group of pah4), as per regulation (eu) number 835/2011 . Developed analytical methods include soxhlet extraction, dispersed solid phase extraction, and accelerated solvent extraction coupled to sample cleanup using gel permeation chromatography which had been used to assess most of pahs in different matrices by changing the technique of cleanup from coextracted interferences that may cause false positive results, but most of these techniques are expensive, use chlorinated solvent for extraction, and are time and chemicals consuming . In 2013 a simple solid phase extraction (spe) method followed by comprehensive two - dimensional gas chromatography coupled to time - of - flight mass spectrometry has been developed for analysis of (15 + 1) carcinogenic polycyclic aromatic hydrocarbons (pahs). This method includes three critically assessed sample preparation approaches: (i) gel permeation chromatography (gpc), (ii) gpc followed by silica based spe, and (iii) spe employing pahs - dedicated molecularly imprinted polymers (mips). Also in 2013, two of the most relevant analytical methods including different extraction procedures such as ultrasound - assisted solvent extraction (usae) and ultrasound - assisted emulsification microextraction (usaeme) for determination of 11 mutagenic and carcinogenic pahs were optimized by the selected extraction techniques . The recoveries ranging from 70% to 100% by usae and from 70% to 108% by usaeme with estimated quantification limits between 0.020 and 2.6 g / kg were achieved . A few researches on the development of quechers analytical method for determination of pahs levels in fish the streamline of quechers (quick, easy, cheap, effective, rugged, and safe) method for extraction of pesticides in tissues of high fat (> 3.5%) encourages scientists to apply modifications and develop this method in order to extract veterinary drugs and pahs from seafood such as shrimp and in fish by using quechers for extraction followed by dispersive spe analysis by gcms in sim mode for quantification . The aim of this study is to adapt and validate quechers method for extraction followed by solid phase extraction for sample purification and gas chromatography mass spectrometer gcms for determination of 16 pahs in fish at low loq level . The edible parts (head, bones, and removable skin were removed) of nonsmoked blank herring fish were obtained and completely homogenized in a food mixer as a blank sample and then stored in a freezer at 20c . Acetone (riedel - de hen, purity 99.8%), acetonitrile (sigma - aldrich, purity> 99.9%), toluene (merck), dichloromethane chromatography grade, and n - hexane (purity> 99.0%) were the solvents used . Agilent quechers salts and buffers were prepackaged in anhydrous packages for en 15662 containing 4 g magnesium sulfate (mgso4), 1 g sodium chloride (nacl), 1 g sodium citrate, and 0.5 g disodium citrate sesquihydrate . Silica gel (60120 mesh, fluka) was activated at 150c for 12 hours prior to use . A 1000 g / ml stock solution of 14 pahs includes naphthalene, fluorene, fluoranthene, benz(a)anthracene, chrysene, pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene, benzo(a)pyrene, acenaphthene, phenanthrene, anthracene, acenaphthylene, and pyrene - d10 (surrogate standard) and reference standards obtained from sigma - aldrich with purity> 95% were prepared, while benzo(g, h, i)perylene and dibenz(a, h)anthracene were obtained as readymade of 100 g / ml in methylene chloride and indeno[1,2,3-cd]pyrene 200 g / ml in methanol . A 1 g / ml working solution of all 16 pahs was prepared in toluene . Calibration mixtures with concentration 2, 10, 50, 100, and 500 ng / ml were prepared from serial dilution of the working solution in toluene where pyrene - d10 maintained at level 50 ng / ml in all calibration levels and all stored in refrigerator at 4c . Pfte or polyethylene 50 ml tubes with screw cap and 15 ml tubes contain 1 g magnesium sulfate were obtained for sample extraction . Centrifuge up to 4000 rpm (heraeus labofuge 400), vortex, automatic pipettes (hirschmann laborgerate) suitable for handling volumes of 10 l to 100 l and 100 l to 1000 l, 10 ml solvent - dispenser (hirschmann laborgerate) for acetonitrile . The glassware were washed with detergent and water then rinsed with acetone and dried at 90c before use . The validation procedure needs to be considered, the context of fitness for purpose and cost benefit criteria . About 10 g of fish sample was weighted in 50 ml teflon centrifuge tube, 50 l of 10 g / ml pyrene - d10 was added which acts as surrogate standard of 50 g / kg, and each set of 6 replicates was spiked with 20, 100, and 500 l of 1 g / ml spiking mixture to get 2, 10, and 50 g / kg, respectively . 10 ml of acetonitrile was used for extraction, shaken for 2 minutes, mixed with agilent quechers, shaken for 1 minute, and centrifuged at 4000 rpm for 5 minutes . Aliquots of the resulting supernatant were transferred to teflon tube containing mgso4, vortexed for 30 seconds, and centrifuged at 4000 rpm for 2 minutes; 4 ml of the acetonitrile layer was transferred into 50 ml flask and then evaporated near to dryness . All fish extracts were subjected to packed solid phase cleanup cartridge which was prepared in - house as follows . Plug a glass wool on 10 ml length syringe; 1 g 20% deactivated silica gel and 0.2 mgso4 were weighted and conditioned with 5 ml of n - hexane / dichloromethane (3: 2), the sample extract loaded to the cartridge using 10 ml of elute (n - hexane / dichloromethane). Collect fractions in a 50 ml flask, evaporate on rotary evaporator at 40cnear to dryness and dissolve in 2 ml toluene and then apply to gcms for analysis . Agilent 6890n series gas chromatography instrument equipped with 5975 series mass selective detector and agilent gc column of model j&w hp-5ms ultra inert with the specifications (30 m length, 0.25 mm internal diameter, 0.25 m film thickness) were used for both qualitative and quantitative determination of pahs . Helium gas was used as the carrier gas; the column was maintained at a constant flow rate of 1.3 ml / min . The column temperature was initially held at 90c for 2 min, ramping to 180c at a rate of 15c / min, held at 180c for 15 min, ramping to 250c at a rate of 10c / min, held for 2 min, ramping to 290c at a rate of 10c / min, and held for 10 min . The mass spectrometer was operated in the ionization mode and spectra were acquired using a mass range of 45450 m / z . Sim acquisition was carried out by comparison of the base peak of each targeted pah as shown in table 1 . Quality control and assurance of each patch were passed by monitoring the performance of the gcms and the mass selective detector daily by tuning the mass detector and monitoring the sensitivity and linearity of the calibration curve, respectively, and also analyzing blank sample to confirm that there in contamination effect on the results during analysis . Figure 1 represents overlay between blank and spike fish at level 50 g / kg samples to show the separation of 16 pahs by gcms in 35 minutes using agilent j&w hp-5ms ultra inert gc column (30 m length, 0.25 mm internal diameter, and 0.25 m film thicknesses). This representative chromatogram of pahs in fish matrix indicates good cleanup separation techniques with minimum interference of coextract that may influence the accuracy of the result . The linearity was obtained by plotting the peak area of each analyte versus its concentration . The linearity of all pahs indicates that both dibenz(a, h)anthracene and indeno(1,2,3-cd)pyrene compounds had r values of 0.996; all others were 0.998 or higher within measurement range of 250 g / l indicating excellent linearity . It is the minimum concentration of analyte in the test sample that can be measured with a stated probability that the analyte is present at a concentration above that in the blank sample . Limits of detection expressed as three multiplied by sd of the recovery replicates at the lowest expected concentrations ranging between 0.09 and 1.94 g / kg are shown in table 2 . It is the lowest concentration of analyte that can be determined with an acceptable level of uncertainty according to eurachem guideline and it is usually the lowest point on the calibration curve which is 2 g / kg . The analytes were considered to be quantitative when their abundance confirmation ion signal to noise is s / n 3 with an accurate quantitation of 20% of their true value in the calibration standard . Sample residues that met all criteria but had s / n <3 were reported as less than the limit of quantification (<loq) while those which had not fit any criteria were reported as not detected (n.d . ). The recovery of (n = 6) replicates at each level was calculated and summarized in table 3 which shows very good recovery and excellent rsd . From table 3, the recovery of each set of 6 replicates was in the range of 56115% where the lower spiking level was selected in order to include the lower concentration of pahs fish muscle fixed at 2 g / kg . The extraction efficiency was consistent over the entire range with indeno(1,2,3-cd)pyrene and benzo(g, h, i)perylene being the most affected compounds where their recovery at lower level was 65 and 69%, respectively, and at the second level was 61 and 56% . No significant dispersion of results was observed for the other remaining pahs and recovery did not differ substantially at the lowest and the highest concentrations . According to commission regulation (ec) number 1881/2006 and (ec) number 333/2007 [22, 23], the maximum level for the determination of pahs in fish was 2 g / kg wet weight and the recovery range of the methods used should be 50120%, indicating that the validated method complies with these criteria . Where rsdpooled can be calculated as(1)rsdpooled = rsd12n11+rsd22n21+n11+n21+.rsd is the relative standard deviation, n is the number of samples, and the equation used to calculate the recovery is (2)recovery%=cfce100,where c f is the found concentration and c e is the expected concentration . Figures 2, 3, and 4 represent mean recovery and rsd% ranges; most of the pahs recovery was between 70 and 120% with most of rsd less than 10% . The reported results provide evidence that the adapted quechers method achieved for most of the pahs gives good recoveries, repeatability, and reproducibility . Using these equations the following relative standard uncertainty u rec = 3.6% and(3)u(rec)=sn . Combined uncertainty u c is(4)uc = up2+urec2+uref=6.2% . U p is the uncertainty due to precision experiments . The uncertainty due to reference standard preparation u ref = 0.7 . U p which is the relative standard uncertainty due to precision experiments expressed as relative standard deviation was found to be less than 5% (the highest pooled rsd% for pyrene). Expanded uncertainty is obtained by multiplying the combined uncertainty by a coverage factor k. for confidence level of 95% k is 2 . The expanded uncertainty (at 95% confidence level) the higher sample weight used in the proposed method (10 g) with accepted solid phase extraction cleanup techniques compared with e1 and e2 quechers acetonitrile based extraction method (1 g) facilitates the ability of lowering the limits of quantification for pahs where the recoveries obtained at 500 g / kg for traditional acetonitrile based quechers extraction using extraction scheme e1 (1% acetic acid in acetonitrile and aoac salts) yield average recoveries less than 67%, with individual pahs recoveries typically ranging from 35 to 87%, also for extraction scheme e2 (acetonitrile and en salts) performed equally poorly, with average pahs recoveries being less than 68% and individual pahs recoveries ranging from 24 to 88%, while for the proposed method the individual pahs recoveries range from 65 to 107% at the loq limits (2 g / kg) with method uncertainty equal to 12 (at 95% confidence level) indicating that the method is quite fit for purpose with acceptable loq, precision, and accuracy according to commission regulation (ec) number 1881/2006 and (ec) number 333/2007 . The results found were very promising; it may be concluded that modified quechers method of extraction followed by cleanup silica gel packed solid phase extraction combined with gcms for quantitation is an efficient method for determination of low concentration of selected group of pahs in homogenized fish samples . This method is suitable for laboratories engaged daily in routine analysis of a large number of samples, and the loq of the method is sufficiently attained low in order to be used in the national monitoring program of egypt for determination of pahs in fish as well as in imported and exported fish following codex regulations.
Toxoplasma gondii (t. gondii) is an intracellular parasite and the etiological agent of toxoplasmosis . Although the infection is asymptomatic in most immunocompetent individuals, toxoplasmosis may cause severe complications in immunocompromised individuals [1, 2]. If t. gondii infection occurs during pregnancy, transplacental transmission can occur, leading to abortion or congenital malformations [25]. The immune response against t. gondii has been largely characterized and it has been demonstrated that cell mediated immunity is essential to control infection [2, 6, 7], involving synergy between cd4 and cd8 t cells [8, 9]. T. gondii triggers the production of il-12, mainly by dendritic cells [1012], which stimulate nk cells and t lymphocytes to secrete large amounts of ifn-, a key cytokine for protection against this parasite [10, 13, 14]. Regulatory t cells (tregs) are a subset of cd4 t cells that control the immune response by suppressing many lymphocyte effector functions [1719]. Natural tregs constitutively express cd25 (the chain of the il-2 receptor), ctla-4, and the forkhead family transcription factor foxp3 [22, 23], which is required for their development and function . Although initially described for preventing autoimmune responses [20, 24, 25], it has also been demonstrated that they can regulate the immune response against infectious agents [2629]. For example, in vivo depletion of cd25 cells leads to an increase in the production of ifn- in animals infected with plasmodium chabaudi adami and trypanosoma congolense, or in animals infected with schistosoma mansoni to an increased production of ifn-, il-4, il-5, and il-13, indicating that tregs can control both th1 and th2 responses . During infection with plasmodium berghei or litomosoides sigmodontis, the aim of this paper is to study the role of tregs during the acute infection of t. gondii in the resistant balb / c strain of mice . We carried out depletion experiments by injection of the pc61 mab in mice followed by infection with the type ii strain me49, and analyzed mortality . Since pc61 mab injection could also eliminate other cell subtypes expressing cd25, mainly activated t cells (tact), we also studied the cd4 t cell subsets affected by injection of the pc61 mab . Six eight - week - old female balb / cann mice, weighing 1820 g, and swiss mice, were bred in our animal house and maintained in pathogen - free conditions . All protocols depicted in this paper were approved by the local bioethics committee for animal research . The me49 strain of t. gondii was maintained in swiss mice as previously described . Briefly, brains from infected mice were removed and homogenized in dulbecco's phosphate buffered saline (dpbs); the number of cysts was enumerated and mice were infected intraperitoneally with 10 cysts; this procedure was carried out every 24 months . For peroral infection, mice anesthetized with sevorane (abbott, mexico city, mexico) were infected with 20 cysts by gavage in 0.1 ml dpbs . The pc61 hybridoma secreting rat igg1 against murine cd25 was obtained from the american type culture collection (atcc, manassas, va). The f41d1 hybridoma, secreting an unrelated rat igg1 mab (isotype control), was a kind gift of dr . Hybridomas were grown on cd hybridoma medium (gibco, grand island, ny, usa) and mabs were obtained after ammonium sulfate (45% w / v) precipitation . After extensive dialysis against pbs, antibody concentration was determined by spectrophotometry at 280 nm . Antibodies were resuspended in pbs at 1 - 2 mg / ml and stored at 20c until used . Unless otherwise stated, mice were injected intraperitoneally (ip) with 200 g of purified pc61 mab or control isotype at day 2 . Two days later (day 0), mice were infected perorally as described above . Depletion was confirmed by analyzing cd4cd25 or cd4cd25foxp3 cells, in peripheral blood samples when mice were infected . Weight and cumulative mortality were recorded daily; survival curves were compared by the logrank test using the prism software (graphpad, san diego, ca). Spleen cells (1 10) were incubated (30 minutes, 4c) with anti - cd4-fitc or -tc (clone rm4 - 5, caltag, burlingame, ca), anti - cd4-percp (biolegend, san diego ca), anti - cd25-pe or apc (clone pc61 5.3, caltag), or anti - cd25-pe (clone 7d4, miltenyi biotec, auburn, ca) in 100 l of washing buffer (dpbs + 1% fcs + 0.1% nan3). After washing 3 times, cells were suspended in dpbs and analyzed immediately . For foxp3 detection, we used the foxp3 staining buffer set (ebioscience, san diego, ca) with anti - foxp3-alexa fluor 488 (clone fjk-16s, ebioscience) following the indications provided by the manufacturer . Flow cytometry analysis was performed on a facscalibur or a facscan cytometer (becton dickinson, san jose, ca), running the cell quest program (becton dickinson). Lymphocytes were identified by forward scatter (fsc) and side scatter (ssc) characteristics, gated and further analyzed . Samples were analyzed using the flowjo software v. 5.7.2 (tree star, ashland or). We carried out depletion studies by injection of the pc61 mab to analyze the role of tregs in the resistant balb / c strain of mice during the infection with the type ii strain me49 of t. gondii . In the literature we found many protocols for tregs depletion using the pc61 mab in different models, using a wide range of mab concentrations, from 100 g to 1 mg [32, 33, 3641], or even several injections of the pc61 mab before and during infection [30, 42]. To reduce the possibility of tact elimination due to high antibody concentrations, we tested the lowest doses reported of pc61 mab (100 g and 200 g) by ip injection . Two days later we analyzed cd4cd25 cells to determine if depletion was achieved, since mice would be infected at this time point . We used the pc61 mab in the facs analysis because mcneill et al ., using foxp3-gfp transgenic mice, demonstrated that detection of cd25 cells in pc61-depleted mice using either the 7d4 or the pc61 mabs showed similar results . As can be seen in figure 1, injection of either 100 (figure 1(b)) or 200 g (figure 1(c)) of the pc61 mab leads to similar levels of depletion of cd4cd25 cells in the spleen . Even though depletion efficiency was the same by the day we intended to infect the animals, we were concerned about how long would the depletion lasted . During the first week after injection of the pc61 mab (figure 2), depletion efficiency was very similar using both doses, but at 10 days post - depletion, a higher number of cd4cd25 cells were observed in animals treated with 100 g when compared to cells from animals treated with 200 g . At 14 days post depletion, about 83% of cells these results show that injection with 200 g leads to a depletion of cd25 cells for at least 10 days . Recovery of cd4cd25 is slightly faster in animals treated with 100 g mab; at 14 days, cd4cd25 cells from both groups reached almost normal levels . We thus chose 200 g of pc61 mab for the subsequent experiments . In order to study the role of tregs during infection with t. gondii, resistant balb / c mice were depleted of cd25 cells, and 2 days later they were perorally infected with 20 cysts of the me49 strain . Since cd25 is a molecule expressed by other cell types, including activated cd4 t cells, and foxp3 is exclusively expressed by tregs and is required for their development and function, we thus analyzed the depletion of foxp3 cells (tregs) the day of infection (2 days after depletion). We found that only 53% of foxp3 cells were eliminated by injection of the pc61 mab (figure 3), confirming results previously reported . Weight changes and mortality were analyzed for 25 days after depletion and infection (figure 4). All mice lost up to 25% weight due to the parasite; it has to be noted that depleted mice lost 5% less weight compared to isotype treated mice . After 15 days the latter started to gain weight (figures 4(a) and 4(b)), but did not reach their initial weight . When mortality was analyzed, isotype - treated mice survived during the 25 day experiment, but 50% of pc61-treated mice died <13 days post infection (dpi) (figure 4(c)), although this result was not statistically significant (p = .0549). A similar result was observed when mice were infected with 50 cysts, although we observed a higher mortality rate (data not shown). Analysis of blood samples of the same animals from this experiment showed that although cd25 cells were eliminated, including foxp3 and foxp3 cells, at later time points, a marked increase in cd25foxp3 cells (tact) was observed in depleted animals, while the percentage of foxp3 cells (tregs) was still decreased (data not shown). We depleted and infected mice as described above, they were killed 10 days pi, when animals showed symptoms of toxoplasmosis (24 days before death) and an exhaustive analysis of spleen cells was performed . Analysis of tregs and tact cells from infected animals at this time point (figure 5) showed that infection induced an expansion of tact cells (3.76 versus 24.79). Depleted infected animals, however, showed a dramatic expansion of tact when compared to depleted / noninfected animals (0.94 versus 25.79), but no difference was detected between tact from infected nondepleted or depleted mice (24.79 versus 25.79), demonstrating that depletion did not prevent activation of t cells . On the other hand, a nearly 50% reduction in percentage of tregs was observed in infected - nondepleted animals, when compared to control mice (8.32 versus 16.35); depleted noninfected animals still showed a 50% decrease in tregs at this time point (8.34 versus 16.35), while depleted infected animals had 4.85% of tregs, which represents a 50% reduction when compared to noninfected - depleted mice (4.85 versus 8.34). All these results were similar when mab 7d4 was used to detect cd25 cells (figure 5), demonstrating no interference in the detection of cd25 with pc61 mab . A summary of the results obtained from all mice studied is depicted in figure 6 . Analysis shows that at 10 dpi (12 days post depletion) 50% of tregs are still lacking in depleted noninfected animals . Interestingly, infection induces a 50% reduction of tregs, but depleted infected animals have 50% less tregs than nondepleted infected mice, and only 25% of tregs when compared to control noninfected mice . Analysis of tact cells confirmed that infection leads to a dramatic expansion of this subset, which is not altered by depletion, since mean percentage of tact cells was unaffected, although a high dispersion in data was observed (figure 6). When the ratio of tact / tregs cells was calculated (figure 7), we found that in noninfected animals, whether depleted or nondepleted, ratios remained nearly unchanged (0.28). In infected mice, a higher ratio was observed (1.24.0), indicating a expansion of tact cells due to the parasite . In depleted / infected mice, however, the ratio was 0.512.7 (figure 7(a)): a group of 4 mice showed a very high ratio (> 5.0), while another group presented a low ratio (0.51.15). The day we carried out this experiment, one animal was moribund, and its spleen cells showed the highest proportion of tact / tregs (ratio = 12.7, figure 7(a)). It has to be noted that in this experiment, an additional group of mice was used to evaluate mortality (figure 7(b)), and we found that 60% of animals died 15 days pi, which correlates to the percentage of mice with the higher proportion of tact / tregs (figure 7(a)). All these experiments show that although the generation of tact cells due to infection is not altered by depletion, the percentage of tregs remained very low, turning susceptible a resistant strain of mice . In the present work we analyzed the role of tregs during infection with t. gondii in the resistant balb / c strain of mice . We observed that infected animals showed a decreased number of treg cells, a result which agrees with that reported by ge et al ., who showed that in pregnant and nonpregnant mice, infection with t. gondii induced a reduction in foxp3 mrna expression levels in spleen and a reduction in both percentage and absolute number of tregs . These results differ from those observed during the acute phase of other infections (p. berghei, s. mansoni, heligmosomoides polygyrus, mycobacterium tuberculosis, plasmodium yoelii, brugia malayi, and l. sigmodontis), in which an increase in foxp3 cell number is observed [32, 39, 4448]. In t. gondii infection, it is possible that tregs die or migrate to other sites in order to control the immune response locally, as it has been shown during p. berghei infection . It has to be noted that t. gondii can infect all cell types and disseminates to most organs [49, 50]. The fate of tregs during t. gondii infection, however, remains currently unknown . Injection of pc61 to deplete cd25 cells has been widely used to study the role of tregs in different models [32, 36, 37, 39, 42, 51, 52]. In our depletion experiments, we observed that 5060% of balb / c mice died during the acute phase of infection, an observation that suggests that tregs play an important role in toxoplasmosis . However, since cd25 is also expressed by other cell types, injection of the mab leads also to the depletion of tact cells and interpretation of results should be taken carefully . We used a low single dose (200 g) of pc61 mab, which was enough to eliminate 50% of tregs . These observations agree with those reported previously, in which a partial depletion of tregs cells is observed after injection of pc61 mab . Injection of pc61 mab initially eliminates 50% of tregs, but in infected mice this reduction is exacerbated due to the infection, reaching 75% tregs reduction in these animals at 10 days pi, when compared to nondepleted - noninfected mice . However, depletion did not hinder the activation of t cells after t. gondii infection . In fact, levels of cd69 expression and percentage of cd69 cells were similar in foxp3 cells from nondepleted infected and depleted infected mice (data not shown), demonstrating that both groups generate the same proportion of tact cells . While this work was carried out, couper et al . Reported that depletion using 1 mg of the pc61 mab leads to an increased susceptibility of male c57bl/6j mice to the me49 strain of t. gondii . Although the results in mortality obtained in our work are similar, we used the highly resistant balb / c strain of mice, in contrast to the highly susceptible c57bl/6j strain . Moreover, we depleted animals with a lower concentration of pc61 mab to lessen undesirable effects in other cell populations; a single dose of mab (200 g), 2 days before infection was enough to achieve a 50% elimination of tregs . We avoided the use of higher concentrations of pc61 mab because we think that this would induce a broad and long lasting depletion of cd25 cells (both tact and tregs) making more difficult the interpretation of the results . The use of a suitable concentration of the pc61 mab allowed us to detect a difference in the proportions of tact and treg cells 10 days pi . Thus, the amount of pc61 antibody did not prevent the generation of tact cells due to the infection . The levels of treg, however, remained low during infection, leading to the loss of resistance of the balb / c strain . These results show that the absence of tregs alters the protective immune response against t. gondii and thus mice become susceptible . T. gondii induces the activation of cd4 and cd8 t cells that are crucial to control infection . These cells could in turn be controlled by tregs, as it has been demonstrated in the t. congolense infection . Our results show that tregs play an important role in the modulation of the protective immune response against t. gondii . Since infection with this parasite drives a powerful th1 immune response, it is tempting to speculate that the absence of tregs induces an uncontrolled inflammatory response by tact cells . The specific molecules and cells directly responsible for the death of animals, however, remain to be established.
Syndrome of inappropriate secretion of antidiuretic hormone (siadh), also known as the syndrome of inappropriate antidiuresis (siad), is one of the most common causes of hyponatremia1). Impaired water excretion in the absence of renal insufficiency, glucocorticoid deficiency, hypothyroidism and decreased effective arterial blood volume are the hallmarks of this syndrome . Although a growing number of drugs have been reported to produce siadh, most published reports concern vasopressin and its analogues such as thiazide and thiazide - like diuretics, chlorpropamide, carbamazepine, antipsychotics, antidepressants and nonsteroidal anti - inflammatory drugs . Old age seems a risk factor of siadh following the use of many of these drugs . A combined use of these drugs, excessive fluid intake, and other underlying conditions which limit free water excretion will increase the risk3). Sodium valproic acid (vpa), known as a carboxylic acid, is being used for an anti - epileptic in idiopathic and symptomatic generalized epilepsies and for some symptomatic focal epilepsies as well as trigeminal neuralgia, migraine and bipolar disorders4). Its mechanism is unknown; however it is probably associated with the metabolism of the gaba neurotransmitter . The toxic effect it provokes there are several vpa - related idiosyncrasies; the most noteworthy are alopecia, bone marrow aplasia, immune - mediated hepatotoxicity and pancreatitis5). Here we describe a patient with hyponatremia caused during the treatment with the antiepileptic drug, i.e., sodium valproic acid (vpa). The clinical course indicated that vpa contributed to an siadh6). To our knowledge, this is a rare case of example in the medical literature in english which shows an association between vpa and siadh . He had suffered from generalized tonic clonic epilepsy that occurred after a craniectomy due to right epidural hematoma . The patient was treated with sodium valproate in a dose of 900 mg / day for 9 months . He had been removed a brain tumor 4 years before and he had craniectomy for an epidural hematoma 10 months ago . He was admitted to our hospital with a reported seizure, dizziness, nausea and vomiting for the day . His vital signs, physical and neurological examination on arrival were within normal limits except drowsy consciousness . Significant laboratory findings were: sodium of 111 (135 - 145) mmol / l, potassium of 2.6(3.5 - 5.0) mmol / l, chloride 66 (95 - 110) mmol / l and serum osmolarity of 245 (280 - 300) mosm / kg . Urine sodium and urine osmolarity were 58 mmol / l and 751 (50 - 1,200) mosm / kg, respectively . Ante meridiem cortisol level, thyroid stimulating hormone, and free thyroxine level were within normal limits . The results of her rapid acth stimulation tests were also within normal ranges (table 1). Valproic acid level was revealed to be within therapeutic range (62.76 g / ml; an optimum therapeutic range 50 to 100 g / ml). The diagnosis of siadh was made based on hyponatremia, and low serum and high urine osmolality . No other causes of hyponatremia, including diuretic therapy, tumors and respiratory system disease, were present . The sodium valproate treatment was discontinued, and hypertonic saline was infused because of his symptomatic and profound hyponatremia . His serum sodium concentration increased to 131 the symptoms resolved immediately after the correction of hyponatremia . During the next 48 hours, normal saline infusion was given, and serum sodium level was restored to 134 mmol / l . The patient presented with hyponatremia, hypoosmolality, impaired excretion of water, which are all features of siadh7) and of generalized tonic clonic convulsions . We consider these seizures to be caused by hyponatremia due to siadh; because other symptoms differed from those of the initial convulsive episode and serum vpa level which was useful to assess the patient compliance was within the target therapeutic range . Other causes of hyponatremia such as volume depletion, hypothyroidism, renal or adrenal insufficiency and diuretic abuse, and vomiting were excluded . The correction of the patient's hyponatremia, combined with the discontinuation of sodium valproate, resulted in the resolution of his hyponatremia . This is the first report in korea on such an adverse reaction to this medication . Use of vpa could lead to gastrointestinal discomfort, weight gain, hair loss, tremor and sedation, but these side effects seems rather uncommon, mild, and transient during vpa monotherapy8). Potentially hazardous reactions such as hepatitis and pancreatitis have occurred in a few patients on vpa, generally in multidrug therapy8). (consider including this in the introduction before noting side effects are quoted), we could find only a few patients who reported hyponatremia at different times after sodium valproate use9 - 13). The mechanism by which valproic acid could cause hyponatremia or siadh has not been fully elucidated . Most cases of drug - induced hyponatremia involve the elderly, and could be related to an altered antidiuretic hormone (adh) regulation or action of adh on kidneys12). We speculate that dopaminergic, serotonergic and noradrenergic systems may play a role in siadh due to sodium valproate14). Another hypothesis is that valproic acid has a direct effect on tubular cell function, because a few cases of tubular dysfunction in association with valproic acid with a positive dechallenge have been described5). Thus, we consider this episode of siadh to be due to a combination of factors including serotonergic stimulation of adh, reduced sensitivity of the hypothalamic osmoreceptors, and reduced renal ability to conserve salt and water . Hyponatremia accompanied by cns disorders has shown to increase delayed cerebral ischemia and mortality rates15). Therefore, we suggest that patients who have high risk of hyponatremia are recommended to measure the baseline electrolyte levels before starting therapy with sodium valproate16), and to monitor for electrolyte levels throughout the full course of treatment.
Aggregation and bordering behaviors were measured essentially as described2; values report the average fraction of three or more behavioral assays of 150 animals each . Average locomotion speed was calculated by tracking 20 animals for 10 minutes with an automated tracking system30 . For rmg - selective expression of transgenes, loxp - flanked lacz sequence containing a transcriptional stop, three repeated polya sequences, and two repeated mrna cleavage sequences was inserted upstream of npr-1::sl2::gfp under the control of the flp-21 promoter (flp-21::loxstoplox::cdna(gfp, npr-1, tetx, or pkc-1(gf)). Transgenic animals containing this plasmid strong and consistent expression was observed in rmg and m2; adl, asj, and ask were seen weakly and inconsistently . For ascaroside chemotaxis assays, washed animals were placed in the center of a 4-quadrant plate with ascarosides in alternating quadrants, and scored after ten minutes . A chemotaxis index (c.i .) Was calculated as (#of animals on pheromone quadrants #of animals on buffer quadrants)/(total #of animals). In the cartoon in fig . 4 a cocktail of three ascarosides was used; individual ascarosides and other combinations are in supplementary fig . Calcium imaging of the aia and ask neurons was performed in a custom - fabricated microfluidic device, essentially as described26 . For ask imaging, the transgene kyex2866 was used, with gcamp2.2b (gift from loren looger) expressed under the sra-9 promoter . For aia imaging, ask fluorescence was recorded in the neuronal cell body, and aia fluorescence was measured in the dorsal aia process in the nerve ring.
It is characterized by the diversion of portal venous blood away from the liver, by either end - to - side or side - to - side shunt . A two - and - half - year - old child presented with respiratory distress, poor growth, and loss of appetite for 2 months . Computed tomography (ct) showed mild cardiomegaly with collapse / consolidation of bilateral lung lobes . Incidentally, there was the presence of an end - to - side shunt between the right branch portal vein (pv) and the inferior vena cava (ivc) with fusiform aneurysmal dilatation of the pv continuing into the left branch, which abruptly ended after a short distance . There was aplasia of the right branch of the pv [figures 1 and 2]. The hepatic artery appeared normal . The splenic and superior mesenteric veins had normal orientation, and these vessels joined to form the main pv . A diagnosis of congenital extrahepatic portocaval shunt (ceps) (abernethy malformation type 1) with pv aneurysm was made . Since the patient was asymptomatic and liver enzymes were normal, the patient was advised follow - up . There was the presence of end - to - side shunt between the right branch of pv and the ivc (solid thick arrow), fusiform aneurysmal dilatation of the pv, which was continuing into the left branch (thin arrow) coronal multiplanar reconstruction (mpr) shows the presence of end - to - side shunt between the right branch pv and the ivc (b) (arrow) with fusiform aneurysmal dilatation of the pv (a). The portal venous system and ivc develop between the 4th and 10th weeks of embryonic life by selective apoptosis of some portions of the vitelline, which may lead to the potential for congenital portosystemic shunts . Type i ceps (congenital absence of the pv) is an end - to - side shunt between pv and the systemic circulation . Here all the splanchnic venous return enters the systemic circulation, and the liver is not perfused with portal venous blood at all . Type ii ceps is a partial side - to - side shunt between the portal and systemic vein, where only a fraction of the splanchnic venous return bypasses the liver parenchyma . Ceps are also associated with an increased frequency of hepatic neoplasms. [37] it has been proposed that the diversion of hepatotropic substances in the splanchnic venous blood, such as insulin and glucagon, away from the liver results in alterations of development, function, and regenerative capacity of the liver . This diversion, along with increased arterial hepatic flow, may contribute to the development of hepatic neoplasms . Currently, a diagnosis of abernethy malformation is usually made by noninvasive cross - sectional imaging techniques such as ultrasound, ct, or mri, which show the shunt and any intrahepatic pv branches . However, liver biopsy may be necessary in patients with suspected type 1 malformation since an occasional patient may have small pv radicles which cannot be seen on ultrasound but can be observed on liver biopsy . Pv aneurysm is a rare clinical entity having a focal fusiform or saccular dilatation of more than 20 mm . Aneurysms of the pv may occur either proximally at the junction of the superior mesenteric vein and splenic vein or more distally in the pv radicals . Congenital origin is suggested based on the discovery of variations in the embryologic development of the pv and may be associated with multiple vascular malformations . The origin of acquired pv aneurysms is more commonly secondary to cirrhosis and other hepatic diseases . Pancreatitis can be included as an extrahepatic cause . In the majority of cases, patients are clinically asymptomatic . The majority of patients with abernethy malformation have other associated anomalies such as liver and cardiac abnormalities . Described a case of 24-year - old man having ceps type-2 with pv aneurysm during an investigation for nonspecific abdominal pain . Determining the patients with type i malformation need clinical, biochemical, and imaging follow - up . However, those patients with type 2 malformations need surgery or percutaneous transcatheter coil placement . In conclusion, although ceps is a rare anomaly, it must be recognized early to prevent the consequences of metabolic derangements by appropriate surgical treatments ., the detection of tiny intrahepatic portal venous radicals may be beyond the resolution limits of the available imaging methods . The limitation of imaging in determining the type of shunt in some cases should be recognized, and a histopathological confirmation of the type of shunt may be crucial in deciding the treatment course.
Parent - of - origin effects is a broad term that encompasses two distinct phenomena parent - of - origin effects on transcription, and parent - of - origin effects on mutation rates . A parent - of - origin effect on transcription, or genomic imprinting, results from epigenetic modification of the genome which, in turn, results in unequal transcription of parental alleles . For these imprinted genes, expression of the alleles is dependent upon the sex of the parent from which they were inherited (1). A parent - of - origin effect on mutation rate, however, refers to the preferential occurrence of some spontaneous mutations in either the father's or the mother's germ line . The mechanisms by which these spontaneous mutations arise depend upon the parental germ line in which the mutation occurred . For example, base substitutions, arising from errors during replication, tend to be paternal in origin, owing to the greater number of cell divisions in spermatogenesis as compared with oogenesis (2). Oocytes are arrested in prophase of meiosis i until sexual maturity, when one oocyte per month is selected to resume the cell cycle . It is thought that the longer the oocytes are arrested in meiosis, the greater the chance for a nondisjunction event to occur (3). Advanced parental age seems to influence the development of some, but not all, of these mutations (also referred to as the paternal or maternal age effect) (2). In 1998, the catalogue of imprinted genes and parent - of - origin effects was first published (4). This catalogue served as the basis for the development of a more comprehensive, searchable, online database, made publicly available in 1999 . The original database included 41 imprinted genes, and other parent - of - origin effects, including some records on the parental origin of spontaneous mutations (5). We have added recently a comprehensive section on spontaneous mutations that show a bias with respect to their parental origin . This new part of the database can be searched according to mutation type, disorder, chromosomal location, gene name and inheritance pattern . Outcomes of the search are presented in a tabular format with the following information: disorder, inheritance pattern, incidence of disorder, gene name, chromosomal location, evidence of a paternal or maternal age effect, mutation type and any recurrent mutations associated with a parent - of - origin effect, number of paternal mutations, number of maternal mutations and pubmed reference (e.g. Table 1). In the case of base substitutions, data are separated according to the type of base substitution (missense mutation, nonsense mutation or splice site mutation), whether the mutation is a transition or transversion mutation, and whether the base substitution falls within a cpg dinucleotide . For deletions and insertions, the distinction is made between large deletions and insertions (> 20 bp) and small deletions and insertions (<20 bp). This size distinction is made based upon the possibility of different mechanisms contributing to these different types of mutations, and therefore potentially different parental origins (2). In general, large deletions do not appear to have a parent - of - origin effect, whereas small deletions tend to be more paternal in origin . Currently,> 1700 mutations with a parent - of - origin effect are catalogued in this database . The other major section of the database includes known imprinted genes and observations of other putatively imprinted genes . Of the 464 database entries, 152 entries describe 85 unique imprinted genes in humans, mice, cattle, sheep, pigs, rats and marsupials, as well as 14 genes for which the evidence of imprinting is conflicting or provisional . An additional 186 entries report parent - of - origin effects in the transmission or linkage of simple and complex genetic conditions including human diseases and animal quantitative traits . The imprinted gene and parent - of - origin effect database is housed at the university of otago in dunedin, new zealand and can be accessed at . The database is maintained by the corresponding authors who welcome submissions and comments and is updated as new literature is published . Submissions to the imprinted gene database should be directed to i.m.m . And submissions to the parental origin of de novo mutations database example of report for parental origin of de novo mutations showing base substitutions within a cpg dinucleotide ad, autosomal dominant; xd, x - linked dominant; xr, x - linked recessive; p, point mutation; ms, missense mutation; ns, nonsense mutation; cpg, mutation in a cpg dinucleotide; ts, transition mutation; tv, transversion mutation.
Workplace violence (wpv) is referred to any incident or situation in which a person in his workplace or work - related circumstances is subjected to mistreatment, threats, or aggression . According to the international council of nurses, the likelihood of health care workers' exposure to violence is even higher than prison guards or police officers . Although all types of violence are destructive, physical violence can hurt victims physically and psychologically more than other forms . Physical violence involves use of physical force against an individual or a group, and can lead to physical, psychological, or sexual harm and includes punching, kicking, slapping, shouting, pushing, biting, pinching, and wounding using sharp objects . In 2007, nearly 15% of work facilities were assigned to violent and threatening acts in usa . Results of a study conducted during 20092010 in italy showed that 13.4% of nurses reported at least one physical attack during the past year . In taiwan, 19.6% reported physical violence . In iran, the results of a systematic review study indicated that the prevalence of physical violence was between 9.1 and 71.6% and the most common types of physical violence were pushing or pitching, as experienced by 43% of participants . Pointed out that the prevalence of physical violence against emergency medical workers in east azerbaijan was 37.7% . The outcomes of wpv include physical consequences such as increasing low back pain, symptoms of somatic and musculoskeletal disorders, and psychological consequences such as posttraumatic stress disorder, anxiety, fear, depression, substance abuse, and poor quality of patient care . Furthermore, health care workers suffer from job dissatisfaction, poor quality of life, and low self - esteem . Although several studies have been carried out regarding wpv in iran, there is no overall feature about physical violence against health care workers . The aim of this study was to investigate the frequency of workplace physical violence among iranian health care providers working in some teaching hospitals, their response to such violence, as well as the contributing factors to physical violence . This cross - sectional study was conducted in 2011 in some teaching hospitals across iran . Study population comprised all health care workers including physicians, nurses, midwives, nurse aids, and paramedical personnel that numbered 57,000 according to the latest ministry of health and medical education statistics in 2011 . Inclusion criteria included: (i) working in a teaching hospital and (ii) having at least 1 year of experience . The participants were selected by multistage random sampling in three phases . In the first phase, all the provinces were included in this study (four provinces excluded due to administrative issues). Sample size of each province was calculated according to the proportion of health care professionals . In the second phase, thus, 135 teaching hospitals were selected . In the third phase, samples were selected by random sampling based on samples' size in each hospital . Sample size was estimated by the following formula and with a confidence interval of 1.96, power of 0.80, and d = 0.01: m = (z1 /2/d)(p)(1 p) m = (1.96/0.01)(0.75)(0.25) = 7203 n = (m)(total)/m + total n = (7203)(65,000)/7203 + 65,000 = 6485 data were collected using the international questionnaire of workplace violence in the health sector developed by the international labor organization (ilo), the world health organization (who), the international nurse council (icn), and the public services international (psi). The questionnaire contains five sections: (a) 21 items about personal and workplace data; (b) 17 items about physical violence; (c) 37 items about psychological violence (emotional abuse), which involves verbal violence, bullying / mobbing, and sexual harassments; (d) 8 items about the health sector; and (e) 3 open - ended questions on participants' views on wpv . The questionnaire was translated from english to persian by a bilingual person and then back - translated from persian to english by another person who was also proficient in both languages . Then, after matching with the other existing persian version, the content validity of the questionnaire items was assessed by a committee including 11 experts who were interested in the research topic . Finally, the items were modified according to the experts' opinions . Moreover, the reliability of the questionnaire was confirmed by test - retest (r = 0.71) through completion by 180 health care workers employed in one of the teaching hospitals of tehran . In this paper, only relevant findings to workplace physical violence are presented because of the extensive amount of data involved . This study was approved by the ethics committee of university of social welfare and rehabilitation sciences (ethics committee approval number: 14/86). Informed consent was obtained from the health workers who agreed to participate in this study . This study was approved by the ethics committee of university of social welfare and rehabilitation sciences (ethics committee approval number: 14/86). Informed consent was obtained from the health workers who agreed to participate in this study . The mean age of the participants was 34 8.5 years, and 78.5% of the participants were nurses . The majority of participants (85.1%) indicated that they had not received training program for dealing with workplace physical violence . Demographic and work characteristics of the participants (n=5874) about 23.5% of the participants reported that they had been physically abused in the past year, and all of them happened without use of any weapons . Pushing (59.9%), kicking (36.2%), and punching (32.7%) were reported as the most frequent forms of workplace physical violence . Among the victims, 118 participants received serious injuries (8.8%). Moreover, 36.5% of physical violence occurred on the night shift . The majority of the physical incidents occurred inside the hospitals (90.1%), against female health workers (67.5%), and between the ages of 30 and 40 years (39.5%). Frequency of physical violence (n=1333) the most common reaction of victims to physical violence was asking the aggressor to stop violence (45%). Six hundred and fifty - two participants (60.5%) did not report violence and the most common reason for not reporting physical violence was they considered reporting it useless (52%) [table 3]. Lack of people's knowledge of employees' tasks (49.2%) was the most common contributing factor to physical violence [table 4]. Reactions of health personnel to physical violence (n=1333) contributing factors to physical violence (n=1333) this study was performed in different cities of iran in order to determine the frequency of physical wpv toward health professionals . The result of a study in jordan showed that 22.5% of hospital nurses were exposed to physical wpv . Reported that 15.93% of emergency staff were exposed to physical violence during the past 3 months . The incidence of physical violence in another study was 21%, which is similar to the frequency obtained in the present study . But in some other studies, between 46 and 70% of participants were exposed to physical violence, which exceeds the results of the present study . This may be due to cultural differences between countries or underreporting . In the present study, rahmani et al . Indicated that the frequency of pushing and punching was 71.4% and 20.4%, respectively . Noted that hitting, kicking, and scratching were the most frequent types of physical violence . Pointed out that hitting, pushing, or shoving was reported by 73.9% of victims, which is consistent with the result of the present study . The main source of violence was patient's family, which is consistent with the findings of other studies . However, merecz et al . Showed that above 64% of psychiatric nurses and more than 16% of other nurses had frequently been subjected to patients' physical violence . In another study, patients were the main cause of physical violence and threats to attack . The difference could be attributed to cultural differences, and the constant presence of patient's family during hospitalization and coming into contact with medical staff and nurses in iran . The results showed that female health workers, especially between 30 and 40 years of age, were exposed to physical violence more than other workers, which is consistent with many reviewed studies . In all these studies, wpv against female workers, who were often younger, was more than that of others . So, managers and health personnel, especially nurses, should identify these risk factors in order to prevent and manage such violence . Moreover, in the current study, nurses were the main victims of physical violence . This is thought to be due to their close contact with patients and/or their families . The present study results also reveal that more than half of the participants did not report exposure to violence, and considered reporting useless . Furthermore, more than 60% of participants stated that there was no guideline for reporting violence in their workplace, and more than half of them said that no action has yet been taken to pursue the incidence of violence . Moreover, the most participants indicated that no specific policy had been thought up for dealing with violence . This is congruent with the findings of another study which showed that only 23.6% of participants reported the physical violence . The most important reasons for not reporting included considering reporting useless and fear of being stigmatized as a troublesome and incompetent person . In other studies, almost all of the participants stated that no guidelines existed in their workplace for preventing and control of violence . These findings indicate lack of proper staff training programs for preventing and managing violence, and also, lack of appropriate legislation and policy for pursuing received reports and managing violence in health care settings . However, results of a study in australia showed that nearly 70% of health workers were satisfied with wpv control policies and reporting mechanisms, which is inconsistent with the finding of the present study . It may be due to existence of transparent policies, appropriate legislation, and reporting mechanisms in developed countries . In the present study, more than half of the participants believed that lack of people's knowledge about staff tasks was among factors associated with violence, which is in agreement with the results obtained by rahmani et al . So, lack of awareness can cause the patients and/or their relatives to have unrealistic expectations of health professionals and, consequently, unmet expectations lead to violence . Second, due to the large sample size and self - reported method for data collection, missing data for each item was relatively significant . Finally, regarding the cultural sensitivities or the related stigma of violence victims, it is probable that participants might not have expressed all their experiences . Many participants were concerned about incidence of violence in their workplace and most disinclined to report violence due to lack of appropriate support and follow - up mechanisms by managers . Provision of appropriate training programs to prevent and manage violence, development of a documenting and reporting system, and identifying and supporting workers - at - risk can lead to minimizing the violence . Moreover, increase of people' awareness about the responsibilities of health care workers should be considered . This article is part of a research project commissioned by the ministry of health and medical education (moh) no . This article is part of a research project commissioned by the ministry of health and medical education (moh) no.
The first and second vertebrae (atlas and axis, respectively) are different from others with their function and anatomy . Normally, the intervertebral disc is located between two vertebrae, but not located between atlas and axis . The most common cervical vertebrae anomalies (cvas) are fusion and posterior arch deficiency (pad). The second (c2) and third (c3) cervical vertebrae are most commonly influenced by fusion . Posterior arch anomalies occur probably the result of a locally decreased blood supply during fetal development . Skeletal deviations in maxillofacial region, head and neck posture deformities, cervical inclination, and orthopedic findings can be associated with malocclusion . Several studies declared the relation between the cervical vertebrae morphology and position of the mandible . Cva is often asymptomatic, for this reason, patients may notice anomalies with decrease age or an injury the pathologic condition may reveal with the radiographic examination . Although orthodontists do not have to be experts in cva these patients should be directed to the experts early as possible and prevents progressively degenerative neurologic defects . The present study is the first report to determine the frequency of cvas in orthodontic patients with dental malocclusions . The aims of this study were to investigate the distribution of cvas among angle class i, ii, and iii malocclusions in a turkish patient population and whether a correlation between cva and dental malocclusion; thus, being the first series of cvas in our population described in the english literature . A power analysis conducted using the g*power version 3.1.7 . Software (franz faul, universitt kiel, germany) indicated that a total sample size of 150 patients would give more than 80% power (actual power = 0.8229) to detect significant differences with an effect size of 0.30 at an = 0.05 level of significance (critical = 11.0705; noncentrality parameter = 13.5000). The study was performed on 318 patients clinical records (case histories, lateral cephalometric radiographs, and study models) which were taken in archive at the department of orthodontics, faculty of dentistry, kirikkale university . If an accurate diagnosis of the cva could not be made from these records, the subject was excluded from the study . Exclusion criteria included the patients, who were less than 18 years of age, had records with poor quality radiographs, had craniofacial anomaly and systemic muscle or joint disorder and, wound, burns, or scarring in the head and neck . Subjects were selected according to the following criteria: turkish with turkish grandparents, no history of trauma, and previous orthodontic treatment, study models including the first molars and standardized lateral cephalometric radiographs with the first five cervical vertebrae visible . A total of 341 subjects were included in the study, but 23 subjects with developmental anomalies were excluded . The radiographs of the patients were obtained with the teeth in occlusion, the lips in a relaxed position in a standardized head posture (the frankfort plane parallel to the horizontal). The radiographs were taken by an experienced x - ray technician using an orthopantograph (planmeca proline cc 2002, helsinki, finland) with a film - to - focus distance of 165 cm and a film - to - median plane distance of 15 cm . Dental malocclusion groups observed through molar relationship in plaster models were divided into angle class i, ii, and iii according to angle's classification . Angle class i: normal relationship of the molars (mesiobuccal cusp of the upper molar occludes in buccal groove of the lower molar), but a line of occlusion incorrect because of malposed teeth, rotation, or other causes . Angle class ii: lower molar distally positioned relative to upper molar, a line of occlusion not specified . Angle class iii: lower molar mesially positioned relative to upper molar, a line of occlusion not specified . Cvas were categorized and recorded for all patients: fusion was defined as no intradiscal radiolucency or osseous continuities without complete separation between two cervical vertebrae . Pad was defined as a uniform radio - opacity without an internal cortical outline at the posterior arch of the cervical vertebra . The lateral cephalograms were examined by an orthodontist (h.k .) And a dentomaxillofacial radiologist (e.y .) Simultaneously . To determine errors in the methods, 20% of the subjects with or without cva were selected randomly.first, each radiograph was separately evaluated by authors, but a final examination was done together, so a sentence was made to decide . In addition, the same examiners twice reevaluated all of the radiographs after 4 weeks of the first evaluation . A paired t - test was applied to both the first set and a second set of measurements, and no significant difference was found between the two sets . Intra - examiner reproducibility was found to be 90 and 92%, respectively, and the agreement between both investigators was 95% . The chi - square and fisher's exact test were used to determine the potential differences in the distribution of dental malocclusions, and genders when stratified by cvas . Pearson's correlation test was used to determine the correlation between cvas and different parameters (dental malocclusions and genders). All of the statistical analyzes were performed with the spss software package (spss version 16.0, spss inc ., 233 south wacker drive, 11 floor, chicago, il, usa). A p <0.05 was considered statistically significant . The final sample of 318 patients was examined (170 females and 148 males, mean age; 20 0.9 years from 18 and 29 years). Of these 318 patients, 98 (30.81%) had angle class i, 124 (38.99%) had angle class ii, and 96 (30.18%) had angle class iii malocclusion . Cva was observed in 42 individuals (of which 26 [8.1%] had fusion and 16 [5.0%] had pad), with a frequency of 13.2% . Of the 26 fusion defect, 8 (30.8%) had angle class i, 8 (30.8%) had angle class ii, and 10 (38.4%) had angle class iii malocclusion . Of the 16 pad, 8 (50%) had angle class i, 8 (50%) had angle class ii but no patients with angle class iii malocclusion was observed . The distribution of dental malocclusions regarding cvas was not statistically significant (p = 0.076) [table 1]. The distribution of cvas according to dental malocclusions of these 42 individuals with cva, 52.3% (15 fusions and 7 pad) were females and 47.7% (11 fusions and 9 pad) were males . The cvas and the gender were also compared [table 2] and no statistically significant differences were found (p = 0.339). As shown in table 3, statistically significant negative correlation (p = 0.025) was found among cvas and dental malocclusions, but no statistically significant correlation was found between cvas and genders . According to the sample size calculation for a power of 0.80 at = 0.05 significant level, 150 subjects would be sufficient . At baseline, there were 341 subjects for this study group; twenty - three subjects in the study group have been excluded from the study . At the end of the study, there were 318 patients for the study group . Correlation between cva and vertebrae morphology, craniofacial malformations, and skeletal malocclusions were reported in the previous studies . The aims of our study were to identify the prevalence of cva in turkish population and also whether there is a correlation between cva and dental malocclusion . In our study, the prevalence of fusion and pad were found 8.1% and 5.0%, respectively [table 1]. Besides, a statistically significant correlation (p = 0.025) was found among cva and dental malocclusions [table 3]. The prevalence of cva was reported with a wide range of 0 - 61.4% in the literature . Sonnesen and kjaer reported that the incidence of fusion (61.4%) more common in skeletal class iii patients and skeletal horizontal overjet when compared with control group (14.3%). They revealed that if a skeletal horizontal overjet was caused by maxillary retrognathia, the decreased prevalence of fusion more likely seen . Reported that the descending distribution of cva were determined in skeletal class i, ii, and iii malocclusion, respectively (17). In addition, a higher prevalence of c1 level partial cleft and occipitalization was reported in their study . Our study was designed to investigate dental malocclusion, but the previous studies were planned to examine skeletal anomalies . To the best of our knowledge, this is the first study evaluate the frequency and distribution of cvas in orthodontic patients with dental malocclusions . Had stated that the angle of the cranial base and the head posture deviations were sexually dimorphic, females showing larger cervicohorizontal, and cranial base angles than males . In addition, they reported that the relation between the cervical column fusion and cranial base angle, the inclination of the upper cervical spine and cervical lordosis were determined in females . Hence, it could be hypothesized that cervical column fusion has a dimorphic pattern in their occurrence . In contrast, some researchers affirmed that there was no significant relation between gender and the occurrence of cva in their studies . So that, our findings supports the studies showing no gender dimorphism [table 2]. It is not clear why vertebral anomalies occur and why these anomalies occur in different craniofacial morphology groups and skeletal malocclusion traits . The genetic studies and insight of the early embryogenesis might be essential to understand the etiology of the cva . The recent studies affirmed that the notochord may be responsible to these anomalies . Because the vertebral bodies were formed around the notochord in the prenatal period . Besides, the jaws develop from the migration of the neural crest cells to the craniofacial area before the notochord is surrounded by bone tissue . However, the association between the precise signaling of notochord to the neural crest and the migration of the neural crest cells to the craniofacial area is still unknown . Lateral cephalograms are usually used in orthodontic clinics to planning pretreatment and examined the postorthodontic treatment results . Early diagnose of these pathologies on cephalograms can provide essential documentation to the patient due to symptoms, injury, aging, and progression of the degenerative process . However, two - dimensional radiographs may not be valid in the diagnosis of cva, because of the superimposition of the spine inclination and radiographic overlapping of the facets . For this reason, the suspectable sign of cva on cephalogram is reevaluated with three - dimensional imaging systems like cone beam computed tomography to prevent misdiagnose . The prevalence of fusion and pad were found 8.1% and 5.0% in turkish population, respectivelystatistically significant differences were found among the dental malocclusions, and no statistically significant correlation between cva and angle class i, ii, and iii malocclusionno statistically significant differences were also found between the genders, and no statistically significant correlation between cva and genders were found . The prevalence of fusion and pad were found 8.1% and 5.0% in turkish population, respectively statistically significant differences were found among the dental malocclusions, and no statistically significant correlation between cva and angle class i, ii, and iii malocclusion no statistically significant differences were also found between the genders, and no statistically significant correlation between cva and genders were found.
The dna double helix in eukaryotes is packed into nucleosomes, which are composed of repeating array of dna protein complexes called the nucleosome core particles, which are connected via linker dna . Dna deforms significantly to create the nucleosome core particle; the 147 base pair dna is wrapped in 1.84 left - handed turns around a core particle of histone proteins (1,2). The wrapped dna histone octamer complex is essentially ubiquitous in nature and has a major role in many vital processes in the cell (3). The tightly wrapped conformation of the nucleosomal dna seems to hinder the accessibility of its genetic information needed for fundamental life processes such as transcription and dna replication . In fact, nucleosome is highly dynamic (4); experiments show spontaneous conformational transitions where thermal fluctuations make part of dna unwrap (5). Sliding' of the histone octamer along dna is another strongly temperature - dependent mechanism that has been observed and modeled both experimentally, and theoretically (6). Therefore, as in many vital processes, the highly compacted conformation of the nucleosomal dna should change to expose its genetic information to proteins involved in these processes; studying nucleosomal dna structure and formation energies are very important . The conformation of the 147 base pair nucleosomal dna has been determined in a high precision experiment by richmond and davey (7). Mohammad - rafiee and golestanian (8) studied the structure of dna in the nucleosome core particle using an elastic model that incorporates anisotropy in the bending energies and twist - bend coupling . Although their simple model can account to a good degree for the observed structure of the nucleosomal dna, obtaining other structural properties of the nucleosomal dna, such as shift and slide, is beyond it . (9) recently showed the importance of the lateral displacements of adjacent base pairs of the nucleosomal dna, especially, the slide in nucleosome structure . In other more recent numerical analysis, 10) have developed a sequence - dependent nucleosome model, and obtained all of the base pair parameters . Although their results show overall correlation with the experimental results, they find significant discrepancies . Particularly, they underestimate the magnitude of the slide peaks that are very important in the nucleosome structure . Considering the elastic and geometrical properties of the nucleosomal dna, we introduce a simple model to obtain its base pair parameters, roll, tilt, shift, slide and rise, so, the lateral displacements of the adjacent base pairs of dna are considered besides the bending and twisting deformations, which are mostly studied in the previous theoretical works and simulations . The dna protein interactions in the nucleosome core particle are taken into account by directly reading off the twist angles from the experimental results of richmond and davey . Since adjacent base pair are coupled through the dna sugar - phosphate backbones, the base pair parameters are not independent, and they are correlated . In this model, the covalent bonds between the adjacent base pairs of the two strands of dna are considered deformable, and simply modeled by two stiff springs . We show that the stiffness of these covalent bonds results in strong correlations between the base pair parameters, particularly, the strong roll - slide - twist coupling . The elastic energy of the molecule consists of two terms: one shows the changes in the covalent bond energies, and the other shows the energy cost of the rotation of the base pairs . By using this simple model, we can find all of the 21 different elastic constants of dna molecule as a function of the covalent bonds stiffness . We simply consider no sequence effect explicitly in writing the elastic energy of dna, and without any tuning parameter, the base pair parameters of the 147 bp steps, especially, the most important ones, roll and slide, are obtained in an overall good agreement with the experimental results . In particular, the peaks of the slide values are close to the experimental ones . As we consider no sequence effect directly, these encouraging results show the important role of the rigidity of the sugar - phosphate backbones of dna in its conformation . The base pairs are considered as rectangular solids of half length and width of l = 1 nm and w = 1/3 nm (11). As a result of deformation and changes in the base pair parameters values, the lengths of two strands of dna can change . These changes result in the elastic energy of deformed covalent bonds between the monomers of each strand . Dna is an anisotropic chiral molecule, so the changes in the length of the two strands can differ . The covalent bonds between the bases of each strand are modeled by springs of stiffness of about kc10 pn / nm (12). These springs connect the middle of the width of one base pair to that of the adjacent base pair . At each base pair, we can affix a localized cartesian coordinate system, so that its x and y axes lie along the width and length of the rectangular solid, respectively (figure 1). The orientation of these localized coordinates can change from one base pair to the other and we have: (1) where = 1,2,3 labels the three axes of the localized coordinates, n is a dimensionless parameter, which labels the base pair, is the z component of the displacement vector between the middle of the adjacent base pairs and shows the rate of the change in the orientation of the adjacent rectangular solids, and can be written in terms of the angular base pair parameters; roll, r, tilt, t and twist,, as: (2) figure 1.the six base pair parameters; twist, roll, tilt, rise, shift and slide . Schematic view of the adjacent base pairs, and the covalent bonds along the backbones, which are simply modeled by two springs (bottom). The half of the length and width of of the base pairs are shown by l and w, respectively, and b equals to the rise of undeformed dna . At each base pair the six base pair parameters; twist, roll, tilt, rise, shift and slide . Schematic view of the adjacent base pairs, and the covalent bonds along the backbones, which are simply modeled by two springs (bottom). The half of the length and width of of the base pairs are shown by l and w, respectively, and b equals to the rise of undeformed dna . At each base pair the length of each spring can be written as (j = 1, 2), where (3) is the displacement vector between the two ends of each spring . To find, we should solve equation (1) and obtain the coordinates of the points of each rectangular solid in the localized coordinate system of its adjacent rectangular solid . We assume that the changes in the orientation of the adjacent base pairs are small, and estimate the coefficients of the displacement vector of the strand attached at y = l, x(1), y(1) and z(1) as: (4) in the above equations, b denotes the base pair step for b - dna, shows the relative changes in rise and s and d correspond to the shift and slide parameters, respectively . To obtain the above equations, we successively apply slide, tilt, twist, shift, roll and rise to the rectangular solids . Note that for small base pair parameters, considering different orders makes no difference . The coefficients of the displacement vector of the other strand, x(2), y(2) and z(2), are obtained by substituting in the above equation as: (5) for undeformed dna, r = t = 0, d = s = 0, = 0 and = 0 = 2/10, so the arc length of the backbone between the two adjacent base pairs of each strand of undeformed dna is . The total energy counts the deformation energy of the covalent bonds, ec is found to be (6) where x(1) = lc(1)lc0, and x(2) = lc(2)lc0 show the changes in the arc length of the backbone between the two adjacent base pairs of each strand, i and n denote the label of base pair and the total number of the base pairs of the nucleosomal dna, respectively . Besides ec, we consider the energy cost of the rotation of the base pairs, erot, in the total elastic energy of the nucleosomal dna, eel, so we have: (7) in this model, the strains are considered as the amount of rotation of the localized coordinates per length of the molecule around each of the three axes of the localized coordinate of the adjacent base pairs, the components of (13). Note that, as a result of deformation, is no longer equals to the base pair step of b - dna, b, and for small deformations can be written as: + d sin t. for small strains, we write the energy of the chain of nucleosomal dna as a taylor expansion of the strains as: (8) here, we consider terms up to the second order of the strains to simply have linear equations after energy minimization . Because of the anisotropy of the dna molecule, which has two distinguishable grooves (minor and major), the asymmetric last term in the above energy equation appears (twist - bend coupling) (14). In the above equation, a1, and a2 are bending rigidities corresponding to tilt and roll, respectively, c is the twist rigidity, g denotes the twist - bend coupling and 0 = 1.85 nm is the spontaneous twist of the helix . Considering the anisotropic bending rigidities is important as it has been shown that the anisotropic bending elasticity can cause the curvature modulation with the period of 5 bp (8,15,16). Note that in this energy equation, we consider the elastic coefficients to be constant, and independent of the base pair steps . We estimate the values of these elastic constants by using the known values of the average rigidities of dna defined in the previous continuous elastic rod models (14,17,18), and consider a1 = 75 nm, a2 = 37 nm (19), c = 100 nm (20), and g = 25 nm (8) for the elastic rigidities . As mentioned before, dna is wrapped by 1.84 turns around the protein octamer, so to find the shape of dna, we should consider a global constraint . To write this constraint, first, we recall the differential geometry of an ideal superhelix, which can be considered as an approximation of the nucleosomal dna; at each point of an ideal superhelix, we can define orthonormal frenet unit vectors as: (9) where s is the arc length, is the position vector at each point and, and are tangent, normal and binormal vectors at point s, respectively . The notation s means the derivative with respect to s. the rate of changes of these unit vectors can be written as: (10) (11) (12) where (s) and (s) are curvature and torsion at each point . We keep writing s in order to emphasize that the mentioned quantities have their local values . Now, we can estimate the global constraint of the nucleosomal dna as, where i is the curvature of the superhelix of the nucleosomal dna in segment i. here, we neglect torsion,, with respect to curvature; it can be shown that the mean curvature and torsion of the nucleosomal dna (considered to be approximately equal to those of an ideal superhelix) with radius r41.9 and pitch of 225.9 are av = r/(r +) and av = /(r +). Therefore, we have av/av = 0.098, which justifies the above approximation . Moreover, localized coordinate unit vectors can be written in the frenet frame as: (13) where (s) is the accumulated twist angle (the angle between the localized coordinate and orthonormal frenet vectors at the plane of each base pair). Considering equations (1, 2 and 10), we can write: (14) where i denotes the label of the base pair . From equations (13 and 14) for an ideal superhelix, we have:, and . In other words, we have and i for an ideal superhelix . Using these relations, the constraint can be written as a function of the local roll, tilt and twist angle as: (15) in order to find the local conformation of the nucleosomal dna, one should take account of the specific local dna histone interactions in the nucleosome core particle, which is denoted by vdna - histone . Due to these interactions, the total energy of the nucleosome core particle can be written as etotal = eel + vdna - histone . In principle, one should consider this total energy etotal, and minimize it respect to the local variables subject to the constraint, and find the local conformation of the dna . There are fourteen binding sites, where the nucleosomal dna contacts the histone octamer (21). In these regions, the minor grooves of the dna face to the nucleosome core, where at each contact region, there are several hydrogen bonds between the histone proteins and the sugar - phosphate groups of the dna backbone (2). The interactions between dna and the histones in the binding sites are quite specific (6,22). We assume that the twist degree of freedom is mostly governed by these local interactions . Therefore, the local potential is considered as a solely function of as vdna - histone() (8). As far as there is no reliable quantitative model for this local potential vdna - histone, for the sake of simplicity, we implicitly consider the effect of these local interactions in our model: we read off the twist angle of the dna from the experimental data from reference (7). It also gives us some information about the sequence effects, which are not explicitly taken into account in this simple model . We now minimize the energy with respect to r, t, s, d and subject to the wrapping constraint . So, we can find the local conformation parameters, roll, tilt, shift, slide and rise at each base pair step . We note that considering the symmetry of the nucleosome core particle with respect to its pseudo 2-fold axis, and following reference (7), the calculations are performed for half of the dna length corresponding to base pairs . The base pairs are considered as rectangular solids of half length and width of l = 1 nm and w = 1/3 nm (11). As a result of deformation and changes in the base pair parameters values, the lengths of two strands of dna can change . These changes result in the elastic energy of deformed covalent bonds between the monomers of each strand . Dna is an anisotropic chiral molecule, so the changes in the length of the two strands can differ . The covalent bonds between the bases of each strand are modeled by springs of stiffness of about kc10 pn / nm (12). These springs connect the middle of the width of one base pair to that of the adjacent base pair . At each base pair, we can affix a localized cartesian coordinate system, so that its x and y axes lie along the width and length of the rectangular solid, respectively (figure 1). The orientation of these localized coordinates can change from one base pair to the other and we have: (1) where = 1,2,3 labels the three axes of the localized coordinates, n is a dimensionless parameter, which labels the base pair, is the z component of the displacement vector between the middle of the adjacent base pairs and shows the rate of the change in the orientation of the adjacent rectangular solids, and can be written in terms of the angular base pair parameters; roll, r, tilt, t and twist,, as: (2) figure 1.the six base pair parameters; twist, roll, tilt, rise, shift and slide . Schematic view of the adjacent base pairs, and the covalent bonds along the backbones, which are simply modeled by two springs (bottom). The half of the length and width of of the base pairs are shown by l and w, respectively, and b equals to the rise of undeformed dna . At each base pair the six base pair parameters; twist, roll, tilt, rise, shift and slide . Schematic view of the adjacent base pairs, and the covalent bonds along the backbones, which are simply modeled by two springs (bottom). The half of the length and width of of the base pairs are shown by l and w, respectively, and b equals to the rise of undeformed dna . At each base pair the length of each spring can be written as (j = 1, 2), where (3) is the displacement vector between the two ends of each spring . To find, we should solve equation (1) and obtain the coordinates of the points of each rectangular solid in the localized coordinate system of its adjacent rectangular solid . We assume that the changes in the orientation of the adjacent base pairs are small, and estimate the coefficients of the displacement vector of the strand attached at y = l, x(1), y(1) and z(1) as: (4) in the above equations, b denotes the base pair step for b - dna, shows the relative changes in rise and s and d correspond to the shift and slide parameters, respectively . To obtain the above equations, we successively apply slide, tilt, twist, shift, roll and rise to the rectangular solids . Note that for small base pair parameters, considering different orders makes no difference . The coefficients of the displacement vector of the other strand, x(2), y(2) and z(2), are obtained by substituting in the above equation as: (5) for undeformed dna, r = t = 0, d = s = 0, = 0 and = 0 = 2/10, so the arc length of the backbone between the two adjacent base pairs of each strand of undeformed dna is . The total energy counts the deformation energy of the covalent bonds, ec is found to be (6) where x(1) = lc(1)lc0, and x(2) = lc(2)lc0 show the changes in the arc length of the backbone between the two adjacent base pairs of each strand, i and n denote the label of base pair and the total number of the base pairs of the nucleosomal dna, respectively . Besides ec, we consider the energy cost of the rotation of the base pairs, erot, in the total elastic energy of the nucleosomal dna, eel, so we have: (7) in this model, the strains are considered as the amount of rotation of the localized coordinates per length of the molecule around each of the three axes of the localized coordinate of the adjacent base pairs, the components of (13). Note that, as a result of deformation, is no longer equals to the base pair step of b - dna, b, and for small deformations can be written as: + d sin t. for small strains, we write the energy of the chain of nucleosomal dna as a taylor expansion of the strains as: (8) here, we consider terms up to the second order of the strains to simply have linear equations after energy minimization . Because of the anisotropy of the dna molecule, which has two distinguishable grooves (minor and major), the asymmetric last term in the above energy equation appears (twist - bend coupling) (14). In the above equation, a1, and a2 are bending rigidities corresponding to tilt and roll, respectively, c is the twist rigidity, g denotes the twist - bend coupling and 0 = 1.85 nm is the spontaneous twist of the helix . Considering the anisotropic bending rigidities is important as it has been shown that the anisotropic bending elasticity can cause the curvature modulation with the period of 5 bp (8,15,16). Note that in this energy equation, we consider the elastic coefficients to be constant, and independent of the base pair steps . We estimate the values of these elastic constants by using the known values of the average rigidities of dna defined in the previous continuous elastic rod models (14,17,18), and consider a1 = 75 nm, a2 = 37 nm (19), c = 100 nm (20), and g = 25 nm (8) for the elastic rigidities . As mentioned before, dna is wrapped by 1.84 turns around the protein octamer, so to find the shape of dna, we should consider a global constraint . To write this constraint, first, we recall the differential geometry of an ideal superhelix, which can be considered as an approximation of the nucleosomal dna; at each point of an ideal superhelix, we can define orthonormal frenet unit vectors as: (9) where s is the arc length, is the position vector at each point and, and are tangent, normal and binormal vectors at point s, respectively . The notation s means the derivative with respect to s. the rate of changes of these unit vectors can be written as: (10) (11) (12) where (s) and (s) are curvature and torsion at each point . We keep writing s in order to emphasize that the mentioned quantities have their local values . Now, we can estimate the global constraint of the nucleosomal dna as, where i is the curvature of the superhelix of the nucleosomal dna in segment i. here, we neglect torsion,, with respect to curvature; it can be shown that the mean curvature and torsion of the nucleosomal dna (considered to be approximately equal to those of an ideal superhelix) with radius r41.9 and pitch of 225.9 are av = r/(r +) and av = /(r +). Therefore, we have av/av = 0.098, which justifies the above approximation . Moreover, localized coordinate unit vectors can be written in the frenet frame as: (13) where (s) is the accumulated twist angle (the angle between the localized coordinate and orthonormal frenet vectors at the plane of each base pair). Considering equations (1, 2 and 10), we can write: (14) where i denotes the label of the base pair . From equations (13 and 14) for an ideal superhelix, we have:, and . In other words, we have and i for an ideal superhelix . Using these relations, the constraint can be written as a function of the local roll, tilt and twist angle as: (15) in order to find the local conformation of the nucleosomal dna, one should take account of the specific local dna histone interactions in the nucleosome core particle, which is denoted by vdna - histone . Due to these interactions, the total energy of the nucleosome core particle can be written as etotal = eel + vdna - histone . In principle, one should consider this total energy etotal, and minimize it respect to the local variables subject to the constraint, and find the local conformation of the dna . There are fourteen binding sites, where the nucleosomal dna contacts the histone octamer (21). In these regions, the minor grooves of the dna face to the nucleosome core, where at each contact region, there are several hydrogen bonds between the histone proteins and the sugar - phosphate groups of the dna backbone (2). The interactions between dna and the histones in the binding sites are quite specific (6,22). We assume that the twist degree of freedom is mostly governed by these local interactions . Therefore, the local potential is considered as a solely function of as vdna - histone() (8). As far as there is no reliable quantitative model for this local potential vdna - histone, for the sake of simplicity, we implicitly consider the effect of these local interactions in our model: we read off the twist angle of the dna from the experimental data from reference (7). It also gives us some information about the sequence effects, which are not explicitly taken into account in this simple model . We now minimize the energy with respect to r, t, s, d and subject to the wrapping constraint . So, we can find the local conformation parameters, roll, tilt, shift, slide and rise at each base pair step . We note that considering the symmetry of the nucleosome core particle with respect to its pseudo 2-fold axis, and following reference (7), the calculations are performed for half of the dna length corresponding to base pairs . After minimizing the energy of the equation (8), with considering the wrapping constraint, equation (15) and reading off the twist values from the experimental data of richmond and davey, the calculated values of the roll (r), tilt (t), shift (s), slide (d) and rise are found . As one can see, the calculated values of the base pair parameters are significantly correlated with the experimental results of reference (7), especially, for the roll and slide . The filled circles correspond to the experimental data taken from reference (7), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm, and g = 25 nm . In the calculation process, the twist angles are directly read off from the experimental data of richmond and davey . The negative values of the roll and positive values of the slide are in good agreement with the experimental results . Figure 3.the relative changes in the length of the molecule, . The calculated and the experimentally observed roll, tilt, shift and slide . The filled circles correspond to the experimental data taken from reference (7), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm, and g = 25 nm . In the calculation process, the twist angles are directly read off from the experimental data of richmond and davey . The negative values of the roll and positive values of the slide are in good agreement with the experimental results . The relative changes in the length of the molecule, . One way to make a quantitative comparison with the experimental results is to calculate the linear correlation coefficients between the calculated results and the experimental data . The correlation coefficient, r, of two variables x and y is equal to (16) where a shows the average of the variable a. the correlation coefficients between the calculation and the experiment for the roll, slide, tilt and shift are 0.840, 0.774, 0.127 and 0.016, respectively . We can see that there is a clear coupling between the twist, roll and slide at kinked steps (i = 36, 48 and 58) correspond to flexible ca = tg base pairs . The slide values are also large at these steps, which are one of the most overwound base pair steps . It is worth to emphasize that the slide peaks are in good agreement with the experiment . We can see the importance of this result when we note that positive slides have a significant contribution to the structure of nucleosome . In our model, the values of the peaks of the roll are also obtained in very good agreement with the experimental results, and around twice the ones for an ideal superhelix (4.53). For the calculated values of the tilt and shift, in spite of overall agreement with the experimental results, the magnitude of the observed oscillations is generally underestimated . In fact, the calculated results for the values of the roll and slide are in more agreement with the experimental data than the ones of shift and tilt, which is also a consequence of the more correlation between the roll and slide with the twist angles that are reading off from the experiment directly . The correlation coefficients between twist and roll, as well as, twist and slide are obtained to be 0.951 and 0.768, respectively . The correlation coefficients between shift and tilt as well as roll and slide are 0.813 and 0.917, respectively . The negative correlation coefficient between roll and slide means that as the value of the slide increases, the value of the roll decreases . In fact, the parameters are correlated so that as a result of their changes, the arc length of the backbone does not change significantly . As shown in figure 3, the stretching of the molecule is also negatively correlated with twist and it has large peaks at the base pair steps that the molecule is highly undertwisted . To make a more refined quantitative comparison with the experiment, we take the fourier transform of each base pair parameter, x, defined as, for a list xs of length m, to better resolve its feature (figure 4). We know that the absolute value of the fourier transform is symmetric with respect to the transformation; therefore, it is sufficient to show the first half of the plots . As one can see, there is a distinct peak in the fourier transform of the base pair parameters at, which is corresponding to the periodicity of 10 bp, which is equal to the helical repeat of dna . We can also see a peak at q=31 in the fourier transform of the shift, which is equal to a period of about 2 bp, which is in consistence with the alternations observed experimentally in the shift values . Note that in spite of small obtained linear correlation coefficient between the calculated and experimental values of the shift, the fourier transform of the calculated shift values is in encouraging agreement with that of the experimental data . The filled circles are corresponding to the calculation of fourier transform of the experimental data taken from reference (7), and the hollow squares are corresponding to the fourier transforms of the calculated results using our simple elastic model . At, the filled circles are corresponding to the calculation of fourier transform of the experimental data taken from reference (7), and the hollow squares are corresponding to the fourier transforms of the calculated results using our simple elastic model . At, corresponding to the helical repeat of dna, the results show distinct peaks . Using equations (3)(5) and the proper relations for the changes in the length of the covalent bonds between the adjacent base pairs of the two strands of dna the relative changes in the length of the covalent bonds between the adjacent base pairs of the two strands of dna are shown in figure 5 . We see that the mentioned relative changes are less than for most of the base pair steps . As is expected, because of the rigidity of the covalent bonds, the arc length of the backbones does not vary significantly during the deformation . We note that, since dna is an anisotropic molecule, the changes in the length of the springs of the two strands are not necessarily the same . In few base pairs, the length of the spring of one strand extends while the length of the spring of the other one decreases . In the base pair steps that the relative changes in the length of the springs are> 10%, the relative changes in the twist are also large, which could be a consequence of dna protein interactions and sequence effects . Figure 5.the relative changes in the length of the covalent bonds between the adjacent base pairs of the two strands of dna, (filled circles) and (hollow squares). The relative changes in the length of the covalent bonds between the adjacent base pairs of the two strands of dna, (filled circles) and (hollow squares). Our simple model shows that the main features of the nucleosomal dna can be determined using a proper elastic model that incorporates some correlations that come from the geometry of the molecule . We see that in this model, without considering the explicit effect of the dna sequence, and without any tunning parameters, we find the structure of the nucleosomal dna in an encouraging good agreement with high precision experimental results . In the above treatment, the effect of the sequence is not considered explicitly in the elastic coefficients . Since we read off the twist of the nucleosomal dna from the experiment, the effect of the sequence of dna appears implicitly in the conformation of the nucleosomal dna . Therefore, we can see the sequence effects in the behaviour of the calculated base pair parameters . For example, at steps corresponding to flexible ca = tg base pair steps, the values of roll and slide are relatively large . In fact, at these base pair steps, roll and slide are more significantly coupled with twist of the molecule . Since we read off the twist of the nucleosomal dna from the experimental data, one may wonder what happens if the dna twist is not determined with the experiment . In principle, the local dna one can assume that this local potential causes the local torque and force on the dna in such a way that the dna is sharply bent and wrapped around the histone octamer . It has been shown that in the similar situations, the dna twist changes very slightly (<2%) (15,16,19). It is worth to check the effect of the twist values on the other base pair parameters . For this purpose, we assume that the twist of the bent dna is not changed from its natural twist . In figure 6, we have plotted the calculated base pair parameters as functions of the base pair steps, considering a constant twist angle equal to that of the undeformed b - dna (= 0 and i = ib0), together with the experimental data . As one can see, in this case, the calculated and experimental data are poorly correlated and the values of the base pair parameters at each base pair are mostly different from their experimental values . These results show that the histone - dna local interactions have a crucial effect on the dna twist . The filled circles correspond to the experimental data taken from reference (7), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm and g = 25 nm . In the calculation process, the twist angles are considered constant and equal to the twist of undeformed b - dna . We can see that, in this case, the calculated and experimental data are poorly correlated and the values of the base pair parameters at each base pair are mostly different from their experimental values . The filled circles correspond to the experimental data taken from reference (7), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm and g = 25 nm . In the calculation process, the twist angles are considered constant and equal to the twist of undeformed b - dna . We can see that, in this case, the calculated and experimental data are poorly correlated and the values of the base pair parameters at each base pair are mostly different from their experimental values . The geometry of the nucleosomal dna, and the rigidity of the covalent bonds in its structure, result in a significant coupling between its base pair parameters . Our sequence independent model, which uses experimental twist values as input, finds the values of roll and slide more significantly correlated with the experimental ones than the model of reference (10), which uses nucleosomal dna sequences as input . This can show the importance of the correlations between the base pair parameters, which come from the geometry and the elasticity of the dna molecule . It also means that we can show the structure of the nucleosomal dna with reduced number of the base pair parameters because of the strong coupling between them . Therefore, as we have shown here, instead of considering three independent base pair parameters, twist, roll and slide, we can only consider the twist of the base pairs, and obtain the other two parameters by taking into account the correlations that come from the geometry of the molecule . As can be seen from equation (7), in this model, we consider the elastic constants of dna molecule as sum of two terms; the elastic constants introduced in the previous elastic rod models for dna, and another term which is proportional to the covalent bond stiffness, kc, and the square of the changes in the covalent bond lengths . Actually, the elastic energy of the molecule can change as a result of deformation even if the covalent bond lengths of the two springs do not vary . In fact, if we want to estimate the total changes in the elastic energy of the molecule by solely the covalent bond term, we should consider more than two springs . In our model, the elastic constants corresponding to the lateral displacements have only the covalent bond term, and so, they are obtained to be a function of the geometrical properties of dna as well as the stiffness of the covalent bonds . These elastic constants are provided in the appendix a. we also find that after considering the effects of the two springs up to the second - order terms of the base pair parameters, the elastic constants showing the coupling terms between r and d, r and t, t and, s and and d and are found to be zero, while other elastic constants have non - zero values . In fact, by using this simple model, we find all the 21 different elastic constants of dna molecule as a function of the covalent bonds stiffness (see appendix a for details). We can also reverse the procedure by using the previously estimated values for the elastic constants of the different 10 bp step of dna molecule (23) to estimate the stiffness of the covalent bonds at individual base pair steps . It is worth to discuss about the values of the elastic constants that we have used in the text . There is still no direct experimental measurements for the anisotropy bending rigidities and twist - bend coupling . Simulation results estimate the values of these elastic coefficients for each of the 10 different sequences of nucleotides, and suggest a range of values for them as a1 = 4779 nm, a2 = 2552 nm (23). In this article, for the bending rigidities, we use a1 = 75 nm, a2 = 37 nm (19) (note that we choose a1 and a2 so that the effective bending rigidity,, equals the bending persistence length of the molecule, measured to be 50 nm). For the twist - bend coupling, we use the suggested value g = 25 nm in reference (8). The simulation works suggest that the twist - bend coupling is about g = 617 nm (23). We have also examined these values for the twist - bend coupling and found no significant effect . Recent direct determination of twist rigidity gives a value of c = 1007 nm (20), and we use c = 100 nm . Here, we simply estimate the interaction energy between dna and histone as only a function of the accumulated angle because the experimental results show that the twist angle mostly changes, and has large positive values at all of the contact regions (2). Moreover, there are also large alternation of shift values at some contact regions, so, it is more accurate to consider the interaction energy as a function of the two less correlated base pair parameters, twist and shift rather than solely a function of twist . Our approach can be used in the future elastic models for the nucleosome and other dna protein complexes, especially, to obtain the correlations between the base pair parameters . To show the more generality of our model, we have applied it to other sequence of dna and studied the results: ong et al . (24) have determined the crystal structure of a nucleosome core particle containing 145 bp of dna (ncp145) and found its base pair parameters . The base pairs 3 of the 147 base pair nucleosomal dna on eider side of the dyad axis are absent in the ncp145 . The same as before, we directly read off the twist angles from the ones obtained by ong et al . And find other base pair parameters using our simple model . The results are shown in figure 7 together with the experimental data of ong et al . (the same as before, the results are shown for half of the dna length, in this case, corresponding to 72 bp and the average base pair parameters of the base pairs on either side of the dyad axis are shown .) We can see that there is an overall good agreement between the experimental and calculated results especially for the values of roll and slide . The peaks of the slide are also in good agreement with the experimental data and there is a large roll - slide - twist correlation . Note that these important quantitative predictions come out naturally from the theory without having to choose a single fitting parameter . We finally note that the present model can also be applied to other protein dna complexes . As mentioned in the text, if the local potential of the interactions is known, one should consider this potential explicitly in the total energy etotal and minimize it with respect to the variables subject to the constraint and find the local conformation of the dna . Figure 7.the calculated and the experimentally observed roll, tilt, shift and slide of the ncp145 . The filled circles correspond to the experimental data taken from reference (24), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm, and g = 25 nm . In the calculation process, the twist angles are directly read off from the experimental data of ong et al . The negative values of the roll and positive values of the slide are in good agreement with the experimental results . The correlation coefficients between the calculation and experiment for the roll, slide, tilt and shift are 0.702, 0.623, 0.165 and 0.104, respectively . The calculated and the experimentally observed roll, tilt, shift and slide of the ncp145 . The filled circles correspond to the experimental data taken from reference (24), and the hollow squares show the calculated results using a1 = 75 nm, a2 = 37 nm, and g = 25 nm . In the calculation process, the twist angles are directly read off from the experimental data of ong et al . The negative values of the roll and positive values of the slide are in good agreement with the experimental results . The correlation coefficients between the calculation and experiment for the roll, slide, tilt and shift are 0.702, 0.623, 0.165 and 0.104, respectively . In conclusion, by introducing a simple elastic model, we study the role of the rigidity of the sugar - phosphate backbones in the structure of the nucleosomal dna . By this new approach, all the different correlations between the six base pair parameters are obtained as a function of the stiffness of the springs, which simply represent the covalent bonds between the adjacent base pairs . Our simple model succeeds to obtain some of the main detailed features of the nucleosomal dna; in fact, we show that some of the important features of the dna molecule can be obtained by just considering the changes in the covalent bond energies in the elastic model . The results, especially, for the roll and slide, are in encouraging quantitative agreement with the experimental results, and show obviously the two significant base pair parameter correlations, roll - slide - twist as well as tilt - shift . Institute for advanced studies in basic sciences (iasbs) research council (grant no . Department of physics and the department of biological sciences of institute for advanced studies in basic sciences (iasbs).
Safety of the donor is vital as it influences the possible outlook of society towards voluntary organ donation . Coagulopathy after major hepatic resection may compromise the donor's safety, especially at epidural catheter removal . In the present study, we retrospectively analysed living donors who underwent hepatectomy (ldh) at our centre over a three year period (march 2010 to 2013). The primary objective was to study the extent, duration and predictors of coagulopathy in the immediate postoperative period . The secondary objective was to recommend the optimum postoperative day to remove epidural catheter to minimise the risk of epidural bleeding and its attendant complications . Approval was taken from the institutional review board and consent waiver was obtained for analysis of data . Data of donor hepatectomy from march 2010 to 2013 including records of perioperative anaesthesia management, intraoperative events, postoperative recovery, nursing, physiotherapy, and computerized hospital data was retrospectively reviewed . We included all donors given general anaesthesia and those that had received thoracic epidural anaesthesia with consent . We excluded those donors in whom hepatectomy did not proceed or they received antiplatelet drugs postoperatively due to other medical reasons . From the anaesthesia records, we noted the age, gender, bmi, presence of co - morbidities, american society of anaesthesiologist (asa) physical status classification, baseline preoperative haematocrit, inr, platelet count and alanine aminotransferase (alt) of each donor on the day of surgery (pod 0). From the preoperative ct scan of abdomen we also noted the anaesthesia technique, presence of epidural catheter, total duration of anaesthesia, type of donor hepatectomy (right versus left lobe), graft weight (in grams), blood loss and blood transfused . Remnant% = (tlv graft weight) 100/tlv rmdwr = (tlv graft weight)/body weight of the donor from the postoperative record and hospital database, we collected the value of platelet count and peak value of inr of each day for first 5 postoperative days or till the epidural catheter was removed . We recorded the postoperative day, inr and platelet count on removal of epidural catheter and any catheter related complications as mentioned in records . Donors were monitored with electrocardiography, invasive blood pressure by insertion of left radial artery catheter, central venous pressure by insertion of right internal jugular catheter, body temperature, end tidal carbon dioxide, arterial blood gas analysis and urine output . The mean blood pressure was maintained above 65 - 70 mmhg with a urine output more than 1 ml / kg / hour . Packed red blood cells (prbc) was transfused wherever the haemoglobin dropped below 8 gm% . Heparin 50 units / kg was administered at the end of parenchymal transaction, before retrieval of graft to prevent graft thrombosis . After surgery, neuromuscular blockade was reversed and trachea was extubated in all donors on table . Thereafter, the patient was shifted to postanaesthesia care unit . For analgesia, either patient controlled epidural analgesia (pcea) or intravenous patient controlled analgesia (iv pca) was started with regular daily follow up by the acute pain services team (apst). Coagulopathy was said to be present when inr> 1.5 or platelet count less than 1 10/mm after surgery . Presence of coagulopathy on this day was then correlated with age, gender, bmi, presence of tea, hepatectomy left or right, duration of anaesthesia, blood loss, remnant liver volume (expressed both as a percentage of remnant donor weight ratio rdwr with total liver volume (% tlv) as estimated by ct volumetry preoperatively). Donors were divided into two groups, group 1-donors with coagulopathy and group 2-donors without coagulopathy . This was done using spss 20 for windows (spss, inc, chicago, il). Univariate analysis was done for presence of coagulopathy and included age, gender, bmi, duration of anaesthesia, blood loss, type of hepatectomy, presence of epidural, remnant liver volume and duration of hospital stay as the variables . Stepwise multivariate logistic regression analysis was done to evaluate independent factors associated with coagulopathy which was taken as the dependent variable . Approval was taken from the institutional review board and consent waiver was obtained for analysis of data . Data of donor hepatectomy from march 2010 to 2013 including records of perioperative anaesthesia management, intraoperative events, postoperative recovery, nursing, physiotherapy, and computerized hospital data was retrospectively reviewed . We included all donors given general anaesthesia and those that had received thoracic epidural anaesthesia with consent . We excluded those donors in whom hepatectomy did not proceed or they received antiplatelet drugs postoperatively due to other medical reasons . From the anaesthesia records, we noted the age, gender, bmi, presence of co - morbidities, american society of anaesthesiologist (asa) physical status classification, baseline preoperative haematocrit, inr, platelet count and alanine aminotransferase (alt) of each donor on the day of surgery (pod 0). From the preoperative ct scan of abdomen we also noted the anaesthesia technique, presence of epidural catheter, total duration of anaesthesia, type of donor hepatectomy (right versus left lobe), graft weight (in grams), blood loss and blood transfused . Remnant% = (tlv graft weight) 100/tlv rmdwr = (tlv graft weight)/body weight of the donor from the postoperative record and hospital database, we collected the value of platelet count and peak value of inr of each day for first 5 postoperative days or till the epidural catheter was removed . We recorded the postoperative day, inr and platelet count on removal of epidural catheter and any catheter related complications as mentioned in records . Donors were monitored with electrocardiography, invasive blood pressure by insertion of left radial artery catheter, central venous pressure by insertion of right internal jugular catheter, body temperature, end tidal carbon dioxide, arterial blood gas analysis and urine output . The mean blood pressure was maintained above 65 - 70 mmhg with a urine output more than 1 ml / kg / hour . Packed red blood cells (prbc) was transfused wherever the haemoglobin dropped below 8 gm% . Heparin 50 units / kg was administered at the end of parenchymal transaction, before retrieval of graft to prevent graft thrombosis . After surgery, neuromuscular blockade was reversed and trachea was extubated in all donors on table . For analgesia, either patient controlled epidural analgesia (pcea) or intravenous patient controlled analgesia (iv pca) was started with regular daily follow up by the acute pain services team (apst). Coagulopathy was said to be present when inr> 1.5 or platelet count less than 1 10/mm after surgery . Presence of coagulopathy on this day was then correlated with age, gender, bmi, presence of tea, hepatectomy left or right, duration of anaesthesia, blood loss, remnant liver volume (expressed both as a percentage of remnant donor weight ratio rdwr with total liver volume (% tlv) as estimated by ct volumetry preoperatively). Donors were divided into two groups, group 1-donors with coagulopathy and group 2-donors without coagulopathy . This was done using spss 20 for windows (spss, inc, chicago, il). Univariate analysis was done for presence of coagulopathy and included age, gender, bmi, duration of anaesthesia, blood loss, type of hepatectomy, presence of epidural, remnant liver volume and duration of hospital stay as the variables . Stepwise multivariate logistic regression analysis was done to evaluate independent factors associated with coagulopathy which was taken as the dependent variable . All donors were healthy and (85/100) with 85% of donors were american society of anaesthesiologist (asa) physical status class i and remaining (15/100) 15% asa physical status class ii . The mean age was 31.02 8.87 years with a bmi of 23.2 3.21 . General anaesthesia was administered in all cases with supplemental thoracic epidural analgesia in 72 donors . Right lobe hepatectomy was done in 86 individuals while left lobe was retrieved in remaining 14 donors . The blood loss ranged from 350 to 750 ml and transfusion of prbc was required in 7 patients . The remnant liver mass was observed to be 47.91 11.4% of total liver volume (tlv) with a remnant donor weight ratio of 0.988 0.26 . The median alt peaked on first postoperative day (166 with iq range 132 - 234) and decreased to 80 with iq 61 - 109 on fifth postoperative day [table 1]. The median duration of hospital stay was 13 days with an interquartile range from 9 to 16 days . Accidental removal of epidural catheter occurred in 3 donors (4.1%) in first three days while there was leakage of drug from catheter site in two donors (2.8%) requiring removal of the catheter . A total of 36.1%, 18.1% and 5.6% epidural catheters were removed on postoperative day 5, 6, and 7 respectively followed by 33.3% on pod 4 . Inr, platelet count, alt baseline (pod 0) and first five consecutive postoperative days (pod 1, 2, 3, 4, 5) * mean standard deviation, median with interquartile range there was a rise in inr and fall in platelet count in all subjects after donor hepatectomy [table 1]. Peak value of inr was found on second whereas the lowest platelet count was found on third postoperative day . On pod1, 62% of donors were categorized having coagulopathy compared to 84% on day 2, 61% on day 3 and 31% on day 4 . Maximum incidence of donors with a hypocoaguable state was on the second postoperative day . Improvement in coagulation parameters started from the third day after surgery when a sharp decline in the number of donors fitting in coagulopathy criteria was noted . By the fifth postoperative day, only 14% donors remained hypocoaguable by inr / platelet criteria [table 2]. Number of donors with coagulopathy first five consecutive postoperative days (pod 1, 2, 3, 4, 5) after ldh on comparison of the subjects with coagulopathy (group 1: n = 84) with those without coagulopathy (group 2: n = 16) on the second postoperative day, a lower bmi (22.83 3.16 versus 25.42 2.72), lower remnant liver volume (remnant% 45.97 9.4 versus 58 15.32, rmdwr 0.956 0.24 versus 1.16 0.30), and longer duration of surgery (12.5 2.3 versus 10.8 2 hours) was found in group 1 . Incidence of coagulopathy was significantly higher after right lobe (88%) than after left lobe ldh (p = 0.003). There was no correlation of development of coagulopathy in the postoperative period with age, gender, blood loss or presence of epidural catheter [table 3]. The overall hospital stay was 12.5 (9 - 16) days in coagulopathic versus 14 (10 - 15.7) days in non - coagulopathic donors (p = 0.512). Comparison between two groups demographic and perioperative variables low bmi, low remnant liver (expressed as a percentage of tlv), and long duration of surgery were independent predictors of immediate postoperative coagulopathy [table 4]. Independent predictors of coagulopathy on multivariate regression analysis since incidence of a hypocoaguable state was more after right lobe donor hepatectomy, we calculated remnant liver volume in donor (remnant% and rmdwr) separately for subjects undergoing right lobe donor hepatectomy to avoid skewing of data . In this subgroup of patients, only low bmi was found to have statistical significance in prediction of coagulopathy in the immediate postoperative period with a low remnant% being a close second factor though failing to achieve a statistical significance [table 5]. Persistent hypocoagulable state was present even on the fifth postoperative day in donors with bmi (20.6 2.9) compared to those with bmi (23.7 3.1) (p = 0.001). Predictors of coagulopathy after right lobe donor hepatectomy on multivariate regression analysis * remnant donor weight ratio there was no correlation of presence of coagulopathy on each day with the respective alt of that day . All donors were healthy and (85/100) with 85% of donors were american society of anaesthesiologist (asa) physical status class i and remaining (15/100) 15% asa physical status class ii . The mean age was 31.02 8.87 years with a bmi of 23.2 3.21 . General anaesthesia was administered in all cases with supplemental thoracic epidural analgesia in 72 donors . Right lobe hepatectomy was done in 86 individuals while left lobe was retrieved in remaining 14 donors . The blood loss ranged from 350 to 750 ml and transfusion of prbc was required in 7 patients . The remnant liver mass was observed to be 47.91 11.4% of total liver volume (tlv) with a remnant donor weight ratio of 0.988 0.26 . The median alt peaked on first postoperative day (166 with iq range 132 - 234) and decreased to 80 with iq 61 - 109 on fifth postoperative day [table 1]. The median duration of hospital stay was 13 days with an interquartile range from 9 to 16 days . Accidental removal of epidural catheter occurred in 3 donors (4.1%) in first three days while there was leakage of drug from catheter site in two donors (2.8%) requiring removal of the catheter . A total of 36.1%, 18.1% and 5.6% epidural catheters were removed on postoperative day 5, 6, and 7 respectively followed by 33.3% on pod 4 . Inr, platelet count, alt baseline (pod 0) and first five consecutive postoperative days (pod 1, 2, 3, 4, 5) * mean standard deviation, median with interquartile range there was a rise in inr and fall in platelet count in all subjects after donor hepatectomy [table 1]. Peak value of inr was found on second whereas the lowest platelet count was found on third postoperative day . On pod1, 62% of donors were categorized having coagulopathy compared to 84% on day 2, 61% on day 3 and 31% on day 4 . Improvement in coagulation parameters started from the third day after surgery when a sharp decline in the number of donors fitting in coagulopathy criteria was noted . By the fifth postoperative day, only 14% donors remained hypocoaguable by inr / platelet criteria [table 2]. Number of donors with coagulopathy first five consecutive postoperative days (pod 1, 2, 3, 4, 5) after ldh on comparison of the subjects with coagulopathy (group 1: n = 84) with those without coagulopathy (group 2: n = 16) on the second postoperative day, a lower bmi (22.83 3.16 versus 25.42 2.72), lower remnant liver volume (remnant% 45.97 9.4 versus 58 15.32, rmdwr 0.956 0.24 versus 1.16 0.30), and longer duration of surgery (12.5 2.3 versus 10.8 2 hours) was found in group 1 . Incidence of coagulopathy was significantly higher after right lobe (88%) than after left lobe ldh (p = 0.003). There was no correlation of development of coagulopathy in the postoperative period with age, gender, blood loss or presence of epidural catheter [table 3]. The overall hospital stay was 12.5 (9 - 16) days in coagulopathic versus 14 (10 - 15.7) days in non - coagulopathic donors (p = 0.512). Comparison between two groups demographic and perioperative variables low bmi, low remnant liver (expressed as a percentage of tlv), and long duration of surgery were independent predictors of immediate postoperative coagulopathy [table 4]. Independent predictors of coagulopathy on multivariate regression analysis since incidence of a hypocoaguable state was more after right lobe donor hepatectomy, we calculated remnant liver volume in donor (remnant% and rmdwr) separately for subjects undergoing right lobe donor hepatectomy to avoid skewing of data . In this subgroup of patients, only low bmi was found to have statistical significance in prediction of coagulopathy in the immediate postoperative period with a low remnant% being a close second factor though failing to achieve a statistical significance [table 5]. Persistent hypocoagulable state was present even on the fifth postoperative day in donors with bmi (20.6 2.9) compared to those with bmi (23.7 3.1) (p = 0.001). Predictors of coagulopathy after right lobe donor hepatectomy on multivariate regression analysis * remnant donor weight ratio there was no correlation of presence of coagulopathy on each day with the respective alt of that day . On comparison of the subjects with coagulopathy (group 1: n = 84) with those without coagulopathy (group 2: n = 16) on the second postoperative day, a lower bmi (22.83 3.16 versus 25.42 2.72), lower remnant liver volume (remnant% 45.97 9.4 versus 58 15.32, rmdwr 0.956 0.24 versus 1.16 0.30), and longer duration of surgery (12.5 2.3 versus 10.8 2 hours) was found in group 1 . Incidence of coagulopathy was significantly higher after right lobe (88%) than after left lobe ldh (p = 0.003). There was no correlation of development of coagulopathy in the postoperative period with age, gender, blood loss or presence of epidural catheter [table 3]. The overall hospital stay was 12.5 (9 - 16) days in coagulopathic versus 14 (10 - 15.7) days in non - coagulopathic donors (p = 0.512). Low bmi, low remnant liver (expressed as a percentage of tlv), and long duration of surgery were independent predictors of immediate postoperative coagulopathy [table 4]. Independent predictors of coagulopathy on multivariate regression analysis since incidence of a hypocoaguable state was more after right lobe donor hepatectomy, we calculated remnant liver volume in donor (remnant% and rmdwr) separately for subjects undergoing right lobe donor hepatectomy to avoid skewing of data . In this subgroup of patients, only low bmi was found to have statistical significance in prediction of coagulopathy in the immediate postoperative period with a low remnant% being a close second factor though failing to achieve a statistical significance [table 5]. Persistent hypocoagulable state was present even on the fifth postoperative day in donors with bmi (20.6 2.9) compared to those with bmi (23.7 3.1) (p = 0.001). Predictors of coagulopathy after right lobe donor hepatectomy on multivariate regression analysis * remnant donor weight ratio there was no correlation of presence of coagulopathy on each day with the respective alt of that day . We observed significant coagulopathy with maximum severity and incidence on the second postoperative day . The rise in inr contributes more towards coagulopathy than fall in platelet count . On the fifth postoperative day, we found that a low bmi was an independent predictor of development of a hypocoagulable state after right lobe ldh . Removal of a considerable hepatic mass may lead to diminished hepatic synthesis of clotting factors causing a hypocoagulable state . Temporary alterations in the haemostatic balance have been documented after liver resection in healthy living donors as well as individuals with benign or malignant masses . Various studies have implicated blood loss, transfusion, temporary vascular flow interruption, fibrinolysis and decreased synthetic activity of the remnant liver as contributor of coagulopathy . However, consumption and transient decrease in synthetic activity could explain the development of coagulopathy in our patients . Postoperative coagulopathy was present in 84% of our donors on the second day which persisted till the third postoperative day in 61% individuals . Kim et al . Reported the presence of coagulopathy after donor hepatectomy however, they did not identify the course and severity of coagulopathy . Our data is in agreement with stamenkovic et al . Who observed a peak in inr on the second day . However, we observed the nadir in platelet count on third postoperative day rather than the second . Patients who underwent right hepatectomy had a prolonged inr as compared to those who underwent left hepatectomy suggesting that parenchymal loss and extent of hepatectomy might have a significant effect on impairment of coagulation status after hepatectomy . The remnant volume as estimated by remnantpercent (43.8 6 versus 48.3 9) and rdwr (0.9 0.2 vs 1.0 0.27), was lower in donors with coagulopathy compared to those without coagulopathy . Our mean remnant% in hypocoaguable donors were lower than that reported by kim et al . However, as a predictor of coagulopathy, the remnant% did not reach statistical significance in donors undergoing right lobe hepatectomy (p value> 0.05). The vascular occlusion technique to reduce blood loss and minimize ischemia reperfusion injury like pringle's manoeuvre have been shown to be an independent risk factor to predict postoperative coagulopathy . Because of the retrospective nature of our study this aspect could nt be ascertained in our patients . We observed a statistically significant association of a low bmi with development of a hypocoaguable state in the immediate postoperative period . Only one study has observed similar finding which is in contradiction with earlier studies which have shown that donors with high bmi may have higher incidence of steatosis and graft dysfunction leading to postoperative coagulopathy . In donors with lower bmi, hypocoagulable state was observed on fifth postoperative day, suggesting that low bmi may have a significant association with persistence of hypocoagulable state . Gruttadauria et al . Studied early liver regeneration of 70 living donors who underwent right hepatectomy . They found that a higher preoperative bmi was one of the predictors of greater liver regeneration . Duration of surgery was a significant predictor of coagulopathy after ldh, though it did not achieve statistical significance when only donors with right lobe hepatectomy were analysed . Coagulopathic state did not increase the postoperative hospital stay or was not associated with persistent rise in alt . However, presence of coagulopathy may endanger the safety of the donor, especially if thoracic epidural analgesia (tea) is used for postoperative analgesia . Coagulation abnormalities post donor hepatectomy has been previously reviewed but no clear consensus on epidural catheter insertion and removal exists . At an inr of 1.5, only 40% of the normal clotting factor activity may be present . Thus, inr should be less than 1.5 for normal haemostasis for safe removal of epidural catheter in patients on anticoagulants . A platelet count of more than 100 10/mm is considered to be safe by many clinicians for the same purpose . In view of the hypocoaguable state as seen in our study, it is unsafe to remove the catheter within the first four days of donor hepatectomy . In 86% donors, this coagulation derangement corrected spontaneously by fifth postoperative day however, inr <1.5 must be confirmed before removal of tec as 14% donors still remain hypocoagulable even on the fifth postoperative day . In three patients, we observed accidental removal of tec in the first two days, but no epidural related complications were noted . We suggest that removal of the epidural catheter should be considered only when there is recovery in coagulopathic state and probably only fifth day after surgery, after confirming normal coagulation parameters . In our study our patients routinely received low molecular weight heparin (lmwh) from the second or third postoperative day . While routine ptt levels were not done but epidural catheter removal and subsequent dosing was done in accordance to current american society of regional anesthesia guidelines . Accidental removal of the epidural catheter within the first three days exposes the patient to these rare but serious complications of epidural hematoma or neurological compression . Because of the rarity of such complications the study was inadequately powered to confirm the safety of epidural analgesia in live liver donor hepatectomy . The risk of infectious complications needs to critically reviewed because of inherent delay of epidural catheter removal . In most of our patients epidural catheter was removed on or after day 4 but no symptoms suggestive of infectious complication developed . Second, detection of a rare complication like epidural hematoma is very difficult in this small number of patients . Third, we followed the coagulation status for the first five postoperative days only and fourth, the efficacy of epidural for analgesia could not be compared to intravenous analgesia . In conclusion, the incidence and severity of coagulopathy is maximum on the second postoperative day after donor hepatectomy . In donors with low bmi, planned for retrieval of right lobe of liver, it may be prudent to remove the tec after the fifth postoperative day after confirming normal coagulation parameters, thereby decreasing the risk of complications associated with coagulopathy.
Undiagnosed and untreated thyroid disease can be a cause for infertility as well as sub - fertility . Both these conditions have important medical, economical, and psychology implications in our society . Thyroid dysfunction can affect fertility in various ways resulting in anovulatory cycles, luteal phase defect, high prolactin (prl) levels, and sex hormone imbalances . Therefore, normal thyroid function is necessary for fertility, pregnancy, and to sustain a healthy pregnancy, even in the earliest days after conception . Thyroid evaluation should be done in any woman who wants to get pregnant with family history of thyroid problem or irregular menstrual cycle or had more than two miscarriages or is unable to conceive after 1 year of unprotected intercourse . The comprehensive thyroid evaluation should include t3, t4, thyroid stimulating hormone (tsh), and thyroid autoimmune testing such as thyroid peroxidase (tpo) antibodies, thyroglobin / antithyroglobin antibodies, and thyroid stimulating immunoglobulin (tsi). Thyroid autoimmune testing may or may not be included in the basic fertility workup because the presence of thyroid antibodies doubles the risk of recurrent miscarriages in women with otherwise normal thyroid function. [13] prevalence of hypothyroidism in the reproductive age group is 24% and has been shown to be the cause of infertility and habitual abortion . A slight increase in tsh levels with normal t3 and t4 indicates subclinical hypothyroidism whereas high tsh levels accompanied by low t3 and t4 levels indicate clinical hypothyroidism . It is extremely important to diagnose and treat the subclinical hypothyroidism for pregnancy and to maintain it unless there are other independent risk factors . Many infertile women with hypothyroidism had associated hyperprolactinemia due to increased production of thyrotropin releasing hormone (trh) in ovulatory dysfunction . It has been recommended that in the presence of raised prl, the treatment should be first given to correct the hypothyroidism before evaluating other causes of raised prl . Measurement of tsh and prl is routinely done as a part of infertility workup . Due to the lack of population - based infertility data of women with subclinical hypothyroidism in our state, we planned to study the prevalence of hypothyroidism in infertile women as well as to assess their response to drug treatment for hypothyroidism . The study was conducted on 394 women (age group 2040 years) on their first visit to infertility clinic of gynecology and obstetrics department of a tertiary care hospital attached to a medical college in north india from february 2007 to march 2010 . The study was approved by the institutional ethical committee and was conducted after taking informed, written consent of the participants . Infertile women having tubular blockage, pelvic inflammatory disease, endometriosis on diagnostic laparoscopy or hysteroscopy and with genital tb (pcr - positive); with liver, renal or cardiac diseases; those already on treatment for thyroid disorders or hyperprolactinemia; or cases where abnormality was found in husband's semen analysis also were excluded from the study . Routine investigations such as random blood sugar (rbs), renal functions tests (rft), hemogram, urine routine, and ultrasound (as and when required) were done . Tsh and prl were measured by the electrochemiluminesence method as per the instruction manual for elecsys, 2010 (roche, usa). Normal tsh and prl levels were 0.274.2 iu / ml and 1.925 ng / ml, respectively, as per kit supplier's instruction . Therefore, hypothyroidism was considered at tsh levels of> 4.2 iu / ml and hyperprolactinemia at prl levels of> 25 ng / ml . Thyroxine 25150 g (thyrox, thyronorm, eltroxin) was given to hypothyroid infertile females depending upon tsh levels . Of the 394 women enrolled for the study, 76 (19.29%) infertile women had raised tsh levels only, 54 (13.7%) infertile females had raised prl levels only, and 18 (4.57) infertile female have raised levels of both tsh and prl, which may be due to hypothalamic and/or pituitary diseases . In 94 hypothyroid infertile females, the mean tsh levels were 8.34 10.52 iu / ml, and in 72 infertile women with hyperprolactinemia the mean prl levels were 53.26 47.17 ng / ml; and the difference in the levels of both these hormones in infertile women with hypothyroidism and/or hyperprolactinemia was highly significant compared to infertile women with normal levels (p <0.001) [table 1]. Depending upon the tsh levels, hypothyroid infertile women were further subdivided into subclinical (tsh 46 iu / ml) and clinical (tsh> 6 iu / ml) hypothyroidism . It was found that 59 (62.7%) of hypothyroid infertile women were with subclinical and remaining 35 (37.3%) were with clinical hypothyroidism . Serum thyroid stimulating hormone and prolactin levels in 394 infertile females of the 94 infertile women diagnosed with hypothyroidism (alone or with hyperprolactinemia), 72 (76.6%) infertile women conceived after treatment with drugs for hypothyroidism (dose depending upon severity of hypothyroidism, i.e. Tsh levels). Of these 72 women, 45 (62.5%) women conceived after 6 weeks to 3 months of therapy and 27 (37.5%) women conceived after 3 months to 1 year of therapy . We further found that hypothyroid infertile women with associated hyperprolactinemia also responded to treatment for hypothyroidism and they conceived . Thyroid dysfunction is implicated in a broad spectrum of reproductive disorders, ranging from abnormal sexual development to menstrual irregularities and infertility . Hypothyroidism is associated with increased production of trh, which stimulates pituitary to secrete tsh and prl . Gynecologists mostly check tsh and prl levels in every infertile female, regardless of their menstrual rhythm . In usa, tsh and prl levels were checked at the time of the couple's initial consultation for infertility . In our study, the prevalence of hypothyroidism was 23.9% (sub - clinical 62.7% and clinical 37.3%) and hyperprolactinemia was 18.3%, which is higher than in usa . The prevalence of hyperprolactinemia was higher in iraq (60%) and even in hyderabad, india, it is higher (41%) as compared to the present study in north india . Hyperprolactinemia may result from stress, and the variable prevalence may be due to the different stress levels in different areas . Thyroid dysfunction is a common cause of infertility which can be easily managed by correcting the appropriate levels of thyroid hormones . It has been recommended that in the presence of raised tsh along with raised prl levels, the treatment should be first to correct the hypothyroidism before evaluating further causes of hyperprolactinemia . It normalizes the menstrual cycle, prl levels and improves the fertility rate . Therefore, with simple oral treatment for hypothyroidism, we tried to maintain normal tsh levels; compliance and adequacy of hypothyroid drug dose were checked by tsh measurement after 6 to 8 weeks interval . The decision to initiate thyroid replacement therapy in subclinical hypothyroidism at early stage is justified in infertile women . Our data also indicate that variations in tsh levels in the narrower range or borderline cases, i.e. 45, 56, and> 6.0 iu / ml, should not be ignored in infertile women which are otherwise asymptomatic for clinical hypothyroidism . This group of infertile women, if only carefully diagnosed and treated for hypothyroidism, can benefit a lot rather than going for unnecessary battery of hormone assays and costly invasive procedures . For better management of infertility cause, we should plan further studies with the large sample size and long - term follow - up which are necessary to validate the variation in tsh and prl levels.
Proximal wrist extensor tendinopathy is a condition most commonly known as tennis elbow, which is pain at or just distal to the lateral humeral epicondyle within the proximal wrist extensor tendon . Many diagnoses have been used to describe this disorder including tendinosis of the lateral elbow, lateral epicondylitis, lateral epicondylalgia, or lateral epicondylopathy . Major first described this disorder in 1883 as a condition causing lateral elbow pain in tennis players . While up to 40% of tennis players may experience this condition, it affects as many as 15% of workers in highly repetitive hand task industries, and can result in an average duration of 12 weeks of absenteeism in as many as 30% of all those afflicted . In a finnish population study, the prevalence was 1.3% of people aged 3064 years old and was more likely to occur in people who smoke, have type 2 diabetes, and are involved in occupations requiring repetitive movements of the arms and those handling loads heavier than 20 kg . Proximal wrist extensor tendinopathy occurs much more frequently than medial - sided elbow pain, with reported ratios ranging from 4:1 to 7:1 . Typically, after soft tissue trauma, there are three phases of healing: inflammation, repair, and remodeling . The first phase is the inflammatory phase and can last up to several days . In this phase, once at the site of injury, immune cells release cytokines that bring fibroblasts to the area to begin the repair phase . The repair phase begins during the inflammatory phase and can last weeks . In this phase, fibroblasts lay down collagen according to the tension placed across the area being healed . Over time remodeling occurs, and the tissue reorganizes and becomes stronger as a result of an expansion of the cross - bonds between collagen fibers and replacement of the collagen fibers themselves . While the term lateral epicondylitis is used most often for wrist extensor tendon pain in the lateral elbow, an inflammatory process is present probably only in the very early stages of the disorder . The pathology is considered to originate within the extensor carpi radialis brevis musculotendinous unit, though up to one third of patients have involvement in the origin of the extensor digitorum communis . Histopathological studies have shown that specimens of tendon obtained from areas of chronic overuse, such as with proximal wrist extensor tendinopathy, do not contain large number of macrophages, lymphocytes, or neutrophils . Normal tendon contains bundles of type - i collagen that are arranged in line with the long axis of the tendon with a sparse number of fibroblasts . In contrast, in patients with proximal wrist extensor tendinopathy, there appears to be a degenerative process that is characterized by the presence of fibroblasts, vascular hyperplasia, and disorganized collagen, which is commonly called tendinosis . Many will not be able to describe an inciting event, but may be able to remember the first time the symptoms were felt . Prior to presenting to a health care professional, patients often will attempt to rest the area and may use ice and/or nsaids to try to alleviate the pain . Unfortunately, the pain often returns once regular use of the hand or forearm is resumed . Patients generally point to the lateral elbow as the source of their pain, but sometimes will point along the majority of the wrist extensor muscle mass . When the pain becomes more severe, symptoms often are felt with gripping activities, shaking hands, turning doorknobs, or lifting objects with the forearm pronated . The first is cozen s test, which involves asking the patient to make a fist, pronate the forearm, and extend the wrist toward radial deviation, while the examiner resists this motion (fig . 1). Another test is mill s test, in which the examiner palpates the lateral epicondyle with one hand, and with the other, pronates the patient s forearm, flexes the wrist fully, and extends the elbow (fig . 2). A third test involves having the examiner resisting extension of the long finger of the patient s symptomatic side (fig . 3). Reproduction of the patient s pain in the area of the lateral epicondyle indicates a positive test . 3resisted finger extension resisted finger extension some have attempted to describe clinical criteria for diagnosing proximal wrist extensor tendinopathy, listing three findings that should be present: lateral epicondylar pain, epicondylar tenderness, and pain on resisted extension of the wrist . Some suggest that grip strength should be tested to see if pain is reproduced during gripping or to compare strength to the unaffected side . With proximal wrist extensor tendinopathy if numbness or tingling is present, then one must consider a neurologic cause for the pain, such as a cervical radiculopathy or entrapment radial neuropathy in the elbow . Other diagnoses that may be considered, especially in athletes, include radiocapitellar disorders, osteochondritis dessicans, lateral collateral ligament incompetency, and plica band syndrome . Routine radiographs of the elbow can assess for osteoarthritis of the elbow or calcific tendonitis of the wrist extensor mass, but often these are normal . When a patient s symptoms are refractory to treatment, a diagnostic ultrasound or an mri may be useful to assess the wrist extensor tendons to confirm the diagnosis of proximal wrist extensor tendinopathy and rule out other causes of pain . Nonoperative treatment is generally effective and includes ice, nonsteroidal anti - inflammatory drugs (nsaids), bracing (e.g., with a forearm strap), activity modification, physical therapy, and injections . Patients often try rest, ice, modified activity, a forearm strap, or nsaids before seeking care, but these may provide only short - term relief . Given that the pathologic process is usually not inflammatory, the use of nsaids only provides relief of pain . Studies using nsaids to treat individuals who have a tendinopathy show minimal, if any improvement of pain . Animal and in vitro studies have not generated consistent data to suggest that nsaids are appropriate or beneficial in tendinopathy . While icing may be recommended, a recent pilot study showed that a 4-week physical therapy exercise program was effective in decreasing pain in lateral epicondylitis, regardless of whether or not ice was used . While multiple meta - analyses have been done to evaluate the effectiveness of physical interventions on proximal wrist extensor tendinopathy, the most recent is by bisset et al . . In this meta - analysis, the diagnosis of tennis elbow or lateral epicondylitis was given to those with lateral elbow pain that increased on palpation and/or had reproduction of pain on resisted wrist extension . While 74 randomized controlled trials with physical interventions for lateral epicondylitis were identified, based on those studies that were included, it was found that manipulation techniques (including cross - friction massage), exercise, and acupuncture provided significant short - term relief . Studies that evaluated the efficacy of orthoses (including a forearm strap), taping, laser therapy, extracorporeal shock wave therapy, electromagnetic field and ionization, ultrasound, and phonophoresis either did not demonstrate a significant effect or showed an inconsistent effect on outcomes . However, given the small number of studies that met criteria for evaluation, more studies may be needed to determine the efficacy of physical interventions for this condition . Only one study that involved exercise therapy in the meta - analysis met criteria to be evaluated, whereas all the other physical interventions had two or more studies that met criteria . A recent review on the effectiveness of eccentric exercise on chronic tendinopathy, including patellar and achilles tendinopathy, found three studies on lateral epicondylitis that met criteria for evaluation . Of the studies evaluated, there is conflicting evidence on the effect of eccentric training on outcomes . One investigator, alfredson, has done multiple studies on tendinopathy has evaluated the efficacy of eccentric training on achilles tendinopathy, and did so while encouraging reproduction of the tendon pain during the therapy sessions . A goal of reproducing patients pain during rehabilitative exercise is a paradigm shift in the treatment of musculoskeletal disorders, since, often patients pain symptoms are avoided or minimized during exercise sessions . While achilles tendinopathy appears to have a similar histologic picture as proximal wrist extensor tendinopathy, the function of the achilles tendon is much different, so comparing treatments for these two conditions may be limited . Studies done to evaluate the effectiveness of eccentric strength training demonstrate that it can take weeks to be completely effective . Further research will clarify the exact role of exercise therapy and determine the specific exercises that help those with proximal wrist extensor tendinopathy . Injections should be considered in patients if above interventions have not provided relief, or in those whose pain on presentation is more inflammatory or debilitating . The most common injection performed is a corticosteroid injection, which is injected at the maximal site of tenderness . A recent review on the effectiveness of corticosteroid injections on lateral epicondylitis showed that a corticosteroid injection is more effective in the short - term (less than 6 weeks) compared to placebo, local anesthetic, and conservative treatments when analyzing pain, global improvement, and grip strength . However, there is no conclusive evidence that suggests that corticosteroid injections are effective in providing long - term improvement of pain . Therefore, a corticosteroid injection is best used for short - term pain relief or in those with debilitating symptoms . Botulinum toxin injections have also been, used but given that these injections can have the side effect of causing digit paresis and weakness of finger extension, this should not be first - line injectable treatment . In a double - blind, placebo - controlled, randomized controlled trial of patients with symptoms lasting longer than three months, patients had a reduction of pain (as reported by a pain vas, the main outcome measure) in the group receiving botulinum toxin compared to those receiving a saline injection . However, the botulinum toxin group still had pain at 4 and 12 weeks follow - up and were not pain - free . Some authors suggest that if botulinum toxin is going to be used it should be used only on those patients with symptoms for more than 1 year . More recently, research has been done on the efficacy of autologous blood injections around the lateral epicondyle . While there was no control group in this study, some of the patients who had received multiple corticosteroid injections still responded favorably to the treatment . It was postulated that introducing blood to the injured area would provoke the inflammatory cascade and restart the healing process . Those who do not respond to a focused, supervised, and intense course of several weeks of conservative care, and continue to have debilitating pain, may be considered to have failed nonoperative management . Surgery may be needed for these individuals, though some suggest waiting at least one year before considering this . When extensive conservative measures have been pursued, but are unsuccessful, then surgery is considered to alleviate pain and improve function . While there are multiple surgical treatments, the goal is to remove all the abnormal tissues and release any of the residual tension on the remaining extensor wad . Options include open surgery, arthroscopic lateral release, and percutaneous treatment to debride the gray, friable, angiofibrotic tissue . While one review reported that studies have had excellent outcomes in those with lateral epicondylitis, a cochrane database systematic review did not identify any controlled trials investigating the effect of surgery on tennis elbow pain . Nonoperative treatment is generally effective and includes ice, nonsteroidal anti - inflammatory drugs (nsaids), bracing (e.g., with a forearm strap), activity modification, physical therapy, and injections . Patients often try rest, ice, modified activity, a forearm strap, or nsaids before seeking care, but these may provide only short - term relief . Given that the pathologic process is usually not inflammatory, the use of nsaids only provides relief of pain . Studies using nsaids to treat individuals who have a tendinopathy show minimal, if any improvement of pain . Animal and in vitro studies have not generated consistent data to suggest that nsaids are appropriate or beneficial in tendinopathy . While icing may be recommended, a recent pilot study showed that a 4-week physical therapy exercise program was effective in decreasing pain in lateral epicondylitis, regardless of whether or not ice was used . While multiple meta - analyses have been done to evaluate the effectiveness of physical interventions on proximal wrist extensor tendinopathy, the most recent is by bisset et al . . In this meta - analysis, the diagnosis of tennis elbow or lateral epicondylitis was given to those with lateral elbow pain that increased on palpation and/or had reproduction of pain on resisted wrist extension . While 74 randomized controlled trials with physical interventions for lateral epicondylitis were identified, based on those studies that were included, it was found that manipulation techniques (including cross - friction massage), exercise, and acupuncture provided significant short - term relief . Studies that evaluated the efficacy of orthoses (including a forearm strap), taping, laser therapy, extracorporeal shock wave therapy, electromagnetic field and ionization, ultrasound, and phonophoresis either did not demonstrate a significant effect or showed an inconsistent effect on outcomes . However, given the small number of studies that met criteria for evaluation, more studies may be needed to determine the efficacy of physical interventions for this condition . Only one study that involved exercise therapy in the meta - analysis met criteria to be evaluated, whereas all the other physical interventions had two or more studies that met criteria . A recent review on the effectiveness of eccentric exercise on chronic tendinopathy, including patellar and achilles tendinopathy, found three studies on lateral epicondylitis that met criteria for evaluation . Of the studies evaluated, there is conflicting evidence on the effect of eccentric training on outcomes . One investigator, alfredson, has done multiple studies on tendinopathy has evaluated the efficacy of eccentric training on achilles tendinopathy, and did so while encouraging reproduction of the tendon pain during the therapy sessions . A goal of reproducing patients pain during rehabilitative exercise is a paradigm shift in the treatment of musculoskeletal disorders, since, often patients pain symptoms are avoided or minimized during exercise sessions . While achilles tendinopathy appears to have a similar histologic picture as proximal wrist extensor tendinopathy, the function of the achilles tendon is much different, so comparing treatments for these two conditions may be limited . Studies done to evaluate the effectiveness of eccentric strength training demonstrate that it can take weeks to be completely effective . Further research will clarify the exact role of exercise therapy and determine the specific exercises that help those with proximal wrist extensor tendinopathy . Injections should be considered in patients if above interventions have not provided relief, or in those whose pain on presentation is more inflammatory or debilitating . The most common injection performed is a corticosteroid injection, which is injected at the maximal site of tenderness . A recent review on the effectiveness of corticosteroid injections on lateral epicondylitis showed that a corticosteroid injection is more effective in the short - term (less than 6 weeks) compared to placebo, local anesthetic, and conservative treatments when analyzing pain, global improvement, and grip strength . However, there is no conclusive evidence that suggests that corticosteroid injections are effective in providing long - term improvement of pain . Therefore, a corticosteroid injection is best used for short - term pain relief or in those with debilitating symptoms . Botulinum toxin injections have also been, used but given that these injections can have the side effect of causing digit paresis and weakness of finger extension, this should not be first - line injectable treatment . In a double - blind, placebo - controlled, randomized controlled trial of patients with symptoms lasting longer than three months, patients had a reduction of pain (as reported by a pain vas, the main outcome measure) in the group receiving botulinum toxin compared to those receiving a saline injection . However, the botulinum toxin group still had pain at 4 and 12 weeks follow - up and were not pain - free . Some authors suggest that if botulinum toxin is going to be used it should be used only on those patients with symptoms for more than 1 year . More recently, research has been done on the efficacy of autologous blood injections around the lateral epicondyle . While there was no control group in this study, some of the patients who had received multiple corticosteroid injections still responded favorably to the treatment . It was postulated that introducing blood to the injured area would provoke the inflammatory cascade and restart the healing process . Those who do not respond to a focused, supervised, and intense course of several weeks of conservative care, and continue to have debilitating pain, may be considered to have failed nonoperative management . Surgery may be needed for these individuals, though some suggest waiting at least one year before considering this . When extensive conservative measures have been pursued, but are unsuccessful, then surgery is considered to alleviate pain and improve function . While there are multiple surgical treatments, the goal is to remove all the abnormal tissues and release any of the residual tension on the remaining extensor wad . Options include open surgery, arthroscopic lateral release, and percutaneous treatment to debride the gray, friable, angiofibrotic tissue . While one review reported that studies have had excellent outcomes in those with lateral epicondylitis, a cochrane database systematic review did not identify any controlled trials investigating the effect of surgery on tennis elbow pain . Once someone is diagnosed with proximal wrist extensor tendinopathy, then it is reasonable to modify the patient s activity and pursue physical therapy with eccentric wrist strengthening exercises, wrist extensor stretches, and cross - friction massage . In an athlete or someone with a job position that requires repetitive use of the hands, a proximal forearm strap may be useful to attenuate the symptoms, while allowing patients to continue with their daily activities . The strap is applied circumferentially around the proximal forearm and attempts to offload the injured area of the tendon . As part of physical therapy if the patient is an athlete, then physical therapy should address any deficits that could lead to overloading the elbow, which would include evaluating the kinetic chain and the patient s form during sports play . If pain is severe, then an injection with corticosteroid is reasonable . While autologous blood injections or botulinum toxin injections are more controversial, either is reasonable if above measures fail or if the patient does not want surgery . Proximal wrist extensor tendinopathy is a condition that can be debilitating, but generally responds well to nonoperative care . While there is a dearth of randomized controlled trials, there is some evidence that manipulation techniques, exercise, acupuncture, and corticosteroids can provide relief . However, it is clear from recent meta - analyses and systematic reviews that more research is needed, with better methodology.
Traumatic brain injury (tbi) is the most frequent reason for neurosurgical consultation in the emergency room . Minor or mild tbi is common in elderly patients, many of whom are treated on anticoagulant . The common practice is to discharge these patients if computed tomography (ct) of the brain is normal . However, a small subgroup of these patients may experience a delayed intracranial bleeding2,4). Here, we describe a patient on anticoagulant therapy that developed an acute subdural haematoma (sdh) 48 hours after a mild head injury . Furthermore, this case report wishes to raise the awareness among emergency department physicians and neurosurgeons that treat elderly anticoagulated patients, for a possible delayed onset of intracranial haematoma, even if the initial assessment is normal . A 66-year - old male presented to the emergency department after a fall and a mild head trauma . The patient had a history of atrial fibrillation and was on acenocoumarol (sintrom). Initial ct scan of the brain was without any sign of intracranial hemorrhage or cranial fracture (fig . 1). The laboratory workup revealed an international normalized ratio (inr) of 2.5 . Forty - eight hours later the patient was transferred to the emergency room with a decreased level of consciousness and vomiting . On neurological examination he had a score of 9/15 on the glasgow coma scale (e2v2m5) and a dilated left pupil unresponsive to light . A ct scan of the brain revealed a large left acute sdh with midline shift (fig . The point of the haemorrhage was some bridging veins to the transverse sinus, which were promptly coagulated . Postoperatively, the left pupil became small and reactive and a ct scan demonstrated complete removal of sdh . The patient progressively improved and one month after the operation he was discharged for further physiotherapy (fig . This case is another example of the very low risk of delayed subdural haematoma after minor head injury in patients, who are treated with anticoagulants . Some reports of delayed haematomas after minor head injury in adults, with a negative initial ct scan, have already been described . However, the incidence has turned out to be extremely low (<0.02%). It is generally accepted that elderly tbi patients are at greater risk for clinically important brain injury . Furtherrmore, oral anticoagulation is associated with a significant risk of intracranial bleeding, even after a minor head trauma2,3). There have been previously five well - documented reports of delayed subdural haematoma after tbi2,5). The clinical and radiologic characteristics are summarized in table 1 . As it is shown in the above table more specifically, there were two deaths, two patients remained with severe and one with moderate disability, while one had a good recovery . One commonly discussed mechanism for the development of acute sdh is the rupture of bridging veins, which empty into the dural sinuses . As the veins cross the subdural space, they have little supporting structure, and are therefore more vulnerable to injury at this point . In elderly patients with cerebral atrophy, bridging veins are stretched and transverse a greater distance in the subdural space . Doherty suggests that rupture of these veins is the mechanism for delayed sdh in patients with trauma - induced hypotension and cerebral edema . In addition, there is a delayed tamponade effect since the atrophied brain is shrunken away from the inner table of the skull . In these patients with hypotension, matsuda et al.4) suggest, that inflammation or vasoparalysis resulting from local hypoxia after a head trauma may increase the permeability of the vessels and may form coalescent small perivascular haemorrhages . In this case, the patient had been straining to tighten a bolt of his football helmet when he suffered the acute subdural hemorrhage . This valsalva maneuver might have caused increased intracranial pressure, hypercapnia, and subsequent venous congestion, resulting in subdural hemorrhage because of a rupture of coalescent vessels . In our patient, it was found intraoperatively that the cause of the subdural hematoma was the tearing of some bridging veins to the transverse sinus . It is believed that these bridging veins were damaged by the primary injury and 48-hours later, a valsalva maneuver and a temporary increase of the icp could have caused the tearing of the bridging veins and the subsequent development of the haematoma . Therefore, an overnight observation period and a negative first ct scan do not entirely eliminate the possibility that the patient will later develop an intracranial haematoma . This possibility, according to the persisting literature, seems to be greater for the patients over the age of 65, who are under anticoagulant therapy . The nice guidelines6) state that it is safe to discharge the abovementioned patients if imaging is normal . However, as it was explained above, these patients may be then exposed to comparatively high risks of delayed deterioration . Currently, there are no specific guidelines regarding the anticoagulated patients with a negative initial ct scan4). One recent paper from menditto et al.5) also underlines the need for reevaluation of the current guidelines after a head injury on patients receiving anticoagulant therapy . They suggest a 24-hour observation period for all the patients under anticoagulants followed by a second ct scan . Both of them had an inr greater than 3.0 and age over 65 years old . Based on the current literature and on our experience we propose a modification of this protocol . We suggest all the patients receiving anticoagulants to be hospitalized for 24 hours followed by a second ct scan . For the subgroup of patients over the age of 65 and with an inr greater than 2.5, we suggest to extend the observation period to 48 hours followed by a ct scan . As long as we cannot prevent primary injuries, we should not fail to prevent fatal deterioration if at all possible . Our case report underlines the need, that physicians and neurosurgeons should maintain a high level of vigilance in anticoagulated patients, after a mild tbi, due to a possible delayed onset of intracranial haematoma, even if the initial assessment is normal . We recommend that all anticoagulated patients, who experience a head injury, should be hospitalized for a 24-hour neurological observation followed by a second ct scan . For the subgroup of patients over the age of 65 and with an inr greater than 2.5, we suggest to extend the observation period to 48 hours followed by a ct scan.
What happens to the transference of learning proper jump - landing technique in isolation when an individual is expected to perform at a competitive level yet tries to maintain proper jump - landing technique? This is the key question for researchers, physical therapists, athletic trainers and coaches involved in acl injury prevention in athletes . The need for acl injury prevention is clear, however, in spite of these ongoing initiatives and reported early successes, acl injury rates and the associated gender disparity have not diminished . One problem could be the difficulties with the measurements of injury rates and the difficulties with the implementation of thorough large scale injury prevention programs . A second issue could be the transition from conscious awareness during training sessions on technique in the laboratory to unexpected and automatic movements during a training or game involves complicated motor control adaptations . The purpose of this paper is to highlight the issue of motor learning in relation to acl injury prevention and to post suggestions for future research . Acl injury prevention programs addressing explicit rules regarding desired landing positions by emphasizing proper alignment of the hip, knee, and ankle are reported in the literature . This may very well be a sensible way, but the use of explicit strategies may be less suitable for the acquisition of the control of complex motor skills (maxwell et al . Acl injury prevention training strategies mainly focussing on warm - up, technique, balance, strengthening, and agility exercises have continued to evolve and represent an ever - increasing and equally important research focus [12, 14, 2123, 29, 30, 40, 42, 43, 48, 53, 65]. Recent epidemiological data, however, suggest that in spite of these ongoing initiatives and reported early successes, acl injury rates and the associated gender disparity have not diminished . The disparity between positive laboratory results and actual effects on injury outcomes suggests a missing link between current research outcomes and clinical applications for neuromuscular training interventions . One problem could be the difficulties with the measurements of injury rates and the difficulties with the implementation of thorough large - scale injury prevention programs . It is difficult to evaluate whether the preventive measure had any effect at all when we know very little about whether sports - active people have implemented or adopted information about preventive training or not . Another issue could be the fact that the transition from conscious awareness during training sessions to unexpected and automatic movements during a training or game involves complicated motor control adaptations . Post - intervention lower extremity positions and loading of the joint in the laboratory do not necessary reflect those on the field . The purpose of this paper is therefore to highlight the issue of motor learning in relation to acl injury prevention and to post suggestions for future research . Instructions can be effective in conveying goal - related information and educators commonly use them to teach and refine motor performance at all levels of skill . There are acl injury prevention programs using instructions and addressing explicit rules regarding desired landing positions by emphasizing proper alignment of the hip, knee, and ankle [22, 23, 26, 28, 30, 40, 41, 43, 46, 48, 5153]. For example, the main goal of the neuromuscular training program of holm et al . Was to improve awareness and knee control during standing, cutting, jumping, and landing. The players were encouraged to focus on the quality of their movements with emphasis on the knee - over - toe position . This may very well be a sensible way, but the use of explicit strategies may be less suitable for the acquisition of the control of complex motor skills . It has been shown that instructions that direct performers attention to his or her own movements can actually have a detrimental effect on performance and learning and disrupt the execution of automatic skills, particularly in comparison with an externally directed attentional focus [33, 37, 6769]. We want to emphasize that we need to make sure that a better landing technique after a jump happens automatically . Therefore, pre - programming with automatization with transfer for laboratory to field is most important . The exact reasons for the beneficial effects of an external focus of attention are still relatively unclear . However, trying to consciously control one s movements might interfere with the normal, automatic motor control processes, leading to a breakdown in the natural coordination of the movement [32, 37]. The performance and learning of motor skills has been shown to be enhanced if the performer adopts an external focus of attention (focus on the movement effect) compared to an internal focus (focus on the movements themselves). In other words, implicit motor learning refers to the acquisition of a motor skill without the concurrent acquisition of explicit knowledge about the performance of a skill that is normally processed in an automatic way, explicit motor learning does refer to acquiring motor skills with an internal focus and specific knowledge about the performance of a skill . Motor skills that are acquired explicitly tend to be less resilient under psychological [7, 18, 19, 32, 39] and physiological fatigue [31, 54], tend to interfere with the normal automatic processing of the motor schema [20, 32], tend to be less durable and less robust when a fast response is required and explicit learning may be affected to a greater extent by an individual s intelligence than implicit learning [17, 45, 57]. Considering the benefits of implicit learning, we feel that in the prevention of acl injuries, we need to discover the possibilities of this method as it may produce more stable solutions under stress, anxiety - provoking conditions and fatigued states . The research group mcnair, onate and prapavessis set up an interesting series of research projects, in which they examined the effect of different types of feedback on jump landing technique and subsequent landing forces [36, 49, 50, 55, 56]. They have compared technical instructions, visual feedback, auditory cues, and metaphoric imagery to controls . They first found that subjects can assimilate precise instructions related to the modification of lower limb kinematics and effectively and immediately lowered their ground reaction forces (grf) [36, 50, 55]. However, in 2003 prapavessis et al . Found that the retention of these technical instructions is poor when the follow up is longer than 1 week . Continuing this research, onate et al . Concluded in 2005 that reviewing one s own performance or one s own performance plus an expert model is more useful than expert only modeling (i.e., viewing an expert model trained in proper landing technique) for increasing knee angular displacement flexion angles and reducing peak vertical grf during landing . They therefore suggested that visual feedback of one s own performance or one s own performance plus an expert model should be used in the implementation of instructional programs aimed at reducing the risk of jump - landing acl injuries . Currently, we do not know yet at what age an injury prevention program should be implemented to reduce potential neuromuscular and biomechanical risk factors . From a motor learning standpoint, it is desirable that children at the youngest age groups (age 612) develop correct playing techniques from the beginning on . However, children are at a relative low risk for injury, e.g., soccer is actually a safe sport for children . It seems therefore that spending effort, time, and money on implementing preventive methods might therefore not be desirable and should potentially start from 12 to 14 years . But without calling it injury prevention (but e.g., exercises for performance enhancement) in the younger age groups, enhanced body awareness will very likely already start and result in a more complete and accurate feeling of the body when learning certain movement skills . The use of an explicit process is less efficient, attention - demanding, and slow . Having to pay attention to the lower extremity is impossible as attention to the game, players and ball and fast acting is required . A high - cognitive task will be less robust during the game . In the acl injury enigma, psychological and physiological pressure or fatigue reported that athletes are at a higher risk of suffering an acl injury during a game than during practice . Fatigue has also been proposed to be a contributor to non - contact acl injuries [24, 47, 61]. For obvious reasons, a game constitutes more psychological and physiological stress compared to a practice session . Especially in later stages of competition, fatigue may have a cumulative, unfavorable effect on neuromuscular control and may potentially result in hazardous movement strategies . The decreased capacity for controlling body movements after fatigue will potentially be more prominent when appropriate landing techniques have been taught in an explicit manner . Also, the possibility that implicit learning may immunize the athlete more against the often debilitating influence of psychological stress on motor output should not go unheeded . In summary, extensively repeating the ideal movement that is explained and demonstrated might be too cognitive. As implicit learning has proven to be effective in establishing a certain movement goal or effect [37, 62, 6769], we assume and propose that implicit motor learning might also be potentially beneficial for injury prevention . Lowering chances of injury during a high performance task is an integrated part of that task itself . This implies that not only the interaction with the environment can be optimized but also the conditions within the body in terms of balance of joint loads for instance . This optimization could be achieved by assisting the athletes to find individual optimal performance patterns for given complex motor skills and to find an individual way, including its effective variations, to control the forces that belong to those complex tasks . In this paper, we would like to put forward that implicit learning could well be an effective way to let the brain and body of the athlete reach a condition in which performance is high, yet the chances of injury low . Implicit, observational learning, where imitation of what is shown plays an important role, might be a good alternative in trying to reduce the acl injury incidence . A fundamental question with imitation is: how does the observer s motor system know which muscle activations will lead to the observed movement if the observer does not see the underlying muscle activation in the actor? . It has been suggested that the mirror neurons resolve this correspondence problem by automatically mapping observed movements onto a motor program, thus leading to the widely held view that the mirror neuron system is crucial for imitation and observational learning [9, 13, 27, 38, 5860]. Mirror neurons are visuomotor neurons that fire both when an action is performed and when a similar or identical action is passively observed . A template of the movement becomes active through the mirror neurons by which the movement itself becomes clear in terms of motor actions, without high cognitive reflections . Mirror neurons mediate understanding of action because neurons that represent an action are activated in the observer s premotor cortex . This automatically induced, motor representation of the observed action corresponds to that which is spontaneously generated during active action and whose outcome is known to the acting individual . An important functional aspect of mirror neurons is therefore their ability to link visual and motor properties . It is interesting to note that the amount of mirror neuron activation correlates positively when the athletes are already proficient in performing that skill . An additional prospective study showed that dancers who were initially naive to certain steps showed an increase in mirror activation over time when they received motor training in which they became skillful in performing the same steps . The previously mentioned studies [36, 49, 50, 55, 56] offer a direction for the development of a method of acl injury prevention, based on implicit learning . They indicate that the solution to injury prevention is hidden in the brains of the subjects themselves . Since every brain and every body is different, the optimal solutions are also different . Future research should provide more detailed information on the way these solutions are linked to certain types of body architecture and motor control capacities . The results support the need for individualized visual augmented feedback using a self model to enhance jump - landing instruction and substantiates that this works best in the motor learning process . The ability for individuals to view themselves performing correctly or making mistakes and responding to the corrections is of greater value to individuals than is viewing an expert model performing the task correctly . One theoretical approach is that learning is a problem - solving process; the more involved the individual is in analyzing his or her own performance, the greater the learning value [1, 63]. With implicit learning the position of the knee will be part of the position of the whole body . The subject will explore and then select the solution that fits best in their body . Preventive studies we have referred to in this article mostly contain exercises that improve performance and reduce injuries by improving strengthening and conditioning . From these investigations, we have learned that acl injuries can be prevented by a combination of balance / coordination, strength, plyometric and agility exercises [3, 4]. Immediate feedback of someone s own performance is an area which is still relatively unexplored and can aid in achieving long term results . For laboratory studies, one s performance could be recorded with a high - speed camera from a posterior view (in order to give the right perspective to the athlete). When using infrared camera s and a force plate, 3d load at the knee can be calculated through inverse dynamics and the best performance so far can be presented to the subject without any explicit instructions on the lower extremity position . For on - field training, a simple camera could be used and with user - friendly software, the athlete s own performances could be reviewed and improved . The transition from conscious awareness during technique training sessions to unexpected and automatic movements during a training or game involves complicated motor control elements that might not fit in explicit learning strategies . Future acl intervention programs may need to provide individualized visual instructional review of jump - landing technique to allow individuals to view how they personally perform the movement task and actively problem solve (by evaluating the mistakes and corrections of their trials) to develop techniques, and find individual ways to achieve those techniques, to obtain proper jump - landing . There is a need for further development of the learning model of visual demonstration and real time feedback . At any rate, the effects of attentional focus on motor performance not only provide interesting insights into the effectiveness of automatic control capabilities of the motor system, but they also have important implications for performance improvements in applied settings.
A 74-year - old man with diabetes mellitus (dm), hypertension (htn), and atrial fibrillation (af) presented to the emergency room with sudden onset of left leg pain due to superficial femoral artery (sfa) thrombosis . Soon after arrival, he was scheduled to undergo emergency thrombectomy . He had been receiving metformin (850 mg / day) for dm, olmesartan (40 mg / day) for htn, and warfarin (3 mg / day) and digoxin (0.25 mg / day) for af . In the preoperative evaluation, chest radiography showed cardiomegaly, while electrocardiogram showed the presence of atrial fibrillation . Prothrombin time (pt) and international normalized ratio (inr) were within the normal range (pt, 10.5 sec; inr, 0.92), even though the patient was on warfarin therapy . A central venous catheter (cvc, 7-fr double lumen catheter) was inserted via the left subclavian vein using the landmark technique under general anesthesia . In the first attempt, the needle was passaged twice without aspiration of blood . In the second attempt, after positioning the needle tip, blood was successfully aspirated through the needle in the third passage to confirm its location, followed by successful insertion of the cvc . Subsequently, 5,000 u of heparin was administered 5 minutes before incision of the femoral artery for thrombectomy . The thrombectomy was performed uneventfully with an operative time of 90 minutes . The arterial blood gas analysis (abga) during surgery showed the following: ph, 7.337; paco2, 43.4 mmhg; pao2, 112 mmhg; and oxygen saturation, 98% . The estimated blood loss and urine output were approximately 100 ml and 300 ml, respectively . The patient was then transferred to intensive care unit (icu) for close monitoring . Postoperatively, continuous infusion of heparin (1,000 u / hr) via cvc was maintained . The infusion rate was adjusted under the activated partial thromboplastin time of 80 - 120 sec . A portable chest radiograph showed proper position of the cvc in the superior vena cava and no interval changes (fig . Consequently, cvc was removed and compressed for 30 minutes . At 15 hr postoperation, when the patient's hemodynamic values were stable and the dorsalis pedis artery was palpable, he was transferred to the general ward . On the first postoperative day (pod), the patient was started on warfarin (4 mg / day). A chest radiograph at this point showed no remarkable findings except a slightly increased opacity in the left anterior chest wall (fig . However, 10 mg of furosemide was administered when the urine output decreased, even though the fluid intake was adequate . On pod 2, the patient experienced syncope on his way to bathroom, possibly due to orthostatic hypotension . His vital signs were as follows: blood pressure (bp), 80/50 mmhg; heart rate (hr), 142 bpm; and spo2, 85% . Subsequently, the patient was transferred to the icu and a diagnostic workup was performed . The abga revealed severe metabolic acidosis (ph, 6.93; paco2, 28 mmhg; pao2, 164 mmhg; hco3, 5.9 mm; oxygen saturation, 98%), and the patient received 15 l / min oxygen via a reservoir mask . His hb level decreased from 14.3 g / dl to 9.6 g / dl . After transferring him to the icu, volume resuscitation was initiated with normal saline and packed red blood cells (rbcs). However, inotropes were not administered to the patient, because his bp increased to 90/50 mmhg after volume resuscitation . His hemodynamic values returned to normal with fluid therapy (4,300 ml of normal saline) and transfusion (3 units of packed rbc). A computed tomography (ct) revealed a huge hematoma between the pectoralis major and minor muscles on the left chest wall (fig . However, an angiogram showed no detectable extravasations from the branches of the left subclavian artery . Laboratory tests revealed multiple organ dysfunction syndrome including respiratory failure, ischemic hepatitis, and acute kidney injury due to hemorrhagic shock . The levels of serum aspartate aminotransferase (ast), alanine aminotransferase (alt), lactate dehydrogenase (ldh), and creatinine (cr) were remarkably elevated: ast, 2,800 iu / l; alt, 2,100 iu / l; ldh, 6,000 iu / l; cr, 3.40 mg / dl . Continuous renal replacement therapy (crrt) was started on pod 2, and tracheal intubation was performed on pod 3 when an ineffective breathing pattern was observed and the spo2 decreased to 90% . Mechanical ventilation was applied without any intervention to the hematoma, such as insertion of the wound, use of a suction tube, or surgical removal . The patient was extubated on pod 12, and crrt was stopped on pod 13 . The patient was transferred to the general ward on pod 20, and the hospital course was uneventful thereafter . Central venous catheterization can be life saving, but can also cause complications such as pneumothorax, inadvertent puncture or perforation of great vessels, air embolism, catheter malposition, infection, and thrombus formation . In this report, we describe a case of hemorrhagic shock caused by a huge hematoma after insertion of a cvc without apparent arterial puncture in a patient on anticoagulation therapy . Signs such as the decrease in urine output, orthostatic hypotension, compensatory increase of hr, and aggravation of af were associated with hypovolemia caused by hemorrhage, which was the cause of shock . However, we could not entirely rule out the possibility of obstructive shock due to the mass effect of the huge hematoma . Complication rates during central venous catheterization have been significantly associated with the number of needle passes . Successful catheterization at the first attempt limits the risk of immediate complications such as arterial puncture and pneumothorax, to less than 1% . In our case, however, we did not note any signs associated with complications, such as pulsatile flow or air bubbles, during the procedure . Similarly, there were no abnormal findings such as extravasations of subclavian artery on the angiogram . Nonetheless, we could not completely rule out the possibility of arterial puncture around the subclavian region, because ct showed that the chest wall was severely compressed by the huge hematoma . Furthermore, small swelling and oozing were also observed at the insertion site after surgery . Therefore, the possibility of arterial puncture influenced the treatment decision for the hematoma in our case . However, we did not use a suction device or surgical removal for hematoma management because we assumed that an undetectable vessel injury might have caused the hematoma, leading to compression of the chest wall . In addition, we believed that respiratory failure might result from multiorgan dysfunction syndrome caused by hemorrhagic shock, and not from compression of chest wall due to the huge hematoma . Therefore, to reduce the complications associated with insertion of a cvc, ultrasound - guided central venous catheterization is strongly recommended . It could result in an initial high success rate with fewer needle passage attempts, faster access, and a reduction in mechanical complications . Internal jugular vein (ijv) and subclavian vein (scv) catheterization have a similar overall risk of mechanical complications such as arterial puncture, hematoma, and pneumothorax . However, scv catheterization is more likely to be complicated by pneumothorax or hemothorax, whereas ijv catheterization is mostly associated with arterial puncture . In contrast, femoral vein (fv) catheterization has a higher incidence of mechanical complications than scv or ijv . The policy for central venous catheterization in our department advocates the scv approach, because it is associated with a lower infection rate and better compliance than other approaches . However, it is difficult to apply pressure around the scv as compared to the ijv or fv, which are easily compressible access sites that can be used when an arterial puncture or hematoma occurs . Therefore, the scv catheterization technique should be particularly avoided, especially for patients on anticoagulation therapy or with coagulation disorders . Arterial puncture, hematoma, and pneumothorax are the most common complications during central venous catheterization . The incidences of arterial puncture and hematoma are 3.1 - 4.9% and 1.2 - 2.1%, respectively, in patients undergoing central venous catheterization . This technique can lead to substantial morbidity, although these complications are usually self - limiting . Furthermore, other serious complications, including hemothorax requiring closed thoracostomy or hemorrhage requiring transfusion, show evident symptoms such as dyspnea and severe hypotension, and their progression is rapid; therefore, they are easily identified at the early stage . In our case, bleeding did not spread into the pleural space but between the pectoralis major and minor muscles in the left chest wall, and a huge hematoma was formed . In addition, the hematoma was too deep to cause an evident change in skin color or swelling, and the patient did not present any symptoms that could be considered serious complications . The abnormal finding of a small increased opacity in the left chest wall was dismissed as inconsequential, because the patient did not have any remarkable changes in hemodynamic values or laboratory findings . Anticoagulation therapy during the perioperative period might also have influenced the formation of a huge hematoma . Reported that hemorrhagic shock is associated with a huge hematoma after catheterization in patients with anticoagulant therapy . In our case, there was a minor association between warfarin therapy, which was administered preoperatively, and formation of the hematoma, as the value of pt (inr) was within the normal range . However, administration of heparin during the intraoperative and postoperative period might also be linked closely to the formation of a huge hematoma, especially if vessel injury occurs during insertion of cvc . In conclusion, it is often difficult to detect serious complication such as concealed hematoma after central venous catheterization . Therefore, when insertion of a cvc is performed in patients requiring anticoagulant therapy, the possibility of massive bleeding must be considered and particular attention must be given to the care of such patients . Additionally, it might be helpful to prevent complications by choosing a proper site of insertion and ultrasound - guided technique.
Igg4-related disease (igg4-rd) is an emerging fibro - inflammatory condition known to involve potentially every organ system in the body . In view of its recent recognition as a nosological entity, the approach to diagnosis, therefore, necessarily involves the exclusion of common infectious, neoplastic and inflammatory mimickers, principally through pathological evaluation of biopsy specimens . Histological features characteristic of igg4-rd are shared by seemingly unrelated organs and include storiform fibrosis, obliterative phlebitis, tissue eosinophilia, and a lymphoplasmacytic infiltrate in which the ratio of igg4- to igg - positive plasma cells generally exceeds 0.40 . Substantial overlap in the types of organ involvement and histopathological features occur in igg4-rd and vasculitides associated with antineutrophil cytoplasmic antibodies (anca), that is, granulomatosis with polyangiitis (gpa), microscopic polyangiitis (mpa), and eosinophilic granulomatosis with polyangiitis (egpa)collectively termed anca - associated vasculitis (aav). As examples, different forms of aav have predilections for affecting the orbital regions, sinuses, lungs, kidneys, meninges, and even the pituitary gland, all of which are known to be affected by igg4-rd, as well . Moreover, the aav can be associated with both peripheral and tissue eosinophilia, and aav rivals igg4-rd in its ability to cause igg4-positive plasma cell infiltration into involved organs . Elevation of serum igg4 concentrations has been considered a useful biomarker of igg4-rd, but broader experience in managing these patients has revealed the shortcomings of this measurement as a diagnostic tool . Conversely, a substantial proportion of patients with clinical presentations and organ biopsies consistent with igg4-rd have normal serum igg4 concentrations . In contrast, the finding of a positive anca assay for either the proteinase 3 (pr3) or myeloperoxidase (mpo) antigen is generally regarded as a highly specific finding in favor of an aav diagnosis . Recent reports, however, have raised the possibility that some patients with igg4-rd are anca positive, thus suggesting reconsideration of the role of anca in the diagnostic workup . In the present work, we describe a patient with concomitant biopsy - proven igg4-rd and gpa in whom we demonstrated anti - pr3 anca of the igg4 subclass . We also review the literature to provide tools for interpreting anca positivity in igg4-rd patients . To this purpose, we searched the entire pubmed and google scholar online databases for variable combinations of the following terms: anca, igg4, igg, igg4-related disease, granulomatosis with polyangiitis, and vasculitis . We then considered all the written - english reports of igg4-rd patients with evidence of a positive anca titer . Ethical approval was not necessary because all diagnostic and therapeutic procedures were performed in accordance with international guidelines for the management of gpa and igg4-rd . A 51-year - old nonatopic woman was referred to our outpatient clinic for swelling of the left lacrimal gland, left orbital pain radiating to the left side of her face, mild proptosis, and redness of the left eye (fig . 1a). She also complained of a mild discomfort in the infra - scapular region . Her medical history was significant for arterial hypertension, gastroesophageal reflux disease, and chronic bronchitis . Gadolinium - enhanced magnetic resonance imaging (mri) of the brain and orbits disclosed an enlarged left lacrimal gland surrounded by an inflammatory tissue in contiguity with the lateral and superior rectus muscles (fig . The inflammatory tissue showed intense 18f - fluorodeoxyglucose (18f - fdg) uptake on positron emission tomography / computed tomography (pet / ct) study (fig . 1e). Both the erythrocyte sedimentation rate (43 mm / h; normal <20) and total ige (1798 iu / ml; normal <100) were elevated, but the c - reactive protein and tests of renal, thyroid, and liver function were within normal range . An assay for antinuclear antibodies was positive in a titer of 1:160 (homogenous pattern) but assays for rheumatoid factor, antibodies to double - stranded dna, thyroperoxidase, and thyroglobulin were negative . Serum igg4 level was 253 mg / dl (normal <135 mg / dl). The preoperative chest radiograph, however, showed multiple oval lung lesions in the right lung, raising concern for the possibility of malignancy (fig . A chest ct scan confirmed 2 round - shaped nodules and 1 cavitary mass in the right lung, and revealed a paravertebral lesion on the right side of the t5 and t6 vertebrae (fig . All of these lesions demonstrated intense 18f - fdg uptake on pet / ct (fig . (c) a gadolinium enhanced magnetic resonance imaging showing left scleritis (arrowheads) and enlarged left lacrimal gland surrounded by an inflammatory tissue in contiguity with the lateral and superior rectum muscles (arrow). (e) 18f - fluorodeoxyglucose uptake in the left periorbital tissue on positron emission tomography scan . (b f) clinical and radiological remission 6 months after methylprednisolone pulses and rituximab (arrows). (a, d, g) thoracic ct scan and (b) chest radiograph showing right lung masses (arrows), 1 of them (g) with cavitation (arrowhead), all showing intense 18f - fdg uptake on pet / ct scan (e, g) (arrowheads). (h) thoracic ct scan revealing a right paravertebral mass with 18f - fdg uptake on pet / ct scan (arrowheads). Disappearance of lung masses 6 months after rituximab on radiograph (c) and pet / ct scan (f). 18f - fdg = 18f - fluorodeoxyglucose, pet / ct = positron emission tomography / computed tomography . Examination of the left lacrimal gland tissue revealed areas of storiform fibrosis with abundant igg4-positive plasma cells (igg4+/igg+ plasma cells ratio> 40%), consistent with the suspicion of igg4-related dacryoadenitis (fig . Neutrophilic infiltration, vasculitis, granulomatous inflammation, and necrosis were all not present in the lacrimal gland, examined in multiple sections . However, the lung tissue showed chronic granulomatous inflammation, leukocytoclastic vasculitis, and areas of geographic necrosis, features highly suggestive of gpa (fig . 4a the patient's serum tested positively for anca by both immunofluorescence (cytoplasmic anca pattern) and enzyme immunoassay, with specificity for pr3 (423 au; normal value <20 au). The anca appeared to consist of both the igg1 and igg4 subclasses (fig . 3a and b). In addition, the counts of circulating plasmablasts defined as cd19 + cd20cd27 + cd38 + bright cells on flow cytometry were dramatically increased (50,000 cells / ml; normal <635 cells / ml). The patient was started on prednisone (1 mg / kg) followed by 2 infusions of rituximab 1000 mg, administered 15 days apart . Immunofluorescence studies, flow cytometry analysis, and histological evaluation of the left lacrimal gland affected by igg4-related disease . (a and b) immunofluorescence assays performed on commercially available slides (nova lite ancakit / substrated slides inova diagnostic san diego, ca) demonstrates antineutrophil cytoplasmic antibodies of igg1 (a) and igg4 (b) subclass in the patient's serum (serum dilution 1:20; secondary anti - igg1 (mouse antihuman igg1-alexa fluor 488 conjugate thermofisher, st waltham, ma) and anti - igg4 (mouse antihuman igg4-fitc conjugate alpha diagnostics international, san antonio, tx) antibodies dilution 1:50 and 1:20, respectively). (c f) histological examination of the left lacrimal gland reveals areas of storiform fibrosis (c asterisks), and lymphoplasmocytic infiltrate (d arrows) without granulomas or vascultis . Immunohistochemistry for total igg (e) and igg4 (f) shows abundant igg4 positive plasma cells with an igg4/igg ratio> 40% . (g) circulating plasmablasts (cd19 + cd20cd27 + cd38bright cells) are expanded at disease onset and diminish following b cell depletion therapy with rituximab . Geographic necrosis (a arrowheads), granulomas (c circles) with giant cells (c arrows), and necrotizing vasculitis (e circle) with extravasation of red blood cells and neutrophils (e arrows). Immunohistochemistry (b, d, f) reveals igg4 positive plasma cells infiltrate in a, c, and e. six months later, the orbital and lung lesions had resolved . In particular, a whole body pet / ct scan showed normalization of the 18f - fdg uptake findings (figs . Follow - up ophthalmologic and orbital mri evaluations confirmed inactive scleritis and substantial regression of the orbital lesion, respectively (fig . Lung masses were no longer evident on either chest radiography or ct (fig . 2c). Laboratory and serological studies revealed normalization of the inflammatory markers and of the serum igg4 (67 mg / dl), normalization of the circulating plasmablast level (350 cells / ml) (fig . 3 g), a negative pr-3 anca assay, and marked reduction of serum ige levels (200 iu / ml). We identified 9 other reports of patients with igg4-rd and positive anca in the english literature (tables 1 and 2). Five cases had biopsy - proven igg4-rd and were included in our analysis (table 1). The remaining 4 cases, in whom igg4-rd was diagnosed presumptively (based on elevated serum igg4 levels and compatible organ involvement), are listed separately in table 2 but not discussed further, because they lacked histopathological investigation . Cases reported in the literature of patients with biopsy - proven igg4-rd and positive anca . The male to female ratio of biopsy - proven igg4-rd cases was 4:2, with a median age at diagnosis of 59 years (range 3873 years) (table 1). Organs involved by igg4-rd were the lacrimal glands and the periorbital tissue (2 cases each), the hypophysis, the mediastinum, the salivary glands, the meninges, the nose, and the paranasal sinuses (1 case each). Four out of 6 patients had also histological evidence of concomitant aav in other organs, namely neutrophilic abscesses, leukocytoclastic vasculitis, fibrinoid necrosis, granulomatous inflammation, and crescentic glomerulonephritis . Organ involvement of aav included the lung (3 cases), the skin and the kidney (2 cases each), and the peripheral nerves and the inner ear (1 case each). Biopsies of organs involved by aav were obtained in 4 cases and histology revealed leukocytoclastic vasculitis (3 cases), and granulomas and crescentic glomerulonephritis (1 case each). Among these 4 patients, 1 was diagnosed with egpa based on a history of long - standing asthma, multiple mononeuritis, peripheral blood eosinophilia, anca positivity with a specificity for mpo, and histological evidence of cutaneous leukocytoclastic vasculitis with abundant eosinophils . Two patients were diagnosed with aav in the absence of specific findings to diagnose gpa, mpa, or egpa definitively . The median c - reactive protein at diagnosis was 26.2 mg / dl (range 21167 mg / dl). The erythrocyte sedimentation rate, measured in 3 cases, ranged from normal to 100 mm / h . Serum igg4 concentration was increased in all 6 patients (median 298 mg / dl; range 143470 mg / dl). All patients also had positive anca, 3 with a specificity for mpo, 2 with pr-3 specificity, and 1 with unknown specificity . Early recurrence after steroid tapering or partial clinical responses, however, prompted the addition of second - line immunosuppressive agents in all 6 cases . Ohno et al and alexandraki et al, for instance, added azathioprine to oral prednisolone at disease relapse but did not observe any further benefit . Paulus at al achieved prompt clinical remission in a patient with scleritis and orbital myositis by combining methotrexate and intraocular triamcinolone to oral prednisone . In the case reported by hanioka et al, prednisolone led to a reduction of lacrimal gland swelling, but peripheral neuropathy improved only with intravenous immunoglobulins and methyprednisolone pulses . Similarly, intravenous cyclophosphamide and methylprednisolone pulses were required in addition to oral prednisone in order to prevent renal failure in a patient with rapidly progressive glomerulonephritis . Our results indicate that patients with biopsy - proven igg4-rd can also have positive anca with specificity for either mpo or pr3, with or without the concomitant presence of an overt aav . This finding is supported by a growing body of literature and suggests caution in the interpretation of anca positivity, a finding traditionally viewed as highly specific for aav if confirmed by both immunofluorescence and enzyme immunoassay . This process is based, first, upon the confirmation of mpo or pr3 specificity through either elisa or chemiluminescent assays . The specificity of immunofluorescence for anca testing is suboptimal, as immunofluorescence assays are associated with positive results in a number of conditions other than small vessel vasculitides . Most anca target antigens other than mpo or pr3; that is, they target an array of granulocyte or monocyte granule components and often have multiple or unknown specificities . Once confirmation by enzyme immunoassay or chemiluminescence is obtained; however, a positive anca result in and of itself is not diagnostic of aav but rather requires clinical - pathological correlation and histological confirmation . The case we describe here is emblematic in this sense because, based on the sole assumption that pulmonary pseudo - tumors are well - described manifestations of igg4-rd, the histological evidence of igg4-related dacryoadenitis appeared sufficient for diagnostic purposes and did not require confirmation with a lung biopsy . Because cavitary lesions are not typical of igg4-rd, however, we proceeded to lung biopsy, which ultimately led to the concomitant diagnosis of aav . The fact of a paravertebral thoracic mass in our patient further complicated the differential diagnosis, as it is an atypical manifestation of either gpa or igg4-rd . In summary, the finding of a positive anca even with a specificity for pr3should not lead to premature closure of the diagnostic evaluation, particularly if the pattern of organ involvement is not strictly typical of aav . In our patient, as described in our aggregate analysis, this was actually the case of 3 patients with biopsy - proven igg4-rd and positive anca who developed clinical manifestations of aav shortly after the diagnosis . Indeed, both mpo- and pr3-anca of patients with aav have been previously shown to induce respiratory burst, calcium flux, and degranulation of neutrophils, thus directly contributing to the pathophysiology of aav . Igg4 anca are known to elicit the vigorous generation of reactive oxygen species in vitro, comparable to those elicited by igg3 anca, and greater than those induced by igg1 anca . The anca in aav are most often igg1 and igg4a finding that we confirmed in our patient . It is therefore tempting to speculate that the prominent igg1 and igg4 production that is characteristic of igg4-rd might foster the development of aav in some patients with an appropriate genetic background . Indeed, the abundant igg4 positive plasma cell infiltrate that we found in gpa lesions may further support this hypothesis . Igg4-rd in patients with positive anca was limited to the head and neck, and did not involve other commonly affected organs, such as the lung, the pancreas, the biliary tree, and the retroperitoneum . In contrast, aav in patients with established igg4-rd presented with systemic manifestations beyond the ear / nose / throat region, consistent with the notion of that anca positivity is more common in the former clinical setting than in the latter . These observations suggest that patients with igg4-rd and positive anca might be more at risk of developing a systemic form of aav . Indeed, head and neck manifestations of igg4-rd are typically anca negative raising the possibility that anca in these patients might sustain an underlying vasculitic process rather than being primarily linked to igg4-rd . Additional cases and a longer follow - up are needed in order to confirm this hypothesis . Table 2 describes the clinical characteristics of 4 additional patients with positive anca and a diagnosis of possible igg4-rd with meningeal (3 cases) and retroperitoneal (1 case) involvement . Anca specificity was confirmed by elisa in all 4 patients, but no diagnostic procedures were performed in these patients . For these reasons, despite serum igg4 increase, we did not include these cases in our aggregate analysis . However, as opposite to pachymeningeal involvement, which might occurs in up to 60% of patients with gpa, retroperitoneal fibrosis is an uncommon manifestation of aav . Therefore, while those cases of anca positive pachymeningitis are more likely patients with gpa, anca positive retroperitoneal fibrosis with elevated serum igg4 could represent a case of igg4-rd . Patients with positive anca and retroperitoneal fibrosis, indeed, have been already reported in the literature, raising the possibility of a novel immune - mediated condition associated with retroperitoneal inflammation . Histological findings of the retroperitoneal tissue, however, have not been reported in these case series, thus making impossible to drive definitive conclusions . In conclusion, the present work demonstrates that anca positivity in patients with biopsy - proven igg4-rd should prompt the exclusion of a concomitant vasculitic process . In addition, a positive anca does not exclude the diagnosis of igg4-rd absolutely, particularly in cases with head and neck involvement that is characteristic of igg4-rd . The hypothesis that anca might predict the development of aav in patients with igg4-rd deserves larger case series with a longer follow - up . Confirmation through immunoenzymatic assays of the anca specificity, clinical - pathological correlation, and histopathological evaluation remain crucial steps for the differential diagnosis between aav and igg4-rd . The authors thank dr raffaella milani (immunohematology and transfusion medicine unit, irccs san raffaele scientific institute) for performing flow cytometry studies.
Alzheimer's disease (ad) is an irreversible, progressive brain disorder slowly destroying learning and memory skills . The histopathology of ad is characterized by two hallmark lesions, extracellular amyloid- (a) plaques, and intracellular neurofibrillary tangles (nfts) composed of hyperphosphorylated tau protein . In addition to the presence of a plaques and nfts in the brain, considerable neuron loss is also a prominent feature of ad, the mechanisms of which still remain unclear . Importantly, familial ad (fad) mutations in genes for amyloid- precursor protein (app), presenilin 1 (psen1), and presenilin 2 (psen2) implicate a as an initiating factor in ad pathogenesis . These fad mutations increase the release of a42 from app, the latter being sequentially cleaved by the - and -secretase enzymes to release the a. the latter plays a central role in the pathophysiology of ad and ultimately leads to neuronal cell loss, for example, in the septum, entorhinal cortex, and hippocampus [1, 2], and finally to dementia [3, 4]. Transgenic mouse models have proven to be valuable tools in investigating the etiopathogenesis of ad [511]. Studies on various ad mouse models revealed dysregulation of the -site app cleaving enzyme 1 (bace1) that is responsible for the generation of a plaques [1214]. Therefore, increased translation of bace1 leads to enhanced plaque formation and finally to a disruption of neuronal functioning within the hippocampus [15, 16]. Among different ad models, the 5xfad model is a most progressive and growth retarded model expressing multiple fad mutations that additively increase a42 production, that is, three human app mutations (swedish mutations, k670n, m671l; florida mutation, i716v; london mutation, v717i) and two mutant psen1 (m146l, l286v). Individually, each fad mutation enhances a42 generation, but together they act synergistically to predominantly accumulate a42 . Thus, 5xfad mice already exhibit intraneuronal a accumulation at 1.5 months, a deposition at 2 months, and memory deficits at 4 months of age [15, 1720]. Furthermore, the 5xfad model is one of a few known mouse models that exhibit significant neuronal loss in the hippocampus that correlates with accumulation of a plaques [15, 21, 22]. However, in the cortex of 12-month - old 5xfad mice, neuronal cell loss was reported to be predominately related to layer 5 [15, 23]; the overall number of neurons in the frontal cortex and hippocampal ca1 region remained unchanged compared with age - matched wild - type (wt) mice . Thus, cortical plasticity is likely to be impaired prior to hippocampal - dependent learning and memory deficits in 5xfad mice . It is noteworthy that 12-month - old 5xfad mice were also reported to exhibit less anxiety, but normal locomotor behavior . Intense efforts were carried out to characterize the transcription and expression profile in 5xfad mice compared to wt . Using quantitative mass spectrometry to investigate proteome - wide changes in 4-month - old 5xfad mice, alterations were predominantly identified in apoe, apoj (clusterin), and nicastrin expression . Furthermore, various neurological glial marker proteins and factors implicated in neurological disorders such as ad, parkinson's disease, huntington's disease, and amyotrophic lateral sclerosis were affected . Transcriptome analysis has also been carried out for the frontal cortex and cerebellum of 7-week - old 5xfad mice . Although neuropathological changes in ad have been well described previously, currently, the impact of brain oscillation analysis as a novel tool in early diagnosis and prediction of disease progression is strongly discussed as functional impairments in ad can occur even without any significant neuronal loss and therefore could be independent of plaque formation [2731]. Recent studies illustrated that altered hippocampal oscillatory activity correlates with an increase of a level and the appearance of plaques [1, 32, 33], but slight changes in hippocampal and cortical network activity can also occur much earlier prior to clinical onset of ad [2931, 34, 35]. Alterations in network activities in ad are accompanied by an early imbalance of excitation and inhibition that elites overall changes in theta activity as a hallmark of hippocampal functioning [1, 20, 36]. These alterations due to a-induced neuronal hyperexcitability are accompanied by decreased gabaergic transmission within the hippocampus and can trigger seizure activity [3744]. Neurons being early affected in ad pathogenesis are those of the septohippocampal circuitry, including cholinergic, gabaergic, and glutamatergic cells [4553]. Interestingly, various mouse models of ad exhibit antithetic alterations in theta rhythmicity; that is, a number of them were reported to present cognitive decline associated with a paradoxical increase in theta activity [27, 5457] whereas others displayed reduced theta rhythm . Though recent studies have gained substantial insight into the etiopathogenesis of ad, we are still lacking detailed information about how septohippocampal dysfunction results in altered theta rhythmicity and neuronal hyperexcitability activity in ad . In this study we combined seizure analysis, time - frequency - based theta analysis, and transcriptome data to elicit systemic cortical and hippocampal network alterations in the 5xfad model of ad . This study was performed in tg(appswfllon, psen1m146ll286v) 6799vas (5xfad) transgenic mice with a b6/sjl background overexpressing mutant forms of human app (the swedish mutations: k670n, m671l; the florida mutation: i716v; the london mutation: v717i) and mutant psen1 (m146l, l286v). The 5xfad mice were obtained from the jackson laboratory (jax mice strains, usa). Five wt controls (body weight: 35.32 2.40 g, age: 66.71 7.88 weeks, 4, 1) and five 5xfad mice (body weight: 24.89 1.40 g, age: 72.20 2.77 weeks, all) were analyzed in this study . All mice were housed in groups of 3 - 4 in clear makrolon cages type ii with ad libitum access to drinking water and standard food pellets . Using ventilated cabinets (model 9av125p, tecniplast, germany), mice were maintained at a temperature of 21 2c, 5060% relative humidity, and on a conventional 12 h light / dark cycle with the light cycle beginning at 5:00 a.m. for spontaneous epidural and deep, intracerebral eeg recordings . All animal procedures were performed according to the guidelines of the german council on animal care and all protocols were approved by the local institutional and national committee on animal care (landesamt fr natur, umwelt und verbraucherschutz, lanuv, germany). The authors further certify that all animal experimentation was carried out in accordance with the european communities council directive of november 24, 1986 (86/609/eec). Mice were anesthetized using ketamine / xylazine (100/10 mg / kg i.p .) And the radiotelemetry transmitter (tl11 m2-f20-eet 2-channel transmitter, data science international (dsi); specifications: weight 3.9 g, volume 1.9 cc, input voltage range 1.25 mv, and channel bandwidth 150 hz) was implanted into a subcutaneous pouch on the back of the animals . The eeg electrodes of both transmitter channels were stereotaxically positioned using a computerized 3d stereotaxic stereodrive (neurostar, germany). The differential epidural electrode of channel 1 targeting the primary motor cortex (m1) was positioned at the following coordinates referring to the bregma craniometric landmark: (+) -lead, cranial + 1 mm, and lateral of bregma 1.5 mm (left hemisphere). For deep, intracerebral brain recordings targeting the hippocampal ca1 region the differential electrode of channel 2 was positioned as follows: (+) -lead, caudal 2 mm, lateral of bregma 1.5 mm (right hemisphere), and dorsoventral (depth) 1.5 mm . For both channels, epidural reference electrodes were placed on the cerebellar cortex at bregma 6 mm, lateral of bregma 1 mm (left hemisphere), and bregma 6 mm, lateral of bregma 1 mm (right hemisphere), respectively (see supplementary figure 1 of the supplementary material available online at http://dx.doi.org/10.1155/2015/781731). Electrodes were fixed using glass ionomer cement (kent express, uk) and the scalp was closed using over and over sutures (ethilon, 60). To avoid hypothermia, supplemental warmth for postoperative pain management animals were administered carprofen (5 mg / kg sc ., this recovery period is based on the observation that 10 days after surgery no difference in physiological parameters between transmitter implanted, nonimplanted, and sham - operated animals could be detected . Seven controls and six 5xfad mice were originally implanted . To verify the correct electrode placement targeting the ca1 region, brains afterwards, brains were cut to 60 m slices using a vibroslice tissue cutter ems 5000-mz (campden instruments limited) and hematoxylin - stained for visualization of the branch canal . Two controls and one 5xfad mouse did not meet strict eeg electrode placement criteria and were thus excluded from the analysis . Ten days after radiotransmitter implantation, simultaneous video - eeg recordings from the motor cortex (m1) and the hippocampal ca1 region were performed for 48 h in all animals from both study groups using dataquest art 4.2 software (dsi) at a sampling rate of 500 hz with no a priori filter cut - off . For further analysis data spike parameters including dynamic and absolute threshold, spike duration, and spike intervals were adapted for different seizure protocols . Dynamic thresholds were based on multiplication of the root mean square (rms) values of the eeg signals one minute prior to eeg segments being analyzed . The threshold ratio (minimum threshold) was defined as 2 while the maximum ratio was defined as 15 . The minimum amplitude value of spikes was 100 v for the dynamic range . In case of the absolute threshold the maximum amplitude was fixed at 1000 v with a threshold value of 200 v . In both seizure protocols the minimum spike duration was determined at 1 ms and the maximum spike and short / slow - wave duration at 100 ms . Spike trains were detected with a minimum train duration of 0.5 s including at least 4 individual spikes . Spike intervals within a train were ranging between 0.05 and 0.3 s. the interval between individual spike trains was determined at 1 s. seizure protocols contained the total number of seizure episodes and spikes, spike frequency, total spike train duration, shortest and longest spike train durations . Data were calculated and plotted throughout the figures as mean standard error of the mean (sem). Significance was calculated using student's t - test which included pretesting for normal distributions via the kolmogorov - smirnov test . Urethane (sigma, germany) was freshly dissolved in 0.9% nacl and systemically (i.p .) Administered at 800 mg / kg to induce atropine - sensitive type ii theta oscillations . Four control mice from the original study group (body weight: 32.98 0.65 g, age: 70.32 9.04 weeks, 3, 1) and four 5xfad animals from the original study group (body weight: 25.52 1.61 g, age: 73.75 2.97 weeks, all) were used for this approach . Ca1 recordings under baseline conditions (30 min duration) and under urethane (30 min duration 15 to 45 min after injection) were used for analysis of urethane induced hippocampal theta oscillations . Complex eeg analysis was performed for spontaneous 48 h recordings at a sampling rate of 500 hz . Data segments with a length of 60 min each were extracted from the 48 h total recordings . Data segments were analyzed using complex morlet wavelets to calculate both frequency and amplitude of oscillations . The complex morlet wavelet is defined as (1)x=b1/2exp2icxexpx2b, where b is the bandwidth parameter, c the center frequency, and i the imaginary unit . This wavelet or similar ones have often been applied in the literature to study eeg data, as they guarantee optimal resolution in both frequency and time [60, 61]. In our case, the bandwidth parameter and center frequency were both set to 3 in order to weight the frequency resolution to distinguish frequency differences on the 0.1 hz level, but not to neglect a sufficient time resolution . Eeg data were analyzed in the frequency range of 0.212 hz with a step size of 0.1 hz, thus including the typical delta, theta, and alpha frequency ranges . In order to apply the wavelet technique for extraction of theta - oscillatory segments, we developed a task - adjusted detection criterion . This theta detection method mimicked the standard visual inspection of theta oscillations and was substantially based on a complex elaboration of the frequency architecture of theta activity . Theta - positive oscillatory segments of 2.5 s duration were defined as follows (amax: maximum amplitude):(2)amax(412 hz)mvamax(23.9 hz)mv>2.the 2.5 s time length is suited to precisely analyze theta activity . Some extracted theta segments did not correspond to normal theta activity and were related to spontaneous behavior, for example, eating or scratching as proven by video analysis of the mice . To eliminate these segments, all theta segments with a mean frequency lower than 5 hz or higher than 10 hz, exhibiting only slight frequency changes over time, were excluded from the analysis . Finally, sorted eeg segments identified as theta oscillation epochs were statistically analyzed and all data were displayed as mean sem . Furthermore, activity data of mice during 48 h recordings and the conventional 12 h light / dark cycle (beginning at 5:00 a.m.) were used to correlate theta activity from the ca1 region with either the active or nonactive state . All eeg calculations were done using custom - made programs in matlab (the mathworks inc ., version r2012b). Total rna (250 ng) was prepared from the hippocampi of three independent control mice (age: 68.10 0.05 weeks, 2, 1) and three independent 5xfad animals (age: 68.24 0.75 weeks, 2, 1) that were not involved in any other experimental procedures before using rneasy lipid tissue mini kit (qiagen). Arrays were washed and stained according to the manufacturer's recommendations . Labeled and purified cdna was fragmented (5.5 g) and subsequently hybridized to the arrays before scanning in a genechip 3000 7 g scanner (affymetrix). Normalization to the median of all samples, background correction, and statistical analysis were performed with genespringgx software (agilent technologies). An implemented gc - rma algorithm was applied on all chips to summarize probe level information . Differentially regulated transcripts with a fold change (fc) greater than 1.6 were then subject to hierarchical clustering analysis in order to visualize gene expression changes across groups . David [63, 64] was used to carry out gene ontology enrichment analyses in the gene set differentially expressed between 5xfad and wt controls . Quantitative real - time pcr was used to validate potential gene candidates that exhibited transcriptional alterations in microarray analysis . The cdna synthesis from hippocampal rna (see above) was carried out using anchored - oligo(dt)18 and hexamer primer in a two - step rt - pcr approach (transcriptor first strand cdna synthesis kit, qiagen) and qpcr reaction protocol was based on lightcycler 480 sybr green i master (roche). The following cycler protocol was used for all primer pairs (table 1): 95c (10 min, preincubation step); 95c (10 s, melting step); 60c (20 s, annealing step); and 72c (30 s, extension step), 35 cycles . The specificity of the amplification was checked by melting curve analysis and the products were identified by electrophoresis . Deionized, nuclease - free water (no cdna) and total rna samples (without rt) were used as controls and hprt was used as an internal reference gene . The ct (cycle threshold) values were calculated using the lightcycler 480 system software . Fold changes (fc) of cacna2d1, kcnma1, cacna1e, prkcb, plcd4, scn8a, plcb1, and casp8 gene expression in 5xfad transgenic mice related to wt controls were calculated according to . Further statistical analyses concerning duration, frequency, amplitude of theta segments, and comparisons between groups and experimental conditions were done with ibm spss statistics, version 22 (ibm corporation, 2013). Student's t - test was used to detect differences between the two groups of the above - mentioned parameters . For data that did not show a normal distribution, the mann - whitney u test was used instead, where we made use of the exact solution . This is necessary since the asymptotic solution overestimates the p value for small numbers of animals per group . For analysis of urethane induced theta oscillations the repeated measures anova with within - subjects factor, that is, experimental condition (baseline versus after urethane) and between - subjects factor, that is, genotype (control mice versus 5xfad mice) was applied . The simes - hochberg step - up procedure was used to correct for multiple testing, if necessary . As reported previously, 5xfad mice exhibited a reduced body weight in comparison to their wt littermates (24.89 1.40 g, n = 5 v. 35.32 2.40 g, n = 5, df = 8, t = 3.757, and p = 0.006). The same holds true for a characteristic clasping phenotype involving a simultaneous retraction of both fore- and hindpaws . In this study epidural m1 and deep intrahippocampal ca1 long - term (48 h) eeg recordings were obtained in 5xfad (n = 5) and wt (n = 5) mice (figure 1). Eeg recordings were combined with simultaneous video - recordings to detect potential movement artefacts and to differentiate convulsive from nonconvulsive seizure activity . 5xfad mice exhibited aberrant hyperexcitability in the m1 recording depicting typical episodes or trains of spike, polyspike, and spike - wave activity (figure 1(a)ii) whereas wt mice did not (figures 1(a)i and 1(b)i). Video analysis revealed that none of the motor cortex seizures were associated with motoric exacerbation, thus remaining subclinical or nonconvulsive . The seizure phenotype of 5xfad mice (n = 5) and wt mice (n = 5) was analyzed using simultaneous video - eeg recordings for a total duration of 48 h (figure 2). None of the wt littermates exhibited aberrant hyperexcitability according to the automated seizure scoring system (neuroscore 2.1, dsi). In contrast, 5xfad mice displayed ictal - like discharges, such as spikes, polyspikes, and spike - waves . These discharges were capable of forming seizure episodes characterized by seizure initiation, seizure prolongation, and seizure termination . None of this aberrant hyperexcitability was accompanied by apparent motoric exacerbation, for example, forelimb clonus, rearing and falling, or generalized tonic - clonic seizures . However, minor motor activity including, for example, orofacial clonus or partial isolated clonus or tonus of the limbs, can be very subtle and thus cannot be fully excluded . In summary, the total number of seizure episodes was 13.00 11.05, the total number of spikes: 51.40 43.37, the spike frequency: 5.26 1.32 hz, and the total spike train duration: 8.84 7.55 sec (figures 2(a)2(d)). Further seizure parameters in 5xfad mice included the spike train duration of 0.51 0.13 sec, the number of spikes per train of 3.22 0.81, the maximum spike train duration of 0.64 0.19 sec, and the minimum spike train duration 0.46 0.12 sec (figures 2(e)2(h)). These seizures turned out to be subclinic or nonconvulsive and were prominent in the m1 deflection . However, a single 5xfad mouse exhibited convulsive tonic - clonic seizures of status - like character with prominent interictal spike activity (not shown) and died during the early recovery period . Interestingly, 5xfad mice did not show ictal discharges in the deep, intrahippocampal ca1 recording (figure 1(b)i). Disinhibitory tendencies as being shown in our seizure analysis were speculated to be relevant also for reduced anxiety in 5xfad mice . Gene expression analysis employing mouse exon st arrays (affymetrix) on hippocampal tissue revealed 1421 transcripts differentially regulated between 5xfad mice and wt controls . Candidates which are likely to be of interest for seizure and theta activity are depicted in supplementary table 1 . Those with fc> 2 are listed in supplementary table 2 . Gene ontology analysis revealed that the strongest transcriptional alterations belong to immune - response and inflammation related genes observed in the context of late - stage cerebral amyloidosis . We performed qrt - pcr on hippocampi from three independent wt controls and three independent 5xfad mice to determine gene expression changes . Among the differentially expressed genes in the microarray assay, we chose eight genes for qrt - pcr analysis based on their involvement in the theta - genesis pathway . The selected genes and their qpcr primers are listed in table 1 . Among the eight genes tested, qpcr revealed upregulation of casp8 (fc: 2.0979, table 2) which is likely to be responsible for neuronal cell loss in 5xfad mice based on altered regulating of microglia activation through a pkc- dependent pathway . The scn8a na channels as well as kcnma1 k channels were not changed in transcription . Interestingly, microarray analysis suggested potential alterations in the muscarinic signal transduction pathway including plcb1, plcd4, prkcb, cacna1e, and cacna2d1 that might be relevant for theta oscillations . Validation of these components finally supported an increase in plcd4 transcript levels (fc: 1.6105) whereas no substantial fold change could be detected for the other factors (figure 3, table 2). Prior to analysis of the hippocampal oscillatory behavior, we analyzed motor activity in control and 5xfad mice as active exploratory behavior is associated with a different type of theta entity as compared to, for example, alert immobility (figure 4). The total time of motor activity did not change between controls and 5xfad mice (9.10 0.72 min / h versus 9.59 1.77 min / h, figure 5(a)). The same holds true for motor activity during the light phase (8.11 1.23 min / h versus 8.72 1.36 min / h, figure 5(b)) and dark phase (10.09 1.05 min / h versus 10.46 2.52 min / h, figure 5(c)). These results correlate with findings from for exploratory and spontaneous locomotor activity in 5xfad mice aged 9 to 12 months . As expected, however, there was an increase in motor activity from light to dark phase in both genotypes (figures 5(b) and 5(c)). Based on these findings, alterations in 5xfad theta architecture cannot be attributed to changes in activity pattern . To determine whether hippocampal theta oscillations were indeed altered in 5xfad mice, we performed spontaneous 48 h video - eeg recordings from the ca1 region of the hippocampus from both controls and 5xfad mice . Using a time - frequency approach, theta duration, theta frequency, and theta amplitude were calculated . No significant changes were observed for controls compared to 5xfad mice during the total observation period (5.44 2.24 min / h versus 7.36 0.89 min / h, figure 6(a)), the light phase (5.29 2.21 min / h versus 6.03 1.06 min / h, figure 6(b)), or the dark phase (5.59 2.27 min / h versus 8.69 1.16 min / h, figure 6(c)). However, data suggested that there might be an increase in theta during the dark phase (figure 6(c)). During nonmotor activity again no significant differences were detected for the total duration (3.89 1.53 min / h versus 4.87 0.57 min / h, figure 6(d)), the light phase (3.91 1.50 min / h versus 4.03 0.59 min / h, figure 6(e)), or the dark phase (3.86 1.56 min / h versus 5.71 0.70 min / h, figure 6(f)). During the dark phase of no motor activity a tendency of increased theta duration based on this observation we analyzed the percentage change of theta from light phase (lp) to dark phase (dp) via (lp / dp 1)100 . For the total 48 h observation period, a significant trend was observed between controls and 5xfad mice (5.55 5.77 versus 28.77 10.56, df = 8, t = 1.928, p = 0.090, figure 7(a)); for nonmotor activity this change turned out to be significant (5.11 4.88 versus 27.51 8.99, df = 8, t = 3.189, p = 0.013, figure 7(b)). Theta analysis during motor activity did not reveal any statistical differences (light and dark: 1.56 0.72 min / h versus 2.49 0.48 min / h; light: 1.38 0.72 min / h versus 2.00 0.50 min / h; dark: 1.73 0.76 min / h versus 2.98 0.74 min / h). An important parameter to be affected during the pathogenesis of alzheimer's disease in humans is theta frequency [6871]. For the total recording period (light and dark phase) and the dark phase there was a tendency of reduced theta frequency in 5xfad mice (7.04 0.28 hz versus 6.50 0.20 hz, figure 8(a); 6.77 0.25 hz versus 6.29 0.23 hz, figure 8(c)) with a statistical trend during the light phase (7.09 0.26 hz versus 6.48 0.19 hz, df = 8, t = 1.896, p = 0.095, figure 8(b)). For the nonmotor activity, the same phenomenon was observed with no significant change during the dark phase (6.77 0.25 hz versus 6.29 0.23 hz, figure 8(f)), a significant trend for the total observation period (6.92 0.22 hz versus 6.32 0.21 hz, df = 8, t = 1.989, p = 0.082, figure 8(d)) and a significant reduction during the light phase (7.06 0.22 hz versus 6.35 0.21 hz, p = 0.045, figure 8(e)). No significant differences in theta frequency were observed for motor activities (light and dark: 7.17 0.38 hz versus 6.69 0.18 hz; light: 7.12 0.33 hz versus 6.61 0.18 hz; dark: 7.23 0.42 hz versus 6.76 0.23 hz). Finally, the mean theta amplitudes were calculated . For the total recording period, no changes in theta amplitude could be detected (light and dark: 0.019 0.004 mv versus 0.018 0.003 mv, light: 0.019 0.004 mv versus 0.018 0.003 mv; and dark: 0.019 0.004 mv versus 0.018 0.003 mv, supplementary figure 2(a c)). The same holds true for the nonmotor activity (light and dark: 0.020 0.004 mv versus 0.018 0.003 mv; light: 0.020 0.004 mv versus 0.018 0.003 mv, and dark: 0.019 0.004 mv versus 0.018 0.003 mv, supplementary figure 2(d f)) and nonmotor phase . This finding correlates with previous observations in 5xfad but also tgcrnd8 mice . Besides analysis of spontaneous theta activity, we also investigated urethane induced theta oscillations in 5xfad (n = 4) and wt mice (n = 4). Pharmacodynamically, urethane has a multitarget character capable of inducing atropine - sensitive type ii theta . Theta oscillations were analyzed for 30 min baseline and 30 min postinjection episodes (figure 9). The duration of hippocampal theta oscillations for the total analytical period, that is, including theta oscillations during episodes with either motor or nonmotor activity, was increased in control mice (1.59 0.47 min / h to 4.20 1.40 min / h, n = 4) as in 5xfad mice (5.09 2.06 min / h to 18.08 6.25 min / h, n = 4) and the factor experimental condition / urethane effect exhibited significance (f(1,6) = 7.270, p = 0.036). Factor exhibited a statistical trend (f(1,6) = 5.256, p = 0.062, figure 9(a)). Ii theta is characteristic of alert immobility data were also analyzed for nonmotor activity eeg segments . As expected, the results matched those for the total analytical period, that is, a significant effect for the factor experimental condition / urethane effect (f(1,6) = 7.691, p = 0.032) with increase in controls (1.45 0.48 min / h to 3.88 1.52 min / h, n = 4) and 5xfad mice (4.11 1.59 min / h to 15.78 5.34 min / h, n = 4). The factor genotype exhibited a statistical trend (f(1,6) = 5.148, p = 0.064, figure 9(b)). These findings demonstrate that 5xfad mice even of higher age are capable of displaying increased theta oscillations upon urethane provocation . However, it remains to be determined whether such theta activity is physiologically integrated or the result of hyperactive, functionally dislinked neuronal clusters within the hippocampus . Interestingly, besides an effect on theta duration, there was a significant effect for the factor experimental condition / urethane effect (f(1,6) = 13.536, p = 0.010) on theta oscillation frequency for the total analytical period (6.57 0.61 hz to 5.48 0.36 hz (n = 4) in controls versus 6.18 0.31 hz to 5.11 0.33 hz (n = 4) in 5xfad mice, figure 9(c)). This significant effect (f(1,6) = 8.036, p = 0.030) also holds true for the nonmotor episodes (6.60 0.63 hz to 5.44 0.35 hz (n = 4) in controls versus 6.14 0.53 hz to 5.15 0.36 (n = 4) in 5xfad mice (figure 9(d)). Alzheimer's disease is a complex neurodegenerative disorder accompanied by cognitive impairment that ultimately leads to dementia . In the present study, we investigated transcriptional alterations and the eeg phenotype of 5xfad mice . This mouse model harbors five early - onset fad mutations and displays substantial amyloid plaques and neurodegeneration [17, 23]. Our study demonstrates that 5xfad mice exhibit nonconvulsive seizure activity of highly different severity, predominantly in the m1 deflection, whereas there was no seizure activity detectable in the ca1 recordings . It is noteworthy that a formation in certain mouse models can differentially alter cholinergically induced rhythmicity according to the structure of a plaques and therefore resulting in variable seizure severity . In addition, stereological quantification of pyramidal neurons of the ca1 layer showed no significant difference between the number of neurons of wt and 5xfad mice; however a significant loss was detected in cortical layer 5 . Experimental studies in genetically engineered mice support these findings, highlighting the presence of subclinical seizures and overlapping pathophysiological cascades . Reduced seizure thresholds and spontaneous convulsive seizure phenotypes have been observed in ad mouse models [7376]. Interestingly, deletion of app and bace1, the secretase that participates in a release, also causes an epileptic phenotype, indicating that normal app signaling is important for the development of hippocampal excitability . In some models, lower thresholds for induced or spontaneous seizures are found even in the absence of amyloid deposits, further stressing the role of soluble forms of a as a pathogen [76, 77]. Chronic eeg monitoring in j20 mice overexpressing happ revealed that most frequent seizures were purely electroencephalographic, that is, nonconvulsive with complete motoric arrest as observed in our study using 5xfad mice [30, 31]. In rare cases motor seizures were observed . This observation raises the question whether abnormal hippocampal neuronal synchronization might remain undetected in human ad patients and whether altered network activity might accelerate a more rapid cognitive decline in patients suffering from fad [29, 31, 79]. Histological evaluation of the j20 mouse hippocampus revealed evidence for hippocampal network remodeling that is similar, but not identical, to the changes identified in both patients with temporal lobe epilepsy and experimental models of hippocampal seizures . The cellular changes included ectopic sprouting of dentate granule cell mossy fibres and sprouting of fibers containing the inhibitory neurotransmitter npy [80, 81]. Convulsive seizures with associated hippocampal network plasticity have been confirmed in other ad mouse models [35, 82]. Interestingly, impairment of gaba transmission in the j20 brain is likely to be responsible for epileptogenesis in these models . Increased adult neurogenesis is found in both human ad and tle cases [81, 83]. The multiple lines of evidence discussed above reveal that soluble forms of a are cytotoxic inducing the appearance of aberrant excitatory neuronal network activity in vivo and triggering complex molecular and cellular patterns of compensatory inhibitory and excitatory mechanisms in the hippocampal circuitry [20, 43, 79, 84, 85]. The toxic accumulation of a peptides underlying ad triggers synaptic degeneration, circuit remodeling, and abnormal synchronization within the same networks . Because neuronal hyperexcitability amplifies the synaptic release of a, seizures create a vicious spiral that accelerates cell death and cognitive decline in the ad brain . While degenerative processes in the nervous system ultimately result in loss of neural signaling, when active inhibitory mechanisms fail early, the resulting disinhibition may destabilize network oscillatory activity at formative stages of the disease . Complex cognitive operations depend on a sophisticated coordination of activity across a plethora of neuronal groups . One of the most intriguing mechanisms of neuronal coordination and communication is through neuronal synchronization by brain oscillations . Theta oscillations represent one of these oscillations and are modulated by specific behavioral and cognitive states and are related to memory deficits, for example, in ad [31, 32, 34, 49, 56]. Disruption of theta activity results in spatial memory deficits, whereas the restoration of theta - like rhythmicity restores learning capabilities in rats . Theta duration analysis in our study suggests an increase of theta oscillations in 5xfad mice during the dark phase . This phenomenon was most prominent during the switch from light to dark phase and nonmotor activity . As analysis of motor / nonmotor activity did not reveal any difference between controls and 5xfad mice; the difference in theta duration is likely to be based on theta - subtype composition . We speculate that nonactive mice in the dark phase predominately exhibit alert - immobility which is accompanied by atropine - sensitive type ii theta [88, 89]. As in our study, a statistical trend for an increase in theta duration has been described in the tgcrnd8 mouse model . These changes in theta duration in 5xfad mice are an important variable because they are known to be associated with memory effectiveness . Animals displaying a higher amount of theta activity are faster in novel task learning than animals that exhibit less pronounced theta oscillations . Unlike the common assumption of decreased theta activity in dementia, an increase in theta activity is observed in various mouse models of ad . Administration of urethane clearly proved that 5xfad mice can exhibit increased atropine - sensitive type ii theta oscillations upon provocation (figures 9(a) and 9(b)). One might speculate that hyperexcitable neuronal clusters surrounded by degenerated neurons might account for this increase in theta which disrupts the ability of neuronal networks to dynamically adjust the amplitude of these oscillations during memory processes . Interestingly, the mean theta frequency was reduced in 5xfad mice; that is, theta oscillations turned out to be significantly slower than in control animals . It has further been suggested that theta frequency could change as a function of novelty and familiarity . Thus, the significant decrease in theta frequency could dramatically skew the delicate balance of theta frequency dynamics between novelty and familiarity . Previous studies have shown that the muscarinic signal transduction cascade is severely affected in ad and this might correlate with a very slight downregulation of plcb1 as observed in our study (supplementary figure 3). Cav2.3 voltage - gated ca channels are involved in both the generation of cellular correlates of ictal discharges, that is, after depolarisation and plateau potentials [94, 95], and the generation of atropine - sensitive type ii theta [62, 88, 96, 97]. Transcriptome analysis of 5xfad hippocampal probes performed in this study suggests an upregulation of plcd4 which could result in type ii theta acceleration via the pkc, cav2.3 cascade; however, other muscarinic signaling targets could also be involved (supplementary figure 3). Our study demonstrates that 5xfad mice exhibit both nonconvulsive seizure activity and altered theta architecture, the latter being related to atropine - sensitive type ii theta . Based on hippocampal microarray analysis we hypothesize that altered muscarinic signaling might play a role in the pathophysiology of both alteration . Although some caution is warranted in interpreting results from the aggressive 5xfad model, our results support the view that pharmacological interference with muscarinic signaling is a potential valuable target in ad treatment . Finally, our study suggests that alterations in theta characteristics might serve as a diagnostic and prognostic biomarker in ad in the future.
Patients who are recently discharged from hospital have an increased risk of experiencing an adverse drug event, and more than half of such adverse drug events may be preventable or ameliorable.1 in one study of the quality of medication instructions following a hospitalization, coleman et al reported that 14% of recently discharged patients experienced a medication discrepancy, with an approximately equal proportion of discrepancies resulting from patient - related or health system - associated factors.2 in another study of medication discrepancies at discharge, wong et al reported that over 40% of patients experienced at least one unintentional medication discrepancy . In this study, incompletely written prescriptions and omissions of medications were identified as the most common types of errors.3 yet even when medication reconciliation is performed accurately during the discharge process, patients may misunderstand medication instructions, particularly when changes occur in complex medication regimens . For example, in one review of medication reconciliation at discharge, ziaeian et al detected either a medication error or a lack of patient understanding about a medication change in approximately 80% of patients.4 payers, providers, and policy - makers have directed increased attention and resources towards improving medication safety during care transitions . Current strategies include implementing robust medication reconciliation processes, and promoting other elements of good transitional care, such as enhancing teamwork and communication, and utilizing health information technologies . In 2012, the american pharmacists association and the american society of health - system pharmacists jointly issued a white paper entitled improving care transitions: optimizing medication reconciliation.5 in this paper, these organizations describe an expansive vision for medication reconciliation, one that is composed of multiple processes that together reduce medication errors, support safe medication use by patients, and encourage community - based providers and those practicing in hospitals and health systems to collaborate in organized medication reconciliation programs to promote overall continuity of patient care . Health information technologies can improve medication reconciliation functions.6,7 patients can be empowered to assume management of their medication regimen through the use of an electronic personal health record system (ephr). Using the ephr, patients or authorized caregivers can maintain their medical information and medication list using a secure electronic application . Patients, pharmacists, and other care providers can utilize ephr technology to promote greater patient self - efficacy in self - management of the medication regimen, and also to exchange and reconcile information among various information repositories.8 while these benefits are particularly apt during care transitions, research assessing the utility of ephr systems to improve medication management is scant.9 researchers from the university of rhode island college of pharmacy piloted an intervention to improve medication management during care transitions . The project was one of several initiatives included in the tech4impact program (technologies for improving post - acute care transitions), sponsored by the center for technology and aging, a national leader in the use of patient - centered technologies for older adults . Our intervention involved deploying pharmacists to visit the homes of recently discharged patients to review medication instructions and to offer patients free use of an ephr system, with ongoing support in setting up and using the ephr . We hypothesized that the pharmacist s ability to identify medication - related problems would be greater among patients who used the ephr system . To our knowledge, no study to date has coupled in - home pharmacist education with the use of an ephr system to promote safe and effective medication management during care transitions . This report presents our findings in delivering this intervention during a 6-month period occurring between august 2011 and february 2012 . This was a prospective nonrandomized pilot study in which recently hospitalized patients were offered the opportunity to meet with a pharmacist in their home within 14 days of their discharge from hospital to review medication instructions and to receive a demonstration of an ephr system . Patients were informed that the pharmacist home visit would include a medication regimen review and help in setting up the ephr system, if desired . Usual care consisted of medication reconciliation at discharge provided by hospital clinicians, but without subsequent home visits provided by pharmacists . The ephr utilized in this project was the er - card system, developed by er - card llc of west warwick, rhode island . This product features online password - protected sharing of health record information via the internet, or by usb drive provided by the consumer . The er - card system provides staff support for assisting with completing and updating the contents of the patient s record . Medical conditions and medication information is self - reported by the patient, with pharmacists verifying medication lists with the patient s pharmacy . The study enrolled patients 50 years of age or older and having any of the following chronic conditions: cardiovascular disease and related conditions (eg, atrial fibrillation), respiratory illness (eg, chronic obstructive pulmonary disease / asthma), and/or diabetes mellitus . As our focus was on medication self - management among community - dwelling patients, we did not recruit patients with dementia or patients who were transitioning from the hospital to a long - term care facility . The pharmacist home visit was offered to patients who were participating in an associated care transitions initiative conducted by the rhode island quality improvement organization (healthcentric advisors) in cooperation with rhode island s aging and disability resource center . A third pathway for patient recruitment was on - site solicitation of patients at kent hospital in warwick, rhode island, which served as the predominant patient recruitment source . Patients agreeable to the pharmacist home visit completed an informed consent process explaining the activities that the pharmacist would be providing during the home visit . Patients were informed that that they were not required to utilize the ephr system to receive the pharmacist home visit, and that if they decided to utilize the ephr system, their information could be shared with other health care providers only if they provided permission . Those patients deciding to utilize the ephr system completed an authorization form routinely required by the ephr vendor for compliance with the health insurance portability and accountability act . The ephr was offered to patients at no cost, and patients were allowed to discontinue their use of the ephr at any time . The study was approved by the institutional review board on human subjects at the university of rhode island and kent hospital . For patients consenting to participate in the study, a home visit was scheduled by the study pharmacist for a suggested period of 2 hours . When a medication - related problem was identified during the medication review, the pharmacist discussed the concern with the patient, and encouraged the patient to contact the prescriber or pharmacy when appropriate . The pharmacist demonstrated the ephr program using a laptop computer, and if the patient was agreeable to trying the ephr system, the pharmacist supported the patient in entering their medical information and medication list into the ephr system . During the home visit the pharmacist completed a data collection form that captured information describing the medication - related problems identified and other data relevant to the study . We categorized study participants according to the referral source and by the primary diagnosis associated with the recent hospitalization . We categorized the types of medication - related problems identified during the home visit as involving therapy duplication, interactions, medication cost, or incorrect use or underuse of a medication (eg, poor adherence). We compared the frequency of medication - related problems identified between users and nonusers of the ephr system, overall and according to patient age and sex . We also documented medication discrepancies using the tool developed by dr eric a coleman s care transitions program,10 which categorizes events as patient - related or health - system related . Our results are presented here as descriptive statistics, with the chi - square test used to determine the statistical significance of differences in observed rates of medication - related problems between users and nonusers of the ephr . Fisher s exact test was used where any cell size was less than five observations . We attempted to contact patients no earlier than 30 days following the home visit to enquire about their satisfaction with the pharmacist visit, to determine if patients continued to utilize the ephr system, and to ascertain if patients had been rehospitalized in the period following the home visit . Approximately 300 patients were identified as eligible for our program and were approached by study recruiters . While 59 of these eligible patients initially agreed to participate in the study, we were unable to schedule a home visit with 29 patients, because some did not return our subsequent telephone calls to schedule the home visit, while other patients changed their mind about participating, transitioned to a long - term care setting or died . The study pharmacists completed home visits for a total of 30 patients, with 20 of these patients agreeing to utilize the ephr system . Among the 30 patients visited, 16 (53%) were male and 23 (77%) were 65 years of age or older . The majority of patients had been hospitalized due to a cardiovascular - related illness (n=24), while six patients were hospitalized for an exacerbation of their respiratory illness or diabetes (see table 1). At each patient home visit, the pharmacist performed a medication regimen review and documented medication - related problems that were identified . Table 2 presents the range of problems discovered, which are categorized as cost - related, involving therapeutic duplication, drug interaction, underuse (lack of use) of a clinically important therapy, or having incorrect or unclear instructions for medication use . Several patients discontinued a clinically important medication due to cost, while other patients did not appear to be utilizing indicated therapies (eg, lack of aspirin use following a myocardial infarction, with no apparent contraindication to aspirin therapy). Instances of therapeutic duplication included concomitant use of two proton pump inhibitors, use of two different albuterol inhaler products, and use of multiple products containing acetaminophen . The percentage of medication - related problems detected by the pharmacist was higher among those patients agreeing to use the ephr system (15/20, 75%), as compared with patients who did not use the ephr (4/10, 40%). Medication - related problems were also identified more frequently among patients who were younger than 65 years of age, as compared with older patients (71% versus 61%, respectively), and were identified more frequently among males as compared with females (69% versus 57%, respectively). Medication - related problems were identified among approximately 60% of patients who were recently hospitalized for a cardiovascular - related condition, and among 67% of patients who were recently hospitalized for a respiratory illness . Despite large proportional differences across several of these cross - tabulations, statistically significant differences were not observed, reflecting the small sample size in this pilot study (table 3). Table 4 presents the frequencies and types of medication discrepancies identified during the home visit using the care transitions program medication discrepancies tool for multiple events.10 discrepancies were detected among 16 of the 30 patients we visited (53%): six of the discrepancies were categorized as relating to patient - associated factors, while ten of the discrepancies were considered to have resulted from system - related factors . The most frequently observed discrepancy was conflicting information from different informational sources, as documented in five of the 30 home visits that were completed . Of these 19 patients, three had been rehospitalized within 30 days (3/19, 16%). Patients who were surveyed at follow - up expressed a high level of satisfaction with the pharmacist home visit, with all patients responding affirmatively to our follow - up survey question: do you think that the pharmacist home visit was helpful in reviewing your medications and addressing your questions? Seven patients reported that they had used the ephr to share information with care providers during their post - discharge medical visits . In this pilot program, pharmacists conducting home visits frequently identified medication - related problems among recently discharged patients . At least three of the 30 patients had discontinued an important medication therapy due to high cost . In these instances, the pharmacist instructed the patient to contact her / his health care provider to discuss treatment options, which might include switching to an affordable alternative therapy (eg, changing to a generic cholesterol - lowering medication). Additionally, several patients reported errors related to their medication regimen that occurred during their transitioning into or out of hospital, with 16 such discrepancy events documented using the medication discrepancy tool. Among the 30 patients who were visited by the pharmacist, 20 agreed to use the ephr technology, and seven patients reported that they had used the ephr to share information with their care providers during follow - up visits or rehospitalizations . While these results indicate that the ephr system can be effectively used by patients during care transitions, our sample size was too small to draw any firm conclusions regarding the characteristics of patents who are more likely to effectively utilize an ephr to manage their medication regimen . Foremost, patient recruitment was difficult, because many of the patients whom we encountered were not agreeable to meeting with the pharmacist in their home . Patient perceptions regarding the role of the pharmacist in the health system may have posed a barrier to our work, as pharmacists do not commonly enter the patient s home to provide medication counseling services . The lack of awareness among patients of the potential benefits of an ephr system also posed a barrier to recruitment . We provided an explanation of the ephr system and its potential benefits during recruitment, and as an element of the informed consent process . However, it was challenging to effectively explain the potential utility of the ephr during our brief recruitment encounters, especially considering that our population of focus included hospitalized or recently hospitalized patients who were often severely ill . Additionally, approximately half of the patients who consented to participate in the study subsequently changed their mind about completing the home visit, or did not return telephone calls when the scheduler contacted them . Most importantly, it should be recognized that this was a pilot study involving a small number of patients . Larger scale application of the model is warranted before any strong conclusions can be made about the benefits of ephr systems to aid medication management during care transitions . The small sample size also limited our ability to determine a difference in effectiveness of the intervention according to the characteristics of the patients studied . Additionally, the nonrandomized design may have resulted in selection bias, whereby participating patients may have generally been more accepting of the role of pharmacists and of information technology . Another limitation of our study pertains to the role of the pharmacist in our model, which did not include direct intervention with the patient s pharmacy or prescribers to pursue each medication - related problem identified to its resolution . We believe that establishing more formalized communications with health care team members would be an important step towards ensuring that the visiting pharmacist s observations and recommendations are best incorporated into clinical decision - making . Finally, we were unable to follow up with 11 of the 30 patients to determine their satisfaction with the intervention, or if they continued to use the ephr system . Our findings from this pilot study suggest that pharmacist home visits following a hospitalization can aid in identifying medication - related problems . The frequency and clinical significance of the problems identified suggests a need for increased involvement of pharmacists during care transitions . The ability to identify such problems may be enhanced when pharmacists work together with patients to review and enter the discharge medication list into an ephr system.
Vitamin d has two different forms: vitamin d2 which exists in food (plants) and d3 (cholecalciferol) which is produced by following the path 7-dehydrocholesterol previtamin d vitamin d3 in the skin upon ultraviolet b (uvb) sun exposure and at skin temperature . The process of generating vitamin d3 from sun exposure is attenuated by reduced exposure of the skin to sunlight (northern latitudes with decreased direct sun exposure, air pollution, confinement indoors, clothes covering all the skin, broad use of sunscreens, increased skin pigmentation) or in dermatologic conditions such as ichthiosis in which sun inadequately penetrates the epidermis . The two vitamin d molecules differ in structure; vitamin d2 has an extra double bond between carbons 22 and 23 and an additional 24-methyl group in comparison with vitamin d3 having been demonstrated to be two to three times more effective than vitamin d2 [24]. Both forms of the vitamin d diffuses into the circulation and is transported protein - bound to the liver where it is hydroxylated to 25(oh)d3 (calcitriol) and 25(oh)d2 . Serum or plasma 25(oh)d3 is the most commonly used and appropriate biochemical marker of vitamin d status [5, 6]. In the kidney, 25(oh)d3 undergoes a further hydroxylation at the first carbon, catalysed by 1,2-hydroxylase, to form 1,25(oh)2d3 which is the biologically most active form of vitamin d . Although 1,25(oh)2d3 represents the active form of the vitamin, due to a tight regulation of its production as well as a relatively short half - life (46 hours), it is not a good indicator of vitamin d status [57]. Serum 25(oh)d3 concentrations are the best indicator of determining adequacy because it represents the combined amounts of vitamin d synthesized in the skin and dietary sources . Serum 25(oh)d3 levels are the accepted measure of vitamin d nutritional status . In the usa, cases of nutritional rickets have been reported from at least 17 states, with 166 cases reported in the medical literature between 1986 and 2003 . Relatively high rates of subclinical vitamin d deficiencies have been reported in otherwise healthy infants [1114] children [15, 16] and adolescents [17, 18] in several american states . A high prevalence of vitamin d deficiency has also been reported in infants, children, and adolescents from diverse countries around the world, including the uk, france, greece, lebanon, turkey, china, finland [25, 26], canada [27, 28] and qatar . In the research that took place in china, 18% of total 42 healthy infants were found with rickets and the fact that not all infants with rickets in this study had low 25(oh)d concentrations suggests 2 possibilities: (1) not all rickets is necessarily related to a vitamin d deficiency, or (2) serum 25(oh)d concentrations are not the best indicator of vitamin d status . Among adolescence, reported prevalence rates of vitamin d deficiency have ranged from 0 to 42%, with variation noted secondary to season, latitude, and participant race / ethnicity . Data from national surveys in the uk, usa and new zealand show that the prevalence of low vitamin d status is less of a concern for children than for adolescents [3234]. There is also some suggestion that intakes of vitamin d may be worse in females than males . For example, moore et al . Reported that adolescent males in the usa were the group most likely to consume the adequate intake value for vitamin d, while adolescent females were about half as likely as males of corresponding age to meet their dietary reference intakes . Vitamin d status changes were also reported using data from the national health and nutrition examination surveys (nhanes). The authors concluded that the mean serum 25(oh)d was lower in 20002004 than 19881994 and that the assay changes unrelated to changes in vitamin d status accounted for much of the difference in most population groups . They also reported that in the adult subgroup, combined changes in bmi, milk intake, and sun protection appeared to contribute to a real decline in vitamin d status . In addition, bener et al . Recently found a very high incidence of vitamin d deficiency in the young population in qatar especially in girls . This deficiency attributed by the authors as a result from a combination of limitation in sunlight exposure and a low oral intake of vitamin d. also, children with renal failure are at risk for vitamin d deficiency . Recently ali et al . Studied over a period of 10-years the prevalence in children with vitamin d efficiency and he found rates from 20% to 75% . Increasing evidence suggests that optimal vitamin d status throughout the lifespan even in utero may be important not only in maintaining bone health, but also in protecting against many chronic conditions, including autoimmune diseases, diabetes, cardiovascular diseases, and cancer . Rickets was a very common disease during the industrialization and had a prevalence of 40%60% in children living in northern europe . Rickets was cured after people were informed about the value of vitamin d in bone conformation and the adequate exposure to sunlight as a prohibitive and therapeutic method . The problem began to reappear in 1960, especially among breastfed infants and in those infants whose mothers' dress included covering . Over the past 2030-years, there has been a reemergence of rickets with reports in the uk [4143], europe [4446],north america and saudi arabia in a variety of ethnic groups . The resurgence of rickets in north america in the 1990s coincided with skin cancer prevention campaigns . Studies in south africa and nigeria suggest that a dietary deficiency of calcium may cause rickets [50, 51] and there are case reports of rickets caused by dietary calcium deficiency in north america [52, 53]. Most of the children in these studies had normal serum 25-hydroxyvitamin d concentrations and high serum 1,25-dihydroxyvitamin d concentrations, indicating adequate intake of vitamin d. other possible reasons for the increasing prevalence of rickets include: breastfeeding without vitamin d supplementation, vegetarian diets, darker - skinned people migrating to countries with less sunlight [45, 55, 56] and increasing atmospheric pollution . Typically, rickets associated primarily with vitamin d deficiency presents during the first year of life . T1 dm is among the most prevalent chronic diseases with onset in childhood, being the second most common chronic disease in children after asthma in the usa . It results from an immune - mediated destruction of pancreatic insulin - producing -cells, with both genetic and environmental factors playing roles in the aetiology . It is linked about 60% to genes in the hla complex of the major histocompatibility complex (mhc) on chromosome 6p21 [58, 59]. Non - mhc chromosomal regions are also involved, particularly the regulatory region of the insulin gene and the interleukin-1 receptor type 1 gene . The specific factors that initiate the autoimmune process are not yet well understood, but -cell destruction often begins during infancy and continues over many months or years . By the time t1 dm is diagnosed, about 80% of the b cells have been destroyed . There is a marked geographic variation in incidence, with a child in finland being about 400 times more likely than a child in venezuela to acquire the disease . The pattern follows a latitudinal gradient that is the inverse of the global distribution of ultraviolet b (uvb) irradiance . Furthermore, it is predicted that by 2010 the incidence of t1 dm will be 40% higher than it was a decade earlier . One of the environmental factors thought to be protective against the development of t1 dm, is early supplementation with vitamin d. vitamin d is either produced endogenously, through skin exposure to sunlight, or exogenously from ingestion of foods and supplements [59, 60]. T1 dm incidence rates are higher in regions that are more distant from the equator, where uvb irradiance is lower, than in those closer to the equator, where uvb irradiance is much higher . Although the importance of vitamin d for preventing rickets and adult bone disease is well established, it is becoming increasingly clear that vitamin d appears to be an immunosuppressive agent, a role that may explain its protective association with autoimmune conditions, including multiple sclerosis and rheumatoid arthritis . Strong evidence of a vitamin d effect on t1 dm risk comes from experiments in the nonobese diabetic (nod) mouse . The nod mouse experiences disease pathogenesis similar to the human, including autoimmune destruction of -cells . When 1,25-dihydroxyvitamin d(1,25(oh)2d), the active form of the vitamin, was administered to nod mice in pharmacologic doses, it prevented the development of diabetes . More recently, nod mice raised in a vitamin d deficient state were shown to develop diabetes at an earlier age than nondeficient nod controls [5961]. The dependence of normal insulin secretion in pancreatic -cells on vitamin d has been known for several decades . A reduction in vitamin d activity can result in both increased insulin resistance and reduced insulin secretion . Epidemiological data have shown a four - to five - fold higher prevalence of noninsulin - dependent diabetes in dark - skinned asian immigrants in comparison with british caucasians indicating that low vitamin d status may contribute to the pathogenesis of diabetes . A recent review including studies from many european countries, particularly the eurodiab, and the finnish study in 2001, concluded that there is evidence from observational studies that vitamin d supplementation in infancy might be protective against the development of t1 dm . The eurodiab study found that children whose mothers consumed vitamin d supplements during pregnancy had a lower risk of type 1 diabetes than those whose mothers did not, and indicated that children being supplemented had a 29% reduction in risk of developing type 1 diabetes compared with their peers who were not being supplemented . The favourable association with vitamin d persisted after adjustment for birthweight, duration of breast feeding, maternal age and study centre . A norwegian study done by stene and jones in 2003 looked at the effect of the time of starting supplementation with vitamin d. it appears that those who had cod liver oil, an important source of both vitamin d and the long - chain n-3 fatty acids docosahexaenoic acid (dha)and eicosapentaenoic acid (epa) in the norwegian population between 7 and 12 months of age had lower chances of developing t1 dm in later life compared to those who were supplemented between 0 and 6 months of age . More recently, significant vitamin d deficiency was found in more than 75% of 128 children with type 1 diabetes . Epidemiological studies describing a north south gradient in incidence rate and an inverse correlation between incidence and mean monthly sunshine hours are also hinting at a possible protective effect of vitamin d [62, 63]. In conclusion, the evidence shows that the vitamin d system plays an important role in t1 dm . By interfering with environmental factors, such as sun exposure and subsequent vitamin d levels, there may be an opportunity to prevent some of the cases of t1 dm . So, the provision of adequate levels of vitamin d is an important goal for public health . Considering the rapid increase in type 1 diabetes incidence among 05-year olds and early appearance of ia, maternal intake of certain dietary nutrients during pregnancy including vitamin d through food, may provide sufficient in utero exposure to these nutrients, offering early protection from or promotion of islet autoimmunity (ia) in infancy or early childhood [63, 67, 68]. While rickets and osteomalacia are the index diseases for severe vitamin d deficiency, there has been growing evidence that less severe deficiency, may also contribute to other chronic diseases, such as cardiovascular disease, hypertension, cancer and other chronic disease . The active form of vitamin d, 1,25-dihydroxyvitamin d, is made in many different tissues, including colon, prostate, and breast . It is believed that the local production of 1,25(oh)2d may be responsible for the anticancer benefit of vitamin d. in a recent review by holick suggested that women who are vitamin d deficient have a 253% increased risk for developing colorectal cancer, and women who ingested 1500 mg / d calcium and 1100 iu / d vitamin d(3) for 4-years reduced risk for developing cancer by> 60% . Low 25-hydroxyvitamin d levels have also been associated with the cardiovascular disease risk factors of hypertension, obesity, and the metabolic syndrome, as well as cardiovascular disease events including stroke and congestive heart failure . Studies suggest vitamin d deficiency may be a contributor to the development of cardiovascular disease potentially through associations with diabetes or hypertension . However, much of the evidence base for this comes from epidemiologic studies of adults . Far less is known of the effect of poor vitamin d status during childhood and adolescence on risk of these nonskeletal chronic diseases . However, in his recent review of childhood vitamin d deficiency, holick highlights evidence that living at latitudes above 35 for the first 10-years of life increases risk of multiple sclerosis by 100%, as well as increasing the risk of several other autoimmune diseases . There is also some evidence that supplementation with vitamin d (usually high dose (202500 mg / day) and in some cases in combination with calcium; (low dose vitamin d supplementation did not appear to be effective) may beneficially influence muscle function, rheumatoid arthritis, blood pressure, blood glucose and insulin levels . After nearly 20-years of debate, there is now sufficient, reproducible evidence supporting a beneficial role for calcium and vitamin d - rich dairy foods in blood pressure regulation . The incidence of hypertension also followed an inverse relation with serum 25(oh)d [74, 75] and increased intake of vitamin d was associated with 9.3 percent decrease in systolic blood pressure in adults, while a more recent study by saintonge et al . Revealed that overweight and obesity in adolescence increases the risk for vitamin d deficiency compared with the normal ones . Recently, a new study by kremer et al . Confirmed that, by examined the relationship of 25 (oh)d status and body fat levels in 90 post pubertal females and concluded that vitamin d insufficiency was associated with increased bf . Rickets can be treated effectively with vitamin d supplementation . In relation to addressing subclinical vitamin d deficiency and insufficiency, sun exposure and dietary vitamin d intake (including vitamin d fortified foods and supplemental vitamin d use) however, the relative importance of these two routes of exposure differs from summer to winter for most people . If sun exposure is sufficient, very little if any vitamin d is required from the diet during summer . It is worth remembering, however, that the production of vitamin d in the skin during summer varies with the geographical location, atmospheric conditions, time spent outdoors, clothing, and skin pigmentation as well as sunscreen use . According to holick, approximately 30 minutes of skin exposure (without sunscreen) of the arms and face to sunlight can provide all the daily vitamin d needs of the body . When sunlight exposure is limited, dietary intakes of vitamin d, in particular, at latitudes above 37n, production of vitamin d3 in winter is virtually zero, because the zenith angle of the sunlight increases in the autumn and winter and consequently, the amount of solar ultraviolet radiation that reaches the earth's surface is substantially reduced . Therefore, there is an increased reliance on dietary vitamin d for maintaining adequate vitamin d status during winter, and even in summer for those who avidly avoid sunshine exposure . While the us authorities recommend 5 mg vitamin d / day for children and adolescents (aged 118 years), respectively, in the uk children aged 13 years are recommended 7 mg vitamin d / day while there is no dietary recommendation for vitamin d for subjects aged 464-years . This lack of dietary recommendation is on the basis that it is assumed that skin synthesis of vitamin d will generally ensure adequacy which depends on regular exposure to summer sunlight . However, vitamin d is rather sparsely represented in the diet, which might explain the low intakes in children and adolescents during winter, as mentioned earlier . Oily fish such as salmon, mackerel and sardines contain high amounts of vitamin d. cod liver oil is also an excellent source of vitamin d. some meats may contain 25(oh)d3 . Fortified foods can also be a major contributor to dietary vitamin d2 vitamin d - fortified foods include some types of margarines, breakfast cereals, infant formulae, fruit juices, chocolates and milks, to name but a few . Use of vitamin d - containing supplements can also make a major contribution to mean daily intake of vitamin d in both adults and children . While rickets can be prevented with far smaller doses, a level needed to prevent diabetes would require intake, by children aged 1 year, of approximately 2550 g (10002000 iu)/day of vitamin d3, an intake associated with major reduction in incidence in norway . Children aged 1 year and who are outdoors in sunlight for a few minutes each day may achieve similar serum levels with smaller oral intake . Pending further research, oral vitamin d intake of infants <1-year old should not exceed 6.25 g (250 iu)/day . Physicians and nutritionists should advise parents that children 1 year who live more than approximately 30 from the equator should consume 2550 g (1,0002,000 iu)/day of vitamin d3, especially during winter, to substantially reduce their risk of childhood type 1 diabetes . It is also very important to point out that supplementation with vit d3 it is more efficient than vit d2 for increasing 25(oh)d levels . In a study by trang et al ., 72 subjects took 260 nmol (approximately 4000 iu) vitamin d2 (n = 17) or vitamin d3 (n = 55) daily for 14 d. the increase in 25(oh)d with vitamin d3 was 23.3 15.7 nmol / l, or 1.7 times the increase obtained with vitamin d2 (13.7 11.4 nmol / l; p = .03). More recently, leventis and kiely, reported that vitamin d3 had greater potency than equimolar vitamin d2, with a higher, sustained serum 25(oh)d response and efficacious pth suppression . There is enough evidence that severe deficiency of vitamin d may lead to skeletal and nonskeletal disease . Both children and adolescents seem to be in high risk of low vitamin d status especially during winter . Having a diet higher in calcium and vitamin d as well as oral supplementation with vitamin d may be necessary for children and adolescents not only in the absence of sun exposure in winter time but also in preventing other diseases such as diabetes type 1, cancer and cardiovascular disease . Further research is needed in order to identify the optimal dietary recommendation needed begging from pregnancy in order to prevent vitamin d deficiency.
Use of immunosuppressive drugs in patients after transplantation of vascularized organs may be associated with changes in the concentration of certain fractions of plasma proteins [13], although data in the literature are scarce . In patients receiving immunosuppressive drugs (tacrolimus or cyclosporine a in monotherapy) following liver transplantation, elevated concentrations of specific serum proteins (e.g., apolipoprotein h, 1 microglobulin, 2 microglobulin of factor vii, and chromogranin a) can be observed . The concentration of these proteins was correlated with an increased risk of developing stage 3 ckd . In plasma of patients at risk of developing diabetic nephropathy, an elevated concentration of plasma kininogen and its fragments was reported . In patients with lipid disorders, who were treated with steroids after renal transplantation cyclosporine a (cya) or tacrolimus, and mycophenolate mofetil (mmf) or azathioprine higher concentrations of proteins such as high - molecular fragments of kininogen (bradykinin) and c4 complement were found . Most studies of protein markers of acute kidney injury, chronic kidney disease, nephrotoxicity of immunosuppressive drugs, and renal graft rejection were carried out using mass spectrometry technique involving renal tissue and urine, but not plasma . The present study examined the long - term (6 months) effect of the most commonly used immunosuppressive drugs in typical combinations used in patients after organ transplantation on the concentration of plasma proteins of wistar rats via electrophoresis technique . We used 36 male wistar rats obtained from a licensed breeder (the institute of occupational medicine in lodz, poland). At the beginning of the study, the study was approved by the local ethics committee for experiments on animals in szczecin (no . The animals were housed in cages, with 6 rats per cage, in the animal facility of pomeranian medical university . The lighting, on a 12/12-h cycle, was controlled by automatic timers . Before the study, all animals were weighed, and their mean weight was 3059 g. during 2 weeks of adaptation, the animals were fed with the specialized lsm diet (1474 kj/100 g, 17.6% agropol motycz, lublin, poland) and ad libitum drinking water . The doses used in the study were: tacrolimus (prograf, astellas pharma, warsaw, poland): 4 mg / kg / day; mmf (cellcept, roche registration limited, welwyn garden city, great britain): 20 mg / kg / day; cya (sandimmune neoral, novartis pharma gmbh, nrnberg, germany): 5 mg / kg / day; rapamycin (rapamune, wyeth, new lane havant hants, great britain): 0.5 mg / kg / day; and prednisone (encorton, polfa, pabianice, poland): 4 mg / kg / day . The animals received medication every 24 h for 6 months . After 3 months the animals were weighed again, and each medication dose was adjusted based on body weight . Thirty - four rats completed the study and 2 rats from the crg (cyclosporine a, rapamycin, glucocorticosteroids) group died before the end of the study . After 6 months, the animals were anesthetized by intraperitoneal ketamine hydrochloride injection (50 mg / kg) and blood samples were collected . At the same time, tissue samples (kidneys) of rats were taken for analysis in a separate study . The concentration of drug was determined after 4 h of enteral drug administration in accordance with the literature data . Rapamycin concentration was determined in the whole blood of rats collected into edta tubes by hplc - uv method with extraction of 1-chlorobutane and 32-desmethoxyrapamycin as an internal standard . A hewlett - packard 1050 instrument equipped with alltech alltima c18 column 1502.1 mm, 5 the flow rate of the mobile phase containing 60% acetonitrile and 40% water was 0.5 ml / min, and the uv detector wavelength was established at 278 nm . The limit of quantitation was 1 ng / ml . The concentration of tacrolimus and cya was determined in the whole blood of rats using imx assay based on microparticle enzyme immunoassay (meia). The assay was performed using abbott equipment (abbott laboratories, park, usa). The concentration of cya was determined with the use of abbott axsym assay, based on a fluorescence method (fpia, fluorescence polarization immunoassay). The concentrations of the drugs were: cyclosporin a (ng / ml) 785.283.3 (ng / ml) in the cmg group, tacrolimus 14.113.1 (ng / ml) in the tmg group, tacrolimus 15.39.2 (ng / ml) and rapamycin 6.52.4 (ng / ml) in the trg group, cyclosporin a 1272556.7 (ng / ml) and rapamycin 6.34.4 (ng / ml) in the crg group, and rapamycin 2.32.1 (ng / ml) in the mrg group . Separation of proteins was carried out using sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) under denaturing conditions, according to the procedure described by laemmli . Plasma was suspended in a solution containing 0.25 m tris - hcl buffer, ph 6.8, 10% sds, and 0.5 m dtt, incubated at 94c for 5 min . The acrylamide concentration of stacking and resolving gels were 4% and 10%, respectively . The separation was carried out at ambient temperature and at a voltage of 60 v for the stacking gel and 120 v for the resolving gel . Subsequently, the gels were stained with 0.1% coomassie brilliant blue suspended in 10% acetic acid and 50% methanol . The separation of proteins was conducted using the mini - protean (bio - rad) system, and the analyses of gels were performed using kte gelscan (kucharczyk te) program . The following ready - to - use kits were used for determination: tim-1/kim-1/havcr immunoassay rat (catalogue number rkm100, r&d systems, minneapolis, usa). Rat mcp-1 instant elisa (catalogue number bms631inst, ebioscience, vienna austria). The values of continuous variables were compared between groups using nonparametric tests (u - mann - whitney test) because most of the variables were non - normally distributed (as evidenced by shapiro - wilk test). The mean, standard deviation, median, minimum, and maximum values were calculated for each group . To evaluate the correlation between continuous variables, nonparametric spearman the cut - off level of statistical significance was set at p<0.05 for bilateral statistical hypothesis tests . We used 36 male wistar rats obtained from a licensed breeder (the institute of occupational medicine in lodz, poland). At the beginning of the study, the study was approved by the local ethics committee for experiments on animals in szczecin (no . The animals were housed in cages, with 6 rats per cage, in the animal facility of pomeranian medical university . The lighting, on a 12/12-h cycle, was controlled by automatic timers . Before the study, all animals were weighed, and their mean weight was 3059 g. during 2 weeks of adaptation, the animals were fed with the specialized lsm diet (1474 kj/100 g, 17.6% agropol motycz, lublin, poland) and ad libitum drinking water . The doses used in the study were: tacrolimus (prograf, astellas pharma, warsaw, poland): 4 mg / kg / day; mmf (cellcept, roche registration limited, welwyn garden city, great britain): 20 mg / kg / day; cya (sandimmune neoral, novartis pharma gmbh, nrnberg, germany): 5 mg / kg / day; rapamycin (rapamune, wyeth, new lane havant hants, great britain): 0.5 mg / kg / day; and prednisone (encorton, polfa, pabianice, poland): 4 mg / kg / day . The animals received medication every 24 h for 6 months . After 3 months the animals were weighed again, and each medication dose was adjusted based on body weight . Thirty - four rats completed the study and 2 rats from the crg (cyclosporine a, rapamycin, glucocorticosteroids) group died before the end of the study . After 6 months, the animals were anesthetized by intraperitoneal ketamine hydrochloride injection (50 mg / kg) and blood samples were collected . At the same time, tissue samples (kidneys) of rats were taken for analysis in a separate study . The concentration of drug was determined after 4 h of enteral drug administration in accordance with the literature data . Rapamycin concentration was determined in the whole blood of rats collected into edta tubes by hplc - uv method with extraction of 1-chlorobutane and 32-desmethoxyrapamycin as an internal standard . A hewlett - packard 1050 instrument equipped with alltech alltima c18 column 1502.1 mm, 5 the flow rate of the mobile phase containing 60% acetonitrile and 40% water was 0.5 ml / min, and the uv detector wavelength was established at 278 nm . The limit of quantitation was 1 ng / ml . The concentration of tacrolimus and cya was determined in the whole blood of rats using imx assay based on microparticle enzyme immunoassay (meia). The assay was performed using abbott equipment (abbott laboratories, park, usa). The concentration of cya was determined with the use of abbott axsym assay, based on a fluorescence method (fpia, fluorescence polarization immunoassay). The concentrations of the drugs were: cyclosporin a (ng / ml) 785.283.3 (ng / ml) in the cmg group, tacrolimus 14.113.1 (ng / ml) in the tmg group, tacrolimus 15.39.2 (ng / ml) and rapamycin 6.52.4 (ng / ml) in the trg group, cyclosporin a 1272556.7 (ng / ml) and rapamycin 6.34.4 (ng / ml) in the crg group, and rapamycin 2.32.1 (ng / ml) in the mrg group . Separation of proteins was carried out using sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page) under denaturing conditions, according to the procedure described by laemmli . Plasma was suspended in a solution containing 0.25 m tris - hcl buffer, ph 6.8, 10% sds, and 0.5 m dtt, incubated at 94c for 5 min . The acrylamide concentration of stacking and resolving gels were 4% and 10%, respectively . The separation was carried out at ambient temperature and at a voltage of 60 v for the stacking gel and 120 v for the resolving gel . Subsequently, the gels were stained with 0.1% coomassie brilliant blue suspended in 10% acetic acid and 50% methanol . The separation of proteins was conducted using the mini - protean (bio - rad) system, and the analyses of gels were performed using kte gelscan (kucharczyk te) program . The following ready - to - use kits were used for determination: tim-1/kim-1/havcr immunoassay rat (catalogue number rkm100, r&d systems, minneapolis, usa). Rat mcp-1 instant elisa (catalogue number bms631inst, ebioscience, vienna austria). The values of continuous variables were compared between groups using nonparametric tests (u - mann - whitney test) because most of the variables were non - normally distributed (as evidenced by shapiro - wilk test). The mean, standard deviation, median, minimum, and maximum values were calculated for each group . To evaluate the correlation between continuous variables, nonparametric spearman the cut - off level of statistical significance was set at p<0.05 for bilateral statistical hypothesis tests . As shown in our previous studies (kedzierska et al .) The immunosuppressive drugs used in popular regimens induce a series of changes in protein expression in target organs (e.g., kidneys). Our team (kedzierska et al .) Found that the apoptosis in nephron tubules caused by immunosuppressive therapy in the same study group is not accompanied by any histopathological changes (e.g., fibrosis, inflammation, tubular atrophy, and vacuolation of the tubular cells) seen in light microscopy . In a recent study the 22 plasma proteins occurring in the highest quantities were divided into 7 fractions (figures 1 and 2; tables 2, 3a, 3b), with molecular mass given in kda as the division criterion . The differences involved the proteins with masses of 195 kda, 170 kda, 103 kda, and 58 kda (anova p=0.05, p=0.01, p=0.02, and p=0.04, respectively). The 48-kda protein was present in higher concentrations in the control group compared to the mrg (mycophenolate mofetil, rapamycin, glucocorticosteroids) and cmg (cyclosporine a, mycophenolate mofetil, glucocorticosteroids) groups (p<0.05 and p<0.05). In the control group, concentration of 58-kda protein was significantly lower compared to trg (tacrolimus, rapamycin, glucocorticosteroids) (p<0.05), cmg (p<0.01), and tmg (tacrolimus, mycophenolate mofetil, glucocorticosteroids) (p<0.05) groups . The 88-kda protein was found in lower concentrations in the tmg group as compared to the control group (p<0.05), as was 66-kda protein (p<0.05 tmg vs. control). Presence of 103-kda protein was found in higher concentrations in the control group as compared to the mrg group (p<0.05). Presence of 108-kda protein was found in higher concentrations in the crg group compared to the control group (p<0.05) (table 3a). The 146-kda protein was found in lower concentrations in the control group as compared to the crg study group (p<0.05). Presence of 154-kda protein was found in higher concentrations in the control group as compared to the trg, mrg, cmg, and tmg groups (p<0.05). The 170-kda protein was found in lower concentrations in the control group compared to the crg (p<0.05), cmg, and tmg (both p<0.01) groups . The 195-kda protein was present in higher concentrations in the control group compared to the cmg group (p<0.05) (table 3b). In the next stage of the analysis, a comparison was made of the immunosuppressive regimens applied and their effect on the concentration of plasma protein fractions . The use of regimens based on cya (crg and cmg) was associated with the occurrence of a higher concentrations of 203-, 170-, and 108-kda plasma proteins (p<0.04, <0.01 and <0.05, respectively), whereas the amount of 54-kda protein was significantly reduced compared to the groups treated with regimens devoid of cya (trg, tmg, and mrg) (p<0.05) (table 4). In the plasma of rats collected from the groups treated with tacrolimus (the trg and tmg groups), we found decreased levels of the 108-kda protein and increased levels of the 103-kda protein (p <0.02 and 0.03, respectively) (table 5) compared to the groups without drug treatment (crg, cmg, and mrg). Compared to other regimens, treatment with a set of drugs including rapamycin (crg, mrg, and trg) had the greatest effect on the change of the parameters studied . The content of plasma proteins in the groups receiving rapamycin was higher compared to the groups without rapamycin (cmg and tmg) in terms of proteins size 195 kda, 88 kda, 66 kda, and 37 kda (p<0.04, p<0.03, p<0.0,3 and p<0.04, respectively), and was lower in terms of proteins size 170 kda, 103 kda, 79 kda, and 58 kda (p<0.001, p<0.01, p<0.05, and p<0.001, respectively) (table 6). Treatment based on the administration of mmf (tmg, cmg, and mrg) along with other regimens had the lowest effect on the change of the parameters studied . There was no correlation between morphology, creatinine, e - gfr, or histology of rat kidneys and plasma protein, and plasma protein was not correlated with serum calcium or urine test results . In the next stage of the study we analyzed the concentration of kim and mcp-1 in rat plasma as well as the correlation between rat plasma proteins and markers of kidney damage . Kim-1 (kidney injury molecule-1) concentration was determined in the plasma of rats, and significant differences between the groups (p=0.05) were found (table 7). The highest value of kim-1 was found in the cmg group and it was significantly higher than in the control group (mann - whitney test, p<0.05). The concentration of mcp-1 (monocyte chemoattractant protein-1) in the plasma of rats was also significantly different between the groups (p<0.001). In the mrg group, it was significantly lower compared to the control group (p<0.05), whereas in the tmg group, the concentration was significantly higher in comparison to the control group (p<0.01). The concentration of kim-1 was inversely correlated with 66 kda and 137 kda proteins and positively correlated with 170 kda protein (figure 3). Mcp-1 was inversely correlated with 37 kda, 120 kda, and 146 kda proteins (p<0.001). In a separate study by our team (kedzierska et al . ), we analyzed the impact of the most commonly used immunosuppressive drugs on protein expression in the native kidneys of wistar rats . We found that the immunosuppressive drugs used in popular regimens induce a series of changes in protein expression in target organs . The expression of proteins involved in drug, glucose, amino acid, and lipid metabolism was pronounced . To a lesser extent very slight differences were observed between the group receiving cyclosporine, mycophenolate mofetil, and glucocorticoids (cmg) and the control group . In contrast, compared to the control group, animals receiving tacrolimus, mycophenolate mofetil, and glucocorticoids (tmg) exhibited higher expression of proteins responsible for renal drug metabolism and lower expression levels of cytoplasmic actin and the major urinary protein . In the tmg group, we observed higher expression of proteins responsible for drug metabolism and a decrease in the expression of respiratory chain enzymes (thioredoxin-2) and markers of distal renal tubular damage (heart fatty acid - binding protein) compared to expression in the cmg group . In the present study, 22 proteins were isolated from rat plasma from both the study groups and the control group, which were further divided into 7 fractions, depending on the molecular mass [kda]. Because of the large number of proteins found in the plasma (several thousand), which would impair the readout of hard - to - observe differences between proteins, 2-dimensional (2d) electrophoresis could not be performed . Statistically significant differences were observed between concentrations of proteins within all the studied groups and the control group . These differences were related to 195 kda, 170 kda, 103 kda, and 58 kda proteins . A protein with a mass of 195 kda may correspond to c4 complement (whole molecule). A 103-kda protein may correspond to the inter a - h4p inhibitor (heavy chain), the 170-kda protein is most probably a 2-macroglobulin, and the 58-kda protein may correspond to a chain of tgf or c1 protease inhibitor . The concentration of 195-kda protein (probably a c4 complement) was higher in the control group; however, its concentration in the cmg and tmg study groups was very low . The 170-kda protein, which is most likely an 2-macroglobulin, which is an acute - phase protein in rats, relative to crp, was at significantly higher concentration in the rat plasma collected from the study groups compared to the control group . In older rats, the concentrations of 2-macroglobulin and other parameters of the acute phase were increased, and the concentration of albumin was decreased . In the study groups, no differences in the concentration of protein corresponding to albumin (66 kda) were observed, except for the tmg group, in which the concentration was significantly decreased compared to the control group . There was a significant increase in the concentration of 58-kda protein in almost all the studied groups except for the mrg and control groups . The 48-kda protein was reported in the highest concentration in the control group, while in the remaining groups it was found at a very low level; however, due to the large variation, statistical significance was only observed between the control group and the mrg and cmg groups . Reported an elevated concentration of plasma kininogen and its fragments in patients with microalbuminuria during the course of type i diabetes . These are very small proteins (~3 kda), which were detected using mass spectrometry technique; unfortunately, the electrophoresis method, which was used in this study, is not sensitive enough to detect such small proteins . However, proteins with masses of 70 kda and 46 kda, which may correspond to low- and high - molecular - weight kininogen in rats, were detected in our study . The concentration of 48-kda protein (possibly a low - molecular - weight kininogen) was significantly different between the experimental groups and the control group . Observed the correlation of apolipoprotein h, 1 microglobulin, 2 microglobulin of factor vii, and chromogranin a with increased risk of chronic kidney disease development in the third stadium . Moreover, elevated levels of these proteins were found in patients who received tacrolimus and cya in monotherapy after liver transplantation . In another study, the effect of atorvastatin on lipid profile and plasma protein composition in patients after kidney transplantation was observed . It was found that treatment with statins may decrease the concentration of certain serum proteins, and patients receiving steroids, cya, tacrolimus, mmf, and azathioprine exhibit higher concentrations of high - molecular - weight kininogen fragment (bradykinin) and c4 complement . We also examined the effect of drugs used in immunosuppressive regimens on the concentration of plasma proteins, but we excluded the control group from this part of the study . Most studies on the protein markers of acute kidney injury, ckd, nephrotoxicity of immunosuppressive drugs, and acute rejection of renal transplant were conducted using mass spectrometry technique in renal tissue and urine, but not in plasma . In the present study, we observed that among all the drugs tested, only mmf used in various regimens usually had no effect on the concentrations of proteins analyzed using sds - page technique . In the rat plasma collected from the groups in which tacrolimus was administered, both decreased and increased proportions of 108-kda and 103-kda proteins, respectively, were observed . Regimens based on cya had higher concentrations of plasma proteins with masses of 203 kda, 170 kda, and 108 kda, whereas the concentration of 54-kda protein was significantly decreased compared to the groups treated with regimens devoid of cya . The concentrations of proteins with masses of 195 kda, 88 kda, 66 kda, and 37 kda were higher, while the concentrations of proteins with masses of 170 kda, 103 kda, 79 kda, and 58 kda were lower compared to the groups devoid of rapamycin . Three proteins, with masses of 170 kda, 108 kda, and 103 kda, were interesting in terms of their mobility . A 170-kda protein (possibly an 2-macroglobulin) was found at significantly higher concentrations in the groups treated with cya, and the 103-kda protein (possibly an inter a - h4p inhibitor, heavy chain) had elevated levels in the groups in which tacrolimus was administered . In the groups in which rapamycin was administered, decreased concentrations of 170- and 103-kda proteins were observed . We found a positive correlation between kim and 170-kda protein, which could correspond to alpha-2 macroglobulin in rats . Alpha-2-macroglobulin is a typical acute - phase protein in rats . In our study groups, kim-1 levels were higher in rats treated with cya and lower in rats treated with rapamycin . Kim-1 in plasma is very sensitive and is a specific marker of acute kidney damage in many rat models (e.g., streptozotocin - induced diabetic nephropathy). Kim-1 is a marker of kidney damage, especially for the proximal tubule, and is useful in the monitoring of acute kidney damage, as well as in renal diseases characterized by interstitial fibrosis and primary and secondary glomerulonephritis . We found that higher release of 170-kda protein and kim-1 concentration in rat plasma was associated with cyclosporine a treatment compared to rapamycin . Although histopathology of kidneys did not show significant differences between study groups, we think our finding is interesting . Our experiment was terminated when our rats were 9 months old; the average lifetime of a wistar rat is 2436 months . Another interesting finding in our study was the multiple negative correlations between mcp-1 and 37-kda, 120-kda, and 146-kda protein (p <0.001). This negative correlation may indicate the strong effect of rapamycin on decreased mcp-1 synthesis and increased production of other proteins in our study groups of rats compared to rats treated with tacrolimus . The meaning of this finding is unknown because there are no relevant studies for comparison . Mcp-1 influences the activation and migration of monocytes, macrophages, and t lymphocytes into the tubulo - interstitial space of kidneys and plays an important role in renal fibrosis . Wu et al . Observed a decrease in the concentration of mcp-1 after treatment with mmf (mycophenolate mofetil). In our study, in the experimental groups of rats, no effect of mmf on the activity of mcp-1 was observed . The level of mcp-1 in rats treated with regimens based on rapamycin was significantly lower in comparison to the groups without rapamycin . In rats treated with regimens based on tacrolimus, significantly higher mcp-1 was observed in comparison to the rats that did not receive tacrolimus . As in our study, lui et al . Demonstrated the influence of rapamycin on the inhibition of mcp-1 expression in the kidneys of mice, and lee et al . Experimentally confirmed, on endothelial cells of the proximal tubules, that rapamycin inhibits stress in the endoplasmic reticulum and indirectly reduces the expression of mcp-1 . Moreover, oliveira et al . Found that rapamycin inhibits the production of cytokines, including mcp-1, much more strongly in comparison to mmf . A 108-kda protein (bone morphogenetic protein bmp-1, probably endothelial lipase) was present at both increased and decreased concentrations in rats treated with regimens based on cya and tacrolimus, respectively . Shu et al . Conducted an experiment in which cya at a low (5 mg / kg) or high (100 mg / kg) dose was administered to rats . As compared to the control group, changes were only reported in rats receiving higher dose of cya . The authors found an increased concentration of 2 plasma proteins: clusterin (51 kda) and alpha-1 acid glycoprotein (23 kda). As compared to the control group, a decreased concentration of haptoglobin, a plasma protein with a mass of 38 kda, was reported . Taking into account all correlations detected in the studied groups of rats, we consider proteins with masses of 48 kda, 146 kda, and 170 kda as the most promising to become novel markers of toxicity in plasma during the course of immunosuppressive therapy in rats . Immunosuppressive drugs cause changes in the proteinogram of plasma proteins . In the groups with regimens based on cya, higher kim-1 concentration was found and kim-1 was positively correlated to 170 kda protein (alpha2-macroglobulin). The use of rapamycin was associated with decreased concentrations of mcp-1 in plasma and mcp-1 in plasma was negatively correlated to 37-kda, 120-kda, and 146-kda proteins the strongest effect on plasma proteins in rats was shown by regimens based on rapamycin; intermediate, weak, and the weakest effects were reported for regimens based on cya, tacrolimus, and mmf, respectively.
Only 10%20% of patients with pancreatic cancer qualify for surgery and the prognosis of this disease is poor; median survival for patients undergoing surgery ranges from 20 to 23 months . For patients receiving solely chemotherapy, survival approximately ranges from 3 to 11 months . With this limited prognosis, there is a high and urgent need for new therapies to improve outcome . Smoking, obesity, and type 2 diabetes are considered to be important risk factors for the development of pancreatic cancer . Metformin is the first - line treatment for patients with type 2 diabetes and is therefore the most prescribed oral glucose - lowering drug (ogld). The decision to prescribe metformin depends on patient characteristics; metformin use is contraindicated in patients with renal failure, cardiac dysfunction, and hepatic insufficiency . Metformin is a biguanide antihyperglycemic agent and has 3 working mechanisms: it decreases the hepatic glucose production by inhibition of gluconeogenesis and glycogenolysis in muscles, it subsequently improves peripheral insulin sensitivity, and reduces glucose absorption . Mouse models suggest that metformin could inhibit the proliferation of xenografted human pancreatic cancer cells within 30 days, but other studies point toward a systemic effect of metformin on cancer by improving the metabolic profile of patients, rather than a direct effect on tumor cells . Recent epidemiologic cohort studies in patients with type 2 diabetes have suggested that patients using metformin have a decreased risk of developing cancer and, possibly, a reduced cancer mortality . Several meta - analysis pointed out that the reduced cancer incidence was not present in all types of cancer; use of metformin seems to be associated with a reduced risk of developing cancer in patients with pancreatic, colorectal, and hepatocellular cancer, with conflicting results for breast cancer, and no association is seen in patients with lung and prostate cancers . Preceding epidemiologic studies assessing the effect of metformin on the risk of cancer and survival may have been subject to several time - related biases, for example, misclassifying exposure to metformin, which could have inflated the estimates . What additionally complicates observational studies on this subject, is that patients using metformin often have other comorbidities supplementary to type 2 diabetes, compared with nonusers . Alternative treatment for type 2 diabetes are sulfonylurea derivatives (sd) which have been used previously as a comparator group in addition to nonusers . The aim of this study was to assess the association between the use of metformin and overall survival in patients with pancreatic cancer with the use of appropriate methodology, a pitfall of the previous studies . Data from the eindhoven cancer registry (ecr) were linked on patient level to the pharmo database network covering a demographic region in the south - eastern part of the netherlands of 1.5 million inhabitants . The ecr is maintained by the netherlands comprehensive cancer organisation and registers newly diagnosed cancer patients from 10 different hospitals located in this region . Patients are informed about this registration and are registered except patients who objected to be registered . The netherlands cancer registry is obliged to work according to the law about protection of privacy data and all procedures to privacy of doctors and patients is fixed in regulations . An independent committee of privacy reassures that the netherlands cancer registry is compliant to these regulations . The pharmo database network is a population - based network of healthcare databases and combines data from different healthcare settings in the netherlands . For this study, the outpatient pharmacy database is used containing drug - dispensing records from community pharmacies . All dispensed drugs are coded according to the anatomical therapeutic chemical (atc) classification (www.whocc.no/atc_ddd_index), and the records include information on type of product, date, dosage, and quantity . All patients diagnosed with a malignancy of the pancreas (classified according to the international statistical classification of diseases and related health problems 10th revision code c-25) between 1998 and 2011 were selected from the ecr - pharmo cohort . To reduce confounding by indication, metformin users were, in addition to nonusers, compared with sd users . Excluded were malignancies with the following morphology: squamous cell carcinoma, epithelial carcinoma, cystic / mucinous / serous carcinoma, or gastrointestinal stromal tumor because of the differences in disease course . Patients using metformin (atc - code: a10ba02) or sd (atc - code: a10bb) for at least 30 days were defined as users . Users were defined as patients using metformin before and after diagnosis, or only after diagnosis, and not using contemporary sd users . The period of metformin or sd use was defined from the first dispensing of metformin or sd to the end of the follow - up period . Follow - up time was determined from date of diagnosis (t0) until death or end of the study period at 31 december 2012 . Cancer registry data were linked to municipal population registries to obtain vital status . To determine time - dependent exposure, patients were defined as nonusers from t0 to the date of first metformin or sd use . Differences in patient characteristics between metformin users and nonusers and between metformin users and sd users were analyzed using the independent samples t - test and the chi square test . A kaplan meier survival curve was constructed to compare overall survival between patients using metformin, sd, and nonusers . A parametric survival model with exponential (poisson) distribution was used to model the effect of metformin use on overall survival, where death of any cause was coded as event . Metformin use and sd use were included as time - varying covariates in the model . Adjustments were made for age, number of comorbidities (0, 1, or 2, excluding diabetes mellitus), tumor - node - metastasis (tnm) stage (categorical), year of diagnosis (19982003, 20042007, and 20082011), surgery (yes / no), chemotherapy (yes / no), and radiotherapy (yes / no). Information about comorbidities was available for lung disease, cardiovascular disease, diabetes, disorders of the gastrointestinal tract, urinary tract, nervous system, musculoskeletal system, and a group of other comorbidities . The difference between overall survival in metformin users and sd users was analyzed with the same model that was used for the analysis of metformin versus nonusers . The results of the model should be interpreted as a favorable association with survival when the result shows a rate ratio <1 in relation to the comparison group . Statistical tests were 2-sided and considered significant at the p <0.05 level . Data from the eindhoven cancer registry (ecr) were linked on patient level to the pharmo database network covering a demographic region in the south - eastern part of the netherlands of 1.5 million inhabitants . The ecr is maintained by the netherlands comprehensive cancer organisation and registers newly diagnosed cancer patients from 10 different hospitals located in this region . Patients are informed about this registration and are registered except patients who objected to be registered . The netherlands cancer registry is obliged to work according to the law about protection of privacy data and all procedures to privacy of doctors and patients is fixed in regulations . An independent committee of privacy reassures that the netherlands cancer registry is compliant to these regulations . The pharmo database network is a population - based network of healthcare databases and combines data from different healthcare settings in the netherlands . For this study, the outpatient pharmacy database is used containing drug - dispensing records from community pharmacies . All dispensed drugs are coded according to the anatomical therapeutic chemical (atc) classification (www.whocc.no/atc_ddd_index), and the records include information on type of product, date, dosage, and quantity . All patients diagnosed with a malignancy of the pancreas (classified according to the international statistical classification of diseases and related health problems 10th revision code c-25) between 1998 and 2011 were selected from the ecr - pharmo cohort . To reduce confounding by indication, metformin users were, in addition to nonusers, compared with sd users . Excluded were malignancies with the following morphology: squamous cell carcinoma, epithelial carcinoma, cystic / mucinous / serous carcinoma, or gastrointestinal stromal tumor because of the differences in disease course . Patients using metformin (atc - code: a10ba02) or sd (atc - code: a10bb) for at least 30 days were defined as users . Users were defined as patients using metformin before and after diagnosis, or only after diagnosis, and not using contemporary sd users . The period of metformin or sd use was defined from the first dispensing of metformin or sd to the end of the follow - up period . Follow - up time was determined from date of diagnosis (t0) until death or end of the study period at 31 december 2012 . Cancer registry data were linked to municipal population registries to obtain vital status . To determine time - dependent exposure, patients were defined as nonusers from t0 to the date of first metformin or sd use . Differences in patient characteristics between metformin users and nonusers and between metformin users and sd users were analyzed using the independent samples t - test and the chi square test . A kaplan meier survival curve was constructed to compare overall survival between patients using metformin, sd, and nonusers . A parametric survival model with exponential (poisson) distribution was used to model the effect of metformin use on overall survival, where death of any cause was coded as event . Metformin use and sd use were included as time - varying covariates in the model . Adjustments were made for age, number of comorbidities (0, 1, or 2, excluding diabetes mellitus), tumor - node - metastasis (tnm) stage (categorical), year of diagnosis (19982003, 20042007, and 20082011), surgery (yes / no), chemotherapy (yes / no), and radiotherapy (yes / no). Information about comorbidities was available for lung disease, cardiovascular disease, diabetes, disorders of the gastrointestinal tract, urinary tract, nervous system, musculoskeletal system, and a group of other comorbidities . The difference between overall survival in metformin users and sd users was analyzed with the same model that was used for the analysis of metformin versus nonusers . The results of the model should be interpreted as a favorable association with survival when the result shows a rate ratio <1 in relation to the comparison group . Statistical tests were 2-sided and considered significant at the p <0.05 level . In total, 1111 patients with pancreatic cancer were diagnosed in the period 19982011; 91 patients were excluded because of morphology (as described above) and 48 patients were excluded because of using merely metformin before diagnosis (fig . 1, flow chart of the study population). This resulted in a study population of 907 patients, of which 77 patients used metformin and 43 used sd as drug for diabetes type 2 . 863 events were reported . In the metformin group, 64 patients deceased during study period, and in the sd group 41 patients deceased . There were no significant differences between the groups concerning tnm stage and treatment (chemotherapy, radiotherapy, and surgery). Metformin users had more additional comorbidities (p <0.001) compared with both nonusers and sd users . Incidence of diabetes did not differ between the group of metformin users and sd users . Contemporary insulin use was 36% for metformin users versus 33% among patients using sd (p = 0.70). Patients who used metformin were diagnosed in more recent years than sd users or nonusers (p <0.001). Finally, median survival of metformin users was 5.7 months (interquartile range [iqr]: 2.214.7), sd users had a median survival of 6.0 (iqr: 1.621.2) months, whereas nonusers had a median survival of 4.0 months (iqr: 1.59.2). Characteristics of the cohort . For all patients with pancreatic cancer, metformin use was associated with an improved overall survival compared with patients not using metformin, rate ratio (rr) 0.76 (95% ci: 0.590.98; p = 0.04; table 2). This association was no longer significant after adjusting for age, number of comorbidities, stage, year of diagnosis, surgery, chemotherapy, and radiotherapy . Multivariable rr for metformin users compared with nonusers was 0.86 (95% ci: 0.661.12; p = 0.26). Overall survival was additionally assessed between the following 3 groups: patients not using ogld, metformin users, and sd users (fig . 2, table 2). Overall survival for metformin users versus nonusers was rr 0.74 (95% ci: 0.570.95 the rr for overall survival of metformin users versus nonusers was 0.85 (95% ci: 0.651.11; p = 0.23). Overall survival for sd users compared with nonusers was rr = 0.60 (95% ci: 0.440.82; p = 0.001), and multivariable analysis showed an rr = 0.82 (95% ci: 0.591.13; p = 0.23). Meier estimation of survival curves in patients with pancreatic cancer grouped according to medication use . Rr was 0.78 (95% ci: 0.531.15; p = 0.21) and adjusted rr was 0.86 (95% ci: 0.501.46; p = 0.57). This retrospective, observational cohort study showed no association between the use of metformin and overall survival in patients with pancreatic cancer . These studies found no association between the use of metformin and survival in patients with (advanced) pancreatic cancer; however, these studies were only done in respectively 44 and 516 patients with type 2 diabetes mellitus . Similarly, 2 recently published randomized controlled trials carried out in 121 patients in the netherlands and 60 patients in italy also showed no effect of metformin on survival . Despite differences in design, such as cancer stage, chemotherapy regime, blinding, and use of placebo, both trials show a consistent no effect of metformin on survival in patients with advanced pancreatic cancer . The results of the randomized controlled trials and our study are in conflict with numerous other observational studies describing a beneficial effect of metformin, not only in pancreatic cancer . Mortality decrease for patients with pancreatic cancer using metformin was consistently 27%40% in previous studies; however, these cohorts were smaller than the cohort that was analyzed in this study, with respectively 302, 764, and 349 patients who were analyzed . This discrepancy could be partly explained by the difference in methodology . Suissa and azoulay studied the effect of time - related biases in observational drug studies of metformin on cancer . These studies could not demonstrate any association between metformin and cancer incidence or the observed incidence reduction was considerably smaller than previous results . Another explanation could be the high number of patients with irresectable pancreatic cancer (89%) in our study, whereas other studies found a survival benefit in patients with resectable pancreatic cancer . In addition, differences in patient characteristics could partly explain the results of our study . Patients using sd had less comorbidities than metformin users . Before 2006, the guidelines recommended prescription of metformin for patients with a body mass index (bmi)> 27 . It could therefore be possible that a majority of the patients who were prescribed metformin (35%) before 2006 were overweight . Obese patients have a worse prognosis and overall survival, partly because of a higher risk surgical risk . This observation could also partly explain the observed trend toward a better survival for patients using sd, however no information on bmi was available in the present dataset . For the direct action of metformin on cancer cells, the effective drug concentrations achieved in neoplastic tissue are crucial . It is possible that the required concentration in the target tissue is not attained with the present dose of metformin . Because of the retrospective nature of this study, no information is available about sufficient concentrations of the effect on tumor cells . The dutch randomized controlled trial has also addressed this aspect, where an effect on survival was found in a subset of patients reaching adequate insulin level decrease . First, this is one of the largest cohorts so far to analyze the association between the use of metformin and survival in patients with pancreatic cancer . Second, our data are linked through 2 validated databases ecr and pharmo preventing both recall and information bias . Third, this is the first observational study adressing the association between the use of metformin and overall survival in patients with pancreatic cancer, taking into account the time between the beginning of the follow up and the first drug prescription, which prevents time - related biases . Not including the time - varying covariate in our model also revealed a highly significant survival benefit for metformin users . Additionally, metformin users were compared with sd users, a group of patients with a more similar baseline prognosis . Lastly, previous articles focused on the effect of metformin on overall survival limited to patients with pancreatic cancer and type 2 diabetes, whereas this study included all patients with pancreatic cancer . A limitation to this observational study could be the small number of patients who received ogld in a large cohort, which also complicated a subgroup analysis, for example, in patients who underwent a resection . Only 43 patients were solely using sd, and because of this small number of users, no robust statements can be made . However, because of the wide interest in a growing field, this remains a relevant study, complementing the existing evidence . Moreover, because of the retrospective nature of the study, the amount of information available is limited . There is no detailed information about the population such as smoking, bmi, glycemic control, or cause of death . It could hypothetically be possible that the nonsignificant relative risk reduction of 15% found in the adjusted analysis was not significant due to a lack of power . However, in the randomized controlled trials recently published, no effect of metformin on survival of patients with pancreatic cancer could be proven, and these trials were of course designed with a power calculation . This observational study contributes to the mounting evidence against an association between improved survival in patients with pancreatic cancer using metformin . These findings could discourage new trials to be designed for metformin as adjuvant therapy in pancreatic cancer, as this disease is generally discovered in an advanced stage were the anti - tumor effect of metformin will not be able to sufficiently inhibit tumor growth . However, this study does not exclude the opportunity that metformin could be a valuable adjuvant therapy in other cancer types or only in patients with resectable, early stage pancreatic cancer . Nowadays, new oncology drugs are very expensive and drug repurposing is an attractive strategy to offer more effective options for patients with cancer.
Lower urinary tract symptoms (luts) due to benign prostatic hyperplasia (bph) are one of the most common diseases in elderly males . Patients in general are prescribed an alpha - blocker first and then, if necessary, are treated by transurethral resection of the prostate (turp) if not enough response to the alpha - blocker is shown . Turp has been accepted as the gold standard for the surgical management of symptomatic bph . Even though several excellent alpha - blockers are in use, some patients with severe luts require surgical therapy . Our county's guidelines recommend surgical management for patients with bph with repeated urinary retention or bladder stone formation . Recently, surgical therapy has come to include methods thought to be relatively less invasive than turp . These new methods have resulted in lower morbidity and excellent improvements in voiding and storage symptoms . For example, holmium laser enucleation of the prostate (holep) has become a widespread and well - accepted treatment modality with excellent outcomes compared to other conventional treatment modalities such as turp and open prostatectomy . Because this surgical procedure is comparatively new, surgeons tend to concentrate on the completion of the surgery, and most previous reports regarding holep have described the efficacy of the procedure for patients' urination . As a next step, surgeons need to consider whether this procedure can be performed safely with a comparatively lower rate of adverse events than turp . This new technique should not only be less invasive and offer better efficacy for urination but also show a lower ratio of adverse events, especially in terms of postoperative infectious diseases . In this study, we retrospectively examined the incidence of postoperative infectious complications (pics) in our early experience with holep for bph with a particular focus on the kind and duration of prophylactic antibiotic administration (paa). A retrospective study was conducted in 90 patients complaining of luts who underwent holep combined with morcellation at our institute between february 2008 and march 2011 . Briefly, a modified 26-fr continuous - flow resectoscope (karl storz gmbh & co., tuttlingen, germany) was used for enucleation of the prostate . A 550-m end - firing laser fiber (slimline 550; lumenis inc ., yoqneam, israel) was engaged with an 80 w holmium: yttrium - aluminum - garnet laser (versapulse select, lumenis inc ., energy power was usually set at 72 to 80 w (1.8 to 2.4 j and 30 to 40 hz) and at 0.2 j and 40 hz for hemostasis . Tissue morcellation was performed with a versacut morcellator (versacut system, lumenis inc .) Through a 6-degree rectangular nephroscope (karl storz gmbh & co.). During the transurethral procedure, the outer sheath was always in the urethra, because the resectoscope and nephroscope were exchangeable in the outer sheath . After completion of the morcellation, a urethral catheter was inserted for continuous bladder irrigation with normal saline . The kind and the dosing duration of paa were based on the physicians' discretion . Pics were diagnosed according to the centers for disease control and prevention (cdc) guidelines; in short, a pic was defined as a febrile (body temperature 38) complication caused by a surgical procedure at a surgical site, such as urinary tract infection (uti), that occurred within 30 days after surgery . We analyzed the relationship between the emergence of pics and the kind or duration of paa . Statistical analysis was conducted with the jstat java virtual machine statistics monitoring tool with use of the chi - square test (sun microsystems inc ., santa clara, ca, usa). A retrospective study was conducted in 90 patients complaining of luts who underwent holep combined with morcellation at our institute between february 2008 and march 2011 . Briefly, a modified 26-fr continuous - flow resectoscope (karl storz gmbh & co., tuttlingen, germany) was used for enucleation of the prostate . A 550-m end - firing laser fiber (slimline 550; lumenis inc ., yoqneam, israel) was engaged with an 80 w holmium: yttrium - aluminum - garnet laser (versapulse select, lumenis inc ., energy power was usually set at 72 to 80 w (1.8 to 2.4 j and 30 to 40 hz) and at 0.2 j and 40 hz for hemostasis . Tissue morcellation was performed with a versacut morcellator (versacut system, lumenis inc .) Through a 6-degree rectangular nephroscope (karl storz gmbh & co.). During the transurethral procedure, the outer sheath was always in the urethra, because the resectoscope and nephroscope were exchangeable in the outer sheath . After completion of the morcellation, a urethral catheter was inserted for continuous bladder irrigation with normal saline . The kind and the dosing duration of paa were based on the physicians' discretion . Pics were diagnosed according to the centers for disease control and prevention (cdc) guidelines; in short, a pic was defined as a febrile (body temperature 38) complication caused by a surgical procedure at a surgical site, such as urinary tract infection (uti), that occurred within 30 days after surgery . We analyzed the relationship between the emergence of pics and the kind or duration of paa . Statistical analysis was conducted with the jstat java virtual machine statistics monitoring tool with use of the chi - square test (sun microsystems inc ., santa clara, ca, usa). Twenty - three (25.6%) had an indwelling catheter owing to urinary retention (table 1). Diabetes was seen in 19 patients (21.1%), heart disease in 17 (18.9%), and hypertension in 15 (16.7%). Urological cancer was seen in 3 patients (2 patients had bladder cancer and 1 renal cancer). There were 18 patterns regarding the kind and duration of paa; the details are shown in table 3 . The most frequently used paa was sulbactam / ampicillin (sbt / abpc; n=32, 35.6%), followed by cefazolin (n=18, 20.0%) and cefotiam (n=9, 10.0%). We examined the influence of the kind or duration of dosing of paa on pcc occurrence . Our statistical data showed that there were no significant differences between 2 or fewer days and 3 or more days of paa dosing with regard to pic occurrence . There were also no significant differences between sbt / abpc, which was most frequently used in this study, and other antibiotics for paa with regard to pic occurrence (tables 4, 5). Pic was diagnosed in 7 cases, and the paa of the cases was 3 sbt / abpc, 2 tazobactam / piperacillin, 1 cefazolin, and 1 cefotiam (table 4). There were 3 cases of prostatitis, 2 cases of pyelonephritis, and 2 cases of epididymitis . One case was diagnosed as sepsis after prostatitis caused by klebsiella pneumoniae and was cured by use of doripenem, cefazolin, and levofloxacin . In all, 2 cases of serratia marcescens, 1 case of proteus mirabilis, and 1 case of k. pneumonia were cultured, and these were quite different from the preoperative culture data shown above, which suggested that preoperative treatments might be effective (table 6). Twenty - three (25.6%) had an indwelling catheter owing to urinary retention (table 1). Diabetes was seen in 19 patients (21.1%), heart disease in 17 (18.9%), and hypertension in 15 (16.7%). Urological cancer was seen in 3 patients (2 patients had bladder cancer and 1 renal cancer). There were 18 patterns regarding the kind and duration of paa; the details are shown in table 3 . The most frequently used paa was sulbactam / ampicillin (sbt / abpc; n=32, 35.6%), followed by cefazolin (n=18, 20.0%) and cefotiam (n=9, 10.0%). We examined the influence of the kind or duration of dosing of paa on pcc occurrence . Our statistical data showed that there were no significant differences between 2 or fewer days and 3 or more days of paa dosing with regard to pic occurrence . There were also no significant differences between sbt / abpc, which was most frequently used in this study, and other antibiotics for paa with regard to pic occurrence (tables 4, 5). Pic was diagnosed in 7 cases, and the paa of the cases was 3 sbt / abpc, 2 tazobactam / piperacillin, 1 cefazolin, and 1 cefotiam (table 4). There were 3 cases of prostatitis, 2 cases of pyelonephritis, and 2 cases of epididymitis . One case was diagnosed as sepsis after prostatitis caused by klebsiella pneumoniae and was cured by use of doripenem, cefazolin, and levofloxacin . In all, 2 cases of serratia marcescens, 1 case of proteus mirabilis, and 1 case of k. pneumonia were cultured, and these were quite different from the preoperative culture data shown above, which suggested that preoperative treatments might be effective (table 6). Holep for bph has become widespread in the urological field and has recently been performed at many institutions . Holep may involve less stress to patients and should offer a lower rate of surgical site infection and postsurgical complications than open surgery or turp . This surgery has the benefit of less extensive injury to prostatic tissue than turp; thus, postsurgical local inflammation may not be as severe as with turp . Inflammation could be one risk factor for pics, such as prostatitis, and therefore holep may also be beneficial for suppressing pics . Basically, holep is thought to cause the patients less stress in addition to having higher efficacy for luts . However, the present study had 7 cases of pics, and this ratio may be comparatively higher than in other reports . There are several possible reasons for this; 1) our 90 cases were performed by 7 surgeons including beginners with less than 5 cases of experience with holep . Even though it is not clear whether there is a significant relationship between longer surgical time and a higher ratio of pic occurrence, beginners or less - experienced surgeons take more time to accomplish the surgery than experienced surgeons, both to finish the surgical procedures such as enucleation or tissue morcellation and to avoid surgery - related adverse events . 2) paa may not have included the most appropriate kind of antibiotics or duration of dosing . This is because the cdc guidelines and japanese guidelines recommend that first - generation cephalosporins be administered every 2 to 3 hours during surgery and that penicillins, first - generation or second - generation cephalosporins, and aminoglycosides be administered within 72 hours in turp, respectively . In addition, discrepancies may exist between paa performance and guideline recommendations in individual cases . This is because, for instance, the japanese guideline recommends first - generation or second - generation cephalosporins, penicillins, and aminoglycosides for turp as mentioned above but has not yet established guidelines for holep . Our most often used paa is sbt / abpc and the duration of dosing is recommended to be within 72 hours . However, our cases tended to have a longer duration of dosing with a higher ratio of pic occurrence than in other reports, even in preoperative nonpyuria cases . Our statistical data showed that pic occurrence did not depend on the kind or duration of paa, which suggests that we may be able to shorten the duration of paa, which may lead to the control of unnecessary antibiotic use . Regarding causative bacteria, the pic cases included 2 cases of s. marcescens, 1 case of p. mirabilis, and 1 case of k. pneumonia . Our comparatively broader spectrum paa than recommended in guidelines or other reports, or preoperative intervention against preoperative pyuria cases, might have accounted for this difference . This was a retrospective study and the number of cases was not enough for making definitive conclusions . Second, some of our cases were performed by surgeons who were less experienced with holep and showed a comparatively higher ratio of pic . Third, our paa duration of dosing tended to be longer and the kind of antibiotics tended to be broad spectrum, which could lead to the emergence and spread of resistant strains . The results of this retrospective study showed that pic occurrence did not depend on the duration or the kind of paa in our early experience with holep . Further prospective study is necessary for the evaluation and establishment of prophylactic measures for pic.
The mammary gland has been a pivotal feature in the evolution and taxonomic classification of animal species, and it has even had a role in the acceptance of evolutionary theory . The presence and secretory capacity of the mammary gland provided the basis for the taxonomic grouping of species into the class mammalia more than two centuries ago; and darwin's explanation of how lactation may have evolved satisfied an early challenge to his theory of evolution by natural selection . The challenge was that evolution of lactation was not feasible, because a neonate could not obtain a survival benefit from consuming the chance secretion of a rudimentary cutaneous gland . In response, darwin hypothesized that mammary glands evolved from cutaneous glands that were contained within the brood pouches in which some fish and other marine species keep their eggs, and provided nourishment and thus a survival advantage to eggs of ancestral species . Two hundred years after darwin's birth, the theory of evolution by natural selection remains a cornerstone of biology, as it has withstood this and other challenges . However, it is now clear that the mammary gland did not evolve from a brood pouch . Milk nourishes the neonate and helps to establish immunological and endocrine competence in the offspring . The nutrient composition of milk varies dramatically across species, and it can also be strongly influenced by the stage of lactation . For example, the fat content of milk may be as high as 60% in seals and negligible during early lactation in wallabies . Furthermore, milk in the tammar wallaby (macropus eugenii) changes from a very dilute secretion containing primarily carbohydrate during early lactation to a more energy - dense milk that contains substantial quantities of protein and fat during later phases of lactation . Thus, the details of lactation have evolved to meet the diverse reproductive and environmental demands of different species . About 10,000 years ago, the domestication of plant and animal species led to the neolithic revolution, with its changes in societal interactions and the evolution of civilization . Milk and dairy products were tightly coupled to this cultural evolution, and dairying (then and now) provides an important source of food and fiber throughout the world . Sequencing and assembly of the bovine genome, establishment of mammary transcriptome and proteome libraries, the discovery of single nucleotide polymorphisms, and discoveries and developments to come, are providing important tools for agricultural scientists to investigate the biology of lactation and to adopt genotype - based breeding schemes to select for desired traits . Moreover, comparative genomic studies enable evaluation of lactation across numerous and diverse mammalian species . Regardless of the perceived target species of this research, such knowledge improves our understanding of mammary gland biology and is applicable to normal and pathological states . Danielle lemay and colleagues, in a recent report in genome biology, have taken this important step towards greater understanding through comparative genomics . Lactation appears to be an ancient reproductive feature that pre - dates the origin of mammals . A cogent theory for the evolution of the mammary gland and lactation has been provided by olav oftedal . The features of current mammals were gradually accrued through radiations of synapsid ancestors, and the mammary gland is hypothesized to have evolved from apocrine - like glands associated with hair follicles (figure 1). Oftedal suggests that these glands evolved from providing primarily moisture and antimicrobials to parchment - shelled eggs to the role of supplying nutrients for offspring . Fossil evidence indicates that some of the therapsids and the mammalia - formes, which were present during the triassic period more than 200 million years ago, produced a nutrient - rich milk - like secretion . The capacity to supply fluid and perhaps nutrients to eggs would be promoted and enhanced by incorporation of antimicrobials into the fluid . These may have been antimicrobials already produced in the skin, as in amphibian skin, and evolutionary pressure would probably have fostered the incorporation of molecules such as lysozyme and iron - binding proteins into the secretion, components that are prevalent in milk . The disaccharide lactose (galactose 14 glucose) is contained in all milks, except for those of some marine mammals . Its synthesis is catalyzed in the mammary gland by lactose synthetase, an enzyme that is a complex of 14-galactosyl transferase and the regulatory subunit -lactalbumin . Because -lactalbumin evolved from lysozyme before the division of amniotes into synapsids and sauropsids (see figure 1), the capacity to produce lactose was an ancient trait that preceded its utility in milk synthesis . It is likely that early milks primarily contained antimicrobial oligosaccharides and the prevalence of lactose as a component of milk arose only when -lactalbumin was produced in sufficient quantity . With the synthesis of lactose the evolution of the casein family of milk proteins in particular would provide calcium, phosphate and protein to hatchlings . Fossil records suggest that caseins were present during the triassic, because the extensive bone and tooth development evident in the relevant species at stages before independent feeding would have required delivery of ample calcium . Given this evolutionary scenario, the composition of mammary secretions during early lactation in monotremes and marsupials is likely to be similar to that of the primitive milk of mammalian predecessors . The milk then converts to a more nutrient - rich source during later stages of lactation . The evolution of placenta - based reproduction displaced the function of milk as a source of water and nutrients for the egg, leading to secretion of a complex milk throughout lactation in eutherians (figure 1). Milk also enhances the survival of offspring by satisfying other needs, for example, by promoting immunological competence and endocrine maturation in the neonate . In this regard, milk seems to provide for the immediate and long - term needs of the offspring . There are also behavioral and' psychological' aspects of suckling and nurturing between mother (dam) and offspring that produce bonds that promote neonate survival . This is an aspect of lactation that is independent of the chemical and physical characteristics of milk . Mammary gland development and function is subject to systemic and local control . In placental mammals, our understanding of this regulation has been advanced by decades of scientific inquiry, using physiological, molecular and genomic tools . In these mammals, differentiation of the secretory cells and the onset of copious milk synthesis and secretion are regulated to coincide with parturition . The combined effects of positive endocrine stimulators (prolactin, insulin, glucocorticoids, growth hormone and estradiol) are kept in check by the overriding negative influence of progesterone . The decline in progesterone at parturition largely determines the onset of copious milk secretion, but regulation in marsupials differs from that in eutherians . The reproductive cycle in marsupials is characterized by a short gestation and a long lactation, during which the female will nurse offspring of different ages . Lactation in the tammar wallaby has been studied and, consistent with the marsupial reproductive strategy, is found to be insensitive to inhibition by progesterone . The tammar wallaby offspring (joey) it remains attached to the nipple for a period, during which it obtains a dilute, carbohydrate - rich milk . However, the composition of the milk changes significantly during lactaton to meet the demands of the developing joey . Moreover, the tammar has asynchronous concurrent lactation, during which the dam provides milk of differing composition from adjacent glands to feed two offspring of different ages and nutritional needs . Another clear example of local regulation is provided by lactation in the cape fur seal (arctocephalus pusillus pusillus), which is characterized by short suckling periods (23 days) on shore and lengthy foraging periods (about 20 days) at sea, during which maternal nutrient stores are replenished . In most eutherian species, milk secretion decreases in the absence of suckling, and this is accompanied by an increase in apoptosis and mammary involution, seemingly promoted by feedback inhibition from components of the unused milk . Lactation in the cape seal has uncoupled the apoptotic response from decreased milk synthesis, so that the mammary gland simply shuts down during the long foraging periods and resumes secretion when suckling is resumed . The -lactalbumin in this group of seals (the otariid pinnipeds) apparently cannot promote apoptosis (or lactose synthesis). Lemay et al . Used the bos taurus genome sequence (draft 3.1, august 2006) and expression libraries derived from tissue obtained during various stages of mammary development and lactation status to identify unique milk proteins and mammary - related proteins . With the exception of four milk - protein gene clusters (casein genes, immunoglobulin genes, fibrinogen genes and genes encoding proteins of the milk fat globule), they found that milk - protein genes do not cluster with each other, but rather tend to cluster with other lactation genes . They also did not cluster by developmental stage or gene duplication, suggesting that these genes clustered to facilitate coordinate gene expression . The bovine genome was compared with six other mammalian genomes: human, dog, mouse and rat (eutherians), opossum (marsupial) and platypus (monotreme). In general, milk and mammary genes were more conserved and seemed to evolve more slowly than others in the bovine genome, despite selective breeding for milk production . This supports the hypothesis that lactation has evolved to minimize the energy cost to the dam while maximizing survival of the neonate, thus promoting survival of the maternal - offspring pair . The most divergent proteins in the lactome were those with nutritional or immunological attributes, suggesting continuing selection of these genes to meet nutritional and pathogen challenges that are incurred by diverse environments and reproductive strategies . The most conserved genes were those for proteins of the milk fat globule membrane, confirming the essentiality of this mechanism for milk - fat secretion and indicating that the diversity in milk fat may be due to altered efficiency in secretion, not to inherent changes in the secretory process . Diversity in milk composition could not be explained by diversity of the encoded milk proteins; and although gene duplication may contribute to species variation, this is not a major determinant . For example, on the basis of analysis of the opossum genome, mikkelsen et al . Concluded that most of the genomic diversity between marsupials and placental mammals comes from non - coding sequences . These, or other factors that regulate the partitioning of nutrients, the interaction between mammary gland and supporting organs, or mammary gland metabolism, may be primary determinants of milk composition . Expansion of comparative studies to include additional non - placental species and inclusion of non - coding regions of the genome is certain to provide additional insight into the regulation of mammary gland function and milk composition . For example, a systematic study of the role of micrornas in mammary development and lactation is likely to be a fruitful area of investigation . Because no single species can provide an ample and sufficient model for the physiology of another, and because the potential gain in knowledge from comparative studies is great continued research in mammary gland biology that incorporates comparative genomic and physiological studies of animals with varied and extreme adaptations to lactation will be necessary to provide insights into the development and regulation of mammary gland function, as well as the probable evolution of these processes . Bovine genome coverage in biomed central: the cattle genome reveals its secrets: burt dw the origin and evolution of lactation: capuco av, akers rm back to bermuda: how is science best served? : church dm, hillier lw
Mammographic density as an independent risk factor for developing breast cancer has been documented since the 1970s . The appearance of density on mammography is the result of the relative proportion of breast stroma, which is less radiolucent compared to fat, accounting for increased breast density . Wolfe classified breast density as an independent risk factor for breast cancer in women [2, 3]. Approximately 70 to 80% of breast cancers occur in women with no major predictors [46]. Population - based screening for early detection of breast cancer is therefore the primary strategy for reducing breast cancer mortality . Mammography has been used as the standard imaging method for breast cancer screening, with reduction in breast cancer mortality . Computer - aided detection (cad) technology with full - field digital mammography (ffdm) has been shown to have several advantages over screen - film mammography, including higher contrast resolution, better dynamic range, and lower noise [8, 9]. Previous studies have shown that cad performance is similar for the detection of cancer in fatty breasts and dense breasts with screen - film mammography (90% versus 88%, resp . ; p = 0.38) and with ffdm (95% versus 98%; p = 0.537). There are numerous studies showing that cad performance is limited by background parenchymal breast density, where the sensitivity of the detection of breast masses sensitivity is significantly higher for fatty breasts than for dense breasts [11, 1315]. The number of missed cancers is substantially increased in mammographically dense breasts, where the sensitivity is reported as low as 30 to 48%, and the odds of developing breast cancer 17.8 times higher . Hand held ultrasound (hhus) has been used to optimize the detection of cancers in mammographically dense breasts but is limited due to technical factors, such as breast size, considerable user variability and reproducibility, technical skill, and time constraints, precluding hhus as an effective screening modality for breast cancer [1921]. Kelly described the use of volumetric breast ultrasound (vbus) as an adjunct to mammography in the evaluation of nonpalpable breast cancers in asymptomatic women . Vbus with mammography resulted in an increase in diagnostic yield from 3.6 per 1,000 with mammography alone, to 7.2 per 1,000 by adding vbus, resulting in a mammography miss rate of 3.6 per 1,000 . However, one of the limitations of the study was that it did not isolate dense breasts as an independent risk factor for developing breast cancer, where the detection rate should be expected to be higher . Vbus is fda approved in the united states for screening of women with dense breast parenchyma . The purpose of this study was to demonstrate that vbus increases the detection of nonpalpable breast cancers in mammographically dense breasts when used as an adjunct diagnostic modality in asymptomatic women . This resulted in the subsequent detection of cancers missed by mammography of smaller size and stage, justifying the basis for the judicious use of implementing vbus in conjunction with mammography in the dense breast screening population . The tabulated data was extrapolated based on known mammography screening utilization to show a cost - benefit of additional vbus as a population - based screening method . This study and the use of patient electronic health records were approved by an ethics committee appointed by the institute board of directors . The study design included two study groups, the control and test groups, in successive years . The control group consisted of women screened by digital mammography alone and stratified for breast density based on a wolf classification of 50% or greater breast density (defined as the mammographically dense breast for the purpose of this study). The second group consisted of women initially screening by digital mammography as having mammographically dense breasts, followed by volumetric breast ultrasound (vbus). Each group was carefully selected on the basis of breast density and having no major preexisting predictors of breast cancer, such as personal or family history of breast cancer, or brca gene positive . In addition, the test group patients were not included in the screening group so as to eliminate impact on the results of the test group patients . The control group, consisting of 4076 asymptomatic women designated as wolf classification of 50% or greater breast density, underwent stand - alone screening digital mammography between january 2009 and december 2009 using digital mammography (selenia, hologic inc ., the sensitivity, specificity, positive predictive value, and negative predictive value for biopsy recommendation were determined, in addition to data collection regarding the size and stage of cancers missed by mammography . The test group, consisting of 3418 asymptomatic women designated as wolf classification of 50% or greater breast density, underwent stand - alone screening digital mammography between january 2010 and may 2011 using digital mammography (selenia, hologic inc ., this was followed by volumetric breast ultrasound (somo - v, u - systems, sunnyvale, ca usa). The mammography - alone results were not used as control results in order to eliminate potential bias introduced by vbus results on the mammography interpretations . In addition, mammography results were interpreted independently from vbus results so as not to introduce bias . The sensitivity, specificity, positive predictive value, and negative predictive value for biopsy recommendation were determined, in addition to derived statistical data regarding the relative risk, and odds ratio for developing breast cancer . Mammographic density was assessed independently by radiologists on a dedicated mammography viewing workstation equipped with 5-megapixel resolution . The radiologists were fda qualified in mammography, with at least 10 years experience in breast ultrasound, 24 months of which included vbus . Two radiologists interpreted both the mammography and vbus examinations under identical viewing conditions of 5-megapixel resolution . The mammograms and vbus studies were double read by two radiologists, with final consensus determination for each case . Mammograms were evaluated according to one of five categories of density (0%, 1 to 24%, 25 to 49%, 50 to 74%, and 75 to 100%) and only mammograms with breast density of 50% or greater were included in the control and test study groups . Volumetric breast ultrasound (vbus) the whole breast ultrasound system (somo - v, u - systems, sunnyvale, ca usa) was used in combination with a 6 to 14 mhz broadband mechanical transducer attached to a rigid compression plate and arm, producing over 300 images per image acquisition obtained as coronal sweeps from the skin to the chest wall . The mechanical arm controls transducer speed and position, while a trained ultrasound technologist maintains appropriate contact pressure and vertical orientation to the skin . Interpretation and reporting time for an experienced radiologist the radiologist has cine functionality to simultaneously view breast images in the coronal, sagittal, and axial imaging planes . Vbus scan data was collected for location and size of breast masses and recorded in a radial or clock orientation consistent with american college of radiology reporting lexicon . Studies were reported according to the american college of radiology breast imaging reporting and data system (bi - rads) six - point scale (0 = incomplete, needs additional assessment; 1 = normal; 2 = benign; 3 = probably benign; 4 = suspicious; 5 = highly suggestive of malignancy) [23, 24]. For bi - rads scores of 1, 2, and 3 on abus, patients were followed prospectively for 1 year to exclude cancers missed on both mammography and vbus . For bi - rads scores of 4 and 5, stereotactic hand held ultrasound (hhus) biopsy was performed using 14 gauge or larger percutaneous biopsy . Hhus was employed because vbus is presently not equipped with biopsy capability . If a benign nonhigh risk lesion was diagnosed, such as simple breast cysts, no further tissue sampling was performed . All pathology proven breast malignancies were further staged using contrast volumetric / whole breast mr imaging (1.5 t hde version 15.0/m4 with vibrant software, ge medical systems, waukesha, wi, usa .) With computer - assisted detection (cadstream software, merge healthcare, belleview, wa, usa). A final pathological stage was assigned by the pathologists in the usual manner in accordance with the american joint committee on cancer (ajcc) tnm system guidelines . The pathologists were blinded to patient participation in the study and the method of cancer detection . Calculations were made of the sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv), relative risk, odds risk, and attributable risk of breast cancer using medcal version 12.2.1 software . Statistical methods involved the chi - square test statistic, which was used to compare the number of cancers detected by vbus, based on the size of cancer . Attributable risk (ar) was calculated according to the following formula: ar = (rr 1)pc / rr, where rr denotes relative risk of greater than 50%, and pc prevalence of density of greater than 50% in case patients [2527]. Comparable interobserver diagnostic reliability (kappa value of 0.98) was observed with mammography and vbus examinations . In the control group (n = 4076), the median age of participants with breast cancer (n = 19) at the time of biopsy was 54 years, distributed as follows: 26% (5 out of 19) cancers occurred in women younger than age 50, 63% (12 out of 19) in women 50 to 69 years, and 11% (2 out of 19) over the age of 70 years . The sensitivity and specificity of stand - alone digital mammography were 76.00% (95% ci: 54.87%90.58%) and 98.2% (95% ci: 97.76%98.59%). The positive predictive value was 20.43% (95% ci: 12.78%30.05%) with a breast cancer prevalence rate of 0.60% (95% ci: 12.78%30.05%). The cancer detection rate was 4.6 per 1,000, with mean tumor size detected by mammography (n = 19) of 21.3 mm . The average size of missed breast cancer (n = 6) was 22.3 mm . The node positivity rate was 5% (1 of 19 cases). In the vbus study group (n = 3418), the median age of participants with breast cancer (n = 42) at the time of biopsy was 57 years, distributed as follows: 17% (7 out of 42) cancers occurred in women younger than age 50, 64% (27 out of 42) in women 50 to 69 years, and 19% (8 out of 42) over the age of 70 years . The sensitivity and specificity of vbus were 97.67% (95% ci: 87.67%99.61%) and 99.70%, (95% ci: 99.46%99.86%), respectively, in mammographically dense breasts . The positive predictive value of vbus was 80.77% (95% ci: 67.46%90.36%), with a breast cancer prevalence rate of 1.25% (95% ci: 0.91%1.69%). The odds ratio of breast cancer in mammographically dense breasts determined by vbus was 2.65 (95% ci: 1.544.57; p = 0.0004). A 2.6-fold increase in cancer detection rate was observed between abus added to digital screening mammography compared to stand - alone digital screening mammography . Invasive breast cancer accounted for 81% (42 out of 52) solid breast masses detected by vbus, of which 93% (39 out of 42) were invasive ductal carcinomas, and 7% (3 out of 42) were invasive lobular carcinomas . The mean tumor size detected by vbus in patients with breast cancer (n = 42) was 14.3 mm, distributed as follows: stage 1a disease accounted for 83% (35 out of 42) of cases; 12% were stage 2a (5 out of 42), and 5% were stage 3a (2 out of 42). Stage 3a disease was associated with multifocal disease in both cases, one of which also was level 1 axillary lymph node positive . The false positive rate of vbus was 19.3%, with a negative predictive value of 99.97% (95% ci: 99.83%100.00%). The pathologies associated with false positive results (n = 10) were fibroadenomas and atypical epithelial neoplasms . We also used our data to extrapolate the theoretical cost - benefit of vbus screening applied to a large screening population in the united states . Our analysis relied on the following assumptions: (1) global centers for medicare and medicaid reimbursement rate of breast ultrasound of $71; (2) estimated mean doubling time of a missed cancer of 250 days at the 95th percentile [29, 30]. According to previously cited cancer kinetics models, a missed breast cancer should be clinically evident within 9 months . When we considered the mean breast cancer size in our positive test subject group, 14.3 mm (n = 42), we extrapolated a theoretical missed cancer size of 29.2 mm at 9 months in mammographically dense breasts, representative of stage 2 or greater disease . In control subjects, a mean breast cancer size of 22.3 mm was consistent with stage 2 breast cancer . Incremental treatment cost assumptions, based on the global centers for medicare and medicaid reimbursement rate between stage 1 and stage 2 breast cancer, were $24,002 and $34,469, respectively, for a cost differential of $10,467 . Accordingly, the aggregate costs of screening 3418 vbus patients in this study were $239,260, compared to the estimated aggregate costs of additional treatment in 26 potentially missed cancers (based on previously noted theoretical assumptions) of $275,557 based on a cancer miss rate of 0.77% (or 7.7 per 1,000). Magnetic resonance imaging (mri) has recently been recommended by the american cancer society (acs) to screen women at very high risk of breast cancer . Though highly sensitive, mri is costly and does have some drawbacks, such as the risks from the required contrast media . Mri for breast cancer screening has also been characterized by lower specificity, as compared to mammography, with a higher rate of false positives, leading to further follow - up mri and/or imaging - guided biopsy costs . For example, a study by leach et al . Reported mri specificity of 81 percent, compared to 93 percent specificity in mammography . Griebsch et al . Reported mri as having almost four times more recalls than mammography for women with high familial breast cancer risk, and 70 percent of the recalls did not involve cancer . Because of lower specificity and higher cost, compared to mammography, mri may not be optimal for breast cancer screening . In our experience, volumetric breast ultrasound (vbus) can be helpful, particularly in identifying small tumors, due to a 3 mm slice thickness and high pixel resolution on postprocessed volumetric scans . Characteristic features of malignancy on vbus include a hypoechoic breast mass with irregular margins, taller - than - wide appearance, and acoustic shadowing . In these cases, mr imaging can provide a specific imaging application over vbus in differentiating between invasive ductal carcinoma (idc) from invasive lobular carcinoma (ilc) based on the enhancement characteristics of the tumor and signal properties on t2-weighted images . Mr imaging shows characteristic desmoplasia as signal loss on t2-weighted images (the thumbprint sign) which can be a reliable indicator that the tumor is idc rather than ilc . Following are the clinical criteria for abus screening, which are the clinical indications for ordering a vbus examination: as a supplement to mammography, screening for occult cancers in certain populations of women (such as those with dense fibroglandular breasts and/or with elevated risk of breast cancer);imaging evaluation of nonpalpable masses in women under 30 years of age who are not at high risk for development of breast cancer, and in lactating and pregnant women;bi - rads (american college of radiology breast imaging reporting and data system) scoring classification class iii, heterogeneously dense, with 50% to 74% or 75% to 100% breast density on mammography, without palpable mass . As a supplement to mammography, screening for occult cancers in certain populations of women (such as those with dense fibroglandular breasts and/or with elevated risk of breast cancer); imaging evaluation of nonpalpable masses in women under 30 years of age who are not at high risk for development of breast cancer, and in lactating and pregnant women; bi - rads (american college of radiology breast imaging reporting and data system) scoring classification class iii, heterogeneously dense, with 50% to 74% or 75% to 100% breast density on mammography, without palpable mass . Table 1 shows the distribution of breast cancer size according to age in the control and test study groups . The test group showed no statistical difference between size of the cancer and patient age at presentation . A significant increase in tumor size in the over 70 patients in control subjects was attributed to the more advanced tumor stage at presentation . Table 2 shows that stand - alone digital mammography was less sensitive than vbus in breast cancer detection, with a 4-fold increase in positive predictive value of vbus compared to stand - alone mammography in dense breasts . Our results showed that mammographic density of 50% or more was associated with an increased risk of breast cancer and resulted in a significant miss rate in asymptomatic women . Table 3 shows a statistically significant age - related attributable risk of developing breast cancer for mammographic density of 50% or greater . These observations are consistent with other studies which have shown an increased risk of breast cancer in dense breasts following negative mammography screening [2, 3, 17, 18]. We observed that breast cancer risk was highest in patients over age 70, where increased breast density was associated with an attributable risk of 29.6 (95% ci: 21.540.8). Figure 1 shows box plots comparing case patients and control subjects according to age, with tumor sizes shown as a function of the odds ratio, relative risk, and attributable risk for each age category . Our study also showed that volumetric breast ultrasound (vbus) was an effective screening modality in mammographically dense breasts . Our extrapolated data suggest a breast cancer miss rate of 7.7 per 1,000 in mammographically dense breasts in asymptomatic women, which is higher compared to the cancer miss rate of 3.6 per 1,000 reported by kelly et al . Using vbus . We attribute the increased breast cancer miss rate due to breast density, which was isolated as the principal risk factor in our study . Other studies have shown that the attributable risk of breast cancer for a mammographic density of 50% or greater was 40% for all cancers detected less than 12 months after a negative screening mammogram, and as high as 50% in women less than the age of 50 . This marked increase in the risk of breast cancer associated with mammographic density of 50% or greater up to 12 months following screening directly reflects cancers that were present at the time of screening but went undetected due to masking by dense breast parenchyma [3741]. In the final analysis, there is the issue of the theoretical cost - benefit of adding vbus screening to mammography in an otherwise healthy population . The importance of screening mammographically dense breasts with vbus has particular relevance based on the small size and early stage of breast cancers . Our study showed a mean tumor size of 14.3 mm, representing stage 1 disease, which was present in 81% of patients . From our data, we derived theoretical population - based costs as a basis for the cost - benefit of vbus in the united states population . Our study compared the incremental costs of screening versus the costs of added treatment related to a change in the staging of missed cancers from stage 1 to stage 2 . The costs of additional treatment outweighed the costs of screening by $32,808, which calculated to $9.60 added healthcare cost per patient in the 3418 participants in the study . In the united states, 48 million mammograms were performed annually, with a reported estimated miss rate of 10% . When comparing control versus test patients, our study suggests a theoretical miss rate of 7.7 cancers per 1,000 mammograms, or 0.77%, which is considerably lower than the reported missed rate of 10% . Based on these theoretical assumptions, annual added vbus screening of the entire usa population would cost $3.40 billion . However, in actual practice, vbus would be used only in the mammographically dense breast, which would potentially reduce the screening costs by at least a factor of 0.8, bringing the cost closer to $2.72 billion . By contrast, the incremental costs of added treatment associated with stage 2 compared to stage 1 breast cancer in the usa population would be $3.82 billion, assuming a conservative cost basis of $10,467 per patient . The cost - benefit of early detection of stage 1 disease results in a theoretical per capital annual cost savings of $22.75 per screened patient in the usa population, according to our model . However, we have no actual or derived data to support improved breast cancer mortality with the addition of vbus as a universal screening modality . This is one of the major limitations of our study because actuarial analyses used to justify screening modalities are typically based on mortality statistics . With respect to five - year survival statistics between stage 1 and stage 2 breast cancers, of 98% and 80%, respectively, one could construe the potential for a theoretical quality - of - life benefit based on judicious vbus screening . Another limitation of our study is the relatively small screening population used in our study, emphasizing the need for continued research in order to validate vbus as a viable and cost - effective population - based screening modality, which should be stratified for other risk factors for breast cancer, such as personal or family history of breast cancer, brca genetic results, environmental factors (late parity, previous exposure to ionizing radiation, exogenous estrogen, smoking, and alcohol use), early menarche / late menopause, and ethnic / racial differences . At most imaging centers, our study corroborates with the data derived from other studies that the principal mechanism for breast cancer in dense breast parenchyma is not rapid growth, but rather, the masking of coincident cancers that are missed on screening mammograms . These findings further suggest that the addition of mammographic screening in patients with dense breast parenchyma is likely not to increase diagnostic yield in the detection of breast cancers . Therefore to conclude, our study of a small representative dense breast screening population showed that the addition of vbus was more effective than digital mammography alone . This study provides a platform for using vbus as cost - effective approach to breast cancer detection in the judicious screening of asymptomatic women with excessive mammographic density, in whom the greatest risk is between screening mammography examinations.
This is a widely endorsed public perception of fear, derision and avoidance of the mentally ill . One reason could be lack of awareness, but other reasons abound . To take an example, popular films seem to suggest that people with mental illnesses: are mass - murdering, homicidally inclined violence junkies;have themselves to blame for not being strong enough to battle illness;have been visited by the divine wrath of an unforgiving god . Are mass - murdering, homicidally inclined violence junkies; have themselves to blame for not being strong enough to battle illness; have been visited by the divine wrath of an unforgiving god . In this case, stigma works insidiously when internalized to erode the sense of self - worth or social relevance . It works at various levels to instill a deep level of insecurity . To take an example, childless women experience self - stigma . Questionable person proves his claim to normalcy by citing his acquisition of a spouse and children, and oddly, by ttesting to his spending christmas and thanksgiving with them . People's perceptions are not going to change overnight that is not to imply that everyone thinks alike . A community's attitude toward the mentally ill plays a paramount role in treatment - seeking, drug compliance and rehabilitation . I hope that this article will help raise greater levels of awareness and help combat stigma against the mentally ill.
Measures were obtained from a cohort of 24 subjects (age 32.2 years 17.7 sd; range, 979 years) from a larger group (n = 78) enrolled in a multicenter natural history study of xlrs, clinicaltrials.gov nct0233117 . Included here are results from a single visit for patients receiving supplementary evaluations that were not part of the natural history study . Not all control subjects performed all tests, so the controls are unique individuals for each analysis . Analyses of within - patient variability were used to determine whether there were significant differences between eyes for each test . Since there were no significant differences between eyes, we averaged both eyes for n = 1 per test . Research adhered to the tenets of the declaration of helsinki and was approved by the western institutional review board . High - resolution horizontal line scans of the macula were obtained using spectralis heidelberg retina angiography + oct (heidelberg engineering, inc ., the average thicknesses of tr and os were measured with manual segmentation (igor pro 6.03a; wave metrics, inc ., tigard, or, usa). The os thickness was determined as the distance between the ellipsoid zone (ez), otherwise known as the inner segment (is)/os junction, and the apical retinal pigmented epithelium (rpe) border . The tr thickness was measured from the inner limiting membrane (ilm) to the basement membrane (bm). These measures were taken at the central 10 with the fovea in the center, therefore depicting thicknesses of the macula . Macular sensitivity was determined under mesopic conditions on a microperimeter (mp1-s; navis software, ver . 1.7; nidek technologies, padova, italy) with spot size 3 (0.43 diameter) and a 10 - 2 protocol . Perimetric sensitivity (with infrared illumination of the fundus) was determined as the mean of 68 points spanning 20 of the retina . The mp1-s microperimeter tests sensitivity up to 20 db, but normal subjects and some xlrs patients need a higher dynamic range of stimuli intensity to get their true sensitivity (> 20 db). To circumvent the ceiling effect of the mp1-s, a 1.0 log neutral density filter was used when the patient exhibited maximum sensitivity (20 db) for the majority of the individual test points . The mean sensitivity for this eye was set to 0 db, averaged with the fellow eye, and included in the analysis . After refraction, bcva was assessed by electronic visual acuity tester (jaeb center for health research, tampa, fl, usa). Shape dh and cip tests to evaluate central vision were performed on an ipad using the myvisiontrack visual function application . The test continues as a 4-alternative, forced choice (4afc) test algorithm with a 2-down, 1-up adaptive staircase procedure for the amount of distortion presented in each trial until the sdh is determined . Inner or outer ring using a 4afc staircase paradigm with a stimulus duration of 0.25 seconds (wang y - z, mitchel g. iovs 2013;54:arvo e - abstract 5019). As with the sdh test a maximum likelihood fitting procedure was implemented to estimate detecting the distortion of contour segments of inner or outer rings . Differences between sample means were analyzed with student's 2-tailed t - test and the pearson coefficient test for the correlation studies . Measures were obtained from a cohort of 24 subjects (age 32.2 years 17.7 sd; range, 979 years) from a larger group (n = 78) enrolled in a multicenter natural history study of xlrs, clinicaltrials.gov nct0233117 . Included here are results from a single visit for patients receiving supplementary evaluations that were not part of the natural history study . Not all control subjects performed all tests, so the controls are unique individuals for each analysis . Analyses of within - patient variability were used to determine whether there were significant differences between eyes for each test . Since there were no significant differences between eyes, we averaged both eyes for n = 1 per test . Research adhered to the tenets of the declaration of helsinki and was approved by the western institutional review board . High - resolution horizontal line scans of the macula were obtained using spectralis heidelberg retina angiography + oct (heidelberg engineering, inc ., the average thicknesses of tr and os were measured with manual segmentation (igor pro 6.03a; wave metrics, inc ., tigard, or, usa). The os thickness was determined as the distance between the ellipsoid zone (ez), otherwise known as the inner segment (is)/os junction, and the apical retinal pigmented epithelium (rpe) border . The tr thickness was measured from the inner limiting membrane (ilm) to the basement membrane (bm). These measures were taken at the central 10 with the fovea in the center, therefore depicting thicknesses of the macula . Macular sensitivity was determined under mesopic conditions on a microperimeter (mp1-s; navis software, ver . 1.7; nidek technologies, padova, italy) with spot size 3 (0.43 diameter) and a 10 - 2 protocol . Perimetric sensitivity (with infrared illumination of the fundus) was determined as the mean of 68 points spanning 20 of the retina . The mp1-s microperimeter tests sensitivity up to 20 db, but normal subjects and some xlrs patients need a higher dynamic range of stimuli intensity to get their true sensitivity (> 20 db). To circumvent the ceiling effect of the mp1-s, a 1.0 log neutral density filter was used when the patient exhibited maximum sensitivity (20 db) for the majority of the individual test points . The mean sensitivity for this eye was set to 0 db, averaged with the fellow eye, and included in the analysis . After refraction, bcva was assessed by electronic visual acuity tester (jaeb center for health research, tampa, fl, usa). Shape dh and cip tests to evaluate central vision were performed on an ipad using the myvisiontrack visual function application . The test continues as a 4-alternative, forced choice (4afc) test algorithm with a 2-down, 1-up adaptive staircase procedure for the amount of distortion presented in each trial until the sdh is determined . The cip test showed smooth and distorted circular contour segments spatially distributed in an inner or outer ring using a 4afc staircase paradigm with a stimulus duration of 0.25 seconds (wang y - z, mitchel g. iovs 2013;54:arvo e - abstract 5019). As with the sdh test, the subject was instructed to choose the distorted line segment . A maximum likelihood fitting procedure was implemented to estimate detecting the distortion of contour segments of inner or outer rings . Differences between sample means were analyzed with student's 2-tailed t - test and the pearson coefficient test for the correlation studies . Other mutations that occurred in our patient population were small frameshifting insertions / deletions (10%), intronic splice site mutations (5%), and exon deletions (5%). For these xlrs patients, bcva ranged from snellen equivalent of 20/25 to no light perception with a median logmar of 0.5 0.3 . Patients ranged in age from 9 to 79 years (mean 32.4 18.1 years). The number of control subjects and their age for each procedure are provided in the table . Demographics of control subjects high - resolution sdoct scans showed different clinical features in our population of xlrs patients . There were seven eyes (14.6%) with cavities intruding into the inner nuclear layer (inl) and outer nuclear layer (onl; fig . Examples for the highest incidence for cavity localizations are shown in figures 1b through 1d, which involved the inl, onl, and ganglion cell layer (gcl) or had an inl - only pattern of schisis cavities (12 eyes each; 25%; figs . Localization of cavities within the inl and gcl occurred in nine eyes (14.6%) of our patients (fig . One eye had cavities in the gcl only (2.1%), and one eye had cavities in the gcl and onl (2.1%, not shown). Eyes without detectable schisis cavities (six eyes, 12.5%) were also noted in our population (fig . 1f). Of interest, the photoreceptor layer (prl, enlarged in fig . 1e) was absent in the sdoct scans from eyes devoid of cavities (fig . (a) cavities were found in the inner nuclear layer (inl) and outer nuclear layer (onl). (b) example of schisis cavities in the inl, onl, and the ganglion cell layer (gcl). (e) mild splitting in the inl and gcl is noted in patient rfs-303 . (f) kec-2101, the oldest subject in the study, had no observable cavities, rpe atrophy, and absence of definitive prl . Since cavity size differs among subjects, we wanted to know if age was a contributing factor to tr thickness in the macula . The tr, determined as the distance between the ilm and the bm in the central 10, was 335.6 97.8 m for xlrs subjects, which was not different than controls (318.1 17.7 m; p = 0.5884; fig . However, the os thickness was smaller in xlrs patients (17.2 8.1 m) compared to controls (37.1 5.7 m; p <0.0001; fig . 2c). When age was considered as a potential factor for either central tr or central os thickness, we found that there was a weak relationship between xlrs patient age and tr (fig . 2d; r = 0.24, p = 0.0158) or os (r = 0.18, p = 0.0379; fig . (a) representative sdoct horizontal line scan from xlrs subject (55 years) showing the central 10 where measurements were made for os or tr thicknesses . Outer segments were indexed by the distance between the ez (yellow line) and the os / retinal pigment epithelium (rpe) border (blue line). Total retina was the distance between the inner limiting membrane (ilm; red line) and the basement membrane (bm; purple line). (b) total retina thickness was not different between patients and controls, whereas (c) macular os thickness was smaller in xlrs compared to controls . (d) total retina thickness in xlrs patients was similar to controls and had a weak correlation with age . (e) macular os thickness was lower than in controls and was not associated with age . 3b). Subject xlrs-001-rfs-325, a 10-year - old boy, had bcva of 20/80 (0.6 logmar) and a lower than normal (24.2 2.4 db) total mean sensitivity (12.8 db) in the left eye (fig . This subject had a similar central tr thickness (333 m) and smaller os thicknesses (8.4 m) compared to normal (318.1 17.7 m and 37.1 5.7 m, respectively). An area highlighting where the ez line was absent from the central retina is enlarged . 3b), which explains why the average of the central 10 os for this subject was decreased . Conversely, the ez line (red arrow) can be seen clearly across the macular region in a 19-year - old subject, xlrs-001-rfs-319 (fig . This individual had bcva of 20/40 (0.4 logmar), a near - normal mean sensitivity of 20.7 db, and a comparable tr thickness (326 m) compared to control (24.2 2.4 db and 318.1 17.7 m, respectively). This subject's os thickness was 22 m, which was larger than the mean os thickness from all xlrs subjects (13.2 6.6 db; fig . Overall, the mean sensitivity in xlrs patients was lower than the control mean sensitivity (xlrs: 13.2 6.6 db; control: 24.2 2.4 db; p = 0.0008). (a) representative fundus - guided perimetry results from the right eye of a 10-year - old patient . His total mean sensitivity was 12.8 db and bcva was 20/80 (0.6 logmar) in the right eye . (b) the horizontal line scan acquired at the position of the arrow in (a) from the same subject . Notice how the ez line was discontinuous (arrows). (c) subject rfs-319 was a 19-year - old man with mean sensitivity = 20.7 db, bcva = 20/40 (0.4 logmar), central os thickness = 22 m, and tr thickness = 326 m . (d) subjects with xlrs had a central tr thickness that was weakly correlated with total retina sensitivity (r = 0.22, p = 0.0158), whereas (e) macular os thickness was highly correlated with total retinal sensitivity . (f) best corrected visual acuity was not associated with tr thickness (r = 0.01, p = 0.6166) but was (g) highly correlated to macular os thickness in xlrs patients . Correlation was determined with pearson's r correlation . To evaluate the relationship between anatomical features and psychophysical functional measures, the sensitivity or bcva was analyzed against central tr and macular os thickness in xlrs subjects . The tr thickness had a weak relationship (r = 0.22, p = 0.0158), but macular os thickness was highly correlated (figs . 3d, 3e; r = 0.55, p = 0.0001) with mean sensitivity . Similarly, bcva was weakly associated with tr (r = 0.01, p = 0.6166) but highly correlated with os (r = 0.79, p <0.0001) thickness in xlrs subjects (figs . Shape dh was worse in xlrs subjects (0.4 0.2 logmar) than in controls (0.7 0.1 logmar, p <0.001; fig . Detection of contour lines in a ring, designated inner cip, was higher (worse) for xlrs subjects (0.6 0.3 logmar) than for control subjects (0.9 0.2 logmar, p = 0.002, fig . However, thresholds for contour lines in a wider ring (outer cip) were not different between the groups (xlrs: 0.7 0.2 logmar; control: 0.8 0.1 logmar; fig . No effect of age was found on sdh and cip thresholds for patients with xlrs (fig . X - linked retinoschisis subjects had decreased ability to detect (a) circular (sdh) and (b) contour distortion (cip inner) compared to controls . (c) contour integration perimetry outer ring tests were not different between xlrs and control subjects . X - linked retinoschisis patients' detetection of circular shape discrimination or contour distortion did not correlate with age . Correlation analysis with tr or os thickness revealed no association of tr thickness with sdh (r = 0.0004, p = 0.9270), inner cip (r = 0.0043, p = 0.7546), or outer cip (r = 0.0039, p = 0.7576) (figs . Os thickness was highly correlated with sdh (r = 0.3297, p = 0.0085) and inner cip (r = 0.4667, p = 0.0001), but weakly associated with outer cip (r = 0.2104, p = 0.0307; figs (a c) shape discrimination hyperacuity and contour integrated perimetry (sdh and cip) acuity did not correlate with total retina thickness, but (d) circular sdh and (e) cip inner ring acuity were highly associated with outer segment (os) thickness . (f) outer segment thickness had a weak correlation with cip outer ring acuity . Other mutations that occurred in our patient population were small frameshifting insertions / deletions (10%), intronic splice site mutations (5%), and exon deletions (5%). For these xlrs patients, bcva ranged from snellen equivalent of 20/25 to no light perception with a median logmar of 0.5 0.3 . Patients ranged in age from 9 to 79 years (mean 32.4 18.1 years). The number of control subjects and their age for each procedure are provided in the table . High - resolution sdoct scans showed different clinical features in our population of xlrs patients . There were seven eyes (14.6%) with cavities intruding into the inner nuclear layer (inl) and outer nuclear layer (onl; fig . Examples for the highest incidence for cavity localizations are shown in figures 1b through 1d, which involved the inl, onl, and ganglion cell layer (gcl) or had an inl - only pattern of schisis cavities (12 eyes each; 25%; figs . Localization of cavities within the inl and gcl occurred in nine eyes (14.6%) of our patients (fig . One eye had cavities in the gcl only (2.1%), and one eye had cavities in the gcl and onl (2.1%, not shown). Eyes without detectable schisis cavities (six eyes, 12.5%) were also noted in our population (fig . 1f). Of interest, the photoreceptor layer (prl, enlarged in fig . 1e) was absent in the sdoct scans from eyes devoid of cavities (fig . (a) cavities were found in the inner nuclear layer (inl) and outer nuclear layer (onl). (b) example of schisis cavities in the inl, onl, and the ganglion cell layer (gcl). (e) mild splitting in the inl and gcl is noted in patient rfs-303 . (f) kec-2101, the oldest subject in the study, had no observable cavities, rpe atrophy, and absence of definitive prl . Since cavity size differs among subjects, we wanted to know if age was a contributing factor to tr thickness in the macula . The tr, determined as the distance between the ilm and the bm in the central 10, was 335.6 97.8 m for xlrs subjects, which was not different than controls (318.1 17.7 m; p = 0.5884; fig . However, the os thickness was smaller in xlrs patients (17.2 8.1 m) compared to controls (37.1 5.7 m; p <0.0001; fig . 2c). When age was considered as a potential factor for either central tr or central os thickness, we found that there was a weak relationship between xlrs patient age and tr (fig . R = 0.24, p = 0.0158) or os (r = 0.18, p = 0.0379; fig . (a) representative sdoct horizontal line scan from xlrs subject (55 years) showing the central 10 where measurements were made for os or tr thicknesses . Outer segments were indexed by the distance between the ez (yellow line) and the os / retinal pigment epithelium (rpe) border (blue line). Total retina was the distance between the inner limiting membrane (ilm; red line) and the basement membrane (bm; purple line). (b) total retina thickness was not different between patients and controls, whereas (c) macular os thickness was smaller in xlrs compared to controls . (d) total retina thickness in xlrs patients was similar to controls and had a weak correlation with age . (e) macular os thickness was lower than in controls and was not associated with age . To assess central retina function, psychophysical sensitivity was measured with fundus - guided microperimetry . The black arrow on the fundus / 3b). Subject xlrs-001-rfs-325, a 10-year - old boy, had bcva of 20/80 (0.6 logmar) and a lower than normal (24.2 2.4 db) total mean sensitivity (12.8 db) in the left eye (fig . This subject had a similar central tr thickness (333 m) and smaller os thicknesses (8.4 m) compared to normal (318.1 17.7 m and 37.1 5.7 m, respectively). An area highlighting where the ez line was absent from the central retina is enlarged . 3b), which explains why the average of the central 10 os for this subject was decreased . Conversely, the ez line (red arrow) can be seen clearly across the macular region in a 19-year - old subject, xlrs-001-rfs-319 (fig . This individual had bcva of 20/40 (0.4 logmar), a near - normal mean sensitivity of 20.7 db, and a comparable tr thickness (326 m) compared to control (24.2 2.4 db and 318.1 17.7 m, respectively). This subject's os thickness was 22 m, which was larger than the mean os thickness from all xlrs subjects (13.2 6.6 db; fig . 3c). Overall, the mean sensitivity in xlrs patients was lower than the control mean sensitivity (xlrs: 13.2 6.6 db; control: 24.2 2.4 db; p = 0.0008). (a) representative fundus - guided perimetry results from the right eye of a 10-year - old patient . His total mean sensitivity was 12.8 db and bcva was 20/80 (0.6 logmar) in the right eye . (b) the horizontal line scan acquired at the position of the arrow in (a) from the same subject . Notice how the ez line was discontinuous (arrows). (c) subject rfs-319 was a 19-year - old man with mean sensitivity = 20.7 db, bcva = 20/40 (0.4 logmar), central os thickness = 22 m, and tr thickness = 326 m . (d) subjects with xlrs had a central tr thickness that was weakly correlated with total retina sensitivity (r = 0.22, p = 0.0158), whereas (e) macular os thickness was highly correlated with total retinal sensitivity . (f) best corrected visual acuity was not associated with tr thickness (r = 0.01, p = 0.6166) but was (g) highly correlated to macular os thickness in xlrs patients . Correlation was determined with pearson's r correlation . To evaluate the relationship between anatomical features and psychophysical functional measures, the sensitivity or bcva was analyzed against central tr and macular os thickness in xlrs subjects . The tr thickness had a weak relationship (r = 0.22, p = 0.0158), but macular os thickness was highly correlated (figs . 3d, 3e; r = 0.55, p = 0.0001) with mean sensitivity . Similarly, bcva was weakly associated with tr (r = 0.01, p = 0.6166) but highly correlated with os (r = 0.79, p <0.0001) thickness in xlrs subjects (figs . Shape dh was worse in xlrs subjects (0.4 0.2 logmar) than in controls (0.7 0.1 logmar, p <0.001; fig . Detection of contour lines in a ring, designated inner cip, was higher (worse) for xlrs subjects (0.6 0.3 logmar) than for control subjects (0.9 0.2 logmar, p = 0.002, fig . However, thresholds for contour lines in a wider ring (outer cip) were not different between the groups (xlrs: 0.7 0.2 logmar; control: 0.8 0.1 logmar; fig . No effect of age was found on sdh and cip thresholds for patients with xlrs (fig . X - linked retinoschisis subjects had decreased ability to detect (a) circular (sdh) and (b) contour distortion (cip inner) compared to controls . (c) contour integration perimetry outer ring tests were not different between xlrs and control subjects . X - linked retinoschisis patients' detetection of circular shape discrimination or contour distortion did not correlate with age . Correlation analysis with tr or os thickness revealed no association of tr thickness with sdh (r = 0.0004, p = 0.9270), inner cip (r = 0.0043, p = 0.7546), or outer cip (r = 0.0039, p = 0.7576) (figs . However, os thickness was highly correlated with sdh (r = 0.3297, p = 0.0085) and inner cip (r = 0.4667, p = 0.0001), but weakly associated with outer cip (r = 0.2104, p = 0.0307; figs . (a c) shape discrimination hyperacuity and contour integrated perimetry (sdh and cip) acuity did not correlate with total retina thickness, but (d) circular sdh and (e) cip inner ring acuity were highly associated with outer segment (os) thickness . (f) outer segment thickness had a weak correlation with cip outer ring acuity . The purpose of the present study was to compare structural properties from sdoct to psychophysical measures in a subset of patients enrolled in a larger multicenter natural history study of xlrs . 5e) but that total thickness of the retina had weak association with these measures (figs . C). The tr thickness failed to show a negative correlation with age in our patients tested with xlrs, unlike previous reports showing that younger patients had large foveal schisis cavities and older patients had thinner retinas with minimal cavities . While this may be common in progression of the disease, it is certainly not seen in all patients . The cavity size can vary according to the individual regardless of age, which could be the result of the specific mutation, other eye diseases, or medication . For example, two patients (ages 53 and 40) in this group, using ocular carbonic anhydrase inhibitors (cais) to reduce the swelling in the retina, had resolution of foveal schisis . Of note, cai use was not prohibited in this study; not all patients respond to cais, and other patients in this study had cystic changes in the macula without resolution while using this medication . Further, this study was not powered to detect group differences between those using and those not using the cais . Although the mean sensitivity was variable in these xlrs subjects, it was still below control sensitivity . Interestingly, sensitivity, a psychophysical examination of macular function, was better correlated with macular os thickness than central tr thickness in xlrs subjects . This suggests that a defect in the photoreceptors, not maculoschisis, contributes to macular sensitivity loss in patients with xlrs . Similar to patients with macular edema in amd, the xlrs patients displayed defects in sdh and cip, validating our hypothesis that these patients would have a deficit in the global integration visual acuity . This could be due to the cystic cavities distorting straight lines when maculoschisis is present . However, after further analysis, tr thickness did not correlate with sdh or cip outcomes in xlrs subjects (figs . Interestingly, it was os thickness that correlated with the results from sdh and cip tests (figs . Thus, the outer retina is the major limitation to the altered sdh / cip results shown here . However, it cannot be dismissed that the schisis could have exacerbated the loss of visual integration as found in amd . This supports the hypothesis that a photoreceptor defect, rather than maculoschisis, is most responsible for the functional deficit in xlrs . It will be interesting to repeat these tests to determine if the sdh and cip change over time in these patients . In particular, if age is not a contributing factor and younger patients do not differ from older patients, this would suggest that the shape discrimination defect is present at the earliest stage of disease . Since it is believed that in the majority of patients the disease shows either no or minimal progression, accurate baseline results need to be documented from each subject when considering outcomes for a treatment trial . Furthermore, test retest variability will also be important when determining significant change in disease progression . Test retest variability has been obtained for microperimetry and bcva in seven patients with xlrs, with the authors evaluating the coefficients of repeatability and associated confidence intervals so that they would know the minimum level of change required in a parameter to be considered statistically different from baseline . Test these measures will be assessed to see how the data vary among these particular xlrs subjects in order to define significant change from baseline for either treatment or longitudinal studies . Data presented here are consistent with previous measures of schisis cavities and decreased photoreceptor sensitivity in patients with xlrs . New findings include measures of os length and the relationship between os length and macular function based on microperimetry, sdh, cip, and bcva . Psychophysical outcome measures in these patients will be imperative when deciphering the effectiveness of therapies in future clinical trials for xlrs.
The interaction between follicle - stimulating hormone (fsh) and the fsh receptor (fshr) is essential for normal oogenesis and spermatogenesis [115]. In the male, fsh is fundamental for sertoli cell function and the induction and maintenance of qualitatively and quantitatively normal spermatogenesis by a specific receptor (fshr) that is a member of the g protein - coupled receptor family [8, 11]. The fshr gene spans a region of 54 kb on chromosome 2p21 and consists of 10 exons and 9 introns [3, 8, 11]. The extracellular domain is encoded by exons 1 to 9; whereas exon 10 encodes the c - terminal part of the extracellular domain, the complete transmembrane, and the intracellular domain [5, 8, 11]. The activity of this gene is driven by a core promoter spanning 225 bp, which represents a tata - less promoter with no evident regulatory elements beside an e - box [8, 9] and a more recently identified initiator element (inr). Mutation screening of the fshr gene revealed various single nucleotide polymorphisms (snps) both in the core promoter and in the coding region [1, 8, 9, 11, 12]. (29g> a) results in a g / a exchange in a potential ggaa binding domain for an e-26 transcription factor, which is altered [3, 11]. The other most common snp in the coding region occurs at nucleotide 2039 in exon 10, in which a / g transitions cause amino acid exchange from asparagine to serine at codon 680 (n680s) [7, 8, 11, 12, 14]. Investigations on the distribution of these snps produced varying results . In the normal and infertile men and women, some studies revealed that there is no difference in the distribution of snp and they have no effect on serum fsh levels [2, 7, 11, 13, 17, 18]; whereas other investigations found significant differences between patients and controls [6, 8, 15, 19, 20], suggesting that ethnic differences could be involved . This is the first study to determine the polymorphism of the fshr core promoter at position 29, alone and in combination with the snp at codon 680 in exon 10, and to evaluate the possible role of these two fshr snps on serum levels of fsh in southeast turkey . The study population consists of 240 proven fathers (sperm count> 20 10/ml and serum fsh levels <7 iu / l), and 270 infertile men (150 nonobstructive azoospermic and 120 severe oligozoospermic in which sperm count <10 10/ml) referred to human genetic department of dicle university hospital . There were not seen karyotype abnormalities and y chromosome long arm microdeletions in the study population . Since infertile men are a quite heterogeneous population and spermatogenesis can vary qualitatively and quantitatively in individual subjects, to increase the stringency of the study we selected only men with nonobstructive azoospermia and oligozoospermia compared them to proven fathers with normal spermatogenesis . This study was approved by the hospital ethics committee (b.30.2.dic.0.01.00.00/80), and written informed consent was obtained from all participants . Genomic dna was extracted from peripheral blood leucocytes by standard procedures [21, 22] before being analyzed by multiplex pcr . The snps at positions 29 of promoter and at nucleotide 2039 (codon 680) of exon 10 were analyzed using the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) technique with the primers which were designed based on the published sequence of the human fshr gene . For position 29 (rs1394205) we used forward primer: 5-tgg tga aca gca agg aga ctt-3, reverse primer: 5-ttg gca gag aaa aac cct gt-3, whereas for nucleotide 2039 genotyping (codon 680) (rs6166), forward primer: 5-ccc aaa ttt ata gga cag-3, reverse primer: 5-gag gga caa gta tgt aag tg-3 . The pcr products were then digested with the restriction enzymes (mboii for 29 and bsri for snp ser680asn), according to the manufacturer's protocol . The pcr fragment following 2.5% agarose gel electrophoresis shows three different patterns for 29 . The uncleaved fragment, homozygous for a, has a size of 404 bp; whereas the cleaved fragment, homozygous for g, gives rise to 289 and 115 bp fragments . The asn 680 allele gives an undigested fragment of 520 bp; whereas the ser 680 allele gives two fragments of 413 and 107 bp . For heterozygous (asn / ser), agarose gel electrophoresis allows visualization of three bands 520 bp, 413 bp, and 107 bp . Serum concentrations of fsh were measured by electrochemiluminescence immunoassays (eclias), using roche elecsys 1010 (roche diagnostics, mannheim, germany) according to the manufacturer's instructions . Statistical analysis was performed by applying a commercially available software package (spss 15.0 for windows, spss, chicago, illinois, usa). And one - way analysis of variance (anova) tests were used for the analysis of the data . Statistical significance was set at p .05 . The separate analysis for snp at nucleotide position 29 did not show any difference in genotypic frequencies between proven fathers and infertile patients (= 1.182, p> snp at nucleotide position 29 was not associated with different fsh concentrations in each group (p>.05, anova) (table 1). When the snp at amino acid positions 680 was separately analyzed, a statistically significant difference was found in the genotype frequency between three groups (= 22.87, p <.001). Further testing by two - by - two statistics revealed significant difference for genotype asn - ser between proven fathers and nonobstructive azoospermic groups (= 5.26, p <.05), for genotype ser - ser between proven fathers and nonobstructive azoospermic groups (= 6.67, p <.05), for genotype asn - ser between proven fathers and severe oligozoospermic groups (= 5.18, p <.05), for genotype asn - ser between nonobstructive azoospermic and severe oligozoospermic (= 15.36, p <.001), and for genotype ser - ser between nonobstructive azoospermic and severe oligozoospermic groups (= 11.86, p <.05). To assess whether the polymorphism at 680 influences fsh levels, we compared fsh concentrations among genotypes . The fsh concentrations were not different between the fshr genotypes for each group of patients and proven fathers (p>.05, anova). When we analyzed the haplotypes determined by the two snps at position 29 and codon 680, our results show that four possible haplotypes result from all the two snps of the fshr gene: a - asn, g - asn, a - ser, and g - ser . These haplotypes account is combined into the 10 major combinations shown in table 2, in which nine groups are presented since the two possible allelic combinations of group 5 (double heterozygous) cannot be distinguished and are considered together . Further testing by chi - square revealed the significant difference for g - asn / g - ser and g - ser / g - ser genotype in men with proven fathers and infertile (nonobstructive azoospermic and severe oligozoospermic). We then calculated the overall frequency of the four fshr haplotypes in proven fathers and infertile men . As shown in table 3, no statistically significant difference between the groups was found (p>.05 by test). To assess whether the haplotypes influences fsh levels, we compared fsh concentrations among genotypes . There were no significant differences in the fsh levels among the fshr genotypes in both the two groups of infertile and proven fathers (p>.05, anova) (table 2). Test for deviation from hardy - weinberg proportions has been performed, and the deviation from the hardy - weinberg equilibrium (excess of homozygosity) takes place almost for all investigated groups (except for snp at nucleotide position 29 for severe oligozoospermic group and snp 680 fshr for nonobstructive azoospermic group). The impact of 29 snp, alone or in combination with exon 10 snps, is less clear but does not seem to influence the clinical parameters or plasma fsh concentrations both in women and men [8, 10, 11]. Our data showed that the genotype distribution of snp 29 is similar both in proven fathers and infertile men and does not influence serum fsh levels when considered alone . This result was in agreement with those reported in the previous similar studies [8, 10, 11], but there are differences in the proportions of genotype distribution between our study and others . The possible ethnic differences might be responsible for this difference . In women with normal ovarian function the polymorphism at codon 680 of the fshr is an important determinant of ovarian sensitivity to fsh [6, 8, 19, 25]. Identified a loss - of - function mutation of fsh receptor in ovarian dysgenesis due to ala189val . The snp at position 680 was then confirmed and has been well studied by perez mayorga et al . . The distribution was 29% for the asn / asn, 45% for the asn / ser, and 26% for the ser / ser fshr variant . In japan, sudo et al . Reported 522 ovulating women who visited the university hospital . The proportions of genotype asn - asn, asn - ser, and ser - ser were 41.0, 46.9, and 12.1%, respectively . In contrast to observations in women, snps in exon 10 of the fshr have no effect on serum levels of fsh and other clinical parameters in men with either normal or impaired spermatogenesis [4, 7, 9]. Simoni evaluated asn - asn, asn - ser, and ser - ser (37.2, 45.4, and 17.4%, resp .) In populations with proven fertility and (32.0, 48.0, and 20.0%, resp .) Infertility, and no significant differences were observed . In another study, shimoda et al . Reported that the proportions of asn - asn, asn - ser, and ser - ser were 38.2, 47.3, and 13.1%, respectively, in subject with proven fertility and 49, 42, and 8% in infertile patients, and there were no significant differences between the two . In our study, the genotype distribution of snp at codon 680 is different between proven fathers and infertile men but does not influence serum fsh levels when considered alone . The differences in the genotype frequency might represent genetic factors contributing to phenotypic expression of severe spermatogenetic impairment . When considered in combinations with the snp in 29 and exon 10 (codon 307 and codon 680), there are a few reports on affected groups with diverse ethnic backgrounds, and the results are not in agreement . A study in german men investigated fshr snp genotypes (29, codon 307 and codon 680) alone or in combinations . The authors concluded that while no fshr haplotype was associated with different serum fsh levels, the a - ala - ser and the g - thr - asn alleles might represent genetic factors contributing to severe spermatogenetic impairment . A recent meta - analyses of fshr snp and male infertility revealed that there is no any association with fsh serum levels or sperm output . A study in italian men also investigated the same three snp genotypes and their combinations . The authors concluded that the genotypes had no influence on fsh concentrations in normal or infertile males and did not associate with spermatogenetic impairment . However, very recently a study in japanese men investigated codon 307 and codon 680 genotypes and concluded that heterozygous combination of thr / ala (codon 307) and ser / asn (codon 680) was significantly increased in infertile patients compared with the controls but not ser / asn alone . In our study, the combination of the snp at position 29 and codon 680 gives rise to four haplotypes as these alleles show a statistically similar distribution (except the two allelic variants g - asn / g - ser g - ser / g - ser) in infertile men compared to proven fathers and suggests that these alleles might not represent a risk factor for male infertility . In the test for deviation from hardy - weinberg proportions, the deviation from the hardy - weinberg equilibrium (excess of homozygosity) takes place almost for all investigated groups (except for snp at nucleotide position 29 for severe oligozoospermic group and snp 680 fshr for nonobstructive azoospermic group). This deviation is very important with regard to high parental consanguinity in populations like turkey . In conclusion, our data demonstrate that fshr gene polymorphisms seem not to have a direct influence on spermatogenesis, but are differently distributed, identifying an additional genetic factor possibly contributing to the multigenic origin of male infertility . The discrepancies are most likely due either to study subjects by chance or to study different genetic backgrounds in different populations . In populations like turkey, high parental consanguinity could bring out genetic factors or provide permissive background for complex disorders . Additional studies on well - defined populations of infertile men will probably clarify these aspects.
The bone marrow stroma contains primitive and potentially self - renewing cells that can differentiate into various mesenchymal cells . These mesenchymal stem cells (msc) are capable of supporting the expansion and differentiation of hematopoietic stem cells (hsc) in vitro and enhance hematopoietic engraftment in vivo (1 - 5). Furthermore, msc express class i, but not class ii, histocompatibility antigens, and they are not immunogenic in in vitro assays and in preclinical or clinical models . Recently, it has been reported that there are mesenchymal precursors in cord blood and peripheral blood of normal individuals . The results obtained demonstrate that after systemic infusion of cord blood msc into nude mice, human dna was found in the marrow and in ex vivo expanded stromal cells grown from the marrow of transplanted animals . Several groups also have reported bone and fat differentiation capacity from cord blood - derived nonhematopoietic cells (6 - 10). Despite the low initial frequency in cord blood, msc have a tremendous expansion potential in culture . Due to the limited number of hsc in a given cord blood unit, the outcome of hsc transplantation (hsct) could be improved by coengraftment of the msc in addition to the hematopoietic precursors . Several lines of evidence suggest that msc produce some essential hematopoietic growth factors (1 - 5). Based on these reports, we hypothesized that exogenously administered msc with cytokine gene - transfected would show additive or augmented effects on hsc expansion . In this study, mononuclear cells (mnc) were harvested from cord blood and seeded in long - term culture for ex vivo msc expansion . We transfected culture - expanded msc with granulocyte macrophage - colony stimulating factor (gm - csf) and stem cell factor (scf) cytokine genes and then cotransplanted with cord blood mnc in nonobese diabetic / severe combined immunodeficiency (nod / scid) mice to further promote hsc engraftment . Although cd34 + cells can be selected for the preparation of hsc, many cord blood hsct practically use unselected mnc . Therefore, we chose unselected mnc samples instead of selected samples as the source of stem cells for transplantation . Our results show that human cells were significantly increased in cotransplanted mice, and the number was even higher with the cytokine gene - transfected msc than with transplantation of mnc alone . These data not only provide direct evidence for the presence of msc in cord blood, but could also add to therapeutic profile of expanded msc for clinical use . Cord blood samples were collected from the umbilical vein after full - term vaginal delivery . Were suspended at a concentration of 110 cells / ml in mesencult medium (stemcell technologies, inc ., vancouver, bc, canada) and seeded in t-25 flasks . Cultures were maintained at 37 in humidified air and 5% co2 with a regular change of medium . After removal of non - adherent cells, the adherent layer was further cultured until 80 - 90% confluence . At this point, the cell population was expanded by successive passage and resulting adherent cells were used for experiments . The adherent cells were detached with 0.05% trypsin - ethylenediamine tetraacetic acid and washed with phosphate - buffered saline (pbs). The cells were washed with pbs containing 2% bovine serum albumin, and incubated with fitc - conjugated cd45 (bd biosciences, san jose, ca, u.s.a . ), pe - conjugated cd73 (bd biosciences), cd105 (dinona, inc ., seoul, korea), and cd166 (bd biosciences) on ice for 30 min in the dark . After fixation with 1% paraformaldehyde, flow cytometry was performed on the facsort instrument (becton dickinson, san jose, ca, u.s.a . ). For plasmid transfections, pegfp - n1 dna (clontech, palo alto, ca, u.s.a .) That encodes an enhanced green fluorescent protein (egfp) was used . Expanded msc were transfected with an egfp - expressing vectors after cloning with gm - csf (pegfp - n1/gm - csf) or scf (pegfp - n1/scf). To create pegfp - n1/gm - csf or pegfp - n1/scf, after sequencing of gm - csf and scf genes, ecori was used for digestion to insert cdna3.1 and noti was treated for scf . Stable msc transfectants that expressed high levels of gfp were cloned by limiting dilution and selected using 2 mg / ml neomycin (invitrogen corp ., the gfp - expressing cells were screened by a microplate spectrofluorometer (shimadzu, kyoto, japan) and confirmed by an enzyme - linked immunosorbent assay (elisa) (r & d systems, minneapolis, mn, u.s.a . ). Stable clones of msc with gfp and gm - csf or scf were maintained in dulbecco modified eagle medium (gibco laboratories, grand island, ny, u.s.a .) In the presence of neomycin until transplantation . Gfp - positive msc were visualized using a fluorescence microscope (olympus, japan) and then used for transplantation to nod / scid mice . Nod / scid mice were purchased from korea research institute of bioscience and biotechnology (kribb, daejeon, korea) and were maintained in sterile microisolator cages . Twelve to 24 hr after irradiation, cells in a final volume of 200 l were injected through the tail vein . We designed 4 experimental groups, and each group received 110 cells as a total: group 1 (n=5) received mnc only, group 2 (n=7) received a mixture of mnc plus msc, 0.510 respectively, group 3 (n=7) received a mixture of mnc plus gm - csf msc, 0.510 respectively, and group 4 (n=6) received a mixture of mnc plus scf msc, 0.510 respectively, per mouse . Six to 8 weeks later, blood samples were collected from the retroorbital venous plexus of the nod / scid mice . An aliquot of the blood was used for complete blood cell counts by sysmex xe-2100 (sysmex corp . Human cell engraftment was detected by flow cytometry, using fitc - conjugated cd45 (bd biosciences) and pe - conjugated cd34 (bd biosciences) antibodies . A part of venous blood was also exposed to a hypotonic solution, and fixed in methanol / acetic acid fixative . Nuclei were then stained with cep x (dxz1) alpha satellite probe (vysis, inc ., downers grove, il, u.s.a .) And cep y (dyz1) satellite iii probe (vysis) for fluorescence in situ hybridization (fish) identification of human cells . A total of at least 500 - 700 nuclei were examined in each case under a fluorescent microscope . Differences in engraftment percentages between experimental conditions were analyzed by student - t test . A p value less than 0.05 was considered statistically significant . Cord blood samples were collected from the umbilical vein after full - term vaginal delivery . Were suspended at a concentration of 110 cells / ml in mesencult medium (stemcell technologies, inc ., vancouver, bc, canada) and seeded in t-25 flasks . Cultures were maintained at 37 in humidified air and 5% co2 with a regular change of medium . After removal of non - adherent cells, the adherent layer was further cultured until 80 - 90% confluence . At this point, the cell population was expanded by successive passage and resulting adherent cells were used for experiments . The adherent cells were detached with 0.05% trypsin - ethylenediamine tetraacetic acid and washed with phosphate - buffered saline (pbs). The cells were washed with pbs containing 2% bovine serum albumin, and incubated with fitc - conjugated cd45 (bd biosciences, san jose, ca, u.s.a . ), pe - conjugated cd73 (bd biosciences), cd105 (dinona, inc ., seoul, korea), and cd166 (bd biosciences) on ice for 30 min in the dark . After fixation with 1% paraformaldehyde, flow cytometry was performed on the facsort instrument (becton dickinson, san jose, ca, u.s.a . ). For plasmid transfections, pegfp - n1 dna (clontech, palo alto, ca, u.s.a .) That encodes an enhanced green fluorescent protein (egfp) was used . Expanded msc were transfected with an egfp - expressing vectors after cloning with gm - csf (pegfp - n1/gm - csf) or scf (pegfp - n1/scf). To create pegfp - n1/gm - csf or pegfp - n1/scf, after sequencing of gm - csf and scf genes, ecori was used for digestion to insert cdna3.1 and noti was treated for scf . Stable msc transfectants that expressed high levels of gfp were cloned by limiting dilution and selected using 2 mg / ml neomycin (invitrogen corp ., the gfp - expressing cells were screened by a microplate spectrofluorometer (shimadzu, kyoto, japan) and confirmed by an enzyme - linked immunosorbent assay (elisa) (r & d systems, minneapolis, mn, u.s.a . ). Stable clones of msc with gfp and gm - csf or scf were maintained in dulbecco modified eagle medium (gibco laboratories, grand island, ny, u.s.a .) In the presence of neomycin until transplantation . Gfp - positive msc were visualized using a fluorescence microscope (olympus, japan) and then used for transplantation to nod / scid mice . Nod / scid mice were purchased from korea research institute of bioscience and biotechnology (kribb, daejeon, korea) and were maintained in sterile microisolator cages . Twelve to 24 hr after irradiation, cells in a final volume of 200 l were injected through the tail vein . We designed 4 experimental groups, and each group received 110 cells as a total: group 1 (n=5) received mnc only, group 2 (n=7) received a mixture of mnc plus msc, 0.510 respectively, group 3 (n=7) received a mixture of mnc plus gm - csf msc, 0.510 respectively, and group 4 (n=6) received a mixture of mnc plus scf msc, 0.510 respectively, per mouse . Six to 8 weeks later, blood samples were collected from the retroorbital venous plexus of the nod / scid mice . An aliquot of the blood was used for complete blood cell counts by sysmex xe-2100 (sysmex corp ., human cell engraftment was detected by flow cytometry, using fitc - conjugated cd45 (bd biosciences) and pe - conjugated cd34 (bd biosciences) antibodies . A part of venous blood was also exposed to a hypotonic solution, and fixed in methanol / acetic acid fixative . Nuclei were then stained with cep x (dxz1) alpha satellite probe (vysis, inc ., downers grove, il, u.s.a .) And cep y (dyz1) satellite iii probe (vysis) for fluorescence in situ hybridization (fish) identification of human cells . A total of at least 500 - 700 nuclei were examined in each case under a fluorescent microscope . Primary cultures of msc mainly consisted of colonies of spindle - shaped fibroblastoid cells (fig . Wright - giemsa staining of detached msc showed a large cell population characterized by abundant cytoplasms with occasional vacuoles and projections, fine nuclear chromatins, and one or more nucleoli (fig . Flow cytometry analyses demonstrated that msc expressed cd73, cd105, and cd166 in all cases, but were negative for cd45 (fig . The purity of expanded msc was 85 - 97% . At 24 hr after transfection, increased gfp expression was identified both by spectrofluorometry and elisa . The highest efficiency of the transfection was obtained after 5 - 7 days of culture both with pegfp - n1/gm - csf and pegfp - n1/scf (fig . 3, 4). Elisa detected increased gm - csf levels from msc cultures after transfection (273.78148.33 pg / ml) compared to those before transfection (34.3517.06 pg / ml) (p<0.05, n=4). Scf also increased from 1.301.05 pg / ml to 24.1020.21 pg / ml post transfection, however, there were no statistical differences (p>0.05, n=4). In mnc transplantation alone, the absolute numbers of total nucleated cell (tnc) count was 0.080.04 (10/l) (n=5) comparable to 0.130.05 (10/l) (n=7) in mice transplanted with mnc plus msc (table 1). However, higher levels of human xx or xy cell by fish (fig . 5) were found in transplantation of mnc plus msc, 0.410.41 (10/l) vs. 1.520.81 (10/l) (p<0.05). The tnc count, 4.630.96 (10/l) (n=7), and the percentage of xx or xy cells, 5.680.58 (10/l), were significantly higher (p<0.05) than those after transplantation of mnc alone . Also, higher levels of tnc count, 2.930.33 (10/l) (n=6), and xx or xy cells, 3.430.49 (10/l), were obtained following cotransplantation of mnc plus scf - transfected msc (p<0.05). Engraftment study with immunophenotypic analysis of cd45+/cd34 + cells by flow cytometry showed similar results (table 1, fig . Genetic modification of stem cells is an attractive target for gene therapy because of their higher proliferative capacity and long - term survival compared with other somatic cells . Msc have been demonstrated to be able to express exogenous protein for an extended period of time and to maintain this ability after transplantation in vitro (1, 11 - 14). Msc with forced expression of interferon beta were shown to inhibit the growth of malignant cells in vivo (11, 12). Gene - modification of msc with therapeutic cytokines also clearly augmented the antitumor effect and prolonged the survival of tumor - bearing animals (13). Recently more efficient non - viral dna transfection methods have been introduced to obtain stably transfected human cells (14, 15). It is possible that a therapeutic benefit from msc could be obtained by local production of growth factors and the provision of temporary immunosuppression . Human msc have a high expansion potential, genetic stability, and reproducible characteristics proven in widely dispersed laboratories (1 - 3). No adverse events during or after msc infusion have been reported, and no ectopic tissue formation has been observed . Based on these results, we hypothesized that exogenously administered msc with cytokine gene - transfected would show additive or augmented effects on hsc expansion . Among the various cytokines, we have previously demonstrated that the combination of scf, thrombopoietin, and flt3 ligand is sufficient for ex vivo expansion of cord blood (16). With the addition of granulocyte (g)-csf, the clonogenic and homing potentials of cord blood were even higher, although statistically significant differences were not observed . 17) also have shown that scf, interleukin (il)-3, il-6, and gm - csf could induce the up - regulation of several adhesion molecules involved in the mobilization and homing of hsc . Currently gm - csf is one of the most widely used cytokines for the purpose of stem cell mobilization and for the treatment of neutropenic patients . Therefore, we transfected culture - expanded cord blood msc with gm - csf and scf cytokine genes, and then cotransplanted with cord blood mnc in nod / scid mice to further promote hsc engraftment . We demonstrated that human cells were significantly increased in cotransplanted mice and even higher with the cytokine gene - transfected msc than in transplantation of mnc alone . Cotransplantation studies in animal models as well as in humans showed that primary or culture - expanded msc promote the engraftment of hsc (18 - 22). Cotransplantation of msc and cord blood (18, 19, 21) or mobilized peripheral blood (20) cd34 + cells resulted in a significantly higher level of engraftment than with transplantation of cd34 + cells only . Cotransplantation of human leukocyte antigen (hla)-identical sibling culture - expanded msc with an hla - identical sibling hsc was also feasible and safe without immediate infusional or late msc - associated toxicities (22). Several lines of evidence suggest that msc produce several essential hematopoietic growth factors including il-6, il-11, scf, leukemia inhibitory factor, and flt3 ligand and express adhesion molecules and extracellular matrix proteins that are known to play an important role in hsc homing such as vcam1, e - selectin, collagen i, and fibronectin (1 - 5, 20, 23). Different studies report that msc have an immunomodulatory effect and are able to suppress proliferation of t lymphocytes both by cell - cell interaction and via soluble factors (22 - 25). It has been claimed that there are mesenchymal precursors in cord blood and peripheral blood of normal individuals (6 - 8, 26, 27). Despite the low initial frequency in cord blood, msc have a tremendous expansion potential in culture . Compared to bone marrow msc, cord blood cultures were slower to establish, but once established, the growth was maintained over multiple passages . Using optimized isolation and culture conditions, cells showing a characteristic mesenchymal morphology and immune phenotype were isolated . The frequency of msc ranged from 0 - 2.3 clones per 110 mnc . Due to the limited number of hsc in a given cord blood unit, the outcome of hsc transplantation could be improved by coengraftment of the msc in addition to the hematopoietic precursors . (8) previously investigated the capability of transplanted cord blood msc to home and survive in the marrow of nude mice . They have detected human dna after transplantation in the marrow of recipients as well as in ex vivo - expanded stromal cells prepared from the marrow of transplants . In this study we found that cord blood msc cotransplantation enhances human cell engraftment . This enhancement was greater after cotransplantation of gm - csf- and scf - transfected msc . According to wagner et al . (26) several genes involved in mesodermal differentiation were differently expressed on msc from human bone marrow, adipose tissue, or umbilical cord blood . These results implied that potentials of mesodermal development might be different depending on msc preparations . By upregulating genes involved in proliferation and homing of cord blood msc msc are multipotent and believed to facilitate the engraftment of hsc when transplanted simultaneously in animal studies, and recently, even in human trials . In this study, we transfected culture - expanded cord blood msc with gm - csf and scf cytokine genes and then cotransplanted with cord blood hsc to further promote hsc engraftment . The tnc count and the engraftment of cd45+/cd34 + cells and xx or xy positive human cells were significantly increased in cotransplanted mice and even higher with the cytokine gene - transfected msc (gm - csf> scf, p<0.05) than in transplantation of hsc alone . Our results indicate that msc may serve as a platform to deliver hematopoietic growth factors in clinical stem cell transplantation . Delivering genes involved in homing and cell adhesions, cxcr4 or vla, would further increase the efficiency of stem cell transplantation in the future.
When detection is delayed or the rupture occurs spontaneously, it sometimes resembles acute kidney injury because ascites, oliguria and increasing serum creatinine levels are observed in patients with intraperitoneal urinary leakage . A 37-year - old woman presented with post - operative acute abdominal distension and an increasing serum creatinine level 7 days after total abdominal hysterectomy for uterine myoma . Her serum creatinine and urea nitrogen levels were elevated, but the serum beta2-microglobulin level was within normal limits . The patient had no history of kidney disease, and her serum creatinine level on post - operative day 1 was normal (0.76 mg / dl). Sodium, potassium and chloride levels in the ascitic fluid were 37, 19 and 76 meq / l, respectively, which differed markedly from the serum electrolyte levels (table 1). Laboratory findings of two cases of intraperitoneal urine leakage because these symptoms may also be caused by drug - induced nephropathy, all medications were stopped . However, no decrease in ascites or in the serum creatinine level was observed . Since the patient s urine volume had decreased, a urinary catheter was inserted . The perforation was closed surgically, and a subsequent retrograde cystography did not reveal urinary leak . Retrograde cystography exhibiting bladder perforation in case 1 (a) and case 2 (b). A 70-year - old woman with a history of radiotherapy for cervical cancer 16 years earlier presented with progressive abdominal distension over a 2-week period . On admission sodium, potassium and chloride levels in the ascitic fluid were 21, 23 and 78 meq / l, respectively, which differed from the serum electrolyte levels (table 1). After placement of the catheter in the bladder, the ascites disappeared, and the serum creatinine level decreased to the normal range . We performed retrograde cystography, but bladder perforation was not detected . Because the patient s condition had improved, she was discharged from the hospital . Three months after discharge, the patient was re - admitted with massive ascites and an increasing serum creatinine level . To determine the cause of serum creatinine elevation, we performed technetium-99 m diethylenetriaminepentaacetic acid (tc-99 m dtpa) renography, which showed extravasation of tc-99 m dtpa into the peritoneal cavity . Retrograde cystography revealed a small perforation in the bladder (figure 1b, arrow). Intraperitoneal urinary leakage is characterized by an increase in the serum creatinine level caused by reabsorption of creatinine in the urine through the peritoneal membrane, oliguria and ascites . Because most cases of intraperitoneal urinary leakage are the result of blunt trauma, leakage without obvious trauma the incidence of bladder injury after total abdominal hysterectomy is 0.1% . Because most bladder injuries are identified intraoperatively, delayed appearance of urinary leakage however, the literature includes one report of delayed intraperitoneal urinary leakage after caesarean section . Although spontaneous bladder perforation is uncommon, several cases have been reported in association with intravesicular obstruction, infectious lesion of the bladder, bladder diverticulum, bladder carcinoma, chemotherapy, and alcohol or substance abuse . Therefore, acute kidney injury with massive ascites and peritonitis should be distinguished from urinary leakage . However, our two cases had abdominal pain, but rebound tenderness, which is a sign of peritonitis, was not noted . Because bladder rupture without signs of peritonitis has been reported, symptoms of peritonitis may sometimes be unclear . Although a correlation between serum and ascitic electrolyte levels has not been clearly established, some papers have reported this correlation [79]. Sodium, potassium and chloride levels in ascitic fluid are nearly identical to those in serum (ascites vs. serum; sodium 133.1 6.6 vs. 131.8 6.3 mmol / l, potassium 4.1 0.8 vs. 4.3 0.9 mmol / l and chloride 107.2 7.6 vs. 101 7 mmol / l) in cirrhosis patients . In peritoneal dialysis patients, electrolyte levels in peritoneal dialysate that are retained longer than 24 h are nearly identical to those in serum (peritoneal dialysate vs. serum; sodium 141.4 vs. 140.6 meq / l, potassium 4.7 vs. 5.1 meq / l and chloride 108.5 vs. 102.7 meq / l). Another report noted that the ratio of sodium, potassium and chloride between serum and transudates which include ascites is 0.95, 0.740.80, and 0.950.99, respectively . However, in our two cases, the ascitic sodium, potassium and chloride levels differed markedly from their serum levels . Both serum beta2-microglobulin and creatinine levels are usually elevated in patients with acute kidney injury . This was not the case in our first patient, and this discrepancy may be a clue to the presence of intraperitoneal urinary leakage . The reason for this discrepancy has not been elucidated; however, beta2-microglobulin, due to its larger molecular size, may not be absorbed through the peritoneal membrane similar to creatinine . In addition, although we did not measure urea nitrogen and creatinine in the ascitic fluid, the higher levels in ascites than in the blood are additional clues suggesting the possibility of intraperitoneal urinary leakage . In summary, we report two cases with intraperitoneal urinary leakage resembling acute kidney injury . These cases suggest that bladder perforation should be considered in the differential diagnosis of acute kidney injury with massive ascites.
Ocular surface diseases occur in 15% of elderly patients and 4859% of patients with glaucoma [13]. Ocular surface disease is hypothesized to occur in patients with glaucoma due to the side effects of antiglaucoma eye drops or glaucoma surgery . Antiglaucoma eye drops are associated with a decrease in lacrimal fluid and disturbances in corneal epithelial barrier function . When drug - induced corneal disorders occur, the use of antiglaucoma eye drops is generally stopped; however, this can lead to intraocular pressure elevation . Thus, it would be preferable to improve drug - induced corneal disorders without discontinuing the use of antiglaucoma eye drops . After systemic oral intake, rebamipide increases mucin secretion from the gastric mucus, and it has been used clinically to treat gastritis and gastric ulcers [57]. Because of its effects on gastric mucin secretion, it was hypothesized that rebamipide might enhance mucin production in conjunctival goblet cells . Indeed, previous studies indicate that mucin production in conjunctival goblet cells was increased after rebamipide treatment [8, 9]. Given that dry eye is caused by decreased mucin levels on the ocular surface and impaired stabilization of the aqueous layer, rebamipide was developed as a treatment for dry eye . Although a recent study demonstrated that rebamipide ophthalmic suspensions were effective in treating keratoconjunctivitis sicca in patients with sjgren's syndrome, its effect on the ocular surface condition in glaucoma patients who are using antiglaucoma eye drops remains unclear . The purpose of this randomized and prospective study was to examine the effect of rebamipide eye drops to prevent antiglaucoma eye drop - induced corneal disorders . Forty eyes of 40 glaucoma patients (mean age: 62.8 13.1 years) were used upon meeting the diagnostic criteria for dry eye . The inclusion criteria for participating in the present study were as follows: history of treatment with 0.005% latanoprost containing benzalkonium chloride (bak) and 0.5% timolol containing bak (unfixed combination) for six or more months, fluorescein staining score of 2 or more points, and symptoms, such as eye discomfort . The eyes were randomized into two groups: 20 eyes of 20 patients (mean age 61.4 14.2 years; 8 men, 12 women) received ophthalmic suspensions containing rebamipide, while 20 eyes of 20 patients (mean age 64.3 12.1 years; 13 men, 7 women) did not receive rebamipide (control). For the rebamipide treatment group, the subjects received rebamipide eye drops four times per day every day during the observation period . Intraocular pressure (iop) was measured by a single examiner (nt) throughout the examination period with a goldmann applanation tonometry at 11:00 am in a sitting position . To evaluate corneal epithelial barrier function, a slit lamp fluorophotometer for the anterior eye was used (kowa, fl-500, tokyo, japan). According to the method by yokoi and kinoshita, the background fluorescence intensity of the central cornea was measured . Using a micropipette, 0.5% fluorescein sodium solution dissolved in bss plus (3 l, alcon, fort worth, tx, usa) was applied to the lower conjunctival sac without contact . Eyes were washed with bss plus (20 ml) 10 min after application . Fluorescein uptake was measured 30 min after application using the same protocol used in the baseline measurement . The background was subtracted, and the fluorescein uptake concentration was calculated based on a standard curve as a built - in function of the fl-500 . The data were expressed as ng / ml (normal value: 28 16 ng / ml). Slit lamp microscopy was used to measure corneal status and tear film break - up time (tbut). To measure tbut, fluorescein sodium was applied to the eye, and the patient blinked several times to allow for uniform distribution . The time until dry spots occurred in the cornea of the open eye was measured three times, and the mean was used . The severity of superficial punctate keratopathy was evaluated by area - density (ad) classification, which scores the range of the lesion (area) and the density of the spotted stain . Data were analyzed using ibm spss statistics 21 (ibm corporation, poughkeepsie, ny, usa). Each examination was analyzed using a paired t - test, and a p value less than 0.05 was considered statistically significant . This study was performed after the approval of the ethical committee of our hospital (ethical committee approval number: 1933), and all the patients provided written informed consent . We first assessed changes in intraocular pressure in patients undergoing control or rebamipide treatment (figure 1). Rebamipide treatment had no effect on the intraocular pressure in patients receiving antiglaucoma eye drops (16.6 2.3 mmhg at baseline; 15.8 2.3 mmhg after 4 weeks; and 15.6 1.8 mmhg after 8 weeks). Furthermore, no changes in pressure were observed in the eyes of control glaucoma patients (16.2 2.3 mmhg at baseline; 16.3 2.1 mmhg after 4 weeks; and 15.9 2.2 mmhg after 8 weeks). Importantly, both groups maintained reduced intraocular pressure without significant difference during follow - up . We next assessed the corneal epithelial barrier function in glaucoma patients receiving control or rebamipide treatment (figure 2). Notably, substantial increases in fluorescein uptake were observed in both groups at baseline, since both groups received 0.005% latanoprost containing bak and 0.5% timolol containing bak, indicating the existence of corneal epithelial barrier dysfunction induced by antiglaucoma drops . In contrast, significant decreases in fluorescein uptake were observed in eyes treated with rebamipide after 4 and 8 weeks (120.7 56.1 ng / ml at baseline; 87.7 43.8 ng / ml after 4 weeks [p = 0.012]; and 91.5 37.9 ng / ml after 8 weeks [p = 0.017]). In contrast, no significant difference in fluorescein uptake was observed in control eyes (119.9 61.7 ng / ml at baseline; 123.6 44.4 ng / ml after 4 weeks [p = 0.671]; and 119.9 42.4 ng / ml after 8 weeks [p = 0.995]). Next, we analyzed tbut in glaucoma patients receiving control or rebamipide treatment (figure 3). There was no statistical difference between the control group and rebamipide - treated group at the baseline (5.8 1.4 s and 5.2 1.5 s, resp . Treatment with rebamipide partially but significantly increased tbut at 8 weeks (5.2 1.5 s at baseline; 5.9 1.6 s after 8 weeks, p = 0.02), although no significant differences were observed at 4 weeks (5.2 1.5 s at baseline; 5.4 0.8 s after 4 weeks, p = 0.331). No significant difference was observed in the control group (5.8 1.4 s at baseline; 5.9 0.9 s after 4 weeks, p = 0.771; and 5.6 1.0 s after 8 weeks, p = 0.082). Finally, we assessed superficial punctate keratopathy in glaucoma patients by ad classification (figure 4). Treatment with rebamipide resulted in significant improvements in keratopathy at 8 weeks, but there were no changes at 4 weeks (2.1 0.7 points at baseline; 1.9 0.7 points after 4 weeks, p = 0.162; and 0.8 1.0 points after 8 weeks, p <0.001). However, no significant difference was observed in the control group (2.1 0.7 points at baseline; 2.2 0.4 points after 4 weeks, p = 0.66; and 2.4 0.6 points after 8 weeks, p = 0.06). Ophthalmic rebamipide suspensions are sterilized, single - use disposable therapeutics that lack preservatives to prevent secondary pollution . Therefore, we attempted to evaluate its effect in view of several ocular surface factors in antiglaucoma eye drops - induced corneal disorder . Fluorophotometry is a technique that can evaluate corneal epithelial barrier function . In this method, enhanced uptake of fluorescein indicates decreased corneal epithelial barrier function . Using this method, previous studies demonstrated the effects of antiglaucoma eye drops containing preservatives, such as bak, on corneal epithelial barrier function [4, 13, 14, 1719]. For example, a previous study showed that fluorescein uptake was significantly increased upon exposure to either timolol with bak or timolol without bak (baseline and postexposure values: 37.5 and 82.0 ng / ml, resp . 35.4 versus 57.6 ng / ml, resp ., p <0.001 for unpreserved timolol), and it also showed that preserved timolol exerted a greater effect (p = 0.028) in healthy volunteers . A different study showed that although the difference in corneal fluorescein uptake was not significant, it increased from 31.3 33.0 ng / ml to 72.3 74.9 ng / ml in eyes treated with timolol solution with bak (p = 0.073) in healthy volunteers . Since timolol with bak alone affects corneal epithelial barrier function even in the healthy subjects, it is reasonable to expect that timolol with bak and other antiglaucoma eye drops with bak further decrease corneal epithelial barrier function in glaucoma patients . Indeed, ishibashi et al . Reported that fluorescein uptake was higher when eyes were treated with a combination of latanoprost and bak plus -blockers and bak (118.9 25.9 ng / ml) than when eyes were treated with latanoprost with bak alone (57.1 11.0 ng / ml) after 30 days . Furthermore, a report by nakagawa et al . Indicated that latanoprost prepared with or without bak can reduce corneal epithelial barrier function, implying that latanoprost itself also affects barrier function . Consistent with these findings, in the present study, we found that the group treated with timolol maleate and latanoprost showed exceedingly high fluorescein uptake at baseline in both the rebamipide - treated group and the rebamipide - untreated group (120.7 56.1 ng / ml and 119.9 61.7 ng / ml, resp . ). These findings suggest that corneal epithelial barrier function was decreased by latanoprost with bak and timolol maleate with bak . In the present study, we found that fluorescein uptake was significantly decreased in eyes treated with rebamipide after 4 or 8 weeks, as compared to baseline . Another group recently demonstrated that rebamipide increases barrier function in a human corneal epithelial cell line, as measured by transepithelial electrical resistance . Therefore, it is likely that rebamipide can increase corneal barrier function in vivo and in vitro . The in vitro study also demonstrated the anti - inflammatory effects of rebamipide because rebamipide inhibited increases in interleukin- (il-) 6 and il-8 induced by tumor necrosis factor (tnf). These data suggest that antiglaucoma eye drop - induced corneal disorder is associated with inflammation because eyes treated with latanoprost with bak and timolol with bak had a higher mean number of inflammatory cells than eyes treated with artificial tears in the epithelium and superficial stroma in rabbits . Furthermore, tbut is widely used as a parameter to noninvasively evaluate the stability of the tear layer . In a report by kinoshita et al ., ophthalmic rebamipide suspensions were administered in patients with dry eye, resulting in a significant increase in tbut versus the placebo group . Antiglaucoma eye drop - related corneal disorders are caused by decreased tbut [2, 24, 25] and a reduction in goblet cell density [26, 27]. Timolol maleate is reported to decrease lacrimal fluid secretion through its local anesthetic effect and through its toxic effect on the keratoconjunctival epithelium . Both -adrenergic receptor blockers and prostaglandin analogs as well as reductions in corneal sensitivity can decrease lacrimal fluid . The impact of antiglaucoma eye drops on the cornea is great because these drugs are administered without dilution . Repeated exposure of the cornea to antiglaucoma eye drops can enhance inflammatory cytokines, such as tnf, il-1, il-6, and il-8, thereby impairing corneal epithelial barrier function [3033], leading to drug - induced ocular surface disorders . In the present study, we found that rebamipide had no effect on intraocular pressure but it decreased fluorescein uptake and ad score as well as enhancing tbut . These results suggest that ophthalmic rebamipide suspensions may improve ocular surface disease as well as corneal epithelial barrier function while allowing for the maintenance of intraocular pressure with antiglaucoma eye drops . The limitations of the current study include a small sample size and a relatively short follow - up duration . Because antiglaucoma eye drops need to be continued for long periods, the effect of rebamipide should be evaluated for longer times . In conclusion, these findings suggest that ophthalmic rebamipide suspensions may improve dry eye and repair drug - induced keratopathy when antiglaucoma eye drop - induced ocular surface disorder occurs.
Dsrcts are rare tumours of young adults (mean age 28.3 years) with a male predominance (4:1). Painful abdominal masses clinically predominate . Multifocal peritoneal masses with a dominant soft tissue lesion is a distinctive imaging finding . A large desmoplastic reaction differentiates dsrcts from histologically similar round cell subtypes . Despite debulking surgery with adjuvant chemotherapy, median survival from diagnosis is 22.3 months . Desmoplastic small round cell tumour (dsrct) is a rare but highly aggressive soft tissue sarcoma that arises most commonly in the abdomino - pelvic cavity of males in adolescence or young adulthood ., this tumour is so called due to its typical histological finding of nests of small blue round cells within a dense desmoplastic stroma . Differentiation of dsrct from other soft tissue sarcomas is important, as it is a high - grade neoplasm often presenting with advanced disease, with a mean survival time of less than 3 years [3, 4]. There are limited data describing the imaging features of dsrct with several published case reports but no substantial case series . This is the largest imaging review of dsrct to date in the context of the demographic and clinical data, describing the imaging features on computed tomography (ct), magnetic resonance imaging (mri), ultrasound and positron emission tomography (pet) that are most suggestive of dsrct . The role of imaging, current treatment options and the follow - up of these patients is also discussed . The imaging of 28 patients with biopsy - proven dsrct was referred to the royal marsden hospital soft tissue tumour unit for diagnosis and management over a 21-year period (from 1st january 1991 to 21st may 2012). Eight patients were referred for opinion only and were managed subsequently at their local hospital . The referral imaging was not pacs - archived for recall analysis at our institution and these patients were excluded from the study (n = 20). The initial imaging of the majority of patients was performed at local hospitals where imaging protocols adopted in those studies could not be influenced . Imaging was only repeated if clinically indicated . In all patients, the diagnosis of dsrct was confirmed at our institution, following percutaneous or surgical biopsy using a combination of histological, immunohistochemical and molecular cytogenetic profiles . The majority of these biopsies were performed in this hospital and the few performed at the referring institution had the biopsy samples re - reviewed by a specialist soft tissue tumour pathologist . Clinical and demographic data (including clinical management and patient outcome) was obtained from the database and review of individual patient case notes was undertaken where appropriate . Two radiologists experienced in sarcoma imaging reviewed all imaging studies and consensus opinion was reached . In each study, the following imaging findings were recorded: the presence of peritoneal deposits; a dominant soft tissue lesion (location, size, the presence of cystic, heterogeneous or calcific components and the presence of enhancement); peritoneal or peritoneal fluid; site and location of enlarged lymph nodes; visceral obstruction; distant metastatic disease . Enhancement of the lesion was characterised by comparing the density of the lesion with that of the normally enhancing liver . The mean age at presentation was 28.3 years (age range 1546 years). The most common clinical presentation was of an abdominal mass (15 patients [75%]). The next most common presentations were with abdominal pain (ten patients [50%]) and weight loss (three patients [15%]), with sweats (one patient [5%]), back pain (one patient [5%]) and lethargy (one patient [5%]) also noted . In two patients (10%), the presentation was an incidental finding at surgery, in one patient during appendicectomy for appendicitis and in the other during caesarean section delivery . All patients underwent contrast enhanced ct (cect) at presentation, prior to treatment . Of these, six underwent ct of the abdomen and pelvis and 14 underwent ct of the chest, abdomen and pelvis . Cect of the chest was obtained in the arterial phase, and cect of the abdomen and pelvis was obtained in the portal venous phase . Of the six patients who did not have ct imaging of the chest, chest radiographs were performed . The most common ct finding at presentation was peritoneal / omental disease (19/20 patients [95%]). In 17 of these 19 patients (89%), this manifested as multiple peritoneal / omental soft tissue masses, with a solitary peritoneal mass seen in the remaining 2/19 (10%) cases (fig . 1, 2, 3 and 4). In the one case without peritoneal disease, there was a right paravertebral mass posterior to the diaphragmatic crus with metastatic involvement of the adjacent t11 and t12 vertebral bodies (fig . 1 a axial cect of the abdomen in a 24-year - old man with dsrct . There is a large, heterogeneous peritoneal mass in the abdominal cavity (white arrowheads). It is predominantly cystic but has solid enhancing tissue within it (black arrows). Peritoneal thickening and a peritoneal soft tissue nodule are seen separate to the mass (white arrow). There is a large heterogeneous, mixed solid and cystic mass in the left upper quadrant (white arrowheads). 3axial cect of the abdomen and pelvis in a 23-year - old male patient with dsrct . There is diffuse omental thickening (white arrows) as well as moderate volume of ascites (black arrow)fig . 4 a axial cect of the abdomen in a 22-year - old female patient with dsrct . There are multiple hypo - attenuating, heterogeneous liver metastases (black arrows). 5sagittal t1-weighted mri of the lower thoracic spine in a 20-year - old man with dsrct . There is a heterogeneous paravertebral mass lying anterior to the t11 and t12 vertebral bodies (white arrowheads). Whilst there is no direct invasion of the vertebral bodies, there is low signal intensity within the t11 and t12 vertebral bodies in keeping with bony metastatic disease (white arrows) a axial cect of the abdomen in a 24-year - old man with dsrct . There is a large, heterogeneous peritoneal mass in the abdominal cavity (white arrowheads). It is predominantly cystic but has solid enhancing tissue within it (black arrows). Peritoneal thickening and a peritoneal soft tissue nodule are seen separate to the mass (white arrow). There is diffuse peritoneal thickening scalloping the edges of the liver (black arrowheads) axial cect of the abdomen in a 25-year - old man with dsrct . There is a large heterogeneous, mixed solid and cystic mass in the left upper quadrant (white arrowheads). There is calcification within it (black arrow) axial cect of the abdomen and pelvis in a 23-year - old male patient with dsrct . There is diffuse omental thickening (white arrows) as well as moderate volume of ascites (black arrow) a axial cect of the abdomen in a 22-year - old female patient with dsrct . There are multiple peritoneal soft tissue nodules in the pelvis (white arrows) sagittal t1-weighted mri of the lower thoracic spine in a 20-year - old man with dsrct . There is a heterogeneous paravertebral mass lying anterior to the t11 and t12 vertebral bodies (white arrowheads). Whilst there is no direct invasion of the vertebral bodies, there is low signal intensity within the t11 and t12 vertebral bodies in keeping with bony metastatic disease (white arrows) a dominant soft tissue lesion was seen in 16/20 cases (80%). In the context of multiple peritoneal / omental soft tissue deposits (fig . 2), this was defined as being at least double the size of the next largest soft tissue deposit . Of these dominant lesions, 10/16 (63%) had their epicentre in the abdomen, 5/16 (31%) in the pelvis and 1/16 (6%) in a paravertebral location posterior to the right diaphragmatic crus . In all 16 cases with a dominant soft tissue lesion, the size of the lesion was 5 cm and in 11/16 cases (69%) its size was 10 cm . The lesions were heterogeneous in 14/20 patients (70%) and demonstrated low attenuation cystic areas in 11/20 patients (55%, fig . Calcification was seen within the soft tissue lesions in 4/20 cases (20%, fig . 2). Peritoneal free fluid was seen in 6/20 patients (30%) with this fluid being large volume in nature in 2/6 (33%) of these cases (fig . Lymph node enlargement was demonstrated in 10/20 patients (50%) with sites of enlargement in the abdomen in 8/10 (80%) cases, of these 8/8 (100%) in a para - aortic, 6/8 (71%) aorto - caval, 4/8 (50%) porto - caval and 1/8 (13%) in a mesenteric location . Mediastinal lymph node enlargement was seen in two of the ten cases (20%). Metastases were noted in the liver in 4/20 patients (20%, fig . 4a), in the lung (as a solitary lesion) in 1/20 patients (5%) and in the bones in 1/20 patients (5%). In one patient (6%), a dominant soft tissue mass in the region of the lesser omentum resulted in biliary obstruction, requiring treatment with a biliary stent . In addition to ct, five patients underwent mri, with three having mri of the abdomen and pelvis, one of the thoraco - lumbar spine and one of the lumbar spine . Mri was performed as clinically indicated to further characterise dominant lesions or findings on the ct studies . In all mri studies, fat - saturated t1 weighted sequences were performed pre- and post - intravenous gadolinium to assess enhancement . In the three mris performed to further characterise dominant soft tissue lesions, the dominant lesion was heterogeneous but predominantly hypo- or iso - intense to skeletal muscle on t1-weighted sequences and hyperintense on t2-weighted sequences (fig . There is a complex lesion in the gallbladder fossa, which demonstrates a measurable soft tissue component with a peripheral myxoid degeneration . The soft tissue returns signal that is marginally higher than the adjacent hepatic parenchyma and isointense to the spleen, with characteristic t2 fluid signal returned from the cystic componentfig . Histology shows sheets of tumour composed of small round cells (white arrow) which are surrounded by prominent sclerotic fibrous stroma (black arrow). (haematoxylin and eosin, 100) coronal t2-weighted mri of the abdomen in a 21-year - old man with dsrct . There is a complex lesion in the gallbladder fossa, which demonstrates a measurable soft tissue component with a peripheral myxoid degeneration . The soft tissue returns signal that is marginally higher than the adjacent hepatic parenchyma and isointense to the spleen, with characteristic t2 fluid signal returned from the cystic component desmoplastic small round cell tumour . Histology shows sheets of tumour composed of small round cells (white arrow) which are surrounded by prominent sclerotic fibrous stroma (black arrow). (haematoxylin and eosin, 100) the mri of the lumbar spine confirmed a low - signal lesion within the l2 vertebral body on the t1-weighted images (fig . Sixteen patients were treated with first - line combination chemotherapy between 1998 and 2009 . Of these sixteen, three were treated elsewhere . Of the 13 patients treated with first - line chemotherapy (with follow - up) at the royal marsden hospital, 6/13 (46%) achieved a partial response and 5/13 (39%) stable disease . Of these 13 patients, two received multimodality management consisting of chemotherapy, surgery and radiotherapy and were alive, 18 and 27 months respectively following initiation of therapy (one having developed severe malabsorption post - therapy). One patient was treated with chemotherapy and surgery, and was alive 110 months following commencement of treatment . One patient was treated with chemotherapy and radiotherapy, and died 50 months following diagnosis . All the other patients (n = 9) received combination chemotherapy alone and have died of disease (69%). The median progression - free survival from starting first line chemotherapy was 15.6 months (95% ci 8.223.1). The median overall survival from diagnosis was 22.8 months (95% ci 1035.5). The most common clinical presentation was of an abdominal mass (15 patients [75%]). The next most common presentations were with abdominal pain (ten patients [50%]) and weight loss (three patients [15%]), with sweats (one patient [5%]), back pain (one patient [5%]) and lethargy (one patient [5%]) also noted . In two patients (10%), the presentation was an incidental finding at surgery, in one patient during appendicectomy for appendicitis and in the other during caesarean section delivery . All patients underwent contrast enhanced ct (cect) at presentation, prior to treatment . Of these, six underwent ct of the abdomen and pelvis and 14 underwent ct of the chest, abdomen and pelvis . Cect of the chest was obtained in the arterial phase, and cect of the abdomen and pelvis was obtained in the portal venous phase . Of the six patients who did not have ct imaging of the chest, chest radiographs were performed . The most common ct finding at presentation was peritoneal / omental disease (19/20 patients [95%]). In 17 of these 19 patients (89%), this manifested as multiple peritoneal / omental soft tissue masses, with a solitary peritoneal mass seen in the remaining 2/19 (10%) cases (fig . 1, 2, 3 and 4). In the one case without peritoneal disease, there was a right paravertebral mass posterior to the diaphragmatic crus with metastatic involvement of the adjacent t11 and t12 vertebral bodies (fig . 1 a axial cect of the abdomen in a 24-year - old man with dsrct . There is a large, heterogeneous peritoneal mass in the abdominal cavity (white arrowheads). It is predominantly cystic but has solid enhancing tissue within it (black arrows). Peritoneal thickening and a peritoneal soft tissue nodule are seen separate to the mass (white arrow). There is a large heterogeneous, mixed solid and cystic mass in the left upper quadrant (white arrowheads). 3axial cect of the abdomen and pelvis in a 23-year - old male patient with dsrct . There is diffuse omental thickening (white arrows) as well as moderate volume of ascites (black arrow)fig . 4 a axial cect of the abdomen in a 22-year - old female patient with dsrct . There are multiple hypo - attenuating, heterogeneous liver metastases (black arrows). 5sagittal t1-weighted mri of the lower thoracic spine in a 20-year - old man with dsrct . There is a heterogeneous paravertebral mass lying anterior to the t11 and t12 vertebral bodies (white arrowheads). Whilst there is no direct invasion of the vertebral bodies, there is low signal intensity within the t11 and t12 vertebral bodies in keeping with bony metastatic disease (white arrows) a axial cect of the abdomen in a 24-year - old man with dsrct . There is a large, heterogeneous peritoneal mass in the abdominal cavity (white arrowheads). It is predominantly cystic but has solid enhancing tissue within it (black arrows). Peritoneal thickening and a peritoneal soft tissue nodule are seen separate to the mass (white arrow). There is diffuse peritoneal thickening scalloping the edges of the liver (black arrowheads) axial cect of the abdomen in a 25-year - old man with dsrct . There is a large heterogeneous, mixed solid and cystic mass in the left upper quadrant (white arrowheads). There is calcification within it (black arrow) axial cect of the abdomen and pelvis in a 23-year - old male patient with dsrct . There is diffuse omental thickening (white arrows) as well as moderate volume of ascites (black arrow) a axial cect of the abdomen in a 22-year - old female patient with dsrct . There are multiple peritoneal soft tissue nodules in the pelvis (white arrows) sagittal t1-weighted mri of the lower thoracic spine in a 20-year - old man with dsrct . There is a heterogeneous paravertebral mass lying anterior to the t11 and t12 vertebral bodies (white arrowheads). Whilst there is no direct invasion of the vertebral bodies, there is low signal intensity within the t11 and t12 vertebral bodies in keeping with bony metastatic disease (white arrows) a dominant soft tissue lesion was seen in 16/20 cases (80%). In the context of multiple peritoneal / omental soft tissue deposits (fig . 2), this was defined as being at least double the size of the next largest soft tissue deposit . Of these dominant lesions, 10/16 (63%) had their epicentre in the abdomen, 5/16 (31%) in the pelvis and 1/16 (6%) in a paravertebral location posterior to the right diaphragmatic crus . In all 16 cases with a dominant soft tissue lesion, the size of the lesion was 5 cm and in 11/16 cases (69%) its size was 10 cm . The lesions were heterogeneous in 14/20 patients (70%) and demonstrated low attenuation cystic areas in 11/20 patients (55%, fig . Calcification was seen within the soft tissue lesions in 4/20 cases (20%, fig . 2). Peritoneal free fluid was seen in 6/20 patients (30%) with this fluid being large volume in nature in 2/6 (33%) of these cases (fig . Lymph node enlargement was demonstrated in 10/20 patients (50%) with sites of enlargement in the abdomen in 8/10 (80%) cases, of these 8/8 (100%) in a para - aortic, 6/8 (71%) aorto - caval, 4/8 (50%) porto - caval and 1/8 (13%) in a mesenteric location . Mediastinal lymph node enlargement was seen in two of the ten cases (20%). Metastases were noted in the liver in 4/20 patients (20%, fig . 4a), in the lung (as a solitary lesion) in 1/20 patients (5%) and in the bones in 1/20 patients (5%). In one patient (6%), a dominant soft tissue mass in the region of the lesser omentum resulted in biliary obstruction, requiring treatment with a biliary stent . In addition to ct, five patients underwent mri, with three having mri of the abdomen and pelvis, one of the thoraco - lumbar spine and one of the lumbar spine . Mri was performed as clinically indicated to further characterise dominant lesions or findings on the ct studies . In all mri studies, fat - saturated t1 weighted sequences were performed pre- and post - intravenous gadolinium to assess enhancement . In the three mris performed to further characterise dominant soft tissue lesions, the dominant lesion was heterogeneous but predominantly hypo- or iso - intense to skeletal muscle on t1-weighted sequences and hyperintense on t2-weighted sequences (fig . There is a complex lesion in the gallbladder fossa, which demonstrates a measurable soft tissue component with a peripheral myxoid degeneration . The soft tissue returns signal that is marginally higher than the adjacent hepatic parenchyma and isointense to the spleen, with characteristic t2 fluid signal returned from the cystic componentfig . Histology shows sheets of tumour composed of small round cells (white arrow) which are surrounded by prominent sclerotic fibrous stroma (black arrow). (haematoxylin and eosin, 100) coronal t2-weighted mri of the abdomen in a 21-year - old man with dsrct . There is a complex lesion in the gallbladder fossa, which demonstrates a measurable soft tissue component with a peripheral myxoid degeneration . The soft tissue returns signal that is marginally higher than the adjacent hepatic parenchyma and isointense to the spleen, with characteristic t2 fluid signal returned from the cystic component desmoplastic small round cell tumour . Histology shows sheets of tumour composed of small round cells (white arrow) which are surrounded by prominent sclerotic fibrous stroma (black arrow). (haematoxylin and eosin, 100) the mri of the lumbar spine confirmed a low - signal lesion within the l2 vertebral body on the t1-weighted images (fig . Sixteen patients were treated with first - line combination chemotherapy between 1998 and 2009 . Of these sixteen, three were treated elsewhere . Of the 13 patients treated with first - line chemotherapy (with follow - up) at the royal marsden hospital, 6/13 (46%) achieved a partial response and 5/13 (39%) stable disease . Of these 13 patients, two received multimodality management consisting of chemotherapy, surgery and radiotherapy and were alive, 18 and 27 months respectively following initiation of therapy (one having developed severe malabsorption post - therapy). One patient was treated with chemotherapy and surgery, and was alive 110 months following commencement of treatment . One patient was treated with chemotherapy and radiotherapy, and died 50 months following diagnosis . All the other patients (n = 9) received combination chemotherapy alone and have died of disease (69%). The median progression - free survival from starting first line chemotherapy was 15.6 months (95% ci 8.223.1). The median overall survival from diagnosis was 22.8 months (95% ci 1035.5). Dsrct is an extremely rare and aggressive soft tissue sarcoma, with only a few hundred cases reported in the literature . This tumour generally presents with multifocal abdomino - pelvic masses and is reported to occur in adolescence and early adulthood . In our series of patients, the mean age at presentation was 28.3 years, with the oldest patient being 46 years of age . This is slightly higher than the usual age range of 1825 years, although dsrct has been reported in patients older than this . The male - to - female ratio of dsrct is reported to be 4:1 [6, 7]. In our patient cohort, the male - to - female ratio was 5:1, confirming a male preponderance in this histological subtype . The aetiology of dsrct is unknown but it is thought to be a malignancy of the mesothelium and, as such, occurs most commonly in the peritoneum and omentum . It has also been noted to occur in other sites of mesothelial origin such as the pleura and tunica vaginalis of the testis as well as solid organs including the pancreas, liver, kidneys and ovaries [5, 912]. In our series, 19 cases (95%) involved the peritoneum or omentum, with only one case occurring in an extraperitoneal location (fig . The imaging findings in our series represent the largest review in the literature to our knowledge . Characteristic imaging features included diffuse peritoneal / omental masses (95%) with multiple soft tissue deposits seen in 79% of these cases (fig . A dominant soft tissue mass not involving a visceral organ of origin, either solitary or at least twice the size of other peritoneal / omental lesions was seen in 80% of patients (figs . 1a, 2). This has been noted in previous smaller studies [1316]. In a review of the ct findings of 11 patients with dsrct by bellah et al ., in their cohort 82% of the dominant lesions were in the rectovesical or rectouterine space and they postulated that this might be due to the dynamic flow of peritoneal fluid and the dependency of these locations . However, our findings do not support this theory, with only 36% (5/16 patients) of the dominant lesions occurring in the pelvis, the remainder occurring in the abdomen (62%) and the right paravertebral region arising from the diaphragmatic crus (6%). Regarding the imaging characteristics of the soft tissue lesions, enhancement following intravenous contrast this was heterogeneous in 70% of cases on ct and in 100% of the four cases in which lesions were characterised further using contrast enhanced mri . Central cystic morphology was seen within lesions on ct in 50% of cases and in 100% of the four cases evaluated on mri, most likely to be due to necrosis, haemorrhage or a fibromyxoid component to the tumour (figs . 1a, 2) [14, 16]. The presence of calcification within lesions has been reported variably in the literature, with one study of 13 patients documenting the absence of lesional calcification in all patients . However, other smaller studies have shown a prevalence of lesional calcification of between 2255% [14, 15, 19]. In our cohort, lesional calcification was noted in 20% of cases on ct (fig . 2). This suggests that whilst lesional calcification is a not uncommon finding in dsrct, it is not frequent enough a finding to be characteristic . Whilst haemorrhagic tumour necrosis has been noted on mri in the literature, none of the cases evaluated with mri in our cohort demonstrated lesional t1 hyperintensity or t2 fluid - fluid levels to suggest the presence of haemorrhage [19, 20, 22]. Lymph node enlargement was a common finding, demonstrated in 50% of patients at presentation . Of those patients with lymph node involvement, 80% had retroperitoneal lymph node enlargement, with the next most common sites being in the mediastinal (20%) and mesenteric (13%) regions . This is consistent with prior smaller studies noting lymphatic spread at presentation [1419]. Ascites (30%) and pleural effusions (25%) at presentation were common findings in our study, and this is again consistent with smaller studies . . Demonstrated distant metastases in 50% of their cases and whilst the frequency in our larger patient cohort was lower (30%), our findings still suggest that metastases are common at presentation . As such, imaging studies should be evaluated thoroughly for metastases, particularly in the liver and bones (fig . Smaller cohort studies of four to eight patients suggest pleural involvement in 63100% [20, 21]. This contradicts our findings of only one patient (0.5%) having macroscopic disease above the diaphragm . In our experience, ct plays the most useful role in diagnosis and staging of dsrct and should be the initial imaging test of choice . Ultrasound may be helpful in guiding percutaneous biopsy of relatively superficial lesions but it does not help characterise lesions further, typically demonstrating lobulated, heterogeneous hypo - echoic lesions (fig . Whilst mri can provide some further characterisation of the lesions of dsrct (such as the presence of intra lesional haemorrhagic necrosis), these characteristics do not occur frequently enough with this tumour to make the findings helpful in differentiating dsrct from other tumours . Fluorodeoxyglucose (fdg)-pet / ct has been shown to identify occult lesions not demonstrated on ct or mri [15, 19]. Histologically because the small round cells are seen embedded in a prominent desmoplastic stroma (fig . This in particular may be useful in the assessment of tumour response to chemo- or radiotherapy, and could detect early tumoral relapse before conventional anatomical imaging [2426].fig . 8two trans abdominal ultrasound images acquired in the transverse and longitudinal plane in a 29-year - old man with dsrct . They demonstrate a heterogeneously echogenic soft tissue mass within the left lower quadrant that is macroscopically inseparable from the adjacent peritoneum and bowel . 9coronal f - fdg pet / ct imaging in a 21-year - old male patient with dsrct . This image demonstrates the extent of disease with multiple areas of fdg uptake within the abdomen, which correspond to peritoneal deposits and retroperitoneal lymph node disease on the ct component . Imaging also confirms the presence of hepatic metastases which were covert on a previous contrast enhanced ct scan two trans abdominal ultrasound images acquired in the transverse and longitudinal plane in a 29-year - old man with dsrct . They demonstrate a heterogeneously echogenic soft tissue mass within the left lower quadrant that is macroscopically inseparable from the adjacent peritoneum and bowel . There is associated ascites coronal f - fdg pet / ct imaging in a 21-year - old male patient with dsrct . This image demonstrates the extent of disease with multiple areas of fdg uptake within the abdomen, which correspond to peritoneal deposits and retroperitoneal lymph node disease on the ct component . Imaging also confirms the presence of hepatic metastases which were covert on a previous contrast enhanced ct scan therapeutic options in the treatment of dsrcts are limited . A retrospective series from memorial sloane kettering cancer centre reviewed 66 patients treated with debulking surgery, multi - agent chemotherapy and abdominopelvic radiotherapy . A survival benefit was demonstrated when compared to patients who did not undergo debulking surgery (58% 3 year survival compared to 0%, p <0.00001). Local treatment to liver metastases following surgery has also been reported with radiofrequency ablation, cryotherapy and more recently yttrium microsphere radioembolotherapy . Chemotherapy alone is associated with high toxicity and poor overall survival benefit with evidence to suggest chemotherapy is efficacious when used as part of multimodality therapy . One such regimen, the p6 protocol comprises cyclophosphamide, doxorubicin, vincristine, ifosfamide and etoposide . The role of platinums, topoisomerase inhibitors and temozolomide has also evaluated but responses are rarely durable . High - dose chemotherapy with autologous stem cell rescue has been explored but no overall survival benefit has been demonstrated . Hyperthermic intra - peritoneal chemotherapy (hipec), developed in the therapy of metastatic ovarian carcinoma, has been investigated . A retrospective review compared patients receiving chemotherapy alone, debulking surgery alone and debulking surgery followed by hipec . There was no statistical difference between the two surgical groups, reporting 62% and 71% 3-year survival respectively . The cohort receiving surgery did significantly better than those in the chemotherapy alone group (26% 3-year survival). The role of novel molecularly targeted agents has provoked interest as the translocation associated with dscrt could potentially give rise to therapeutic targets such as insulin - like growth factor 1 and platelet - derived growth factor . Case reports show benefit with novel agents such as imatinib, sunitinib, sorafenib and temsirolimus . Whole abdominal radiotherapy (wap) has been used as part of multimodality treatment in addition to surgery and chemotherapy . Wap is a toxic treatment in both the long and short term, and note is made that in one series the majority of patients relapsed in field . Intensity modulated radiation therapy (imrt) has been shown to be feasible and associated with less bowel toxicity . Dscrt remains a challenging disease to treat and evidence supports the use of maximum debulking therapy, where possible in combination with multiagent chemotherapy . There remains a need for prospective clinical trials, although this is challenge in such a rare tumour type . Our case series of 20 patients, support smaller cohort studies in the characteristic imaging features and the diagnosis should be suspected in adolescent / young males in whom imaging studies demonstrate: diffuse peritoneal involvement with multiple soft tissue lesionsdominant soft tissue lesion measuring at least 5 cm without a visceral organ of origin diffuse peritoneal involvement with multiple soft tissue lesions dominant soft tissue lesion measuring at least 5 cm without a visceral organ of origin supporting ancillary findings include: heterogeneous tumoral enhancementcystic change and calcificationmetastatic spread to retroperitoneal lymph nodes, liver and spine these imaging features were not found frequently enough to be characteristic of dsrct, and although their incidence varies throughout the literature, they are in line with smaller cohort groups . Several studies found a strong propensity towards pleural disease, but despite our common findings of a pleural effusion, our data did not support macroscopic pleural involvement . Heterogeneous tumoral enhancement cystic change and calcification metastatic spread to retroperitoneal lymph nodes, liver and spine these imaging features were not found frequently enough to be characteristic of dsrct, and although their incidence varies throughout the literature, they are in line with smaller cohort groups . Several studies found a strong propensity towards pleural disease, but despite our common findings of a pleural effusion, our data did not support macroscopic pleural involvement . There is unanimous support for ct as the primary imaging modality of choice in dsrct, with ultrasound and mri offering additional information in individual cases . Fdg - pet / ct can infer a response to treatment and may prove useful in tumour relapse.
Recent progress in high - throughput sequencing has opened new avenues in studying genome structure and its implications on gene regulation . Lieberman - aiden et al (2009) recently presented the first contact map of the human genome . They obtained this map using hi - c, a method enabling the examination of the spatial proximity of dna fragments in the nucleus . These results confirmed the existence of chromosome territories and showed that open and closed chromatin compartments are spatially segregated . They determined the distribution of the genomic distances between interacting dna fragments within chromosomes and proposed that this distribution is compatible with a fractal globular organization of the chromosomal fiber . Another interesting outcome of hi - c experiments is that the interactions are highly nonrandom; the same dna fragments are often found to interact with each other . In this study, we address this question in detail and question whether these specific interactions can be explained by the action of the ccctc - binding factor (ctcf). Ctcf is a highly conserved protein from fly to human and was recently presented as the master weaver' of the genome (phillips and corces, 2009). Chromosome conformation capture (3c) techniques have highlighted its role in organizing long dna loops within chromosomes at specific loci (phillips and corces, 2009; zlatanova and caiafa, 2009; ohlsson et al, 2010). Evidence of ctcf - mediated intra- and inter - chromosomal interactions has also been obtained using 4c (an advanced 3c technique) on the mouse igf2/h19 locus (kurukuti et al, 2006; ling et al, 2006; zhao et al, 2006). In addition to this architectural role, this versatile protein is found to be involved in gene regulation (phillips and corces, 2009; zlatanova and caiafa, 2009; ohlsson et al, 2010). Over 13 000 ctcf - binding sites (ctcf sites) on the human genome have been identified using chromatin immunoprecipitation (chip) on chip, enabling the characterization of the specific binding sequence (kim et al, 2007). This library of binding sites has been enriched using chip followed by deep sequencing (chip - seq; barski et al, 2007) and computational predictions (xie et al, 2007), yielding an extensive inventory of over 40 000 locations (bao et al, 2008). We set out to determine whether fragments found to interact in the hi - c experiments are associated with a ctcf site . We show that the presence of ctcf sites is highly correlated with the ability of fragments to make strong interactions, both within the same chromosome and between different chromosomes . We based our analysis on a hi - c experiment (lieberman - aiden et al, 2009) conducted using human lymphoblastoid cell line (gm06990). The restriction enzyme used (hindiii) cuts the human genome in 800 000 fragments; 37 000 of which bear at least one ctcf site . Almost all the fragments in the genome are found in at least one of these reads and some fragments are found in many interaction reads . The first question we have addressed is whether observing the same interaction many times in the experiment confers nonrandomness . To answer this question, we first noticed that the results from the experiment can be represented by a network in which each node is a dna fragment, and each link represents an interaction between two fragments (figure 1a). Taking any two random nodes from this network, they can be either unlinked, or linked by one link, or even linked by many links . Nodes with a high degree correspond to fragments, which are found to interact a lot in the experiment, and we can expect that such high - degree nodes will have many links in common . To statistically quantify the significance of the number of interactions between two fragments (i.e. The number of links between two nodes), we created samples of randomized networks (n=100), which preserve the linkage characteristics of the original network, that is, the number of nodes, links, and node degrees . We subsequently inspected the number of interactions between any two nodes arisen due to pure chance and contrast that to the actual observed value . We observe significantly higher numbers of interactions between nodes in the observed data than those in the randomized networks . Figure 1b shows the distributions of the number of links between each nodes pairs for both the actual network and the randomized networks . The two distributions are found to be significantly different (kolmogorov smirnov test, p<2.2 10). The same difference is found when considering only interchromosomal interactions (supplementary figure 1). This means that the nonrandomness of an interaction between two fragments is not only due to the genomic proximity between those two fragments . At this point, we decided to test the hypothesis that these nonrandom interactions are due to specific factors, the most widely known being ctcf . We therefore set out to determine whether the fragments that are found in many interaction reads are more likely to have a ctcf - binding site . We took the following approach: first, we removed all binary interactions from the data that were present only once as some of these may well be attributed to noise in the experiment.second, we set a threshold n and considered only the fragments that are present in at least n interaction reads.lastly, for each value of n ranging from 1 to 100, we computed the corresponding number of fragments (figure 2a, black line) and the percentage of those fragments that contain at least one ctcf site (figure 2b, black line). First, we removed all binary interactions from the data that were present only once as some of these may well be attributed to noise in the experiment . Second, we set a threshold n and considered only the fragments that are present in at least n interaction reads . Lastly, for each value of n ranging from 1 to 100, we computed the corresponding number of fragments (figure 2a, black line) and the percentage of those fragments that contain at least one ctcf site (figure 2b, black line). From figure 2a, we estimate that about 200 000 fragments are found in at least two interaction reads; however, only 100 are found in at least 100 reads . Interestingly, the decline in the number of fragments for increasing n is not monotonic but clearly has two different components: a fast one for n<10 and a slow one for n>10 . In other words, two different kinds of fragments can be distinguished: strongly interacting fragments that correspond to the slow component and weakly interacting fragments that correspond to the fast component . Strong interactions can either result from a stable interaction in a subpopulation of cells or a weaker, but more frequent interaction in a majority of cells . We then computed the proportion of fragments containing ctcf - binding sites for increasing n and found that strongly interacting fragments are enriched in ctcf sites with respect to weakly interacting fragments (figure 2b, black line). As n becomes higher than 20, the percentage of fragments containing ctcf reaches 40% . These results strongly support the proposed role of ctcf as a major factor in mediating long - range interactions among distant dna elements (phillips and corces, 2009; zlatanova and caiafa, 2009; ohlsson et al, 2010) and show that hundreds of such interactions are formed within the nucleus of human lymphoblastoid cells . The results are presented in figure 2a and b with green lines . Out of the 200 000 fragments found to interact with another fragment, the same high proportion of interchromosomal interactions holds for the strong interactions found in the hi - c experiment . To verify whether these strong interchromosomal interactions are mediated through ctcf, we computed the percentage of fragments containing ctcf sites involved in these interactions (figure 2b, green line). We observed that as n increases, the percentage of fragments containing ctcf sites continues to increase eventually reaching 60% . These results suggest that strong interchromosomal interactions found in the human genome can be mediated by ctcf . These results point toward ctcf being a key interactor in mediating chromosome chromosome interactions and in organizing chromosome territories in the cell nucleus . The genomic coordinates of ctcf - binding sites that we used to compute these correlations come from three different human data sets (supplementary table i). These data sets were obtained from different cell types and using different modus operandi . As shown in figure 3a, the two experimental data sets (barski et al, 2007; kim et al, 2007) have an overlap of about 50%, whereas the computationally predicted positions (xie et al, 2007) for ctcf sites have weaker correlation with experimentally determined positions . To check whether these three data sets contribute differently to the correlation we observed (figure 2b), we computed the proportion of fragments containing ctcf - binding sites for increasing n for each data set separately (figure 3b). To our surprise, only one (barski et al, 2007) of these three data sets account for all the observed correlation . This difference might be explained either by the technique used (chip - seq versus chip - on - chip or computational predictions) or by the difference in cell type used in different experiments (supplementary table i). First, differences in ctcf sites have been reported between fibroblast and erythroid cell lines by using the exact same protocol (hou et al, 2010). Lymphoblastoid cells on which interactions were determined (lieberman - aiden et al, 2009) are more closely related to the cd4 t lymphocytes used in the chip - seq analysis (barski et al, 2007) than to the fibroblast cells used in the chiip - on - chip experiment (kim et al, 2007). Second, deep sequencing that allows probing of the entire genome is used both in hi - c and chip - seq, whereas chip - on - chip is only suitable to probe positions predetermined by the oligomers that are found on the microarray . We noticed that many interacting fragments were found on regions that were not covered by the microarray used in the experiment by kim et al (2007). To contextualize the correlation we found between strongly interacting fragments and the presence of ctcf, we repeated the same analysis with other dna - binding factors . First, we used six chip - seq data sets from two factors known to activate transcription (srf and gabp) in three different cell lines: hela cells, lymphoblastoid cells and liver carcinoma cell (valouev et al, 2008). The results presented in figure 4a do not show similar correlation compared with the one seen with ctcf . This suggests that the correlation we found with ctcf is not simply due to the matching of experimental conditions between chip - seq and hi - c protocols . Second, we mapped on the genome all 132 known dna - binding factors that have a specific consensus binding sequence longer than 15 bp (see materials and methods section) and used the top 50 000 genomic coordinates to repeat the same analysis for each factor . Three conclusions can be drawn from the results (figure 4b): none of these factors' presence on a fragment correlates with the ability of this fragment to interact strongly as much as ctcf presence, as determined in the experiment of zhao et al (2006), does.for most of the factors, this correlation is comparable to the same correlation computed for a random 20 bp sequence (figure 4b, in black). This is also the case for the correlation computed with the consensus sequence for ctcf determined from the experiment by kim et al (2007). This is consistent with the fact that the experimentally determined positions for ctcf from kim et al (2007) data didn't correlate with strong interactions.for some of the factors, this correlation is greater than the same correlation computed for a random sequence . The three factors for which the correlation is the highest are: hnf4, ppar and freac4 . Interestingly, these three transcription factors are all known to be expressed in lymphocytes (su et al, 2004; jo et al, 2006; humphreys et al, 2009) and to activate gene transcription . This agrees with the concept that these transcription factors would trigger the formation of transcription factories that recruit active genes, thus mediating strong interactions between the different genes expressed in lymphocytes . None of these factors' presence on a fragment correlates with the ability of this fragment to interact strongly as much as ctcf presence, as determined in the experiment of zhao et al (2006), does . For most of the factors, this correlation is comparable to the same correlation computed for a random 20 bp sequence (figure 4b, in black). This is also the case for the correlation computed with the consensus sequence for ctcf determined from the experiment by kim et al (2007). This is consistent with the fact that the experimentally determined positions for ctcf from kim et al (2007) data didn't correlate with strong interactions . For some of the factors, the three factors for which the correlation is the highest are: hnf4, ppar and freac4 . Interestingly, these three transcription factors are all known to be expressed in lymphocytes (su et al, 2004; jo et al, 2006; humphreys et al, 2009) and to activate gene transcription . This agrees with the concept that these transcription factors would trigger the formation of transcription factories that recruit active genes, thus mediating strong interactions between the different genes expressed in lymphocytes . Lastly, we looked in more detail at the eight strongest interactions detected in lymphoblastoid cells (table i). Seven of these interactions are found between fragments that both contain ctcf sites (for more details on the number of pairs of interacting fragments having both ctcf sites see supplementary figure 2). We observed that some fragments (such as chr10:11 184, chr4:14 220) are found to interact with multiple fragments on different chromosomes . These fragments contain several ctcf sites (nine for chr10:11 184 and four for chr4:14 220), suggesting that ctcf can mediate the formation of chromosomal hubs of interactions across chromosomes . Analyzing the 8 interactions listed in table i, we identified one hub gathering fragments from chromosomes 1, 3, 4, 10, and 19 . This hub involves centromeres and telomeres, suggesting that repeat sequences have a central function in genome folding and ordering as proposed by kumar et al (2010). Many examples of repetitive dna sequence clustering have indeed been reported (de laat and grosveld, 2007). In conclusion, our results show that the hi - c data can be used together with chip data to characterize the role of ctcf as the master weaver of the human genome and to identify chromosomal hubs of interactions and factors participating in the formation of those hubs . To create a randomized network, we used a random rewiring procedure on the original network described as follows: for each node a, we rewired each emanating edge.for each of these edges (a, b), we picked a random node b (a b) in the network and rewired the edge to connect a to b.if b was different from b, b had one extra edge and b had one less edge . We then randomly removed an edge connecting b to a (a b) and created a new edge connecting a to b.repeat steps 13 until all edges have been rewired . For each node a, we rewired each emanating edge . For each of these edges (a, b), we picked a random node b (a b) in the network and rewired the edge to connect a to b. if b was different from b, b had one extra edge and b had one less edge . We then randomly removed an edge connecting b to a (a b) and created a new edge connecting a to b. repeat steps 13 until all edges have been rewired . After each rewiring run, we inspected the pairs of nodes that were connected in the original network and gathered the number of interactions found between them in each randomized instance of the network . We can then compare the number found in the original network to the average of the randomized networks (see supplementary figure 3 for a schematic of the procedure). Hi - c data sets were downloaded from gene expression omnibus; geo accession: gse18199 . Fragments obtained from hi - c were labeled according to the presence of ctcf - binding sites . The ctcf - binding sites that span multiple contiguous fragments were assigned to each of those fragments . The percentage of fragments involved in at least n interaction reads was then computed for each n. we tested for two possible biases in our analysis: the fragments lengths and the repetitive sequences (see supplementary figures 4 and 5). The gabp and srf data sets were downloaded from gene expression omnibus, geo accession: gse8489 . Position - specific scoring matrices (pssm) were downloaded from transfac release 10.2 (wingender et al, 1996). We selected all human transcription factors which have a consensus sequence longer than 15 bp . Each tf matrix was used to find binding sites on the human genome (assembly hg18) using patser (hertz and stormo, 1999), and the top scored 50 000 matches were retained and mapped on the fragments . This resulted in 29 634 to 46 778 fragments containing at least one tf - binding site . The random hypothesis was assessed using 10 random sequences (with the same gc content as the human genome). To create a randomized network, we used a random rewiring procedure on the original network described as follows: for each node a, we rewired each emanating edge.for each of these edges (a, b), we picked a random node b (a b) in the network and rewired the edge to connect a to b.if b was different from b, b had one extra edge and b had one less edge . We then randomly removed an edge connecting b to a (a b) and created a new edge connecting a to b.repeat steps 13 until all edges have been rewired . For each node a, we rewired each emanating edge . For each of these edges (a, b), we picked a random node b (a b) in the network and rewired the edge to connect a to b. if b was different from b, b had one extra edge and b had one less edge . We then randomly removed an edge connecting b to a (a b) and created a new edge connecting a to b. repeat steps 13 until all edges have been rewired . After each rewiring run, we inspected the pairs of nodes that were connected in the original network and gathered the number of interactions found between them in each randomized instance of the network . We can then compare the number found in the original network to the average of the randomized networks (see supplementary figure 3 for a schematic of the procedure). Hi - c data sets were downloaded from gene expression omnibus; geo accession: gse18199 . Fragments obtained from hi - c were labeled according to the presence of ctcf - binding sites . The ctcf - binding sites that span multiple contiguous fragments were assigned to each of those fragments . The percentage of fragments involved in at least n interaction reads was then computed for each n. we tested for two possible biases in our analysis: the fragments lengths and the repetitive sequences (see supplementary figures 4 and 5). The gabp and srf data sets were downloaded from gene expression omnibus, geo accession: gse8489 . Position - specific scoring matrices (pssm) were downloaded from transfac release 10.2 (wingender et al, 1996). We selected all human transcription factors which have a consensus sequence longer than 15 bp . Each tf matrix was used to find binding sites on the human genome (assembly hg18) using patser (hertz and stormo, 1999), and the top scored 50 000 matches were retained and mapped on the fragments . This resulted in 29 634 to 46 778 fragments containing at least one tf - binding site . The random hypothesis was assessed using 10 random sequences (with the same gc content as the human genome).
The use of laparoscopy as an alternative to laparotomy in gynecologic procedures has increased in recent years, especially since the advent of laparoscopic cholecystectomy . Local general hospitals in taiwan have been slow to follow this trend because of the large initial investment required for state - of - the - art equipment, patient education issues, and difficulties obtaining reimbursement . Only recently has the government approved reimbursement for the following laparoscopic procedures: hysterectomy, myomectomy, ovarian cystectomy, and treatment of ectopic pregnancy . However, reimbursement levels have not been sufficient to cover basic procedural costs . In addition, costs for initial equipment setup and disposable surgical items have proven to be considerably more prohibitive in local privately owned general hospitals than in government owned hospitals . The advantages of the laparoscopic approach in these procedures have been well documented and include less patient discomfort, shortened hospital stay, and quicker recovery . Specifically, laparoscopic appendectomy results in lower morbidity and shorter hospital stay than does laparotomy . Similar advantages have also been shown for laparoscopically treated adnexal masses . In addition, minimizing adhesions improves the patient's chances of remaining fertile following surgery . Although the taiwanese government has approved reimbursement for a number of these procedures, concern remains regarding the potential for inexperienced surgeons performing these operations and creating iatrogenic injuries . We present a summary of 571 gynecologic laparoscopies performed at yuan's general hospital, taiwan, in 1998 and 1999 and include a discussion of advancements in the use of these procedures at this institution . We performed a comprehensive review of all laparoscopic gynecology procedures performed at yuan's general hospital in kaohsiung, taiwan, r.o.c . In 1998 and 1999 . All procedures were performed by 1 of 6 board - certified gynecologic surgeons or by 1 of 4 residents under the direct supervision of a board - certified surgeon . Data include indications for surgery, complications, rate of conversion to laparotomy, need for transfusion, and length of hospital stay . From 1998 through 1999, 571 gynecologic laparoscopies were performed at yuan's general hospital, 293 in 1998 and 278 in 1999 . Secondary procedures performed in combination with the hysterectomy or adnexal procedures are shown in table 3 . The most common indications for hysterectomy were fibroids, menometrorrhagia / dysmenorrhea, and pelvic mass (table 4). Twelve of 280 laparoscopic hysterectomies performed during this period (4.3%) required conversion to laparotomy (5 of 149 in 1998, 7 of 131 in 1999). Reasons for conversion to laparotomy included bleeding (8 cases), adhesions (3 cases), and bladder injury (1 case). A j - p drain was inserted postoperatively in 154 of the laparoscopic hysterectomy cases (91 in 1998 and 63 in 1999). Serous adenomas and endometriomas were the most common types of adnexal masses diagnosed in this series (table 5). Only 2 of the 291 adnexal procedures (0.7%) required conversion to laparotomy (1 of 144 in 1998 due to adhesions, 1 of 147 in 1999 due to endometriosis). We used j - p drains in 39 adnexal cases in 1999 but in no adnexal surgeries the previous year . The mortality rate in this series was 0%, and the morbidity rate was 7.2% (41 of 571). Bleeding was the most common complication, occurring in 38 of the hysterectomy cases (21 in 1998 and 17 in 1999, 13.6% of the total), and 1 of the adnexal laparoscopies (<1%). Two patients incurred bladder injury during hysterectomy . From 1998 to 1999, we observed a reduction in both mean surgery time (135.4 to 123.0, p=0.032) and mean length of hospital stay (5.52 to 4.62, p=0.046) for hysterectomies and adnexal procedures combined . Patient demographics in 571 gynecologic laparoscopies performed at yuan's general hospital, taiwan, r.o.c ., in 1998 and 1999 571 gynecologic laparoscopies performed at yuan's general hospital, taiwan, r.o.c ., in 1998 and 1999 secondary laparoscopic procedures performed in combination with the hysterectomy or adnexal procedures performed at yuan's general hospital, taiwan, r.o.c ., in 1998 and 1999 . Indications for laparoscopic hysterectomy in 280 cases at yuan's general hospital, taiwan, r.o.c ., in 1998 and 1999 . Pathology of adnexal masses in 291 cases managed at yuan's general hospital, taiwan, r.o.c . The use of laparoscopy in gynecologic surgical procedures has increased in recent years as more studies have been presented that support the safety and efficacy of this approach . In particular, the advantages of laparoscopically assisted vaginal hysterectomy (lavh) over laparotomy have been well documented . These advantages include shorter hospital stay, shorter recovery time, reduced hospital charges, and comparable if not fewer complications while avoiding a large laparotomy wound . Similar advantages have occurred with laparoscopic management of adnexal masses that appear benign on ultrasound . Several authors have suggested that with appropriate preoperative evaluation, laparoscopy should replace laparotomy in the management of most adnexal masses . Despite this information, although some institutions have reported reductions in the laparotomy rate for hysterectomy to around 10%, evidence exists from the united kingdom and the united states that more than 70% of all hysterectomies are still being performed via laparotomy . The primary obstacles cited include the large initial capital investment for equipment, the significant training necessary, and reluctance on the part of payers to reimburse for these procedures . The taiwanese surgical community has also been slow to adopt laparoscopic techniques for many of these same reasons . For example, at our institution, disposable surgical tools are often sterilized and reused to save on expenses . For those procedures approved for reimbursement, the reimbursement levels are so low they rarely cover the basic costs of the procedure . In addition, a limited number of hospitals are set up to perform training, and few qualified surgeons are available to conduct the training . No reimbursement is available for procedures performed during training prior to certification . Even at our hospital, where we are making substantial progress with our laparoscopy program, patients are reluctant to consent to laparoscopic surgery not only because it is new to them, but also because they often do not understand the benefits . For example, the average length of hospital stay for our series of patients does not differ significantly from that for patients undergoing laparotomy . The majority of our laparoscopy patients could safely be discharged on the second or third day postoperatively; however, our system allows patients to stay 4 or 5 days following gynecologic surgery . Patients expect to stay in the hospital for that period of time and often choose to do so even when unnecessary . Despite these obstacles, we successfully train 4 or 5 new residents each year in laparoscopic gynecology techniques and have shown improvement in our surgeons' technique through lower complication rates, shorter procedure times, and shorter hospital stays . We believe these data support ongoing efforts to incorporate gynecologic laparoscopy as an alternative to open surgeries for treatment of appendectomy, hysterectomy, and adnexal masses at our institution . We feel these data support ongoing efforts to incorporate gynecologic laparoscopy as an alternative to open procedures at our institution . Introduction of these procedures in privately owned hospitals in taiwan has been limited because of the large initial investment required for state - of - the - art equipment, patient education issues, and difficulty in obtaining reimbursement.
Streptococcus agalactiae, also known as group b streptococcus (gbs), is a bacterium often isolated from vaginal or rectal swab of pregnant women and long recognized as the major cause of neonatal sepsis, meningitis, and infection in pregnant women . Gbs is a minor pathogen of necrotizing fasciitis (nf); however, the incidence of gbs nf in nonpregnant adults with underlying disease has increased in recent years . Here, we report a case of bilateral gbs nf of the foot with a unique clinical presentation and describe the clinical characteristics of gbs nf based on a review of published cases . A 43-year - old male with a history of type 1 diabetes presented with severe pain in both feet . Two weeks before our examination, he began to notice swelling and pain in the left sole, which gradually spread to his left lower leg . One week prior to presentation, the same symptoms began to emerge on his right sole and the dorsum of his right foot . The symptoms worsened, and he was admitted to our clinic because he had developed a fever of 39.2c and was unable to walk unassisted at the time of his first visit . On initial examination, he exhibited a reddish fluctuant cystic nodule on the dorsum of the right foot (fig 1a), an ulcer covered with necrotic tissue on the lateral side of the right foot (fig 1b), and swelling with redness on the dorsum of the left foot (fig 1c). Moreover, a large callus and ulcer due to diabetic peripheral neuropathy on the right sole (fig 1d) and streaks of necrotic skin on the left sole (fig 1e) were observed . Laboratory analysis revealed elevated wbc (15,100 cells/l), c - reactive protein (22.8 mg / dl), blood glucose (434 mg / dl), hemoglobin a1c (12.2%) and anti - gad - antibody (350 u / ml) levels . Computed tomography showed fluid collection, suggesting a subcutaneous abscess in the dorsum of the right foot (fig 2a), and fascial thickening associated with fat stranding in both soles (fig 2a, b). In addition, gas shadows were detected within the deep fascia of the right sole and left sole up to the lower leg (fig 2a, b). As the gram stain of the exudate obtained from the necrotic skin of the left sole demonstrated the presence of gram - positive cocci and gram - negative rods, we suspected nf of polymicrobial origin, and the patient was empirically treated with meropenem . On the day following admission, debridement of necrotic tissues and amputation of the left fifth metatarsal bone were performed . A large amount of brownish pus was discharged from the dorsum of the right foot . Necrosis of subcutaneous tissue, fascia and muscle were observed in both feet and the lower half of the left lower leg . Culture of excised tissue of the left foot yielded gbs, group g streptococcus, and morganella morganii . In addition, culture of excised tissue of the right foot yielded gbs, staphylococcus aureus and pseudomonas species . Furthermore, blood culture prior to administration of antibiotics yielded solely gbs . Based on these findings, although debridement was repeated several times, necrosis of the fascia, muscles and bone developed in the tissues surrounding the excised parts of both feet and we were not able to control the infection . Including our case, 22 cases of gbs nf in nonpregnant adults have been reported in english to date (table 1) [3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16]. The mean age of patients was 54 years with a male: female ratio of 7: 15 . Nf can be classified as type i nf due to a polymicrobial infection or type ii nf due to a monomicrobial infection, and the majority of gbs nf cases were type ii nf . In the 22 patients, the lower extremity was the most common site of nf, accounting for approximately 70% of cases . Notably, 16 patients (73%) had diabetes and 3 had cancer (14%), suggesting that an immunocompromised host is a risk factor . Our case was particularly rare in that nf occurred bilaterally and there was a time lag of 1 week between the development of primary and secondary nf . Bilateral nf is rare, and approximately 15 cases have been reported in english to date [4, 16, 17, 18, 19]. It can be caused by (i) procedures of multiple puncture, cannulation or surgery; (ii) direct spreading of nf to the opposite site, and (iii) metastatic seeding of bacterium during the bacteremia . Almost all of the reported cases, except gbs nf cases, developed bilateral nf simultaneously . Regarding bilateral gbs nf, two cases of bilateral gbs nf of an extremity have been previously reported and both cases developed secondary nf after a 1-week time lag [4, 16]. One case developed nf on the right lower leg secondary to nf of the left lower leg, and the other developed nf bilaterally on upper and lower extremities secondary to septic arthritis of the left knee . Of note in both cases, secondary nf appeared at remote sites several days after debridement or amputation of the primary infected lesion, and gbs was detected in blood culture even at the start of treatment for the primary infection . Thus, hematologic dissemination of gbs is an early event in the development of secondary gbs nf, and it appears that the occurrence of secondary nf with a 1-week delay is due to the slow evolution of inflammation in remote fascia and subcutaneous tissue . Including cases of bilateral gbs nf of an extremity, gbs was detected in blood culture in 50% (11 of 22) of gbs nf cases . Importantly, patients with positive blood culture had a high mortality rate of approximately 30%, whereas none of the patients with negative blood culture died (table 1). Although it is difficult to differentiate gbs nf and gbs cellulitis because the speed of evolution of gbs nf is slow, dermatologists must be aware of the characteristics of gbs nf and the possibility of appearance of secondary nf at remote sites with an approximate 1-week delay.
. Chronic lower respiratory tract disease, defined as asthma, emphysema, chronic bronchitis, bronchiectasis, and chronic obstructive pulmonary disease (copd), is the third leading cause of death in people aged 65 years and older.1 according to 2010 census data, 13% of the us population, or 40.3 million people, are older than age 65, which is higher than any previous census . Additionally, the population is aging at an increasingly faster rate each year . Between 2000 and 2010, the population age 65 years and over increased by 15.1% compared to the total us population which only increased by 9.7%.2 with such a large and rapidly growing aging population it is critical to understand how the body changes with age and how this impacts the entire respiratory system . Understanding the aging process in the lungs is necessary in order to provide optimal care to our aging population . The structure of the thoracic cavity, which houses and protects the lungs, is vital for optimal lung function . Changes to the spine, muscles, and ribs over time with aging impact normal lung function . As people normally age, narrowing of the intervertebral disk spaces causes kyphosis or curvature of the spine.3 this curvature decreases the space between the ribs and creates a smaller chest cavity.4 while a small amount of anterior curvature or kyphosis of the thoracic spine is normal, an angle greater than 40, which is the 95th percentile of normal, is defined as hyperkyphosis.5,6 after age 40, the kyphosis angle begins to increase more rapidly in women than men, from a mean of 43 in women aged 5560 years, to a mean of 52 in women 7680 years of age.5 the prevalence and incidence of hyperkyphosis is reported in older adults varying from approximately 20%40% among both men and women.5,6 in a study of 55 nonsmoking women with variable degrees of thoracic kyphosis lombardi et al7 found that with increasing vertebral angle there was a significant decline in the fraction of exhaled volume in 1 second (fev1) and vital capacity (vc) during spirometry testing.7 this effect was most significant once the kyphotic angle was over 55. culham et al hypothesized that this effect is not from a decrease in thoracic cavity size alone, but due to the rib space narrowing, which decreases the length of the intercostal muscles.8 the angle of the muscle fibers in relation to the ribs may also affect the efficiency and decrease the movement of the lower ribs during inspiration.8 these changes are structural and based on the origin and insertion of the muscles . In addition to structural changes, there are changes in intrinsic function of the muscles with age . Overall muscle function in the body decreases by 2% annually as we age.9,10 aging is associated with reduced inspiratory and expiratory respiratory muscle strength.11 respiratory muscle decline can lead to an inability to ventilate in the face of increasing demands, such as that seen in respiratory disease . There is also evidence that at the cellular level, the muscles of elderly individuals have less mitochondrial adenosine triphosphate reserves to sustain a sudden increase in metabolic demand.12 if an elderly person becomes ill with pneumonia, and therefore has increased metabolic demands for oxygen in the setting of decreased respiratory muscle strength, decreased cellular energy reserve, and decreased overall muscle function, he or she may not be able to meet those demands . This leads to an increased risk of respiratory failure in older individuals.13 with aging there is a decreased ability to clear mucus from the lungs . Two mechanisms primarily contribute to this decline: 1) reduced cough strength and 2) alterations in the body s ability to clear particles in the airways . Coughing is a maneuver that requires generation of a high forced expiratory flow . During a cough maneuver, inspiratory muscles contract to allow the lungs to take in a large tidal volume necessary to augment a sustained high expiratory flow.14 next, the expiratory muscles contract to build high positive intrapleural and intraairway pressures for the development of peak expiratory flow rates.15 finally, when the glottis is opened, the cough occurs, and the mucus is expelled from the airway into the mouth . Any decrease in the strength of the respiratory muscles will greatly impact an individual s ability to generate the force required for an effective cough.16 aging is associated with both inspiratory and expiratory respiratory muscle strength reduction.11 polkey et al showed a 13% decrease in transdiaphragmatic pressure gradients, a surrogate for diaphragm strength, in older subjects (ages 6781) as compared to younger subjects (ages 2140).17 tolep et al compared the maximum transdiaphragmatic pressure (pdimax) obtained during voluntary maximal inspiratory efforts in nine young (1928 years) and ten elderly (6575 years) subjects and found that the average pdimax of the elderly subjects (128 9 cm h2o) was significantly lower than the average pdimax of the younger subjects (171 8 cm h2o).18 more specifically, there is age - related atrophy of muscle fibers, termed sarcopenia, which may also explain the reduced respiratory strength in the elderly . The decrease in muscle fiber strength can be as high as 20% by age 70.1821 there are complex changes involving the mitochondria, muscle fiber disorganization, age - related muscle fiber transitions, and metabolic shifts in the aging muscle that can also explain the reduction in muscle strength.22 the mucociliary elevator refers to the action of ciliated cells along the upper and lower airway to beat in synchrony, trapping and clearing mucus and foreign particles out of the lungs.23 the upper airway nasal mucociliary cells work to remove large particles before they enter the smaller airways, and the lower airway mucociliary cells remove fine particles from the airway over a longer period of time.24 there are alterations in both the clearance of large and small particles with aging . De oliveira - maul et al used the clearance of saccharin that was inhaled through the nares of healthy subjects to measure large airway nasal mucociliary function . They demonstrated that in people over age 40, there was a delayed nasal mucociliary clearance time of saccharin compared to subjects under 40 years of age.25 using radiolabeled particles that can travel past the upper airway and enter into the smaller airways in healthy nonsmoking subjects, svartengren et al evaluated clearance of the labeled particles in different age groups ranging from age 1981 years . They found that age alone was negatively associated with airway clearance of radiolabeled particles at 1, 2, 7, 14, and 21 days.26 the association between age and decreased clearance by the mucociliary elevator may be due to beat frequency of the cilia . The studies of beat frequency in cilia are confounded by the presence of cigarette smoking, which has a large impact on beat frequency . Age has not been a statistically significant predictor of decreased beat frequency.27 the impact of structure and functional changes created by the aging process is summed up in figure 1 . In addition to these age - related structural changes in the lung, advanced age contributes to systemic immune dysfunction . Of particular interest is the basal activation of the innate immune system in aged individuals in the absence of an immunologic threat.28 this phenomenon, referred to as inflamm - aging, is marked by elevated levels of tissue and circulating proinflammatory cytokines in aged subjects.28 specifically, increased levels of interleukin (il)-1, il-6, and tumor necrosis factor- (tnf-) have been observed in aging rodent and human studies.2932 theoretically, heightened levels of these cytokines in the absence of an immunologic threat or infectious target may be a contributory factor to reduced elasticity and destruction of the delicate lung parenchyma with advanced age . Related to inflamm - aging is the blunted immune response, known as immunosenescence, following a pathogenic threat or tissue injury.28 multiple studies have established reduced levels of mediators such as tnf-, il-6, interferon-, nitric oxide, monocyte chemoattractant protein-1, and macrophage inflammatory protein-1 after different types of antigenic stimulation in aged animals.3338 this basal level of inflammation, for example, elevated levels of il-6, has been suggested to contribute to this subsequent immunosenescence following an immune challenge.28,39 using a model of il-6 knockout mice, gomez et al demonstrated restoration of cytokine production of il-1, il-12, and tnf- following lipopolysaccharide (lps) challenge in aged il-6 knockout animals to levels comparable to young wild - type.40 these data suggest that the basal elevation of circulating il-6 observed in aged wild - type animals prior to stimulation may contribute to the inability to upregulate cytokine production in the presence of an infectious threat as represented by lps.40 in addition to these cytokine alterations with aging, more recent data demonstrate a role for micrornas in inflamm - aging and cellular senescence.41 specifically, microrna 146a has been associated with a senescent associated proinflammatory status in the setting of vascular remodeling.42 together, these data support the relationship between inflamm - aging and immunosenescence, suggesting that a disruption in the balance of pro- and anti - inflammatory mediators results in a baseline proinflammatory environment with advanced age that subsequently dampens an appropriate innate and adaptive immune response (figure 2). In addition to this reduced activation, there are data that support a shift in the temporal response to injury with aging, such that this initial immunosenescence over time results in a protracted immune response and chronic inflammation.43,44 these studies will be discussed in depth later in the context of pulmonary inflammation with aging; however, it is important to consider that this imbalance of immune mediators, delayed immune activation, and protracted course of inflammation may result in increased morbidity and mortality in aging individuals following infection, environmental exposures, or systemic injury4548 the lung has immunologic defenses that are both complex and resourceful, utilizing both an innate and adaptive immune response to inhaled antigens . Adaptive immunity (acquired immunity) is antigen - specific and is required to ward off encapsulated bacteria, viruses, and intracellular pathogens . This form of immunity relies on immunologic memory and lymphocyte production of antibodies to nonself threats . Toll like receptors (tlrs) are key molecules in recognition and initiation of the innate immune response . In the context of aging, there are conflicting data regarding the impact of age on murine and human expression of tlrs or downstream signaling mediators.38,4951 while some of these murine studies on monocytes and macrophages report reduced expression of one or several tlrs,34,49 another report demonstrates alterations in downstream tlr signaling involving p36.51 reduction in p38 signaling is supported by studies in human monocytes from aged subjects, where dampened p38 signaling was associated with diminished phosphorylation of p38.37 additionally, these authors observed a reduction in tlr1 but no changes in tlr2 expression . While the data are divergent on how aging impacts tlr expression, the data do suggest that alteration in the tlr pathways plays a role in an age - related aberrant initiation of the innate immune response and may contribute to an inability in rapidly recognizing and eradicating a pathogen . In studies of cigarette smoke exposure, elevated expression and nuclear translocation of nuclear factor - k murine neutrophil chemokines, cxcl1 and cxcl2, were observed in aged mice.52 this was accompanied by a protracted neutrophilia in the lung parenchyma.52 moreover, following exposure to environmental toxins such as diesel exhaust, the increased pulmonary neutrophilia in lung parenchyma led to congestion and delayed clearance in aged animals as compared to young mice.53 these data suggest that inhaled pollutants cause a prolonged, aberrant pulmonary immune response, which may translate into increased tissue damage, playing a part in environmental, age - related pathology like copd . Pulmonary infection with francisella tularensis in aged rodents demonstrated delayed production of neutrophil chemokines in conjunction with an attenuated neutrophil recruitment at early times points,43 supporting the concept of an aberrant initial immune response with age . At later time points, inoculation of lps into the respiratory tract of aged mice was associated with subsequent heightened levels of chemokines cxcl1 and cxcl2, il-1, and lingering pulmonary neutrophilia at 72 hours in aged animals as compared to young.44 considering the delicate lung alveolar architecture and the highly hydrolytic enzymatic degranulation products of activated neutrophils, this may contribute to excessive tissue damage and reduced lung function over time . In addition to age - related perturbations in recruitment following inhalational injury or infectious insult, mclachlan et al examined cytotoxic activity of monocytes in older patients compared to younger patients in response to lps exposure, and found that older patients display less reactive oxygen species (ros).54 cytotoxicity generated by the production of ros and reactive nitrogen intermediates (rni) is a key function of m1, or proinflammatory macrophages, responsible for activating the type 1 helper t cells (th1) pathway . Alteration in macrophage polarization marked by reduced ros and rni is reported with advanced age.55 supporting the study by mclachlan et al, alveolar macrophages from aged rats had reduced basal and lps - activated levels of ros and rni.56 our lab and others have also demonstrated that aging is associated with lower levels of inducible nitric oxide synthase (inos), an enzyme that regulates production of ros and rni under control of the interferon- receptor.57,58 in conjunction with these changes in macrophage phenotype and cytotoxicity, others found that neutrophils from older individuals (85 years) produced less superoxide.54,59 these changes in reactivity have implications for compromising host defenses with age . In addition to changes in innate system functioning with age, there are changes seen in adaptive immunity with age . In order to activate b- and t cells, dendritic cells (dcs) must migrate from sites of tissue injury and infection to local lymph nodes . Dc migration in response to chemokine ligand-21, a key dc chemokine that is localized in lymph nodes and binds chemokine receptor type 7 and presents on dc cell membranes, was reduced in aged mice as compared to young.60 interestingly, following respiratory infection in the lungs of aged mice with either mouse hepatitis virus-1, respiratory syncytial virus, influenza a virus, or severe acute respiratory syndrome coronavirus, elevated expression of prostaglandin d2 correlated with reduced homing of lung dcs to regional lymph nodes and t cell activation.61 functional antagonism of prostaglandin d2 resulted in upregulation of chemokine receptor type 7, the critical receptor for dc migration, and improved dc homing to draining lymph nodes, subsequently improving t cell activation and survival after viral infection.61 there are many adaptive immune functions that are inefficient with age . The thymus is primarily responsible for producing nave t cells and is replaced by fatty tissue by age 60 years.62 this leads to an increase in memory t cells relative to nave t cells.63 both nave cd4 + and cd8 + t cells are reduced in aged animals and humans relative to their memory t cells counterparts.6466 in regard to cd8 + t cells, it has been suggested that repeated or latent cytomegalovirus infection may results in expansion of cd8 + memory cells, again diminishing the nave cd8 + t cell pool.67 moreover, the proliferative aptitude of cd4 + t cells from aged donors appears to be reduced following t cell receptor engagement with high - dose anti - cd3 antibody in comparison to young controls,68 suggesting a weaker novel pathogen - specific immune response . Meyer et al looked at the ratio of cd4 + to cd8 + t cells in bronchoalveolar lavage fluid in young versus old normal volunteers and found an increase in cd4+/cd8 + ratio as a function of age, suggesting there are fewer nave cells available to be converted to memory cells in the face of a novel infection.69,70 recently, forkhead box n1, a transcription factor known to play a role in embryonic thymus development, has been shown to play a critical role in preventing thymic involution and preservation of nave t cell subsets with aging.71 overexpression of forkhead box n1 was demonstrated to increase early thymic progenitors, decrease splenic cd4 + memory t cells, and increase splenic nave cd4 + and cd8 + t cells.71 these data suggest a possible potential target to increase the number of nave t cells in aged individuals, increasing the ability of the elderly to respond to novel antigens . The antibody - secreting capacity of b cells the prevalence of copd is two to three times higher in people over age 60.73,74 it is projected that from 1990 to 2020, copd will move from the sixth to the third leading cause of death worldwide.75 the rotterdam study found that of healthy 55-year - olds without copd, one in six women and one in four men will develop copd later in life, with the risk for developing copd over the coming 40 years being 24% and 16%, respectively.76 cigarette smoking is the greatest risk factor for developing copd in genetically susceptible individuals . Copd is characterized by airway and lung inflammation, mucociliary dysfunction, alveolar destruction, and airway fibrosis.77 the increased burden of copd seen in the elderly population may be due to age - associated changes in the structure and function of the lung, increasing the pathogenetic susceptibility to copd . These changes, described in elderly lifelong nonsmokers, are characterized by airspace dilatation resulting from loss of supporting tissue without alveolar wall destruction, similar to changes seen with copd.77 the global initiative for chronic obstructive lung disease (gold) criteria, accepted by the american thoracic society and the european respiratory society, is the standard for the diagnosis and classification of copd, and is assessed by measuring the ratio of fev1 to the forced vital capacity (fvc).78 fev1 peaks between ages 2036 years, and then begins to decline as we age.79 the annual rate of decline after the age of 25 is 20 ml per year and further declines to a loss of 38 ml per year after age 65.79 fvc begins to decline later in life than fev1 and at a slower pace . Because of the unparalleled rate of decline, use of the fev1/fvc ratio alone to diagnose copd will over represent a copd diagnosis when no such pathology may exist.80 to complicate this matter, ohar et al found that copd is underdiagnosed in the united states, arguing that this is due to underutilization of spirometry as a screening test for copd.81 therefore, it is recommended to practitioners that a combination of spirometry and symptoms typical of copd be utilized in the diagnosis of copd in the elderly . These include osteoporosis, mental illness, malnutrition, risk of cardiovascular disease, and skeletal muscle dysfunction.82 low body mass index is commonly seen in patients with copd and has been shown to be inversely related to mortality in copd.83,84 anxiety and depression are prevalent comorbidities and have also been shown to be related to negative outcomes in copd . It is estimated that 40% of individuals with copd have depression, compared to a prevalence of 15% in the general population.85 cognitive impairments are common and associated with copd in the elderly . It is estimated that anywhere between 42%70% of aged persons with copd have concomitant dementia or neurocognitive impairment.8688 this may be related to hypoxemia and hypercapnia associated with copd.89 it may also be due to the common occurrence of cardiovascular disease in elderly with copd.90 these conditions certainly impact the ability to tolerate and comply with prescribed copd therapies . Treatment options are varied and include metered dose inhaler, dry powder inhaler, or nebulized formulations . There are many factors which may impact effective treatment use in the elderly copd population including arthritis, weakness, poor manual dexterity, cognitive impairments, and visual limitations.91 careful consideration regarding treatment recommendations must be made in the aging copd population . The size of the thoracic cavity decreases, limiting lung volumes and altering the muscles that aid in respiration . Muscle function on a cellular level is less efficient and has decreased reserve . Cough strength is reduced in the elderly population due to anatomic changes and muscle atrophy . Clearance of particles from the lung through the mucociliary elevator is negatively impacted and associated with ciliary dysfunction . There are many complex changes in immunity with aging that increase susceptibility to infections, including a less robust immune response from both the innate and adaptive immune systems . Finally, copd has the highest prevalence in the elderly and deserves special consideration in regard to treatment in this fragile population . Additional research is needed to improve our understanding of the determinants of lung aging and the effects on lung immunity.
Micronutrients such as vitamins and mineral deficiency are associated with hiv infection and contribute to worsening of the disease and increased mortality . The prevalence of micronutrients deficiency is more in hiv - infected patients than the non - hiv individuals . Hiv - positive patients appear to require an intake of these nutrients in multiples of recommended dietary allowances when compared to normal individuals . Micronutrients are essential for maintaining proper immunologic function . A decreased plasma levels of b6, b12, a, e, and zinc have been correlated with significant alterations in immune response and cognitive functions . Micronutrient supplementation has shown several clinical benefits to the patient, including a reduction in mitochondrial toxicity and an improvement in immune reconstitution . Vitamin b12 deficiency impairs neutrophil function and folic acid deficiency depresses the cell - mediated immunity response . Micronutrients such as b12 and folic acid deficiencies are found in higher number in hiv - infected patients . Deficiencies of these vitamins typically present initially with neuropsychiatric disturbances including depression, dementia, and demyelinating myelopathy . Although there are several studies examining the effects of micronutrient supplementation in hiv - positive patients in general, there are no studies describing the effect of supplementation of specific micronutrients such as vitamin b12 and folic acid . Hence, this study was carried out to examine the effect of vitamin b12 and folic acid supplementation on neuropsychiatric manifestations, cd4 count, and anthropometric measurements in hiv - positive patients . This cohort study is done at a tertiary care hospital attached to a medical college in south india . The study protocol was approved by the institutional ethics committee and the written informed consent was taken from all participants before their inclusion in the study . Group i: hiv - positive patients with coexistent tuberculous infectiongroup ii: hiv - positive patients with neuropsychiatric symptomsgroup iii: hiv - positive patients without neuropsychiatric symptoms or tuberculosis . Group i: hiv - positive patients with coexistent tuberculous infection group ii: hiv - positive patients with neuropsychiatric symptoms group iii: hiv - positive patients without neuropsychiatric symptoms or tuberculosis . Definition of hiv positivity was taken as any patient tested positive by two hiv elisa tests and a monospot test using three different antigens (or) 3 monospot test positive using three different antigens by voluntary counseling and testing centre established by the national aids control organization, india . Neurological manifestations included strokes, central nervous system (cns) toxoplasmosis, cryptococcal meningitis, cytomegalovirus encephalitis, and peripheral neuropathy . Psychiatric manifestations included delirium, acute confusional state, dementia, depression, and severe anxiety and mood disturbances . Patients were inquired regarding any prior multivitamin supplementations and the duration of the same before enrolling into the study . A detailed clinical examination was performed which included detailed neurological assessment as well as psychiatric assessment . Absolute cd4 count estimation was done in all patients using flow cytometry (normal reference range was 3801200 cells/l). Folic acid estimation was done using carbonyl metallo immunoassay method and reference range that was taken for this study was 2.734.0 ng / ml . Vitamin b12 estimation was done using carbonyl metallo immunoassay method and reference range that was taken for this study was 189883 pg / ml . If the patient is found to have folic acid deficiency, they are supplemented with 5 mg in folic acid daily . If the patient was found vitamin b12 deficient, injection vitamin b12 was supplemented till the symptoms resolved and then once a month for 6 months . If the patient is symptomatic, all the necessary investigations to diagnose the opportunistic infections were done and treated accordingly . Patients who were initiated antiretroviral therapy before the study or after enrollment into the study were also periodically reviewed for any side effects of the medications along with the compliance . Follow - up of patients was done for 6 months at an interval of 2 weeks in the 1 month followed by monthly follow - up . At each visit, 24 h diet recall history was obtained and subjects were counseled regarding healthy food practices and they were subjected to neuropsychiatric assessment using folstein's mini mental state examination (mmse), hamilton depression score (ham - d) and anxiety score (ham - a), anthropometric measurements and neurological assessment for any peripheral neuropathy, etc ., the immune status was assessed by cd4 count estimation . Throughout the study, the standard of care was extended to all the subjects . At the end of 6 months, patients were analyzed for any changes in the neuropsychiatric assessment scores, anthropometric parameters, and immune response as evidenced by cd4 count . The sample size was calculated using open epi version 3 (open source epidemiologic statistics for public health . Assuming that population folate and vitamin b12 deficiency is 5%, a sample size of 32 per group was calculated at a confidence level of 80% with the confidence limits as 5% . Statistical analysis was done using statistical package spss 17.3 version (spss statistics for windows, version 17.0 . The sample size was calculated using open epi version 3 (open source epidemiologic statistics for public health . Assuming that population folate and vitamin b12 deficiency is 5%, a sample size of 32 per group was calculated at a confidence level of 80% with the confidence limits as 5% . Accounting for dropouts, statistical analysis was done using statistical package spss 17.3 version (spss statistics for windows, version 17.0 . A total of 150 patients were included in the three groups with fifty patients in each group . Among these, 74 completed the study, 33 expired, and 43 were lost to follow - up . The median duration of illness was 18.50 (2, 54.25) months, i.e. From the date of diagnosis of hiv illness to the date enrollment into the study . Mean age of presentation for group i, ii, and iii was 36.28 5.93, 39.22 9.02, and 38.57 8.84 years, respectively, and was comparable among three groups . The ratio of males and female subjects enrolled in the three groups was 40:10, 35:15, and 33:17, respectively, which is on par with the sex ratio of hiv - positive patients . The median baseline folic acid levels in groups i iii were 5.91 (2, 9.37), 3.64 (2.12, 8.17), and 5.08 (3.16, 9.96) ng / ml, respectively . The prevalence of folic acid deficiency in group i was 27.1%, group ii was 31.9%, and group iii was 23.4% . The overall prevalence of the folic acid deficiency is 27.5% . The baseline median serum b12 levels in groups i iii were 380 (263.45, 701.05), 555 (343, 1127), and 460.5 (325, 698.75) pg / ml, respectively . The prevalence of vitamin b12 deficiency in group i was 8.16%, group ii was 6.12%, and group iii was 4.16% . The mean follow - up body mass index (bmi) in the hiv cohort of the groups i iii was 18.65 2.79 kg / m, 19.82 3.06 kg / m, and 19.51 3.02 the follow - up bmi increased in all the groups, suggesting that nutritional supplementation has a beneficial effect in improving the overall nutritional status of the patient . The improvement could also be due to the antiretroviral therapy (art), which would have been introduced for some of the followed up patients . Changes in body mass index the follow - up median triceps skinfold thickness in groups i iii was 6 (9, 12), 11 (6.5, 15), and 10 (7.25, 14.75) mm, respectively [figure 2]. The triceps skinfold thickness increased in groups ii and iii but decreased marginally in group i, i.e., in hiv patients with tuberculosis . Changes in triceps skinfold thickness the follow - up median mid - arm circumference in groups i iii was 22.4 2.93, 23.47 2.92, and 23.87 3.83 cm, respectively [figure 3]. The median mid - arm circumference increased in all the diseased groups at the end of follow - up and the increase was more in group ii compared to other groups . Changes in mid - arm circumference the follow - up mean waist circumference in groups i iii was 71.78 8.07, 75.68 8.82, and 73.36 10.55 cm, respectively [figure 4]. The mean waist circumference increased in all the diseased groups at the end of follow - up and the increase was more in group ii compared to other groups . Changes in waist circumference the follow - up mean hip circumference in groups i iii was 83.56 8.58, 84.73 7.16, and 86.15 7.61 cm, respectively [figure 5]. The mean hip circumference increased in all the diseased groups at the end of follow - up and the increase was more in group ii compared to other groups . Changes in hip circumference table 1 shows the baseline values for mean mmse scores, median ham - a scores, and median ham - d scores in groups i iii, respectively . Hiv patients with neuropsychiatric manifestations (group ii) were noted to have the lowest mean mmse score when compared to group i and iii . The mean mmse of group i and group ii differs (p = 0.012). The mean mmse of group iii and group ii significantly differs (p <0.001) [table 1]. At the end of the study, mmse scores improved in all the three groups [figure 6]. Ham - a scores improved in group iii, but in the other two groups, it remained same [figure 7]. Baseline neuropsychiatric scores changes in hamilton anxiety score changes in hamilton depression score of 20 folic acid deficient patients who completed 6 months follow - up, 9 (45%) improved in their ham - a and 10 (50%) improved in their ham - d score . Of 3 vitamin b12 deficient patients who completed 6 months follow - up, 1 (33.33%) improved in their ham - d score, but all three did not show improvement in ham - a score . Median baseline cd4 count in groups i, ii, and iii was 125.5 (62.25, 271.25), 89 (46.75, 175.75), and 282 (135.50, 611.75) cells/l, respectively . Statistically significant difference in the median cd4 counts (p <0.001) existed between groups i and iii and also between groups ii and iii (p <0.001). The follow - up median cd4 count has improved in groups i and ii, but there was a marginal fall in the median cd4 count of group iii [figure 9]. This study has examined the effect of supplementation of vitamin b12 and folic acid on the neuropsychiatric manifestations, immunological response, and anthropometric measurements in three different groups of hiv patients, namely, hiv patients with tuberculosis, hiv patients with neuropsychiatric manifestations, and asymptomatic hiv patients . The mean age of the patient population was 38.00 8.12 years and was comparable between these three hiv groups . In a study conducted by jiamton et al . On impact of multiple micronutrient supplementation on mortality among hiv - infected individuals, the median age was 32 years . The mean bmi was more in asymptomatic hiv patients compared to the other two groups . The presence of opportunistic infections or advanced disease in groups i and ii might have led to weight loss and wasting . The mean bmi in a study conducted by jiamton et al . At bangkok was 21.2 (2.7), which is higher than that found in our study . This indicates that malnutrition and wasting are more common in hiv - affected individuals in our country because of poverty, undernutrition, and late presentation due to poor awareness of the disease . All the other baseline anthropometric parameters such as mid - arm circumference, triceps skinfold thickness, and waist and hip circumference also showed the same trend . Ham - d scores were higher in groups i and ii compared to group iii because of the advanced nature of the disease in both groups and specific cns involvement in group ii . High prevalence of folic acid deficiency resulting in diminished cognitive function and depression in these groups would have contributed to low mini mental score and high ham - d score . There was no significant difference between the groups with regard to ham - a scores . Median baseline cd4 count was less in group i and ii compared to group iii because of the advanced hiv disease in those two groups . The incidence of opportunistic infections, mainly affecting the cns, leads to neuropsychiatric manifestations and is maximum in group ii because of low cd4 counts and lower immune status of the patients . The median cd4 count in the study conducted by jiamton et al . Was 244, which is comparable to the median cd4 count of group ii, which was 282 (135, 611) that comprised asymptomatic hiv - positive patients however, in a study conducted by fawzi et al . In tanzania on 1078 pregnant women with hiv infection, mean cd4 count was 429 224 . This might have been because of early detection of hiv infection as well as prompt initiation art in this region . The median folic acid level was lower in group ii compared to group i and iii, which may be because of cachexia induced malnutrition and decreased absorption of folic acid due to advanced disease in this group . Prevalence of folic acid deficiency was higher in group ii, which might have played a role in diminished cognitive function and depression found in this group . The prevalence of vitamin b12 deficiency was highest in group i indicating that b12 deficiency is common in chronic diseases . The high prevalence of vitamin b12 and folic acid deficiency in group i indicates that special attention is required regarding micronutrient supplementation among hiv patients who have coexisting tuberculosis . In our study, there was a significant correlation between vitamin b12 deficiency and mortality but there was no association between folic acid deficiency and mortality . This is consistent with the study done by tang et al ., in which they found that participants with low vitamin b12 concentration had significantly shortened aids - free time . In contrast, folic acid deficiency did not have any association with progression to aids or decline in cd4 count . All the anthropometric parameters improved at the end of the study in all three hiv - infected groups . This may be because of appropriate nutritional supplementation and also the concomitant art administration . The neuropsychiatric scores also improved at the end of the study in all the groups which indicates a beneficial effect of nutritional supplements on neuropsychiatric symptoms . The median cd4 count in group i and ii increased at the end of follow - up but the median cd4 count in group iii dropped marginally . The increase in the cd4 count in the groups ii and iii may be due to the nutritional supplementation and also the concomitant use of art in these patients . The marginal fall in the cd4 count in asymptomatic hiv group might be because of the fact that as per naco guidelines, art is not indicated in this group of patients . The fall in cd4 count in these patients could be because of the continuing viral replication in the absence of art . Patients with folic acid deficiency were supplemented with folic acid and were improved in bmi at the end of follow - up . This signifies the role of supplementation of folic acid in deficient individuals . Of 20 folic acid deficient patients, 9 improved in ham - a and 10 improved in ham - d after supplementation with folic acid low levels of folic acid and vitamin b12 have been found in studies of depressive patients, and an association between depression and low levels of the two vitamins is found in studies of the general population . Low folate level is also associated with a poor response to antidepressants, and treatment with folic acid is shown to improve response to antidepressants . However, such benefit in the improvement of ham - a and ham - d scores was not found with b12 supplementation in patients who had vitamin b12 deficiency . Patients who were found to have a folic acid deficiency improved in cd4 count after supplementation . The role of vitamin b12 in improving the immunological status cannot be commented from our study as only a few number of patients with vitamin b12 deficiency could be followed up till the end of the study . Kaiser et al . Showed that micronutrient supplementation which included vitamin b12 and folic acid twice daily for 12 weeks significantly increased absolute cd4 cell count and mean change in cd4 cell count from baseline in hiv - infected patients taking art . Studies have shown that though art is associated with a decreased prevalence of opportunistic gastrointestinal diseases and incidence of malnutrition, gastrointestinal infections, and severe gastroenteritis, which alter micronutrient absorption, may persist after art initiation . Several hiv medications, particularly nucleoside reverse transcriptase inhibitors, can inhibit the replication of mitochondrial dna and cause vomiting and diarrhea that can reduce the absorption or increase the losses of several micronutrients . Cd4 count was lower in hiv patients with tuberculosis and hiv patients with neuropsychiatric symptoms . The majority of people who had a folic acid deficiency has shown an increase in their bmi, ham - a, and ham - d scores after supplementation . Folic acid supplementation in people with folic acid deficiency leads to improvement in cd4 count.
Using a previously reported method (4), we assembled the pseudovirus with membrane proteins of hemagglutinin (ha) and neuraminidase (na) from influenza a / shanghai/4664t/2013(h7n9) and capsid protein from hiv . The genomic rna of the pseudovirus also carries a luciferase reporter gene; thus its infectivity can be quantified by luciferase activity in virus - infected cells (57). To produce the pseudovirus, we carried out the following procedures: 4.5 10 293 t cells cultured in a 10-cm dish were co - transfected with 5 g of lentivirus vector pnl4 - 3-luc r - e-, 2.5 g of pvkd - ha, and 2.5 g of pvkd - na by using lipofectamine 2000 from invitrogen (cat no . (these constructs of pvkd - ha and pvkd - na can be provided on request from the authors .) After overnight incubation, cells were washed once with phosphate - buffered saline and cultured in 5 ml complete dulbecco minimum essential medium . The pseudovirus containing supernatant was harvested at 48 hours and stored at 80c in aliquots until used in the neutralization assay . Mdck cells were infected with serially diluted pseudovirus stock, and the infectivity reflected by the relative luciferase activity (rla) was determined as the median (50%) tissue culture infective dose, according to the method of reed and muench . We then implemented the pseudovirus assay to measure neutralizing antibodies in clinical samples with known hi titers for subtype h7n9 . Fourteen convalescent - phase serum samples with real - time rt - pcr confirmed infection with 2013 subtype h7n9 were from patients 5681 years of age from whom samples were collected 1232 days after onset of symptoms and who were hospitalized in shanghai public health clinical center; control samples were 50 stored serum samples collected in 2009 before the emergence of 2013 subtype h7n9 . The neutralizing activities in patients serum samples were also validated by the mn assay against live virus . In a 96-well plate, 2-fold serially diluted serum samples beginning at 1:10 were incubated with 200 median (50%) tissue culture infective doses of pseudovirus at the final volume of 100 l at 37c for 1 hour; then the mixture was added to the culture of mdck cells . After incubation overnight, the cells were washed with 200 l of phosphate - buffered saline and cultured in complete dulbecco minimum essential medium for 48 hours in the original 96-well plate . Rla was measured by brightglo luciferase substrate (promega, madison, wi, usa; cat . Inhibition percentage was calculated as the following: (rla in virus challenge controls rla in test well for each serum at specific dilution)/rla in virus challenge controls . The 50% inhibitory concentration (ic50) titer was determined by the reciprocal of the last dilution that resulted in> 50% reduction of luciferase activity . As expected, the ic50 titer quantified by the pseudovirus - based assay significantly correlated with hi titer measured by the inhibition of 1% guinea pig erythrocytes hemagglutination when incubated for 1 hour with reacted mixture of diluted serum samples and live virus (figure; spearman r = 0.88, p<0.0001, n = 64). Correlation between conventional hemagluttination (hi) titer and 50% inhibitory concentration (ic50) titer of pseudovirus - based assay for diagnosing influenza a(h7n9) virus infection . Correlation between the ic50 titer of the pseudovirus - based neutralization assay and the titer of conventional hi assay, tested with 14 serum samples collected> 10 days after symptom onset from patients with real - time rt - pcr confirmed 2013 influenza a(h7n9) infection () and 50 control samples (, spearman r = 0.88, p<0.0001, n = 64). To display the information from all the samples, overlapped markers were shifted on the x- and/or y - axis with small incremental units . To determine the criteria delineating seropositive samples from seronegative samples for the pseudovirus - based assay, we tested the agreement between the hi assay and pseudovirus - based assay with the thresholds of 20 and 40, respectively . The strongest concordance between these assays was achieved by using 40 for the pseudovirus - based assay as the cutoff titer (table; = 0.904; mcnemar test, p = 0.5 for 1:40 and = 0.788; mcnemar test, p = 0.375 for 1:20). With 40 as the cutoff, 12 (86%) of 14 hi assay samples positive for subtype h7n9 had an ic50 titer> 40, whereas none of the control samples had an ic50 titer> 40 (table). Thus, in our preliminary assessment using this limited number of samples, the sensitivity of this assay was 85.7 (95% ci 0.5720.982), and the specificity was 1.000 (95% ci 0.9290.978). In addition, the serum samples used as negative controls contained antibodies against contemporary circulating seasonal influenza viruses, including h1 and h3 subtypes, which also supported the strain specificity of this subtype h7n9 neutralization assay (data not shown). * values are no . Here we provide an alternative approach for quantifying antibody responses to the new avian influenza a(h7n9) virus . Conventional hi or mn assays require propagating the live subtype h7n9 virus, which is known as a lethal virus . The pseudovirus can infect in a single round, which is much safer than handling the highly virulent subtype h7n9 virus . All of these processes for the pseudovirus - based neutralization assay can be performed at routine bsl-2 settings, and most field laboratories equipped with mammalian cell culture facilities meet this biosafety requirement . Moreover, propagating avian influenza virus in embryonic eggs to high titer is labor intensive and time consuming and requires empirical judgment to interpret the results of hi and mn assays . By contrast, large amounts of pseudoviruses take only 23 days to produce, and using rla as the readout of pseudovirus - based neutralization assay provides an objective means of interpreting the endpoints . Therefore, this pseudovirus - based neutralization assay could be used as an alternative for safely conducting serologic studies in a rapid response in assessing the threat posed by subtype h7n9 virus . Of note, the pseudovirus - based assay was less sensitive than hi assay when tested by our small number of samples, indicating that some false - negative results would be observed and thus that some samples that would test positive by hi might be missed . The differences between the 2 assays could be explained by the possibility that hi and pseudovirus - based assays evaluate different components of the antibody response . Hi only measures the proportion of antibodies directed to the receptor - binding site of hemagglutinin, whereas the neutralization assay detects a broader range of neutralizing antibodies . The results of these 2 assays were in agreement for most samples, indicating that 2 different components of antibodies are likely to be developed in parallel in most persons . Therefore, this assay will provide a new contribution to the understanding of how the immune system responds to infection with influenza viruses.
. These compounds are 1,4-naphthoquinone derivatives usually found alongside with some of their corresponding esters, in different ratios, in the roots of some plants of boraginacea family such as lithospermum erythrorhizon, arnebia euchroma, and alkanna tinctoria . It was being used for dying foods and fabrics as well as curing burnt skin and ulcers in traditional medicine of east asia [24]. Modern medicinal studies also support its old - known uses and promise additional applications in combats against cancers, hiv and risky microorganisms . While there is an increasing demand for shikalkin in pharmaceutical, food, and cosmetic industries, a synthetic procedure for mass production of any of the enantiomers has remained impracticable . In contrast, plant biotechnology methods based on cell and tissue culture of l. erythrorhizon root earned success in early 1980s . Expectedly, the costs of the production and geographical limitation of l. erythrorhizon encouraged scientists to search for other accessible and more capable shikalkin producing cell lines among the other members of boraginacea family . Scientific reports indicate that a. euchroma, a perennial herbaceous plant, could be a valuable competitor for l. erythrorhizon [8, 9]. In addition to shikalkin derivatives, pigment extracted from the a. euchroma root contains some novel substances which seem important from both biodiversity and biological points of views [10, 11]. This paper presents results of a five - year study on the solid culture of the callus obtained from the iranian a. euchroma root and antimicrobial properties of its pigment . Thiamine, inositol, 2,4-dichlorophenoxyacetic acid (2,4-d), 3-indoleacetic acid (iaa), and n-(2-furanylmethyl)-1h - purin-6-amine (kinetin) were purchased from sigma - aldrich company . Murashige - skoog (ms), linsmaier - skoog (ls), white, sh and m9 media were prepared according to the literature . Shikalkin pigment was extracted by thf from the powder of the dried a. euchroma roots and calli . The extracts were dried in the dark under a moderate vacuum . The dried pigment was weighed and identified according to the reported procedure . The sterilized seeds were sprouted on hormone - free ms medium from one to eight weeks . Callus induction was examined on two groups of explants at two different ages (10 and 20 days old) excised from the young plantlets (figure 2(b)). Then, callus induction was examined in the absence and presence of light and phytohormones . Each group had explants, of different parts of the plantlets, in two different sizes (24 and 46 mm). Based on the literature [7, 8, 1416], the culture medium of those samples which had to be studied in the presence of phytohormones was supplemented with 2,4-d (10 m) and kinetin (10 m). The resulting callus cells were primarily transferred on solid ls medium containing sucrose 3%, 2,4-d 10 m, and kinetin 10 m and solidified with 0.8% agar . The induction was successfully carried out via transferring the a. euchroma calli onto white medium supplemented by sucrose (25 g / l), iaa (10 m), and kinetin (10 m) and maintained under darkness at 25c . Modifications to the propagation and the pigment production media were made according to the results presented in this paper . All the species showed in table 2 were obtained from the bacteriology department of shahid beheshti pharmaceutical faculty . Two methods of antibiogram disks and growth inhibition in suspension culture were used in these experiments . The antibiogram tests were carried out by impregnating the paper disks in thf solutions containing various amounts, in a range of 50500 g / ml, of the pigment . The thf solvent was considered as the blank and clotrimazole and ciprofloxacin at different concentrations of 0.10.5 mg / ml were used as the standards . The suspension cultures were carried out in 50 ml flasks containing various amounts of the thf extract in a range of 50300 g / ml . The growth rate of the desired bacteria was measured by reading the optical density of the diluted (1/20) cultures at 600 nm . The growth of the desired species in the liquid culture in the absence of thf and thf extract was considered as 100% in inhibition calculations . Solid and liquid mueller - hinton media were used for the antibiogram and suspension cultures, respectively . All of the tests were assayed after 24 h incubation under darkness at 25c . Data were analyzed by microsoft excell 2003, and p values less than .05 were regarded significant . Two species of a. euchroma, grandis and ordinary, have been reported from iran . They are found at dena altitudes in the central zagross and shah mountains in kerman district . The dark red root of the ordinary species, locally named ho'e - cho'e, grows up to 2 cm in diameter and exceeds 40 cm in length . It usually blooms in mid - june and its petals are dark - purple with yellow limb apex, figure 2(a). In contrast, the grandis species has thinner and shorter root in bright red color . It is only found at altitudes higher than 3300 m and grows beside stones . It seems that its root has penetrated into the stones, but grandis a. euchroma is found at lower altitudes on sandy soil . Yet, none of them is seen in shadow and locals use the former for flourishing their foods and healing wounds . Chemical analysis showed that the dried root of the iranian a. euchroma contained about 8.5% (w / w), in average, shikalkin pigment (table 1). Germination of 30 sterilized a. euchroma seeds on hormone - free ms medium was studied in a four - month plan . The first and the last seeds germinated on the 7th and 54th day of the experiment, respectively, and about 30% of the seeds never germinated . The observations indicated that despite the rough coat of a. euchroma seed, the conventional sterilizing method was efficient enough, because only one of the sprouted seeds showed fungal contamination . The observations also proved that there is no need to apply sophisticated methods for germination of a. euchroma seeds . Yet, it is possible to raise the germination possibility close to 100% by exposing seeds to current water (data is not showed here); however, keeping the sprouted seeds clean under this condition is cumbersome . Callus induction can be a bottle neck in plant cell and tissue culture . Nonetheless, running the program introduced in the materials and methods section proved it was not bothersome in this case . Results of examining different explants employed in this experiment were strongly in favor of the younger and shorter (10 days old, 24 mm in length) collar and root explants which had been maintained in the dark . In fact, some of the explants, which had been under the effect of 2,4-d (10 m) and kinetin (10 m), started to show callus formation in the dark after 10 days . But all the explants which had been maintained in the light or on phytohormones - free media failed to form callus and gradually started to darken . These results are in parallel to those reported for l. erythrorhizon and chinese a. euchroma [8, 14]. Callus propagation rate of a. euchroma was optimized through examining the effects of light, carbon source concentration, nitrogen source, vitamins, growth regulators, and the type of the medium culture . It is understood from figure 3(a) that a. euchroma cells which had been propagated in the dark produced about 30%, in average, higher biomass in comparison with those propagated in the light . It seems that light not only inhibits shikalkin production [15, 19], but it also bothers faster growth of a. euchroma cells . One reason for this growth decline could be initiation of chlorophyll formation in these cells in the presence of light (figure 2(c)). Figure 3(b) shows the positive impact of increasing the sucrose concentration on a. euchroma callus propagation . Apparently, sucrose concentrations higher than 50 g / l perturb the right balance of carbon to nitrogen ratio and cause a decline in the growth of a. euchroma cell literature indicates that similar to light, ammonium inhibits shikalkin production [8, 21]. In order to examine the effect of this cation on a. euchroma callus propagation, the growth rate of these cells was measured on normal ls and some modified ls media . As it is seen in figure 3(c), the propagation rate drops to the lowest level when the nitrogen source of ls medium is at the lowest concentration (nh4 is omitted and no3 is halved). Interestingly, keeping the no3 concentration at its normal amount in ls is more efficient when the nh is totally omitted in comparison with those containing decreased nh4 concentration (down to 0.01 of its normal level). This result suggests that the imbalanced ratio of no3 to nh4 could play a negative role in a. euchroma callus propagation . This idea is more supported by the observations revealing that a. euchroma calli grown on such a medium (ls medium with imbalanced ratio of no3 to nh4) gradually browned (figure 2(d)). However, those cells propagated on the ammonium - free ls medium containing higher (1.5 fold) nitrate remained friable and colorless (figure 2(e)) and even showed growth rate about 14% higher than those propagated on normal ls . So, this modified medium was nominated mls and used in next studies . In the next step, the growth rate of a. euchroma calli on normal ls and mls was studied in the presence and absence of the vitamins (thiamine and inositol) during 4 subcultures in three months . Results in figure 3(d) indicate that omitting the vitamins has caused about 7% decrease in the growth rates of a. euchroma calli subcultured on both ls and mls media . Therefore, solid mls medium containing vitamins, sucrose (50 g / l), 2,4-d (10 m) and kinetin (10 m) was selected for the propagation of a. euchroma callus under darkness at 25c . It is noteworthy to mention that the grown calli under the mentioned conditions were cream in color, friable, and showed about 6 folds increase in biomass during a subculture period (21 days). Applying treatments containing other combinations of the mentioned phytomormones' concentrations caused vitrification and morphological changes which is not presented and discussed here . Based on cell culture technique, the existing literature suggests a two - step plan for shikalkin production . The aim of the first step is increasing the biomass of the desired cells in known media such as ls and sh in the presence of 2,4-d and kinetin . In the second phase, instead of biomass growth hence, the cells are transferred into media like white or m9 to start pigment production [2224]. It is known that similar to light and ammonium cation, 2,4-d inhibits shikalkin production . This is why 2,4-d is substituted by iaa in the second phase of the shikalkin producing cell cultures [7, 8, 2124]. To evaluate the efficacy of mls medium (developed in this research), the biomass growth and the pigment production of a euchroma callus were investigated on mls, sh, and white media . Results in figure 4(a) supports the idea that 2,4-d inhibits shikalkin production, while iaa induces it . As a matter of fact, substituting 2,4-d by iaa triggered the pigment production even on ls medium which contained nh4 . However, browning was the prominent phenomenon under that conditions (figure 2(f)). It has been showed that nh4 does not inhibit directly the shikonin biosynthetic pathway, but it causes a hindrance through accumulation of glutamine in the cells . Results in figure 4(a) also suggest that the callus propagation rate declines in the presence of iaa regardless of the type of the medium and white medium can be considered as a suitable medium for pigment production . So, further studies on the shikalkin production by a. euchroma calli were carried out on white medium . G / l [20, 24], the literature introduces some elicitors for enhancing shikalkin production . Figure 4(b) confirms that increasing the copper ion concentration has caused enhancement in the shikalkin formation . Comparing the composition of m9 with white reveals the obvious difference in the copper ion concentration of these media (0.3 mg / l in m9 and 0.01 mg / l in white), but experiments in this lab indicated a. euchroma callus was able to produce higher amounts of shikalkin on white medium in comparison with m9 . Figure 4(c) illustrates the results of shikalkin production by a. euchroma callus on white and m9 media under different conditions of the phytohormones . It is understood from these results that the combination of iaa (10 m) and kinetin (10 m) which had been selected for l. erythrorhizon and chinese a. euchroma is similarly effective on the iranian a. euchroma cell culture, but m9 which had been engineered for the pigment production by l. erythrorhizon does not work as efficient as white medium does for these cells (figure 2(g)). In order to see what kind of factor(s) influences the efficacy of m9 and white media for the iranian a. euchroma shikalkin production, the compositions of these media were reviewed . In addition to the difference in copper concentrations, it seems that white medium enjoys a kind of balance between the concentrations of potassium and sodium cations, while the sodium concentration is about 9 times higher than the potassium in m9 medium, figure 4(d). So, the pigment production of a. euchroma callus was studied on a modified m9 (mm9) in which the concentrations of sodium sulfate and potassium sulfate were adjusted at 740 and 907 results of these experiments in comparison with the results of the pigment analysis of the natural root of iranian a. euchroma have been summarized in table 1 . It is evident that a. euchroma callus on the solid mm9 has produced shikalkin 16 times higher than the natural root in 21 days (figure 2(h)). This result is slightly higher than the results reported by other researchers [8, 22, 24, 26]. So, there are several reports now on antimicrobial activity of shikonin, alkanin, shikalkin, their different derivatives, and even various extracts of the roots of different plants of the boraginacea family [2, 5, 28]. Although some of these results have been commercialized and some are promising, the review of the literature indicates that there are still serious works to be done to explain the healing effect or selective antimicrobial ability of the shikalkin derivatives . In addition to the shikalkin derivatives, the a. euchroma root contains some novel compounds . This makes the a. euchroma root extract more precious to be studied . In this research, the thf - extract of the a. euchroma root was applied in the antimicrobial experiments on 2 fungi, 4 gram - negative and 5 gram - positive bacteria species showed in table 2 . More importantly, the results on this gram - positive bacterium produced the lowest p value (.031), while the data on s. aureus resulted in a p value of .298 . Sasaki et al . Had announced that acetylshikonin obtained from a. euchroma could inhibit candida albicans . Two years later, shen et al . Reported that the a. euchroma extract had little effect on fungi and gram - negative bacteria, but it was effective on some gram - positive bacteria specially s. aureus . Comparing this conclusion with the results showed in table 2, it seems that the thf - extract of iranian a. euchroma has not showed meaningful effect on the fungi and gram - negative bacteria but has affected a gram - positive bacterium, m. luteus, and not s. aureus . To validate the results of table 2, the a. euchroma extract was applied in the liquid culture of s. aureus, m. luteus, e. coli, and salmonella . It is evident from the results, illustrated in figure 4(e), that the extract of iranian a. euchroma has almost completely inhibited the m. luteus growth, while the s. aureus growth has remained unchanged . Considering these results and the previous scientific reports, it can be concluded that the a. euchroma root extract has a greater inhibiting potential toward gram - positive bacteria . However, this potential has to be formulated according to the biodiversity of the plant source and the extraction method.
Although decades have passed since most cellular organelles were initially characterized by microscopy and subcellular fractionation, a complete catalogue of the proteins in each organelle has yet to be obtained . Whereas genomics provides a list of potential proteins encoded by an organism's genome, data from proteomic analysis can provide the' rosetta stone' that allows assignment of specific proteins to different subcellular structures . The most informative proteomic analysis requires highly purified organelle (sub)fractions, yet subcellular fractionation is notorious for cross - contamination . Comparative analysis of organellar subfractions can potentially circumvent this problem by providing a rational basis for distinguishing bona fide organelle components from contaminants . Here, we scrutinize the use of such an approach to survey the integral membrane proteins of the nuclear envelope . The nuclear envelope is a double - membrane system, continuous with the endoplasmic reticulum (er), that encloses the nuclear contents (figure 1). It is perforated by nuclear pore complexes (npcs), large supramolecular assemblies that mediate nucleo - cytoplasmic traffic . In higher eukaryotes, the nuclear envelope is lined by a protein meshwork, the nuclear lamina, which is an attachment site for npcs and chromatin . In contrast, the inner nuclear membrane (inm) contains a set of unique integral membrane proteins, many of which bind to lamins (the predominant proteins of the nuclear lamina) and/or to chromatin . A quarter of a century of biochemical, cell biological, and genetic approaches has identified several integral inm proteins in higher eukaryotes, including lamin - b receptor (lbr), lamina - associated polypeptides (laps) 1 and 2, man1, nurim, and emerin . Most of these proteins and several novel components have now been detected in a single proteomics study of nuclear envelopes . Many methods have been developed to isolate nuclear and nuclear - envelope fractions from eukaryotic cells . These fractions are invariably contaminated by other cytoplasmic organelles and filaments, however . Moreover, the close interactions between the npcs, nuclear lamina, inm and chromatin make it impossible to cleanly separate these components . Proteomics, which couples mass - spectrometric analysis of proteins with mining of the protein databases derived from genomics, can potentially identify most proteins in a nuclear envelope fraction, but it cannot distinguish nuclear envelope components from contaminants . Dreger and colleagues used comparative proteomics of different nuclear envelope subfractions isolated from cultured neuroblastoma cells to identify integral proteins of the inm . They took advantage of previous findings that the nuclear lamina is insoluble in both nonionic detergent and salt, and that many integral proteins of the inm remain associated with the lamina after detergent or salt extraction . They therefore separated proteins from three different nuclear envelope subfractions on two - dimensional gels, excised protein spots from the gels, cleaved the proteins within each spot with protease, and analyzed the resulting peptides by maldi - tof (matrix - assisted laser - desorption / ionization time - of - flight) mass spectrometry . In one extraction, nuclear envelopes were treated with the detergent triton x-100 to solubilize proteins of the outer nuclear membrane and er . The triton x-100 pellet (' detergent - resistant' in table 1), which contains the nuclear lamina, is enriched in lamin - binding inm proteins . A second pellet was obtained by salt extraction of nuclear envelopes (' salt - resistant'; table 1) and is expected to be similarly enriched in the lamina, but with different contaminants removed . A third extraction involved treatment of nuclear envelopes with a urea / carbonate solution and yields a pellet (' chaotrope - resistant'; table 1) containing integral membrane proteins of the inm, outer nuclear membrane and er (plus contaminating organelles). On the basis of the logic discussed above, integral membrane proteins (chaotrope pellet) that were also found in the detergent and salt pellets were good candidates for novel inm proteins . This analysis identified most previously characterized inm proteins, as well as four novel integral proteins . Two of the novel four were splice variants of the lamina - associated protein lap2, previously observed only as mrnas . The identification of unique peptides, including some that overlap predicted splice junctions between exons, confirmed the presence of three previously observed (,,) and two novel (,) lap2 isoforms . The remaining two lap2 isoforms that had been identified as mrnas (,') were not observed (although all lap2 isoforms contain chromatin and/or lamin - binding domains that predict their targeting to the nuclear envelope). Lap2, a splice variant lacking a transmembrane domain, was absent from the chaotrope - resistant fraction, supporting the logic of the comparative approach . The third novel inm protein to be identified was a homolog of unc84a, a caenorhabditis elegans protein previously localized to the nuclear envelope . The fourth protein, luma, was completely novel and includes no known domains and so has no predicted functions . Dreger and colleagues did not detect lap1, although it has been observed in a variety of mammalian cell types . This could result from its loss during fractionation, its absence from the neuroblastoma line examined, or other technical problems (for example, only about 75% of the protein spots seen on the two - dimensional gel yielded assignments by mass spectrometry). Low abundance is also a potential problem . Whereas lamins are present at millions of copies per cell, previously characterized inm proteins are far less abundant . Notwithstanding the high sensitivity of mass spectrometry, minor proteins may go undetected . Just as local dialect modifications can limit some translations using the rosetta stone, atypical protein behaviors can limit comparative proteomic approaches . Each comparative approach is tailored by knowledge of the fractionation behavior of previously characterized components of an organelle . Thus, in comparing the proteins appearing in the three nuclear envelope fractions, dreger and colleagues found that all well characterized intranuclear proteins were absent from the chaotrope - resistant fraction, and most known inm proteins were in all three fractions . Emerin, which is known to bind lamins, was absent from the detergent - resistant fraction, and lbr, the sequence of which includes seven transmembrane segments, was detected only in the detergent - resistant fraction and not in the chaotrope- or salt - resistant fractions (table 1). Three of the novel proteins identified by the study were in all three fractions, but luma was absent from the salt - resistant fraction . Thus, luma would have been missed if a requirement that novel inm proteins appear in all three fractions had been enforced . Atypical behavior of contaminants can also limit the effectiveness of comparative approaches . In the dreger study, some known proteins with clearly cytoplasmic localizations and functions also appeared in all three pellets, including mitochondrial proteins (f1-atp - synthase) and cytoskeletal ones (actin and tubulin). This underscores the need to complement the proteomic identification of new organellar components with other approaches, including direct localization . Thus, to ensure that luma and the unc84a homolog were not contaminants, their cdnas were isolated, epitope - tagged, and transfected into cos7 cells, to confirm nuclear - envelope targeting . Rout and colleagues, when analyzing the yeast npc by proteomics, used the additional criterion of enrichment with the npc to distinguish contaminants . Candidate proteins from an npc - enriched fraction were epitope - tagged at their genomic loci . Only when the majority of tagged protein was found to reside at the npc (by immunogold electron microscopy, immunofluorescence microscopy, and co - fractionation with known npc proteins) was it considered a true npc component . Some proteins have multiple cellular localizations, however, and this criterion eliminated, for example, the sec13 protein, which is involved in protein translocation across the er membrane yet has a second function at the npc . Even with the four novel inm proteins demonstrated by the dreger study, we predict that many inm proteins remain to be discovered; some of these could be amongst the 25% of protein spots that eluded analysis . For example, unc84a appears in all c. elegans tissues, but unc83, an inm protein that interacts with unc84a, appears in only a subset . Nuclear envelope proteome analyses of different tissues may uncover a mammalian unc83 homolog and other tissue - specific inm proteins . Indeed, a novel tissue - specific inm protein was just discovered . This protein, named myne-1, binds lamins and appears specifically in myocytes . Applying proteomics directly to complex protein mixtures, rather than restricting analysis to the proteins recovered from gels, should increase the number of proteins detected . Moreover, this method could estimate the relative amounts of different proteins in a subcellular compartment by determining the relative peptide quantities after protease cleavage . Post - translationally modified peptides could be identified by comparing peptide profiles with or without treatments that remove the modifications (for example, chemical removal of sugars); and a combination of this type of approach with relative quantitation could provide information on the proportion of a protein in an organelle that is modified . By analysis of complex mixtures, the protein profiles of organelles in different functional states or extracted with different ionic strengths can be compared more comprehensively and rapidly than with classical approaches . In the past two years, organellar proteomics has also profiled mitochondrial, chloroplast, and nucleolar proteomes, uncovered minor golgi proteins, and compared functional states of the golgi . The speed of proteomics can produce petabytes of data far faster than we can analyze them . It thereby allows a wider range of comparative analyses than has so far been possible . The roads opened by comparative proteomics will one day provide a complete map of all the cellular proteins in each organelle in each tissue at each stage of development . Through comparison of this map with datasets generated from people with particular diseases, proteomics the opening of the nuclear envelope by proteomics has already identified new inm proteins and produced a catalogue of yeast npc proteins . Schematic of the nuclear envelope . The outer nuclear membrane (onm) and inner nuclear membrane (inm)
Adipose triglyceride lipase (atgl, ec 3.1.1.3) deficiency is caused by mutations in atgl gene, also called pnpla2,, . It presents profound lipid accumulation mainly in skeletal and cardiac muscles, manifesting neutral lipid storage disease with myopathy (nlsd - m)/triglyceride deposit cardiomyovasculopathy (tgcv),,,, . Only up to 40 patients most of the reported cases were diagnosed in adulthood except for one case each in childhood and adolescence, . In adulthood, the myopathy and cardiomyopathy can be severe and rapidly progressive, and refractory to various therapies . Affected patients with atgl deficiency exclusively exhibit persistent lipid droplets in the cytoplasm of circulatory neutrophils known as jordans' anomaly (fig . 1a),,,,,,,,,, . In earlier life, clinical symptoms seem to be absent or minimal in most cases, however jordans' anomaly has been documented in subclinical or preclinical adolescents with atgl deficiency, . Blood smear examination with may - giemsa this report concerns a simple, easy and feasible laboratory test using a routine automated hematological analyzer that detects leukocyte abnormalities in patients with myopathy or cardiomyovasculopathy and possibly leads to a diagnosis of homozygous atgl deficiency . Four homozygous atgl - deficient patients (3 males and 1 female, 4560 years of age) (table 1) and nine heterozygous family members (4 males and 5 females, 1783 years), lacking atgl deficiency - associated symptoms, were enrolled . The diagnosis of atgl deficiency was based on gene analyses together with clinical manifestations of myopathy, including easy fatigability, reduced exercise capability and limb weakness, and cardiomyopathy . Forty - three healthy subjects (14 males and 29 females, 3284 years) lacking the mutations in atgl gene and having no abnormality under the physical examination were also enrolled as controls . Blood specimens were analyzed by the xe-5000 automated hematology analyzer (sysmex, kobe, japan) and investigated all the parameters including wbc / baso channel of the xe-5000 to screen for jordans' anomaly . In the wbc / baso channel, its hemolyzing reagent, stromatolyzer fb (sysmex), lyses plasma membranes of cells other than basophils in the specimen and, as a result, the cytosolic components of non - basophils are released from the cells . Lipid droplets released from atgl - deficient leukocytes which retain their shape in aqueous environment due to their own lipid monolayer membranes can be detected as smaller particles . Thus, in the wbc / baso scattergram, almost intact basophils, nucleus of non - basophil leukocytes, and relatively large cytosolic components including lipid droplets or debris are detected as particles (fig . Parameters named baso - wx and baso - wy, which stand for the spread of particle distribution in side and forward scattered light, respectively, are calculated in the wbc / baso channel . An analysis of welch's t - test was performed to compare differences in baso - wx and baso - wy values between homozygous and heterozygous or controls . Four homozygous atgl - deficient patients (3 males and 1 female, 4560 years of age) (table 1) and nine heterozygous family members (4 males and 5 females, 1783 years), lacking atgl deficiency - associated symptoms, were enrolled . The diagnosis of atgl deficiency was based on gene analyses together with clinical manifestations of myopathy, including easy fatigability, reduced exercise capability and limb weakness, and cardiomyopathy . Forty - three healthy subjects (14 males and 29 females, 3284 years) lacking the mutations in atgl gene and having no abnormality under the physical examination were also enrolled as controls . Blood specimens were analyzed by the xe-5000 automated hematology analyzer (sysmex, kobe, japan) and investigated all the parameters including wbc / baso channel of the xe-5000 to screen for jordans' anomaly . In the wbc / baso channel, its hemolyzing reagent, stromatolyzer fb (sysmex), lyses plasma membranes of cells other than basophils in the specimen and, as a result, the cytosolic components of non - basophils are released from the cells . Lipid droplets released from atgl - deficient leukocytes which retain their shape in aqueous environment due to their own lipid monolayer membranes can be detected as smaller particles . Thus, in the wbc / baso scattergram, almost intact basophils, nucleus of non - basophil leukocytes, and relatively large cytosolic components including lipid droplets or debris are detected as particles (fig . Parameters named baso - wx and baso - wy, which stand for the spread of particle distribution in side and forward scattered light, respectively, are calculated in the wbc / baso channel . An analysis of welch's t - test was performed to compare differences in baso - wx and baso - wy values between homozygous and heterozygous or controls . After confirming that all the specimens from the four atgl - deficient patients had jordans' anomaly by examining their blood smears stained with may - giemsa (fig . 1a), we investigated all the parameters of the xe-5000 automated hematology analyzer to find any change corresponding to jordans' anomaly . The wbc / baso scattergram revealed an increased number of small particles in the homozygous patients, typically shown as the blue dots in fig . The observed small particles are supposed to be the lipid droplets released from the patients' leukocytes, because lipid droplets can be expected to retain their spherical forms with neutral lipid core and phospholipid monolayer surface in this aqueous environment . The baso - wx and baso - wy values obtained from the wbc / baso channel of xe-5000 were significantly higher in the atgl - deficient patients than those in the non - affected heterozygotes and the controls (fig . 1c): 251.8 100/132.0 7.7 (baso - wx / baso - wy, mean sd) for the atgl - deficient patients, 80.2 3.8/74.8 8.2 for the heterozygous carriers, and 80.4 5.5/70.3 8.2 for the controls . We, therefore, anticipate that detection of the leucocyte abnormality in a routine automated hematological analysis may be a first step toward the diagnosis of homozygous atgl deficiency . We further suggest that detected positive subjects should undergo more detailed analyses, including atgl gene analyses, to establish the diagnosis in the clinical practice . In homozygous atgl deficiency, once the clinical presentations of myopathy and cardiomyopathy occur, it has been difficult so far to regress or resolve symptoms through any conventional treatments,,,,,,,,, . We recently provided data indicating that up - regulation of peroxisome proliferated activated receptor- and the related genes may promote triglyceride accumulation in the skeletal and cardiac muscles in atgl deficiency . We believe that the development of an easy method to detect cellular triglyceride accumulation is desired . It is quite likely that the change in the leukocyte emerges before the development of myopathy or cardiomyovasculopathy, as it does in other congenital lipid storage diseases such as gaucher's and niemann pick disease, which show distinct lipid storage in circulatory and bone marrow macrophages . In our settings, heterozygous carriers could not be differentiated from control subjects, even though jordans' anomaly has been reported in some heterozygous atgl deficiency . We speculate that one of the reasons for this may be that heterozygous leukocytes may have enough atgl enzymatic activity to reduce the number and/or size of intracellular lipid droplets, so that baso - wx and baso - wy parameters were not different between heterozygous and control subjects . It has been known that jordans' anomaly in leukocytes is present not only in atgl deficiency but also in chanarin dorfman syndrome also called nlsd with ichthyosis, which is caused by deficiency of the protein cgi-58, an activator of the atgl enzyme, . Further, in carnitine palmitoyltransferase deficiency type 1, a fatty acid beta - oxidation disorder engendering hypoglycemia and acidosis, this anomaly can sometimes be found in blood smears . It would be of interest to know whether the present system can detect leucocyte abnormalities in these disorders, even we did not have the chance to test the possibility because of the disease rarity . The sensitivity and specificity of baso - wx and baso - wy for atgl deficiency remains to be investigated, however we believe that this automatic detection of changes in leukocytes with an automated hematology analyzer may provide an earlier diagnostic clue for atgl deficiency to clinicians, who encounter patients with neuromuscular and cardiovascular disorders, whose causes are unknown . In order to increase information on the natural history and pathophysiology in nlsd / tgcv patients, we have started an international registry system on the web (http://www.tgcv.org/r/home.html). The baso - wx and baso - wy values obtained from automated hematology analyzer xe-5000 could help to detect jordans' anomaly . A notification system using an automated hematology analyzer may prompt the earlier and easier diagnosis of homozygous atgl deficiency.
Brain plasticity, the developing brain's ability to change in response to either positive experiences or negative experiences, is a critical component of pediatric neurology . The major types of plasticity in the developing brain include adaptive plasticity occurs in response to learning or recovering from injury or disability; impaired plasticity results from brain injury due to an acquired or neurogenetic disorder; maladaptive plasticity a plastic response leading to a new disorder; plasticity as the brain's achilles' heel a mechanism, such as selective vulnerability of neurons, which creates risk for injury . Basic cellular mechanisms of plasticity include overproduction of neurons followed by reduction via apoptosis; continued production of new cells from stem cells in the hippocampus and lateral ventricle throughout life; activity - dependent synaptic plasticity through receptor trafficking; activity - dependent production of growth factors; overproduction of synapses and axodendritic connections followed by pruning, activity - dependent stabilization of dendrites and axons; regulation of dna expression by epigenetic regulation . Although there are many disorders associated with impaired plasticity, this paper will highlight the clinical features, neurobiology associated with dysregulation of mtor, preclinical studies, and clinical trials in tuberous sclerosis complex (tsc), neurofibromatosis-1 (nf1), and fragile x syndrome (fxs), as well as phosphatase and tensin homolog hamartoma syndromes (pths), neurogenetic disorders linked by abnormalities in synaptic plasticity and mtor (mammalian target of rapamycin) signaling . Pubmed was searched using the following search strategies: mtor and/or neurology; mtor and/or plasticity; mtor and/or tsc; mtor and/or nf1; mtor and/or fxs; mtor and/or pths; plasticity and/or neurology; plasticity and/or tsc; plasticity and/or nf1; plasticity and/or fxs; plasticity and/or pths . Clinicaltrials.gov was searched by disorder without language or country of origin restrictions for active studies through 11/30/11 . Tuberous sclerosis complex (tsc) has an incidence of 1/6000 and may be defined clinically by the presence or absence of major and minor features associated with the disorder and genetically by spontaneous or inherited mutations in tsc1 or tsc2 . Major neurologic features include brain lesions - subependymal nodules, subependymal giant cell astrocytomas, and cortical tubers, intractable epilepsy in 6090% [46], autism in up to 61% [7, 8], intellectual disability in 45%, and self - injury in 10% . Tsc has also been associated with pulmonary, cardiac, and cutaneous lesions (table 1). Overexpression of the serine / threonine protein kinase mammalian target of rapamycin (mtor) results from disruption of either tsc1 or tsc2 . Typically, tsc1 and tsc2 form a complex, which inhibits rheb (ras homologue expressed in brain), an activator of mtor . The consequences of mtor overexpression include abnormally rapid cell growth and hyperactivation of mrna translation, which may lead to impaired synaptic plasticity in tsc (figure 1). Impaired synaptic plasticity as a consequence of a disruption in either tsc1 or tsc2 has been supported by results from preclinical studies . Abnormalities in long - term potentiation (ltp) and long - term depression (ltd) were found in the tsc2 eker rat, which carries a spontaneous germline mutation . Abnormal late - phase ltp induction and hippocampal - dependent learning deficits was observed in tsc2 adult mice and improved after rapamycin treatment . Metabotropic glutamate receptor - mediated long - term depression (mglur - ltd) was impaired in tsc2 mice and related to decreased translation of proteins required for stabilization of ltd . Prolonged neuronal hyperexcitability, typically associated with epilepsy, has also been supported by recent studies as a possible mechanism of impaired synaptic plasticity in tsc . This hyperexcitability was maintained despite the absence of cortical tubers from brain sections of an individual with tsc and tsc1 conditionalknockout mice, a neuronal model of tsc in an earlier study [18, 19]. An astrocyte - specific model of tsc, tsc1 conditional knockout mice, was also characterized by abnormally elevated glutamate . Astrocytic dysfunction in the uptake of extracellular potassium may explain the hyperexcitability in this model . Guided by preclinical observations, investigators have completed studies to reduce the burden of neurologic disease in individuals with tsc . A clinical trial of everolimus for subependymal giant cell astrocytomas (segas) achieved the primary outcome of reduction in the size of segas, supporting similar results from a case series [2224]. Everolimus is now fda - approved for reduction in the size of segas that are nonsurgically resectable . Positive outcomes from these studies have led investigators to consider rapamycin for additional neurologic conditions, such as autism . The ability of everolimus to improve cognition is currently under investigation (http://www.clinicaltrials.gov/; nct01289912). Neurofibromatosis 1 (nf1), a disease caused by an inherited mutation in nf1, has an incidence of 1 in 3500 . Nf1 can be diagnosed by identification of the genetic mutation or the presence of two or more clinical features family history of nf1; six or more cafe - au - lait spots; neurofibromas; plexiform neurofibromas; axillary or groin freckling; lisch nodules (a hamartomatous nodule of melanocytes on the iris); skeletal abnormalities such as tibial dysplasia or thinning of the shin bone; or optic glioma . Associated conditions include cognitive impairments, pilocytic astrocytomas, and neuropathological abnormalities characterized by mri hyperintensities, megalencephaly, and thalamic lesions . Cognitive impairment is the most common source of neurological impairment in children with nf1, affecting as many as 81% of children . Megalencephaly associated primarily with increased white matter volume was identified in individuals with nf1-associated adhd . Abnormalities in gray matter volume and enlargement of the corpus callosum have also been associated with cognitive impairment . Nf1 has also been characterized by the presence of mri t2-hyperintensities (nonenhancing bright areas of unknown etiology), sometimes referred to as ubos (unidentified bright objects). An early study employing sibling comparison found distribution of these lesions to be predictive of lower iq . Subsequent studies have also supported the role of these lesions in cognition [31, 32]. A longitudinal profile revealed changes in these lesions with childhood regression followed by recurrence in early adolescence . Disinhibited ras mapk signaling underlies the molecular basis of disease, and mtor hyperactivity has also been identified in preclinical models . Nf1 encodes neurofibromin, a gtp - ase activating protein, which normally leads to inactivation of ras . Mutations in neurofibromin lead to overactivation of ras activity, followed by enhanced activation of the ras - mapk signaling pathway as well as pi3k and erk 1/2 which both inactivate the tsc1/tsc2 complex releasing inhibition of rheb and allowing activation of mtor . However, there may be pathways leading to dysregulation of mtor in nf1 that differ from other conditions . Mtor hyperactivity in nf1 leads to increased astrocyte proliferation, an effect not shared by preclinical models of pten, tsc1, tsc2, or overexpression of rheb . Phospho - histone - h3 rather than phosphor - s6 or ki67 correlated with response to rapamycin in nf1 mice . Long - term potentiation was impaired by increased hippocampal inhibitory transmission in mice heterozygous for a germline mutation in nf1 (nf1). However, restoration of ltp deficits and reversal of cognitive impairments was achieved with pharmacological inhibition of ras using lovastatin, an hmg coa reductase inhibitor and bms 191563, a farnesyltransferase inhibitor . Farnesyltransferase inhibitors demonstrated inhibition of rheb and subsequent inhibition of mtor in tsc1 and tsc2 mouse embryonic fibroblasts . Inhibition of erk also led to restoration of early - phase and long - term ltp . Simvastatin in children with nf1 improved object assembly, a secondary outcome in a randomized trial, but there was no difference in primary outcome . Preliminary results of a subsequent of lovastatin in children with nf1 revealed improvement in verbal and nonverbal memory . Fragile x syndrome (fxs) is the leading cause of inherited intellectual disability and has a full mutation gene frequency of 1 in 2500 [45, 46]. Associated neurologic conditions include autism, anxiety, and adhd [47, 48]. Definitive diagnosis relies on genetic confirmation and individuals may be classified as full mutation if there are greater than 200 cgg repeats within the promoter of the fragile x mental retardation-1 gene (fmr1) and premutation if there are 50 to 230 repeats . These abnormal cgg repeats result in suppression of fmr1 gene transcription and subsequently reduced to absent fragile x mental retardation protein (fmrp) [50, 51]. Loss of fmrp releases inhibition of pike, which activates pi3k and leads to increased mtor activity . Proposes that elevation of group i mglurs (mglur1 and mglur5) glutamate receptors leading to reduced insertion of ampa receptors into the postsynaptic membrane is one of the central mechanisms of impaired synaptic plasticity in fxs, and this has been supported in experimental models . Increased mglur5 activity and reduced insertion of ampa receptors leads to long - term depression (ltd) due to reduced ampa - mediated synaptic activity . Using preclinical models, specific interactions among synaptic proteins and fmrp have been identified . Initially, abnormal synaptic translation of camkiia, psd-95, and glur1/2 mrnas was observed in the fmr1 knockout mouse . Subsequent studies revealed regulation of expression of psd-95 by fmrp, mir125a, and mglur . Phosphorylation of fmrp induces the creation of an ago2-mir125a complex, which inhibits psd-95 mrna . Mglur stimulation, however, causes dephosphorylation of fmrp, which leads to activation of translation of psd-95 . In fmr1 ko mice, in addition to hyperactivity of group 1 mglur and mglur - ltd, abnormally increased signaling of mtor in hippocampus was discovered in fmr1 ko mice, providing a link between mglur elevation and abnormalities in synaptic plasticity leading to cognitive impairment . Loss of fmrp releases inhibition of pike, which activates pi3k and leads to increased mtor activity as measured by four methods . Abnormally increased mtor leads to an abnormal increase in cap - dependent translation of synaptic proteins and subsequent abnormalities in synaptic plasticity . Increased pten activity, mediated by dephosphorylation, was discovered in fmr1 ko mice and may serve as a feedback inhibition to compensate for abnormally increased pi3k since pten dephosphorylates pi3k, which reduces phosphorylation and activation of akt . In a drosophila model of fxs, treatment with mglur antagonists during development resulted in reversal of neuropathology, abnormal courtship behavior, and impaired memory . Partial reversal of impaired memory and abnormal courtship behavior without change in neuropathology was seen in treated adults . Reduction in genetic function of mglur5, achieved by crossing fmr1 mutant mice with heterozygous mglur5 mutant mice, rescued many of the core phenotypic features in the fmr1 ko mouse . Treatment of fmr1 ko mice with either an mglur1 antagonist (jnj) or an mglur5 antagonist (mpep) led to similar, but slightly different neurologic and behavioral improvements . Marble burying, a measure of repetitive behavior, was reduced without reduction in activity in fmr1 ko and wt mice . Prepulse inhibition, a measure of sensorimotor gating, known to be abnormally increased in fmr1 ko mice was not affected by jnj or mpep . Abnormalities in prepulse inhibition were linked to abnormalities in presynaptic short - term plasticity in mice models of schizophrenia . Prolonged up states, a marker of cortical hyperexcitability in fmr1 ko mice was found to be due to a non - translation - related function of mglur5, and treatment with mpep reversed this phenomenon . In addition to long - term postsynaptic plasticity, abnormalities in short - term presynaptic plasticity were also identified in fmr1 ko mice and may also contribute to cognitive impairment . Another approach utilized gabaa receptor agonist in fmr1 ko mice, resulting in restoration of amygdala - based deficits in neuronal excitability, reduced prepulse inhibition, and alleviation of hyperactivity . The behavioral effects of genetic reduction of mglur1 and mglur5 by 50% were observed in fmr1 ko mice . Reduction in mglur1 led to decreased activity, whereas reduction in mglur5 led to decreased active social behavior and decreased thermal sensitivity . Neither genetic reduction resulted in changes in memory, motor responses, sensorimotor gating, audiogenic seizures, and responses related to anxiety and perseveration . Human studies have led to the identification of the behavioral / cognitive profile of fragile x as well an endophenotype of autism in fragile x distinguished by social withdrawal [6365]. Comparison of patients with fxs with and without autism supported the previously identified endophenotype of social withdrawal in fxs - associated autism by the finding of decrease in the left temporal gyrification index, an indicator of cortico - cortical connectivity and organization . Recent significant scientific discoveries have culminated in human clinical trials targeting different aspects of the neurobiological impairments in fxs . Afq056, an mglur5 antagonist, resulted in different responses dependent upon the methylation status of fmr1 . Patients with full methylation of fmr1 and no detectable fmr1 mrna in the blood responded positively to treatment with improvement in inappropriate speech, stereotypic behavior, and hyperactivity . Additional trials focused on antagonizing mglur5 include a trial of fenobam, which reduced anxiety, hyperarousal, improved accuracy in continuous performance tasks, and prepulse inhibition of startle; acamprosate, which in three young adult patients, resulted in improvement in communication and global clinical improvement (cgi - i). Results are pending from an open label phase i study of stx107 (seaside therapeutics) and a phase ii trial of ro4917523 (hoffman - laroche) (clinicaltrials.gov). Other mechanisms that may lead to repair of the impaired plasticity associated with fxs have also been examined . Phospholipase c and glycogen synthase kinase-3, linked to gp1 mglur signaling, have been targeted using lithium, which resulted in improvement in cognition and adaptive skills . Ampalex (cx516) is an ampakine (binds ampa receptors) that increases hippocampal ltp by slowing receptor deactivation [71, 72]. Evaluation of ampalex in a placebo - controlled phase ii trial for fragile x - associated autism did not reveal differences in the primary outcome of memory or any of the secondary outcomes: overall functioning, attention / executive functioning, language, or behavior . Minocycline, a broad spectrum antibiotic and analogue of tetracycline, has been found to have neuronal effects . In c57bl/6j mice, minocycline increased phosphorylation of glur1 and subsequent insertion of ampa receptors in vivo and vitro . Study of minocycline in fmr1 ko mice revealed behavioral improvement: reduction in anxiety and improved exploration as well as neuropathological improvement dendritic spine maturation associated with inhibition of abnormally elevated matrix metalloproteinase-9 (mmp-9) in hippocampal neurons . The observations in fmr1 ko mice were supported in a drosophila model of fxs where treatment with minocycline or genetic elimination of mmp1 reverses synaptic structural abnormalities . Open - label treatment with minocycline in individuals with fxs led to significant improvement in irritability . Cholinergic deficits in fxs, confirmed in individuals by h magnetic resonance spectroscopy, were targeted using donepezil in an open label study with noted improvement in continuous naming, attention difficulties, and total abc score as well as irritability and hyperactivity . Reduction in glutamate using riluzole in an open - label study corrected abnormal activation of erk; however, improvement in the primary outcome - repetitive, compulsive behavior was not achieved . A single - dose, placebo - controlled trial of oxytocin for social anxiety in fxs resulted in improvement in eye gaze towards the examiner in a social challenge . Aripiprazole, an atypical antipsychotic that is a partial d2 and 5-ht1a agonist as well as a 5-ht2a antagonist, improved scores on cgi - i and abc - irritability . A phase ii, randomized double - blind study of arbaclofen has been completed with results pending, and a phase iii study of arbaclofen is now recruiting (http://www.clinicaltrials.gov/). Phosphatase and tensin homologue deleted on chromosome 10 (pten) is a phosphatase which limits cell growth by apoptosis and cell cycle arrest . Conditions linked by a genetic mutation in pten have been collectively termed phosphatase and tensin homologue hamartoma syndromes (pths) and include juvenile polyposis, lhermitte - duclos disease, bannayan - riley - ruvalcaba, cowden syndrome, proteus - syndrome, and proteus - like conditions . Cowden syndrome and bannayan - riley - ruvalcaba have been associated with autism and intellectual disability . Cowden syndrome has an estimated prevalence of 1/200,000 and may be diagnosed by the presence of either pathognomonic criteria or a specific combination of major and minor criteria . Severe and progressive macrocephaly (> 2 s.d .) Associated with autism should prompt consideration of the diagnosis and led to publication of the first reported case of cowden syndrome - associated autism and epilepsy . A similar pattern with the addition of a lipoma and thyroid adenoma led to the identification of bannayan - riley - ruvalcaba syndrome (brrs) in a nine - year - old girl . A retrospective review of 114 patients analyzed for pten mutations revealed mutations in 18% of those with macrocephaly in addition to either asd or i d . This contrasts with a pten mutation in one of eighty - eight children (1%) with macrocephaly and asd . Brrs does not have established diagnostic criteria; however, macrocephaly is usually the most striking feature . Identification of cowden and bannayan - riley - ruvalcaba syndrome in the same family raises the possibility of the two syndromes being the same syndrome with variation in phenotypic expression . Functional analysis of the consequence of pten germline mutations from individuals with autism spectrum disorders was compared to pten germline mutations in individuals with pths in a humanized yeast - based bioassay and revealed greater preservation of pten pip3 phosphatase activity in those with asd . Pten is important in mtor signaling since it removes a phosphate from phosphatidylinositol 3,4,5-triphosphate (pip3). This conversion from pip3 to pip2 negates the activity of pi3k and results in elevation of mtor since the processes downstream akt activation, akt - mediated phosphorylation and inhibition of tsc2, release inhibition of rheb which activates mtor . Evidence of impaired synaptic plasticity in pten mutations has been identified in pten conditional knockout mice . Neuropathological features include enlarged neuronal nuclei and cell bodies, increased density of dendritic spines, abnormalities in axonal myelination, and weakening of excitatory synaptic transmission in hippocampal neurons between ca3 and ca1 as evidenced by impaired epsps, normal presynaptic function, and reduced long - term potentiation . Cre - driven deletion of pten in cortical and hippocampal neurons of mice was associated with hyperactivity of the mtor pathway as well as hypersensitivity to stimuli, social interaction abnormalities, ectopic dendrites, increased axonal synapses, and macrocephaly associated with neuronal hypertrophy . A pilot study is now recruiting for an open label trial of sirolimus, an mtor inhibitor, in adult patients with cowden syndrome, tumors, and germline pten mutations (http://www.clinicaltrials.gov/). Synaptic translation mediated by eif4e is a common and final process of the pathways associated with pten, mtor, and fmrp and serves a critical role in learning and memory [91, 92]. Linkage to chromosome 4q, the region containing eif4e has been shown in genome - wide linkage studies [93, 94]. After identification of a translocation involving the region containing eif4e in a young boy with autistic regression, investigators screened for mutations among families with two autistic siblings and found eif4e mutations in two related families . Review of recent literature reveals significant advances in our ability to understand the pathogenesis of several neurogenetic conditions associated with intellectual disability and autism that have been considered to be idiopathic and untreatable . In this paper, we have highlighted recent discoveries in neurogenetic conditions united primarily by dysregulation of mtor and evidence of impaired synaptic plasticity (table 2). In addition to autism and intellectual disability, some of these conditions also share an association with cutaneous lesions and tumor development . Based on this knowledge, it is reasonable to hope that these disorders could become treatable in the near future . Investigators have already begun the process of connected research, as exemplified by the work of auerbach et al . Who simultaneously examined models of tsc and fxs and created a model by crossing the two models to discover that the same intervention, modulating metabotropic glutamate receptor 5, demonstrates efficacy for both models in opposing directions . Continuing to examine the link between these disorders is likely to lead to a greater chance of discovery for all of them . Tools needed to translate basic science research into clinical trials which yield definitive results include refined genotypic and phenotypic characterization, detailed knowledge of the natural history of the conditions, knowledge of optimal therapeutic windows, valid biomarkers, and expertise in clinical trials.
Hiv / aids is spreading rapidly in the society and the major cause is attributed to commercial sex workers sexual behaviour . Higher risk of hiv transmission is determined by frequent partner change or higher number of partners; lack of, low level, or inconsistent condom use; unprotected anal intercourse; and presence of certain types of stis, especially genital ulcerative disease, as cofactors . Hiv prevalence among sex workers in 2007 was over 30%, and in some cities like kano and abuja, 50% of all brothel - based sex workers are hiv - infected . Thus, while hiv prevalence among the general population in nigeria has been declining from its peak of 5.8% in 2001 to 4.1% in 2011 prevalence among brothel - based sex workers has shown no sign of declining . In a recent survey among most - at - risk populations in six states in nigeria, over half of sex workers did not consider themselves at risk of hiv infection . In lagos state, with the highest concentration of sex workers in nigeria, only 16% of brothel - based sex workers felt they were at risk, even though each has on average 34 clients per week . Despite their high - risk sexual activity, many sex workers perceive their risk of hiv infection to be low . As in most regions globally, many african individuals support themselves and their dependants through sex work, primarily women . Between 1% and 4% of women in several west african capital cities are estimated to be sex workers, with even higher proportions in areas were transport and employment networks increase the demand for paid sex [8, 9]. Estimated 37% of sub - saharan female sex workers (fsws) live with hiv . The risks of hiv transmission experienced by sex workers who inject drugs are related to their individual exposure to factors such as unprotected sex with multiple partners or sharing injecting equipment while injecting drugs . There is evidence from many countries that sex work rates are much higher among female than among male injecting drug users and that female injectors are more likely to have less control over sharing of injecting equipment in a group injection or even with a sexual partner and are more likely to inject after male injecting drug users, thereby increasing their risk for acquiring hiv . The hiv prevalence decreased from 4.3% in 2001 to 1.2% in 2003 and again increased to 2.0% in 2005 and decreased to 1.2% in 2008 [12, 13]. Factors driving the epidemic in osun state include poverty, multiple sex partners, marital infidelity, high unprotected sexual activities among youths, ignorance, low risk assessment, negative cultural activities such as female circumcision, and migration of people from the high prevalence states that share borders with osun . The sexual behaviour of sex workers according to has been identified as the likely central problem of the transmission of hiv / aids because the business may expose them to the danger of contracting hiv infections if they are ignorant of the use of condom as a protective measure against hiv virus as they engage in sex with multisexual partners in respect of their hiv / aids status . This study therefore investigates sexual practices of female sex workers who inject drugs in osogbo, nigeria . The scope of the study was delimited to sexual behaviour, drug use, awareness of hiv magnitude, and hiv counseling and testing (hct), condom use, and sexually transmitted infection (sti) challenges among fsws . Osogbo lies on the railway line from lagos to kano and is the trade centre for a farming region . Osogbo is the venue of the annual osun - osogbo festival along the river osun . The festival is centered around the sacred grove of the river goddess sun, which is a unesco world heritage site . The population of the state according to the 2006 national population census figures is 3,423,535, including 1,740,619 (50.8%) men and 1,682,916 (49.2%) women . Osun state consists chiefly of the yoruba people, but with variations in dialects; approximately half of the residents are muslim, with several mosques in major towns such as iwo, ede, osogbo, ikire, and ejigbo . The study population was brothel - based fsws who inject drugs in osogbo, osun state, nigeria . Snowball technique was used in selecting a total of 27 fsws who inject drugs from 11 brothels (urban = 6 brothels; semiurban = 5 brothels) in osogbo . This implies that the participants were selected because they are sex workers and also injecting drug users . In - depth interview guide and semistructured questionnaire were developed by the researchers based on the literature reviewed together with input from health promotion specialists at the university of ibadan, nigeria . The questionnaire was used to document female sex workers sociodemographic characteristics and sexual behaviour, while in - depth interview questions focused on drug use, awareness of hiv magnitude and hiv counseling and testing (hct), condom use, and sti challenges . Two of the researchers moderated all the interviews, while note - taking was done by other research members to complement the audio recording by the moderator . Questionnaire was self - administered before the interview and idis were conducted in a quiet space within their brothels . Each interview lasted about 3045 minutesand the discussions were audiotaped with the consent of the participants . The study instruments were reviewed by health promotion experts at the faculty of public health, university of ibadan, and were also pretested among fsws who are also injecting drug users in ibadan which has the same characteristics with the study area to determine how effective the developed instrument would be in collecting appropriate data relevant to the research objectives . A total of four idis and questionnaire each were conducted during the pretest and they were revised based on the issues identified by the team . The quantitative data collected was collated, screened, and entered into computer . The statistical package for social science (spss) the analysis was done by reading through the transcribed interviews and listening to the audio records in order to get all major discussions during the interviews and the data were manually analyzed using content analysis technique . Approval for the study was sought from the osun state ministry of health . Written consent of all the participants was obtained before the interview by giving them informed consent form to fill according to their ability to read and write after explaining the objectives of the study to them . Participation in the study was voluntary and there was no criticism of participants who refused to participate or wish to withdraw from the study . No identifier like participants' name or address was recorded so as to keep the information given by each participant confidential . The age of respondents ranged from 21 to 38 with mean age of 26.2 7.5 . Many (63.0%) of the respondents were single, the respondents have been in the business for an average of 5.3 years (table 1). The age of respondents at first intercourse ranged from 13 to 19 with mean age of 15.7 3.2 . More than half of the respondents (55.6%) reported boyfriend, as first sexual partner, and employer (18.5%) (figure 1). Reasons adduced by respondents for first sexual intercourse included pressure by partner (29.6%) and financial reason (25.9%) (figure 2). All (100.0%) the respondents' reported not using a condom at their first intercourse and their reasons included that they did not have one at hand (55.6%) (figure 3). Majority of the respondents reported having a daily average of 4 clients and usually spending at least 30 minutes with the client . The majority (88.9%) of the respondents were current family planning users, and intrauterine device (iud) (54.2%) was a major method used by the respondents . All (100.0%) the respondents had ever aborted pregnancy more than once and 66.7% reported using contraceptive when pregnancy happened . Less than a third (25.9%) of the respondents had ever experienced abortion complications and these were severe bleeding (71.4%) and internal infection of the abdomen (28.6%) (table 2). Majority of the respondents were aware of the magnitude of hiv in nigeria and also considered hiv as a serious health problem amongst sex workers . A respondent in urban brothel specially saidi consider myself at risk of sexually transmitted diseases including hiv / aids because most times i don't protect myself when having sex because am not always mentally stable because of the drugs i use . Even most times i fight with my clients when i see them because most of them don't pay me because they know am not normal again because of the drugs have injected, so they use the advantage to get a free sex from me and this is always unprotected sex . I consider myself at risk of sexually transmitted diseases including hiv / aids because most times i don't protect myself when having sex because am not always mentally stable because of the drugs i use . Even most times i fight with my clients when i see them because most of them don't pay me because they know am not normal again because of the drugs have injected, so they use the advantage to get a free sex from me and this is always unprotected sex . Few of the respondents were also of the opinion that other women who are not sex workers are also at risk of hiv as sex workers . A respondent in semi - urban brothel saidi am at risk of hiv as other women who are not into this business because their husbands come here to do business with us, so if we are infected with hiv then we are going to transfer this to their husband and their husband will also transfer to them at home . I am at risk of hiv as other women who are not into this business because their husbands come here to do business with us, so if we are infected with hiv then we are going to transfer this to their husband and their husband will also transfer to them at home . Another respondent in urban brothel saidi think we are not even at risk of hiv compared with other women who are not sex workers because i can say no to sex if my client refuse to use condom but married women cannot say that to their husband and their husbands are our clients who can easily infect them when infected with this disease from us . I think we are not even at risk of hiv compared with other women who are not sex workers because i can say no to sex if my client refuse to use condom but married women cannot say that to their husband and their husbands are our clients who can easily infect them when infected with this disease from us . On the issue of hiv counseling and testing, some of the respondents reported that they had ever tested for hiv and only one of these respondents disclosed to be hiv positive . Respondents who had never taken hiv test were also asked for their reasons and their reasons were fear of rejection and discrimination by the community and even among other sex workers if the test is positive . Other reasons were inadequate understanding of the importance of hct, fear of high blood pressure, and depression and shock if tested positive . Many of the respondents reported use of condom, regular talking of herbs, and good personal hygiene as ways of protecting themselves from hiv . A respondent in urban brothel saidi have been tested twice this year and the results showed that am negative . I have been tested twice this year and the results showed that am negative . Another respondent in urban brothel saidi have never been tested because am scared of discrimination even from my colleagues . I have never been tested because am scared of discrimination even from my colleagues . Another respondent in semiurban brothel saidi have not been tested in the last 3 years and i engage in unprotected sex intercourse with many of my clients . Personally, i don't think i need to be tested because if am tested positive i will die of hypertension so i think is better i don't do the test now . I have not been tested in the last 3 years and i engage in unprotected sex intercourse with many of my clients . Personally, i don't think i need to be tested because if am tested positive i will die of hypertension so i think is better i don't do the test now . Cocaine, marijuana, tobacco, and alcohol were reported as the drugs mostly used by the respondents . Few of the respondents reported that they were involved in sex work as a means of financing their drug use, while majority reported that they were into sex work before becoming drug users with a major reason to escape from intense burden of their work . Other reasons were to become bold, to be confident to negotiate with clients, and to be strong in bed for clients to enjoy their money . A respondent in urban brothel saidi inject cocaine at least twice a week to enable me to be strong and mentally stable . Am actually doing this sex work to raise money to finance the drug am taking . I inject cocaine at least twice a week to enable me to be strong and mentally stable . Am actually doing this sex work to raise money to finance the drug am taking . Another respondent in semiurban brothel saidi inject drugs many times to enable me to be very strong in bed so that my clients can enjoy me . I inject drugs many times to enable me to be very strong in bed so that my clients can enjoy me . All the respondents reported not using a condom at their first intercourse but all had ever used a condom . Less than a third reported using a condom with their last client and more than half reported that ninety percent of their regular clients do not like using a condom . Nearly all the respondents were willing to have clients not to wear a condom in exchange for accepting more money in return, and the majority of them were aware that using a condom could help prevent hiv transmission . Major reason adduced by respondents for inconsistent condom use was mental imbalance effects from drug use . Other reasons were as follows: clients objected to use it, it reduces sexual pleasure, and they did not have one at hand . A respondent from urban brothel who disclosed to be hiv positive reported to be inconsistent with condom usage with reason that most of her clients always rejected using a condom and even offer more money for this . The respondent specifically saidi always try my best to enforce my clients to use condom but majority of them always reject this with reason that condom reduce sexual pleasure and i can't tell them i am hiv positive because of my previous experience . I always try my best to enforce my clients to use condom but majority of them always reject this with reason that condom reduce sexual pleasure and i can't tell them i am hiv positive because of my previous experience . The respondent narrated her previous experience as thusi came from x state to this state to continue this sex work because when i tested positive to hiv, i disclosed this to my friends whom we are doing this business together and within a week the information has spread rapidly to everybody and they started discriminating against me . I suffered a lot during this period as i was not getting any client and life became miserable for me and that was why i travelled down to this state so that i can continue this business as i have nothing else to survive with . Am telling you this because you may assist me with treatment and because you have assured me of my confidentiality and if you don't keep your promise and disclose my status to other sex workers then i will leave this state for another state . I came from x state to this state to continue this sex work because when i tested positive to hiv, i disclosed this to my friends whom we are doing this business together and within a week the information has spread rapidly to everybody and they started discriminating against me . I suffered a lot during this period as i was not getting any client and life became miserable for me and that was why i travelled down to this state so that i can continue this business as i have nothing else to survive with . Am telling you this because you may assist me with treatment and because you have assured me of my confidentiality and if you don't keep your promise and disclose my status to other sex workers then i will leave this state for another state . The respondent further added thati am actually not seeing any sign on my body to show that i am hiv positive only that i easily get tired and that is one of the reasons for my taking drugs and that has been assisting me a lot . I am actually not seeing any sign on my body to show that i am hiv positive only that i easily get tired and that is one of the reasons for my taking drugs and that has been assisting me a lot . Questions on sexually transmitted infections (stis) were also discussed with the respondents and more than half of the respondents had ever been treated for sti more than once . Reported stis among respondents were gonorrhea, syphilis, trichomoniasis, and chlamydia infections . Reported signs and symptoms experienced by respondents were pain during sexual act, pus like discharges from vagina, an itch in the vagina region, and pain during urination . A respondent in urban brothel saidi suffered from gonorrhea last year and it was since then have made up my mind not to allow any client to have sex with me without using condom . I suffered from gonorrhea last year and it was since then have made up my mind not to allow any client to have sex with me without using condom . Another respondent in semiurban brothel saidhave been infected with gonorrhea and syphilis in this work and i think it was because of my lack of knowledge of these diseases . Many times when we attend health talk as sex workers it is always hiv / aids education so many of us don't really know about other diseases . Have been infected with gonorrhea and syphilis in this work and many times when we attend health talk as sex workers it is always hiv / aids education so many of us don't really know about other diseases . Another respondent in semiurban brothel saidi was told last 2 years that i was infected with chlamydia infection when i went for medical check - up due to itches in the vagina region which i do experience then and this was treated for me and i was counseled to always use condom with my client when i disclosed to the matron that am a sex worker . I was told last 2 years that i was infected with chlamydia infection when i went for medical check - up due to itches in the vagina region which i do experience then and this was treated for me and i was counseled to always use condom with my client when i disclosed to the matron that am a sex worker . This is similar to the findings of which also revealed that interviewed fsws have been in the business for an average of 4.1 years . Majority of the respondents reported having a daily average of 4 clients . In the russian city of st . Petersburg, female injecting drug users who exchange sex for money had a mean of 49.5 sexual partners in the previous 30 days . This is in accord with the findings of who reported that, in the netherlands, a large proportion of sex workers, mainly from latin america and eastern europe, do not use contraceptives other than condoms and some have undergone two or three abortions . This is in accord with the findings of where all the respondents reported sharing needles and injecting equipment . The riskiest activity for hiv infection during injection is frequent sharing of injecting equipment with strangers . The highest infection risk lies in the sharing of needles and syringes, where blood is most likely to collect during injection, especially when jacking back (injecting into a vein, drawing blood into the syringe, and reinjecting the blood - and - drug mixture). Even if no blood is visible in either the needle or syringe, hiv may remain trapped in microscopic blood particles . A syringe is a particularly viable atmosphere for hiv within blood, and a contaminated syringe may remain capable of infecting others for up to six weeks . Cocaine, marijuana, and heroin were reported as the drugs mostly used by the respondents and also it is also reported that about one third of the idus reported having injected cocaine, heroin, or speedball (heroin and cocaine). All the respondents reported not using a condom at their first intercourse, but all had ever used a condom . Less than a third reported using a condom with their last client and more than half reported that ninety percent of their regular clients do not like using a condom . Lower levels of condom use have also been shown among those injecting drugs and selling or buying sex in other countries . For example, only 10 percent of injecting drug users from three cities in indonesia, many of whom had multiple - sex worker and other partners, reported using condom . Among crack using sex workers in southern brazil, condom use was reported to be lower with clients who paid more, looked clean, and were regulars . Among injecting drug user cohorts in vancouver, canada, and in several cities of usa condom use with all types of sexual partners (clients and casual and primary partners) is rare or low among those exchanging sex for drugs or money [23, 24]. More than half of the respondents had ever been treated for sti more than once . This is in accord with the findings of where more than half of the respondents indicated having sexually transmitted diseases once or more . Valdez et al . Also reported that 37 percent of respondents reported some history of infection with a sexually transmitted disease since entering sex work . High levels of stis such as syphilis, gonorrhea, chlamydia, and herpes among sex workers have pointed to the urgent need to provide sti prevention and treatment services for this population . Respondents have a relatively high number of sexual partners, but this in itself does not necessarily increase their likelihood of becoming infected with hiv; if they use condoms consistently and correctly, then they will probably be protected no matter how many people they have sex with . Some of the respondents reported becoming pregnant even while using family planning and this calls for further investigation to determine the antecedent factors behind this failure . Involving sex workers directly in hiv prevention campaigns can raise their self - esteem and empower them, thereby encouraging them to look after their health and to access services that could help them . Evidence suggests that sex workers who use / inject drugs face increased risk of sexual hiv transmission because they often have a higher number of clients or sexual partners who are more willing to engage in unprotected sex and have sexual partners who also inject drugs.
Health care workers (hcws) are at the front line for acquiring blood - borne viruses (hepatitis b virus, hbv; hepatitis c virus, hcv and human immunodeficiency virus, hiv) infections . The worldwide hbv infection rate is higher in dentists than other blood borne viruses like hcv and hiv . Hbsag prevalence among dentists reported to be 0.6% in the usa (1), 2.4% in malaysia (2) and 13% in korea (3). Likewise, among health care workers, dentists experience the highest chance of hbv infection and hbv incidences increase with duration of clinical experience of dentistry (4, 5). On the other hand, past (anti - hbc positivity) or present (hbsag positivity) hbv infection rate in dentists are usually higher than the general population, regardless of hbv endemicity in those area (6). Among blood - borne viruses, despite being effective in decreasing the hbv prevalence, the extended program on immunization (epi) only targeted newborns and adults in general populations, as well as high - risk groups, including dentists . However, dental health care workers are not fully covered by hbv immunization programs . Estimated of a 100-fold reduction in the incidence of hbv infection in vaccinated individuals compared to non - vaccinated individuals, regardless of the vaccine response (7), indicates that dental care workers should be advised to receive hepatitis b vaccine and it should be confirmed if they have acquired immunity to hbv by testing the level of anti - hbs (1, 4, 5, 8 - 10). Reports from different countries indicated that hbv vaccine coverage rate in dental health care workers ranged between 26% and 96.6% (8, 9). In iran, this coverage rate ranged between 74.8% and 94.9%; on average 70% of dentists care workers received at least one dose of hbv vaccine (11). As it shown, the reported response to hbv vaccine has not been reached 100% among dentists . Response to hbv vaccine (i.e. Anti - hbs levels> 10 iu / ml) between iranian dental workers has been studied extensively and 89.2% to 94.4% of dentists showed reasonable levels of anti - hbs following one to three doses of hbv vaccine (11 - 14). In the largest iranian survey, of 598 participants, 35 (5.9%) were nonimmune (anti - hbs <10 iu / l), 101 (16.9%) were relatively immune (anti- hbs> 1099 iu / l) and 462 (77.3%) were completely immune (anti - hbs> 100 the objectives of the present study were to assess the hbv vaccine coverage and investigate the responsiveness to hbv vaccine as well as socio - demographic data, health - related and occupational factors and other correlates of vaccine responsiveness in iranian dentists and dental staff . This was a cross - sectional survey of dentists attending the 51st annual international congress of iranian dental association held on 10 to 13 may 2011 . Individuals who met our inclusion criteria and willingness to give blood samples and knowing their vaccination history were recruited . An informed consent was obtained from all enrolled participants and a questionnaire was distributed to collect data . At a special booth in the conference building, potential participants gave oral consent and completed the questionnaire . The items on the questionnaire included: demographic information, such as age, gender and marital status; occupational information, comprising years of dental practice and place of practice and vaccination data, which included the number of doses, time interval between doses, last dose date and checking the titer of antibody after vaccination . Among 1665 participants, history of immunization was extracted for 1612 individuals; hence 53 cases were excluded from the study . The samples were tested for antibodies against hepatitis b (anti - hbs) and anti - hbc using commercially available enzyme linked immunosorbent assays (elisa) (m.b.s s.r.l . Anti - hbs were measured in iu / ml, and the results were classified into two groups as follows: 1) titers below 10 iu / l as no immunity and 2) titers above 10 iu/ ml as complete immunity . Data was analyzed using the statistical package for social sciences (ibm corp . Released 2011 . Ibm spss statistics for windows, version 20.0, armonk, ny: ibm corp). All statistical comparisons were performed by simple and multiple linear regression analyses on logarithm (base 10) of the anti - hbs antibody values . 1612 participants including 1300 (80.7%) general practitioner, 155 (9.6%) students, 120 (7.4%) specialists and 37 (2.3%) clinical dental assistants were studied (table 1). The subjects comprised 1058 (65.6%) males and 554 (34.4%) females with a mean age of 40.4 years (range 19 - 75 years, results not shown). The number of years in practice ranged from 0 to 55 years (excluding students) with a median of 15 years (results not shown). The demographic characteristics of the study sample according to job classifications are shown in table 1 . (%). Of total 1538 vaccinated individuals, 176 (11.5%) were nonimmune (anti - hbs <10 iu / ml) and 1362 (88.5%) were immune (anti - hbs> 10 iu/ ml) regardless of the number of doses and time after the last dose and time intervals between doses . No significant associations were found between the levels of anti - hbs and the kind of dental job (table 2). According to subjects reports, 55 (3.7%), 126 (8.4%) and 1309 (87.9%) had received one, two and full three doses of vaccine, respectively (see table 1 for more details). Fifty - eight (3.59%) of participants did not receive any hbv vaccine at all; however, they had positive results for anti - hbs, indicating a past hbv infection . However, anti - hbs mean value was 12.96 (95% ci: 5.72 - 29.39) for those who did not receive hbv vaccine . Nevertheless, the mean anti - hbs titers were 24.89 (95% ci: 11.16 - 55.52), 100.32 (95% ci: 70.52 - 142.72) and 107.04 (95% ci: 96.82 - 118.33) for subjects who received one, two and three doses of vaccine, respectively (p values between 1 and 2; 2 and 3 doses: 0.006, and 0.98, respectively, results not shown). Therefore, no significant difference was found between antibody levels and receiving second or third doses of vaccine; whereas, this association was significant between individuals who received only one versus those who received the second dose . Among total participants, 1033 who knew their exact time of vaccination history, 542 (52.5%) mentioned that they received vaccination within the past five years, while others (491; 47.5%) reported having received the last dose of vaccine more than five years prior this study . 356/542 (65.7%) of dentists who had received their third dose of vaccination less than five years before the study were completely immune (anti - hbs> 100 iu / ml); this rate was significantly higher than individuals who had completed all three recommended doses in a period more than 5 years prior to the study 279/491 (56.8%) (p = 0.003) (table 1). A significant relation was found between gender and anti - hbs antibody titer; females showed a higher level of anti - hbs (p = 0.022), (table 1). Accordingly, the median of antibody titer was significantly higher in the age group <45 years compared to the age group> 45 years (p <0.001). Furthermore, statistically significant associations were found between the median titer of anti - hbs following vaccination and duration of dental practice engagement (p <0.001) (table 1). Eighty - one (5%) of participants had positive results for anti - hbc, of whom 66 (81.4%) had a history of vaccination (results not shown); 55 (83.3%) had protective levels of anti - hbs (10 iu / ml) and 11 (16.7%) had inadequate anti - hbs levels (<10 iu / ml). Although 13 (16.5%) of anti - hbc positive dentists did not receive vaccine, seven had protective levels of anti - hbs and six had inadequate levels, indicating a possible past hbv infection . Data are presented as mean se . To determine possible risk factors and anti - hbs levels, no significant associations were found between levels of antibody titers and number of needle stick as well as other risk factors such as trauma, suspicious sexual contact and a history of liver disease (table 2). However, a significant negative association was found between the history of transfusion and low levels of anti - hbs (p = 0.016) (table 2). Of 1385 cases with known cigarette smoking history, there were 211 (15.2%) dentists who were smokers . The median of years for smoking was 14 and the median of pack - years of smoking was 3.75 (results not shown). However, there was no significant association between antibody titer and history, duration and pack - years of smoking (p = 0.1, 0.38 and 0.37, respectively). Among participants, anti - hbs levels were not different according to consistent use of gloves (p = 0.322; table 2). On the other hand, anti - hbs levels for those who regularly used mask, glasses and shield were higher than those who used them irregularly or not at all, although they were not significant statistically (p = 0.093, 0.158 and 0.127, respectively; table 2). 1612 participants including 1300 (80.7%) general practitioner, 155 (9.6%) students, 120 (7.4%) specialists and 37 (2.3%) clinical dental assistants were studied (table 1). The subjects comprised 1058 (65.6%) males and 554 (34.4%) females with a mean age of 40.4 years (range 19 - 75 years, results not shown). The number of years in practice ranged from 0 to 55 years (excluding students) with a median of 15 years (results not shown). The demographic characteristics of the study sample according to job classifications are shown in table 1 . Of total 1538 vaccinated individuals, 176 (11.5%) were nonimmune (anti - hbs <10 iu / ml) and 1362 (88.5%) were immune (anti - hbs> 10 iu/ ml) regardless of the number of doses and time after the last dose and time intervals between doses . No significant associations were found between the levels of anti - hbs and the kind of dental job (table 2). According to subjects reports, 55 (3.7%), 126 (8.4%) and 1309 (87.9%) had received one, two and full three doses of vaccine, respectively (see table 1 for more details). Fifty - eight (3.59%) of participants did not receive any hbv vaccine at all; however, they had positive results for anti - hbs, indicating a past hbv infection . However, anti - hbs mean value was 12.96 (95% ci: 5.72 - 29.39) for those who did not receive hbv vaccine . Nevertheless, the mean anti - hbs titers were 24.89 (95% ci: 11.16 - 55.52), 100.32 (95% ci: 70.52 - 142.72) and 107.04 (95% ci: 96.82 - 118.33) for subjects who received one, two and three doses of vaccine, respectively (p values between 1 and 2; 2 and 3 doses: 0.006, and 0.98, respectively, results not shown). Therefore, no significant difference was found between antibody levels and receiving second or third doses of vaccine; whereas, this association was significant between individuals who received only one versus those who received the second dose . Among total participants, 1033 who knew their exact time of vaccination history, 542 (52.5%) mentioned that they received vaccination within the past five years, while others (491; 47.5%) reported having received the last dose of vaccine more than five years prior this study . 356/542 (65.7%) of dentists who had received their third dose of vaccination less than five years before the study were completely immune (anti - hbs> 100 iu / ml); this rate was significantly higher than individuals who had completed all three recommended doses in a period more than 5 years prior to the study 279/491 (56.8%) (p = 0.003) (table 1). A significant relation was found between gender and anti - hbs antibody titer; females showed a higher level of anti - hbs (p = 0.022), (table 1). Accordingly, the median of antibody titer was significantly higher in the age group <45 years compared to the age group> 45 years (p <0.001). Furthermore, statistically significant associations were found between the median titer of anti - hbs following vaccination and duration of dental practice engagement (p <0.001) (table 1). Eighty - one (5%) of participants had positive results for anti - hbc, of whom 66 (81.4%) had a history of vaccination (results not shown); 55 (83.3%) had protective levels of anti - hbs (10 iu / ml) and 11 (16.7%) had inadequate anti - hbs levels (<10 iu / ml). Although 13 (16.5%) of anti - hbc positive dentists did not receive vaccine, seven had protective levels of anti - hbs and six had inadequate levels, indicating a possible past hbv infection to determine possible risk factors and anti - hbs levels, no significant associations were found between levels of antibody titers and number of needle stick as well as other risk factors such as trauma, suspicious sexual contact and a history of liver disease (table 2). However, a significant negative association was found between the history of transfusion and low levels of anti - hbs (p = 0.016) (table 2). Of 1385 cases with known cigarette smoking history, there were 211 (15.2%) dentists who were smokers . The median of years for smoking was 14 and the median of pack - years of smoking was 3.75 (results not shown). However, there was no significant association between antibody titer and history, duration and pack - years of smoking (p = 0.1, 0.38 and 0.37, respectively). Among participants, anti - hbs levels were not different according to consistent use of gloves (p = 0.322; table 2). On the other hand, anti - hbs levels for those who regularly used mask, glasses and shield were higher than those who used them irregularly or not at all, although they were not significant statistically (p = 0.093, 0.158 and 0.127, respectively; table 2). This study was performed to determine the anti - hbs antibody titers of iranian dental care workers and to investigate the possible correlation between demographic features as well as details of vaccination schedule with anti - hbs antibody titer in this population . Moreover, risk factors related to immune status of subjects together with protective measurement were considered in this investigation . Although the study sample was not selected randomly, our sample size was the largest among iranian researches . In the present investigation, 1538 hbv vaccine recipients were anti - hbs - positive, of whom 1362 (88.5%) subjects developed adequate levels of antibody to hbv infection and 176 (11.5%) were non - immune . A similar study on dentists in iran showed that 69%-77% of participants were completely immune, while 17% were relatively immune and 6 - 13% were non - immune (12, 14). The number of those who had received their three recommended doses of vaccine was 1312 (87.9%). Furthermore, statistically significant correlations were found between the median titer of anti - hbs following vaccination and time after the last vaccine injection (p <0.001). Regarding very low to moderate levels of anti - hbs (<10 - 100 iu / ml) in 481 (31.3%) participants, they are at increased risk for hbv infection (15 - 17). There are two possibilities: (i) decline in the antibody titer with the passage of time despite initial adequate levels of anti - hbs . In the present study, the difference between the times lasting from the third dose of vaccine was statistically significant (> 5 years vs. <5 years). Similar studies showed that in individuals who respond adequately to vaccination, anti - hbs antibody levels decrease over time and may fall below protective levels . Basically, administering a booster dose of hbs ag vaccine results in a vigorous anamnestic response, demonstrating that immune memory against hbv infection lasts longer than anti - hbs antibodies (18, 19). On the other hand, (ii) the other possibility is nonresponsiveness to the vaccine . Several factors were reported to influence the response to hbv vaccine in nonresponders such as genetic background, older age, obesity (20, 21) and smoking (9, 22). For those who do not respond to the primary vaccination series, an additional regimen of ordinary vaccines (either administration of a higher dose or a second course of three doses of hbv recombinant vaccine) usually gives rise to about 15% to 25% and 30% to 50% of responsiveness to one and three additional doses, respectively (23, 24). Likewise, still more than 50% of non - responders are not able to acquire protective levels of anti - hbs despite administration of at least two additional booster recombinant vaccines (25, 26). Alternate schedule includes intradermal vaccine administration (27) or third generation vaccines (that contained pre - s1/pre - s2 proteins through recombinant technology in mammalian cell lines) with higher immunogenicity and more seroconversion rate compared to the second generation vaccines (28, 29). Otherwise, for those persistent nonresponders, it is recommended to avoid epp (exposure - prone procedures) and they should be noticed that they may be susceptible to hbv and that they should receive hepatitis b immune globulin (hbig) following hbv exposure (30). We did not check anti - hbc status of participants, hence anti - hbs level in the study does not necessarily differentiate rising of antibody following vaccination or past infection with hbv . In the present study, the rate of incomplete vaccinations was 13%, hence more efforts should be made to persuade all dentists to receive the three doses of vaccine . Unfortunately, as worldwide, no mandatory hbv vaccination program exists for dentists in iran, which may cause a low rate of compliance in voluntary vaccination program(s) now available for hcws at health offices . It is of some concern that dentists are willing to accept significant degree of personal risk, despite recorded danger from hepatitis b, either by failing to ensure immunization against hepatitis b or by failing to check the presence of hepatitis b antibodies following immunization . In conclusion, hbv vaccine coverage and infection control measures were satisfactory among iranian dental personnel in this study . Since dental care workers have a high risk of exposure to hepatitis virus, a compulsory vaccination for hepatitis b virus is desirable for all dental care workers.
An 81-year - old female with oavs presented to a general dentist for a dental implant consultation . Her medical history was remarkable for an epibulbar dermoid and previous grafting of an anterior mandibular defect at the age of 16 . After a routine examination, the patient was referred to an oral and maxillofacial surgeon for implant treatment planning . The surgeon requested a maxillofacial cbct scan extending from the level of the nasal fossa through the inferior border of the mandible, and from the anterior border of one ramus to the anterior border of the contralateral ramus . Upon radiographic examination, the bilateral paramedian area of the mandible appeared abnormally heterogeneous with a poorly defined border on the right . The mandibular canals anterior to the right second molar and the left mental foramen were untraceable (fig . 1). Multiplanar reconstructions revealed a large, heterogeneous, expansile entity of mixed density along the facial side of the mandible, extending from the mandibular left premolar area to the mesial aspect of the mandibular right third molar, and from the level of the root apices through the inferior border of the mandible . Effacement of the facial cortical plate without an effect on the neighboring teeth was observed (fig . 3). Three - dimensional volume rendering depicted the considerable size of the entity in question (fig . 4). A cartilaginous neoplasm could not be ruled out based on cbct imaging and an incisional osseous biopsy was therefore performed . Hematoxylin and eosin - stained slides prepared after formalin fixation and decalcification were reviewed (fig . Growth or overgrowth is a recognized sequela of ccgs . Almost all patients that seek corrective surgery following ccg overgrowth in the mandibular body or condyle present with facial asymmetry . This happens even when the grafts are placed bilaterally due to their unpredictable growth potential . For a definitive diagnosis to be made, radiographic examination followed by a histopathological evaluation is indicated.9 most of the published cases of ccg overgrowth in the mandible were described radiographically using panoramic images and/or multi - detector computed tomography (mdct).10111415161718 yang et al.9 reviewed 68 cases of ccg overgrowth in the maxillofacial region . The authors described a case of overgrowth of a ccg that replaced the right mandibular body using panoramic, lateral cephalometric, and posteroanterior skull radiographs, and mdct . None of the radiographs demonstrated asymmetry due to the inherent limitations of this imaging modality . Mdct allowed better visualization of the facial deformity and chin deviation in all dimensions.9 the advantage of the 3-dimensional visualization of such complex cases using mdct is indisputable . However, plain radiography is still commonly used due to its availability, low cost, and reduced patient exposure to ionizing radiation . The authors reported 4 cases that demonstrated low - attenuation grafts with occasional foci of high attenuation, clear borders between the graft and host bone, and lateral and superior rims of ossification using mdct . The follow - up period of these cases ranged from 5 months to 8 years . A clear border was only seen in the case in which only 5 months had elapsed since surgery . Fukuta et al.16 published a case of recurrent overgrowth of a ccg placed for hemimandibular reconstruction using panoramic images, mdct, and a nuclear medicine bone scan . These images were of poor quality, but the authors noted the deviation of the mandible on mdct on 2 occasions (before each corrective operation) and increased uptake of the radionuclide by the graft on the third day after surgery . This profound growth potential may have been due to the patient's young age (2 years old). Similarly, samman et al.18 demonstrated an increase in isotope uptake by the graft using technetium scintigraphy, supporting the theory that ccgs have an inherent growth potential . Kaban et al.11 described the incorporation and calcification of a ccg replacing the mandibular condyle, and ultimately resembling a normal condyle upon periodic follow - up . Unfortunately, the quality of the images was poor in the previous articles, which made us unable to evaluate the imaging findings . Eckardt et al.10 described a case of ccg reconstruction after hemimandibulectomy in which follow - up was performed at regular intervals, up to 6 years after surgery, using panoramic images . The authors used linear and angular measurements to calculate the ratio between the operated and unoperated side to evaluate overgrowth versus growth retardation . Although this approach is inaccurate, as panoramic images are prone to positioning errors and unpredictable distortion between successive images and within the same image;19 significant growth of the ccg along the vertical dimension was evident . Ko et al.13 accurately used landmarks on lateral and posteroanterior cephalometric radiographs to assess ccg growth . The authors noted that the follow - up period was critical when evaluating overgrowth; the longer the follow - up period, the more growth they found in their sample . Jang et al.20 described the case of a ccg extending from the angle of the mandible and replacing the condyle using ct . The graft appeared stable with no signs of resorption or overgrowth at 10 months after surgery . Schatz and ginat8 pointed out that autografts have the disadvantage of resorption hindering their cosmetic effect . The authors demonstrated a low - attenuation cartilage graft with a peripheral rim of ossification using an axial mdct image . Karacaolan et al.21 also demonstrated that cartilage grafts had a tendency to undergo resorption, using magnetic resonance imaging (mri) after a 12-month follow - up period to assess the degree of resorption . The majority of the grafts had a low signal with a few foci of high signal near the soft tissue periphery on follow - up imaging . No article in the literature described similar growth or changes in synthetic cosmetic implants in the soft tissue . However; cosmetic implants, like autogenous grafts, can become incorporated into the underlying bone . Other complications associated with cosmetic implants include migration, extrusion, erosion, and foreign bone reaction.8 with the increased use of radiographic imaging to diagnose and treat a variety of dental and medical conditions, there is an increased likelihood of incidental findings, such as implants that were not expected based on the patient's history . A history of implants for cosmetic purposes may not be elicited because the patient may not feel that they are important to the issue being discussed . Although most implants and grafts will present as benign - looking entities within the soft tissue that can easily be interpreted as such, some may present as unusual entities that may mimic a more serious disease, such as a benign or malignant neoplasm . The common management of facial defects in oavs includes reconstructive surgery, often using implants or grafts to improve patients' cosmetic appearance . We present the case of an incidentally found cosmetic graft . According to the patient, an autogenous rib graft was harvested and sectioned to augment the mandibular symphysis . On imaging, attempts to recover previous medical and surgical notes were unsuccessful, as the surgeon who performed the procedure in 1950 was deceased . The exact surgical technique used was unclear; however, the graft had maintained its proper anatomical location and aesthetic shape for over 65 years . The most probable surgical technique may have involved the surgeon dicing the osteocartilage into multiple pieces and creating a tunnel between the mandibular periosteum and overlying mucosa to hold the diced cartilage graft in place during the healing period.21 to our knowledge, this is the last published case of an anterior mandibular costochondral graft . No case with long - term follow - up has been published and a review of the literature concerning imaging related to cosmetic facial grafts did not identify any similar cases . Clinical correlations, imaging, and histology were essential to render a final diagnosis of costochondral graft material . The histopathology suggested a benign cartilaginous process; however, the anterior mandible is a rare site for benign cartilaginous neoplasms, and without proper clinical and radiographic correlations the lesion could have been misdiagnosed . However, mandibular osteochondromas have almost exclusively been reported in the condyle.22 the characteristic imaging findings of an osteochondroma, involving a pedunculated or sessile bony cortical mass continuous with the underlying bone, were absent . Facial implants and grafts are found incidentally in many cbct studies performed for dental treatment . A thorough knowledge of their normal appearance is important in order to recognize what is abnormal . Based on imaging alone, chondrosarcoma was initially considered due to the speckled diffuse flocculent calcification and the infiltration into adjacent normal bone . Chondrosarcomas occur where cartilaginous tissues may be present and may occasionally occur in the symphyseal region.23 schatz and ginat8 discussed the imaging appearance of these augmentation materials using ct and mri . Chin augmentation materials such as hydroxyapatite, silicone implants, and cartilage grafts have been described . The authors concluded that cartilage grafts appear to have a soft tissue density that may form a rim of calcification or ossification.8 our case involved a more diffuse calcification pattern, which may have been due to the longer follow - up period . Although most are well defined and radiographically homogeneous, being of relatively inert non - biological material, immune reactions to some may stimulate alterations in the appearance of surrounding tissues . Biological implants may undergo growth and differentiation, causing their appearance to mimic neoplastic lesions . We present the case of a costochondral graft in the soft tissue anterior and facial to the mandible, with changes mimicking a cartilaginous neoplasm . In light of the fact that chondrosarcomas are known to occur in the anterior rib cage, an evaluation of random growth a vascularized graft is thought to be more controlled in growth than a nonvascularized graft . This is the first case to report the cbct imaging features of a long - standing graft in the anterior mandible.
Microarray technology, monitoring mrna abundance of tens of thousands of genes simultaneously, provides an efficient tool to characterize a cell at the molecular level . It has been applied to a variety of research areas, ranging from biomarker detection [1, 2] to gene regulatory networks [35] and cancer classification [68]. When applied to cancer research, microarray technology typically measures gene expressions of cancer and normal tissues or different types of cancer . One important area in microarray - based cancer research is to identify genes that are differentially expressed between cancerous and normal cells and to discover diagnostic and prognostic signatures in order to predict therapeutic responses . Over the years, many statistical methods for the identification of differentially expressed genes have been developed, and most of them focused on the expression analysis of individual genes [915]. However, the simple list of individual differentially expressed genes can only tell us which genes are altered by biological differences between different cell types and/or states . It cannot explain the reasons for the significant alterations in gene expression levels and the effects of such changes on other genes' activities . It is well known that in a biological system genes interact with each other forming various biological pathways in order to carry out a multitude of biological processes . To better understand the roles of these differentially expressed genes and their interactions in a complex biological system, since the identification of biological pathways is significantly influenced by those differentially expressed genes from different datasets or different statistical methods [16, 17], we reason here that an integration of multiple cancer microarray datasets and identification of the most common pathways from these data would reveal key relationships between crucial genes in carcinogenesis . Our focus on the interactions and pathways of cancer - related genes is important since changes in gene relations and key pathways are more relevant to carcinogenesis than individual genes alone . Li observed differences of gene coexpression patterns in different cellular states and attributed these changes in gene coexpression patterns to some third set of influential genes . Lai et al . Proposed a similar method to identify differential gene - gene coexpression patterns in cells from normal state to cancerous state . However, these methods often perform the analyses on one single microarray dataset and typically generate unreliable results; the results from different microarray datasets and various statistical methods could hardly overlap using these methods [20, 21]. Furthermore, these methods fail to grasp the common molecular changes in cells transitioning from a normal state to the cancerous state . Choi et al . Introduced a model to find differential gene coexpression patterns related to cancer by combining independent datasets for different cancers . They used a model similar to the t - test, which only considered the mean and variance of two groups of samples . It is well known that traditional t - test has two disadvantages for microarray data analysis: first, it assumes that the datasets under analysis have a normal distribution, which is usually violated in microarray datasets; second, if the number of genes is large and the number of samples is small, some of the standard deviations will be extremely small, and therefore the test statistics will be very high, which may lead to a significant bias . Nonparametric statistical test methods, such as the k - s test, require fewer assumptions for the data and may be preferred, especially, when the number of samples is small . In this paper, we propose a novel method to detect the differentially changed gene relations in cancer versus normal tissues . These 36 datasets contain both normal and tumor samples, which can subsequently yield two pearson correlation coefficient vectors for every gene pair, one for normal samples and the other for tumor samples . We then perform a bootstrapping k - s test to identify some differentially changed gene relations . Finally we verify our results with three key pathways related to cancer and demonstrate that our method can find some meaningful alterations of gene relations . As shown in table 1, these microarray datasets contain both normal and tumor samples across 21 different types of cancer, and their platforms come from one of the three platforms: gpl570 (affymetrix genechip human genome u133 plus 2.0 array), gpl96 (affymetrix genechip human genome u133 array set hg - u133a), and gpl91 (affymetrix genechip human genome u95 version set hg - u95a). We divided every dataset into two expression data matrices: one matrix includes all normal samples, and the other includes all tumor samples . To integrate multiple microarray datasets across different platforms, we mapped each probe in different platforms to a unique entrez gene i d or a unique unigene symbol . For genes with more than one probe in one platform, we chose the probe with the highest mean expression value . These pathways are related to three common traits in most and perhaps all types of human cancer: self - sufficiency in growth signals, insensitivity to antigrowth signals, and evading programmed cell death (apoptosis). In fact, hanahan and weinberg have already identified some signaling pathways to demonstrate the capabilities cancer cells acquire during tumor development in . We extended these signaling pathways to three relatively complete and larger cancer - associated pathways (antigrowth signaling, apoptosis, and growth signaling pathways) from the cell cycle pathway, the apoptosis pathway and the mapk pathway in kegg . We used these three pathways (i.e., cell cycle, apoptosis, and mapk pathways) as our seeds and the genes in these pathways as our seed genes . Next we constructed three gene networks corresponding to the three cancer - associated pathways from hprd (human proteins reference database, http://www.hprd.org/) and transfac based on seed genes and their interacting partners . We downloaded the protein - protein interaction (ppi) data released by hprd on september 1, 2007 . This ppi dataset contains 37107 human binary protein - protein interactions whose supporting experiments are indicated as in vivo, in vitro, or yeast two - hybrid . We also collected 1042 transcription factor - target gene relations on human species from transfac . So our gene networks included seed genes, protein interaction partners, and transcription factors (tfs) of seed genes or target genes for which seed genes served as their tfs . We used the kolmogorov - smirnov test (k - s test) to determine whether the distributions of values in two datasets differed significantly . The two - sample k - s test is the most useful for comparing two samples because it is nonparametric and distribution - free . The null hypothesis for this test is that two datasets are drawn from the same distribution ., xn with some unknown distribution, we can define an empirical distribution function by (1)sn(x)={0,if x <x(1),kn, if x(k)x <x(k+1)1,if xx(n), for k=1,2,,n-1, where x1,, xn are ordered from the smallest to the largest value . The kolmogorov - smirnov statistic for a given function s(x) is (2)dn = max x \|sn(x)-s(x)\| . Dn will converge to 0 if the sample comes from distribution s(x). Moreover, the cumulative distribution function of kolmogorov distribution is (3)k(x)=1 - 2i=1(-1)i-1e-2i2x2=2xi=1e-(2i-1)2 2/(8x2). It is easy to prove that ndn = n maxx\|sn(x)-s(x)\| will converge to the kolmogorov distribution . Therefore if ndn> k=pr(kk)=1-, the null hypothesis for the kolmogorov - smirnov test will be rejected at level . For the case of determining whether the distributions of two data vectors differ significantly, the kolmogorov - smirnov statistic is (4)dn, m = maxx\|sn(x)-sm(x)\|, and the null hypothesis will be rejected at level if (5)nmn+mdn, m> k. the p - value from the k - s test can measure the confidence of the comparison results against the null hypothesis . Obviously, the smaller the p - value, the more confident we are of rejecting the null hypothesis . Assume that we have n microarray datasets and a list of m genes, we denote the expression data matrix for normal samples as (6)nk=(x11kx12kx1pkx21kx22kx2pk .... xm1kxm2kxmpk) k=1,,n, and the expression data matrix for tumor samples as (7)tl=(y11ly12ly1qly21ly22ly2ql .... ym1lym2lymql) l=1,,n, where p(k) is the number of normal samples in the kth dataset, and q(l) is the number of tumor samples in the lth dataset . For these two types of expression data matrices, each row represents one gene, and each column represents one sample . The correlation coefficient for gene i and gene j from the kth normal sample can be calculated by (8)npcijk=a=1p(xiak - xik)(xjak - xjk)a=1p(xiak - xik)2a=1p(xjak - xjk)2, where xik is the average value of expression levels for gene i. the correlation coefficient for every gene pair from tumor samples can be calculated similarly . We use the bootstrapping k - s test to detect some gene relations with different pc (pearson coefficient) distributions . The bootstrapping method generates n bootstrapping samples npc and tpc by repeatedly sampling with replacement from the original npcij and tpcij (e.g., step 4), respectively . It can give us an empirical distribution of p - value, with which, we can estimate the probability that the distribution of two pc vectors are different . In our computational experiment, for a gene pair, if its value of pr(<0.05) was larger than 0.8, we considered it as a pair of genes with the correlation relation significantly different between normal and cancer cells . For example, npc is an m m matrix from normal samples in the first dataset, and npcij represents the correlation coefficient between gene i, and gene j. compute n correlation coefficient matrices npc for example, npc is an m m matrix from normal samples in the first dataset, and npcij represents the correlation coefficient between gene i, and gene j. step 2compute n correlation coefficient matrices tpc step 3for every gene pair (gene i and gene j), let (9)npcij=[npcij1npcij2npcij3npcijn],tpcij=[tpcij1tpcij2tpcij3 tpcijn], for every gene pair (gene i and gene j), let (9)npcij=[npcij1npcij2npcij3npcijn],tpcij=[tpcij1tpcij2tpcij3 tpcijn], step 4perform the following (n is the number of samples we will generate using bootstrapping). For k = 1 to n do generate bootstrap samples npc and tpc from npcij and tpcij, respectively . K = p - value of k - s test on npc and tpc.end-foroutput pr(<0.05) = (<0.05)/n . Perform the following (n is the number of samples we will generate using bootstrapping). Do generate bootstrap samples npc and tpc from npcij and tpcij, respectively . K = p - value of k - s test on npc and tpc . Output pr(<in this section, we applied the bootstrapping k - s test method to analyze three cancer related pathways . Cancer cells have the ability to evade these antiproliferation signals . In the antigrowth signaling pathway, transforming growth factor beta (tgf) initiates this pathway by binding to two tgf receptors, tgfbr1 and tgfbr2 . The smad family proteins then transduce antigrowth signals to the cell cycle inhibitors p21, p16, p27, and p15, which can inhibit the action of cyclin - cdk complex . The cyclin - cdk complex can phosphorylate rb and make rb dissociate from the e2f / rb complex to liberate e2f to activate the cell cycle procession from g1 to s phase (figure 1(a)). We found 689 unique genes related to these 19 genes from transfac and hprd . Among these 708 genes, there were 4215 paired gene interactions, among which the correlation relations of 47 gene pairs were identified as significantly changed between normal and cancer cells . Among these 47 relations, we detected a cluster around smad family proteins which contained 15 relations with different distributions between normal samples and tumor samples (figure 1(b)). Most of them came from large - scale protein - protein interaction experiments without the associated molecular function . For example, (smad1arl4d), (rhod smad2), and (wee1smad3) in, (papola smad2), (snrp70smad5), (gpnmb smad4), (psmd11smad3), and (smad9mbd1) in, and (ewsr1smad4) in, all of them were detected based on large - scale protein - protein interaction experiments without annotation of molecular function . Our results indicate that although their associated functions and internal mechanisms are still unclear, these gene pairs are related to the tgf-smad signaling pathway, and the relation between the two genes in each pair is significantly different in cancer and normal cells . Additionally, we identified some differentially changed relations with known molecular functions as follows: magi2 (a.k.a . Arip1)smad3 . Magi2 (arip1) can interact with smad3, and overexpression of arip1 can significantly suppress smad3-induced transcriptional activity . We validated this from the boxplot for magi2 (arip1)smad3 (figure 2(a)). In normal samples, magi2 (arip1) and smad3 showed a high positive correlation, while they had a high negative correlation in tumor samples . Although the experiment type of the interaction between ewsr1 and smad4 is yeast two - hybrid, mutations in ewsr1 are known to cause ewing sarcoma and other members of the ewing family of tumors . From the boxplot for ewsr1smad4, we found that the third quartile is the densest part of the whole distribution for both normal and tumor samples . The third quartile for normal samples showed a positive correlation whereas that for tumor samples showed a negative correlation (figure 2(b)). Therefore, we suspect that ewsr1 can suppress the activity of smad4 in tumor samples . Trap1 has been shown to bind to tgf receptors and play a role in tgf signaling pathway . Mutant trap1 can prevent the formation of the smad2smad4 complex to inhibit the tgf signaling pathway . In the boxplot for trap1tgfbr2 (figure 2(c)), the densest quartile for tumor samples showed a high negative correlation . Tnf, fasl, trail, and other genes can initiate apoptosis by binding to their receptors such as tnfr1, fas, and trail - r . Mitochondria can help transduce the apoptosis signals by releasing cytochrome c (cytc), a potent catalyst of apoptosis . There are two different bcl-2 family members: proapoptotic members (bid, bad) and antiapoptotic members (bcl-2, bcl - xl), which activate and inhibit, respectively, the release of cytc . Finally, two key caspases (casp8 and casp9) activate other downstream caspases that perform the cascading events of cell death (figure 3(a)). In our results, we detected 33 relations with different distributions in the apoptosis pathway, and some are supported by existing experimental evidence . Examples include (figure 3(b)) the following: puma bcl - xl (bcl2l1). Puma can interact with bcl - xl and meanwhile puma can also neutralize and antagonize all the bcl-2-like proteins . From the boxplot for puma bcl - xl, we can find that bcl - xl, and puma showed a higher negative correlation in normal samples than in tumor samples (figure 4(a)). Active forms of akt can phosphorylate bad in vivo and in vitro to prevent it from promoting cell death . In the boxplot for akt1bad, the first quartile, the densest quartile for normal samples, showed a higher positive correlation than the second quartile, the densest for tumor samples (figure 4(b)). Krt18 may inactivate tradd to prevent interactions between tradd and the activated tnfr1 and thus affect tnf-induced apoptosis . In the boxplot for krt18tradd the interaction between the death domain of tnf receptor-1 (tnfr1) and tradd can trigger distinct signaling pathways leading to apoptosis . Tradd also interacts strongly with another death domain protein; rip and rip plays an important role in the tnf signaling cascades leading to apoptosis . In the boxplot for tnfr1ripk1, tnfr1 and ripk1 inhibitor of apoptosis (iap) suppresses the activities of caspases and inhibits different apoptotic pathways . Iap and casp9 showed a high negative correlation in tumor samples (figure 4(f)). Among the eight differential gene relations in figure 3(b), three of them were in the seed pathway: trail - r fadd, iap casp9, and akt bad, which demonstrates the effectiveness of the proposed method . Egf, tgf, and pdgf are activated and then bind to their receptors to transduce the growth signals . The activated growth factor receptors can in turn activate the sos - ras_raf_mapk cascade . In the growth signal pathway (figure 5), . We could find 68 relations with different distributions in the growth signal pathway, and we discuss three relations as follows: rassf2kras . Although different forms of ras are frequently thought of as oncogenes, they also have the ability to produce antigrowth effects such as cell cycle arrest, differentiation, and apoptosis . Moreover, rassf2 can inhibit the growth of tumor cells, and the activated k - ras can enhance this ability . This might be why rassf2 and ras showed a high positive correlation in normal samples in the boxplot (figure 6(a)). As expected, maz and myc demonstrated a higher positive correlation in tumor samples (figure 6(b)). Activated epidermal growth factor receptors (egfrs) can both physically and functionally interact with plscr1 . In turn, plscr1 can interact with shc and thus accelerate the activation of src kinase through the egf receptor, while src can initiate some activating pathway for the oncogene jun . In the boxplot for plscr1egfr, the densest quartile for normal samples showed a low negative correlation, whereas the densest quartile for tumor samples showed a low positive correlation (figure 6(c)). After several decades of cancer research, some details of the underlying mechanisms of cancer at the gene level are still unclear . In this paper, we propose an integrative method based on the bootstrapping k - s test to evaluate a large number of microarray datasets generated from 21 different types of cancer in order to identify gene pairs that have different relationships in normal versus cancer tissues . The significant alteration of gene relations can greatly extend our understanding of the molecular mechanisms of human cancer . In our method, we obviate the disadvantage of the traditional t - test, which only considers the mean and variance of samples and fails in the analysis of microarray data with small numbers of samples . Instead of the t - test, we propose the use of the bootstrapping k - s test method to detect gene pairs with different distributions of pearson correlation coefficient values in normal and tumor samples . The experimental results demonstrated that our method could find meaningful alterations in gene relations and opened a potential door for further cancer research.
Tobacco and alcohol are the most common risk factors for oral malignancy . Other factors, including dna viruses, especially human papilloma virus (hpv) have been documented to play a role in the initiation or development of these lesions . And then supported by others on basis of the fact that hpv shows epitheliotropism and has the ability to immortalize human oral keratinocytes in vitro . High - risk hpv type 16 and 18 were declared as human carcinogens by the international agency of research on cancer . The hpv family comprises more than 100 genotypes, classified in accordance with the type of epithelial cells infected and the ability to affect cellular transformation . Certain types of hpv such as hpv1 infect cutaneous epithelial cells, whereas hpv6, 11, 16, and 18 infect mucosal epithelial cells of the oral cavity, oropharynx, anogenital tract, and uterine cervix . The genomic hpv dna has nine open - reading frame sequences present on single strand of dna . These are divided into seven early (e1e7) and two late - phase genes (l1l2). Expression of viral oncoproteins e6 and e7 interferes with crucial cellular mechanisms such as cell cycle regulation and apoptosis . Hpv - positive scc are clinically and molecularly distinct from hpv - negative scc and may be associated with different prognostic outcomes . The prevalence of hpv has been assessed by many techniques, including polymerase chain reaction (pcr), southern blot, dot blotting, and in situ hybridization (ish). These methods are satisfactory and reliable for detection of hpv, but are neither easily available universally, nor can every patient afford these procedures especially in developing countries such as india . While histopathological analysis by light microscopy is the most commonly used method for confirming a diagnosis, it is also a useful method for observation of viral particles when molecular biology methods are not available . The purpose of the study was to compare the histopathological features with pcr method to predict the presence of hpv infection in oscc biopsies as the detection of hpv in patients of oscc may be of great help in planning targeted therapy and for better prognostication . The study sample comprised of 45 histologically confirmed cases of oscc . Each case of oscc was evaluated for the presence of e6 and e7 protein of hpv 16 and hpv 18 with the help of nested multiplex pcr . Hyderabad, india) were used in two successive pcr reactions . In the first reaction, one pair of primers was used to generate dna products, which besides the intended target, may still consist of non - specifically amplified dna fragments . The second round of primers (internal) were located within the desired amplification product produced by the first round primers (external) so they specifically amplified required dna fragment . The identification of hpv 16 was done by the presence of a positive band at 457 bp and hpv 18 was identified as positive band at 322 bp [figure 1]. Band analysis: m lane: 100-bp deoxyribonucleic acid marker, lane 1: hpv 16-positive control (457 bp), lane 2: human papilloma virus - negative control, lane 3: hpv 16-positive specimen, lane 4: hpv 18-positive control (322 bp), lane 5: hpv 16-negative specimen, lane 6: hpv 18-positive specimen for histological evaluation, 5-m thick sections were obtained from the same paraffin - embedded squamous cell carcinoma blocks and later stained with hematoxylin and eosin stain . All the 45 cases were evaluated for light microscopy histological features, such as presence of koilocytes, dyskeratosis (individual cell keratinization), invasion and alteration in collagen . In this study, the presence of koilocytes in tissue was considered significant if more than five koilocytes per 10 high power fields (hpf) were seen in both neoplastic and non neoplastic areas (just surrounding the neoplastic area). Only if koilocytes were present in both the areas, it was considered positive [figure 2]; positivity for dyskeratosis was considered to be the presence of more than three dyskeratotic cells per 10 hpf [figure 3]. Invasion was considered to be positive if epithelial cells were found in the connective tissue with clear breach of basement membrane [figure 4], and collagen alteration was considered when any abnormal pattern of collagen structure in connective tissue was found [figure 5]. Koilocytes (black arrow) in epithelium (h&e, 400) dyskeratotic cells (black arrow) (h&e, 400) invasion of epithelial cells in the connective tissue (h&e, 100) abnormal pattern of collagen structure (h&e, 400) a single pathologist examined all the histological sections for the four features . The results of pcr evaluation for the presence of e6 and e7 protein of hpv 16 and hpv 18 were blinded from the pathologist assessing the histopathological slides in order to remove bias . Nested multiplex pcr revealed that out of 45 selected cases of oscc, 22 cases (48.8%) were hpv16 positive, 13 cases (28.8%) were hpv18 positive, and 10 cases (22.2%) were positive for both hpv16 and 18 . Table 1 shows detailed clinicopathological data of patients age, gender, site, and tumor differentiation of oscc taken up for the study . Clinicopathological data of patients two groups were made depending on the presence of hpv16, hpv 18, and both hpv16 and 18 separately for the four histological features [table 2]. Two - tailed fischer's exact test was used for evaluating the difference for the four histological features between hpv positive and negative cases of oscc . Table 3 shows statistical evaluation of all four histological features in hpv16, hpv18, and combined, respectively . Application of fischer's exact test (two tailed) when fischer's exact test (two tailed) was applied for evaluating the difference in the presence of koilocytes it showed that there was a significant difference in the number of koilocytes in hpv positive and negative cases for hpv16, hpv 18 and combined hpv 16 and 18 . Dyskeratosis was significantly different in hpv 16 and combined hpv 16 and 18, but was not significantly different for hpv18 . The other two histological features of invasion and abnormal alteration in collagen showed no significant difference between hpv positive and negative cases hpv16, hpv18, and combined hpv 16 18 . Table 4 shows the sensitivity and specificity of two histological features: koilocytes and dyskeratosis when nested multiplex pcr is taken as gold standard procedure for identification of hr - hpv . There have been numerous reports on hpv - dna detection in hn - scc with rates varying from 0% to 100% of carcinomas studied . These differences in detection rate are due to at least two principal factors: (1) differences in the epidemiological distribution of oncogenic hr - hpvs in the world; and (2) different analytical methods used . The great variation in hpv prevalence found in osccs in different studies may be not only due to the differences among the analyzed population, but also due to the differences in the samples tested (ie, formalin - fixed or fresh biopsies, exfoliated fresh cells), the methods of dna extraction, and most importantly the hpv detection methods used . Although hr - hpv detection is important in clinical settings for the oscc patients, there is no consensus on which to consider the golden standard among the numerous detection methods available either as single test or combinations . A few indian studies have been done on the prevalence of hpv in oscc in indian population . The overall prevalence of hpv in oscc in india has been reported as ranging from 20% to 50% . It has been reported as 33.6% in eastern india, 67% in south india, and 15% in western india . Chocolatewala et al ., reported a prevalence of 17.6%-41.8% for hpv16, and 0%-47.3% for hpv18 in oscc cases . Nested amplification of the gp - e6/e7 pcr products with type - specific primers, was chosen to achieve exact typing of the hpv infections . These primers were again selected from sequence alignments of the e6/e7 genes, which were aimed to indicate sequence variation between closely related genotypes . In order to reduce the number of nested pcr for detection of two different genotypes of hpv, multiplex primer cocktails were used in which requirements for both the type - specific primers are met . This strategy allows first, hpv genotyping based on pcr product size; second, extension of assay with multiplex primers cocktails for additional hpv genotypes and also direct detection of the viral oncogenes . Total prevalence of hpv in lesional tissue of oral cavity proper was found to be 55.55%, hpv16 was found to be 48.88%, and hpv18 was found to be 28.88% . The high prevalence of hpv in present study may be due to the fact that most cases were from region of tongue, which is known to show high prevalence of high risk - human papilloma virus in the oral cavity . In the present study, the prevalence of hpv16 in scc of oral cavity proper was found to be 48.88%, which is in accordance with a mexican patient cohort study done by anaya - saavedra et al ., which showed a high frequency of hpv positivity with prevalence of 43.5% in oscc and higa et al ., who reported prevalence of 52.2% . Conducted a study for presence of hpv - dna in head and neck squamous cell carcinoma and normal mucosa using pcr where they found 45% prevalence of hpv 16 . Studied the prevalence of hpv by pcr in oscc, found 35% prevalence of hpv 16 . In india, balaram et al . Conducted a study on hpv in oscc using pcr and found 41.8% prevalence of hpv 16 . The histological diagnosis of hpv presence in a given tissue sample, is based on hpv - related histopathological aspects, such as koilocytes, dyskeratosis, papillomatosis, hyperkeratosis, acanthosis, and parakeratosis . Koilocytes consisting of the presence of abnormal cells that are vacuolated, with nucleus showing pyknosis and large clear perinuclear halos that usually occupies a greater volume than that of the cytoplasm is the most common hpv - related cytopathic effect and is considered by pathologists to be the major histopathological feature for determination of hpv infection . Although some authors suggested an association between cytological and immunohistochemical positivity for hpv, others found no morphological aspects that confirmed the presence of hpv by pcr . (2011) compared the histopathological analysis with pcr to predict the presence of hpv infection in oscc biopsy tissues and found that the presence of koilocytes is unreliable for the detection of hpv presence in oral and oropharyngeal scc . Our study revealed that there was statistically significant differences for koilocytes and dyskeratosis between hpv (16,18) positive and negative cases, which indicated that koilocytosis and dyskeratosis can be reliably used as markers for the diagnosis of hpv in scc . This study also revealed that invasion and abnormal alteration in collagen structure showed no histological difference between hpv (16,18) positive and negative cases . Studied the difference in invasion pattern between hr - hpv positive and negative cases with the help of important regulators of cancer invasion and metastasis, such as matrix metalloproteinase-2 (mmp-2) and its tissue inhibitor (timp-2), which revealed that there was no significant difference between them . Similarly, garzetti et al . Described marked overexpression of mmp-2 in microinvasive carcinomas as compared with cervical intraepithelial neoplasia, but this upregulation was unrelated to the hpv status in these lesions . Hence, even in our study we did not find any difference in invasion pattern between hpv - positive and -negative cases with the help of light microscope . In the present study, when nmpcr is taken as gold standard, koilocyte shows high sensitivity of 77.27% with 73.91% specificity in detection of oscc, whereas dyskeratosis shows sensitivity of 86.36% and specificity of 43.47% for hpv 16 alone . In contrast to present study, pannone et al . Used p16-ihc to demonstrate the presence of hpv and demonstrated that although p16-ihc is a good prognostic indicator when used in combination with hpv - dna molecular methods, it is not satisfactory when evaluated as hpv detecting test when used alone (specificity less than 75%). They also showed that adding ish technique, (although it is a method known to be less sensitive than pcr - based ones) has the advantage to preserve the morphological context of hpv - dna signals in formalin fixed paraffin embedded samples and, unexpectedly, increased the sensitivity of p16/consensus pcr combination . Thus, it is evident that no single technique can be used as an indicator of hpv testing but it is combination of techniques, which helps in detecting and evaluating prognosis of hpv - related oscc . On large community screening examination for detection of oscc, especially in the developing countries, where molecular detection methods are not easily available, light microscopic features might provide help in selecting patients for further molecular detection methods of hpv as hpv - related oscc has better prognosis than smoking - related oscc . Thus the study points the use of light microscopic features, such as koilocyte and dyskeratosis for positive prediction of hpv 16 and 18's presence in oscc . The study concludes that the presence of koilocytes and dyskeratosis at light microscopic level can be used as an indirect marker for the presence of hpv (16,18) in oscc . However, features such as invasion and abnormal alteration in collagen cannot be used as predictors for hpv status . Therefore, for economically poor patients of oscc, indirect determination of the hpv status using koilocytosis and dyskeratosis as indicators, may eliminate the need for more expensive hpv tests using pcr, as hpv - positive patients are reported to have better prognosis than hpv - negative cases.
Chronic kidney disease (ckd) is an irreversible and progressive disorder characterized by loss of kidney function . Esrd patients eventually need renal replacement therapy via dialysis (subdivided into hemodialysis and peritoneal dialysis) or kidney transplantation in order to survive . As the life expectancy of esrd patients has increased with improvements in dialysis technology, systemic complications of kidney disease are likely to become increasingly important . Ckd, in fact, is not only a localized disease, but also affects virtually all organ systems, especially at the late stage of disease . Among these, a variety of pulmonary abnormalities, including pulmonary edema, pleural effusion, acute respiratory distress syndrome, pulmonary fibrosis and calcification, pulmonary hypertension, hemosiderosis, pleural fibrosis, and sleep apnea syndrome, have been documented in these patient cohorts [35]. Impaired pulmonary function may be the direct result of circulating uremic toxins or may indirectly result from fluid overload, anemia, immune suppression, extraosseous calcification, malnutrition, electrolyte disorders, and/or acid - base imbalances, which are common issues in esrd patients . It is known that fluid overload is a common and serious problem that leads to severe complications in hd patients . In the interdialytic period, weight fluctuations are commonly seen in patients with esrd on regular hemodialysis program due to body fluid overload . Fluid overload, together with a potential increase in pulmonary capillary permeability, can result in pulmonary edema and pleural effusion, abnormalities that could explain, at least in part, the decrease in pulmonary function . Since hemodialysis removes excess body fluid, it can also lead to improvement in pulmonary functions by reducing water content of the lungs . Relatively few studies have investigated the alterations of pulmonary function in esrd patients undergoing hemodialysis treatment, and conflicting results have been reported . Therefore, we designed this study to investigate the acute effects of hemodialysis treatment on spirometry parameters . We particularly focussed on the relationship between pulmonary function and fluid status in esrd patients on regular hemodialysis, using a novel bioelectrical impedance analysis device to measure the fluid status . The study design included 54 patients with esrd receiving chronic hd therapy 3 times per week in dicle university hospital s dialysis unit . This cross - sectional study was conducted at a tertiary care university hospital and among patients diagnosed with esrd . The local human research ethics committee approved the study protocol, and informed consent was obtained from all patients at the time of study enrollment . All patients were dialyzed with using 1.6 m surface area high - flux polysulphone dialyzers (fresenius, bad homberg, germany) with bicarbonate - based dialysate (glucose 1 mmol / l, na 140 meq / l, hco332 the prescribed duration was 5 h with a blood flow rate of 250350 ml / min and dialysate flow rate of 500 ml / min . The exclusion criteria were: (1) hemodynamically unstable patients; (2) patients with lung disease, such as chronic obstructive pulmonary disease, asthma, or pleural disease; (3) known cardiovascular disease; (4) patients who had limb amputation, pacemakers, metallic intravascular devices, any malignant disease, or pregnancy; and (5) patients who have been receiving diuretic treatment . All patients demographics and baseline clinical characteristics were obtained from patient registries and the patients themselves . Body mass index (bmi) was calculated as the ratio weight / height (kg / m). Standard spirometric pulmonary function tests (easy - on pc, true flow by ndd, medizintechnik ag ch-8005 zurich, switzerland) were performed immediately before and after the midweek hemodialysis session . All patients were able to perform acceptable and re - producible forced expiratory maneuvers with the same physician . The patients were studied in sitting posture while wearing a nose clip using standard methodology . Forced vital capacity (fvc), forced expiratory volume in the first second (fev1), peak expiratory flow rate (pefr), mean forced expiratory flow between 25% and 75% of the fvc (fef2575), and the fev1/fvc ratio were measured and calculated as%predicted using normal values determined on the basis of age, race, height, and sex (fvc%, fev1%, pefr%, and fef 2575%). In recent years, multifrequency bioelectrical impedance analysis (bia), which is a simple, safe, novel, rapid, noninvasive, and promising method, has been used to determine fluid status in patients on dialysis therapy . A multi - frequency bia device (body composition monitor, bcm, fresenius medical care d gmbh), which measures 50 different frequencies from 5 to 1000khz, bia was performed just before (pre - hd) and 30 min after (post - hd) the midweek dialysis session . The following parameters were obtained: overhydration (oh), extracellular water (ecw), and oh / ecw% ratio . Fluid overload was defined as a oh / ecw 7%, corresponding to the value of the 90th percentile for the reference cohort . Data analyses were performed using the statistical package for social sciences (spss), version 18.0 for windows (spss inc ., the variables were investigated using visual (histograms and probability plots) and analytical (kolmogorov - smirnov test) methods whether or not they were normally distributed . Normally distributed variables are presented as means and standard deviations, and non - normally distributed variables are presented as median and range (maximum and minimum). The paired student s t - test was used to compare the pre - hd and post - hd measurements . The study design included 54 patients with esrd receiving chronic hd therapy 3 times per week in dicle university hospital s dialysis unit . This cross - sectional study was conducted at a tertiary care university hospital and among patients diagnosed with esrd . The local human research ethics committee approved the study protocol, and informed consent was obtained from all patients at the time of study enrollment . All patients were dialyzed with using 1.6 m surface area high - flux polysulphone dialyzers (fresenius, bad homberg, germany) with bicarbonate - based dialysate (glucose 1 mmol / l, na 140 meq / l, hco332 the prescribed duration was 5 h with a blood flow rate of 250350 ml / min and dialysate flow rate of 500 ml / min . The exclusion criteria were: (1) hemodynamically unstable patients; (2) patients with lung disease, such as chronic obstructive pulmonary disease, asthma, or pleural disease; (3) known cardiovascular disease; (4) patients who had limb amputation, pacemakers, metallic intravascular devices, any malignant disease, or pregnancy; and (5) patients who have been receiving diuretic treatment . All patients demographics and baseline clinical characteristics were obtained from patient registries and the patients themselves . Body mass index (bmi) standard spirometric pulmonary function tests (easy - on pc, true flow by ndd, medizintechnik ag ch-8005 zurich, switzerland) were performed immediately before and after the midweek hemodialysis session . All patients were able to perform acceptable and re - producible forced expiratory maneuvers with the same physician . The patients were studied in sitting posture while wearing a nose clip using standard methodology . Forced vital capacity (fvc), forced expiratory volume in the first second (fev1), peak expiratory flow rate (pefr), mean forced expiratory flow between 25% and 75% of the fvc (fef2575), and the fev1/fvc ratio were measured and calculated as%predicted using normal values determined on the basis of age, race, height, and sex (fvc%, fev1%, pefr%, and fef 2575%). In recent years, multifrequency bioelectrical impedance analysis (bia), which is a simple, safe, novel, rapid, noninvasive, and promising method, has been used to determine fluid status in patients on dialysis therapy . A multi - frequency bia device (body composition monitor, bcm, fresenius medical care d gmbh), which measures 50 different frequencies from 5 to 1000khz, bia was performed just before (pre - hd) and 30 min after (post - hd) the midweek dialysis session . The following parameters were obtained: overhydration (oh), extracellular water (ecw), and oh / ecw% ratio . Fluid overload was defined as a oh / ecw 7%, corresponding to the value of the 90th percentile for the reference cohort . Data analyses were performed using the statistical package for social sciences (spss), version 18.0 for windows (spss inc ., chicago, il). The variables were investigated using visual (histograms and probability plots) and analytical (kolmogorov - smirnov test) methods whether or not they were normally distributed . Normally distributed variables are presented as means and standard deviations, and non - normally distributed variables are presented as median and range (maximum and minimum). The paired student s t - test was used to compare the pre - hd and post - hd measurements . The mean age of the study population (n=54) was 49.5115.08 years and 51.8% were male . The baseline demographic and clinical characteristics and relevant laboratory parameters of the patients are presented in table 1 . Fvc, fvc%, and fev1 levels were significantly increased after the hemodialysis session (p<0.05). As regards the bia parameters, oh / ecw% were significantly lower in post - hd patients compared to pre - hd patients (p<0.05). Table 2 depicts comparison of pulmonary function tests and bia characteristics in pre - dialysis and post - dialysis patients . Fvc, fvc%, fev1, fev1%, fef2575, fef2575%, pefr, and pefr% were significantly lower in patients with fluid overload than in those without fluid overload (p<0.05). There were significant negative correlations between oh / ecw and fvc, fvc%, fev1, fev1%, fef2575, fef2575%, pefr, and pefr% (table 4). Further, we modelled a stepwise multiple regression analysis to define the independent determinants of post - hemodialysis fvc . Sex, age, oh / ecw% ratio, and ultrafiltration volume were included into the model . Male sex and increased ultrafiltration volume were independently associated with higher fvc, whereas increased age and oh / ecw% ratio were independently associated with lower fvc (r=0.569, p<0.001, table 5). Ckd, which can lead to esrd, is a worldwide public health problem and is associated with increased morbidity, mortality, and diminished quality of life . Unfortunately, the prevalence of esrd is increasing with the rise in diabetes, hypertension, obesity, and the aging population . Almost all systems of the body are adversely affected as the patient approaches esrd; therefore, these patients suffer from serious respiratory, cardiovascular, and metabolic complications . The respiratory system is especially affected due to the pulmonary complications commonly encountered in esrd patients receiving hemodialysis treatment . The pathogenesis of impaired pulmonary functions has not been completely elucidated in hd patients, perhaps partly due to the small number of studies . To the best of our knowledge, this is the first study to investigate the relationship between fluid overload based on oh / ecw ratio measured by using bia and pulmonary function in patients receiving regular hd . Several alterations in pulmonary functions, including restriction, obstruction, and impaired diffusion capacity, have been reported in ckd patients . Despite some conflicting results, improvement of spirometry parameters after demonstrated that spirometry parameters (fvc, fev1, fef75, 50, 25,% of predicted) significantly improved at 1 h after a hemodialysis session . In a study by alves et al ., including in 61 hemodialysis patients, spirometry parameters were examined before and after hemodialysis; they found a significant correlation between the improvement of pulmonary functions (fev1 and fvc) and weight reduction after dialysis . They also suggested that correction of volume overload after hemodialysis seems to be an important factor in the spirometric improvement . Moreover, a study by kovelis et al . Conducted in a relatively small number of patients (17 hd patients) showed an improvement in fvc after a hemodialysis session, and they also concluded that the pronounced weight gain in the interdialytic period is associated with worsening of pulmonary function, which is almost fully reversible by hemodialysis . On the contrary, myers et al . Reported that the accumulation of body water between dialysis sessions did not significantly influence pulmonary function . In a similar study, lang et al . Found no significant difference in pre- and post - dialysis values of vc (%), fev1/vc (%), and correlation between lung function parameters and interdialytic changes in body weight in 14 patients receiving hd . In the present study, we demonstrated that spirometry parameters (fvc, fvc%, and fev1) were significantly improved after hemodialysis . Another finding of the present study is that pulmonary functions tests (fvc, fvc%, fev1, fev1%, fef2575, fef2575%, pefr, and pefr%) were significantly lower in patients with volume overload . Also, oh / ecw, which was used to assess volume overload, was negatively correlated with fvc, fvc%, fev1, fev1%, fef2575, fef2575%, pefr, and pefr% . Importantly, this study showed that volume overload, determined by oh / ecw ratio and ultrafiltration volume, is an independent predictor of fvc after hd . Our study results support previous studies by demonstrating the improvement of spirometry parameters, which are mainly related to reduction of excess lung water, after a hemodialysis session . In addition, the findings of the present study demonstrated that volume overload is closely associated with restrictive and obstructive respiratory abnormalities . Although excess fluid is removed by ultrafiltration during a dialysis session, patients still can be overhydrated . On the other hand, many hemodialysis patients also return to the pre - dialysis period with overhydration as a consequence of water overload . One major consequence is the accumulation of fluid during the interdialytic period, which has a propensity to collect in the lungs and lead to progressive pulmonary congestion . Pulmonary congestion is highly prevalent among patients with esrd treated with hemodialysis and is associated with a mixed restrictive - obstructive pattern on pulmonary function tests . Hemodialysis can lead to improvement in lung restriction, due to decreasing interstitial edema and bronchial wall decongestion . Hemodialysis can remove the excess fluid from the body in overhydrated patients, which in turn reduces water content of the lungs and thus decreases the pressure on airways, and reduces obstruction . A major limitation of the present study is the lack of a long - term follow - up . Remeasurement of pulmonary function tests after achievement of euvolemia in overhydrated patients is needed in a future prospective study . The present study indicates that fluid overload is closely associated with restrictive and obstructive respiratory abnormalities in patients with end - stage renal disease on maintenance hemodialysis treatment . In addition, hemodialysis has a beneficial effect on pulmonary function tests, which can attributed to reduction of volume overload . We suggest that intervention to reduce excess volume in hemodialysis patients with volume overload could result in better pulmonary functions.
Haemolytic uraemic syndrome (hus) is most frequently caused by infection with shiga toxin - producing strains of escherichia coli or shigella dysenteriae type 1 . Other causes include inherited and acquired abnormalities affecting the alternative pathway of complement, other infections and certain drugs, including cisplatin and carboplatin . Recently eculizumab, a humanized monoclonal antibody directed against c5 that prevents the activation of the terminal complement pathway, has been shown to be an effective treatment for patients with atypical hus (ahus). Thrombotic microangiopathy has long been recognized as a complication of disseminated cancer and cisplatin therapy . The acute form has a high mortality rate, although successful treatment with plasma exchange has been described [2, 7, 8]. A previously well 27-month - old boy with no family history of kidney disease presented with a cervical mass unresponsive to antibiotics . The plasma lactate dehydrogenase (ldh) was elevated at 1600 iu / l (normal 266500). Bone marrow examination and metaiodobenzylguanidine (mibg) scan showed no evidence of distant metastases . Pre - treatment, the plasma creatinine concentration was 21 mol / l, and the glomerular filtration rate (gfr; measured by plasma disappearance of technetium (tc)-99 labelled diethylene triamine pentacaetic acid (dtpa) was 107 ml / min/1.73 m body surface area . Therapy was started with a combination of vincristine, etoposide, carboplatin, cisplatin and cyclophosphamide . On day 45 of treatment (35 days after the first cisplatin dose, 15 days after the second), the gfr had fallen to 60 ml / min/1.73 m. this was presumed to be due to acute cisplatin nephrotoxicity . The hypertension became increasingly severe (maximum value recorded 160 mmhg systolic) and he required five agents to control the blood pressure . He required seven infusions of platelets and four of red blood cells between days 50 and 59, suggesting that the pancytopaenia was not solely due to myelosuppression and the plasma creatinine concentration rose from 39 to 140 mol / l . A blood film confirmed the presence of schistocytes, the ldh had risen to 2438 iu / l and the plasma haptoglobin concentration was <0.06 g / l) and c4 (0.20 g / l) concentrations were normal . Renal biopsy was considered unsafe at this time, but the results above were considered compatible with a diagnosis of hus, likely due to cisplatin . Stool and blood cultures were negative, as were serological tests for hiv1&2 . Adamts13 (von willebrand factor - cleaving protease) levels were 80% of control values . Despite the dearth of information concerning the pathogenesis of cisplatin / carboplatin - associated chemotherapy, we opted for therapy with eculizumab partly because it was felt that his severe hypertension, profound thrombocytopaenia and small size made plasma exchange hazardous . He received the first dose of 600 mg the following day when his plasma creatinine was 155 the next day the plasma creatinine peaked at 160 mol / l and it steadily decreased thereafter (figure 1). After a further dose of 300 mg a week later, he was maintained on fortnightly doses of 300 mg according to the manufacturer's dosing guidelines . Five weeks after administration of the first dose of eculizumab, the plasma creatinine concentration had reduced to 34 iu / l and the gfr was 67 ml / min/1.73 m. a decision was made to avoid further exposure to platinum - containing agents, and therapy was changed to a combination of vincristine, topotecan and doxorubicin . There was little further change in tumour size and, 126 days after starting chemotherapy, the tumour was surgically removed with clear excision margins and eculizumab was discontinued . At this time, the platelet count was 181 10/l and the plasma creatinine concentration was 34 the platelet count fell to 138 four weeks after the last eculizumab dose and remained in the range of 98160 10/l for the next 2 months . Two months after discontinuing the eculizumab, the plasma ldh had risen to 807 iu / the plasma concentration of the terminal complement complex (sc5b-9) was elevated at 137 ng / ml (normal range <80). Of the 20 glomeruli in the light microscopy sections, five were globally sclerosed, and two showed periglomerular fibrosis . The patent glomeruli showed an increase in mesangial cells and matrix with segmental sclerosis and capsular adhesions . The toludine blue preparation and electron microscopy (em) showed thickened glomerular capillary loops (double contour appearance), and areas of widening of the sub - endothelial space were seen . This marked widening of the sub - endothelial space and fibrillar / particulate material is characteristic of hus (figure 2). Light microscopy showing sclerosed glomeruli (to the left of the figure) and a glomerulus showing increased mesangial matrix expansion and segmental sclerosis (boxed area). There is also focal tubular atrophy around damaged glomeruli (jones silver histochemical stain, scale bar = 10 m). (b) high power light microscopy showing glomerulus with mesangial matrix expansion and segmental sclerosis (asterisks) (jones silver histochemical stain, scale bar = 5 m . (c) toludine blue semithin preparation showing increased mesangial matrix expansion and segmental sclerosis (asterisks) and thickened capillary loop (arrow) mimicking membranoproliferative glomerulonephritis, scale bar = 5 m . (d) em showing fluffy - like material within a markedly widened sub - endothelial space consistent with hus scale bar = 2 m . Light microscopy showing sclerosed glomeruli (to the left of the figure) and a glomerulus showing increased mesangial matrix expansion and segmental sclerosis (boxed area). There is also focal tubular atrophy around damaged glomeruli (jones silver histochemical stain, scale bar = 10 m). (b) high power light microscopy showing glomerulus with mesangial matrix expansion and segmental sclerosis (asterisks) (jones silver histochemical stain, scale bar = 5 m . (c) toludine blue semithin preparation showing increased mesangial matrix expansion and segmental sclerosis (asterisks) and thickened capillary loop (arrow) mimicking membranoproliferative glomerulonephritis, scale bar = 5 m . (d) em showing fluffy - like material within a markedly widened sub - endothelial space consistent with hus scale bar = 2 m . The haematological, biochemical and histopathological features suggested active hus, and eculizumab was therefore recommenced with an initial dose of 600 mg given 105 days after the last dose . Before restarting the eculizumab, the gfr was measured at 54 ml / min/1.73 m, the serum complement c3 concentration was 0.9 the total haemolytic complement (ch50) was 111%, but the alternative pathway haemolytic complement (ap50) was low at 34% (normal 80200). G / l), normal platelets (248 10/l) and a plasma creatinine concentration of 32 mol / l . The gfr had risen to 71 ml / min/1.73 m. the plasma concentration of sc5b-9 remained elevated at 133 ng / ml, casting doubt on the suitability of this assay for assessing activity and response to treatment . Dna extracted from a buccal smear at the time of diagnosis of hus was amplified by pcr for all coding exons 10 bases of the cfh (factor h), cfi (factor i), c3 (complement component 3), cfb (factor b) and cd46 (membrane cofactor protein, mcp) genes . Amplified products were subjected to bi - directional sanger sequencing (abi), as previously described . Cd46 expression on cell surfaces was assessed on peripheral blood neutrophils after recovery from myelosuppression by flow cytometry using cd46 fluorescein isothiocyanate - conjugated antibody (bd pharmingen, 555949). An intronic sequence variant (c.1027 + 5g> t) was identified in cd46 . This variant had not been previously reported nor was it detected in dna from 188 normal control subjects . In silico splicing prediction analysis undertaken using alamut (interactive bioscience software, seine biopolis, 70 route de lyons - la - foret, 76 000 rouen, france; http://www.interactive-biosoftware.com) suggests that this variant may cause aberrant splicing . After discussion with the parents, a decision was made not to test other family members, because the result was felt to be of limited clinical utility, outweighed by potential anxiety induced in a carrier . Endothelial cells, glomerular basement membrane and podocytes all show ultrastructural evidence of damage after cisplatin exposure . Opsonization of damaged or apoptotic cells with c3b plays an important role in the efficient removal of such cells by phagocytes, and there is evidence of complement activation in cisplatin - induced aki . On host cell surfaces, deposited c3b is usually rapidly inactivated by several regulatory proteins including cd46 (mcp) and factor h, both of which act as cofactors for factor i. deficiency or reduced activity of these complement regulatory proteins would potentially lead to amplification of the endothelial cell damage induced by cisplatin . Ahus is most frequently associated with impaired regulation of the alternate pathway of complement regulation on the surface of host cells with normal regulation in the fluid phase, and plasma c3 levels are therefore frequently normal . Because endothelial damage is associated with complement activation and c5 plays a pivotal role in the development of ahus, it seemed appropriate to initiate treatment with eculizumab . The finding of a novel mutation causing decreased expression of cd46 suggests that dysregulated complement activation played an important role in pathogenesis . The response to eculizumab, deterioration on withdrawal of eculizumab and improvement after restarting treatment all support this hypothesis . Our patient is the first to have genetic investigation of the factors involved in the regulation of the alternative pathway of complement regulation and the first to be treated with eculizumab . The possibility that dysregulated complement activation underlies the thrombotic microangiopathy in other patients with cisplatin - induced hus should be considered, and testing for abnormalities of complement regulation should be performed in future patients . The optimal duration of eculizumab therapy remains unclear; 4 months of therapy was clearly inadequate in our patient but we hope to be able to withdraw treatment in the future . R.d.g . Received a travel grant to attend the era - edta conference in paris in 2012.
Rapid correction of hyponatremia is a known risk factor for the development of osmotic demyelination syndrome (ods), a disorder characterized by the wide spread development of demyelination in the pontine as well as the extra - pontine regions . We herewith describe a patient of ods in the face of a slow correction of hyponatremia and associated hypokalemia . A 47-year - old non - alcoholic male presented to the er with altered sensorium . One week earlier, he had been started on ofloxacin for a lower urinary infection, following which he developed oliguria and swelling of whole body . On examination, he had pedal edema, facial puffiness, and mild hypertension (146/92 mmhg). Urine examination revealed a protein 100 mg / dl, 18 - 20 wbc, and 2 - 4 rbc per hpf . Serum creatinine was 1.8 mg / dl, and a diagnosis of drug - induced interstitial nephritis was made . A history of jaundice, diabetes, uremia, or trauma was denied . On examination, the patient was an average - built man in grade 2 - 3 encephalopathy without any localizing neurological deficits . Serum urea was 48 mg / dl (normal 10 - 38) and the creatinine 1.6 mg / dl (normal 0.6 - 1.2). Mmol / l (normal 135 - 145), serum potassium 2.5 mmol / l (normal 3.5 - 5.3), and the chloride 105 mmol / l (normal 98 - 110). The serum osmolality was 238 mosm / kg (normal 285 - 295) with a urine osmolality 292 mosm / kg . The patient was started on 3% nacl till the sodium level reached 120, when 3% saline was replaced with 0.9 n saline . Correction was given at a rate not exceeding 8 mmol / l day, and serum sodium of 135 was achieved over a period of 8 days . Simultaneously, serum potassium levels were corrected with intravenous potassium chloride [graph 1]. The patient's consciousness improved dramatically but only to deteriorate again after a period of 72 hours with steady deterioration over 24 hours till his speech became incomprehensible and he developed quadriparesis . Neurological examination revealed generalized spastic quadriparesis, mutism and inability to swallow, characteristic of a pseudobulbar state with spontaneous eye opening consistent with the diagnosis of locked - in - syndrome . Mri of the brain revealed symmetrical areas of altered signal intensity in the pons and basal ganglia, being hypointense on t1-weighted imaging [figure 1] and hyperintense on t2-weighted imaging [figures 2 and 3]. The involved areas were also hyperintense on a fluid inversion recovery (flair) images [figure 4], suggesting a diagnosis of pontine and extrapontine myelinolysis . The patient received supportive treatment for about a month when he succumbed to intercurrent sepsis . Series-1 depicts highest daily sodium levels and series-2 represents potassium levels sagittal t1w image showing hypointensity in the pons t2w image showing symmetrical hyperintense signals in basal ganglia bilaterally t2w image showing diffuse hyperintense signals in the pontine region flair image showing hyperintensity in the pons first described in alcoholic and malnourished patients who developed neurological symptoms in association with non - inflammatory demyelination within the pons, the demyelination was then reported in extrapontine areas like basal ganglia, cerebral white matter, peripheral cortex, hippocampi, and lateral geniculate bodies . Seen in up to 10% cases of ods, commonly associated with rapid correction of hyponatremia, (rise in sodium level by> 12 mmol / day) the pathogenesis of ods is not fully understood . It is speculated that in the face of a depleted adaptive process to protect against brain swelling, the redistribution of solutes upon correction of hyponatremia leads to a corresponding brain shrinkage, which leads to disruption of tight junctions and opening of blood brain barrier leading to oligodentrocyte damage triggering the demyelination of neurons . Recently, it has been shown that hyponatremia leads to down regulation of a neutral amino acid transporter that impairs cellular reuptake of amino acids, rendering them more susceptible to injury as hyponatremia is corrected . As normonatremia is restored, mental status improves and may return to normal within 48 - 72 hrs, only to rapidly deteriorate days later . Symptoms associated with cpm include dysarthria, dysphagia, flaccid quadriparesis that later becomes spastic, and horizontal gaze paralysis, which is typically followed by coma or delirium . Epm is characterized by tremor, ataxia, and other movement disorders including mutism, parkinsonism, dystonia, and catatonia . An important accompaniment of the hyponatremia in our patient was hypokalemia [figure 1]. In a recent study, hypokalemia was found to be a predisposing factor in 7 cases of cpm seen amongst 22 cases of hyponatremia, even when rapid correction of hyponatremia and non - acuteness of hyponatremia were not found to be the risk factors . In another report, 89% of 74 cases of ods had associated hypokalemia at presentation that, in contrast to our patient, had not normalized prior to the rapid correction of hyponatremia . Reduced endothelial cell membrane concentration of nak - atpase in hypokalemia may predispose the cell to injury by osmotic stress associated with the rapid rise in the serum sodium concentration . Gradual correction of hyponatremia is supposedly the most important step in the management of hyponatremic patients, the rate of correction dictated by the clinical condition of the patient . In asymptomatic patients, plasma na+ should be raised very slowly (0.5 - 1.0 mmol per h and up to 10 - 12 mmol / l over first 24 hrs). In patients with altered mental status and/or seizures, a relatively rapid correction (1 - 2 mmol / l per h for first 3 - 4 hrs or until seizures stop and up to 10 - 12 isolated case reports suggest that steroids, imidazolpyridine tartrate, or plasmapheresis may be helpful in therapy . Patients who survive might require extensive and prolonged neurorehabilitation . In a recent study of 34 patients with ods, one - third of the surviving 32 recovered, one - third were debilitated but independent, and one - third were dependent . Furthermore, clinical severity or extent of radiological / imaging changes is not predictive of the prognosis . Our case illustrates the development of ods in graded correction of hyponatremia and emphasizes the possible pathogenetic role of associated hypokalemia.
Nutritional status is very important especially in old age population because any imbalance in nutritional status has negative effect on quality of life and causes increase morbidity and mortality . For instance, phytobezoar, a bezoar consist of fruit and vegetable fibers, can lead to small bowel obstruction and has risk factors such as intake of large amount of food with high - fiber content and inadequate chewing (1, 2). Furthermore, aging process and some of related physiologic changes can predispose one to phytobezoar formation . We describe a case of small bowel obstruction due to phytobezoar following large amount of pomegranate seeds intake a few days before admission as an example of increased morbidity relating to unusual dietary habit . A 61 year - old man was admitted to emergency department of nemazee hospital, shiraz university of medical sciences, shiraz, iran, in 2015 with bowel obstruction . Ct scan showed a mottled - appearing lesion in terminal ileum with air bubbles and dilated proximal bowel loops (fig . Three consecutive ct images show mottled - appearing lesion in terminal ileum five cm before ileocecal valve with air bubbles and dilated proximal bowel loops in favor of phytobezoar (black arrows) causing obstruction . Note normal non - distended distal ileum just distal to bezoar (white arrows) because our patient had consumed large amount of pomegranate seeds five days before admission and with no history of previous abdominal surgery, phytobezoar became first diagnosis as cause and scheduled for surgery . During laparotomy, there were impacted materials in favor of phytobezoar just before ileocecal valve causing complete obstruction of small - bowel . The blockage resolved with pushing the intestinal contents into large bowel . The patient was discharged after passing unremarkable postoperative course and was doing well at two months follow up visit . Nutritional status is very important especially in old age population because any imbalance in nutritional status has negative effect on quality of life and causes increase morbidity and mortality . One of the problems relating to dietary habit is phytobezoar formation in the gastrointestinal tract . Bezoars are masses produced by accumulation of undigested material such as fruit, hair, and milk in gastrointestinal tract more frequently in stomach (3, 4) and one of the most common types of bezoar is phytobezoar (5), composed of fruit and vegetable fibers . Phytobezoar as a cause of small bowel obstruction has risk factors such as intake of large amount of food with high - fiber content and inadequate chewing (1, 2). Inadequate chewing can result of dental problems such as difficult chewing following loss of teeth that frequently seen in older age group (6). Other factor in aging population is loss of intestinal elasticity, as a physiologic change commonly seen in this group, and resultant constipation (6) may be considered as another reason for increased chance of intestinal phytobezoar formation . In other words, intestinal phytobezoar formation is a multifactorial entity, involving dietary and alimentary factors (7) and dental hygiene . Therefore, good dietary habit and proper dental hygiene in lifetime are necessary for maintaining a healthy population especially in older adults . Small bowel obstruction is another area for consideration that is a common disease and result from many causes such as adhesion, hernia, inflammation, tumor and bezoar . Two to three percent of small bowel obstructions are due to bezoar (7). In addition, most frequent manifestation of bezoar is complete intestinal obstruction (8) and computed tomography is useful in its diagnosis (1). Findings of bezoar - induced small bowel obstruction on ct scan are intraluminal mass containing air bubbles and dilated bowel loops proximal to mass and normal distal loops (1). The dietary habit of having large amount of vegetables and fruit in asian countries can be result in phytobezoar formation as relatively common cause of small bowel obstruction in the absence of previous gastric surgery (4). Small bowel obstruction due to bezoar may need surgery for treatment and this entity rarely improves with conservative therapy, hence it is important to consider this diagnosis as the reason for obstruction (1). In this way, in patients with small bowel obstruction that have history of recent consumption of vegetables or food with high fiber content and no past history of surgery, phytobezoar should be kept in mind with high index of suspicion . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Drug - coated balloon has been developed as an alternative to drug - eluting stents (des). Results of several preclinical and clinical studies indicate that short - term exposure of injured arteries to paclitaxel eluted from regular percutaneous transluminal angioplasty and ptca balloons may be sufficient to reduce late lumen loss and restenosis rates during a critical period of time after angioplasty of diseased coronary and peripheral arteries.- we present a case of particularly proliferative instent restenosis treated with a new type of drug eluting balloon . A 68-year - old man with severe silent ischemia was admitted to our center for elective coronary angiography and percutaneous coronary intervention . The patient had bypass grafting of left anterior descending (lad, with mammary artery), first obtuse marginal branch and right coronary artery (rca) 6 years before . Three years after the surgical procedure, he developed unstable angina and angiography showed occlusion in both vein grafts . He underwent percutaneous transluminal coronary angioplasty with des in the obtuse marginal branch and left main and with a bare metal stents vision 3.5 18 mm in the proximal and 3.0 23 mm (abbot vascular, abbott park, illinois, usa) in the distal dominant rca (figure 1a and 1b). After one year, he had recurrent angina and a complete occlusion of previous bare - metal stents of rca was noted . The patient underwent repeated coronary angioplasty with des and extensive reconstruction of the rca was accomplished using two promus (boston scientific, usa) 3.5 28 mm and a 3.5 15 mm followed by another 3.0 12 mm from the proximal to the distal portion of rca with excellent angiographic results (figure 1c) after high pressure over- dilation with 4.0 12 mm sprinter nc balloon (medtronic, minneapolis, minnesota, usa). Nevertheless after 8 mo the patient developed severe stress myocardial ischemia in the inferior territory associated with mild effort angina . The coronary artery angiography revealed diffuse proliferative and subocclusive in - stent restenosis of previous des (figure 1d). The patient was considered at risk for repeated bypass surgery, so a percutaneous ballaoon angioplasty with a medicated balloon was scheduled . Because the in - stent restenosis was too long to treat with a coated balloon, that usually can be used only one time for each inflation, an infusion balloon such as the genie (acrostak ag, stegackerstrasse 14, winterthur, switzerland) was selected . The device is composed of a balloon with two heads at each distal extremity which allow for stopping the blood flow for at least 80 s (ideally 120 s) and a central chamber with micro - holes which is filled up with liquid paclitaxel (130 - 170 mol) (figure 1e), and can be implanted at a low pressure (2 atm). Thus, the rca was wired and dilated with multiple inflation of a standard 3.0 30 mm sprinter balloon and then, four dilatation along the entire rca was accomplished with a 3.5 28 mm genie catheter . The immediate final (figure 1f) as well as 6 mo follow - up coronary angiographic results (figure 1 g) were excellent . The patient is free from symptoms and silent ischemia at 9 mo clinical and instrumental follow - up . The presented case suggests that drug - infusion balloon can offer an effective therapeutic option in selected patients with very extensive in - stent restenosis after des implantation . Although the number of published trials and patients treated with drug eluting - balloon is still limited, and its effectiveness in treating in - stent restenosis, and in particular in the treatment of restenosis after des has been only suggested but not yet proved, there is some promise for drug - coated stent for such purpose . Most drug - coated balloon cannot be used for more than one inflation and thus resulted useless in long segment treatment . The genie catheter has been used in in - stent restenosis after bare - metal stent implantation . However, to the best of our knowledge, this is the first report about its use in very long proliferative and occlusive in - stent - restenosis after des treatment.
The largest systematic review to date of the use of botulinum toxin for the management of both neurogenic and idiopathic detrusor overactivity (ndo and ido) revealed that 300iu onabotulinumtoxina was the most commonly reported dose in the former and 200u in the latter . With the initial off licence use of this therapy, well designed dosing studies were lacking and therefore, a dose of 300iu was commonly utilised in patients with proven detrusor overactivity . Subsequently, data emerged which showed the efficacy of lower doses of onabotulinumtoxina for both ndo and ido [2, 3]. We had been treating all patients with either ndo or ido with 300iu in our institution . In light of the new evidence, a decision was made in july 2008 to switch all new patients to an initial dose of 200iu . We found no evidence in the literature describing the feasibility of down titrating patients who had already received 300iu down to 200iu onabotulinumtoxina . Therefore our aim was to assess treatment efficacy and longevity after switching from 300iu to 200iu in patients with either ndo or ido . All patients admitted prior to june 2008 with detrusor overactivity (do) received 300iu onabotulinumtoxina at our institute . All 79 patients were started on 300iu onabotulinumtoxina and had proven detrusor overactivity prior to injection . After july 2008, due to the emergence of new evidence, we down titrated the administered dose to 200iu onabotulinumtoxina in all patients with do . A retrospective notes review was performed for all patients (group b) that had received 200iu after 300iu up to april 2011, to assess the efficacy and tolerability of dose reduction . Onabotulinumtoxina 100iu (allergan, irvine ca) was dissolved in 5 ml of normal saline, making a concentration of 20iu / ml . All patients were injected using a flexible cystoscope and an olympus needle using intraurethral 2% lidocaine hydrochloride gel anesthesia only . Injection volume was 0.5 ml resulting in 30 injections with 300iu and 20 injections with 200iu . We injected with evenly distributed intramural injections in the base and the posterolateral walls of the urinary bladder and spared the dome and trigone . All patients received a prophylactic course of antibiotic; ciprofloxacin 500 mg twice a day for three days is the preferred choice of antibiotic unless contraindicated . All patients were educated on the use of clean intermittent self catheterization (cisc) prior to receiving the injections . All patients were taught to record symptoms such as frequency of voids, urgency episodes, and incontinence episodes in a voiding diary . Urinary tract infections, which settled with antibiotic therapy microbiological evidence of bacteriuria were defined as appropriate urinary symptoms . Patients were instructed to telephone the continence specialist nurse when symptoms (frequency, urgency, and incontinence) returned and further injections were required . In order to assess overall perception of treatment satisfaction, at a three year follow up visit patients were also asked the following question: compared to previous injections, how much has this new dose changed your symptoms? Possible replies included: better than before, same as before, or worse than before . From 79 patients in group a, who started with 300iu onabotulinumtoxina injections, 44 patients went on to receive 200iu onabotulinumtoxina (36 female and 8 male). Of these, 16 patients had a diagnosis of ndo (figure 1 shows the underlying neurological diagnoses) and 28 patients of ido . Table 1 lists the reasons why 35 patients in group a did not receive any further injections . Underlying diagnoses in patients with ndo . The underlying reasons for which patients from group a did not proceed to receive further onabotulinumtoxina therapy after switching ndo patients to 200iu, 15 (94%) patients continued to report symptomatic improvement . Four patients (all with ndo) reverted back to receiving onabotulinumtoxina 300iu with good effect and two patients had another 200iu of onabotulinumtoxina after five months and reported good efficacy . Only one patient noticed shorter longevity of treatment with onabotulinumtoxina 200iu (3 months) compared to 300iu (5 months). Reduction rates of daytime frequency and nocturia in patients receiving 200iu onabotulinumtoxina were 87.5% and 81.3% respectively vs. 75% and 75% in the same group of patients when they were receiving 300iu onabotulinumtoxina . Significant or complete improvement in urgency was reported by 81% and 75% of patients receiving 300iu and 200iu respectively (figure 2). Subjective improvement in the urgency symptom in ndo patients while they were receiving 300iu and 200iu respectively . At three year follow up, 82% of ndo patients who had switched to the lower dose were happy with their symptomatic improvement and were keen to continue receiving 200iu onabotulinumtoxina . After switching ido patients to 200iu, 22 (79%) patients continued to report symptomatic improvement; five (18%) patients reported mild deterioration of their symptoms when they received 200iu onabotulinumtoxina, compared to their symptoms while they were receiving 300iu, and one patient did not attend follow up . The median longevity of efficacy was 67 months with both doses and only two patients noticed a shorter longevity of efficacy with 200iu (2 and 6 months) compared to 300iu (7 and 8 months). Reduction rates of daytime frequency and nocturia in patients receiving 200iu onabotulinumtoxina were 50% and 64% respectively, compared to 60.7% and 71.4% respectively in the same group of patients when they had previously received 300iu onabotulinumtoxina . The majority of ido patients reported either a significant or complete improvement in their urgency symptoms while they were receiving onabotulinumtoxina 300iu (82.2%) and 200iu (75%) (figure 3). Subjective improvement in the urgency symptom in ido patients while they were receiving 300iu and 200iu respectively . * 2 patients wished for no further treatments and 1 patient was unable to perform cisc . Three (7%) patients, all with ido, had to commence intermittent self follow up, 75% of ido patients who had switched to the lower dose were happy with their symptomatic improvement and were keen to continue receiving 200iu onabotulinumtoxina . Twelve out of 44 patients (both groups a&b) developed symptoms of uti, of which eight had positive urine culture . Rate of uti's and other complications (including cough, suprapubic pain, and lethargy) were comparable between both groups (table 2). Outcomes of injecting onabotulinumtoxina 300iu and 200iu in patients with ndo and ido patients experienced uti symptoms . Abdominal pain (1 patient), cough (1patient) and lethargy (1 patient) after switching ndo patients to 200iu, 15 (94%) patients continued to report symptomatic improvement . Four patients (all with ndo) reverted back to receiving onabotulinumtoxina 300iu with good effect and two patients had another 200iu of onabotulinumtoxina after five months and reported good efficacy . Only one patient noticed shorter longevity of treatment with onabotulinumtoxina 200iu (3 months) compared to 300iu (5 months). Reduction rates of daytime frequency and nocturia in patients receiving 200iu onabotulinumtoxina were 87.5% and 81.3% respectively vs. 75% and 75% in the same group of patients when they were receiving 300iu onabotulinumtoxina . Significant or complete improvement in urgency was reported by 81% and 75% of patients receiving 300iu and 200iu respectively (figure 2). Subjective improvement in the urgency symptom in ndo patients while they were receiving 300iu and 200iu respectively . At three year follow up, 82% of ndo patients who had switched to the lower dose were happy with their symptomatic improvement and were keen to continue receiving 200iu onabotulinumtoxina . After switching ido patients to 200iu, 22 (79%) patients continued to report symptomatic improvement; five (18%) patients reported mild deterioration of their symptoms when they received 200iu onabotulinumtoxina, compared to their symptoms while they were receiving 300iu, and one patient did not attend follow up . The median longevity of efficacy was 67 months with both doses and only two patients noticed a shorter longevity of efficacy with 200iu (2 and 6 months) compared to 300iu (7 and 8 months). Reduction rates of daytime frequency and nocturia in patients receiving 200iu onabotulinumtoxina were 50% and 64% respectively, compared to 60.7% and 71.4% respectively in the same group of patients when they had previously received 300iu onabotulinumtoxina . The majority of ido patients reported either a significant or complete improvement in their urgency symptoms while they were receiving onabotulinumtoxina 300iu (82.2%) and 200iu (75%) (figure 3). Subjective improvement in the urgency symptom in ido patients while they were receiving 300iu and 200iu respectively . * 2 patients wished for no further treatments and 1 patient was unable to perform cisc . Three (7%) patients, all with ido, had to commence intermittent self follow up, 75% of ido patients who had switched to the lower dose were happy with their symptomatic improvement and were keen to continue receiving 200iu onabotulinumtoxina . Twelve out of 44 patients (both groups a&b) developed symptoms of uti, of which eight had positive urine culture . Rate of uti's and other complications (including cough, suprapubic pain, and lethargy) were comparable between both groups (table 2). Outcomes of injecting onabotulinumtoxina 300iu and 200iu in patients with ndo and ido patients experienced uti symptoms . Abdominal pain (1 patient), cough (1patient) and lethargy (1 patient) to our knowledge, this cohort study is the first to evaluate the feasibility of switching patients with ndo from 300iu to 200iu onabotulinumtoxina in real life clinical practice and the first to assess the longevity of this treatment . A recent abstract presented at the 2012 eau congress reported similar efficacy and quality of life improvements in 46 neurogenic patients with do who switched from 300iu to 200iu . We found a similar subjective efficacy with onabotulinumtoxina 200iu among ndo patients when compared to 300iu, once an effective dose had been administered . Confirmation of this finding is provided by a study reported in abstract form by ginsberg et al ., which has reported similar findings to ours in terms of longevity of treatment . They reported that the median time until repeated treatment was not different between 200iu and 300iu at 36.6 weeks and no significant differences were seen in the improvements over baseline in the bladder diary parameters . However, in that study both groups of patients were exclusive and the patients were not switched to the lower dose . Cruz et al . Have compared 200iu or 300iu onabotulinumtoxina against placebo . By two weeks, both doses had led to significant improvements in urgency incontinence episodes per week in patients with multiple sclerosis and spinal cord injury . Although at two weeks the difference between urgency incontinence episodes was less than three per week (10%) in favour of 300iu, this was not deemed significant, and by 12 weeks there was no difference between the doses . Median time until repeated treatment for both doses was 42 weeks compared to 16 weeks for placebo . In patients catheterisation, increases in post void residue were reported in 12, 30 and 42% of the placebo, 200iu and 300iu groups respectively . Only one serious, treatment related, similarly, apostolidis et al . Have assessed 50iu, 100iu and 200iu onabotulinumtoxina in ndo patients, randomised against placebo in 19, 21, 17 and 16 patients respectively . Significant symptomatic improvements compared to placebo were only seen in the 200iu group, however due to the low power of the study, significant differences in the use of the lower doses were not seen over 54 weeks . A different formula of 1012iu / kg is utilised . With this, zeino et al . Similarly to ndo, we did not find any clinical difference in the subjective efficacy among the ido patients when they received onabotulinumtoxina at a dose of both 300iu and 200iu . This was also noted in the dmochowski study, where they reported the proportion of patients requiring intermittent catheterisation were 21% and 16% in the 200iu and 300iu groups respectively . However, we feel that this is not a significant finding in an underpowered retrospective study; since, in the dmochowski study, a lower dose of onabotulinumtoxina was similarly efficacious with a lower retention rate . Our study is limited by the relatively small number of patients involved . The lack of randomisation of patients to different therapeutic dose groups and lack of variation in the baseline demography of patients are also limiting factors ., has also reported significant improvements in frequency, incontinence, and quality of life (qol) scores over placebo for 100iu, 150iu, 200iu and 300iu onabotulinumtoxina . Response curve revealed that doses greater than 150iu did not impart further significant symptomatic improvements . Fifty units were shown to lead to significant improvements in incontinence episodes but the proportion of patients who were completely dry was less than with higher doses . Denys et al . Have investigated even lower doses of onabotulinumtoxina (50iu, 100iu and 150iu) versus placebo in ido patients with greater than three urgency or urgency incontinence episodes in a three day diary . Reduction of urgency and/or urgency incontinence rates by 50% were 29%, 37%, 65% and 56% for the placebo, 50iu, 100iu and 150iu groups . Only three patients with a post void residual volume over 200ml were reported in the 150iu group . Although the authors state that a greater number of incontinent patients became dry with 150iu, this was not deemed significant . The limitation of this sub limitations of our study include its retrospective nature and the fact that it relies on the accuracy of past documentation . In addition, there was a 1/3 reduction in the volume of injection and number of injection sites with 200iu . Data from guinea pig bladders has shown 2iu dissolved in 20 ml led to increased cleaving of snap25 compared to 2iu in 2 ml both given as single injections . Although we did not find significant differences in outcomes, it must be recognised that the dose was not the only parameter altered in this study . Furthermore, it has been suggested that injection of the trigone improves outcomes without adverse events [13, 14]. We spared the trigone due to earlier concerns regarding the possible occurrence of ureteric reflux if the trigone was injected . One study has shown no differences between intradetrusor and suburothelial injections, however the number of patients for each was only 15 and therefore limited information can be gained from this . In real life to our knowledge, this cohort study is the first to evaluate the feasibility of switching patients with ndo from 300iu to 200iu onabotulinumtoxina in real life clinical practice and the first to assess the longevity of this treatment . A recent abstract presented at the 2012 eau congress reported similar efficacy and quality of life improvements in 46 neurogenic patients with do who switched from 300iu to 200iu . We found a similar subjective efficacy with onabotulinumtoxina 200iu among ndo patients when compared to 300iu, once an effective dose had been administered . Confirmation of this finding is provided by a study reported in abstract form by ginsberg et al ., which has reported similar findings to ours in terms of longevity of treatment . They reported that the median time until repeated treatment was not different between 200iu and 300iu at 36.6 weeks and no significant differences were seen in the improvements over baseline in the bladder diary parameters . However, in that study both groups of patients were exclusive and the patients were not switched to the lower dose . Cruz et al . Have compared 200iu or 300iu onabotulinumtoxina against placebo . By two weeks, both doses had led to significant improvements in urgency incontinence episodes per week in patients with multiple sclerosis and spinal cord injury . Although at two weeks the difference between urgency incontinence episodes was less than three per week (10%) in favour of 300iu, this was not deemed significant, and by 12 weeks there was no difference between the doses . Median time until repeated treatment for both doses was 42 weeks compared to 16 weeks for placebo . In patients catheterisation, increases in post void residue were reported in 12, 30 and 42% of the placebo, 200iu and 300iu groups respectively . Only one serious, treatment related, similarly, apostolidis et al . Have assessed 50iu, 100iu and 200iu onabotulinumtoxina in ndo patients, randomised against placebo in 19, 21, 17 and 16 patients respectively . Significant symptomatic improvements compared to placebo were only seen in the 200iu group, however due to the low power of the study, significant differences in the use of the lower doses were not seen over 54 weeks . A different formula of 1012iu / kg is utilised . With this, zeino et al . Similarly to ndo, we did not find any clinical difference in the subjective efficacy among the ido patients when they received onabotulinumtoxina at a dose of both 300iu and 200iu . This was also noted in the dmochowski study, where they reported the proportion of patients requiring intermittent catheterisation were 21% and 16% in the 200iu and 300iu groups respectively . However, we feel that this is not a significant finding in an underpowered retrospective study; since, in the dmochowski study, a lower dose of onabotulinumtoxina was similarly efficacious with a lower retention rate . Our study is limited by the relatively small number of patients involved . The lack of randomisation of patients to different therapeutic dose groups and lack of variation in the baseline demography of patients are also limiting factors . The dose ranging study, by dmochowski et al ., has also reported significant improvements in frequency, incontinence, and quality of life (qol) scores over placebo for 100iu, 150iu, 200iu and 300iu onabotulinumtoxina . Response curve revealed that doses greater than 150iu did not impart further significant symptomatic improvements . Fifty units were shown to lead to significant improvements in incontinence episodes but the proportion of patients who were completely dry was less than with higher doses . Denys et al . Have investigated even lower doses of onabotulinumtoxina (50iu, 100iu and 150iu) versus placebo in ido patients with greater than three urgency or urgency incontinence episodes in a three day diary . Reduction of urgency and/or urgency incontinence rates by 50% were 29%, 37%, 65% and 56% for the placebo, 50iu, 100iu and 150iu groups . Only three patients with a post void residual volume over 200ml were reported in the 150iu group . Although the authors state that a greater number of incontinent patients became dry with 150iu, this was not deemed significant . The limitation of this sub limitations of our study include its retrospective nature and the fact that it relies on the accuracy of past documentation . In addition, there was a 1/3 reduction in the volume of injection and number of injection sites with 200iu . Data from guinea pig bladders has shown 2iu dissolved in 20 ml led to increased cleaving of snap25 compared to 2iu in 2 ml both given as single injections . Although we did not find significant differences in outcomes, it must be recognised that the dose was not the only parameter altered in this study . Furthermore, it has been suggested that injection of the trigone improves outcomes without adverse events [13, 14]. We spared the trigone due to earlier concerns regarding the possible occurrence of ureteric reflux if the trigone was injected . One study has shown no differences between intradetrusor and suburothelial injections, however the number of patients for each was only 15 and therefore limited information can be gained from this . In real life this study shows that down titrating ndo and ido patients treated with 300iu to 200iu onabotulinumtoxina leads, in 90% of cases, to similar efficacy with no apparent reduction in longevity of treatment . Patients with ndo may need up titrating back to 300iu . Larger, multi centre studies investigating effects of lower doses would support these observations . Although it has some weaknesses, to our knowledge this is the first study which explores the feasibility of dose down titration in real life clinical practice
In the last decade, the worldwide distribution in the different environmental compartments of perfluoroalkyl substances (pfas) became a concern for the scientific community [14]. This class of chemicals has been used in a wide range of industrial and consumer products for the past six decades mainly to repel dirt, water, and oil [5, 6]. Pfas include thousands of chemicals, but the environmental studies have been concentrated mainly on two classes of perfluoroalkyl acids (pfaa), that is, perfluorosulphonic acids (pfsa), which include perfluorooctanesulphonic acid (pfos), and perfluorocarboxylic acids (pfca), which include perfluorooctanoic acid (pfoa). Pfsa and pfca are low molecular weight surfactants in which all carbons are bonded to fluorine atoms, consisting of homologous series of molecules that differ in carbon chain length . Pfos and pfoa have been demonstrated to be persistent in the environment and bioaccumulative in the trophic chain . The accumulation in the aquatic trophic chain poses concern about the risks for the end consumers, including humans . After a risk assessment study, the european commission very recently introduced pfos in the list of priority hazardous substances which must be monitored in the eu water bodies, setting an environmental quality standard (eqs) of 0.65 ng / l for freshwater and maximum allowable concentrations (mac) of 36 g / l and 7.2 g / l for inland and other surface waters, respectively, while the us environmental protection agency (epa) proposed provisional health advisories of 400 ng / l and 200 ng / l, respectively, for pfoa and pfos in drinking waters . In italy, eqss for five pfaa in surface waters have been recently proposed and are currently under discussion: the lowest eqs is 100 ng / the introduction of regulatory restrictions in the use of pfos and pfoa [9, 10] induced the major pfas producers to find other substitutes for these compounds especially among the congeners with different chain lengths . The homologues, which have usually from 4 to 14 carbon atoms (c) for pfca and from 6 to 10 c for pfsa, show very different physicochemical behaviours which present a serious challenge for the simultaneous determination of pfaa in water samples . Solubility strongly decreases by increasing the chain length, for example, from 100 g / l for pfhpa to 0.1 g / l for pfunda [11, 12], while acidity decreases as the chain length increases (pkas vary from 0.1 to 3.8 in the range pfba - pfdoda) (and references therein). The increase of the number of cf2 moieties also leads to a significant increase in lipophilicity expressed as pkow; for example, from pfhxa to pfdoda pkows increase from 3.68 to 9.21 (and references therein). All these physicochemical variables drastically influence recoveries with classical extraction techniques such as liquid - liquid extraction (lle) or solid phase extraction (spe). According to the review of jahnke and berger, lle worked best for pfaa with carbon chain lengths> 7 whereas spe was best suited for pfaa with <10 carbon atoms . Major drawbacks of the spe approach in pfaa analysis are the sample contamination and possible losses of the surface - active pfaa to container walls and other materials (tubing, connections) besides the problems inherent in spe such as breakthrough and clogging of the column . Moreover, spe requires the extraction of large volumes of sample and solvent recovery of the adsorbed molecules followed by solvent concentration and the whole procedure can take some hours . The automation of spe has been employed to increase sample throughput for many years [15, 16] and on - line spe coupled to lc - ms has been also applied to the analysis of pfaa in water samples [1721]. The on - line spe made the development of faster methods by reducing the analysis time and thus increasing the analytical productivity possible . The challenge of the on - line spe methods is still to optimize preconcentration and elution procedures to achieve a satisfactory accuracy in a single run for a class of compounds with different physicochemical variables such as pfaa . In addition, the coupling of on - line spe with uhplc is not easy due to the high back pressure generated from the use of high flow rates with a low particle size column (<2 m). Furthermore, it is common to have release of pfaa (mainly pfoa) from the uhplc hardware since polytetrafluoroethylene is often used in the manufacturing of tubing and fittings and seals in uhplc systems . An extra column can be placed before the injector to delay the elution of pfaa from the pump and distinguish between pfaa actually present in the sample and those released by the system . This implies that the system may contain up to 3 columns connected in - line (trap, preconcentration, and chromatographic column). The aim of our work is to explore the possibility of optimizing an on - line spe / uhplc - ms / ms method for pfca and pfsa ranging, respectively, from 4 to 12 and from 4 to 8 carbon atoms and to understand the factors that influence the method accuracy . The optimized and validated method was then applied to a large survey of italian surface and drinking waters whose preliminary results are presented in this paper . Perfluorobutanoic acid (pfba), perfluoropentanoic acid (pfpea), perfluorohexanoic acid (pfhxa), perfluoroheptanoic acid (pfhpa), perfluorooctanoic acid (pfoa), perfluorononanoic acid (pfna), perfluorodecanoic acid (pfda), perfluoroundecanoic acid (pfunda), perfluorododecanoic acid (pfdoda), tetrabutylammonium perfluorobutane sulphonate (pfbs), potassium perfluorohexane sulphonate (pfhxs), and tetrabutylammonium perfluorooctane sulphonate (pfos) were purchased from sigma - aldrich (st . Louis, mo, usa). Separate stock solutions of the analytes were prepared in methanol at a concentration of 1.0 mg / ml of the anionic compound . A multicomponent standard solution containing the 12 analytes at 10 / l) containing all analytes were freshly prepared by serial dilution of the methanolic mixed solution of standards in clean drinking water . Stable isotope labelled pfca and pfsa internal standard compounds (sil - is) were purchased from wellington laboratories (guelph, on, canada) in 2 g / ml solution mixtures . Sil - is were c4-pfba, c2-pfhxa, c4-pfoa, c5-pfna, c2-pfda, c2-pfunda, c2-pfdoda, o2-pfhxs, and c4-pfos . The solution of sil - is was diluted to a concentration of 40 ng / ml with methanol . Supelco - supelclean envicarb, lc - ms chromasolv methanol, lc - ms chromasolv acetonitrile, ammonium acetate (99%), and concentrated formic acid were purchased from sigma - aldrich . Water (<18 m cm resistivity) was produced by a millipore direct - quv water purification system (millipore, bedford, ma, usa). The surveyed river basins were rivers po, adige, and brenta in northern italy and rivers arno and tevere in central italy . In the river po basin, samples were collected also from the main tributaries bormida, tanaro, ticino, lambro, adda, oglio, and mincio (figure 1). River waters were collected by means of a bucket at the centre of the river bed . Samples from lake (lake como) and transitional environments (lagoons of venice and goro in the po delta) were directly collected in the sampling vials by manually dipping the vial below the water surface from a boat . The samples were collected in polypropylene (pp) centrifuge tubes and kept in a refrigerator at 4c until analysis . Contamination or adsorption of target compounds onto tube surfaces was assessed by analysing selected samples (3 drinking water samples with low levels of contamination, 3 river samples with low levels of contamination, and 3 river samples with high levels of contamination) just after collection and after 1 month, without significant differences in the resulting concentrations . In order to prevent the clogging of any parts of the injector or column all aqueous samples were centrifuged . Before injection, in the final analytical procedure, standards and samples were acidified to ph 3 by adding 50 l of concentrated formic acid to 10 ml of sample directly into the glass vials of the autosampler . For native spiking experiments, known volumes of the standard mixed solution containing the 12 analytes were added to aqueous sample to give a target concentration of 100 ng / l . For sil - is spiking experiments, 25 l of the diluted sil - is solution was added to native - spiked aqueous samples to obtain concentrations of 100 ng / l both of native and of stable isotope labelled perfluorinated compounds . The on - line spe has been carried out by a thermo equan system which consists of two thermo scientific accela lc pumps (600 and 1200) with a preconcentration column (thermo hypersil gold aq 12 m, 20 2.1 mm), an analytical column (thermo hypersil gold pfp 1.9 m, 50 2.1 mm), and a ctc pal autosampler equipped with three 6-way vici valves (figure 2). Samples were injected into a high volume loop (figure 2(a)) and then transferred onto the preconcentration column by the loading pump (thermo scientific accela 600) using 2 mm ammonium acetate (nh4oac) with 5% methanol (meoh) eluent at 1200 l / min (figure 2(b)). When the enrichment step was completed (260 s), a 6-way valve on the autosampler switched over and the elution pump (accela 1200) flowed the elution gradient, composed of two eluents [(a) 2 mm nh4oac-5% meoh and (b) methanol] at 300 l / min, through the preconcentration column and the analytical column (figure 2(c)). The loading and the elution gradients are illustrated in table 1 . In order to delay the interfering background peaks of perfluorinated compounds, which are present in solvents or are released from the analytical system, a trap column (thermo hypersil gold 1.9 m, 50 2.1 mm) has been placed between the analytical pump and the injection valve . A triple quadrupole mass spectrometer (thermo scientific tsq quantum access max) equipped with a heated - electrospray ionization (hesi - ii) probe was used . The source - dependent parameters were as follows: spray voltage (3000 v); sheath gas pressure (25 psi); auxiliary gas pressure (10 arbitrary units); skimmer offset (0 v), ion transfer tube temperature (270c), vaporizer temperature (40c); high purity argon (> 99.98%) which was used as the collision gas (1.5 mtorr). The mass spectrometer operated at a resolution of 0.7 da in negative selected reaction monitoring (srm) mode . Table 2 lists the ms / ms transitions, tube lens offset, and collision energies applied for the different target analytes and isotope labelled standards . The xcalibur 2.1 (thermo scientific) was used for instrument control, data acquisition, and processing . Analytes were identified by comparing their retention times (rt) with the rt of the sil internal standards (deviation 0.25%) when possible and with the rt of the reference standards if no sil internal standard was available . For all the analytes, except pfba, one precursor and two product ions were monitored; pfba does not fragment into two stable product ions and only one precursor and one product ion were monitored (table 2). Separate stock solutions of the analytes were prepared in methanol at a concentration of 1.0 mg / ml . A standard mixed solution in methanol containing the 12 selected analytes at 5 or 10 g / ml was made from the stock solutions . The sil - is solution was diluted to 40 ng / ml with methanol . The aqueous standard solutions were freshly prepared by serial dilution of the methanol standard mixed solution in real drinking water which was devoid of analysed contaminants . Quantification was performed by using the isotopic dilution method and calibration curves were made before each analytical run . Before injection, standards and samples were acidified to ph 3 and spiked with sil - is by adding 50 l of concentrated formic acid and 25 l of the diluted sil - is solution (40 ng / ml) to 10 ml of sample . Blank samples (clean drinking water) were injected at the beginning and at the end of the analytical sequence and every ten samples . Applicability to different typologies of waters, including saltwater and wastewater, was tested through fortifications of the different sample matrices . Relative recoveries were in the same range calculated during validation procedures (75 and 135%). The performance of the on - line - spe - uhplc - ms / ms method was verified in the pfos and pfoa in surface water analytical results were satisfactory with calculated z - scores of + 1.43 and + 1.70 and expanded relative uncertainty of 13% and 10% for pfos and pfoa, respectively . In an on - line spe procedure, several experimental variables, such as sample volume and sample ph, should be optimized in order to achieve the maximum extraction efficiency of the target analytes . Generally, it may be difficult to achieve comparable and reliable efficiencies for all target compounds when the analytes have a broad range of polarity . In order to get the maximum chromatographic efficiency the trapped analytes should be eluted and refocused onto the analytical column by the analytical elution gradient by the time the extraction column is switched into the analytical flow path . However in multiresidue analysis, the gradient elution for reversed - phase separations usually starts at high percentage of aqueous in the mobile phase, and the slow elution from the spe preconcentration column results in peak broadening, which may cause a decrease in efficiency and thereby in sensitivity [22, 23]. For these reasons, before carrying out the method validation, the optimisation of the elution gradient and the volume as well as the matrix modification of the injected sample was carried out in order to achieve the best recovery and sensitivity for the on - line spe / uhplc - ms / ms analysis of the perfluorinated carboxylic and sulphonic acids . Optimisation of the analytical separation was carried out by direct injection of standard solutions with a 25 l loop . The elution gradient started at only 5% of mobile phase b (methanol) in order to separate the shorter chain pfca (pfba and pfpea). An initially faster gradient with mobile phase b raising from 5 to 70% within 2 min followed by a slower gradient with mobile phase b raising up to 100% within 5 min allowed the separations of all perfluoroalkyl acids and the elution of the longer chain homologues (pfunda and pfdoda) within 5 min . Then, an isocratic step at 100% methanol for 3.5 min was followed by a fast return to 95% of mobile phase a in 1 min and a conditioning step of 4 min at starting composition before the following analysis . In the on - line spe method, during the sample loading step, analytes are trapped in the stationary phase of the preconcentration column . Then, elution of analytes is achieved in back - flush mode by putting in - line the preconcentration column with the eluting mobile phase . The first approach was simply to use in the on - line procedure the separation gradient elution program, as optimised by direct injection of analytes . In this case (table 1: unchanged gradient) the gradient program started soon after the end of the loading of the sample into the preconcentration column (4.34 min). Throughout the so - called loading time, a solvent mixture at the initial conditions (5% methanol) isocratically flowed through the chromatographic column . By using these settings, peak broadening and distortion were observed for the shorter chain and more polar homologues (pfba and pfpea), because these compounds, which show lower affinity for the preconcentration column stationary phase, were poorly focused on the preconcentration column . To overcome this problem, the this technique provides elution bands of only a few seconds width using high percentage solvent in order to get a rapid transfer of the analytes from the preconcentration column to the analytical column as well as to keep them focused . Generated short plugs of high - elution strength solvent by means of an external loop and an additional lc - pump . We achieved the same high - elution strength solvent plugs by using the separation uhplc pump which is characterised by very low dead volumes . A step with a high percentage of organic solvent (80% methanol) was inserted in the eluting gradient at the switching time, in order to provide narrow high - elution strength eluent band containing all the eluted analytes (table 1: plug gradient). The subsequent elution gradient was modified in order to obtain a chromatographic separation similar to the one used for direct injection of the sample (table 1). The effects of the different elution gradient are reported in figure 3(a) which shows the height ratios between the analyte peaks detected with the plug gradient and those obtained with the unchanged gradient . Both early- and late - eluting perfluorocarboxylic acids benefited from plug gradient by improving the shape of their peaks whereas no significant effects were detected for pfsa . The peak heights improved up to 3.7 times for the less retained pfca . Nevertheless, the optimization of the solvent plug injection technique is laborious and highly time - consuming because it involves several runs to find out the best high - elution strength solvent and elution band width as well as the subsequent elution gradient in order to avoid loss of retention along with severe peak distortion and artefact formation . Finally, we tested a further and simpler approach: when the loading on preconcentration column is still on going, we anticipated the start of the gradient program in separation column, and, in this way, when the mobile phase is switched on the preconcentration column, the mobile phase had an higher solvent percentage and thereby is able to quickly transfer analytes onto the separation column with a focusing effect (table 1: early gradient). The optimum mobile phase composition at the switching time is determined by calculating the composition when the first peak (pfba) elutes in the chromatographic run obtained by direct injection of the standard mixture without a preconcentration step . Improvements in the pfaa peak heights with respect to the unchanged gradient were analogous to those obtained by the injection plug technique and even better for the longer chain pfca (figure 3(a)). Because of its simplicity, the sample volume effect was evaluated comparing the peak areas obtained by injecting 1 and 5 ml of the highest standard mixture (200 ng / l). Proportionality was satisfactory (figure 3(b)), with an average response ratio of 4.1 for pfsa and pfca from 6 to 12 carbon atoms, despite a slight peak broadening . Only pfba and pfpea did not show any proportional improvement in the response when the loop volume increased, suggesting that the shorter homologues in the perfluorocarboxylic acid series have smaller breakthrough volumes on the concentration column . The loss in efficiency attributable to the on - line preconcentration step was evaluated by comparing the peak areas obtained in the on - line spe (injection volume: 5 ml) with those obtained by direct injection (injection volume: 25 l) of the same analyte mass (100 pg). As shown in figure 3(c) ratios of peak areas close to 1 (0.751.2) were obtained for all pfsa homologues and the pfca with carbon chain length greater than 6, indicating an efficient extraction for those compounds . Differently, the response of the more soluble pfca (pfba and pfpea) in the on - line spe method was much lower than that obtained by direct injection (0.10.2) because of their limited affinity for the stationary phase of the preconcentration column . Since all target analytes are acid compounds, samples were acidified to ph 3 by adding 50 l of concentrated formic acid in order to improve their retention on the endcapped c18 phase of the preconcentration column . Acidification significantly improved the peak areas of the less retained and more soluble homologues (pfba, pfpea, pfhxa, and pfbs) whereas no effects were pointed out for the homologues with a longer carbon chain (figure 3(d)). This can be explained by the fact that the acidification suppresses the ionization of the pfca, and thereby increases their affinity for the reverse stationary phase of the preconcentration column . The effect on the lc - ms / ms response for the pfaa was also examined as a function of the percentage of solvent (acetonitrile and methanol) modifier in the water samples . Addition of organic solvent (10%) to the sample before the injection caused a decrease in the area response for shorter and longer chain perfluorocarboxylic homologues (peak area ratio ranging from 0.65 to 0.75). However, this effect was not observed when injecting 25 l of the aqueous standards directly onto the analytical column without preconcentration step: in the latter case peak areas and symmetry increased with perfluorinated carbon chain when the standard was prepared in water and methanol . The negative effect on response of the solvent addition procedure in on - line spe may be attributed to a loss of retention on the preconcentration column . Finally, the optimised procedure was to acidify the sample at ph 3 without further matrix modification . The optimised method (early gradient), with 5 ml injection volume of acidified samples, was subjected to the validation procedure . Lc - esi - ms / ms is the most suitable analytical technique for the analysis of the target compounds though it may suffer from matrix effects on the ionization efficiency (and references therein,). Matrix effects on the ionization in esi - ms / ms determination are usually evaluated by comparing the signal responses of target compounds in matrix extracts, spiked immediately before instrumental analysis, with those in standard solutions . But when the extraction step is on - line connected with the hplc separation the effects of sample matrix on extraction recovery cannot be evaluated separately from the matrix effects on efficiency of ionization . Total matrix effects in the on - line spe analysis of target compounds were determined analysing native - spiked aqueous samples at a 100 ng the experiments were carried out with different matrices: drinking water produced from ground water (tw1 and tw2) and from lake water (tw3), surface water from rivers with a low level of pollution (rw1 and rw3), and rivers impacted by industrial discharges (rw2) and by organic domestic wastewaters (rw4). Total matrix effects ranged between 70 and + 35% with more than 80% of the results included in the range 30% . Suppression of the signal response of the target compounds was found in some samples, both drinking and river waters, for short, as well as long carbon chain perfluorinated homologues (figure 4). We tested the possibility to remove the matrix by dispersive spe clean - up with activated graphitized carbon (envi - carb), which has been successfully employed to purify methanol and acetonitrile extracts for pfaa analysis, but very low recoveries of the target analytes in aqueous samples (results not shown) were achieved . We explored, thus, the utilisation of isotope dilution with sil - is analogues to correct matrix effects on ionization efficiency as well as to compensate for variation in injection, sample extraction, and instrumental parameters . For some target compounds, the peak area of the coeluting sil figure 5(a) shows the pfoa and pfhxs results obtained in the analysis of calibration standards spiked with sil - is at 100 ng / l level . This effect was also observed with a 25 l direct injection, without the preconcentration step, indicating that the effect is not due to a competition on the active sites in the preconcentration column but it is really a suppression effect in the electrospray ionization . Previous reports have noted mutual ionization suppression between target analytes and their coeluting sil - is [27, 28] which was attributed to the competition among ions for the limited number of excess charge sites on the generated droplet during electrospray ionization [29, 30]. Liang et al . Investigated this phenomenon for nine drugs: generally, the extent of suppression in each drug - sil - is pair was concentration - dependent and was correlated with the hydrophobicity of the compounds . Maximum suppression was determined for each perfluorinated sil - is at 200 ng / l native concentration (figure 5(b)). The suppression of pfca decreases with the increase of the number of carbon chain length, but the suppression of pfsa is lower for the shorter chain homologues . Quantitation, however, was not affected by the variation in the peak area of the internal standard . Mutual suppression effects of target analytes and sil - is are equal and this ensures good linearity of peak area ratio versus analyte concentrations . Results of figure 4(a) were recalculated using sil - is calibrations (figure 4(b)). The scattering of the results was significantly reduced: total matrix effects ranged between 34 and + 39% . Sil - is successfully corrected the effects on the ionization as well as any eventual losses during the on - line extraction step . The linearity of the instrumental response was assessed by injecting five levels of aqueous standards with native analyte concentrations spanning two orders of magnitude (1, 5, 10, 50, and 100 ng / l for pfunda and pfdoda and 2, 10, 20, 100, and 200 ng / l for the remaining compounds) spiked with sil - is at 100 ng working calibration curves presented acceptable linearity range and coefficients of determination (r) higher than 0.95 for all target compounds (table 3). Deviations from the linearity occurred at the highest concentrations where mutual suppression with sil - is is likely to occur (see section 3.2.1). Nevertheless, most of the measured concentrations fell into the linear part of the calibration curves . Limits of detection (lod) and limits of quantification (loq) were estimated as threefold and tenfold, respectively, the standard deviation of the aqueous standard solutions, prepared in real drinking waters, at the lowest injected concentrations (1 and 2 ng / l), according to the iso 6107 - 2: 2006 standard . Ng / l and from 1 to 20 ng / l, respectively (table 3). It is important to emphasize that these values refer to the whole analytical procedure, incorporating mutual ionization suppression and recovery losses, while the detection limits estimated from solvent calibration curves usually underestimate the true values . Method precision has been evaluated by 3 replicate injections of standards prepared in real drinking waters in the 1100 ng / l range for pfunda and pfdoda and 2200 ng / l range for the other compounds on 4 nonconsecutive days (table 3). Repeatabilities (intraday precision) and reproducibilities (interday precision) were under 20% for carboxylic acid homologues from 7 to 9 carbon atoms while pfbs, pfhxs, pfos, pfba, pfpea, pfhxa, pfda, pfunda, and pfdoda showed rsds from 30 to 65% at the lower limits of the explored range which was very close to their detection limits . Trueness is expressed as recoveries determined by analysing spiked drinking and river waters since no certified reference materials were available for pfaa in these matrices . The recoveries were between 76 and 134% for pfca and between 87 and 115% for pfsa (table 3). The validated on - line spe / lc - ms / ms methodology has been applied in a wide survey of the pfaa concentrations in italian surface and drinking waters with the aim to get a reliable picture of pfaa contamination and sources in italian waters . The low volumes needed for the on - line extraction allowed us to minimise the duration of the sampling campaigns, avoid the need for a large refrigeration system during the travel, and thus minimise the risk of sample degradation and contamination during the transport to the laboratory . Data summarized in table 4 showed that the method can be applied to the monitoring of different typologies of waters, including complex matrices, such as saline waters of coastal lagoons and discharges from industrial and urban wastewater treatment plants (wwtps). Results of monitoring of italian surface waters have been recently discussed by valsecchi et al . . Monitoring data of rivers in northern italy, which includes rivers in the basins of river po, adige, and brenta which discharges into the adriatic sea, show that the highest concentrations were measured for pfoa and pfbs, while the highest detection frequencies were found for pfoa, pfhxa, and pfbs . The highest concentrations were measured downstream the discharges of perfluorinated compounds and polymers factories, but the detection frequency suggests that the same compounds were diffused in many rivers of the explored territories . Rivers in central italy (belonging to the basins of tevere and arno rivers) were less impacted and the only substances measured at concentrations> 100 ng / l were pfoa and pfbs . Pfhxa, pfoa, and pfos were detected at the highest detection frequency in ground waters used for drinking water abstraction (table 4) and these findings reflected diffuse and historical pollution coming both from urban pressure and industrial pressure on the territory . Ng / l) which was much diffused since the 80s, but it is currently subject to restrictions in use . Nevertheless, it should be underlined that all measured concentrations were significantly lower than the provisional health advisories of 400 ng / l and 200 ng / l proposed by us epa, respectively, for pfoa and pfos in drinking waters, showing a very limited risk for the final consumer . The validated on - line spe - uhplc - lc / ms / ms method has been successfully used also for determining pfaa in difficult matrices . We were able to determine low concentrations of pfaa in transitional waters, characterised by a range of salinity from 23 to 31, collected in the lagoons of venice and in the po delta . We also analysed effluents from industrial and urban wwtps and, after the appropriate dilution, concentrations up to 4.8 mg / samples were injected in the system after centrifugation and dilution and matrix effects were minimized by using internal isotopically labelled standards . The use of on - line spe coupled with uhplc, with 2 m particle size columns, made the development of faster methodology by reducing the analysis time and thus increasing the sample throughput possible . However, reduction of the total analysis time originating from the development of ultrafast separation and the reduced sample treatment may introduce new analytical challenges during method development, such as increase of ionization matrix effects and loss of chromatographic efficiency . In this work, we present the development and validation of a rapid analytical method for the simultaneous determination of compounds with different polarities and other physicochemical properties such as pfca and pfsa . Manual sample preparation was reduced to sample centrifugation and acidification, thus eliminating several procedural errors and contamination and significantly reducing costs and analytical time, which was only about 20 min from extraction to analysis . Method development was carried out after having understood the factors that can negatively impact the on - line spe methodology . Optimization of elution gradient and acidification of the aqueous samples allowed reliable chromatographic efficiencies for all compounds, including shorter chain perfluorocarboxylic acids such as pfba and pfpea . Mutual ionization suppression between target perfluorinated analytes and their coeluting sil - is was reported for the first time for perfluorinated compounds . Generally, the extent of suppression in each target compound - sil - is pair was correlated with the carbon chain length . Validated on - line spe - lc - ms / ms method has been applied in a wide survey of the concentrations of pfaa in italian surface and drinking waters . The method is able to measure contaminants at the environmental levels in urbanized and industrialized areas and attain most of the adopted quality standards except for european eqs for pfos (0.65 ng / l) which is considered a challenging limit for every lc - ms analytical method.
Since the introduction of the guglielmi detachable coils in the early 1990s, endovascular detachable coil embolization has become one of the most preferred treatment modalities for intracranial aneurysms . However, some technical complications of endovascular coil embolization of intracranial aneurysms have yet to be overcome, such as intraprocedural aneurysmal rupture, thromboembolism, parent artery occlusion, and coil migration either during the procedure or after coil embolization . When such a complication occurs, immediate open surgery is required as soon as possible in order to save the patient from severe sequela or even death . We report on migration of a coil into the inferior branch of the middle cerebral artery (mca), which was retrieved by craniectomy and arteriotomy . The coil migration occurred during an endovascular embolization performed for treatment of a mca bifurcation aneurysm at a local medical center where no neurovascular surgeon is available . A 63-year - old man was referred to chonbuk national university hospital emergency center because of a coil migration during endovascular coil embolization . He had received treatment for a left mca bifurcation unruptured aneurysm at a local medical center . A neurovascular surgeon was not present at this particular medical center and the nearest hospital with one who could perform surgical management and endovascular management for such a patient with a coil migration complication was chonbuk national university hospital, which was located approximately two hours away from the local medical center . At admission, he had stuporous mental status and right hemiparesis grade iii . Initial brain computed tomography taken at the emergency center showed no intracranial hemorrhage, but showed a metallic object which appeared to be a migrated coil around the left insula (fig . Cerebral angiography performed at the local medical center showed a saccular aneurysmal sac, which measured 9.41 mm 6.54 mm in size with a relatively broad neck of 4.38 mm at the left mca bifurcation (fig . The coil part of coil embolization had detached from the aneurysmal sac and migrated to the left m2 inferior branch (fig . An emergency left pterional craniectomy was performed . After a left fronto - temporal opening, following dissection of the sylvian fissure, the aneurysmal sac and m2 inferior branch were found, and the aneurysmal sac was in an unruptured state . After placement of temporary clips at the proximal and distal m2 inferior branch, the artery was incised, and the migrated coil and thrombus were visualized (fig . The migrated coil and thrombus were removed gently and safely, and the arteriotomy vessel was repaired with 10 - 0 nylon (fig . An intraoperative trans - cranial doppler ultrasound confirmed the presence of distal flow in both m2 branches . The aneurysmal sac was clipped using a sugita titanium #18 clip and a prophylactic decompressive craniectomy was performed (fig . 5). Postoperative magnetic resonance diffusion - weighted imaging showed the acute cerebral infarction in the left m2 inferior division territory (fig . 6a) and magnetic resonance angiography showed decreased blood flow in the left m1 distal portion, maybe due to a clip artifact (fig . He was in stable condition with no aggravating signs of neurologic symptoms, therefore, he was discharged . At the six - month follow - up, since the introduction of guglielmi detachable coils in 1991, endovascular treatment with detachable coils has been established as a mainstay therapy for intracranial aneurysms.6)12) with the development of neuroendovascular techniques, endovascular coil embolization has become a valid and increasingly used alternative to surgical clip obliteration in patients with intracranial aneurysms.9)17) however, despite increasing clinical experience and technical improvements, endovascular treatment still has inherent risks for morbidity and mortality.11) several technical complications include intraprocedural aneurysmal rupture, thromboembolism, parent artery occlusion and coil migration, coil stretching, coil fracture either during the procedure or after coil embolization, and vasospasm of the parent artery . The most common complication of endovascular coil embolization for the aneurysm is thromboembolic event, which may result from poor technique, endovascular devices, and/or poor flushing of the catheter systems.11)14) although coil migration into the parent artery is not a common event, it is one of the most feared complications that can occur during endovascular treatment of cerebral aneurysms and might be related to poor functional outcomes.2)4)13)15) migration of coils or stents from their targets may be one of the most challenging complications of endovascular neurosurgery and contributes significantly to thromboembolic events when it comes to the endovascular embolization.8) development of remodeling devices such as stents and balloons has recently made endovascular coil embolization a popular treatment option for mca aneurysm . Such a procedure has also provided equivalent angiographic results and showed an acceptable complication rate compared with aneurysmal neck clipping.7) hence, compared with neurosurgical clipping, endovascular treatment should be the first treatment option for unruptured cerebral aneurysms in any location because it is cost - effective and has a lower morbidity and mortality rate.16) in addition, for patients with ruptured aneurysms judged to be technically amenable to both endovascular coiling and neurosurgical clipping, american heart association / american stroke association recommends that surgeons consider endovascular coiling as a preferred treatment option.3) despite the worldwide popularity of endovascular treatment for intracranial aneurysms, surgical aneurysmal neck clipping is the primary treatment option for mca aneurysms . Not only are they easily accessed in the surgical clipping approach, but also these aneurysms often have broad necks relative to the sac width and may partially incorporate one or both of the m2 branches into the aneurysm neck.7) the patient was incidentally found to have an unruptured aneurysm on the left mca bifurcation with a relatively broad neck during a health check - up . Even though the neck of the aneurysm was relatively broad, the decision was made to occlude it by endovascular coil embolization due to a large dome to neck ratio (> 1.5). However, a coil migration into the distal parent artery occurred during the embolization, especially for particularly broad - neck aneurysms . Possible causes include a size mismatch between the embolized coil and the caliber of the parent artery, inadequate position of the microcatheter within the aneurysm, mechanical vasospasm due to catheter manipulation in the early stage of the endovascular procedure,1)5)11) disuse of an assisting device like stent or balloon, and unskillful technique of an inexperienced operator . An emergency surgical operation for complications associated with coil embolization is uncommon,10) however, as mentioned above, coil embolization is still associated with fatal complications . Obstruction with migration of a coil into the parent artery may be particularly difficult to resolve with an endovascular procedure.13) use of a coil retrieval device is a possible alternative, but this may require negotiating through the clot and may be associated with complications like perforation.10) further endovascular procedures may risk pushing the migrated coil more distally, resulting in a more complex situation . In addition, it has been reported that an open surgery could be the best option when endovascular procedures are difficult or unsuccessful.2)13) coil embolectomy, vessel repair, and aneurysmal neck clipping are necessary for surgical treatment after such distal coil migration . However, removal of intravascular coils is not always possible due to adhesion to the arterial wall . In such a case, revascularization procedures such as superficial temporal artery - mca bypass may even be necessary; therefore, it is important to preserve the superficial temporal artery when performing surgery.15) for achievement of a successful endovascular coil embolization, selection of the right indication is essential and should be performed carefully because unexpected complication can occur during the procedure . Neurosurgical management is one of the most effective ways to revascularize parent artery occlusion by coil migration . In order not to leave any sequela associated with coil migration, rapid extraction of the migrated coil as possible is critical, and, for this reason, a skillful neurovascular specialist who can provide appropriate surgical management and endovascular management for such a patient with a coil migration complication can come in handy.
Worldwide prevalence estimates for hypertension may be as much as 1 billion individuals, and approximately 7.1 million deaths per year may be attributable to hypertension . The world health organization reports that suboptimal systolic blood pressure (sbp)> 115 mmhg is responsible for 62 percent of cerebrovascular disease and 49 percent of ischemic heart disease (ihd), with little variation by sex . Hypertension has been identified as the leading risk factor for developing congestive heart failure, stroke, chronic kidney disease, and end stage renal disease and is ranked third as a cause of disability - adjusted life - years . The risk of developing these complications depends on the level of elevated blood pressure and has been seen in all age groups starting from blood pressure as low as sbp 115 and dbp of 75 . Data from observational studies involving more than 1 million individuals have also indicated that death from both ihd and stroke increases progressively and linearly from levels as low as 115 mmhg sbp and 75 mmhg dbp upward especially in individuals ranging from 40 to 89 years of age, indicating need for new blood pressure classification . The risk of coronary heart disease increased significantly in the high range prehypertension individuals (sbp 130139 or dbp 8589 mmhg) but not in the low range prehypertensive population (sbp from 120 to 129 or dbp 80 to 84 mmhg). Because of the new data on lifetime risk of hypertension and the highly increased risk of cardiovascular morbidity associated with levels of bp previously considered to be normal, the jnc 7 report has introduced a new classification that includes the term prehypertension for those with bps ranging from 120 to 139 mmhg systolic and/or 80 to 89 mmhg diastolic . This new designation is intended to identify those individuals in whom early intervention by adoption of healthy lifestyles could reduce bp, decrease the rate of progression of bp to hypertensive levels with age, or prevent hypertension entirely . Robust population - based data using these recent blood pressure categories are still needed to confirm prior estimates and inform policy decision makers in sub - saharan africa . Increasing urbanization has fueled social and economic changes in sub - saharan africa, which have contributed to a surge in noncommunicable disease (ncd), including hypertension . Epidemiological studies on hypertension in this region have been conducted over the years in an attempt to estimate the burden of hypertension, and these have reported variable rates within and between different population groups . In the first national demographic and health survey, of 12,952 randomly selected south africans aged 15 years, a high risk of hypertension was associated with less than tertiary education, older age groups, overweight and obese people, excess alcohol use, and a family history of stroke and hypertension . Prehypertension was also more common in those aged 35 years compared with those aged <35 years and in overweight and obese people compared with people of normal weight . Hypertension was defined in these studies as individuals with self - reported treated hypertension or with an average of 2 blood pressure measurements of at least 140/90 mmhg [9, 12, 13]. Prior studies on hypertension mainly focused on these dichotomous definitions of hypertension and did not examine the sociodemographic characteristics and risk factors for hypertension across full distribution of blood pressure . The current study follows the work of basu and millet on social epidemiology of hypertension in low- and middle - income countries from world health organization's study on global ageing and adult health (sage). Their work further showed additional variation in hypertension prevalence and social determinants of awareness when categorical definitions of hypertension were used compared to dichotomous definitions . Men had significantly lower probability of hypertension awareness than women at stage 1, but not at stage 2 . This empirical study with an objective of studying social determinants and risk factors of different stages of hypertension tries to address this question . It determines the prevalence and independent predictors of different stages of hypertension in two countries in sub - saharan africa, ghana and south africa . We conducted a cross - sectional analysis of the study on global ageing and adult health (sage), wave 1 dataset which is a part of longitudinal survey program in who's multicountries study unit . The main sage surveys compile comparable longitudinal information on the health and well - being of adult populations and the ageing process from nationally representative samples in six middle- and low - income countries . We used the dataset of two sub - saharan countries, ghana and south africa . The sage study included nationally representative sample of persons aged 50 years and sample from younger adults aged 1849 years as comparison which were also selected from both countries . The sampling design entailed two - stage probabilistic sample that yielded national and subnational estimates . In the first stage, a total sample of 600 enumeration areas (ea) in south africa and 300 (ea) in ghana were drawn from the master sample and used as the primary selection units (psu). The second stage of the sample design was the selection of households from the ea's which formed the secondary sampling units . This stage of the process involved georeferenced aerial photograph maps of urbanized areas on which the locations of households were plotted . The total sample size of individuals was targeted to be 1000 people in the age group 1849 years and 5000 people aged 50 years or older in each country . We recorded information about the household members from household and individual questionnaires; living place variable from the household questionnaire and sociodemographic characteristics, work history, blood pressure measurements, and risk factors including preventive health behaviors were taken from the individual questionnaire . Both the household and individual questionnaires were translated into six local south african and three local languages of ghana . Blood pressure was measured three times while the respondent seated using automated omron r6 wrist blood pressure monitor, hem-6000-e, health care europe, b.v ., such digital monitors have been shown to have high degree of agreement with mercury sphygmomanometers for systolic blood pressure [16, 17]. Average blood pressure was calculated arithmetically for the 3 measurements of each systolic and diastolic blood pressure . Prehypertension was defined as systolic blood pressure (sbp) measurement of 120139 mmhg or diastolic blood pressure (dbp) of 8089 mmhg . Stage 1 hypertension was defined as sbp of 140159 mmhg or dbp of 9099 mmhg and stage 2 as sbp of greater than or equal to 160 mmhg or dbp of greater than or equal to 100 mmhg . Accordingly normal pressure was defined as sbp of less than 120 mmhg and dbp of less than 80 mmhg . All respondents were initially asked if they have ever been diagnosed with hypertension and if they did, whether or not they have been taking any kind of drugs or other treatment for the last 2 weeks and last 12 months . Normal blood pressure was defined as sbp <120 and dbp <80 mmhg and either no previous history of diagnosis or not taking antihypertensive medication . Those with sbp of 120 or more and dbp of 80 or more who did not have prior diagnosis nor treatment were designed as to have hypertension . Those who reported as either having a diagnosis of hypertension previously or taking antihypertensive medication were excluded from analysis due to overlapping . All participants older than 18 years, of both sexes, were included in the study and classified as living in urban or rural area . Current marital status (married or single that included unmarried, widowed, or separated) was asked about using the individual questionnaire . Educational level was assessed by first asking whether respondents have been in any school, and those who answered yes were asked for the highest educational level completed according to the international standard classification of education . Respondents were asked whether they had ever worked for pay, type of work, and employer . Occupation responses were written verbatim by the interviewer, then coded, and mapped to the international standard classifications of occupations (isco) scheme . Classification of income quintiles was based on permanent income estimates derived from household assets and characteristics of the dwelling upon which the 2001 who world health survey / sage wave 0 relied . Recent alcohol intake was asked for by asking whether the respondents have consumed alcohol in the past 30 days . Current smoking (yes or no), with provision for the collection of information on other forms of smoking apart from cigarettes, such as cigars, pipes, snuff, or chewing smokeless tobacco, was asked about . Work related and sport or leisure time physical activities were separately asked in a typical week . Vigorous or moderate physical activities required hard or moderate physical effort and caused an increase in breathing or heart rate for at least 10 minutes . Inadequate intake was defined based on who recommendations and labeled as less than 5 servings (80 g per serving) on a typical day . Height was measured in centimeters after the respondents took off their shoes, put their feet and heels close together, stood straight, and stood forward with their back, head, and heels touching the wall . Body composition and fatness were assessed using who body mass index (bmi) derived from measured weight in kilograms and normalized by dividing by height in meters squared . It was categorized as underweight <18.5, normal weight 18.524.9, overweight 25 to 29.9, and obese greater than or equal to 30 . Since abdominal obesity is highly correlated with atherosclerotic cardiovascular morbidity and mortality than bmi indices, waist circumference was also used to measure central obesity . The interviewer identified the top of the hip bone and after making sure the tape measure is parallel to the floor all the way around the body measured waist circumference (wc). The national cholesterol and education program: adult treatment panel iii (ncep: atp iii) guideline was used to designate central obesity: accordingly men with wc measurements greater than or equal to 102 cm and women with greater than or equal to 88 cm were considered to have one . Living place variable was taken from the household data while all the others were included from the individual dataset . To make sure the results of the individual country dataset represent the respective country population, weighting at the country level was done which was available in the sage dataset . Individual weights were poststratified according to the 2009 projected population estimates in ghana and to the 2009 medium midyear population estimates in south africa . Weighted estimates of different stages of hypertension prevalence were reported as proportions of the actual sample size . Invalid blood pressure measurements such as values of diastolic blood pressure greater than systolic and those in the outliers were considered missing and excluded from analysis . The associations between sociodemographic, biological, and health behavior variables and stages of hypertension (prehypertension, stage 1, and stage 2) were assessed in a two - step procedure where individuals with the different stages of hypertension were compared separately with those having normal blood pressure . In the first step, each variable was evaluated independently in a bivariate multinomial logistic regression analysis with different stages of hypertension as dependent variable to generate unadjusted or with respondents' characteristics in each country separately . Those variables with p values less than 0.2 were retained and entered into multinomial logistic regression model in ascending stepwise manner to determine variables that were independently associated with the stages of hypertension . A probability level of p <0.05 was considered significant . Age and bmi variables were entered in the multivariable multinomial models as continuous due to fewer numbers of people in the most upper and lower categories . The total sample size of the study was 8939, 3974 from south africa and 4965 from ghana . Participants who have been diagnosed previously with high blood pressure or who were already taking treatment were excluded from analysis due to overlap and difficulty to stratify them into mutually exclusive hypertension stages . Those with previous diagnosis of hypertension were 587 (12%) in ghana and 1,111 (28%) in south africa . Individuals taking antihypertensive medications were 396 (8%) in ghana and 981 (25%) in south africa . Completed interview response in south africa was 2853 (96%) and 5057 (99%) in ghana . Of these blood pressure was assessed for a total of 7545, 2980 (75%) respondents from south africa and 4565 (92%) from ghana which was included for analysis (table 1). A higher number of study participants in ghana were males (50.2%) compared to 48.5% in south africa . More people lived in urban areas in south africa (69.7%) compared to only 44.4% in ghana . In south africa, the proportion of obesity was 30.5% as compared to 12.1% in ghana . Only 26.1% of the respondents in ghana and 24.1% in south africa fulfilled the definition of normal blood pressure . Prehypertension was more prevalent in ghana (30.7%) than south africa (29.4%). The weighted prevalence of hypertension (both stages 1 and 2) was 42.4% in ghana and 46% in south africa . The age group distribution across stages of hypertension was similar in both countries, the majority of prehypertensive individuals being in the age group of 18 to 49 . Obese individuals constituted 45.4% of stage 2 hypertension in south africa while they constituted only 25.3% of stage 2 hypertension in ghana . Prehypertension was significantly associated in ghana with income distribution (or = 1.9, 95% ci: 1.113.23) and bmi category (or = 2.64, 95% ci: 1.116.3) in the bivariate multinomial analysis when compared with normal blood pressure measurement while in south africa age (or = 2.66, 95% ci: 1.345.28) and educational level (or = 0.18, 95% ci: 0.050.63) only had a significant association (table 2). In addition age emerged as a new variable with significant correlation with stage 1 hypertension in ghana in the bivariate analysis (or = 1.71, 95% ci: 1.252.33). In south africa stage 1 hypertension was significantly associated with age of the study participants (or = 6.02, 95% ci: 2.6113.88), educational level (or = 0.09, 95% ci: 0.020.49), type of occupation (or = 4.32, 95% ci: 1.0617.55), bmi category (or = 11.72, 95% ci: 2.3558.43), and number of vegetable servings per day in the bivariate multinomial analysis (or = 0.3, 95% ci: 0.110.82). Age, income, and bmi remained to be significantly associated with stage 2 hypertension in the bivariate multinomial analysis in ghana . In addition educational level (or = 0.07, 95% ci: 0.020.35) became a significant correlate with stage 2 hypertension . In south africa factors significantly associated with stage 2 hypertension were age, living place, educational level, and fruit and vegetable intake . For the multinomial logistic regression analysis, 10 independent variables which were associated with hypertension stages at level of p value <0.2 in the bivariate analysis were retained in the model . These were age, educational level, type of occupation, income quintile, smoking status, bmi category, abdominal waist circumference, work related physical activity, and fruit and vegetable intake per day . Those with p values <0.05 in the multivariable model were considered statistically significant and were considered independent predictors of hypertension stages (figure 1). At prehypertension level bmi (or = 1.08, 95% ci: 1.031.14), income (or = 2,24, 95% ci: 1.273.97), and number of vegetable intakes per day were found to be independent predictors after being adjusted for the other variables in the model . There was 32% increased risk of having stage 1 hypertension for every age increase by one year (or = 1.32, 95% ci: 1.141.53). Age (or = 1.35, 95% ci: 1.171.56), income (or = 3.52, 95% ci: 2.026.12), and bmi (or = 1.14, 95% ci: 1.081.21) remained as independent predictors for stage 2 hypertension as well . In addition higher educational level emerged as a protective variable against stage 2 hypertension in the model (or = 0.47, 95% ci: 0.240.93). Eight variables which were associated with stages of hypertension in the bivariate analysis at probability level of p <0.2 were retained in the multinomial logistic regression model . These were age, sex, living place, educational level, bmi category, work related physical activity, and fruit and vegetable servings per day (figure 2). Only sex (or = 0.27, 95% ci: 0.090.78) remained independent predictor of prehypertension in the multivariate logistic regression model after being adjusted for the other variables . Age and bmi emerged as independent predictors of stage 1 hypertension (or = 2.27, 95% ci: 1.533.36 and or = 1.15, 95% ci: 1.071.25). Sex remained as an independent predictor of stage 1 hypertension (or = 0.28, 95% ci: 0.081). Being female resulted in 72% lower risk of having stage 1 hypertension than being male (or = 0.28, 95% ci: 0.081). Age (or = 2.06, 95% ci: 1.48.7), sex (or = 0.16, 95% ci: 0.050.47), and bmi (or = 1.18, 95% ci: 1.11.28) remained independent predictors of stage 2 hypertension in the final model . Those with high school education tended to have 84% lower odds of stage 2 hypertension compared to those with no education (or = 0.16, 95% ci: 0.040.74). The study has showed high burden of prehypertension and hypertension stages in the sub - saharan african countries, ghana and south africa . The weighted prevalence of hypertension (including both stages 1 and 2) was higher in south africa (46%) compared to ghana (42.4%). The high prevalence of hypertension in the current study is mostly due to higher age distribution of participants . More than 85% of respondents in ghana and around 90% south africans were in the age group more than 50, as part of the who sage study . The probability that a middle - aged or elderly individual will develop hypertension in his or her lifetime is 90%, explaining the higher prevalence in this study . Higher prevalence of hypertension (77.3%) than the current study was also reported in hypertension and associated factors in older adults study in south africa . Comparing the two countries south africa had higher prevalence of hypertension that could be explained by higher proportion of people living in urban area (69.7% in south africa and 44.4% in ghana) and increased number of obese people (30.5% in south africa and 12.1% ghana). In addition lower rate of physical activity and fruit intake per day was reported in south africa . The weighted prevalence of prehypertension was higher in ghana (30.7%) than south africa (29.4%). Higher reports were made from the pure hypertension trial done on 153,996 adults aged 35 to 70 years, from 628 communities in 3 high - income, 10 upper - middle and low - middle - income, and 4 low - income countries of 36.8% . These are groups of people with increased cardiovascular risk but who do not need pharmacologic treatment unless there is another compelling medical indication such as diabetes or chronic kidney disease . They have higher likelihood of progression to overt hypertension and need lifestyle changes as a treatment such as weight reduction, physical activity, and decreased salt intake . Progression from prehypertension to stage 1 hypertension was positively related to male gender, higher waist circumference, and having parents with hypertension in population - based study keelung, taiwan . Identifying these individuals has high public health importance as such measures taken could delay or prevent progression or development of hypertension . The weighted prevalence of stage 1 hypertension in ghana was higher (21.6%) than in south africa (18.5%) and the weighted estimate of stage 2 hypertension was higher in south africa (28.1%) and ghana (21.6%). Prior studies on these two countries were mainly done on dichotomized blood pressure classification using sbp of 140 mmhg or dbp of 90 mmhg and more . According to hypertension in south african adults, results from the demographic and health survey, 1998, when blood pressure cut - off point (160/95 mmhg) was used . In the current study bmi was an independent predictor for prehypertension in both ghana and south africa which was a similar finding in the study done in the ashanti region of ghana which showed age (or = 1.56, 95% ci: 1.122.18; p <0.01), obesity (or = 2.71; 95% ci: 1.405.24; p <0.001), and sex (or = 2.36, 95% ci: 1.773.15; p <0.001) being independent predictors of prehypertension on multivariable logistic regression . In addition income became one of the strongest predictors for prehypertension in ghana in our study, with higher income quintiles associated with higher levels of prehypertension . This was similar with household characteristics for older adults and study background from sage ghana wave 1, which showed people with the higher income quintiles generally reported more hypertension (income quintile 5, wealthiest = 26.7%, versus quintile 1, poorest = 5.5%) and received more current and chronic therapy . Other studies in us and canada have shown the opposite effect; inverse linear relationship between household income and hypertension prevalence in the united states, but no evidence of such a relationship in canada, was seen due to similar burden of hypertension across different socioeconomic classes . Getting income data reliably was difficult as income was generated from household assets and converted later to quintiles, hence requiring cautious interpretation of result . The proportion of both overweight and obese was higher in the 4th and 5th income quintiles than the lower ones (23% and 30%, resp .) Which could explain the high prevalence of prehypertension in the group . Being in the higher bmi category contributed significantly to having prehypertension and could be related to the low physical activity of the current study participants . South africa has one of the lowest rates of insufficient physical activity (49% in adult women and 43% in adult men) compared to global figure of 17% and africa's coverage of about 10% . Some of the explanations were high rate of urbanization, increased mechanized labour, and television watching . The very low report of physical activity contributing to both obesity and prehypertension needs to be addressed in south africa by clinicians, public health specialists, patients, and policy makers at the government level . We have tried to see the social determinant and risk factors for different hypertension stages (1 and 2) separately and whether they differ in the two countries and across different hypertension stages in the same country . The study has showed only age, income, and bmi remaining as independent predictors of stage 1 hypertension in ghana . We found educational level and number of fruit intakes per day having an inverse relationship to stage 1 hypertension in south africa in the bivariate multinomial analysis . This is similar with the first demographic and health survey study: determinants and treatment of hypertension in south africa which showed higher risk of having hypertension with less than tertiary education . Adults with no education or less than primary school were more than 50%, and the highest report of stage 1 hypertension was seen in this group in the current study . Curriculum reforms and models to increase opportunity of education in the postapartheid education system are undergoing and should be further strengthened . Increasing fruit and vegetable intake was seen to have significant blood pressure lowering effect in stage 1 and stage 2 hypertension . The finding is consistent with other trials that demonstrated the greatest benefit of dietary changes at lower stages of hypertension . The dash (dietary approaches to stop hypertension) trials introduced the dash diet which is comprised of four - five servings of fruit, four - five servings of vegetables, two - three servings of low - fat dairy per day, and <25 percent fat . Drop in average systolic blood pressure by 11.4 mmhg and diastolic blood pressure by 5.5 mmhg in hypertensive individuals has been seen as early as two weeks, with the dash diet . Increasing fruit intake is thus highly recommended in individuals especially with lower stages of hypertension to prevent progression of disease . The weighted estimate of people taking the recommended fruit intake was very low (9.9%) in ghana and (3.5%) south africa . Vegetable intake was even much worse (0.9%) in ghana and (3.5%) in south africa . The wide confidence interval and attenuated beneficial effects of fruits and vegetables could be attributed to the very little proportion of people in these categories making the expected statistical association loose . Though smoking cigarette was one of the most important risk factors for cardiovascular disorders and acute myocardial infarction in the interheart africa study, it was associated only in the bivariate analysis when studied individually . The effect was lost when multiple variables were retained in the regression model in both countries at every stage of hypertension . The incidence of hypertension increases in those who smoke 15 or more cigarettes per day and could be the reason why strong association was not seen as only less than 2% individuals (ghana) and around 7% (south africa) smoked more than 15 cigarettes per day . Lower blood pressure measurements in those habitual smokers than nonsmokers due to weight loss and some vasodilatory effect of cotinine a metabolite of nicotine [42, 43]. Only increasing age, income, bmi, and educational level were found to be independent risk factors for stage 2 hypertension in the final model in ghana . There was no significant variation of stage 2 hypertension between sexes in ghana, although it is known that men had higher systolic blood pressure measurements in early adulthood, while older women have steeper age - related rate of rise . This could be in part due to the higher proportion of women who are overweight and obese in both countries . This particular study has assessed the burden of hypertension in sub - saharan african countries . It focused mainly on risk factors and social determinants across different stages of hypertension among the two countries . This helps to identify newly emerging associated risk factors at different stages of hypertension and helps to be able to recommend measures accordingly . As it is always said prevention is better than cure, we also recommend identifying individuals and treating accordingly at pre- and early hypertension stages, where the maximum benefit of lifestyle changes can be seen . These include having regular and intense physical exercise, reduction of body weight which can decrease average sbp by 520 mmhg for every 10 kg weight loss, increasing the opportunity to have basic education for all, and educating people with higher income in ghana who are at high risk of prehypertension and subsequent overt hypertension due to probable acculturation to change their lifestyle . Government bodies at policy level and health specialists need to design methods to improve diagnosis and treatment of hypertension at earlier stages in respective countries . One of the major limitations of the current study was high number of missing and some invalid values in the original dataset . Missing and invalid blood pressure measurements accounted for 8% in ghana and 25% in south africa . Alcohol consumption was an independent variable with the highest missing values (63%) in ghana and (35%) in south africa . This could be the reason for not seeing the expected protection from moderate dose of alcohol against hypertension and increased risk from excess dose . The other components of therapeutic lifestyle changes that include intake of salt, saturated fat, and amount of calories were not included in the sage questionnaire and their association with hypertension was not studied . The current study as any other cross - sectional studies determines only associations that are statistically significant without inferring causality . Further cohort studies that examine risk and causality are recommended . And finally using the jnc 7 blood pressure classification that was originally designed for us population and using its blood pressure cut - off points for sub - saharan population could impose risk of overgeneralization . Blood pressure cut - off points at which cardiovascular morbidity starts should be looked for in sub - saharan africa context and guidelines should develop in the future.
The american cancer society has estimated 22,280 new cases of ovarian cancer and 14,240 deaths in 2016 (siegel et al ., 2016). Amongst the types of ovarian cancer, epithelial ovarian carcinoma represents greater than 90% of cases . Has helped stratify two different subsets of disease (malpica et al ., 2004). Greater than eighty - percent of serous adenocarcinomas of the ovary are high - grade lesions with numerous mitotic figures and high - grade nuclei . Low - grade histology constitutes the remaining cases and is typically diagnosed at earlier stages . Furthermore, they have an indolent disease course with a series of stepwise mutations from borderline tumors with low malignant potential progressing to a well - differentiated carcinoma (vang et al ., 2009). High - grade serous carcinomas, on the other hand, are genetically unstable leading to rapid progression and diagnosis at advanced stages . Modalities of serous ovarian cancer metastases are direct tumor invasion into the peritoneal cavity followed by lymphatic and hematogenous spread . Malignant pleural effusions and intraparenchymal liver metastases are the most common sites that upstage the disease (bonnefoi et al ., 1999). Cardiophrenic lymph node (cpln) metastases also upstage the disease to iv - b . References six total case reports describing mediastinal metastases from high - grade carcinoma (mayadagli et al ., 2012). There are currently no case reports that document cpln metastases in low - grade serous carcinomas or borderline tumors . When noted on computed tomography (ct) imaging, surgical planning can accommodate resection of cardiophrenic lymph nodes by either gynecologic oncology or cardiothoracic surgery to help achieve complete cytoreduction . Currently, an abdominal ct and a chest x - ray are used to assess for thoracic and pleural metastases . A study done by hynninen et al . Found that preoperative f - fluorodeoxyglucose (fdg) positron emission tomography / computed tomography (pet / ct) diagnosed cpln metastases in 67% of advanced stage epithelial ovarian cancer patients (n = 30), which was significantly higher than conventional imaging (33%) (hynninen et al ., 2012). Whether resection of these cardiophrenic lymph nodes truly results in no residual disease is patient dependent . A study done in 2007 found that 65% of patients with advanced staged ovarian cancer and moderate to large pleural effusions had macroscopic intrathoracic lesions . They went on to propose using video - assessed thoracic surgery (vats) prior to primary cytoreductive surgery to help stratify patients to neoadjuvant chemotherapy versus a complete cytoreductive operation (juretzka et al ., 2007). This raises the importance of appropriate patient selection for cardiophrenic lymph node resection to ensure the benefits outweigh the risks . The purpose of this report is to describe, to our knowledge, the first two cases of low - grade serous ovarian carcinoma with cardiophrenic lymph node metastasis . Furthermore, by presenting these cases, we strive to improve awareness of this rare disease pattern and optimize surgical cytoreduction in this chemotherapeutic resistant population . A 42 year - old woman presented to her gynecologist with a history of pelvic pressure, bloating, constipation, notable left lower quadrant mass and abnormal uterine bleeding . Transvaginal ultrasound (tvus) revealed a uterus measuring 10.8 6.8 5.3 cm with a complex right ovarian mass measuring 11.1 7.4 6.2 cm . Computed tomographic (ct) imaging showed a complex cystic right adnexal mass measuring 10.9 8.6 8.5 cm, a complex left ovary measuring 4.7 4.2 3.6 cm, a solid appearing mass in the anterior pelvis measuring 5.4 6.6 7.5 cm, trace ascites, and multiple calcified omental nodules . She underwent a robotically assisted - total laparoscopic hysterectomy, bilateral salpingo - oophorectomy, omentectomy, appendectomy, and peritoneal biopsies and washings at an outside hospital in august of 2014 . Intra - operative frozen section revealed a mucinous borderline tumor with no area of invasive disease however final pathology showed a mixed mucinous and grade i serous papillary ovarian adenocarcinoma with involvement of the omentum, anterior pelvic peritoneum, right pelvic sidewall, and right posterior cul - de - sac . Two months after her primary surgery, the patient complained of diffuse upper abdominal discomfort . Repeat ct imaging of her chest, abdomen, and pelvis showed shotty retroperitoneal lymphadenopathy and enlarged right cardiophrenic angle lymph nodes measuring up to 7 mm . She underwent a second cytoreductive surgery with complete debulking for stage iiic low - grade serous and mucinous ovarian carcinoma . This included a right diaphragm peritonectomy with resection of 100% of the right diaphragmatic surface area and full - thickness resection of the right diaphragm muscle (2 1 cm) with transdiaphragmatic resection of clinically enlarged four right cardiophrenic lymph nodes . She also had hyperthermic intraperitoneal chemotherapy with carboplatin at a dose of 800 mg / m at 41 to 42 c for 60 min . Her final pathology was consistent with stage iv - b low grade mixed mucinous and papillary serous histology with 4/4 positive cardiophrenic lymph nodes . She underwent six cycles of intravenous carboplatin, paclitaxel, and bevacizumab with normalization of her ca-125 . She continues on maintenance bevacizumab without evidence of recurrent disease radiologically or serologically 27 months after initial diagnosis . A 53 year - old woman presented to the emergency department with worsening abdominal pain for 6 months associated with nausea and vomiting . Ct imaging of her abdomen / pelvis revealed a large 12.7 13 13.3 cm large lobulated heterogeneous partially calcified pelvic mass encasing the uterus and causing moderate right hydroureteronephrosis, scattered omental, mesenteric, and serosal nodular implants with calcifications suspicious for diffuse carcinomatosis . A chest ct showed a 7.4 mm cardiophrenic lymph node possibly reactive in nature versus metastasis (fig ., she underwent an exploratory laparotomy, type 2 radical oophorectomy, right pelvic and paraaortic lymphadenectomy, total omentectomy, en block distal ileectomy, appendectomy, and resection of cecum and subtotal right colectomy, morison's pouch peritonectomy, right diaphragm peritonectomy (100% surface area), transdiaphragmatic resection of right cardiophrenic lymph node with primary closure and transdiaphragmatic evacuation of pneumothorax, nonanatomic wedge resection of the liver segment 6 with associated tumor, resection of round ligament of liver and falciform ligament, resection of anterior abdominal wall tumor and umbilectomy (5 2.5 cm segment of the anterior abdominal wall fascia and associated soft tissue), takedown of splenic flexure, stapled 33 mm circular end - to - end descending colon to rectum anastomosis, and stapled functional end - to - end ileo to ascending colon anastomosis (enterocolostomy) her post - operative course was complicated by a small pulmonary embolism, for which she was treated with lovenox . Her final pathology was consistent with stage iv - b low - grade serous adenocarcinoma of the ovary (fig . She completed six cycles of intravenous carboplatin and paclitaxel and is without evidence of disease 6 months after diagnosis . A 42 year - old woman presented to her gynecologist with a history of pelvic pressure, bloating, constipation, notable left lower quadrant mass and abnormal uterine bleeding . Transvaginal ultrasound (tvus) revealed a uterus measuring 10.8 6.8 5.3 cm with a complex right ovarian mass measuring 11.1 7.4 6.2 cm . Computed tomographic (ct) imaging showed a complex cystic right adnexal mass measuring 10.9 8.6 8.5 cm, a complex left ovary measuring 4.7 4.2 3.6 cm, a solid appearing mass in the anterior pelvis measuring 5.4 6.6 7.5 cm, trace ascites, and multiple calcified omental nodules . She underwent a robotically assisted - total laparoscopic hysterectomy, bilateral salpingo - oophorectomy, omentectomy, appendectomy, and peritoneal biopsies and washings at an outside hospital in august of 2014 . Intra - operative frozen section revealed a mucinous borderline tumor with no area of invasive disease however final pathology showed a mixed mucinous and grade i serous papillary ovarian adenocarcinoma with involvement of the omentum, anterior pelvic peritoneum, right pelvic sidewall, and right posterior cul - de - sac . Two months after her primary surgery, the patient complained of diffuse upper abdominal discomfort . Repeat ct imaging of her chest, abdomen, and pelvis showed shotty retroperitoneal lymphadenopathy and enlarged right cardiophrenic angle lymph nodes measuring up to 7 mm . She underwent a second cytoreductive surgery with complete debulking for stage iiic low - grade serous and mucinous ovarian carcinoma . This included a right diaphragm peritonectomy with resection of 100% of the right diaphragmatic surface area and full - thickness resection of the right diaphragm muscle (2 1 cm) with transdiaphragmatic resection of clinically enlarged four right cardiophrenic lymph nodes . She also had hyperthermic intraperitoneal chemotherapy with carboplatin at a dose of 800 mg / m at 41 to 42 c for 60 min . Her final pathology was consistent with stage iv - b low grade mixed mucinous and papillary serous histology with 4/4 positive cardiophrenic lymph nodes . She underwent six cycles of intravenous carboplatin, paclitaxel, and bevacizumab with normalization of her ca-125 . She continues on maintenance bevacizumab without evidence of recurrent disease radiologically or serologically 27 months after initial diagnosis . A 53 year - old woman presented to the emergency department with worsening abdominal pain for 6 months associated with nausea and vomiting . Ct imaging of her abdomen / pelvis revealed a large 12.7 13 13.3 cm large lobulated heterogeneous partially calcified pelvic mass encasing the uterus and causing moderate right hydroureteronephrosis, scattered omental, mesenteric, and serosal nodular implants with calcifications suspicious for diffuse carcinomatosis . A chest ct showed a 7.4 mm cardiophrenic lymph node possibly reactive in nature versus metastasis (fig ., she underwent an exploratory laparotomy, type 2 radical oophorectomy, right pelvic and paraaortic lymphadenectomy, total omentectomy, en block distal ileectomy, appendectomy, and resection of cecum and subtotal right colectomy, morison's pouch peritonectomy, right diaphragm peritonectomy (100% surface area), transdiaphragmatic resection of right cardiophrenic lymph node with primary closure and transdiaphragmatic evacuation of pneumothorax, nonanatomic wedge resection of the liver segment 6 with associated tumor, resection of round ligament of liver and falciform ligament, resection of anterior abdominal wall tumor and umbilectomy (5 2.5 cm segment of the anterior abdominal wall fascia and associated soft tissue), takedown of splenic flexure, stapled 33 mm circular end - to - end descending colon to rectum anastomosis, and stapled functional end - to - end ileo to ascending colon anastomosis (enterocolostomy) her post - operative course was complicated by a small pulmonary embolism, for which she was treated with lovenox . Her final pathology was consistent with stage iv - b low - grade serous adenocarcinoma of the ovary (fig . She completed six cycles of intravenous carboplatin and paclitaxel and is without evidence of disease 6 months after diagnosis . They show low - grade serous histology with stage iv - b disease by cardiophrenic lymph node metastasis . From a diagnostic standpoint, being able to recognize this pattern of spread where chemotherapeutic resistance is high, can dictate a more targeted surgical strategy . Identifying these cardiophrenic lymph node metastases gives the surgeon a much higher probability of performing a complete tumor debulking . In 2004, chi et al . Found that incorporating these invasive upper abdominal and lower mediastinal procedures substantially increases the rate of successful cytoreduction (chi et al ., 2004). Their follow up study in 2010 showed that of the common postoperative complications seen (pleural effusion, pancreatic leak, intra - abdominal fluid collection), two - thirds of them were managed with percutaneous drainage of fluid collections . Overall, there was a 22% rate of major morbidity and 1.4% rate of mortality that was seems acceptable (chi et al ., 2010). There is a paucity of data evaluating the prognostic impact of cardiophrenic lymph node metastasis in epithelial ovarian cancer . Genetic and molecular profiling can also be a helpful tool in finding optimal chemotherapeutic agents in low - grade disease, as some evidence suggests a higher likelihood of resistance to standard platinum - taxane based therapy . Evidence suggests high resistance to platinum and taxane based chemotherapeutic agents though they do remain first line with close surveillance . In the setting of persistent disease, given higher estrogen and progesterone receptor expression in low - grade disease, hormonal therapy is a reasonable option . Whether thoracic surgery influences the chemotherapeutic regimen is unknown . In conclusion, cardiophrenic lymph node metastasis, defining stage iv - b ovarian cancer, is extremely rare in low - grade serous ovarian carcinoma . We have presented two cases that bring to light the importance of pre - operative imaging and astute physician awareness to this unique disease pattern . Given high chemotherapy resistance, surgical cytoreduction for patients with low - grade serous carcinoma will remain the mainstay of treatment . By improving awareness of this topic, the authors whose names are listed on this manuscript have no affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers' bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent - licensing arrangements), or non - financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.
Systemic inflammation participates in atherosclerosis evolution from the early development of endothelial dysfunction, to formation of mature atheromatic plaques, to the ultimate endpoint, rupture, and thrombotic complications . Plaque rupture with the formation of an occlusive thrombus is the cause of acute coronary syndromes (acs). Inflammatory cells, involving activated neutrophils, are more frequently found in plaques vulnerable to rupture . Neutrophil activation has been reported in unstable angina (ua) and acute myocardial infarction (ami) but not in patients with stable angina (sa) [410]. Recent studies have shown that gelatinase b also known as matrix metalloproteinase-9 (mmp-9), an endopeptidase capable of degrading the extracellular matrix, is thought to be associated with atherosclerosis, and plaque rupture [12, 13]. Therefore, mmp-9 is considered to be an important mediator of vascular remodeling and plaque instability . The mmp-9 action is enhanced b neutrophil gelatinase - associated lipocalin (ngal), also known as lipocalin-2, a 25 kda glycoprotein, that is, found in the granules of human neutrophils, with many diverse functions, such as scavenger of bacterial products, modulator of inflammation, iron trafficking, and apoptosis . The formation of a complex with ngal and mmp-9 is crucial for atherosclerotic plaque erosion and thrombus formation . Ngal is also produced by kidney tubular cells in response to various ischemic or toxic insults and has been proposed as an early biomarker for the diagnosis of acute kidney injury [16, 17]. In this study, we hypothesized that levels ngal in blood may reflect the extent of neutrophil activation in various stages of acs and could discriminate various types of acs (ua, nstemi, and stemi) and stable from unstable coronary syndromes . One hundred and seventy consecutive patients programmed for coronary angiography to the invasive cardiology department of the kat general hospital athens, greece, were recruited for this study, from june 2010 to october 2010 . The study was performed according to the principles of the declaration of helsinki and was approved by the hospital's ethics committee . Exclusion criteria included a negative coronary angiography in patients with a typical chest pain which was considered as angina or had a false positive single photon emission computed tomography (spect), any surgery in the previous six months, liver disease, end stage renal disease, renal cardiac or liver transplantation, neoplasia, and infection since all these can affect serum - ngal levels . The 140 patients who fulfilled the study criteria after the clinical assessment and final diagnosis were divided into the following 4 groups: sa (n = 40), ua (n = 35), nstemi (n = 40), and stemi (n = 25). Twenty (20) healthy amateur athletes without risk factors served as control group (figure 1). The demographics and clinical characteristics of patients and controls are shown on table 1 . All patients, upon presentation in emergency room, underwent an initial clinical assessment that included clinical history, physical examination, 12-lead ecg, continuous ecg monitoring, and standard blood tests (including white blood cell, polymorphonuclear neutrophil counts, and troponin - i). These tests were repeated at 6 at 12 and 24 hours as long as clinically indicated . To determine the final diagnosis for each patient 2 cardiologists blinded to ngal results reviewed all patients available records (including patient history, laboratory results, radiologic testing, ecg, echocardiography, and coronary angiography) at the completion of their hospital stay . The sa group consisted of patients with angiographically documented organic coronary stenosis> 70% by quantitative coronary angiography in major arteries who had chronic symptoms of angina or a positive spect test . Ua was diagnosed in patients with typical angina at rest, or a sudden increase in episodes of a previously stable angina . Ami was diagnosed when there was evidence of myocardial necrosis in a clinical setting consistent with myocardial ischemia . Necrosis was diagnosed by a rising and/or falling pattern of troponin - i with at least one value above the cutoff value (defined as the 99th percentile of a normal population where the assay shows an imprecision <10%). Our troponin - i assay fulfills the imprecision criteria for concentration> 0.2 ng / ml . Serum and k2edta - plasma samples were collected from all sa patients in the morning before the coronary angiography . In all acs patients pci was performed within 24 hours from admission and the blood samples were collected on admission . From all healthy subjects, total white blood cell count (wbc), and peripheral polymorphonuclear neutrophil count (pmn) were assessed using the cell - dyn sapphire haematology analyzer (abbott, chicago, il, usa). Serum creatinine was measured with a modified jaffe method on architect ci16200 analyzer (abbott, chicago, il, usa). High - sensitivity crp (hs - crp) was measured with a turbidimetric assay on the same analyzer . Serum - ngal was measured with an elisa (bioporto, gentofte, denmark). For normally distributed parameters data were presented as means + standard deviation . For comparisons of means among patients groups and healthy controls a standard one - way anova test was used . Because serum - ngal did not distribute normally, nonparametric tests were used: the mann whitney test and the kruskal - wallis test with multiple - comparison procedures (dunn's method) for comparisons between groups, and the friedman test and the wilcoxon test with the bonferroni correction for comparisons within groups . Chi - square statistics were used for categorical variables . A p value of less than 0.05 (two - tailed) receiver - operating characteristic (roc) analysis was performed to calculate the area under the curve (auc) and define cutoff points . Differences between aucs were investigated with the non - parametric approach of delong, delong and clarke - pearson . Statistics were performed with the ncss 2004 statistical and power analysis software (ncss inc, kaysville, ut, usa). The mean age and the mean bmi of the patients did not differ significantly among the four groups whereas the controls were significantly younger and their bmi was significantly lower (anova - test). The proportion of diabetic patients did not differ significantly among four patient groups (chi - square = 1.69, p = 0.639) as well as the proportion of patients with hypertension and dyslipidemia (chi - square = 1.63, p = 0.652). Finally smoking habits did not differ significantly in the first three patient groups while it was significantly higher in group 4 . The differences we observed in the median serum - ngal values among the 4 patient groups and the healthy controls were significant (p <0.001, anova test). Further statistical analysis using multiple - comparisons between groups revealed that the median serum - ngal levels in ua (108.00 ng / ml), nstemi (166.49 ng / ml), and stemi (178.63 ng / ml) patients were significantly higher than in patients with sa (79.23 ng / ml) and healthy controls (50.31 ng / ml) (table 2 and figure 2). Also significant were the differences observed between healthy controls and sa patients, between ua patients and patients with ami (nstemi or stemi). Patients with stemi had higher levels of ngal than patients with nstemi but the difference was nonsignificant (table 2). The median plasma levels of hs - crp were similar in patients with sa (0.40 mg / dl) and those with ua (0.69 mg / dl) and were significantly higher than the levels in the control group (0.12 mg / dl). Hs - crp levels were significantly increased in patients with nstemi (1.20 mg / dl) and stemi (6.76 mg / dl). In order to further investigate the relationship between serum - ngal and hs - crp, we performed regression analysis between serum - ngal and hs - crp (figure 3). This analysis revealed that there is a linear and positive correlation between hs - crp and serum ngal (spearman rank correlation coefficient rho = 0.685, p <0.0001). The differences that were observed among the four patient groups in wbc and pmn counts were statistically significant (p <0.001, anova - test). There was a positive and significant correlation between serum - ngal and wbc (r = 0.510, p <0.0001) and pmn (r = 0.511, p in a multivariate regression analysis model entering as independent parameters age, serum creatinine, hs - crp, and pmn count, we identified only hs - crp (p <0.005) and pmn count (p <roc curves were generated for sensitivity and specificity with the respective areas under the curve for serum - ngal hs - crp and pmn counts (figures 5 and 6). The diagnostic value for serum - ngal in discriminating patients with ua, from those with sa is high (auc = 0.852) and better than of hs - crp (auc = 0.735) or pmn count (auc = 0.761). If we use as cutoff for serum - ngal 83.74 ng / ml, we can predict an ua event with sensitivity and specificity, 82.8% and 75%, respectively . The diagnostic value for serum - ngal in discriminating acs patients, from patients with sa is high (auc = 0.929) and better than of hs - crp (auc = 0.794) and pmn count (auc = 0.830). If we use as cut - off for serum - ngal 89.29 ng / ml, we can discriminate an acs patient from a stable patient with sensitivity and specificity, 89.3% and 81.6%, respectively . In this study, we demonstrated that serum levels of ngal are higher in patients with cad than in healthy controls patients . Among acs patients, these levels are gradually elevated according to the severity of the coronary clinical syndrome (ua, nstemi, and stemi). Also serum levels of ngal are higher in patients with acs than in patients with sa and could be used, with high negative value, to discriminate patients with stable or unstable coronary syndromes . Elevated plasma ngal levels were associated with atherosclerosis and were implicated as a predictor for cardiovascular mortality after cerebrovascular ischemia, possibly because of activation of blood leukocytes [1820]. Although in recent reports has been shown that ngal is present in atherosclerotic plaques and in human abdominal aortic aneurisms, raising the possibility that expression of ngal can be induced in vascular cells during atherogenesis, the underlying mechanism for the induction of ngal in vascular cells remains unknown [15, 21]. In further analysis the main source of ngal was found to be neutrophils, probably recruited in the vascular wall by platelet activation . Ngal is considered to have a protective effect on mmp-9 and enhancing its proteolytic activity, could be considered as an important factor indirectly contributing to the progression of aneurism as well as involved in the physiologic and pathologic remodeling of vessel walls . This view is further supported by the observation that similar neutrophil ngal / mmp-9 overexpression can be found in atherosclerotic plaques, particularly those with intramural haemorrhagic debris and central necrosis [15, 22]. The above evidence supports the clinical observations that high - circulating leucocyte (particularly neutrophil) counts are independent predictors of recurrent ischaemic attacks . This may be explained by their presence in the necrotic core of unstable plaques and by their proteolytic activity towards atherosclerotic tissue and secondary mobilization of thromboembolic fragments . The evidence derived from these experimental studies, showing the close link between neutrophils, their products and the natural history of atherosclerosis, and its complications, generated clinical studies that investigated the clinical utility of serum - ngal measurements . In two recent studies it was found that serum levels of ngal were significantly elevated in patients with angiographically confirmed cad compared to those with normal arteries or controls [24, 25]. Our data agree with these reports since we found that levels of serum - ngal are significantly higher in patients with all clinical syndromes of cad than in healthy controls, reinforcing the utility of ngal as biomarker of detection and the extent of cad . The expression of ngal from vascular cells during atherogenesis can also explain the differences between patients with sa and control subjects with no risk factors observed in our study . In addition to its induction in the vessels after mechanistic injury, previous studies suggest that ngal is strongly upregulated in atherosclerotic lesions and also in the heart after ischemic injury . It is possible that ngal produced by vascular cells could also be secreted into the systemic circulation . Inflammation plays a critical role not only in development and progression of atherosclerosis but also in pathogenesis of the destabilization of atherosclerotic plaque that leads to acs [1, 26]. Activation and degranulation of polymorphonuclear neutrophils and probably an underestimated critical components of an acute coronary inflammation event . Infiltrating macrophages and neutrophils participate in the transformation of stable coronary artery plaques to unstable lesions with a thin fibrous cap . It has been repeatedly reported that thrombosed plaques were densely infiltrated by neutrophils and macrophages [28, 29]. Macrophages and neutrophils and some other types of leukocytes produce various proteolytic enzymes which facilitate the rupture of plaques by thinning and weakening their normally thick and firm cap [30, 31]. Ngal is one protein, that is, produced not only by the distressed kidney but also by activated neutrophils and by the vascular wall cells . Recent studies have shown that neutrophils are the main source of ngal in blood [32, 33]. Increase in serum ngal resulting from activation of neutrophils may reflect an acute systemic inflammatory response to events such as stroke, renal failure, or infection [18, 3436] but are also linked with the presence of chronic inflammatory diseases such as atherosclerosis whose acute clinical manifestations represent acute on chronic inflammation . Besides neutrophils, ngal is also expressed by epithelial cells, renal tubular cells, and hepatocytes during inflammation or injury [3739]. Our data agree with the above studies since we found a positive correlation between levels of serum - ngal and systemic inflammation (expressed by the serum hs - crp levels and neutrophil count), and also serum levels of ngal were higher in patients with acs than with sa . The higher levels of serum - ngal observed in patients with acs compared to sa could be explained by the fact that neutrophil activation is present only in patients with acute coronary events (10,11). Also, our results, as far as patients with sa and ami, are similar with the findings of a recent published study which showed that the plasma level of ngal is higher in patients with ami compared with the patients with stable cad . In clinical practice, levels of serum - ngal have a high negative predictive value, 97.28% and 98.65% for patients with ua and acs, respectively . So, serum - ngal could be used in discriminating of patients with acs or especially ua from whom with sa or without cad, giving the possibility to exclude patients with symptoms similar to angina but not having true acs . As far as the gradual increase of serum - ngal, according to the seriousness of unstable coronary clinical syndrome, this could reflect the intensity of the inflammatory reaction, as it is expressed by the incremental increase of hs - crp and neutrophil count and their combination with serum ngal . Especially between serum - ngal and hs - crp,, our study shows that serum levels of ngal increase in patients with cad with every coronary clinical syndrome and reflect the inflammatory status in the same population . Having high negative predictive value could be used as a marker for the discrimination of sa or chest pain without cad from those with acs . Also in patients with acs, serum levels of ngal reflecting the inflammatory status could show the severity of coronary clinical syndrome (ua, nstemi, and stemi).
Diabetic nephropathy (dn) is the leading cause of chronic kidney disease and the primary diagnosis in more than 40% of new patients on dialysis in several parts of the world including the united states . Identifying the factors that contribute to the pathogenesis of dn is a critical step towards halting its progression . Connective tissue growth factor (ctgf; ccn2) is a matricellular protein involved in modulation of the extracellular environment and plays a role in the development and progression of diabetic complications [211]. In dn, increased renal ctgf expression has been described both in glomeruli and in the tubulointerstitium . Urinary ctgf (uctgf) is elevated in dn and correlates with markers of disease severity such as urinary albumin excretion and glomerular filtration rate (gfr) [1214]. Furthermore, uctgf has been shown to correlate with progression of microalbuminuria in diabetic patients . However, to interpret elevated uctgf in diabetes, it is crucial to understand the mechanisms behind this elevation . Both increased intrarenal production and elevated plasma ctgf have been suggested to account for elevated uctgf in dn [13, 14]. We have shown in healthy volunteers and normoglycemic mice that blockade of proximal tubular reabsorption results in a major increase in uctgf . The aim of this study is to evaluate which factors contribute to elevated uctgf in diabetes . In diabetic mice, we measured the fractional excretion (fe) of both endogenous ctgf and recombinant ctgf (i.e., not intrarenally derived ctgf) and examined the renal expression pattern of ctgf . Moreover, we examined the association between uctgf and urinary markers in type 1 diabetic patients . Diabetes was induced in nineteen 1012-week - old male c57bl/6 mice (harlan, horst, netherlands) by a single intraperitoneal injection of 200 mg / kg streptozotocin (stz, sigma, st . Louis, mo, usa) in sodium citrate buffer (100 mmol / l, ph 4.5). Blood glucose was determined one week after injection of stz (medisense precision xtra, abbott, abbott park, il, usa). Slow - release insulin pellets were implanted subcutaneously to stabilize the condition of the diabetic animals (linbit, linshin, scarborough, on, canada). Ten weeks after stz, renal function parameters and fractional excretion of ctgf were determined . Two miniosmotic pumps (model 1003d, alzet, cupertino, ca, usa, 100 l reservoir volume, release rate of 1 l / h) were implanted intraperitoneally under isoflurane anaesthesia . The other pump was used for simultaneous infusion of recombinant human ctgf (rctgf, 38 pmol / h) in fourteen of the diabetic mice and four of the control mice . We used the proteolytic aminoterminal fragment of ctgf since this is the predominant form of ctgf detected in plasma and urine [13, 1719]. To exclude that rctgf had an effect on endogenous ctgf mrna expression in the kidney, we infused four control mice and five diabetic mice with vehicle . The mice injected with rctgf were used to determine fe of rctgf and intrarenally derived uctgf (see below). Forty - eight hours after pump implantation, mice were put in metabolic cages overnight for timed urine collection . Plasma was collected before and after the urine collection, ctgf levels were determined, and time - weighted averages of plasma ctgf were calculated . All samples and metabolic cages all experiments were approved by the animal ethical committee of the university of utrecht and performed in accordance with national guidelines for the care and handling of animals . Three hundred and forty - nine well - characterized adult type 1 diabetic patients were selected from the outpatient clinic at steno diabetes center (copenhagen, denmark). Forty - three of the patients with diabetic nephropathy had been previously analysed in a longitudinal study examining the impact of losartan on uctgf . The study was approved by the ethical committee of copenhagen county and performed in accordance with the declaration of helsinki . Demographic and clinical data were recorded, including age, sex, duration of diabetes, and body mass index . Creatinine was determined in venous blood samples using the cobas mira plus (roche, basel, switzerland). Hba1c was determined using variant high - performance liquid chromatograph (bio - rad laboratories, hercules, ca, usa). The estimated gfr (egfr) was calculated using the modification of diet in renal disease study method . Albumin excretion rate (aer) was determined in 24 h urine collections using turbidimetry . Macroalbuminuria was defined as albuminuria> 300 mg/24 h, microalbuminuria as albuminuria 30300 mg/24 h, and normoalbuminuria as albuminuria <30 mg/24 h. sixty patients were excluded from analysis because of incomplete data due to insufficient sample availability or incomplete patient characteristics . Ctgf levels in plasma and urine were determined by sandwich elisa, using specific antibodies (fibrogen) directed against distinct epitopes in the aminoterminal fragment of ctgf, detecting both full length ctgf and the n - fragment (n - ctgf), as described previously . Two elisa assays were used: an assay for detection of human or rctgf in either human or mouse samples and an assay for detection of rodent ctgf in mouse samples . The antibody used for detection in the human ctgf assay does not cross - maxisorp microtiter plates (nunc, rochester, ny, usa) were coated with 0.4 g antigen (fitzgerald industries international, acton, ma, usa). After washing, 20-time diluted samples were incubated with biotinylated detection antibody (chicken anti - human 1-microglobulin; icl, newberg, or, usa). After washing, wells were incubated with hrp - conjugated streptavidin and binding was detected by measuring hrp activity using o - phenylenediamine as chromogenic substrate . Urinary 2-microglobulin (2 m) (anogen, mississauga, on, canada), heart - type fatty acid - binding protein (h - fabp) (hytest, turku, finland), immunoglobulin g subclass 4 (igg4), kidney injury molecule-1 (kim-1), and neutrophil gelatinase - associated lipocalin (ngal) (r&d systems, minneapolis, mn, usa) were measured by elisa, as described previously . Urinary n - acetyl--glucosaminidase (nag) was measured using a modified enzyme assay according to lockwood and bosmann and corrected for nonspecific conversion (haemoscan, groningen, netherlands). Prior to the animal experiments, 5% fitc - inulin (sigma - aldrich, zwijndrecht, netherlands) was dissolved in 0.9% nacl by heating in boiling water and dialyzed to remove residual free fitc . The dialyzed fitc - inulin solution was sterilized by filtration through a 0.20 m syringe filter (corning, new york, ny, usa). Fluorescence of plasma and urine was measured within hours after collection in black 96-well plates (fluotrac, greiner bio - one, kremsmnster, austria) in a fluostar optima (bmg labtech, offenburg, germany) at 485 nm excitation and 538 nm emission . Plasma and urine samples were buffered to ph 7.4 by dilution with hepes 50 mmol / l ph 7.4 (5- and 10-fold, resp .) Before fluorescence measurement . Matrix correction was applied for the standard curves . For routine histological examination and scoring of tubular atrophy (ta), formalin - fixed, paraffin - embedded (ffpe) tissue sections were stained with periodic acid - schiff (pas). Ta was defined as the presence of tubules with thickened tubular basement membranes and/or atrophic cells lining the tubules, with loss of brush border . Ta was scored by two skilled observers in ten randomly selected cortical areas on 100 magnification . The following semiquantitative scale was used: 0: no ta; 1:> 010% ta (> 010% of tubuli in the field shows atrophy); 2: 1025% ta; 3: 2550% ta; 4: 5075% ta; 5: 75100% ta . Photographs were taken on a nikon eclipse e800 microscope with a nikon dxm1200 digital camera using the nikon act-1 software version 2.70 (nikon netherlands, lijnden, netherlands). Briefly, 6 m thick ffpe tissue sections were dewaxed and rehydrated, incubated with proteinase k, postfixed, prehybridized, and hybridized with a 542-nt antisense ctgf dig - labeled riboprobe for 16 h at 70c . Upon washing, bound dig was detected using alkaline phosphatase - conjugated sheep anti - dig and nbt / bcip (roche, almere, netherlands). For isolation of cortical mrna, about 30 mg of the renal pole was cut using a scalpel . For medullary mrna, fifteen 10 m cryosections per sample were put on a glass slide and medulla was identified based on location and morphology and microdissected using a scalpel . The remaining tissue was stained with hematoxylin and eosin to check the accuracy of medullary microdissection . Total rna was isolated using the rneasy rna isolation kit (qiagen benelux, venlo, netherlands). Rna was reverse - transcribed with superscript ii reverse transcriptase (invitrogen, paisley, uk). Quantitative reverse transcription pcr (qrt - pcr) was performed on an applied biosystems 7900ht fast real - time pcr system (applied biosystems, nieuwerkerk aan den ijssel, netherlands). Expression levels of ctgf and the internal references, tbp and gapdh, were determined using applied biosystems inventoried taqman gene expression assays, containing primers and probe . Urinary ctgf, fractional ctgf excretion, ctgf mrna (fold change), urinary markers, and human plasma ctgf data were logarithmically transformed to allow parametric analysis . Urinary igg4 was dichotomized as greater than or less than the detection limit because of a high proportion of subjects with undetectable levels . Differences were calculated using student's t - test or mann - whitney u test where appropriate . Correlations between variables were evaluated by pearson's and spearman's correlation coefficients (r and, resp .) Where appropriate . Multiple linear regression analysis was performed to identify parameters independently associated with uctgf . To explore the association between clusters of biomarkers and uctgf, we used mean standard deviation scores (z - scores), a method previously described by schram et al . . For each individual, the values of each marker were expressed as a z - score, that is, (value in the individual minus the mean value in the study population) divided by the standard deviation . The proximal tubular reabsorption (ptr) z - score was then calculated as (z - score of 1 m + z - score of 2m)/2, the proximal tubular injury (pti) z - score as (z - score of kim-1 + z - score of nag + z - score of ngal)/3, and the combined proximal tubule (pt) z - score as (ptr z - score + pti z - score)/2 . This approach was used in order to avoid underestimating the associations between the different markers and uctgf . For all comparisons, the statistical analysis was performed using pasw statistics software version 18.03 for macintosh (spss inc ., chicago, il, usa) and graphpad prism software version 4.03 for windows (graphpad software, san diego, ca, usa). In the diabetic mice study, urinary ctgf expressed per g creatinine provided similar results (see supplementary figures in the supplementary material available online at http://dx.doi.org/10.1155/2015/539787). Fractional excretion (fe) of ctgf was calculated as follows:(1)fectgf = ctgfurineinulinplasmactgfplasmainulinurine100%.assuming that rctgf and endogenous ctgf (ectgf) are handled similarly by the kidney and taking into account that rctgf can only appear in urine by filtration from plasma whereby ferctgf is only determined by ctgf filtered from the plasma (and not by intrarenal ctgf production), the relative contribution of plasma - derived ectgf to urinary ectgf could be estimated as follows:(2)fraction of uectgf derived from plasma = ferctgffeectgf.the relative contribution of intrarenally derived ctgf to urinary ectgf could be estimated as follows:(3)fraction of uectgf derived from a local intrarenal source=1ferctgffeectgf.one diabetic mouse was excluded from this calculation because of unreliable measurements (below lower limit of quantification). The absolute amount of urinary ectgf derived from an intrarenal source was estimated as follows:(4)excretion of intrarenally - derived ectgf = excretion of ectgf1ferctgffeectgf.renal clearance of fitc - inulin was calculated by the standard formula . Diabetes was induced in c57bl/6 mice with stz which caused pronounced hyperglycemia within one week . At the end of the study period the diabetic mice had developed dn, for example, increased albuminuria and decreased gfr (table 1). Urinary excretion of ctgf was markedly elevated in all diabetic mice (999 fmol/24 h (1902946), p <0.0001) while in control mice uctgf was measurable in only a minority, with a maximum of 57 fmol/24 h. plasma ctgf was mildly increased in diabetic mice (340 pmol / l (290370) versus 230 pmol / l (185295) in control mice, p = 0.003). To establish the influence of diabetic kidney disease on the renal handling of ctgf, we infused recombinant human ctgf (rctgf) and fitc - inulin simultaneously by miniosmotic pumps . For detection of rctgf levels we used an elisa that does not cross - react with endogenous ctgf (ectgf). This allowed us to study urinary excretion of plasma derived ctgf independent from intrarenally produced ctgf, since urinary recombinant ctgf is exclusively derived from filtered plasma rctgf . On the contrary, urinary endogenous ctgf (uectgf) since ctgf is almost completely filtered from the plasma (sieving coefficient 0.74) and rctgf clearance and fitc - inulin clearance were not differentially affected between control and diabetic mice (p = 0.53, data not shown), fractional excretion of rctgf (ferctgf) could be regarded as a measure of tubular ctgf passage with increased ferctgf reflecting reduced tubular reabsorption of ctgf . We observed that in diabetic mice ferctgf was strongly increased (72-fold, p = 0.004, figure 1(a)), while in control mice tubular reabsorption of (filtered) rctgf was virtually complete . Ferctgf showed a tight linear correlation with urinary excretion of endogenous ctgf (uectgf) in diabetic mice (r = 0.95, p <0.0001, slope 1.1 on a logarithmic scale (figure 1(b))) and emerged as an independent determinant of uectgf (= 1.3, p <0.001) in a multivariate model that included the following parameters: ferctgf, plasma ctgf, cortical and medullary ctgf gene expression (derived from qrt - pcr data of microdissected kidney, see below), and gfr . We observed no obvious glomerular damage in diabetic animals, but significant tubular atrophy was observed (figures 1(c) and 1(d)), which correlated with uectgf (r = 0.62, p = 0.005, figure 1(e)). This is consistent with tubular function as a major determinant of elevated uectgf . To investigate the relative contribution of plasma - derived ectgf to uectgf, we compared the fractional excretion (fe) of recombinant and endogenous ctgf . Assuming that rctgf and ectgf are handled similarly by the kidney, comparison of ferctgf and feectgf allowed us to estimate the contribution of plasma - derived ectgf to uectgf, the ratio ferctgf / feectgf representing the fraction of urinary ectgf derived from plasma . This revealed that only 37 (2955)% of urinary ectgf could be accounted for by plasma - derived ectgf, implying that most urinary ctgfs in diabetes must be derived from an intrarenal source and excreted into the tubular lumen (figure 2). Due to the extremely low uectgf in healthy animals, the relative contribution of plasma - derived ectgf to uectgf in the healthy situation could not be established . To investigate the localization of intrarenal ctgf production this showed that ctgf expression was hardly detectable in control kidneys but abundant in diabetic kidneys, where it was mainly present in glomeruli and medullary tubules (figure 3(a)). In agreement, qrt - pcr of microdissected kidney revealed that both cortical and medullary ctgf mrna were significantly increased in diabetic animals compared with controls (2.5-fold and 2.7-fold, resp ., we did not observe differences in ctgf mrna expression in cortex or medulla between animals infused with rctgf or with vehicle, both in diabetic mice and in nondiabetic controls (data not shown). Intrarenally derived uctgf showed a tight linear correlation with ferctgf (r = 0.92, p <0.0001, slope 1.0 on a logarithmic scale, figure 4(a)). Cortical ctgf expression also correlated with intrarenally derived uctgf (r = 0.78, p = 0.002, figure 4(b)), while no such correlation was observed for medullary ctgf expression (p = 0.12, figure 4(c)). In a multivariate model including cortical and medullary gene expression ferctgf remained the only independent determinant of intrarenally derived uctgf (= 1.1, p <0.001). These data suggest that tubular function is also an important determinant of intrarenally derived ctgf in the urine . To investigate the determinants of uctgf in human diabetes, we studied the associations of uctgf with tubular markers and a glomerular marker in a cohort of patients with diabetes mellitus type 1 . The low - molecular - weight proteins 2 m and 1 m were used as markers for reduced tubular reabsorption [27, 28]. Kim-1, ngal, and nag were used as markers for proximal tubular damage [29, 30] and h - fabp as a marker for distal tubular damage [31, 32]. In univariate analysis, uctgf correlated with each of the damage markers (table 3). In a multivariate linear regression model containing age, sex, egfr, plasma ctgf, duration of diabetes, bmi, and hba1c, each of the tubular markers remained independently associated with uctgf while the glomerular damage marker igg4 lost its significance (table 3). When igg4, the proximal tubular reabsorption, and proximal tubular injury z - scores (or the combined proximal tubular z - score) and h - fabp were included simultaneously into the model, both proximal and distal tubular markers, but not igg4, were independently related to uctgf (table 3). These findings suggest that also in human diabetes uctgf is dependent on tubular status, with elevated uctgf reflecting both proximal tubular dysfunction and pathology in the distal tubule . Understanding the different determinants of elevated uctgf in diabetes is essential for its proper interpretation as biomarker and pathogenic factor . Previously, we have shown that in the healthy kidney filtered ctgf is almost completely reabsorbed in the proximal tubules by megalin - mediated endocytosis and that impairment of tubular reabsorption results in increased urinary excretion of ctgf (in close correlation with that of 2 m). Here we show that also in diabetes tubular damage is a major determinant of elevated uctgf . Our findings indicate that in addition to reduced proximal reabsorption of uctgf increased intrarenal ctgf production plays a role . Both in human and in experimental diabetes, uctgf was independently associated with decreased tubular reabsorption . While in experimental diabetes uctgf correlated very tightly with tubular dysfunction, the association in human diabetes was somewhat less prominent . There was a clear independent association between uctgf and distal tubular damage marker h - fabp, suggesting increased ctgf secretion by the distal nephron . This conforms to the increased distal tubular ctgf mrna expression that we observed in diabetic mice, although the correlation between uctgf and medullary ctgf mrna did not reach significance . Tubular damage might thus contribute to uctgf in two ways, by (1) decreased proximal reabsorption of ctgf and (2) increased expression and luminal secretion of ctgf in the distal nephron . Possibly, solute overload to the distal nephron due to proximal tubular dysfunction may cause distal tubular injury and induce distal tubular ctgf expression . Although we are not aware of any clinical, experimental, or in vitro studies addressing ctgf expression specifically in medullary tubules in diabetic kidney disease, increased tubular ctgf protein expression has been reported before, both in human and in experimental diabetes, and was postulated to contribute to tubulointerstitial fibrosis via paracrine effects at the basolateral membrane [4, 3335]. However, secretion of ctgf at the apical membrane of the distal tubular cell into the tubular lumen has not been described . It would be useful to have matched kidney biopsies from diabetic patients with known plasma and urine ctgf levels to explore the associations between increased uctgf and pctgf, tubular dysfunction, and local production of ctgf . Although dn is traditionally viewed as a primarily glomerular disease, tubulointerstitial injury is also a major feature of dn with important prognostic significance [36, 37]. Tubular injury was shown to be an early event in the pathogenesis of dn and tubular proteinuria could identify patients susceptible to dn even earlier than albuminuria alone [3741]. Renal ctgf protein overexpression at 5-year duration of diabetes predicted 10-year albuminuria values, while at 5-year albuminuria values did not differ from nondiabetic controls . Elevated uctgf reflecting tubular damage might thus be a valuable prognostic marker in dn and useful for early detection of patients at risk . As compared to established markers of tubular damage, ctgf is of particular interest because it might also enhance tubulointerstitial fibrosis [4, 34, 35]. However, the true clinical value of uctgf in diabetes still needs to be established . In this study, we used a single high dose of stz to induce diabetic kidney disease in mice . Since stz has been associated with acute tubular injury, we cannot exclude that part of the tubular damage observed in our dn model might be directly related to stz toxicity . However, at 10 weeks after infusion of stz, we expect that the animals have recovered from the acute toxic effect of stz . Instead, they have developed kidney disease in which both chronic glomerular and tubular damage are present, features that are also present in human diabetic kidney disease . To deduce the relative contributions of local production and tubular dysfunction in uctgf, a dn model with both glomerular and tubular features was required . Since both features are not always present in non - stz pure dn models, which typically manifest a primarily, if not exclusively, glomerular and sometimes vascular phenotype, we selected the stz model for our studies . In our mouse model of diabetic kidney disease, we observed that most uctgf had a local renal source . In addition to increased medullary ctgf mrna expression, ctgf production was increased in glomeruli, which is in agreement with previous reports [34, 35, 4446]. However, it remains unclear how much intrarenally derived uctgf has a glomerular source and how much is secreted at the apical membrane of the distal tubular cell . The tight independent linear association of intrarenally derived uctgf with ferctgf suggests that reduced tubular reabsorption of ctgf originating from a source upstream the proximal nephron, that is, the glomerulus, plays an important role . In human diabetes, but not in experimental diabetes, plasma ctgf emerged as an independent determinant of uctgf . This suggests that in human diabetes the amount of ctgf filtered from the plasma in the glomeruli also contributes to uctgf, in addition to tubular damage . Plasma ctgf was shown to predict end - stage renal disease and mortality in macroalbuminuric patients . For uctgf this has not been investigated yet, but the independent association with plasma ctgf and tubular damage suggests promising biomarker value . In conclusion, urinary ctgf excretion in diabetes is elevated as a result of both increased local production and reduced reabsorption due to tubular dysfunction . We submit that urinary ctgf may be a useful biomarker reflecting both glomerular and tubulointerstitial hallmarks of diabetic kidney disease.
In a recent article in genome research, thompson and colleagues present a development of a next - generation sequencing technology - the heliscope sequencer - that enabled them to detect mutations in the human breast cancer 1 (brca1) gene, as a model of a clinical diagnostic protocol . It therefore holds great promise for overcoming the emerging problem in clinical genetics of target overload: the presence of a large number of gene mutations of clinical relevance in a single disease entity . In no field is this challenge more apparent than in the genomics of cancer . The past few years have seen an unprecedented deluge of data on the genes mutated in cancer and other diseases . So far, the sequences of over 50 individual cancer genomes have been published and this number is set to increase exponentially . The advent of next - generation technologies (such as the roche 454 gs flx+, llumina hiseq 2000, applied biosystems solid and heliscope single - molecule sequencer machines), which allow a human genome to be sequenced in a single week - long run, has led to a large shift in our understanding of the mutations that drive cancers . For the clinician, mutations in cancer can have relevance for diagnosis, prognosis and treatment choice . However, it is now apparent that these clinically relevant mutations will be both numerous and found at low prevalence in individual cancer types . In particular, for the majority of cancers there will be no single' magic bullet' targeted therapy . The breakpoint cluster region - abelson murine leukemia homolog (bcr - abl) fusion kinase, which is characteristic of chronic myeloid leukemia, is the exception not the rule when it comes to druggable cancer genes; it seems, instead, that multiple drug targets will be mutated at low frequency throughout common cancers . This target overload is not restricted to the management of cancers and is also seen with monogenic disorders, for example, mental retardation and hereditary cancer pre - disposition . It is therefore necessary to screen numerous genetic loci to decide on the best course of clinical management for an individual patient and this must be done in a rapid and cost - effective manner . The current technology for searching for mutations is to amplify a region of interest - in multiple fragments of a few hundred base pairs each in separate pcr reactions - then sequence the products by standard sanger chain terminator sequencing . Although highly accurate for the detection of single - nucleotide variants and small insertions or deletions, this approach is expensive, labor intensive and unable to detect large - scale insertions or deletions . This is because sanger sequencing can reliably detect mutant alleles only when they are present in more than about 20% of the relevant dna, and this will not be the case, for example, for a heterozygous mutation in a tumor contaminated with 60% normal dna, a scenario that is not uncommon . Thompson and colleagues have used a next - generation true single - molecule sequencing (tsms) system, the heliscope sequencer, to profile the mutational pattern of the human cancer gene brca1 . Germline mutations in the genes brca1 and brca2 are associated with dramatically increased rates of breast and ovarian cancers and contribute to about 10% of all breast cancer cases . In addition, poly - adp ribose polymerase inhibitors, a recently developed family of pharmaceutical agents, seem to show selective toxicity for cancers with mutations in the brca genes . Cost - effective sequencing of these genes is therefore a highly desirable clinical tool for the management of breast cancer patients and those with strong family histories of the disease . The technology used is a development of the heliscope tsms platform . In the standard heliscope protocol, dna is fragmented and poly(a) adaptors are added to the ends of fragments . They are then captured on a glass slide coated with covalently bound poly(dt) oligonucleotides, and sequenced . Thompson et al . Were able to dispense with the initial sample preparation steps (addition of poly(a) adaptors and 3' blocking - performed to prevent extension of the 3' end of bound poly(a)-tagged dna molecules) and instead directly captured only the fragments of dna belonging to the brca1 locus, using oligonucleotides that match sequences in the brca1 region (figure 1). Approximately 20% of the sequenced reads mapped to brca1, which equates to about 100,000-fold enrichment of the target sequence . As the length of sequence that can be read in this system is limited, oligonucleotides were designed at 20 - 30 base pair intervals throughout the coding sequence of the gene, to ensure complete coverage . Importantly, the authors were able to obtain sequencing results from as little as 100 ng of input material - thus showing that the technology could be used with samples collected as diagnostic biopsies . Tumor material can be collected and (a) snap frozen to preserve intact dna and rna or (b) fixed in formalin then embedded in paraffin for section and histopathological review . Following (c) dna extraction, (d) the dna (e) dna fragments are hybridized to the flow cell, which is covered with oligonucleotides with sequence complementary to the region corresponding to the brca1 gene . (f) each individual molecule of dna is then sequenced simultaneously by sequential addition of fluorescently labeled nucleotides (purple). This approach has several advantages over the more traditional sanger sequencing commonly used for the detection of mutations . Firstly, there is little required in the way of sample preparation - only sonication of the dna, and in the case of archival formalin - fixed material it is possible that even this step could be dispensed with - therefore reducing cost, turn - around time and the risk of errors in sample handling . Secondly, unlike sanger sequencing, the heliscope system allows the detection of large deletions, by determining the number of fragments of dna that are present from a specific location; a decreased number of fragments from a region suggests a loss of genetic material . Finally, the heliscope system directly sequences individual molecules rather than - as with sanger sequencing - examining the average sequence of many millions of dna molecules . This should provide increased sensitivity for the detection of low prevalence mutations, an essential feature in the sequencing of a heterogeneous cancer sample . The present technology is an advance over recently presented techniques for analyzing the mutational status of target genes using next - generation sequencing instruments . With the advent of more competitively priced next - generation sequencing machines, which can provide sequence data in a matter of hours, not days (such as life technologies' ion - torrent and illumina's miseq), it is feasible that such approaches could be used routinely in the clinical setting . However, the instruments involved still require the selective amplification of target dna and the relatively complex preparation of this material for sequencing . Thus, although they take advantage of the exceptionally cheap per - base cost of next - generation sequencing, competing techniques are still limited by its flaws: high complexity and slow turnaround time . Genotyping by mass spectrometry has also been applied to the resequencing of relevant mutations . This approach, although sensitive, is limited, in that it is capable of detecting only known mutations and will therefore miss novel gene lesions . For the foreseeable future, the high cost and complexity of data analysis will limit the application of whole - genome sequencing for the detection of mutations in a clinical setting . Targeted resequencing of areas of interest will therefore remain key to determining mutational status . The method published by thompson et al . Although currently only a single gene is screened, there is clearly scope for the creation of multi - gene capture arrays, allowing large numbers of loci to be analyzed rapidly and cost - effectively with low dna input requirements . In its simplicity, this approach provides an opportunity to truly begin integrating the vast quantity of genomic data generated in this next - generation era with clinical practice . We would like to thank claire pike and karen howarth for helpful discussion and reading of the manuscript and the wellcome trust translational medicine and therapeutics program, breast cancer campaign and cancer research uk for funding.
The first step in a typical computational pipeline for protein identification through database searching is comparing ms / ms spectra to peptide sequences to identify the best matching peptide for each spectrum, referred to as peptide - to - spectrum matches (psms). These psms are then processed by protein inference algorithms to produce a minimal list of proteins that would need to be present in the sample to explain the identified psms . The proteins in this list are also assigned a confidence score or protein probability calculated on the basis of several factors, including the number of psms supporting the protein and the match score of the psms . To determine the confident identifications from the results of protein inference, false discovery rates (fdr) only proteins identified at or above a certain fdr threshold (typically 1 or 5%) are chosen as high - confidence identifications for further analyses . Although sophisticated algorithms for spectral matching and analysis have been developed, protein identification can still be hampered by issues such as low efficiency of peptide ionization, low - quality or noisy spectra, dynamic range of protein abundances, and the complexity of protein samples . To deal with such issues, there have been continued attempts to incorporate additional information about the ms / ms experiment into analysis pipelines, such as peptide chromatographic retention time, pi, or mass accuracy, some of which are now a routine part of many proteomic analysis pipelines . Studies have also investigated using matching ms and ms information, match scores from multiple search engines, and various other information sources to rescore or adjust protein identification probability . Another category of methods have investigated utilizing external information (information from outside the ms / ms experiment) such as microarray data, protein protein interaction networks, or gene functional networks to improve protein identifications . A recent study by wang et al . Described an approach to utilize rna - seq abundance information to limit the size of protein sequence databases and, we describe an alternate method for incorporating external information such as rna - seq abundance and gpmdb identification frequency into proteomic analysis pipelines, through rescoring or adjustment of protein identification probabilities . Rna - seq uses short read sequencing technologies to sequence the rna content (transcriptome profile) of a sample . On the basis of the central dogma of molecular biology, it is a reasonable assumption that proteins corresponding to high - abundance transcripts are more likely to be found in a sample . The global proteome machine database (gpmdb) is a repository storing the results of proteomics experiments . With the large volume of data aggregated in gpmdb, the frequency of identification of a protein in gpmdb can be used as a surrogate measure of a protein s propensity to be observed in a ms / ms experiment . In other words, we can reasonably assume that proteins with a high gpmdb identification frequency (gpmfreq) are more likely to be identified in an ms / ms experiment . In this study, we evaluate the utility of incorporating both of the above types of information into proteomics analysis pipelines . Data from vcap, a human prostate cancer cell line, and hek293, a cell line derived from human embryonic kidney cells, were used in this study . The ms / ms and rna - seq data for the vcap cell line were generated in parallel at the same lab . This rna - seq data was also used as the control sample in a paper by sam et al . And is available for download from the ncbi short read archive, sra (sra accession nos ., ms / ms data was obtained from control samples in a publication by fonslow et al ., whereas the rna - seq data was downloaded from data generated by sultan et al . The gpmdb identification frequencies, which are not cell line specific, were obtained by querying gpmdb for every ensembl protein i d using a perl script . Collection of vcap whole cellular protein extract was done in ripa complete buffer supplemented with halt protease and phosphatase inhibitor cocktail (peirce biotechnology). Fifty milligram aliquots of total cellullar proteins were first separated by 1d sds - page (412% bis - tris novex - invitrogen, carlsbad, ca). Forty equal - sized gel bands were excised and subjected to in - gel digestion as previously described . Extracted peptides were reconstituted with mobile phase a prior to online reverse - phase nanolc peptides were eluted online to the mass spectrometer with a reverse - phase linear gradient from 97% a (0.1% formic acid in water) to 45% b (0.1% formic acid in acetonitrille). Peptides were detected and fragmented in the mass spectrometer in a data - dependent manner, sending the top 12 precursor ions, excluding singly charged ions, for collisional induced dissociation . Raw spectra files were converted into mzxml by an in - house version of readw . Both of the ms / ms experiments (vcap and hek293) used in this study were seen to have very deep proteome coverage, with about 40006000 protein identifications at 1% fdr . However, most ms / ms experiments do not achieve this level of proteome coverage . To investigate performance under experimental conditions with varying depths of proteome coverage, the ms / ms data was sampled at the level of individual mzxml files to create various subsets of data of varying sizes (fewer files would be included for a smaller subset, and more files, to get a larger subset). The vcap data had a total of 40 mzxml files, whereas the hek293 data consisted of 60 mzxml files . The number of protein identifications in these subsets ranged between about 500 and 5000 protein identifications at 1% fdr . The ms / ms data was searched using the x!tandem (cyclone; 2010.12.01.1) search engine with a k - score plugin provided by the trans - proteomic pipeline . The search was performed against the ensembl v.66 human proteome with reversed protein sequences appended as decoys . Trypsin was specified as the enzyme with no missed cleavages allowed, and cysteine carbamidomethylation and methionine oxidation were set as fixed and variable modifications, respectively . Vcap data was searched using a precursor mass error of 1 to + 4 da, whereas the hek293 data (high mass accuracy data) was searched with a precursor mass error of 50 ppm . Statistical validation of psms was performed using the trans - proteomic pipeline (tpp v4.6 occupy rev 2) software suite . Vcap data was processed with + 1 charge state ions set to be ignored and using a semisupervised model for estimating negative distributions . Hek293 data was processed using the same settings as above along with additional parameters to use accurate mass binning and the ppm scale for the mass models . The output protxml files from tpp were processed using the abacus software tool to select a representative protein for each protein group, according to heuristic filters built into the tool . Rna - seq data was aligned to the ensembl v.66 human genome (hg19 build 37) using the tophat aligner (tophat v.1.3.2). Parameters were set to allow up to one mismatch per alignment, and a gtf file containing ensembl v.66 gene annotations was provided to tophat, using the g transcript abundance, in the form of reads per kilobase per million mapped reads (rpkm) (read count normalized to transcript length and total number of reads in the experiment), was calculated for each transcript from the bam file output from tophat . Rpkm calculation was performed with a custom r script utilizing functions from the bioconductor packages rsamtools (v.1.6.3) and genomicfeatures (v.1.6.9). Our approach to incorporating rna - seq or gpmdb frequency information (figure 1) is built upon a statistical adjustment of the protein probability . The probability adjustment increases the identification confidence scores of proteins that have significant supporting evidence from external data (high transcript abundance in rna - seq or high frequency of identification in gpmdb), relative to other proteins without such supporting evidence . Protein identifications that previously fell just below the fdr threshold based on ms / ms evidence alone, in a gray zone of identification confidence, can be promoted above the threshold when ranked by the adjusted probability . Therefore, we are able to obtain more protein identifications at the same fdr . (a) external information is added to protein identifications from the analysis pipeline . Protein probabilities are adjusted on the basis of transcript abundance (rpkm) or gpmdb identification frequency (gpmfreq). (b) decoys sequences used to estimate fdr thresholds do not have native rpkm (or gpmfreq) values; they are assigned values by sampling from a set of all forward sequences with similar length (see methods). Decoy approach (reversed decoy sequences are appended to the forward protein sequence database before performing database searching . The number of identifications matched to decoy sequences is used to estimate the rate of random matches in the identifications mapped to forward sequences). Because decoy sequences do not have inherent rpkm / gpmfreq values, their identification probabilities would be selectively decreased during probability adjustment based on the external information . To be able to estimate fdr after probability adjustment in an unbiased manner, a rational method for assigning rpkm / gpmfreq values to decoy sequences the density distribution of rpkm / gpmfreq values for proteins identified in the ms / ms experiment at 1% fdr (confident true positive identifications) is seen to be appreciably different from that of rpkm / gpmfreq for all proteins (figure 2). On the basis of this observation, sampling from the all proteins distribution allows for the unbiased assignment of rpkm / gpmfreq values to decoy sequences while maintaining discrimination between decoy and forward identifications . Weak correlations among the rpkm, gpmfreq values, and protein length were also observed in the data (data not shown). To preserve this structure in the data, our sampling approach was designed to sample rpkm / gpmfreq values together from forward sequences and assign them only to decoys of similar length (see supporting information methods for a more detailed description of the sampling process). In further analysis, it was observed that the improvement from probability could be slightly increased if the sampling for decoy values was weighted to prefer values from proteins not identified in the ms / ms experiment, instead of using a completely random sampling (supporting information figure 5). However, only results from the more statistically rigorous approach of completely random sampling are reported here . Density distributions of rpkm (a) and gpmfreq (b) values (log - scaled) for proteins identified at 1% fdr in the vcap cell line and all proteins in ensembl are plotted . The difference between the two distributions allows us to sample the all proteins distribution to assign values to decoys in an unbiased manner while still maintaining discrimination between true positive and decoy identifications . When performing probability adjustment, pprot, a protein probability score calculated on the basis of maximum peptide probability, was used as the prior probability (see supporting information methods for details of pprot calculation). Pprot was used instead of the native protein probability reported by tpp because it has been observed that the maximum peptide probability is a more reliable indicator of true protein identifications than the protein probability value (supporting information figure 1), especially for large samples . Using bayes theorem, the probability adjustment estimates the probability of a protein identification being a true positive given its rpkm / gpmfreq value (eq 1).1where v can be either an rpkm or gpmfreq value . The prior probability terms p(+) and p() were substituted with pprot and 1 pprot, respectively . To estimate the conditional probabilities of decoy or forward identifications having value v, p(v\|) and p(v\|+), the density distribution of log - scaled rpkm / gpmfreq values was placed into bins of equal width (supporting information figure 2). Conditional probabilities for each bin were calculated as p(vi\|) = ndi / ndt, where vi is any rpkm / gpmfreq value that falls within bin i, ndi is the number of decoys having rpkm / gpmfreq values within bin i, and ndt is the total number of decoys in the sample . Values for p(vi\|+) were also estimated similarly, but instead of number of decoys, the number of forward hits with pprot> 0.5 (i.e., forward identifications that are more likely to be true positive than false positive) were used . Because the rpkm / gpmfreq values are assigned through random sampling, the assignment and probability adjustment (figure 1a) are repeated multiple times to nullify any sampling artifacts and to obtain stable mean adjusted probability values . In our study, the mean values were typically seen to stabilize after about 200 iterations (supporting information figure 3), but the process was repeated to 500 iterations for the results reported here . The effect of the probability adjustment was measured by comparing the number of protein identifications at 1% fdr without adjustment to the number of protein identifications at 1% fdr after probability adjustment (rpkm or gpmfreq based). The percent improvement from all of the various subsets was calculated and plotted, as shown in figure 3a, b . Percentage improvement due to the probability adjustments (rpkm and gpmfreq) for vcap (a) and hek293 (b) cell lines plotted at various depths of proteome coverage (no . Of proteins). The probability adjustment results in improvements of almost 8% in the hek293 cell line and up to 4% in vcap (figure 3). Notably, the amount of improvement observed is similar for both the rpkm and gpmfreq adjustments . Furthermore, it appears that using rna - seq data generated in parallel to the ms / ms data (vcap) or rna - seq generated at a different time and location from the ms / ms data (hek293) does not significantly affect the results . We believe the probability adjustment works by boosting protein identifications that fall in a gray zone of confidence of identification . To test this hypothesis, the entire analysis described above was repeated using maximum hyperscore instead of maximum peptide probability as the identification confidence score . Hyperscore is a spectral matching score calculated and reported by the x!tandem search engine . The maximum hyperscore for a protein can be used as an alternate, albeit less effective than the maximum peptide probability, confidence score for sorting protein identifications and estimating fdr thresholds . Because maximum hyperscore is a suboptimal score compared to maximum peptide probability, the resulting protein identifications should have more proteins in the gray zone and therefore the probability adjustment on these identifications should provide increased improvement . As expected, figure 4a, b shows that the percentage improvement is much greater (720%) in the maximum hyperscore - based analysis . These results support the idea that the amount of improvement obtained from probability adjustment is dependent on the number of proteins falling in the gray zone of the confidence of identification . Percentage improvement at various depths of proteome coverage when probability adjustment is performed on a maximum hyperscore - based protein identification probability . As expected, the improvement is significantly greater when the suboptimal maximum hyperscore is used instead of maximum peptide probability (figure 3). In our analysis, a clear trend of the percentage improvement from probability adjustment decreasing as the depth of proteome coverage (i.e., number of proteins identified in the data set) increases can be seen (figure 3). With deeper coverage of the proteome, such proteins would have low rna - seq abundance and/or low frequency of identification in gpmdb . Therefore, these proteins will not benefit from a probability adjustment based on rpkm / gpmfreq evidence and, in fact, may have their confidence scores decreased by it . Furthermore, increasing depth of proteome coverage not only increases the number of proteins identified but also increases the amount of ms / ms or spectral evidence collected for each identified protein . This would lead to a decrease in the number of proteins falling in the gray zone . On the basis of this, we believe that the observation of decreased improvement in deeper coverage data sets reflects the fact that in these data sets there are fewer proteins that would benefit from the probability adjustment . A more detailed analysis of the effects of probability adjustment was carried out on one of the sampled data subsets from each cell line, the results of which are shown in table 1 . Proteins that were promoted above the 1% fdr threshold as a result of the probability adjustment were selected for manual validation . These selected proteins were compared with the list of proteins identified at 1% fdr in the complete data set (largest data set without any sub sampling) of that cell line . A promoted protein being found in the complete sample would suggest that the protein is indeed a true identification . It is possible that there was not sufficient ms / ms evidence in the smaller sampled data set for the protein to be confidently identified, but the probability adjustment using rpkm / gpmfreq information provided the necessary boost to promote it above the fdr threshold . In our analysis, the remaining 2030% of promoted proteins, which were not observed in the complete data set, were seen to have high confidence scores in the same range as that of the validated proteins . In other words, it is possible that these proteins were not observed in the complete data set because, even with the increased amount of ms / ms evidence collected in the complete data set, there still is not sufficient evidence to confidently identify them solely by ms / ms evidence without the aid of external information . In our analysis, a larger proportion of proteins are validated in the vcap sample, which has more ms / ms data collected (6000 proteins), than in the hek293 sample (3000 proteins), which appears to support this interpretation . The probability adjustment method described here allows us to utilize external data, such as rna - seq abundance, or gpmdb identification frequency, to improve the sensitivity of protein identification through database searching . Although some studies generate rna - seq data in parallel to proteomics data, large amounts of rna - seq data for many common organisms and/or cell lines used in biological research are already freely available from public resources such as the sequence read archive (sra). As we can see from figure 3, whether rna - seq data is generated in parallel with proteomics data (vcap) or independently (hek293) this will allow us effectively leverage the large amounts of publicly available rna - seq data . Furthermore, the improvement obtained by adjusting probability based on gpmfreq is similar to, and sometimes better than, improvement from rpkm adjusted probability . This is very convenient, allowing us to make use of readily available gpmdb information in our proteome analysis pipelines . Of course, this requires that the gpmdb repository contains enough experiments for the organism of interest for the gpmfreq values to be meaningful . However, for commonly studied organisms of interest such as human or mouse, with numerous experiments in gpmdb, it can be a useful source of external information . Computing a combined adjusted probability from both rna - seq and gpmdb information does not result in a marked improvement in protein identification over the individual probability adjustments (supporting information figure 4), suggesting that rna - seq and gpmdb capture similar types of information about a sample for the purposes of probability adjustment . As mentioned earlier, the improvement obtained from probability adjustment decreases as the depth of proteome coverage of the experiment increases because there are fewer proteins in the gray zone that would benefit from the probability adjustment and there are more rare and low - abundance proteins that could be penalized by it . This is an inherent upper limit to the amount of improvement that is possible by this method and must be taken into consideration when applying this probability adjustment to large samples . However, this method remains useful for ms / ms data of low - to - medium levels of proteome coverage . Hence, one potential application of this method may be for data obtained from older instruments or experiments where the amount of instrument time available was low . Compared to the customized database approach described by wang et al ., the probability adjustment method was seen to provide better improvement for low - to - medium - coverage samples, whereas the customized database approach performed better for deep - coverage samples (supporting information figure 9), suggesting nonoverlapping scenarios of usage for the two methods . Although the probability adjustment approach has been demonstrated using rna - seq and gpmdb data, it does not include any assumptions that would limit it to only these two kinds of data . Therefore, this approach can be utilized to incorporate any external source of data (with a significant association with protein presence or abundance) into proteomic analysis pipelines to improve the sensitivity of protein identification.
Recently, there has been a focus on evaluating the association between the nutritional quality of dietary intake and health outcomes . Several studies have reported an inverse association between higher diet quality, all - cause, and chronic disease - specific mortality . Our recent systematic review demonstrated a significant association between poor diet quality and greater weight gain . A recent study demonstrated, in a nationally representative sample in the united states, that younger adults have poorer diet quality when compared with both children and older adults . The evidence indicates that early adulthood is a high - risk period for weight gain, especially for females [4, 5]. For example, the australian longitudinal study on women's health (alswh) data shows that when young women reach their forties, they will be heavier than middle - aged women are now . However, our systematic review found limited studies that have specifically examined the association between diet quality and weight gain amongst young women . Greater understanding of the association between diet quality and weight gain among young women may assist with the development of strategies for preventing weight gain during this life stage . In this study we are analysing the relationship between three different approaches of diet quality indices including: index based on the food groups, which is the australian recommended food score (arfs), and nutrients - based approach, the diet quality index (dqi). In addition, we developed a new brief index that, based on consumption frequency and variety of fruits and vegetables items, is called the fruit and vegetables index (favi). This tool can help to reduce the burden to both participants and researchers in terms of measuring diet quality . It can be used to predict weight change and therefore weight gain prevention or treatment interventions . Evidence suggests that greater consumption of fruit and vegetables in adults is associated with lower weight gain in longitudinal studies and greater weight reduction in the intervention studies . Notably, two studies exploring the association between diet quality and weight gain among middle - aged women have shown mixed results . A longitudinal study, conducted in an american middle - aged population, demonstrated that those who achieved the highest score on the dqi had a smaller weight gain (3 pounds) than those who achieved the lowest dqi score (58 pounds) during eight years of followup . In contrast, we have previously demonstrated that overall diet quality measured using the arfs did not predict weight gain in a sub - sample of middle - aged women from the alswh . Therefore, the aim of this study was to investigate the relationship between diet quality and weight gain in young women from the alswh, using three different diet quality indices, arfs, australian - dqi (aus - dqi), and the fruit and vegetable index (favi). Alswh recruited women into three cohorts according to age at baseline (young, middle - aged, and older). Baseline (2003, aged 27.6 1.5 years) and the six - year followup (f / u) (2009, aged 33.7 1.5 years) were the two data time points selected for the current analyses . Participants were excluded if they had been diagnosed by a doctor as having diabetes, heart disease, or cancer (excluding skin cancer), or if they were currently pregnant . Of the 9081 young women at baseline, the response rate at followup totalled n = 8,200 young women, with n = 5856 eligible for inclusion . Complete baseline and followup data for weight, diet, and confounders were available for 4,287 women (figure 1). Weight was self - reported at baseline (2003) and at followup (2009), in stones or kilograms (kg) to the nearest pound or gram, respectively . Weight change () was calculated as the absolute difference (kg) in weight at followup from baseline . Participants self - reported their frequency of walking, moderate and strenuous physical activity (pa). There are two questions taken from the national health surveys which are validated and show reliability . The questions were used to derive a pa score in metabolic equivalents (mets) per minute (metmins) at baseline . The total met minutes were calculated as follows: (3 minutes walking) + (4.0 minutes moderate activities) + (7.5 minutes vigorous activities). The cut points of pa were as follows: nil / sedentary 0 <40 met minutes / week, low 40 <600 met minutes / week, moderate 600 <1200 met minutes / week, and high physical activity 1200 met minutes / week . The highest qualification obtained was self - reported as no formal qualifications, school certificate, higher school certificate, trade / apprenticeship, university degree or higher university degree . Numbers of births were classified as: no births, one to two births, and three births . The location of residence definitions used in the alswh dataset are taken from the abs classifications . For this study, each region was classified as: urban (with 100,000 or more people), rural (with 200999 people) and remote (<200 people). Participants self - reported smoking status as current smoker, never smoker, or ex - smoker . The study was approved by the university of newcastle and the university of queensland human ethics committees and the current analysis on 13/10/2011 (eoi a342). Baseline self - reported dietary intake was assessed using a food frequency questionnaire (dietary questionnaire for epidemiological studies version 2 (dqes v2), cancer council of victoria). The dqesv2 has been previously validated [1214] and assesses intake of 74 food items over the past 12 months . Usual consumption frequency of each food item is indicated on a ten - point likert scale, ranging from never up to three or more per day . Additional questions assessed the total number of daily serves of fruit, vegetables, bread, dairy products, eggs, fat spreads, and sugar, as well as the type of bread, dairy products, and fat spreads used . Nutrient intakes were computed using a food composition database of australian foods (nuttab 1995, australian government publishing service, canberra, australia) and software developed by the cancer council of victoria . The arfs is a food - based index adapted to the australian adult population by collins et al . (2008) from the original us version of the recommended food score by kant et al . . The arfs ranges from zero to a maximum score of 74, with a higher score indicating greater diet quality . The seven subscales with different maximum points include vegetables (22 points), fruits (14 points), protein foods (14 points), grains (14 points), dairy (seven points), fats (one point), and alcohol beverages (two points). Each food item is scored as one or zero, with an additional score for food quality . Scoring is independent of reported amounts of food, such that items consumed less than once a week scored zero and those consumed once a week or more scored one . More details about the scoring methods and items of the arfs can be found in the supplementary material (see appendix 1 in supplementary material available online at http://dx.doi.org/10.1155/2013/525161). The dqi was chosen as studies have shown that higher scores on this index are associated with lower weight gain . A longitudinal study, conducted in a middle - aged us population, demonstrated that those who achieved the highest diet quality index (dqi) scores had a smaller weight gain (3 pounds) than those who achieved the lowest dqi score (58 pounds) after eight years of followup as part of the adaptation of the us dqi to the aus - dqi, the scoring was adjusted to incorporate the australian nutrient reference values (aus nrvs) [16, 17]. The original dqi was designed to evaluate adherence to the fourth edition of the dietary guidelines for americans, and each participant achieved one point for each of the following nutrients: total fat (<30% kcal), saturated fat (<10% kcal), cholesterol (<300 mg / d), sodium (<2400 mg / d), and carbohydrate (> 50% kcal). The aus - dqi was adapted to australian recommendations . However, given that there is currently no australian recommendation for the intake of cholesterol, this subscale was omitted . In the aus - dqi, each participant gets a maximum of one point for each of the four sub - scales: total fat <35% kj, saturated fat 7% kj, carbohydrate 45% kj, and sodium <2300 mg / d . These targets were set according to australian and new zealand nutrient reference values . Evidence suggests that greater consumption of fruit and vegetables in adults is associated with lower weight gain in longitudinal studies and greater weight reduction among overweight and obese participants in the intervention studies . Fruit and vegetable consumption data, derived from the baseline dqesv2, were used to inform the development of the favi . The favi is divided into two sub - scales: the fruit sub - scale, which contains 13 items, including canned or frozen fruit and fruit juices, and 11 types of fresh fruit, such as oranges, apples, and pears, and the vegetable sub - scale which contains 24 items, including potatoes cooked without fat, tomato, zucchini, mushroom, celery, and beans . Consumption frequency of all fruit and vegetable items was scored using the full range of the ffq likert scale from zero to nine, with never 3 times per day scored as nine points . In the favi score zero point are awarded for those who consume no items of fruit and vegetables . One point is awarded for consuming each fruit or vegetable item less than once per month, two points for one to three times per month, and three points for once per week, with an additional point awarded on an increasing scale for each additional frequency response category up to a maximum of nine points for consuming an item three or more times per day . The maximum possible score is 117 for the fruit sub - scale and 216 for the vegetable sub - scale, giving a maximum total favi score of 333 points . A higher favi score indicates a greater variety and frequency of usual fruit and vegetable consumption . Results were considered statistically significant if p <0.05 . Weight and macronutrient variables were treated as continuous variables . Each dietary quality index was categorised into tertiles based on the distribution of the total number of participants included in the study, to give approximately equal numbers in each tertile . For each diet quality index, multivariate linear regression was used to predict six - year weight change (95% confident interval, p value). The diet quality index of interest was the independent variable(s), with the first tertile being the reference value . To address misreporting and try to identify the subgroup least likely to have under- or over - reported total energy intake; the ratio of energy intake (ei) to basal metabolic rate was calculated . Basal metabolic rate (bmr) for each woman was calculated using the schofield equations . Using the goldberg equations for a moderate physical activity level of 1.55 for this group then a tei of 1.272.1 times bmr can be considered plausible [19, 20]. Three different regression models were applied to both the total sample and the subsample with plausible total energy intakes: (1) crude model: unadjusted; dependent variable = weight; independent variable = baseline diet quality index of interest . (2) the second model is adjusted specifically for the most important covariates that were available in the alswh data set, the specifically adjusted model: adjusted for physical activity, education, number of births, location of residence, marital status, smoking, and weight at baseline . (3) the final model: sought to evaluate the impact of energy intake on the model and included all the co - variates as per model 2 above, but also included total energy intake (tei). All statistical analyses were carried out using stata (version 11.1 for windows, 2009, statacorp lp, usa). The total number of women included in this analysis, with complete baseline and followup data on weight change and diet, was n = 4,287 . Overall, the mean weight change from 2003 to 2009 was + 3.6 1.5 kg . A comparison of diet quality scores and co - variates for those with and without complete data on weight change from 2003 to 2009 indicated that there were no differences in diet quality score, measured by all three indexes: education, pa, and smoking status, p> 0.05 (data not shown). For those who had missing data on ffq there was no significant difference across tertiles of arfs for mean weight change, but there were significant differences in the means of energy intake (kj / d), fibre (g / d), carbohydrate (%), and protein (%) intakes total fat (%) and saturated fat (%) intakes observed across arfs tertiles (table 2). In the plausible tei sub - sample, the top tertile of arfs had the lower mean weight gain (2.9 7.9) kg; however, this was not significantly different compared to the second and lowest tertiles (3.4 7.7 kg and 4.0 7.9 kg, resp . ). The top tertile of arfs had greater total energy intake (tei) (kj / d), fibre (g / d), carbohydrate (%) and protein (%) intakes and lower total fat (%) and saturated fat (%) intakes compared with other tertiles (table 2). There was no significant difference in the mean weight change across the aus - dqi tertiles (table 3). Aus - dqi tertile 3 had lower tei (kj / d), fat (%), saturated fat (%), protein (%), and fibre (g / d) intakes and higher carbohydrate intakes (%), compared with the other aus - dqi tertiles (table 3). In the plausible tei sub - sample, there was no significant difference in weight changes between tertiles of aus - dqi . There were significant differences in means of carbohydrate (%), fiber (g / d), energy intake (kj / d), total fat (%), saturated fat (%), and protein (%) intakes . There was a significant difference in mean weight change across the favi tertiles (p = 0.003), with the third tertile of favi gaining the least amount of weight during the six years of followup compared with the other tertiles (table 4). The intakes of fat (%) and saturated fat (%) were significantly lower, while tei, protein (%), carbohydrate (%), and fibre (g / d) intakes were significantly higher in the third favi tertile . In the plausible tei sub - sample, those in the lower tertile of favi had significantly greater weight gain than those in the second and the top tertiles of arfs (table 4). In the plausible tei, the top tertile of favi had lower total fat (%) and saturated fat (%) but greater intakes of carbohydrate (%), fiber (g / d). There were no significant differences between tei and protein intake across favi tertiles . In the plausible tei sub - sample, only those in the top tertile of the arfs had significantly less weight gain (1.6 kg) compared with those in the lower tertile of the arfs . In the fully adjusted model, those who were in the top tertile of the arfs had significantly lower weight gain compared with the lower tertile for the plausible tei sub - sample, (= 1.6, ci: 2.67 to 0.56, p = 0.003). Baseline favi was a statistically significant negative predictor of weight gain in this group of young women, while arfs and aus - dqi were not statistically significant predictors of weight change (table 5). Compared with the first tertile of favi, women in the third tertile had the lowest weight gain over six years (= 0.72, ci: 1.4 to 0.03, p = 0.04) in the fully adjusted model . In the plausible tei sub - sample, we found that those in the second and third tertiles of favi had significantly less weight gain compared with the first tertile . More specifically, we found that, in the fully adjustmed model, those who were in the top tertile of favi gained the lowest weight compared with other tertiles (= 1.6, ci: 2.4 to 0.3, p = 0.01). The second tertile of favi: (= 1.5, ci: 2.4 to 0.2, p = 0.02), also had lower weight gain than the first tertile . The current study tested three different diet quality indices as predictors of weight change over the subsequent six - year period in a cohort of young women participating in the alswh . It demonstrated that higher scores on either a food variety and frequency index (arfs) or an index based on fruit and vegetable variety and frequency alone (favi), predicted lower six - year weight gain in this group of women . In the whole sample the arfs showed no relationship with prospective weight gain, while the aus - dqi showed no relationship in either the whole or the plausible tei sub - sample . The main findings of this study support the role of increased fruit and vegetable consumption as a key strategy to prevent weight gain, particularly for young women . Vioque et al . Found that those in the highest quartile of vegetable and fruit consumption (> 698 g / d) at baseline, as assessed by a ffq, had a reduced risk of weight gain (3.41 kg) compared with those who were in the lowest quartile of vegetable and fruit consumption during 10 years of followup (or 0.22, 95% ci 0.06 to 0.81, p trend = 0.022). Another prospective study conducted by kahn et al . (1997) in 79,236 healthy white non - hispanic american adults found that greater consumption of vegetables (highest quintile) was associated with a smaller gain in bmi over 10 years of followup (= 0.12; p = 0.09, 0.012) for women and men, respectively . A systematic review of experimental studies supports increasing fruits and vegetables to support weight management . A randomised controlled trial in 97 obese adults aimed to assess the effect of two approaches to weight loss, a decreased dietary fat intake, or an increased intake of fruit and vegetables plus decreased dietary fat intake over one year (both groups reduced fat by the same amount). The main finding demonstrated that those who increased their consumption of fruit and vegetables and decreased dietary fat achieved significantly greater weight loss, 7.9 0.9 kg compared with 6.4 0.9 kg for the other group . A trial carried out in brazil in 80 overweight people found that those who increased their fruit and vegetable intakes by 100 g / d experienced lower weight gain (300 g cf . 550 g) over six months compared with those who did not change their intakes for fruits and vegetables . In the whole sample, we found that higher tei was associated with the highest favi score . However, we also found that higher favi scores were associated with the lowest weight gain . However, in the plausible tei sub - sample, there was no significant difference between tei across the tertiles of favi, as shown in table 4 . One possible explanation for this is that there are only a limited number of energy - dense, nutrient - poor foods in the ffq, meaning that tei from these items may not be well captured . Those with a lower tei may have higher energy intakes from these non - ffq items . Although the arfs and favi were strongly positively correlated with each other; the arfs in the full sample did not predict weight gain, while favi did in both the whole and plausible energy intake samples . This suggests that neither the arfs nor the favi captures the association between foods that are energy dense, nutrient poor, and weight change . In the current study, the focus was to examine the association between the healthful, nutrient - dense food items, and weight change . Higher diet quality index scores have been shown in a review to predict the risk of future morbidity and mortality . The aus - dqi failed to predict weight gain during the followup period in this sample of young women, even though it incorporates sub - scales for the percentage energy from total fat, saturated fat and carbohydrate intakes, and total sodium intake . The limited scoring scale and that it had not been previously validated limit the interpretation of this result . This also may be due to the limited list of energy - dense, nutrient - poor foods, particularly soda, and other sweetened beverages within the dqes which is to be expected given that it was developed more than 20 years ago . Thus, an assumption and limitation are that tei may be partly underestimated due to the items in the ffq . In the whole population, we found that the lowest intake of fiber across the aus - dqi tertiles was for the top tertile, or highest diet quality scores . Among those women with plausible tei however, we found that the highest aus - dqi tertile was associated with higher intakes of fiber . This difference is likely due to misreporting of tei and we expect that the results in the plausible tei sub - sample are more likely to be more accurate . The alswh cohort is a representative sample of the population of australian women, and the weight change data from the current study indicate that weight gain is common among young women . The mean diet quality score in the highest tertile of each index was not high, indicating that interventions seeking to optimise diet quality in this age group are warranted as has been suggested previously [2628]. In addition, a recent systematic review has highlighted that intervention studies specifically targeting body weight are needed to prevent the development of overweight and obesity in this age group . This includes that there are a large number of women with missing data on weight or dietary intake at baseline and follow - up . Furthermore, a limitation that needs to be acknowledged is loss to follow up . In the alswh study, attrition is the most common in participants with a lower education, those not born in australia and those with poorer health or who smoke . The potential impact of this attrition is that there may be selective loss of those whose weight change is greater and/or have poorer dietary intake than in those who have been retained . This potentially underestimates the ability of diet quality indexes to detect a relationship between dietary patterns and weight change . In addition, dietary intake was only measured once over this time period, and we are therefore not able to evaluate how or whether the women changed their eating habits over time . Furthermore, all data were self - reported including weight which introduces a potential reporting bias . A previous validation study of self - reported weight on mid - aged women from the alswh demonstrated that there was no clinical difference between self - reported weight and measured body weight . While a similar validation has not been done for the young cohort of the alswh, it might be expected to give similar results . Another limitation that must be considered is that the aus - dqi was not validated but was adapted from the original usa dqi which was based on american nrvs not australian nrv's . As a consequence the strengths of this study include the use of a healthy representative sub - sample derived from alswh population, with an adequate followup period . In addition, we used appropriate and rigorous statistical analyses and three different approaches to the measurement of diet quality to reflect the national dietary guidelines for australia, including two based on established methods and one new index based only on fruit and vegetable intakes . This new tool provides a simple approach to diet quality assessment and successfully predicted weight change in this cohort of young women . Further research evaluating and validating the performance of favi in other age and gender groups is warranted . Frequency and variety of fruit and vegetable intakes, and overall diet quality predicted weight gain over six years in this healthy population group of young women . Strategies to encourage young women to more frequently consume a greater variety of fruit, and vegetables are required and may assist to prevent weight gain in this age group.
A healthy 35-year - old man was scheduled for laparoscopic cholecystectomy under general anesthesia for acute cholecystitis . He had a history of asthma and allergy to animal hair and was treated with a salbutamol inhaler 3 years prior, but showed no symptoms recently . Physical and pre - anesthetic examinations, including a chest x - ray, electrocardiography (ecg), laboratory results, and a pulmonary function test were unremarkable . The patient received tazobactam intravenously for preventive antibiotics and glycopyrrolate (0.2 mg) intramuscularly for premedication 30 min before the operation . At arrival to the operating room, standard monitoring included non - invasive blood pressure, ecg, and peripheral oxygen saturation (spo2). The patient's initial blood pressure was 155/85 mmhg, heart rate was 70 beats / min, and spo2 level was 99% . General anesthesia was induced with 1% propofol (150 mg) with lidocaine (40 mg) pretreatment and continuous infusion of remifentanil (0.10.5 g / kg / min). After the patient was asleep, rocuronium (80 mg) was administered intravenously and, after 1 min, his trachea was intubated successively . Next, anesthesia was maintained with sevoflurane, and his vital signs, including blood pressure, heart rate, and spo2, were maintained stably during the operation . Fifty minutes after starting anesthesia, efforts of self - ventilation were shown, and we administered additive rocuronium (10 mg). Ten minutes before the end of the surgery, we administered fentanyl (100 g) and discontinued remifentanil . The operation was finished within 90 min without complication . At the end of surgery, at a train of four (tof) count of 3, we administered sugammadex (200 mg; about 1.8 mg / kg) to antagonize neuromuscular blockade intravenously . Two minutes after sugammadex administration, his tof ratio was recovered to 0.9, and he could breathe spontaneously . At that time, we discovered an erythematous wheal in his anterior thorax that was considered strange but not serious, and decided to extubate . Soon after, he complained of dyspnea, his blood pressure decreased to 85/40 mmhg, his heart rate was 130 beats / min, spo2 level was 83%, and bilateral wheezing was demonstrated on chest auscultation . We administered dexamethasone (15 mg) and dexchlor - pheniramin (4 mg) intravenously, and a salbutamol nebulizer (5 mg) with 6 l / min of 100% oxygen via face mask was inhaled . Despite these interventions, his symptoms did not improve, his blood pressure decreased further to 65/38 mmhg, his heart rate was 135 beats / min, and spo2 level was 83% . Our suspicion of an anaphylactic reaction increased; thus, epinephrine infusion (0.06 g / kg / min) was started after an intravenous epinephrine bolus (20 g), and 100 ml of fluids was administered over 10 min . At that time, arterial blood gas analysis (ph 7.277; pco2, 28.7; po2, 63.3; hco3, 13.1; be, 12.1) and chest radiography, which showed no active lesion on the chest radiographic image, were performed . Within 10 min, his vital signs gradually increased to 105/55 mmhg, his heart rate was 105 beats / min, spo2 level was 95%, and his generalized erythema and tachypnea disappeared . After an additional 10 min, his blood pressure increased to 138/59, his heart rate was 90 beats / min, and spo2 level was 98% . The patient's vital signs continued to remain stable, and we discontinued the epinephrine infusion and transferred the patient to the intensive care unit . After half of the day, he was transferred to the general ward without any complication, and was discharged satisfactorily 5 days after surgery . Ku / l (reference, <100 ku / l) and specific ige for antibiotics were all negative, but he refused the serum tryptase test . After 7 weeks, skin prick tests for sugammadex, rocuronium, and fentanyl were performed, and the result was weakly positive for only 1: 1 sugammadex (3 2 mm) compared with the positive (histamine; 5 5 mm) and negative (normal saline; negative) controls, but negative in 1: 10, 1: 100, 1: 1000 sugammadex and all concentrations of fentanyl and rocuronium . Based on the time course of the event, anaphylactic reaction associated with sugammadex was strongly suspected . Anaphylaxis is defined as " a serious, life - threatening, generalized or systemic hypersensitivity reaction " and " a serious allergic reaction that is rapid in onset and might cause death " . The diagnosis of anaphylaxis is mainly based on the clinical course because the course rapidly deteriorates, as mentioned in the definition . The most common clinical manifestations are cardiovascular symptoms such as hypotension, tachycardia or bradycardia, cardiovascular collapse, bronchospasm, and mucocutaneous symptoms such as erythema, edema, urticaria, and angioedema . Cardiovascular shock in anaphylaxis was reported as 41% . In our case, after 2 min of sugammadex administration, the patient had generalized erythematous wheals, dyspnea, and progressive cardiovascular shock . This case met world anaphylaxis organization criteria for anaphylaxis, and the severity grade using the severity scale was grade iii . It is difficult to identify the cause of anaphylaxis during anesthesia because various drugs are used . The most common cause of perioperative anaphylaxis is neuromuscular blocking agents (69.2%), latex (12.1%) and antibiotics (8%). Sedatives, analgesics, local anesthetics, and other drugs are less frequent causes . In our patient, antibiotics were administered without complication 30 min before surgery, and other drugs such as neuromuscular drugs and opioids were administered 20 min before the anaphylactic reaction . Elevation of serum tryptase and histamine levels is useful to confirm the diagnosis of anaphylaxis . The serum tryptase test has a positive predictive value of 93% and a negative predictive value of 54%, and should be performed within 6 h because of its short half - life . However, in our case, the serum tryptase test was not performed because of the patient's refusal . The detection of specific ige antibodies using the in vivo ige test (skin prick test or intradermal test) and in vitro ige test is useful to identify the cause of the allergic reaction . The skin prick test is more sensitive than in vitro tests and is generally used but remains unvalidated . There is no absolute agreement on the concentration of sugammadex to be used . In british society or allergy and clinical immunology, the use of 1: 10 diluted or undiluted agent is recommended for anaphylaxis associated with perioperative agents . A positive decision is made when the wheal diameter with a 1: 10 dilution is at least 2 mm greater than the negative control . However, a positive wheal to only undiluted agent may be considered a positive decision when the clinical course is fitted to the agent and other causes are ruled out . Fourteen cases of anaphylaxis associated with sugammadex reported a positive result of the skin prick test or intradermal test . Soria et al . Reported a positive intradermal test with 1: 1000 sugammadex, although the patient showed a positive skin prick test only with undiluted sugammadex at 30 min . In our case, we had a weakly positive skin prick test to undiluted sugammadex, but an intradermal test was not recommended because of concern regarding the potential risk of anaphylaxis . In vitro - specific ige for antibiotics were also examined, and the result was negative . When anaphylaxis is suspected, turning off the responsible agent and administering appropriate treatment promptly are important . Epinephrine is the drug of choice for anaphylaxis because it maintains blood pressure with an 1 adrenergic effect and relaxes the bronchial smooth muscle with a 2 adrenergic effect . In our case, sugammadex is a modified gamma - cyclodextrin that is used as an antagonist to aminosteroid neuromuscular blockade, and has been used since february 2013 in korea . Sugammadex is an innovative agent that has a rapid recovery time and rapid renal clearance . It provides several advantages, including avoidance of cardiovascular side effects associated with neostigmine, avoidance of postoperative residual curarization, and reversal of deep neuromuscular blockade . However, in the united states, the food and drug administration has not yet approved sugammadex due to the possibility of anaphylactic reactions . Several cases of hypersensitivity reactions associated with sugammadex have been reported in countries that frequently use the drug . These reactions appear to be more frequent at higher clinical doses . However, godai et al . Reported three cases, although they used 1.92.2 mg / kg low - dose sugammadex . Cases of sugammadex - induced anaphylaxis have been reported more frequently in japan because sugammadex is widely used . To our knowledge, thirteen cases of anaphylaxis associated with sugammadex have been reported until now in japan . However, to our knowledge, there is no reported case of anaphylaxis to date in our country . . Reported that two patients with an asthma history showed bronchospasm associated with sugammadex . Five cases of anaphylactic reaction associated with sugammadex had reported an asthma or allergic history . Allergic patients may have been predisposed to anaphylaxis to sugammadex . However, most patients with anaphylaxis associated with sugammadex have no history of sugammadex exposure . It has been suggested that the use of cyclodextrins in food may result in sensitization to sugammadex . We suggest that strict caution should be applied when considering sugammadex administration in asthmatic and allergic patients . Second, the use of sugammadex is likely dangerous because it's associated anaphylactic reaction appears at the time of extubation and movement to the postanesthetic care unit or intensive care unit when the patients are less monitored . Therefore, we suggest that vigilance after sugammadex administration is necessary . In summary, we present a case of a patient who presented with generalized erythema, dyspnea, and cardiovascular shock 2 min after sugammadex administration; the case was confirmed to be anaphylaxis associated with sugammadex by a positive skin test . We ruled out other causes using specific ige for antibiotics and a negative skin prick test for rocuronium and fentanyl, as well as the clinical course of the event (they were administered 20 min before the event). This is a suspected case of hypersensitivity reaction associated with sugammadex reported for the first time in korea . We need to be aware that the use of sugammadex is associated with a serious risk of anaphylaxis.
The differential diagnosis between breast lymphoma and breast adenocarcinoma is difficult clinically and radiologically as these diseases share common characteristics, and the diagnosis is usually confirmed postoperatively . Diagnosis of the two conditions in a single patient is often thought to be coincidental, but there is evidence supporting a possible pathophysiological connection involving a common genetic background or etiologic factor, or possibly, one disease causes the other . In this case, the presentation of multifocal bilateral epithelial breast cancer with three primary tumors suggests that tumorigenesis was not coincidental . It has also been suggested that breast lymphoma can change the behavior of concomitant breast cancer either by altering the axillary lymphatic vessels, which aids breast cancer dissemination, or by changing the lymph node microenvironment . Distinct treatment strategies are required for these two diseases including surgery, radiotherapy, hormonal therapy, chemotherapy, and immune therapy, depending on the disease type and patient characteristics such as stage of disease, aggressiveness, histological subtype, and estrogen receptor (er)/human epidermal growth factor receptor 2 (her2) status . Here, we report the unique case of a patient with ductal carcinoma in situ (dcis) and follicular lymphoma of the breast, who also presented with second primary contralateral multifocal breast cancer at a later date . A 55-year - old caucasian woman presented in april 2011 to the hospital with a painless lump in the upper outer quadrant of the left breast, discovered during a breast self - examination . The patient had a 20 - 30 pack - year smoking history and had one full - term pregnancy previously . Her medical history was significant for a swelling of the left parotid gland 6 months before her current presentation . This was investigated by ultrasonography and fine - needle aspiration (fna), which revealed an enlarged benign intraparotid lymph node . A clinical examination revealed a small, firm, painless, ill - defined nodule in the upper outer quadrant of the left breast with no associated lymphadenopathy . An enlarged lymph node was found in the right inguinal area, which corresponded to the nodule detected by the patient . The examination of the right breast and axilla, neck, abdomen, and left inguinal area was unremarkable . A bilateral mammography and breast ultrasound revealed a single lesion in the upper outer quadrant of each breast with characteristics suspect of malignancy, but a tissue diagnosis was warranted (figure 1). A histological examination of the left breast specimen revealed the presence of a lymph node with complete coagulative necrosis . The necrotic area contained some medium - sized shadow cells, which were immunohistochemically positive for cluster of differentiation 20 (cd20) and cd10, and were admixed with some small b - cells . Immunohistochemical analysis showed b- and t - cells, and scattered cells positive for cd10, cd23, and b - cell cll / lymphoma 6 (bcl-6) (figure 2). A histological examination of the right breast specimen revealed a typical dcis, which followed an ethmoid pattern with intermediate nuclear - grade and comedo - type necrosis (figure 3). Accordingly, histological analysis showed that the inguinal lymph node was infiltrated by a follicular b - cell lymphoma grade 1/2 (figure 4). Immunohistochemical analysis showed that the cells were positive for cd10, bcl-6, and bcl-2, and partly for cd23 . The tumor ki-67 proliferative index was low at approximately 10% . Cells positive for cd10 and bcl-6 were found in the interfollicular area, and monoclonality for the kappa light chain was also noted . The neoplastic cells had infiltrated the nodal capsule and spread to the perinodal adipose tissue . The patient underwent computed tomography of the cervix, thorax, and abdomen, which was normal . The final diagnosis was simultaneous dcis of the right breast and non - hodgkin b - cell follicular lymphoma, stage iiiea . Right breast irradiation was administered for dcis postoperatively . As the follicular lymphoma was disseminated, but did not fulfill the criteria for treatment initiation, a watch and wait strategy was adopted . In december 2013, a routine follow - up mammography showed two speculated lesions in the left breast . One was retroareolar and measured <1 cm in maximum diameter, while the other lay deeper and measured approximately 1.5 cm in diameter . Ultrasonography and magnetic resonance imaging confirmed the suspicious findings, and an ultrasound - guided core biopsy was taken from the largest lesion . This revealed a grade ii invasive ductal carcinoma (idc), positive for the er/ progesterone receptor (pr) and her2 (2 +). New staging investigations revealed no evidence of lymphoma and no metastases from the breast disease . After several consultations with the patient, a bilateral routine skin - reducing mastectomy with an inferior dermal flap and silicon - based reconstruction, together with a left sentinel node biopsy was performed . The breast histopathologic examination revealed 2 grade ii idcs, measuring 0.9 cm and 1.4 cm with surrounding dcis . Er and pr were strongly positive, and fluorescence in situ hybridization analysis confirmed her2 amplification . The sentinel lymph nodes were free of breast cancer deposits . However, immunohistochemical analysis for cd20, cd3, cd10, bc1 - 2, and ki-67 was indicative of in situ follicular lymphoma as shown by the presence of lymphoma cells bcl-2 (+), bcl-6 (+), cd10 (+) confined into the germinal center (figure 5). Subsequently, the patient completed four cycles each of anthracycline and taxane - based chemotherapy in september 2014, and was prescribed trastuzumab in combination with an aromatase inhibitor . Synchronous breast cancer and follicular lymphoma is a rare clinical condition, and has been described only a few times in the literature . Our case describes the synchronous presentation of dcis and secondary breast lymphoma (according to the wiseman and liao criteria), further complicated by metachronous contralateral infiltrating breast carcinoma . Primary or secondary breast lymphoma may have a clinical presentation indistinguishable from breast cancer as it usually manifests as a breast lump or axillary lymphadenopathy . Generally, the diagnosis of lymphoma is made postoperatively after the histological examination, but occasionally, analysis of the preoperative fna or core biopsy can lead to a diagnosis . Breast cancer patients have been found to have an increased incidence of non - hodgkin lymphoma because of treatment with radiotherapy and chemotherapy; however, this does not explain cases with synchronous disease . There are several hypotheses regarding the connection between these two entities, including the role of epidemiologic factors, such as age or gender, or a common genetic background, or possibly that one disease causes the other . With regard to the common genetic background, mutations in the ataxia telangiectasia mutated gene have been found in both lymphoid neoplasia and breast cancer . Furthermore, the mouse mammary tumor virus is strongly suspected to play an etiologic role in both tumors, as its genetic sequence or similar sequences have been discovered in both breast cancer and lymphoma cells, but not in nonneoplastic cells . Finally, results from rare cases of collision tumors support the hypothesis that breast cancer may act as an antigenic stimulus and cause non - hodgkin lymphoma, analogous to cases where helicobacter pylori inflammation of the stomach may cause mucosa - associated lymphoid tissue lymphoma . Furthermore, it seems that the connection between these two diseases may not just be etiologic and there may be synergism between the two cancers after tumorigenesis has occurred . One important theory is that the lymphoma could obliterate the lymphatic channels, thus altering the predominant mode of breast cancer metastasis . There are also clinical data suggesting that lymphomas can change the course of a radioactive tracker, diminishing the utility of a sentinel lymph node biopsy to indicate breast cancer lymphatic dissemination . Moreover, neoplastic lymphoid cells could reduce tissue necrosis factor or interleukin - induced adhesion of breast cancer cells to the endothelial layer of the axillary lymph nodes, thus facilitating lymphatic dissemination to certain lymph nodes . However, since some lymphomas develop outside of the nodal sinuses, these theories are not universally accepted, and any interaction between breast cancer and breast lymphoma may be overestimated . Described a case of t1n0 idc coexisting with lymphoma in the ipsilateral axillary lymph nodes . Cox et al . Described two cases, one with t1n0 idc coexisting with disseminated follicular lymphoma (stage iii) and one with dcis coexisting with lymphoma in the ipsilateral axillary lymph nodes . Reported a case of synchronous invasive lobular carcinoma and follicular lymphoma discovered during sentinel lymph node dissection . Describe a case of t3n0m0 idc coexisting with follicular lymphoma in the ipsilateral lymph nodes . Finally, tamaoki et al . Described dcis of the breast coexisting with lymphoma in the para - aortic lymph nodes . In all of these reports, lymphoma was discovered incidentally during the histologic examination of the specimen; however, in our case, a palpable inguinal lymph node was present . The occurrence of metachronous breast tumor after the synchronous diagnosis of dcis and lymphoma is unique . While lymphoma patients have a higher risk for second tumor development due to the therapy they have received, this does not apply to our patient as she did not receive any treatment . To our knowledge, only two similar cases involving three primary malignancies have been described in the literature . The coexistence of dcis in the right breast and diffuse large b - cell lymphoma in the right axilla, and invasive ductal carcinoma in the left breast has been described by miles and jacimore, while synchronous bilateral invasive ductal carcinoma and primary breast lymphoma has been described by garg et al . . In conclusion, the coexistence of breast cancer and follicular breast lymphoma, complicated by contralateral metachronous multifocal mammary carcinoma has not been described before now in the literature . There appears to be a pathophysiol ogical connection between the two diseases, involving cancer pathogenesis and behavior, although this may be due to circumstantial evidence . Management of coexisting breast lymphoma and breast cancer may be a challenge, requiring input from surgeons, medical and clinical oncologists, radiologists, and pathologists . A multidisciplinary approach, a high level of clinical vigilance, and teamwork are required to avoid an undesirable outcome.
Aconite rootstocks of aconitum carmichaelii (chuanwu) and a. kusnezoffii (caowu) have been used in traditional chinese medicine for over two millennia . They are commonly used as a key ingredient in many herbal prescriptions in the orient for rheumatalgia, heart failure, contracture of limbs, and pain in joints . The principal active ingredients in chuanwu and caowu are alkaloids with c19-diterpenoid skeleton, including aconitine (a), mesaconitine (ma), and hypaconitine (ha) [1, 2]. However, these alkaloids are also toxic and have a very narrow safety range, because they could easily induce ventricular tachycardia and fibrillation even at therapeutic dose levels . Down the ages, various processing methods, including prolonged steaming and boiling, were developed to reduce their toxicity [2, 3]. During the course of steaming and boiling, aconitines would be hydrolyzed to benzoylaconitines and aconitines, which still retain analgesic properties while their toxicity is reduced about a hundred - fold . From 1989 to 2006, over 45 aconite poisoning cases were reported in hong kong, among which three cases were fatal [46]. Aconite poisoning cases often occur in other asian countries, as well as, for example, india and japan . In order to ensure the safety and effectiveness of clinical diagnosis as well as forensic investigation of aconite poisoning, it is necessary to develop convenient, selective, and accurate methods to identify and determine these alkaloids in herbal medicine . Various methods have been published, including ir, hplc [10, 11], hpce, hplc / ms [1315], and gc / ms . However, there have been few reports about the analysis of aconite alkaloids in herbal medicine using hplc in combination with an automated analytical system and esi / ms / ms . In the present study, an hplc method was established and validated to determine a, ma, and ha in raw and processed caowu and chuanwu . Then an automated analytical system and esi / ms / ms were applied to the qualitative analysis of these alkaloids and their semihydrolyzed products . The results indicated that ha was the most stable compound among a, ma, and ha, after undergoing the prolonged heating treatment, which suggested that ha plays a major role in the toxicity of aconite alkaloids in processed chuanwu and caowu . Hence, ha could be used as an indicator when one alkaloid is required as a reference to monitor the quality of aconite alkaloids . In addition, raw and processed chuanwu and caowu can be distinguished by monitoring the ratio of a and ma to ha . The reference standard of a was purchased from sigma chemical co. (st . Louis, u.s.a). The reference standards of ma and ha were purchased from the institute for the control of pharmaceutical and biological products, china . Raw and processed herbs (chuanwu, caowu) were purchased from herb market in hong kong . Benzoylaconitine, benzoylmesaconitine, and benzoylhypaconitine were prepared from a, ma, and ha, respectively, in our laboratory . Lc - grade acetonitrile (acn) and tetrahydrofuran and analytical - grade phosphoric acid and triethylamine (tea) were purchased from riedel - de haen co. (germany). Three standard solutions were prepared by accurately dissolving the a, ma, and ha in acn - tea (75: 25, v / v) buffer, respectively . Raw and processed herbs (chuanwu and caowu) were pulverized into powder . After passing through a 0.45 mm sieve, the powder was dried in an oven at 55c for 6 - 7 h, then three samples with 1.0 g weight were accurately weighed . Each weighed sample was extracted with 1 ml aqueous ammonia solution (30%) for 20 min at room temperature and then was extracted with ethyl ether (20 ml) in an ultrasonic bath for 10 min . After the sample was placed at room temperature for 16 h, the liquid phase was filtered . The residue was further extracted for 3 additional times in the same manner (and the final extraction was assured complete). The filtrate was pooled together and was extracted with 2% hydrochloric acid for 4 times (25 ml each time). The aqueous solution was adjusted with ammonia solution to ph 10 and further extracted with ethyl ether for 3 times (25 ml, each time). After being washed with water (10 ml), the combined ether solution was dried with anhydrous sodium sulphate and then was evaporated to dryness at 40c in an evaporator . The residue was further dissolved with 1 ml acn - tea (75: 25, v / v). All final solutions were filtered through a 0.45 m filter membrane, and 20 l filtrate was injected into the hplc system for analysis . The agilent / hp 1090 series hplc system (hewlett packard, ca, usa) consisted of quaternary pump, guard column (econosphere c18, 5 m, alltech, usa), analysis column (25 cm 4.6 mm i.d ., microsorb c18, 5 m, usa), and a diode - array detector . The optimal hplc conditions were as follows: a mixture of acn - tea (75: 25, v / v) was selected as the solvent of standards and samples, while a mixture of acn, tea buffer (ph 3.0; 25 mm), and thf was used as the mobile phase in the gradient program, and the flow rate was maintained at 1 ml / min . Detection wavelength was set at 238 nm and the column temperature was maintained at 45c . The automated analytical system mainly included an autosampler, four tandem columns (concentration column, extraction column, separation column i, and separation column ii), a uv detector, the intelligence software, and a spectral library . Automated analytical system has several distinct advantages, including automated pretreatment and sample analyses, short analysis time, and high specificity . The system was used for the direct qualitative analysis of a, ha, and ma, and sample pretreatment was not necessary in this system . The esi / ms / ms system consisted of an esi source and a model mat tsq 700 tandem mass spectrometer (finnigan, ca, usa). The esi source was operated in the positive ion mode, and the high voltage for the cylindrical electrode was set at 4510 v. in the above experiments, extracted sample dissolved in methanol - water - acetic acid (50: 50: 0.005, v / v / v) was directly infused into the esi source at a rate of 5 l / min . The mass spectrometer was scanned from 100 to 700 amu per second . It was found that the resolutions of aconitine, mesaconitine, and hypaconitine were markedly affected by the concentration of triethylamine phosphate in buffer solution . Since the best separation resolution for the alkaloids was achieved at the concentration of less than 30 mm and the background signal noise increased at less than 10 mm, therefore, 25 mm buffer solution was finally chosen as the hplc mobile phase for subsequent analysis . Different gradient modes of mobile phases were chosen according to the following gradient programs (table 1) and the subsequent chromatograms were shown in figure 1 . The best result in terms of peak shape, resolution, and run time was obtained with a mixture of acn, tea buffer (ph 3.0; 25 mm), and thf, in a gradient mode of mode d of table 1 . So the optimal hplc conditions were as follows: a mixture of acn - tea (75: 25, v / v) was selected as the solvent of standard and samples, and a mixture of acn - tea buffer (ph 3.0; 25 mm) and thf was used as the mobile phase in a gradient mode of 0: 90: 10 (0 min), 6: 84: 10 (20 min), and 26: 64: 10 (40 min). The regression equation, linear range, correlation coefficient (r), and limit of detection obtained from the established hplc method for the assay of a, ma, and ha are listed in table 2 . The intraday relative standard deviations (3 run for each concentration) were less than 1.61%, and interday relative standard deviations (3 run per day for each concentration within 3 consecutive days) were less than 7.3% . The average recovery of a, ma, and ha was found to be 91%, 89%, and 87%, respectively . A, ma, and ha in raw and processed aconite samples were determined by the established hplc method . It could be seen that the contents of the three alkaloids in processed chuanwu samples were much lower than those in raw chuanwu samples (figures 1(d) and 2), the apparent reason of which was that these aconite alkaloids in raw chuanwu were hydrolyzed to their corresponding semi - hydrolyzed products during the treating process . In addition, we have also conducted preliminary study to identify the benzoylaconitines hydrolysed from the three alkaloids in raw and processed chuanwu and caowu, by heating a, ma, and ha in dioxin / h2o (7.5/2.5, v / v) at 120c for 50 min . Benzoylaconitine, benzoylmesaconitine and benzoylhypaconitine were obtained from a, ma, and ha, which lost the acetal groups during the hydrolysis process . After heating treatment, most of a and ma transformed to benzoylaconitine analogues, while, ha had little change, which makes its content the highest among the three alkaloids (a, ma, and ha) in the processed herbs . Moreover, the results, obtained from boiling raw herbs in water for 15, 30, 60, 90 and 150 min, revealed that contents of a and ma dropped rapidly with an increase in boiling time, and a and ma disappeared completely at 150 min . However, the reduction of ha was small after the same treatment, and its amount still remained significant even at 150 min . It is interesting that ha could survive the heating process, which suggested that ha might play a major role in the toxicity of aconitum alkaloids in processed chuanwu and caowu . Hence, it could be used as an indicator when one alkaloid is required as a reference to monitor the quality of aconite alkaloids . In addition, the raw and processed chuanwu and caowu can be distinguished by monitoring the ratio of a and ma to ha . In the qualitative analysis of these alkaloids, the standard solution of a was injected into the automated analytical system . The spectral fingerprint parameters of the unknown sample are shown in table 4 and are compared with those of the candidates suggested by the intelligence software . The searching results for match - fingerprint parameters in the spectral library proved that the unknown sample was a. the identification of ma and ha was achieved by the same procedure . The automated analytical system chromatogram of a mixed standard (a, ma, ha) is shown in figure 3 . To confirm the results obtained by automated analytical system, aconite alkaloids the mass spectra showed the fragments of protonated molecules ([m+h]) and the characteristic losses of side chain ch3cooh (60), c6h5cooh (122), m / z 152, and 279 (table 5). The esi / ms spectra of a mixture of a, ma, and ha standards at 1 g / ml level and a decocted chuanwu (the time of decoction was 0.5 h) were shown in figure 4 . The mass spectra showed [m+h] ion at m / z 646 for a, at m / z 632 for ma, at m / z 616 for ha, at m / z 603 for benzoyl - aconitine, at m / z 589 for benzoyl - mesaconitine, and at m / z 573 for benzoyl - hypaconitine . The protonated molecular ion has minimal fragmentation because of the soft ionization of the esi . As shown in figure 4(a), the [m+h] peaks of the aconite alkaloids were the characteristic peaks, which could be used to simultaneously identify these alkaloids, though the sample was directly introduced into the esi / ms . Figure 4(b) shows the relative amounts of the three aconite alkaloids and semi - hydrolyzed products in a decocted chuanwu . The identity of each alkaloid could be further confirmed by esi / ms / ms . After undergoing cid (collision - induced decomposition) by argon gas, the protonated molecular ion (the parent ion, selected by the first mass analyzer) was transformed into fragments, which could facilitate structural identification of the parent ion . It can be seen from figures 5(a), 5(b), and 5(c) that the protonated molecule ions ([m+h]) of a, ma, ha are at m / z 646, 632, and 616, respectively, and the major fragment ions (the neutral loss 60, 122, 152, 279) are at m / z 524, 494, 367 for a, m / z 510, 480, 353 for ma, and m / z 494, 464, 337 for ha, respectively . Figure 5(d) shows that the esi / ms / ms spectrum of ha in decocted chuanwu is the same as that of the standard ha . Hplc in combination with automated analytical system and esi / ms / ms was employed to analyze a, ma, ha, and their benzoyl analogs in our study . The analytical results obtained from of automated analytical system are identical to those from esi / ms / ms . Therefore, the automated analytical system would be a good complementary method for the quality control of the herbal preparations containing aconite alkaloids . The most important finding in this research is that the analytical results indicated that ha was the most stable compound among a, ma, and ha, even after prolonged heating treatment, and thus suggest that ha might play a major role in the toxicity of processed chuanwu and caowu . Hence, ha could be used as an indicator when one alkaloid is required as a reference to monitor the quality of aconitum alkaloids, and the raw and processed chuanwu and caowu can be distinguished by monitoring the ratio of a and ma to ha.
Melanin is a heterogeneous polymer produced and concentrated within the melanosomes of the melanocytes, and tyrosinase is a key rate - limiting enzyme for melanin biosynthesis . Tyrosinase catalyzes three steps in melanin biosynthesis: the hydroxylation of tyrosine to 3, 4-dihydroxyphenylalanine (dopa), the oxidation of dopa to dopa - quinone, and the oxidation of 5, 6-dihydroxyindole to indolequinone . Because of its central role in melanogenesis, tyrosinase is a key target for the development of new inhibitors [13]. In the present study, we aimed to directly regulate tyrosinase expression using rna interference (rnai). We screened small interfering rnas (sirnas) corresponding to the tyrosinase sequence using the mouse melanoma cell line b16 and then delivered the most effective sequence into c57bl/6 mice to study its effect in vivo . B16 mouse melanoma cells (shanghai institute of cell biology, chinese academy of sciences) were cultured in dmem (gibco, usa), supplemented with 10% (v / v) fetal bovine serum (hangzhou sijiqing biological engineering materials co., ltd ., china) and 2 mmol / l glutamine (amresco, usa) at 37c in a humidified atmosphere with 5% co2 [3, 4]. The b16 cells were trypsinized and centrifuged at 1,500 rpm for 5 minutes and then resuspended in dmem culture medium and seeded in a six - well plate (corning, usa) at 2 10 per well and 96-well plate (corning) at 1 10 per well . Cells were cultured for 12 hours and transfected when cells were at 30% to 50% confluence . C57bl/6 mice were purchased from the laboratory animal center at sun yat - sen university in china and were handled in accordance with the research in vision and ophthalmology guidelines for the use of animals in research (animal quality certificate, 0028619; animal experiment license, syxk [guangdong] 2005 - 0058). Twelve hours after seeding, cells were transfected using lipofectamine 2000 (invitrogen, usa) according to the manufacturer's instructions . Sirnas were prepared by serial dilution (1060 nmol / l) in opti - mem i medium (gibco) to determine the optimal transfection concentration . The optimal transfection concentration was defined as the minimum concentration of sirnas that can produce the highest fluorescence intensity . The sirna - targeting tyrosinase mrna was designed by the dharmacon online sirna design tool (http://www.dharmacon.com/homepage.aspx) and synthesized by ruibo biotechnology co., ltd . The sirna sequences against tyrosinase were as follows: sinm_011661_001 target sequence, aagcgagtcttgattagaa; sense (5-3), aagcgagucuugauuagaa(dtdt); antisense (3-5), (dtdt)uucgcucagaacuaaucuu; sinm _ 011661_002 target sequence, acaatgccttacatatctt; sense, acaaugccuuacauaucuu (dtdt); antisense, (dtdt)uguuacggaauguauagaa; and sinm_011661_003 target sequence, tcataccgctctatagaaa; sense, ucauaccgcucuauagaaa(dtdt); antisense, (dtdt) aguauggcgagauaucuuu . A lipofectamine 2000-containing negative sirna (green fluorescence protein mrna sequence) group and a blank group (lipofectamine solution alone) were used as controls . After transfection, the cells were harvested at three different time points (24, 48, and 72 h) to determine the mrna expression, melanin content, and tyrosinase activity for each treatment . The grouping information is as follows: group1 (sinm_011661_001), group2 (sinm_011661_002), group3 (sinm_011661_003), negative control group (negative sirna), blank group (lipofectamine). Tyrosinase mrna in sirna - treated b16 cells was quantitatively analyzed using quantitative real - time pcr (qrt - pcr). Cdna was synthesized with random primers using no more than 500 ng of total rna in each 10-l reaction according to the manufacturer's instruction (takara, japan). Sybr green qrt - pcr were done in a real - time detection system (abi7000, usa) according to the manufacturer's instructions (takara, japan) using the comparative cycle threshold method . Thermal cycler conditions were 95c for 10 seconds followed by 40 cycles of 5 seconds each at 95c and 31 seconds at 60c . The primer pairs were designed for tyrosinase and -actin using primer 5.0 express software as follows: tyrosinase forward primer, 5-gcccagcatccttcttc-3; tyrosinase reverse primer, 5-tagtggtccctcaggtgttc- 3; -actin forward primer, 5-cagccttccttcttgggtat- 3; and -actin reverse primer, 5-tggcatagaggtctttacgg- 3. tyrosinase activity was assessed by determining the catalysis of l - dopa to dopachrome, which has an absorption peak at 490 nm . In this study, the inhibitory action of sirnas on tyrosinase was assayed as described previously [4, 6, 7] with slight modifications . Briefly, b16 cells were seeded at a density of 1 104 cells per well in 96-well plates . After 12 hours, the cells were treated with different sirnas and cultured for 24 to 72 hours at 37c the adherent cells were washed three times with pbs and then lysed in sodium phosphate buffer (0.1 mol / l, ph 6.8) containing 1% triton x-100 . Then, 10 l l - dopa (1%; icn, china) was added, allowed to react, and incubated for 2 hours at 37c . Absorbance was measured at 490 nm using an enzyme - linked immunosorbent assay reader (powerwave xs, bio - tek, usa). The melanin content was determined as described previously [4, 79] by alkaline lysis with minor modifications . After transfection, adherent cells (1 10) were washed with pbs, detached by trypsinization, collected in a test tube, and then washed twice with pbs . The cells were resuspended in 1 mol / l naoh, incubated at 80c for 30 minutes, and then centrifuged at 1,500 rpm for 5 minutes . The absorbance of the supernatant was measured at 475 nm and compared with the standard curve of the serial dilution of standard melanin (sigma, usa). Injection of chloral hydrate (0.008 ml / kg) and local anesthesia with 2% pontocaine . With the guidance of an operating microscope (olympus, japan), two groups of mice were given an intravitreous injection of 2.5 l pbs containing either 0.65 or 1.3 nmol sinm_011661_001, and 2.5 l pbs was injected as control . Twenty - four hours after injection, total rna extraction (qiagen, germany) was done from the retina of c57bl/6 mice as described previously and analyzed with qrt - pcr . Anova was used to compare the differences between the groups using spss 13.0 for windows (chicago, usa). Before transfection, most cells appeared fusiform, and some cells were reticular at low density . The cells in the division phase showed a clear outline, an obvious boundary between cells, and a fine refractive index (figure 1), but after transfection, the cells swelled and the boundary between them became indistinct . Twenty - four hours after transfection, the distribution of intracellular fluorescence was sporadic in cells treated with 10, 20, 30, and 60 nmol / l sirna . However, intracellular fluorescence was widespread, and the intensity was strengthened in cells transfected with 40 and 50 nmol / l sirna (figure 1). In this study, we achieved the best transfection efficacy with the lowest lipofectamine 2000 (0.2 l per cell in a 96-well plate; 4 l per cell in a 6-well plate) and sirna concentrations (40 nmol / l). We evaluated the efficiency of each sequence to suppress tyrosinase expression at 24, 48, and 72 hours after transfection . The results were 82.81%, 76.19%, and 75.46% for sinm_011661_001; 75.75%, 43.49%, and 37.86% for sinm_011661_002; 50.54%, 23.66%, and 22.42% for sinm_011661_003; 17.22%, 11.34%, and 8.68% for the negative control sequence, respectively (figure 2). The efficiency of the three fragments decreased gradually from 24 to 72 hours after transfection . The statistical results showed that the sirna sequence sinm_011661_001 was the most effective in suppressing tyrosinase expression (f = 298.566 and p <.05 at 24 h; f = 179.217 and p <.05 at 48 h; f = 188.564 and p <.05 at 72 h). We evaluated reductions in tyrosinase activity in the transfected cells at 24, 48, and 72 hours after transfection . Tyrosinase activity was reduced by 64.73%, 40.42%, and 28.74% for sinm_011661_001; 63.37%, 25.06%, and 17.33% for sinm_011661_002; 48.16%, 18.33%, and 16.65% for sinm_011661_003; 6.44%, 4.90%, and 3.56% for the negative control sequence, respectively (figure 3). The tyrosinase suppression decreased with time for each sirna sequence, which was similar to the suppression at the mrna level . After 24 hours, there was no significant difference between sinm_011661_001 and sinm_011661_002 (p>.05), whereas significant differences were observed among the other groups (f = 58.485; p <.05). At 48 hours, significant differences were observed among the groups (f = 160.208; p <.05). At 72 hours, no significant difference was found between sinm_011661_002 and sinm_011661_003, whereas significant differences were observed between the other groups (f = 117.372; p <.05). The decrease in melanin content in each group was evaluated at days 1, 2, and 3 . The percent reduction in melanin was 52.53%, 48.55%, and 32.73% for sinm_011661_001; 25.59%, 21.61%, and 6.15% for sinm_011661_002; 21.01%, 18.79%, and 1.70% for sinm_011661_003; 5.53%, 3.58%, and 1.00% for the negative control sequence, respectively (figure 4). After 48 hours, the melanin content and interference efficiency of sinm_011661_002 and sinm_011661_003 were not significantly different . However, after 72 hours, cells transfected with sinm_011661_001 contained significantly less melanin than the other groups (p <.05), whereas comparisons between other groups were not significantly different . Because sinm_011661_001 most effectively reduced mrna expression of tyrosinase in b16 cells, we evaluated its effect in c57bl/6 mice . To determine the change in tyrosinase mrna levels, qrt - pcr was carried out using tyrosinase - specific primers and total rna isolated from retinas (table 1). Negative interference sequence and liposome (blank group) have nonspecific interference effect during our experiment . All three sirna sequences that we screened suppressed tyrosinase expression, but sinm_011661_001 was most effective, exerting the maximum effect at 24 hours after transfection . It is presumed that tyrosinase mrna possesses a special functional structure that is most similar to sinm_011661_001 . The data presented here suggests a crucial role for sirna structure in rnai [8, 10]. In this study, the suppressive effects on melanogenesis in b16 cell line peaked at 24 hours, suggesting that sirna was active for 24 hours after transfection and then was gradually degraded . However, we used modified sirna, which can enhance stability and reduce the potential for off - target effects . Sequences of sirna for a target gene do not perform equally, but significant progress has been made in defining sequence features that contribute to sirna potency . Low internal stability at the 5 terminus of antisense sirna is an important prerequisite for gene silencing . Excessive stability can result in double - strand unwinding, but inferior stability can reduce the affinity of sirna to its mrna target . In the present study, we noted an interesting phenomenon: sinm_011661_001 transfection resulted in the considerable suppression of tyrosinase mrna compared with other control sirnas . Furthermore, the negative controls (sirna sequence and lipofectamine transfection reagent) were observed to slightly reduce melanin content with time (figure 4), which was similar to the effect of sinm_011661_002 and sinm_011661_003 72 hours after transfection . This phenomenon also appeared at the level of gene expression and tyrosinase activity, suggesting nonspecific rnai activity . In addition to showing that sinm_011661_001 is the most potent sirna sequence against tyrosinase in b16 cells, we assessed the effect of this sirna sequence on tyrosinase expression in c57bl/6 mice . One of the important factors for rnai effectiveness in vivo may be the delivery and transfection efficiency of sirnas . In mammalian cells, sirna has been administered locally or systemically, and the efficiency of rnai delivery systems is still relatively low . Previous studies showed that the systemic delivery of sirnas by tail vein injection does not deliver sirnas efficiently to their target areas because sirna molecules are easily trapped in nonspecific organs . We thought that the optimal efficacy of sirna targeting pigmentary epithelium would be largely deprived via intravenous injection, because the nutrient vessel supporting pigmentary epithelium belongs to distal circulation vessel . What is more, the synthetic sirna pieces are heterogenous to mice; appearance of these heterogenous pieces in circulation may potentially induce severe immune lesion to mice . In contrast, intravitreous treatment may have its advantage to overcome these problems, because vitreous space has the immediate proximity to retina, the small molecular weight of sirna may be efficiently delivered to retina and pigment epithelium through posterior vitreous membrane and thus have direct effects on target tissues . In addition, the blood - ocular barrier may function to prevent the entry of intravitreously injected sirna into circulation . In summary, intravitreous administration may take many advantages beyond intravenous injection, due to efficient and direct delivery of sirna pieces to target tissues combined with reduced risk of inducing side effects . After considering these factors collectively, we chose intravitreous injection throughout this work . We also believe that this method would provide a new approach to ocular albinism mouse model preparation . In contrast, our results showed that sirna administered locally had significant inhibitory effects on the retina . It strongly suggests that sinm_011661_001 can be delivered effectively in vivo and may also be delivered to other tissues such as skin and hair . In summary, we have shown that sinm_011661_001-targeting tyrosinase is the most potent sequence in vitro and in vivo . Rnai is a new tool for gene silencing using antisense nucleic acids and gene targeting . In addition, it gives us a new method to use in the development of pigmentation disease (e.g., ocular albinism) animal models and treatments . Furthermore, this technique may be useful in the study of downstream factors of tyrosinase.
Femoral head avascular necrosis (fhavn) is the result of irreversible anoxia of the subchondral bone . Fhavn is one of the increasing common causes of musculoskeletal disability that poses a major diagnostic and therapeutic challenge . With approximately 20,000 new reported cases each year, it is the underlying disease in as many as 10% of 500,000 total hip replacements annually performed in the usa . Affecting mainly young men in their late 30s and early 40s, it results in manpower loss and adds to morbidity . Left untreated, fhavn will progress to secondary osteoarthritis in 80% of cases and eventually require total hip arthroplasty, hence the importance of early diagnosis is needed . The causes of fhavn include trauma and nontraumatic causes such as long - term corticosteroid use, alcohol abuse, hematological diseases (sickle cell anemia, thalassemia, polycythemia, hemophilia, and myeloproliferative disorder), metabolic diseases (gaucher's disease, hypercholesterolemia, pregnancy, chronic renal failure, hyperparathyroidism, and cushing's disease), autoimmune diseases, chronic pancreatitis, caisson's disease, radiation, congenital hip dislocation, and use of potent intravenous bisphosphonates . Various pathophysiologic mechanisms have been proposed to explain the occurrence of fhavn in these diverse conditions . The proposed mechanisms of cell death include some form of arterial or venous insufficiency or extravascular compression in the context of a rigid bony compartment . Avascular necrosis (avn) is characterized by areas of dead trabecular bone and marrow that extend to involve the subchondral plate . Typically, the principal weight bearing region, the anterolateral aspect of the femoral head is involved, but any region of the femoral head may be involved . Measures to preserve the joint are associated with better prognoses when the diagnosis of fhavn is made early in the course of the disease . The results of joint replacement therapy are poorer in younger age groups than in older patients . It is, therefore, critical to diagnose this condition as early as possible to prevent or delay progression of the disease . Noninvasive diagnostic tests used in detecting avn include radiography, three - phase bone scintigraphy (tpbs) with or without single photon emission computed tomography / computed tomography (spect / ct), conventional ct scan, and magnetic resonance imaging (mri). Tc-99 m methylene diphosphonate (mdp) bone scintigraphy could be an ideal modality for assessing the reparative processes of osteonecrosis as the radionuclide activity reflects osteoblastic activity and blood flow . On planar scintigraphic images, the boundary of the necrotic lesion typically appears as a margin of increased tracer uptake adjacent to a photopenic area . However, if the necrotic lesion is small or eccentrically located, it becomes difficult to detect the scintigraphic changes around the necrotic lesion . Thus, planar scintigraphic images suffer from important limitations such as poor spatial resolution and inability to quantify the lesion . Although spect, a technique involving three - dimensional scintigraphy, has been developed as a means of overcoming the limitations of planar scintigraphic images, the lack of anatomical detail makes it difficult to use often the information reliably . Uptake of f-18 fluoride, like that of tc-99 m mdp, depends on regional blood flow and osteoblastic activity . However, positron emission tomography (pet) offers superior spatial resolution, and the favorable pharmacokinetic characteristics of f-18 fluoride make this a more sensitive modality than spect / ct . Since pet / ct provides both structural and functional information, it has been proven useful for interpreting radionuclide uptake not only in patients with malignancies but also in nonmalignant conditions . Also, pet / ct provides an accurate evaluation of the site of the lesions with the ct part of the pet providing anatomical details . However, to the best of our knowledge, there are no studies to date showing the utility of f-18 fluoride pet / ct bone scan in the diagnosis of fhavn . The purpose of this study was to assess the utility of f-18 fluoride pet / ct bone scan in the diagnosis of fhavn and compare it with mri . Exclusion criteria included pregnancy, severe debilitation, contraindication to mri, and refusal to give written informed consent . Fifty - one consecutive patients (39 male, 12 female) aged 1748 (mean 32.5) years with high clinical suspicion of fhavn and referred for mri from a tertiary orthopedic care unit were prospectively evaluated . All patients underwent mri and f-18 fluoride pet / ct bone scans within 410 (mean 8) days of each other . All patients underwent mri on a 3.0 t (ge discovery mr750w) mri unit with a body phased array coil . The following sequences were used: t1 axial, sagittal, and coronal (tr / te, 717/9.2), t2 fs - axial and coronal (tr / te, 4528/102), pdfs - coronal (tr / te, 275/30), 1fs - coronal (tr / te,576/9.2). One experienced radiologist (ps) and one experienced orthopedic surgeon (rks) read and staged the mri images . Diagnostic criteria for ficat staging pet / ct (diagnostic ct) of the pelvis (including both hip joints) was performed 1 h after intravenous injection of 370 mbq of f-18 fluoride on a dedicated pet / ct scanner (discovery ste 16; ge healthcare, usa). Reconstruction of the acquired data was performed so as to obtain fused pet / ct images in transaxial, coronal, and sagittal views . Two patients with history of long - term steroid use for systemic lupus erythematosus (sle), with pain in multiple joints underwent total body pet / ct . Two experienced nuclear medicine physicians (ab, brm) blinded to the mri reports read the pet / ct scans separately . Regions of interest (rois) were drawn separately over the photopenic area, and the entire head of the affected femur - and the maximum standardized uptake values (suvmax) of each of these were recorded . In patients with unilateral fhavn, all patients were followed up clinically for a mean period of 10 months (range: 718 months). A final diagnosis of fhavn was made by surgical pathology or clinical and radiologic follow - up . Spss (statistical product and service solutions, version 16.0, ibm, usa) software was used for statistical analysis . Descriptive statistics such as mean and range were used to describe demographics and clinical profile of all patients . Sensitivity, specificity, and accuracy of mri and pet / ct compared to composite gold standard . Exclusion criteria included pregnancy, severe debilitation, contraindication to mri, and refusal to give written informed consent . Fifty - one consecutive patients (39 male, 12 female) aged 1748 (mean 32.5) years with high clinical suspicion of fhavn and referred for mri from a tertiary orthopedic care unit were prospectively evaluated . All patients underwent mri and f-18 fluoride pet / ct bone scans within 410 (mean 8) days of each other . All patients underwent mri on a 3.0 t (ge discovery mr750w) mri unit with a body phased array coil . The following sequences were used: t1 axial, sagittal, and coronal (tr / te, 717/9.2), t2 fs - axial and coronal (tr / te, 4528/102), pdfs - coronal (tr / te, 275/30), 1fs - coronal (tr / te,576/9.2). One experienced radiologist (ps) and one experienced orthopedic surgeon (rks) read and staged the mri images . Diagnostic criteria for ficat staging pet / ct (diagnostic ct) of the pelvis (including both hip joints) was performed 1 h after intravenous injection of 370 mbq of f-18 fluoride on a dedicated pet / ct scanner (discovery ste 16; ge healthcare, usa). Reconstruction of the acquired data was performed so as to obtain fused pet / ct images in transaxial, coronal, and sagittal views . Two patients with history of long - term steroid use for systemic lupus erythematosus (sle), with pain in multiple joints underwent total body pet / ct . Two experienced nuclear medicine physicians (ab, brm) blinded to the mri reports read the pet / ct scans separately . Regions of interest (rois) were drawn separately over the photopenic area, and the entire head of the affected femur - and the maximum standardized uptake values (suvmax) of each of these were recorded . In patients with unilateral fhavn, all patients were followed up clinically for a mean period of 10 months (range: 718 months). A final diagnosis of fhavn was made by surgical pathology or clinical and radiologic follow - up . Spss (statistical product and service solutions, version 16.0, ibm, usa) software was used for statistical analysis . Descriptive statistics such as mean and range were used to describe demographics and clinical profile of all patients . Sensitivity, specificity, and accuracy of mri and pet / ct compared to composite gold standard . Diagnostic criteria for fhavn on the pet / ct included a photopenic area surrounded by areas of reactive increased tracer uptake along with the asterisk sign (loss of thickening of bone trabeculae in the center of the femoral head which appears similar to a star) and crescent sign (horizontal subchondral fracture) on ct . Findings on the ct part of the pet / ct like subchondral sclerosis, subchondral cysts, loss of contour of the femoral head, and joint space narrowing were noted whenever present . Presence of various diagnostic features on mri such as bone marrow edema, a circumscribed subchondral band - like lesion with low signal intensity on t1-weighted (t1w) sequences, double line sign (an inner bright t2 line representing granulation tissue and an outer dark line representing sclerotic bone), rim sign (a high t2 or intermediate t1 signal line sandwiched between two low signal lines), and joint effusion were noted when present . Thirty - nine of the 51 patients evaluated were diagnosed to have fhavn on mri; 23 had unilateral, and 16 had bilateral femoral head involvement . Of the 55 hips diagnosed with avn, 7 were diagnosed to be ficat stage i, 19 stage ii, 25 stage iii, and 4 stage iv . Using the criteria described earlier, fhavn was diagnosed on f-18 fluoride pet / ct in 57 hips including all 55 hips diagnosed on mri . Representative images of pet / ct and mri in a patient with bilateral fhavn are shown in figure 1 . One patient diagnosed with bilateral early fhavn on pet / ct had imaging features indeterminate for avn on mri [figure 2]. During 13 months of follow - up, this patient continued to have pain in both hips, and a subsequent mri showed ficat stage i fhavn on the right side and stage ii fhavn on the left side . Of the remaining 11 patients, 3 patients had degenerative arthritis, 4 had transient osteoporosis of the hip [figure 3], and 4 were normal on both imaging modalities . A 24-year - old male patient with bilateral ficat stage iii femoral head avascular necrosis (a) coronal positron emission tomography, (d) axial positron emission tomography, (f) fused axial positron emission tomography / computed tomography images show photopenic areas (arrows) in the antero - superior regions of both femoral heads, corresponding to subchondral cysts surrounded by sclerosis on computed tomography (b and e) and decreased signal intensity on t2 weighted magnetic resonance (c). The photopenic areas are bordered by increased tracer uptake corresponding to bone marrow edema on magnetic resonance imaging . Note is also made of bilateral joint effusion, double - line sign in the right femoral head and rim sign in the left femoral head on magnetic resonance imaging (c) a 32-year - old female patient with bilateral hip pain for 6 months: (a) coronal positron emission tomography, (d) axial positron emission tomography, and (e) fused axial positron emission tomography / computed tomography images show photopenic areas (arrows) in the antero - superior regions of both femoral heads, with no definite morphological changes on computed tomography (b and f) and nonspecific marrow edema on mri (c). A diagnosis of bilateral early femoral head avascular necrosis was made on positron emission tomography / computed tomography while magnetic resonance imaging was indeterminate for avascular necrosis . During 13 months of follow - up, the patient continued to have pain in both hips and a subsequent magnetic resonance imaging showed ficat stage i femoral head avascular necrosis on the right side and stage ii femoral head avascular necrosis on the left side a 39-year - old male patient with left sided hip pain for 1-year: (a) coronal positron emission tomography, (b) fused coronal positron emission tomography / computed tomography, (d) axial fused positron emission tomography / computed tomography images show diffusely increased tracer uptake (arrow) in the head and neck of the left femur, (e) computed tomography showed no morphological changes (c and f) coronal and axial magnetic resonance imaging images show diffuse bone marrow edema extending up to the neck and decreased signal intensity from the 112 oclock position (arrow) in the left femoral head . A diagnosis of transient osteoporosis of the hip was made which was proved on clinical follow - up by surgical pathology or clinical and radiologic follow - up, a final diagnosis of fhavn was made in 40 patients (57 hips). Final diagnosis in the rest was made by clinical or radiological follow - up, as they refused to undergo biopsy / surgical intervention . Seventeen (43%) patients had a history of steroid use, 10 (24%) of alcohol use, 7 (17%) had trauma, 1 (2%) was pregnancy - related and in 5 (14%) no causative factor was identified . Mri was 96.5% sensitive, 100% specific, and 98.03% accurate in diagnosing fhavn, while pet / ct was 100% sensitive, specific and accurate in diagnosing fhavn . The agreement between the two imaging modalities for the diagnosis of fhavn was 96.07% . Using the rois drawn on the affected femoral head, the photopenic area and normal femoral head as described, mean (range) suvmax of the photopenic area was 1.9 (0.22.8), affected femoral head was 21.3 (8.242.8) and normal femoral head was 4.4 (3.56.7). Mean suvmax values for the affected femoral heads with ficat stage i, ii, iii, and iv were 10.9, 23.1, 27.8, and 35.5, respectively . As the number of hips in different stages of avn varied, with only a few hips with stage i and iv disease, a cut - off value to stage avn based on suvmax alone could not be calculated . However, it was observed that with increase in stage, suvmax value of the femoral head was also higher, representing increased ongoing reactive changes . Two patients with a history of long - term steroid use for sle and pain in multiple joints underwent total body pet / ct . In addition to bilateral fhavn, one patient showed avn of both humeri and the other showed avn of the right distal end of the femur . Fhavn is a disease process for which progression is difficult to predict due to the varying etiology . Delayed intervention in undiagnosed fhavn leads to degenerative arthritis and eventual collapse of the femoral head, making early diagnosis crucial . Noninvasive diagnostic tests used in detecting avn include plain radiography, ct, mri, tpbs, and spect / ct . On radiography, abnormal findings in avn include the crescent sign (horizontal subchondral fracture line), cystic or sclerotic change in the femoral head, abnormal contours of the femoral head, and collapse or secondary degenerative change . However, the sensitivity of plain radiography for detecting early stages of the disease is as low as 41% . Demonstrated the sensitivity of tc-99 m mdp in demonstrating the absence of uptake in viable osteocytes by 72 h. they showed that initially a cold area is noted in the femoral head, indicating avascularity and reduced delivery of the radiopharmaceutical . There may be a doughnut appearance, with a photopenic center surrounded by a region of hyperemia and reactive change . Subsequently, the photopenic area diminishes as there is ingrowth of osteoblasts upward from the metaphysis into the femoral head so that ultimately, as healing progress, there will be uniform intense radioactivity throughout . Using a 1.5 t magnet, beltran et al . Reported 88% sensitivity, 100% specificity, and 94% accuracy with mri and 78% sensitivity, 75% specificity, and 76% accuracy with bone scintigraphy . Spect scanning provides images of the radioactivity within the target organ in three dimensions . With this modality, overlying and underlying areas of radioactivity may be separated into sequential tomographic planes, thus providing increased image contrast and improved lesion detection and localization, as compared with planar scintigraphy . Early in the disease, spect scans may demonstrate an avascular focus, which may be missed on mri unless contrast is used . Collier et al . Found a sensitivity of 85% for spect scanning . With triple - head high - resolution compared the diagnostic sensitivity of tc-99 m mdp bone spect and mri in the early detection of femoral head osteonecrosis after renal transplantation and showed a sensitivity of 100% (32/32) for spect and only 66% for mri . Evaluated a total of 22 patients and 24 symptomatic hips out of which seven hips (29%) were confirmed to have avn and showed additional value of spect / ct versus spect in the diagnosis of fhavn . They concluded that spect / ct conferred a benefit of improvement of area under curve in receiver operating characteristic in the diagnosis of hip avn compared with spect alone . The reported sensitivity of mri for early diagnosis of osteonecrosis ranges between 88% and 100% . In the early stages of the disease, there may not be any alteration of the normal signal intensity of the femoral head . The first sign of avn is nonspecific: diffuse areas of decreased signal intensity are seen in the normally high - signal - intensity fatty marrow on t1w images . Hence, there are chances that early avn may be missed in mri . While previous studies have demonstrated the utility of tpbs and spect in the diagnosis of avn, there are not many studies using spect / ct for detecting avn . Thus, the reported sensitivity and specificity of bone scintigraphy in the diagnosis of avn in the literature is either lower or comparable to mri . An earlier case report has described the use of f-18 fluoride pet / ct in the diagnosis of fhavn . Pet has better spatial resolution than spect (5 mm vs. ~1 cm respectively). F-18 fluoride has favorable kinetics such as faster blood clearance and 2-fold higher uptake in bone compared to tc-99 m mdp . It has higher capillary permeability and faster blood clearance, which results in better target to background ratio compared to mdp . Also, the high spatial resolution and contrast resolution of the ct component of pet / ct provides morphologic identification . Ct scanning is appropriate in evaluating the extent of involvement, such as subchondral lucencies and sclerosis during the reparative stage, before the onset of femoral head collapse and superimposed degenerative disease . Ct scanning also defines the extent of disease at stages ii and higher better than mri and plain film radiography . With multiplanar reconstruction thus, hybrid pet / ct improves the sensitivity and specificity compared to pet alone . However, f-18 fluoride pet / ct has slightly higher radiation dosimetry than tc-99 m mdp . The estimated radiation dose in adult humans is 0.19 mgy / mbq compared to 0.03 mgy / mbq from tc-99 m mdp for the bladder wall and 0.0120 mgy / mbq compared to 0.035 mgy / mbq for the bone surfaces . The final choice of mdp spect / ct or 18f - naf pet / ct would depend, to a large extent, on availability as well as costs involved . The dynamics of naf allow for more rapid imaging (within 1 h of tracer injection) as compared to tc-99 m mdp allowing higher throughput in departments with high patient turnover . Imaging time with pet / ct is also much shorter compared to spect / ct . As pet / ct provides better image resolution and allows for semi - quantitative analysis, f-18 fluoride pet / ct may be the preferred investigation in the diagnosis of fhavn . While dynamic phase pet / ct may provide important information on femoral head vascularity, the increased scan duration may be perceived as a drawback . The results of this study suggest that the 1-h static pet / ct image may be useful for a rapid evaluation of fhavn . While the additional cost and radiation exposure of naf pet / ct (compared to mdp spect / ct) may limit the use of this investigation, the accurate diagnostic information obtained would tend to justify the use of this investigation, especially in postoperative patients with orthopedic hardware . The cost will be significantly lower for institutes equipped with a medical cyclotron since no additional radiopharmaceutical preparation is required . In the present study, pet / ct has the advantage of detecting abnormalities at multiple sites without increasing the cost . It can also be considered when a patient complains of pain at multiple bone and joint areas . In our study, quantitative bone scanning provides physiologic data that cannot be obtained with other modalities, including mri and spect; for example, this technique allows quantification of uptake, which can be used for prognostic purpose . Mri cannot be performed in patients with cardiac pacemakers or when intracranial clips are present and is challenging in patients with claustrophobia . It is difficult to detect fhavn after surgery using orthopedic hardware, which creates significant image distortion . F-18 fluoride pet / ct can also be performed when results of mri are indeterminate . The study group included patients with high suspicion of fhavn referred from a tertiary orthopedic care, which might have increased the sensitivity of the study . Also, histopathology, which is gold standard in the diagnosis of avn could not be obtained in all the cases, as it is invasive . The study group included patients with high suspicion of fhavn referred from a tertiary orthopedic care, which might have increased the sensitivity of the study . Also, histopathology, which is gold standard in the diagnosis of avn could not be obtained in all the cases, as it is invasive . F-18 fluoride pet / ct showed good agreement with mri in the initial diagnosis of fhavn . It can be especially useful in detecting early disease and also in patients in whom mri is contraindicated.
Intraosseous ganglion cyst (igc) is a benign, no neoplastic bone lesion with histological similarity to the soft tissue ganglion cyst.1, 2 intraosseous ganglion contains mucoid viscous material with no epithelial or synovial lining . The radiolucent carpal lesions are usually symptom - free found incidentally on radiographs of the wrist performed for other reasons . Detecting a single radiolucent lesion in the lunate accompanied by pain is rare, and detecting a pathological fracture of the lunate revealing an intraosseous ganglion cyst is exceptional . Isolated rare cases of intraosseous ganglion cysts in the carpal bones have been reported, most commonly in the lunate and the scaphoid.5, 6, 7, 8, 9 their etiology remains largely unknown; however trauma, herniation of the joint capsule, mucoid degeneration, intramedullary metaplasia of mesenchymal cells, and congenital rests of synovial producing cells have been suggested to play a part . We report a case of a pathological fracture of the lunate revealing an intraosseous ganglion cyst . A 42-year - old female, with a history of right distal radius fracture, presented with right wrist pain following a fall on the palm of the right hand . Clinical study revealed a moderate swelling over the mid - section of the palmar face and pain through extreme ranges of motion of the wrist . Radiographic studies of the right wrist revealed a round - shaped defect with a fracture of the lunate (fig . 1). Ct scan confirmed a cystic lesion of the lunate and was able to localize the lesion and the fracture precisely (fig . 2). The patient was operated upon using anterior surgical approach with a medial palmar extension; both the lunate and the distal radius were exposed for harvesting vascularized bone . A soft - tissue ganglion cyst communicating with the lunate intraosseous ganglion cyst was identified through a defect on the anterior side of the lunate . Through the cortical defect the cavity was rinsed with saline solution and packed using a vascularized bone graft based on the volar carpal artery, e.g. Kuhlman's vascularized radial bone graft (fig . 3). After closing the joint capsule, the subcutaneous and cutaneous tissues, a removable wrist cast was applied for six weeks . The content of the cyst was described anatomopathologically as a cystic formation with walls constituted by flattened, synovial - like, fibro - connective tissue cells with no true epithelial lining . After a ten - month follow - up period she was completely relieved of pain without any limitation of the wrist motion . In 1956, hicks described radiolucencies with a sclerotic margin within bones as synovial bone cysts . In 1966 crabbe first used the term intraosseous ganglion . Synonymous terms include synovial bone cyst, ganglionic cystic defect of bone, subchondral bone cyst and juxta - articular bone cyst . Radiolucent carpal bone lesions are usually symptom - free found incidentally on radiographs of the wrist performed for other reasons . Their differential diagnosis includes igc, osteoarthritic cyst, post - traumatic cyst, simple bone cysts, and aneurysmal bone cyst . When they present themselves as painful wrist, kienbock's disease, osteoid osteoma and osteoblastoma should be included in a differential diagnosis list . Ganglia in the lunate is mostly located near the radiocarpal joint in the proximal part of the bone, and in the majority of cases turned toward the scaphoid . Most intraosseous ganglions in the scaphoid are located in the proximal portion near the lunate because about 70% of hand tissue - ganglia arise from the posterior side of the scapho - lunate joint.12, 13 a lesion was classified as an intraosseous ganglion when histopathology was identical to soft - tissue ganglion cysts . The wall of the cysts consists of fibrous, collagenous fibers similar to flattened histiocytes, partly mucoid - degenerated without epithelial cells and without synovial lining . The cyst wall in general is surrounded by sclerotic bone with necrotic and regenerated bone tissue.6, 14 the causes of both soft tissue and intraosseous ganglion remain unsettled . There seem to be two fundamental types of intraosseous ganglia: one originating by penetration of an extra - osseous ganglion into the underlying bone, the other being idiopathic . Erosion of an extraosseous ganglion through bone is the generally agreed - on mechanism for the penetrating type . It seems that idiopathic type of ganglion cyst originates from modified mesenchymal or synovial cells at the capsule synovial interface in response to repeated minor injury, explaining high prevalence of ganglion cyst in the scapho - lunate site where the motion and force is concentrated . . Then proliferation of fibroblasts and histocytes and production of hyaluronic acid with mucoid degeneration during tissue revitalization occur to form a cyst . Surgical treatment is indicated if the igc is symptomatic or if its size is growing in imaging findings . Growing igc can result in traumatic and collapsing fracture in the lunate with serious complications . When igc has been completely stopped growing and there is no cortical defects or collapsing fractures, regular follow - up with radiography is recommended . Increased uptake in lunate area in a painful wrist indicates surgical treatment.17, 18 treatment of igc consists in the curettage of the cyst, injection of saline solution and packing the cavity with cancellous bone graft . In our case an anterior approach was preferred and a kuhlman's vascularized radial bone grafting was performed because of the palmar localization of the ganglion cyst within the lunate bone . In addition to this approach, a dorsal approach or some alternative surgical techniques such as excision of the lunate, dorsal flap arthroplasty, prosthetic replacement, radiocarpal or intercarpal fusion are also used . An igc should be suspected when patients present with pain or swelling of the wrist following a trauma along with a cyst with fine marginal sclerosis close to the scapholunate joint . Although ct scan shows the bony architecture, mri may better demarcate the tissues surrounding the bones . In conclusion, this case shows an unusual presentation of an intraosseous ganglion cyst of the lunate revealed by a pathological fracture . Surgical treatment provided excellent outcome.
Malignant melanoma rarely affects the breast, accounting for less than 5% of all malignant melanomas . Malignant melanoma of the breast has various manifestations: primary cutaneous melanoma, primary glandular melanoma, metastatic melanoma, and in - transit metastases to the breast . Primary cutaneous malignant melanoma of the breast shows similar clinical features to melanomas arising from other cutaneous areas . It follows different metastatic patterns than do primary carcinomas of the breast and require a different therapeutic approach . Wide local excision with sentinel lymph node (sln) biopsy is the most important therapeutic modality in preventing local recurrence . Malignant melanoma is an immunogenic tumor and adjuvant immunotherapy is indicated in high risk patients . Common metastatic sites are brain, lung, liver and overall prognosis is very poor in metastasis . Herein, we report a case of primary cutaneous malignant melanoma of the breast in a 59-year - old woman and discuss the clinicopathologic features and treatments in correlation to the literature data . A 59-year - old woman was admitted with a black pigmented skin lesion in the right breast . She mentioned that the lesion had appeared at birth but grew rapidly and bled recently . The lesion was 2.0 1.5 cm in size and located on the periareolar skin in the upper inner quadrant of the right breast which is not associated any breast mass (fig . The axillary lymph node was not palpated and there was no nipple discharge or retraction . She underwent incisional biopsy a week earlier at a local breast clinic and was diagnosed with malignant melanoma . The specimen was an ulcerative, pigmented lesion, measuring 1.0 0.6 cm in size and 0.25 cm in thickness (pt3b). Careful examination of the other skin and mucous membranes revealed no areas suggestive of a malignant melanoma . Brain computed tomography (ct) and positron emission tomography - ct showed no evidence of metastasis . She underwent wide local excision of the lesion, including removal of normal appearing skin and underlying subcutaneous tissue to provide a safety margin; and subsequent sentinel lymph node biopsy (slnbx) using the technetium (tc)-99 m phytate was performed . Grossly, the specimen revealed a sharply defined, black pigmented lesion, measuring 1.9 1.6 cm in size including normal skin 2 cm apart from the tumor margin and subcutaneous tissue (fig . Microscopic findings showed intraepidermal tumor cells and nests that were laterally spreading in a pagetoid manner and tumor nests invaded the superficial dermis 0.12 cm in thickness (pt2a) (fig . Tumor cells often had large nuclei and nucleoli and abundant cytoplasm with brown - black pigments (fig . The resection margins were free of tumor cells and there was no regional lymph node metastasis (pn0). The final pathologic stage considering incisional biopsy report was iib (t3bn0m0) according to the 7th edition of the american joint committee on cancer classification . Three years after surgery, the patient is alive and shows no signs of local recurrence or distant metastasis . The incidence of malignant melanoma has risen sharply over the last decade and can occur anywhere on the body . It occurs most commonly on the extremities in females and on the trunk in males . Malignant melanoma of the breast is classified into primary melanoma of the breast skin or gland, and metastatic melanoma to the breast from an extramammary site . Cutaneous malignant melanoma of the breast is a rare tumor, accounting for less than 5% of all malignant melanomas and primary cutaneous malignant melanoma of the breast is particularly rare . Reported that cutaneous malignant melanoma showed different manifestations in the breast not only at initial presentation but also during the follow - up periods of each patient . To date, several cases of primary cutaneous malignant melanoma of the breast have been reported in the west but have not yet been reported in korea . Exposure to solar ultraviolet radiation is the major environmental risk factor and the presence of host factors including skin pigmentation, sensitivity to the sun and large numbers of nevus are strongly associated . Bono et al . Reported cutaneous malignant melanoma prefers the upper inner quadrant of the breast and this finding is consistent with an etiologic role for sun exposure . In the present case, the lesion was also located in the upper inner quadrant of the right breast . In comparison to primary cutaneous malignant melanomas arising from other areas, neither the symptoms nor the physical findings of primary cutaneous malignant melanoma of the breast present any characteristic pattern . However, in cutaneous malignant melanoma of the breast, mmg and/or us should be obtained to reveal the breast lesion that is considered a metastatic lesion . In our case, if malignant melanoma occurs in the nipple - areolar area, phagocytosis of melanin by paget's cells can distinguish the malignant melanoma from paget's disease of the breast . In our case, however, incisional biopsy should never be performed to establish the diagnosis of cutaneous malignant melanoma because it would be confusing in determining the pathologic stage . Therefore, if a suspicious lesion is found, excisional biopsy should be performed . For an accurate diagnosis of primary cutaneous malignant melanoma, a comprehensive physical examination also, any history of previous removal of pigmented lesions must be investigated and reviewed if present . The management of primary cutaneous malignant melanoma of the breast requires special consideration in view of the rarity of the disease and the intricate anatomy of the breast . Surgery is the main therapeutic option and wide local excision with a margin containing normal appearing skin and underlying subcutaneous tissue is the standard of treatment . Adequate excision margin is considered a 1 to 2 cm clearance according to tumor thickness; 1 cm clearance is adequate for lesions <1 mm thickness and 2 cm for> 2 mm thickness . In our case, mastectomy does not improve the survival rate obtained by breast conserving surgery . Because regional lymph node metastasis is the most important prognostic factor it is rare for it to spread systemic metastasis without first passing through the sln . Reported that lesions located below 3 cm from clavicle metastasized to the axillary lymph nodes regardless of gender or location and lesions located above 3 cm, assessment on the cervical region has been recommended . The incidence of lymph node metastases ranges from 6% for patients with 1 mm cutaneous malignant melanomas to 35% in patients with 4 mm . A positive sln is associated with clark level iv depth, tumor regression and ulceration, young age, higher mitotic rate, male and axial location . Cutaneous malignant melanoma is an immunogenic tumor and high dose interferon alpha has gained approval for adjuvant treatment of malignant melanoma . Interferon has shown to improve relapse - free survival but a definitive benefit in overall survival is debatable . Though radiotherapy decreases the locoregional failure from 30 - 50% to 10 - 20%, a survival benefit remains vague because of low radiosensitivity in melanoma cells . In contrast to breast carcinoma, a significance of chemotherapy or hormonal therapy is unclear . Despite various aggressive systemic treatments, cutaneous malignant melanoma is possibly a life - threatening disease in which regional or distant metastasis may develop . The most common metastatic site is the brain, for which dacarbazine is considered the standard treatment . The important prognostic factors are regional lymph node metastasis, primary tumor thickness, and ulceration . During follow - up visits, particular attention should be paid to the importance of breast examination . Not only in visible in - transit metastasis, but also when there is evidence of mild breast skin abnormalities such as a light blue spot, histological confirmation should be performed . The rarity of cutaneous malignant melanomas of the breast have made them difficult to evaluate . Moreover, distinguishing whether a cutaneous malignant melanoma of the breast is primary or metastatic is important for the treatment strategies and the overall prognosis . Awareness of unusual cutaneous lesions of the breast is necessary to determine the optimal treatment modalities on this rare disease.
These materials are made of either latex (natural rubber) or synthetic polymer materials (polyurethane). Latex elastics are more commonly used because they present improved properties such as: greater flexibility, lower cost and greater capacity of returning to the original dimensions after undergoing deformation . In orthodontic practice, the use of elastics has some advantages, such as biocompatibility, low cost, easy installation and removal by the patients . However, the oral environment may interfere negatively in the properties of these materials . Exposure of these elastics to oral environment results is degradation of their elastic forces . Literature has reported that rubber elastics exposed to oral environment lose between 10 to 40% of their initial force . After 1211 to 24 h of installation, this degradation rate is greatly reduced, resulting in forces with reasonably constant intensity . Moreover, in spite of being considered a biocompatible material, santos, et al . The elongation of the molecular chains of materials should be considered one of the main mechanisms by which the elastic force decay occurs . When the elastic stretches, the polymer chains are uncoiled becoming elongated . If the force is excessive, such chains will slide one over another resulting in permanent deformation of the material and consequently in the degradation of the force generated by the elastic . Additionally, the oral environment acts as an agent of the elastic force degradation because of physical damages, e.g. : mechanical traumas and temperature alterations . Moreover, the chemical interactions among the material, saliva and dietary substances promote both the absorption of water and other salivary constituents and the solubilization / release of the material's components in the saliva, consequently modifying the elastics' molecular structure and favoring their degradation . Most studies on the influence of the oral environment are conducted in vitro, evaluating humidity, saliva composition, ph, temperature and stress induced by elastic cyclic stretch . However, few studies on the effects of dietary substances are found in the literature . (2004) evaluated the effect of diet on the mechanical properties of intermaxillary elastics . These authors observed that dietary substances did not significantly increase the degradation of the mechanical properties of elastics . (1998) verified that the immersion of elastomeric chains in coca - cola resulted in a greater degradation of forces compared with the immersion in water . (2008) demonstrated that immersion in coca - cola was not able to alter the pattern of force degradation in two different types of elastomeric chains . Intermaxillary elastics have been routinely employed in orthodontics it is thus important that orthodontists be aware of the mechanical properties of these materials as well as of the influence of oral environment factors on their properties . Due to the limited number of studies evaluating the effect of diet on force degradation, the aim of this study was to evaluate in vitro the effects of frequently ingested beverages on the force degradation of intermaxillary elastics . One hundred and eighty medium force 1/4-inch intermaxillary elastics (tru - force latex elastic system; tp orthodontics inc ., la porte, in, usa) were used and divided into six groups (n=30): group 1 (control - artificial saliva), group 2 (coca - cola - coca - cola company, so paulo, sp, brazil), group 3 (beer - heineken, so paulo, sp, brazil), group 4 (orange juice - del valle pure squeezed orange juice, coca - cola company, so paulo, sp, brazil), group 5 (red wine - santa lucia cabernet sauvignon, henriquez hermanos ltd ., talca, chile), group 6 (coffee - nescaf classic, nestl s.a ., araraquara, sp, brazil). The composition of artificial saliva was 0.0625% kcl, 0.0865% nacl, 0.0056% mgcl2, 0.0166% cacl2, 0.0804% na2hpo4, 0.0326% kh2po4, 4.274% sorbitol, 0.0004% naf, 0.1% c6h5coona, 2% carboxymethylcellulose and distilled water . Elastics with tensile strength ranging from 1.55 to 2 n were selected to standardize the samples and eliminate possible mechanical behavior bias . Therefore, 282 elastics were tested to reach a test sample size of 180 elastics . Initially all elastics were mounted on an epoxy resin board on two steel pins at a distance of 26 mm (figures 1a and 1b) and their forces were measured in a tensile testing machine (dl1000; emic ltda ., so jos dos pinhais, pr, brazil) at a crosshead speed of 150 mm / min . B) elastic stretched at 26 mm next, the samples were randomly divided into six groups . The test of variance homogeneity was applied to verify the baseline forces, showing statistically similar mean values of initial forces (p>0.05) among the groups . After the baseline readings, the elastics were immersed in a glass flask (15x9x14 cm) containing 300 ml of the tested beverages, according to the experimental groups . Immersion period was 15 min for the first (t1) and second (t2) cycles and 30 min for third to fifth (t3, t4, t5) cycles . At every immersion cycle, the beverages were changed (figure 2) and the elastics were washed in distilled water and immersed into 300 ml of artificial saliva for 3 min . Next, the elastics were again washed in distilled water and removed from the resin board to perform a new tensile strength test . Sequence of the experimental groups data were analyzed by one - way repeated measures anova to compare the effects of intervals, beverages and the interaction between them . Figure 3 shows the homogenous distribution of the sample at t0, where the groups presented statistically similar mean values of initial force (p>0.05). Since the mean force values of each group were statistically similar, it may be affirmed that the alterations were due to the tested treatments and not to the differences in each group behavior . Homogeneous distribution of samples at t0 figure 4 exhibits the mean force values produced by the intermaxillary elastics regardless of their groups . Notice that in the first moments (from t0 to t1), there was a greater reduction of the generated forces (p<0.05), followed by a decrease of degradation rate in the following periods . Mean force values of the intermaxillary elastics regardless of the group this same behavior pattern was seen in the tensile strength forces produced by each group at all observation periods (figure 5). Figure 5 reveals that the different groups behaved similarly at each study period (t1, t2, t3, t4 and t5) (p>0.05). This study evaluated in vitro the effects of frequently ingested beverages on the force degradation of intermaxillary elastics . The force degradation of intermaxillary elastics, measured by tensile strength test, was observed at all periods, regardless of the group (figure 4). The greatest degree of force degradation occurred at the initial periods (from t0 to t1) and a gradual reduction of this degradation occurred at the following periods, showing a tendency to reduction over time . This was confirmed by the statistically significant difference existing between t0 and t1, t1 and t2, t2 and t4, t3 and t5 (p<0.05). The mechanical behavior of intermaxillary elastics in the present study was similar to the findings of previous studies in which a greater degradation in the elastic forces at the initial periods of assessment was detected . (2011) found a different behavior of the degradation of elastic forces: after a first phase of greater force degradation, there was a second stage where the elastics partially recovered the force (negative degradation), followed by a third stage in which slow and gradual force degradation occurred . Due to this behavior, andreassen and bishara (1970) suggested the use of a force magnitude four times greater than the intended magnitude for a determined case . Consequently, when the elastics lose 40% of their initial force, levels close to those required would still be present for longer periods . Notwithstanding, such procedure should be carefully analyzed because of the risks of damaging the tooth and periodontal tissues by excessively strong forces . Additionally, the findings of an in vivo study suggested that elastics should be changed daily because the oral activity dynamics would increase the fatigue and deformation of material, enhancing the risk of their fracture and failure . Some in vitro studies have been conducted using a dynamic experimental model in which mouth opening and closing movements are simulated, stretching the intermaxillary elastics . For the present study, a static experimental model was chosen based on the results of previous investigations, which demonstrated that the cyclic elastic stretching only enhances force degradation in the first hour of the experiment; after this period, the degradation rate returns to its pattern and, by the end of the study, cyclic stretching or not exerts no statistically significant influence on the elastics . Liu, et al . (1993) showed that after 200 stretching cycles there was no significant force degradation of intermaxillary elastics . The results of this research indicate that the contact of dietary beverages with intermaxillary elastics is not able to influence the degradation degree of their forces (figure 5). The elastics presented the same behavior when immersed in either artificial saliva or test beverages at all observational periods . The lack of influence of dietary components on the degradation of intermaxillary forces has also been observed in a laboratory study . Other studies have demonstrated that the ph of the medium in which the intermaxillary elastics are immersed did not influence significantly force decrease of the elastics . Based on this evidence, the beverages used in the present study were not subjected to any ph analysis . The mechanical behavior of the intermaxillary elastics in the present study can be explained by the " swelling phenomenon " . The chemically cross - linked points among the molecular chains enable the absorption of liquid into the latex three - dimensional reticulate structure . The rubber's free energy decreases with the simultaneous effect of mixing entropy . At the same time, the molecular chains are elongated followed by the decrease of elasticity of the rubber . Although this study showed solid evidences, the obtained results should be carefully examined because no in vitro study is capable of simulating all factors acting on intermaxillary elastics in the oral environment . Notwithstanding, our findings contribute to improve the knowledge of the mechanical behavior of the intermaxillary elastics employed in orthodontics, enabling greater predictability in the application of mechanotherapy involving latex elastics . The results also have clinical applications since no restrictions were found to the consumption of the studied beverages in relation to the use of the tested intermaxillary elastics, bringing comfort and freedom for patients choosing their own diet during the orthodontic treatment . The chemical nature of the evaluated beverages was not able of influencing the degree of degradation of intermaxillary elastics' forces.
The porcelain fused to metal technique has been known as a reliable choice of treatment for fixed partial dentures (fpd) for almost four decades now, still representing the gold standard. [13] however, with the increasing interest in esthetic dentistry and the question of some dental metals and alloys being biocompatible or not, the development of other alternatives to metallic ceramic dental restorations has advanced . In the early 1990s, yttrium oxide partially stabilized tetragonal zirconia polycrystal (y - tzp) was introduced to dentistry as a core material for all - ceramic restorations and has been made available through the cad / cam technique . Y - tzp has proved to be superior in mechanical properties compared with other all - ceramic systems (flexural strength of 900 - 1200 mp a, and fracture toughness of 9 - 10 mp a.m1/2) due to a transformation toughening mechanism . Long - term clinical results for zirconia all - ceramic restorations are not available at the present time . In short and medium - term studies[911] there have been no fractures of the zirconia framework reported to date. [1012] however, delamination or minor chip - off fracture of veneering porcelain has been described as the most frequent reason for the failures of zirconia fpds . The incidence of veneer fractures in zirconia fpds was significantly higher compared with those in metal - ceramic fpds . Therefore, the bond between core and veneer or the veneer material itself is one of the weaknesses in layered zirconia - based restorations and plays a crucial role in their long - term success . Chip - off fracture rates of 15% after 24 months, 25% after 31 months, 15.2% after 60 months and 8% and 13% after 36 - 38 months, were observed respectively . A review of the literature for fpds with metal framework, however, revealed either no fracture of the veneering ceramic or substantially lower fracture rates ranging from 2.7 up to 5.5% for observation periods from 10 to 15 years . The cause of fracture of veneering ceramics on zirconia all - ceramic cores was reported to be multifactorial in clinical applications . Restoration geometry such as lack of proper veneering ceramic support, inadequate framework design and thickness of the ceramic layers seem to play a decisive role . Moreover, direction, magnitude and frequency of the applied load other than the size and location of occlusal contact areas can lead to failures of the veneering ceramic . Bond strength is determined by a series of factors including strength of the chemical bonds, mechanical interlocking, type and concentration of defects at the interface, wetting properties, and the degree of compressive stress in the veneering layer due to a difference in the coefficients of thermal expansion between zirconia and the veneering ceramic. [1820] since the mechanical integrity and adhesion of the veneering ceramic to the ceramic substructure have proven to be key factors for the successful performance of veneer / core bilayered restorations, the initial bond strength and their reliability after thermocycling obtained from in vitro investigations can provide useful information for the behavior and predictability of y - tzp all - ceramic systems in clinical application . The purpose of this study was to evaluate the shear bond strength (sbs) of two commercial zirconia core ceramics to their corresponding veneering ceramics and microscopic characteristics of bond failure at fracture surface . Two types of zirconia - based ceramics were selected for this experimental study: biodenta (biodenta swiss ag, bernek, switzerland) and cercon (degudent, hanau, germany). With each zirconia system, 10 disk - shaped specimens of 7-mm diameter and 3-mm height were fabricated . Then, they were cleaned, dried, and sintered according to the suggested firing schedules [table 1]. The bonding surfaces of zirconia core specimens were polished with diamond paste (lach diamant, hanau, germany) to obtain standardized surface roughness of 3 m . Then, airborne particle abrasion was applied on the bonding surfaces with 110-m aluminum oxide (al2o3) particles (hasenfratz, assling, germany) for 15 seconds at 3 bar pressure and at 10-mm distance from the surface . Finally, the specimens were ultrasonically cleaned in 96% isopropyl alcohol for 3 minutes and steam - cleaned for 15 seconds . The specimens of biodenta and cercon zirconia systems were veneered with their manufacturer - recommended veneering ceramics, 2 in 1 ceramic (biodenta swiss ag, bernek, switzerland) and cercon ceram (degudent, hanau, germany), respectively [table 2]. Using a specially designed, separable stainless steel mold, a prepared zirconia disk specimen was placed in the mold where clearance of 5-mm diameter and 3-mm height was available above the core material for condensing the veneer ceramic . First, two liner layers of porcelain were applied and fired independently, then the dentin porcelain was condensed using the vibration blotting technique, fired and finally a glaze firing was performed according to the manufacturer's instructions . By means of an autopolymerized acrylic resin (meliodent, heraeus kulzer gmbh, hanau, germany), each specimen was embedded at the center of a t - shaped metal holder, with the core - veneer interface positioned at the top level of the holder [figure 1]. Zirconia systems evaluated in this study and their firing schedules chemical composition and mechanical properties of the core and veneering materials (cte, coefficient of thermal expansion) according to the manufacturers information illustration of shear bond strength test setup and specimen preparation then, these metal holders were mounted in universal testing machine (type lfm - l, walter+bai ag, lhningen, switzerland). Specimens were tightened and stabilized to ensure that the 1-mm thick edge of the shearing device was in contact with the core surface and was positioned as close as possible to the veneer - core interface . Shear load was applied at a crosshead speed of 0.5 mm / min until fracture occurred . The ultimate load to failure the average sbs (mpa) was calculated by dividing the load (n) at which failure occurred by the bonding area (mm) as follows: shear stress (mpa) = load (n)/19.625 (mm); these data were used to calculate the mean failure load and standard deviation for each group . The fractured surfaces were visually analyzed with a stereomicroscope (mbx10, n9116734, st petersburg, russia) to determine the failure modes of specimens . Failure modes were classified as follows: cohesive fracture within the veneer, adhesive fracture between the core and veneer, or a combination of both . T - test was used to analyze the differences in sbs between zirconia ceramics and their veneering ceramics . An alpha - level of 0.05 was used for all statistical analyses, which were performed using statistical software (spss 15.0; spss, inc, chicago, il). Table 3 summarizes the mean values and standard deviations of sbs for the tested zirconia ceramics and veneering ceramics and presents the fracture analysis results in percentage . T - test revealed that there is no significant difference between two groups (p = 0.551). Upon examination under the stereomicroscope (36), the biodenta group exhibited mostly adhesive failures [figure 2]; whereas, the cercon group showed mixed cohesive / adhesive failures [figure 3]. Summary of shear bond strength values in mpa and failure modes in percentage (%) combined (adhesive and cohesive) failure bond strength measurement of metal ceramic systems was standardized by the international organization of standardization through the schwickerath crack initiation test (three point bending test) and the mean debonding strength / crack initiation strength should be greater than 25 mpa to meet the iso requirement. [2123] due to the brittleness of all - ceramic core materials this test setup cannot be applied to all - ceramic multilayered system . An adequate standardized test set - up and a minimum required bond strength for bi - layered all - ceramic materials has not been determine yet . Few articles have utilized various bond strength test methods for all - ceramic core and veneering ceramic, such as the sbs test,[2531] three and four point loading test, biaxial flexure strength test, and the microtensile bond strength test. [273335] however, each test has a common limitation which is the difficulty in determining the core - veneer bond strength from applied force at failure on the sample in the specific test setup . In this study, the sbs test method was selected because of its simplicity, such as the ease of specimen preparation, simple test protocol and the ability to rank different products according to bond strength values . But the sbs test has some disadvantages; such as high standard deviations, occurrence of nonuniform interfacial stresses, and the influence from specimen geometry . Therefore, the standardization of specimen preparation, cross - sectional surface area and rate of loading application are important for improving the clinical usefulness of sbs test . In metal - ceramic systems, excessive stresses arising from coefficient of thermal expansion (cte) mismatch may be compensated to some extent by plastic or elastic deformation of the metallic framework . However, unlike metals, the zirconia framework has a higher rigidity and this feature causes more destructive stress to be formed in the veneer layer of zirconia - based restorations . In some studies, the sbs between metal alloys and porcelain has been found to range from 26.4 to 96.80 mpa . For core - veneered all - ceramic restorations, previous investigations indicated that the core - veneer bond strength ranged from 9.4 mpa to 42 mpa. [25262831333540] mean sbs values obtained in the present study were 27.19 and 28.22 for cercon and biodenta groups, respectively, confirming the findings of previous studies . Mean sbs value of cercon zirconia to cercon ceram has been reported to be 20.19 mpa by ozkurt et al ., 25.43 mpa by choi et al . And 9.4 mpa by guess et al . In our study this value was higher than the previous studies . In a study by aboushelib et al ., cercon ceram express (press - on veneering ceramic) exhibited a bond strength value of 37.9 mpa with the cercon framework, which was higher than the 27.19 mpa obtained in this study and the values of sbs in previous studies for cercon ceram (layering veneer ceramic). Maybe, a key reason for this difference in bond strength lays in the use of press - on veneering ceramic versus the layering veneer ceramic . We could not find any studies evaluating the mechanical properties of biodenta zirconia system . In the present study, specimens of biodenta group revealed predominantly adhesive failure between the zirconia cores and their veneering ceramics, but in cercon group, the most failure pattern was combined . Adhesive failure does not occur in the presence of a good bond between compatible ceramic core and veneering materials, so it seems that the cohesive strength of biodenta ceramics was higher than the bond strength between biodenta zirconia and the veneering ceramic . In cercon group some studies showed that the bond strength of veneering ceramics to zirconia core seems to be higher than the sbs of the ceramic itself . In sbs tests with zirconia / veneering ceramic composites, adhesive failures were the least failure modes seen in these studies, whereas others claimed that the sbs of veneering ceramics were higher than sbs between core and veneering ceramics and the failure mode observed was mainly combined as adhesive at the interface and cohesive in the veneering ceramic . Ozkurt et al . Showed 80% adhesive and 20% combined failure modes for cercon zirconia ceramics in their study, and guess et al . Showed that the intrinsic sbs of cercon ceram s (33.6 mpa) was significantly higher than the sbs between cercon zirconia core and its corresponding ceramic (9.4 mpa) which was not consistent with the findings of our study . We could not find any studies about biodenta zirconia system . In order to compare the strength of the adherence zone and the mechanical properties of the veneering ceramic, determination of the intrinsic sbs of the veneering ceramic all the test specimens were stored in distilled water at 37c for one week before testing and thermal cycling was also performed for each specimen, which is important in the simulation of clinical conditions, but some critical aspects must be taken into account when using an in vitro method to estimate the clinical performance of materials . First, in - vitro information cannot be used as a direct, straightforward prediction for the clinical situation . The specimens investigated do not represent clinical shape conditions of dental restorations, but provide a geometry that permits sbs measurement . Within the limitations of the current study it can be concluded that (1) sbs of veneering porcelain to zirconia core for both cercon and biodenta systems did not show significant difference and (2) failure mode for biodenta system was mostly adhesive while it was mostly combined (adhesive and cohesive) for cercon system.
Human beings always encounter different kinds of problems and they try hard to solve them . Obviously, even the contemporary people face their own problems, but in the last two decades, such problems were focused more . One of these is leisure time and its spending, which is a serious and effective issue in different aspects of human community, considering the social changes and the progress of science and technology . Leisure time means entertainment, hobby, and every activity that is done after daily works . Absolutely, its main achievements include refreshment, entertainment, recreation, and the growth of personality . Finix believes that entertainment and leisure time refers to people's free time during which they can rest and relax . Leisure time refers to the special part of time in which people are not forced to work or earn money and also they have special voluntary programs to have fun and enjoy themselves . In line with romney, bracho, caldo, green, and recreation, carlson et al . Added that recreation also refers to every voluntary experience in leisure time by which people are expected to be satisfied and pleased . On the other hand, social capital is an interdisciplinary concept which first entered sociology, then economics, literature, and at last management; then, social capital role and effect was emphasized in different institutes . It is possible to say that social capital is a result of the relationship which is based on understanding and trust between the manager and employees of an organization . This relationship refers to those which are formed in the nature of social relationship of an organization and they satisfy the social life in the organizations . According to puntam (2000), the definition of social capital is: a set of sources which form through the interpersonal relationship, social networks, mutual norms and trust . Social capital talks about social organ or organization characteristics like trust, norms and networks which make possible those activities which need social capital and the people . Undoubtedly, the social capital of a community is composed of the social capital of different small groups . With regard to the level of knowledge, the attitude, and investment, it is expected that different people with different occupations would have different levels of social variables . Researches prove that sports are necessary for the improvement of a society, especially as a leisure activity which plays an integral role in the production and increase of social capital . The belief and behavior of teachers or university professors has a great effect on youth . This fact shows that mind training among these people is more important and sensitive than other jobs . As a result, the quality and the characteristics of leisure time and also the nature of its activities depend on the level of people's knowledge, awareness, attitude, and dominant values of different groups of the society . Therefore, the way of spending leisure time in different groups of the society under the effect of social capital is different, which consequently has different social and cultural outcomes . Another issue to be considered is that because of the intergenerational relationship in multitudinous leisure time, people would have social capital . Hemingway believes that multitudinous leisure time and obtaining substantial benefit of it, when people with different ages are included, is a method which boosts the intergenerational relationship in a broad and limited form . Ghafari (2010) conducted a survey entitled interaction between social capital and young people leisure time . The results showed that participating in group activities of leisure time like sports and physical activities plays a crucial role in the promotion and development of social capital level . Sharepoor and hosseini rad (2009) proved that there is a positive correlation between friendly relationship and participation in sport activities . Also, parsamehr and jesmani's (2011) research entitled the role of social capital on sport consumption in addition, they proved that people with higher educational and social position have fewer tendencies toward sports . Much lengthy and comprehensive research has been conducted by non - iranian researchers around the world about social capital and leisure time . Ward and tampubolon (2011), in an article entitled social capital, networks and leisure consumption, believed that social capital is gained as a result of friendship and sports and recreation activities . (2010) conducted a study entitled sport, trust and social capital, with emphasis on the trust variable which is an important part of social capital . They reported that the effect of playing sport on trust and social capital is different in different countries, which may be due to the differences between sports in different countries . In some countries sports act as an instrument to spread and develop the social capital . Collin et al . (2011), in an article entitled sport, leisure, culture and social capital, believed that sports and cultural and artistic activities are important ways to involve people in an effective decision making about society . Obviously, presence of people in the community and their cooperation and collaboration cause the formation of networks . Lindstrom (2011), in a study entitled social capital, tendency to the increase of physical activities in the leisure time, observed that there is a positive and significant relationship between lower level of trust in social capital and the absence of physical activities in leisure time . Legh - jones and moor (2007), in an article entitled network social capital, social participation, and physical inactivity in an urban adult population, believed that those people who do not participate in any formal company and also do not have any physical activities would enjoy more social capital, in comparison with those who participate in formal companies and have physical activities . By analyzing the relationship between social capital and the way of spending physical leisure time among the faculty members of the university of medical sciences, this survey aims to identify unknown aspects of the effective parameters on the social capital of the faculty members . The main hypothesis is that there is a significant relationship between social capital parameters and the way of spending leisure time . This was a descriptive correlational study which was conducted on 680 faculty members of isfahan university of medical sciences in 2012 . After conducting a primary study and calculating the estimated variance by using cochran's formula, the sample size was determined to be 150 people . They were selected by stratified random sampling based on their sex, in proportion with the number of members of each college . For example, medical science college with 388 members comprised 58% and rehabilitation college with 30 faculty members comprised 4.5% of the sample size . In order to assess social capital, this is a 47-item questionnaire which scored on a 5-point likert scale (from strongly disagree to strongly agree), including seven factors (trust, mutual relationship, commitment, participation, attitude, social norms, and unity). The maximum score earned by a subject can be 235 and the minimum can be 47 . Questionnaire designed by the researcher on leisure time, which included 29 items in the frame of 20 closed questions scored by a 5-point likert scale and 9 open questions related to the quality of spending leisure time . In this part, the maximum score earned by a subject can be 190 and the minimum score can be 38 . In the meantime, because the measurement scale was 5, the average and cut - off point were considered as 3 . In order to assess the questionnaire's face validity and content validity, academic scholars confirmed the social capital and leisure time questionnaire . In addition, a pilot study had been done on 30 faculty members of isfahan university of medical sciences to measure the reliability of questionnaire . The results gave 92% and 82% for social capital and leisure time, respectively, on using cronbach's coefficient alpha . Descriptive and inferential statistical methods were used for data analysis . Mean and standard deviation were used for the descriptive data analysis . Furthermore, kolmogorov smirnov test, normality test, and multiple regressions were used for the inferential analysis of findings . The result in the level of (0/05) was analyzed by the 17 edition of spss software . Statistical results showed that a sample of 120 participants included 81 men (67.5%) and 29 women (32.5%). The faculty members with assistant professor degree formed the largest number of the sample population (38.3%), which was followed by associate professors (29.9%) and instructors (17.5%), and full professors were the least in number (14.2%). Fifty - nine people (about 50%) of the sample population were from the medical college . The rest belonged to dentistry, nursing, rehabilitation, pharmacy, and sanitary college . Also, 61% of the sample populations were clinical specialists and 39% were science specialists . Findings showed that with regard to the mean of social capital scores which are = 0.541 and ` mean = 3.82 and the mean of leisure time scores which are = 0.406 and mean = 3.48, it is possible to say that organizational social capital of isfahan university of medical sciences and also people's physical leisure time is more than the normal level . As it is shown in table 1, considering the social capital result scores which are z = 0.832 and p 0.05 and leisure time result scores which are z = 1.06 and p 0.05, because p is more than the error (= 0.05), the data normality based on null assumption will not be rejected . So, it is possible to say that score distribution and social capital and leisure time data, with the probability of 95%, are normal . In addition using parametric tests will be possible too . Normality test for data distribution r = 0.659, r2 = 0.435, = 0.399 as it is shown in table 2, the coefficient of multiple correlations for the combination of social capital and physical leisure time factors is 0.659 and the coefficient of determination is 0.435 . It shows that 43.5% of the variance of physical leisure time score by a combination of social capital factors can be defined and described . The value of f with degrees of freedom 7 and 112 shows that the results of coefficient correlations and coefficient of determination are not significant statistically; therefore, the results of statistical population are generalizable . The explanation of physical leisure time based on social capital parameters (analysis of variance (anova)) as it is considerable in table 3, it is observed that just the beta factors of commitment and the beta factors of social norms are 0.293 and 0.196, respectively, in which t at least is in the level of (= 0.05) and is significant, but the other social capital factors are not significant statistically . As a result, the equation of foreseeing physical leisure time is as follows: y = 0.293 1 + 0.196 2 . Separated correlation coefficient of social capital parameters statistical analysis shows that sport and physical activities in leisure time among the faculty members of isfahan university of medical sciences are more than the average level, which cannot guarantee physical and mental health in an ideal situation . The organization's executives can provide proper situations to enhance the level of physical leisure time by analyzing the effective factors on physical activities in the leisure time of organization members . Different researches have shown that sport and physical activities have direct relationship with the decrease of stress, depression, anxiety, and also the increase of mental health and feeling revitalized . Sport and physical education's social functions play a crucial role in developing the social relationships; obviously, it has a great effect on the society's structure and the relationship between different social groups . By considering the social capital mean score of faculty members is more than the average level, so it is concluded that isfahan university of medical sciences does not have enough social capital . It is recommended that managers think about effective activities for making the social capital better . It is possible that the available social capital including relationships, norms, and trust in a particular environment can be copied into another social environment . Suitable social organizations can provide a potential network for people to give them some sources like knowledge and information . This exchange can be done well by the cognitive and relational dimension of social capital . The results of statistical analysis show that there is a significant relationship between social capital, sport, and physical activities on people's leisure time . By considering social capital and physical leisure time, it is inferred that the presence and the absence of each of them, either at an individual level or in a social level, has a great effect on the growth and development of the people and society . Therefore, it is possible to say that social capital is a manageable phenomenon; it means that we can help forming the process . In fact, this matter can be right if high - positioned managers and policymakers of organizations would have correct information about the current situation's social capital . Considering the importance of this matter, if managers would get familiar with different levels of this concept, they can decrease the costs by putting out this social capital, and then can have big processing and structure changes in the organization in the next step . Also, leisure time and physical activities as one of the most important social capital products in organizational and individual level could be a trustful way to enhance the level of social capital for the managers and organization managers . Overall, considering the findings of this study, it is observed that the results are in line with the results of ghafari, parsamehr and jemani, ball et al s, hezar jiribi and mardookhi, lindstrom et al ., mummery et al ., and ball et al . Ghafari, in his research entitled the interaction between social capital and leisure time, observed the same results . In addition, this survey's results are in line with the results of hezar jiribi and mardookhi's study, which was about social welfare include leisure time . Parsamehr and jesmani's research entitled the effect of social capital on consumption showed that people with higher economic and social level have lesser tendency to do sports activities, which is in line with the result of this survey . This fact is true as reported in lindstrom et al. 'sstudy entitled social capital and physical leisure time . They showed that there is a positive and significant relationship between social capital and physical leisure time . However, the results showed that there is a direct relationship between these two factors, but seippel pointed out that trust forms in social capital by participating in group activities and doing sport activities . To some extent, the result of mummery et al s study is in line with that of the present study . They reported that some social capital factors like social participation, social norms, commitment, and trust have significant relationship with physical activities in leisure time . Also, ball et al s study entitled social capital, crime, and physical activities in leisure time proved that sport can enhance the social capital level and improve social norms among women, in particular . Doing sport and physical activities in leisure time and participating in group activities and having membership provide a situation for individuals to respect group interests by having relationship with the other group members . Such activities cause the increase of social capital and its factors such as trust, social norms, mutual relationship, commitment, involvement, and participation . Those organizations which are about to find a solution to make their members social capital better and consequently have an increase in the organizational social capital level can achieve this important target by focusing on sport, just like many other countries and famous organizations in the world . Reaching this important target can be possible just through exact programming and providing proper situation for people to participate in sport activities in their leisure time . Findings of this study show that the level of organizational social capital of isfahan university of medical sciences is less than the mean, which is not satisfying . Managers of organizations can compensate this gap by conducting training workshops and holding special related coursesfindings show that the level of physical leisure time of organizational individuals is less than the mean . Managers can provide perfect conditions and facilities for individuals to participate in sports activities in leisure time by analyzing and determining the effects of relevant factors on the level of physical activities in the leisure time of the individualsconsidering the results of this study and those of similar studies, it is inferred that physical social capital is one of the most suitable methods to increase and even produce social capital and productivity . Managers of the organizations can achieve the aim by having a particular viewpoint about the physical activities and physical leisure time and also by planning applicable and practical programs . Findings of this study show that the level of organizational social capital of isfahan university of medical sciences is less than the mean, which is not satisfying . Managers of organizations can compensate this gap by conducting training workshops and holding special related courses findings show that the level of physical leisure time of organizational individuals is less than the mean . Managers can provide perfect conditions and facilities for individuals to participate in sports activities in leisure time by analyzing and determining the effects of relevant factors on the level of physical activities in the leisure time of the individuals considering the results of this study and those of similar studies, it is inferred that physical social capital is one of the most suitable methods to increase and even produce social capital and productivity . Managers of the organizations can achieve the aim by having a particular viewpoint about the physical activities and physical leisure time and also by planning applicable and practical programs . Findings of this study show that the level of organizational social capital of isfahan university of medical sciences is less than the mean, which is not satisfying . Managers of organizations can compensate this gap by conducting training workshops and holding special related coursesfindings show that the level of physical leisure time of organizational individuals is less than the mean . Managers can provide perfect conditions and facilities for individuals to participate in sports activities in leisure time by analyzing and determining the effects of relevant factors on the level of physical activities in the leisure time of the individualsconsidering the results of this study and those of similar studies, it is inferred that physical social capital is one of the most suitable methods to increase and even produce social capital and productivity . Managers of the organizations can achieve the aim by having a particular viewpoint about the physical activities and physical leisure time and also by planning applicable and practical programs . Findings of this study show that the level of organizational social capital of isfahan university of medical sciences is less than the mean, which is not satisfying . Managers of organizations can compensate this gap by conducting training workshops and holding special related courses findings show that the level of physical leisure time of organizational individuals is less than the mean . Managers can provide perfect conditions and facilities for individuals to participate in sports activities in leisure time by analyzing and determining the effects of relevant factors on the level of physical activities in the leisure time of the individuals considering the results of this study and those of similar studies, it is inferred that physical social capital is one of the most suitable methods to increase and even produce social capital and productivity . Managers of the organizations can achieve the aim by having a particular viewpoint about the physical activities and physical leisure time and also by planning applicable and practical programs.
Gram - positive cocci are impor tant pathogens which can specially cause soft tissue and skin infection (1). S. aureus and coagulase - negative staphylococci (cons) are recognized as common microorganisms leading to nosocomial or community acquired infection all over the world (2, 3). Increased incidence of methicillin resistance among staphylococci is a growing problem (1) and they are commonly reported as multi - drug resistant (mdr) microorganisms (1, 2, 4). This fact has changed the trends in the usage of macrolide, lincosamide and streptogramin b (mlsb) antibiotics in the treatment of staphylococcal infections (3, 5). The mlsb antibiotics are a family, reserved as alternatives in the treatment of resistant gram positive cocci (staphylococci and streptococci) (1). Although they are structurally different, their mode of action is similar (1, 4). These antibiotic share common binding sites thus called mlsb phenotype (2). Clindamycin has been considered as the preferred agent due to its excellent pharmacokinetic properties (1, 2, 4, 5) including good penetration and distribution in to the skin and other soft tissue structures (6) and acceptable oral absorption with no dosage adjustment in renal disorders (1). However regarding wide spread use of this antibiotic, increasing number of resistant isolates are being developed (1, 7). Firstly, it can be mediated by msr(a) gene encoding efflux pump and secondly by a variety of erm genes coding enzymes that confer inducible or constitutive resistance to mlsb agents (through methylation of the 23sr rna) (1, 3, 4). Constitutive resistance can normally be detected by routine standard susceptibility testing whereas strains that demonstrate inducible resistance cannot be recognized by routine broth or agar based susceptibility tests (1, 3, 8). In such cases treatment with clindamycin may lead to clinical failure by developing constitutive resistant microorganisms (1, 5, 9). The presence of inducible clindamycin resistance can appropriately be recognized with d - zone test (9). This study was designed to determine the frequency of inducible clindamycin resistance among staphylococci and -hemolytic streptococci in our hospital, as a tertiary center, to highlight the necessity of performing d - test in routine practice in order to avoid reporting false susceptible results . Also, we aimed to evaluate any possible correlation between the frequency of inducible clindamycin resistance and susceptibility pattern to methicillin in staphylococci . Total number of 487 consecutive non duplicate isolates of staphylococci and -hemolytic streptococci group b and spp . Were recovered from various clinical specimens during march to september 2014 at microbiology laboratory of shariati hospital, tehran, iran . During this period, 172, 277, 23 and 15 isolates of s. aureus, coagulase - negative staphylococci and -hemolytic group b streptococci and spp . Were identified, respectively . Identification was done based on colony morphology on 5% blood agar, gram staining and further conventional biochemical tests (10). Staphylococci and -hemolytic streptococci isolates were evaluated for the pattern of erythromycin susceptibility using kirby - bauer disk diffusion method on muller hinton agar with or without blood supplement . All erythromycin resistant and clindamycin sensitive isolates were subjected to d - zone test using erythromycin (15 g; rosco diagnostica, denmark) and clindamycin (2 g; rosco diagnostica, denmark) according to clinical and laboratory standards institute (clsi) (11). Briefly, erythromycin disks were placed at a distance of 15 mm and 12 mm (edge to edge) from clindamycin disk (for staphylococci and streptococci, respectively) on plates inoculated with the bacterial suspension with adjusted turbidity to mcfarland standard 0.5 followed by overnight incubation at 37 c . The results were interpreted as follows (1); ms phenotype, sensitive to clindamycin with circular zone of inhibition around the disk; imlsb (inducible resistance) phenotype, sensitive to clindamycin with a d - shaped zone of inhibition around clindamycin disk; cmlsb (constitutive resistance) phenotype, resistant to clindamycin with a circular shape of inhibition . Resistance to methicillin in staphylococci was detected by disk diffusion method using cefoxitin disk (30 g; rosco diagnostica, denmark) according to clsi (11). Complementary quality control for d - test also was done with selected in - house strain that was d - test positive . Comparison of non - parametric quantitative variables was performed by mann - whitney u test while chi - square and fisher s exact test was utilized for analyzing qualitative data . Total number of 487 consecutive non duplicate isolates of staphylococci and -hemolytic streptococci group b and spp . Were recovered from various clinical specimens during march to september 2014 at microbiology laboratory of shariati hospital, tehran, iran . During this period, 172, 277, 23 and 15 isolates of s. aureus, coagulase - negative staphylococci and -hemolytic group b streptococci and spp . Were identified, respectively . Identification was done based on colony morphology on 5% blood agar, gram staining and further conventional biochemical tests (10). Staphylococci and -hemolytic streptococci isolates were evaluated for the pattern of erythromycin susceptibility using kirby - bauer disk diffusion method on muller hinton agar with or without blood supplement . All erythromycin resistant and clindamycin sensitive isolates were subjected to d - zone test using erythromycin (15 g; rosco diagnostica, denmark) and clindamycin (2 g; rosco diagnostica, denmark) according to clinical and laboratory standards institute (clsi) (11). Briefly, erythromycin disks were placed at a distance of 15 mm and 12 mm (edge to edge) from clindamycin disk (for staphylococci and streptococci, respectively) on plates inoculated with the bacterial suspension with adjusted turbidity to mcfarland standard 0.5 followed by overnight incubation at 37 c . The results were interpreted as follows (1); ms phenotype, sensitive to clindamycin with circular zone of inhibition around the disk; imlsb (inducible resistance) phenotype, sensitive to clindamycin with a d - shaped zone of inhibition around clindamycin disk; cmlsb (constitutive resistance) phenotype, resistant to clindamycin with a circular shape of inhibition . Resistance to methicillin in staphylococci was detected by disk diffusion method using cefoxitin disk (30 g; rosco diagnostica, denmark) according to clsi (11). Complementary quality control for d - test also was done with selected in - house strain that was d - test positive . Comparison of non - parametric quantitative variables was performed by mann - whitney u test while chi - square and fisher s exact test was utilized for analyzing qualitative data . Total number of 487 microorganisms from different clinical samples was subjected to the study including 172 (35.3%) s. aureus, 277 (56.9%) coagulase - negative staphylococcus isolates, 23 (4.7%) streptococcus group b and 15 (3.1%) streptococcus spp . Eighty six out of 172 (50%) s. aureus isolates and 174/277 (62.8%) con staphylococci were categorized as methicillin - resistant . Erythromycin resistance was detected in 100/172 (58.1%) of s. aureus isolates and 214/277 (77.25%) con staphylococci . The frequency of susceptibility pattern to erythromycin as well as different patterns of susceptibility to clindamycin in both s. aureus and con staphylococci are summarized in table 1 . We did not observe any significant difference between inducible clindamycin resistance and methicillin susceptibility pattern . Frequency of different patterns of susceptibility to erythromycin and clindamycin in staphylococcus isolates frequency of inducible clindamycin resistance in staphylococci regarding to methicillin susceptibility methicillin - resistant s. aureus methicillin - susceptible s. aureus methicillin - resistant con staphylococci methicillin - susceptible con staphylococci we also performed d - test in -hemolytic streptococci (group b and other streptococcus spp . ). Frequency of susceptibility patterns towards erythromycin and clindamycin in streptococci we also determined the frequency of inducible clindamycin resistance in different hospital wards and clinical samples . Medical wards were categorized as emergency (general, oncology, obstetrics), internal medicine (nephrology, respiratory, general, renal transplant, endocrinology, gastrointestinal, heart and ccu), surgical wards (general, orthopedics, urology, neurosurgery, gynecology, head and neck), intensive care units (general, nicu, neurosurgery) and hematology / oncology / bone marrow transplant . Data are summarized in tables 4 and 5, respectively . Considering the number of submitted samples, the most frequent inducible resistant microorganisms were retrieved from internal medicine wards . In regard to the number of samples frequency of inducible clindamycin resistance regarding to different hospital wards frequency of inducible clindamycin resistance regarding to different clinical specimens accurate designation of antimicrobial susceptibility pattern of the infecting microorganisms is an important crucial factor in making appropriate therapeutic decisions (2, 12). Regarding the emergence of resistance in gram positive cocci, especially staphylococci, various antibiotics have been considered as alternative therapeutic options . The macrolide, lincosamide and streptogramin b (mlsb) family including clindamycin as one of the best preferred agents serves as one of these alternatives (2). Clindamycin has good oral bio - availability and is helpful for outpatient therapy or as oral agent can be followed after intravenous therapy (2). Clindamycin also has good penetration into skin or soft tissues or may be able to inhibit production of some toxins or virulence factors by staphylococci and is cost effective as well (46, 13). The widespread use of this family of antibiotics has led to the development of resistant strains (7, 14). The common mechanism of resistance is via erm gene encoding for enzymes confer constitutive or inducible resistance to mls b family (7, 1517). Routine in vitro susceptibility tests may fail to detect inducible resistance to clindamycin when erythromycin and clindamycin disks are not placed adjacent to each other thus false susceptible report may result in treatment failures (2, 4, 7, 12). The prevalence of inducible mlsb resistance varies in different geographic locations and is believed that depends on patient population, hospital characteristics and geographic area (3). According to our findings, the frequency of erythromycin resistance was 69.93% among staphylococci (58.1% in s. aureus isolates and 77.25% in con staphylococci) which is higher than the prevalence rates reported by others (1, 4, 5, 18). Our data revealed the similar incidence rate of inducible clindamycin resistance among methicillin resistant staphylococcus aureus (mrsa) and methicillin sensitive staphylococcus aureus (mssa) isolates (7/86 and 6/86 strains, respectively). Although this finding is the same as published reports in other parts of the world (4, 19) but higher rate of inducible resistance among mrsa have also been reported (1, 5, 18, 20, 21) and even controversial results have been observed (3, 22, 23). Among coagulase negative staphylococci, 28/214 (13%) of erythromycin resistant isolates showed inducible clindamycin resistance phenotype which is close to the 17% incidence rate reported by others (1). The frequency of methicillin resistance in our study was 50% and 62.8% in staphylococcus aureus and con staphylococci, respectively . In a study by dibah et al . (24) the frequency of mrsa isolates in ardabil (north west of iran) was 46.3% and most of the specimens were isolated from icu . In another national study by pourmand (25) the frequency of mrsa was 50% using both cefoxitin disk diffusion method and pcr assay . Both of these studies approximately supported our findings . In another study conducted in a burn center in ahvaz, higher frequency of methicillin resistance in staphylococcus aureus isolates was reported (60%) while the rate of methicillin resistance among con staphylococcus strains was 63% (26) which was quite similar to the present study . For streptococcous agalactiae, the frequency of resistance towards erythromycin was about 34.78% which is near to the 40% frequency rate reported by hraoui et al . The rate of inducible and constitutive clindamycin resistance among erythromycin resistant microorganisms was 17.40 and 8.69%, respectively while hraoui et al . The emergence of antibiotic resistance, especially methicillin resistance in gram positive cocci, considers clindamycin as an acceptable alternative treatment option . According to our findings, considerable number of bacterial isolates in our center showed imbl pattern . Because this type of resistance cannot be recognized in routine tests, clsi recommends d - zone testing as a simple test which should be performed to avoid false susceptible results leading to treatment failure.
A 26-year - old female was admitted to the neurology unit for fever, severe temporal, parietal and occipital headache, paresthesia of the hands and involuntary blinking of the left eye which had started 10 days before . A transient episode of aphasia she had undergone dental procedures some months before without any antibiotic prophylaxis . On physical examination a holosystolic murmur was heard . The erythrocyte sedimentation rate and the c - reactive protein were slightly increased while the white blood count was normal . A computed tomography scan detected two small areas of hyperintensity compatible with subarachnoid haemorrhage in the left parietal lobe; a smaller area with the same characteristics was detected in the right parietal lobe . Magnetic resonance imaging (mri) and angio - mri revealed an irregular, nodular image of 4 mm with high flow, in the left parietal lobe, interpreted as a vascular malformation; two smaller areas with similar characteristics were observed in the left and the right parietal lobe . Angiography revealed three small aneurysmal dilatations along the course of the left paracentral lobular artery, the left superior parietal artery and the left angular artery (figure 1). Aneurysms were interpreted as possible mycotic aneurysms and an echocardiography was requested because infective endocarditis was suspected . A trans - thoracic ecocardiography confirmed the mitral prolapse with moderate insufficiency and revealed thickened mitral lembs . A follow up transesophageal ecocardiography documented remarkable reduction of the thickness of the lembs of the mitral valve and an improvement of the mitral regurgitation . A follow up mri of the brain showed hemosiderin deposits as a result of bleeding . A follow up scintigraphy showed the resolution of the accumulation on the mitral valve and at brain level . According to the most recent guidelines of the american heart association, issued in 2007, antibiotic prophylaxis is no longer indicated in patients with mitral prolapse undergoing dental procedures, as it was in the previous edition . This decision has been criticized by some authors who reported cases of infective endocarditis occurring in patients with such a cardiac defect and undergoing dental procedures without any prophylaxis . Though infective endocarditis in these patients cannot be attributed to dental procedures for sure, we believe a more prudent approach should be considered . The diagnosis of endocarditis is based on the duke criteria . In our case, the following occurred: one major criteria (major echocardiographic findings) and four minor criteria (fever, embolism, predisposing heart condition and minor microbiological criteria). Positive leukocyte scintigraphy is not included in the duke criteria; however, in our case, it was consistent with the diagnosis of endocarditis with cerebral embolism . Some data suggests scintigraphy is of little value in the evaluation of patients with suspected endocarditis, since vegetations consist mainly of masses of fibrin, clotted platelets, blood cell debris, bacteria and only a few leukocytes . Other studies suggest a positive granulocyte scan correlates with high activity of the inflammatory process and predicts a poor prognosis for the patients concerned . Probably, more evidence is needed to define the role of scintigraphy in the diagnosis of infective endocarditis . Indications for therapy with daptomycin approved by the fda include staphylococcus aureus bloodstream infections including right - sided endocarditis and daptomycin is also considered as an alternative option for the empirical treatment of endocarditis on native valves and the treatment of endocarditis due to gram positive bacteria . Daptomycin is not generally recommended for infections of the central nervous system since there is no adequate evidence on its penetration in the cerebral parenchyma and the cerebrospinal fluid . However, in our case, we considered cerebral mycotic aneurysms as caused by the infection of the vascular side of the wall of the vessels . Our report suggests that daptomycin is safe and effective in case of left endocarditis with cerebral embolism.
Unenhanced computed tomography (low - dose ct) in risk groups for lung cancer, spiral ct demonstrated non - calcified nodules in up to 66% of asymptomatic smokers with no history of malignancy . The proportion of individuals with nodules was higher with thin slice thickness and use of multidetector ct [110]. The proportion of non - smokers or children with nodules is not precisely known but ct performed in these groups also frequently shows pulmonary nodules . Sensitivity for pulmonary nodules differs with different imaging modalities . Whereas the sensitivity of chest radiography is relatively low (solitary nodule rarely detected if <5 mm, 50% detected if 610 mm, may be missed even if as large as 35 mm) [1113], magnetic resonance imaging (mri) is more sensitive with sensitivities of> 50% for nodules computed tomography (ct), particularly spiral multidetector ct (mdct) is the method of choice for detection of pulmonary nodules . In a study using surgical exploration of deflated lungs as the gold standard, even single slice spiral ct had a sensitivity of 95% for nodules the good sensitivity is maintained with low radiation dose ct protocols [1820]. On the other hand, not every nodule exhibited by ct nodules may be missed due to errors of detection (e.g. Lack of concentration) and interpretation (e.g. Confusion between nodules and vascular cross - sections) [11, 13]. It has been demonstrated, that in small nodules (\documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $\le $\end{document} 10 mm) the sensitivity of individual readers is only 6070% depending on the nodule size, the expertise of the readers, the time allowed for the assessment, and viewing mode (monitor vs. film) [2123]. Furthermore, this proportion has not significantly improved with multidetector technology, thinner slices or monitor reporting the better spatial resolution may be compensated by the higher number of images . Recently, computer - assisted detection (cad) of pulmonary nodules has become available (fig . The technique is based on automatic identification of nodules as relatively round areas of increased density compared to surrounding lung with lower density . Adequate software algorithms allow differentiation between nodules and other areas of soft tissue attenuation with different shapes (vessels, mediastinum, chest wall). It has been shown that the application of these tools can increase the sensitivity of individual human readers for pulmonary nodules, particularly when small and central . This applies to readers with different degrees of experience but is most pronounced in relatively inexperienced readers . This is probably due to the fact that humans tend to detect and miss the same nodules whereas cad and humans detect and miss different nodules . At present, automated cad tools should only be used in conjunction with visual reading due to false positive and false negative results [2327]. Screenshot of a commercially available software tool for automated detection (lungvcar, ge healthcare, milwaukee, wi) providing: 3d - volume with red dot marking every detected nodule (top right), axial image (top left), thin - slab maximum intensity projection (ts - mip) (bottom left), targeted 3d - reconstruction of nodule and adjacent structures (mid right), simulated scout view (bottom right). Screenshot of a commercially available software tool for automated detection (lungvcar, ge healthcare, milwaukee, wi) providing: 3d - volume with red dot marking every detected nodule (top right), axial image (top left), thin - slab maximum intensity projection (ts - mip) (bottom left), targeted 3d - reconstruction of nodule and adjacent structures (mid right), simulated scout view (bottom right). More than a hundred different histological entities may present as pulmonary nodules, however, in clinical practice, the single most important issue is the classification into benign or malignant lesions . Malignant nodules usually require therapy such as resection, chemotherapy or radiation therapy, whereas benign nodules are usually not treated . Several features have been analysed in the hope of making this differentiation . In subjects with no history of previous malignancy only the person s age (<30 years), the presence of benign patterns of calcification (diffuse, peripheral, popcorn) and the presence of fat (hamartoma, lipoid pneumonia) allow reliable exclusion of malignancy . Other demographic (age> 40, 60 years, etc ., smoking habits) or morphologic (well - defined vs. ill - defined, smooth vs. lobulated contour, apical vs. basal or peripheral vs. central localisation etc . Nodule diameter, however, correlates with the likelihood of malignancy with a threshold of 10 mm detected empirically: 50% of nodules> 10 mm are malignant, whereas less than 5% of nodules \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $\le $\end{document} 10 mm are malignant . Several studies have shown that malignant nodules usually enlarge over time [4, 29, 30]. Typically, the nodule volume doubles within 30400 days, whereas the volume in benign nodules doubles faster (e.g. Inflammatory nodules) or slower (e.g. Hamartomas). There is, however, an overlap in volume doubling times of benign and malignant nodules . In addition, doubling of the volume represents an increase in diameter of only 26%, e.g. Growth from 4 to 5 mm, which may be difficult to detect visually . Again, computer - assisted diagnosis, namely volumetry can be applied to detect enlargement of nodules more precisely and, thus, earlier (fig . Figure 2computer - assisted volumetry of a pulmonary nodule in a patient with colorectal cancer . (a) thin - section ct: well - defined non - calcified pulmonary nodule in the posterobasal segment of the left lower lobe with a diameter of 9 mm; (b) computer - assisted volumetry of the nodule (lungvcar, ge healthcare, milwaukee, wi) demonstrating a nodule volume of 436 mm \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $^{\boldsymbol {3}}$\end{document}; (c) thin - section ct 6 months later: questionable growth of the nodule; (d) computer - assisted volumetry of the nodule demonstrating a nodule volume of 549 mm \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $^{\boldsymbol {3}}$\end{document} corresponding to an increase in volume of 26% . Computer - assisted volumetry of a pulmonary nodule in a patient with colorectal cancer . (a) thin - section ct: well - defined non - calcified pulmonary nodule in the posterobasal segment of the left lower lobe with a diameter of 9 mm; (b) computer - assisted volumetry of the nodule (lungvcar, ge healthcare, milwaukee, wi) demonstrating a nodule volume of 436 mm \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $^{\boldsymbol {3}}$\end{document}; (c) thin - section ct 6 months later: questionable growth of the nodule; (d) computer - assisted volumetry of the nodule demonstrating a nodule volume of 549 mm \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $^{\boldsymbol {3}}$\end{document} corresponding to an increase in volume of 26% . However, it has been shown that accuracy and particularly reproducibility of volumetric measurements differs between different scanning protocols, ct scanners, software tools and versions and also between different nodule types (well - defined vs. ill - defined, adjacent to chest wall, vessels or surrounded only by pulmonary parenchyma) [31, 34, 35]. Also, two functional imaging techniques have been introduced which are useful for classification of nodules . Contrast - enhanced ct (ce - ct) is applied to assess the perfusion of the lesions . Studies by swensen and co - authors have demonstrated that lack of enhancement has a high negative predictive value for malignancy . Positron emission tomography (pet) using [f]fluorodeoxyglucose (fdg) has a sensitivity and specificity of> 7080% for malignancy, although false positive (inflammatory lesions) and false negative (well - differentiated adenocarcinoma, carcinoid tumours, lesions <10 mm) findings have been reported . Unfortunately, these techniques are not appropriate for application in the huge numbers of small nodules due to the use of contrast media (ce - ct), cost, availability, radiation exposure and the limited use in nodules \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $\le $\end{document} 10 mm (pet). The definitive means to assess the nature of a nodule is histology obtained from bronchoscopic (in central lesions), percutaneous ct - guided (in peripheral lesions) biopsies or resection of the nodule at video - assisted thoracoscopic surgery (vats). Pulmonary nodules are common . They are mostly small (\documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $\le $\end{document} 10 mm) and benign, even in risk groups . Detection of nodules is limited at chest radiography, better at mri and best at ct, particularly with multidetector technology . Visual reading is limited even when reporting thin - slice mdct scans on a monitor . Nodules \documentclass[12pt]{minimal} \usepackage{wasysym} \usepackage[substack]{amsmath} \usepackage{amsfonts, amssymb, amsbsy} \usepackage[mathscr]{eucal} \usepackage{mathrsfs} \declarefontfamily{t1}{linotext} {} \declarefontshape{t1}{linotext}{m}{n}{<-> linotext} {} \declaresymbolfont{linotext}{t1}{linotext}{m}{n} \declaresymbolfontalphabet{\mathlinotext}{linotext} \begin{document} $\le $\end{document} 10 mm should be followed with unenhanced ct and computer - assisted volumetry applied if possible .> 10 mm a more invasive work - up is usually required, using ce - ct, pet or biopsy . Guidelines suggesting the diagnostic algorithm for nodules with different size classes have recently been published.
The british thoracic society have provided guidelines that detail a systematic approach to the investigation of unilateral pleural effusion . Our case highlights the potential for serious harm when pleural procedures are performed without bedside pleural ultrasound . Pulmonary tuberculosis (tb) is a leading cause of death worldwide, especially in developing countries . Diagnosis can be made from sputum for microscopy for acid - fast bacilli (afb) and tb culture . Pleural tb usually presents with symptoms such as pleuritic chest pain, cough, and fever and it is recommended that when pleural tb is suspected, patients should undergo thoracocentesis and a blind closed pleural biopsy (bcpb). In our institution, bcpb is not performed, which posed a dilemma since the patient was deemed too unwell for a thoracoscopy . Our patient was an 86-year - old man, never smoker, who presented to a regional hospital with a 4 weeks history of nonproductive cough, dyspnea, and left pleuritic chest pain . He had migrated to australia from korea 40 years ago, and his only significant medical illness was atrial fibrillation for which he was receiving oral digoxin 125 mcg daily . At the time of hospital presentation, blood tests demonstrated leukopenia 3.2 10 9/l and lymphopenia 0.76 10 9/l . C - reactive protein was 145 mg / l (normal <5 mg / l). However, the medical officer did not use image guidance and mistakenly attempted the thoracocentesis on the right hemithorax instead of the left side . Chest x - ray showing moderate amount of left sided pleural effusion in our institution, we performed a bedside pleural ultrasound - guided thoracocentesis . The pleural fluid analysis revealed the fluid to be an exudate (protein 54 g / l and lactate dehydrogenase 289 u / l). Since the cause of the effusion was unknown, 1 week later a 2 thoracocentesis was performed which was also nondiagnostic . The patient underwent a computed tomography (ct) chest which revealed a moderate amount of left - sided pleural effusion and an irregular left upper lobe linear nodular opacity [figure 2]. Our institution does not offer an induced sputum test, and consequently, the patient underwent a bronchoscopy, and bronchial lavage was performed on the left upper lobe . Computed tomography chest showing left sided pleural effusion and apical pulmonary nodular opacity clinically, the patient continued to deteriorate and was now bed bound . To obtain a pathological diagnosis, it was decided that a pleural biopsy must be performed as a next step investigation . Bcpb equipment was not available in our institution . Due to his poor performance status, furthermore, there was no discrete pleural tissue that could be biopsied using ct image guidance . Six weeks later the bronchial lavage culture grew mycobacterium tb, which was sensitive to first - line anti - tb agents . Hence, he was commenced on standard daily regimen antibiotic treatment consisting of isoniazid 300 mg daily, pyridoxine 25 mg daily rifampicin 600 mg daily, pyrazinamide 1500 mg daily, and ethambutol 800 mg daily were prescribed for 2 months followed by isoniazid and rifampicin for 4 months . Over the course of the 6 months, finally, 8 months after he initially presented to hospital, he was discharged from the respiratory clinic after completion of anti - tb treatment . We believe that this case report has highlighted three pertinent issues in the management of patients' with pleural effusion: wrong side thoracocentesis, lack of equipment to perform bcpb and induced sputum . It is estimated that approximately 178,000 thoracenteses are performed per year in the united states . Typically, thoracocentesis is a safe procedure but can result in significant complications including pneumothorax, hemorrhage, and death . Despite these efforts, wrong side thoracocentesis can still occur . They found that absence of verification images to be cause in almost 50% of cases . Consequently, there has been a trend to the widespread implementation of ultrasonography, training, and restriction of thoracentesis to experienced health care professionals . Another reason for the delay in diagnosis was the lack of availability of equipment to perform a bcpb in our institution . However, it has now been demonstrated that if the pleural biopsy is guided by an imaging technique (ultrasound or computed tomography), its yield is even better . The increasing availability of video - assisted thoracoscopy and the low prevalence of tb effusions in developed countries has led to the declining use and experience with bcpb . The third reason for delays in the diagnosis of tb was the lack of availability of induced sputum in our institution . A randomized study previously demonstrated that induced sputum has a greater diagnostic yield and is more cost - effective than bronchoalveolar lavage in detecting active pulmonary tb in patients who cannot produce spontaneous sputum . Induced sputum is performed with hypertonic saline solution delivered by nebulizer and samples can be obtained readily . This is in contrast to bronchoscopy, where immediate availability is not always possible due to staffing, bronchoscopy suite availability, and time constraints . This case highlights certain health care system deficiencies that resulted in delays and potential harm to our patient with pleural tb . Importantly, these deficiencies are readily amenable to correction, and our health care service is currently undertaking reform to rectify these errors.
The global labor force is about 2,600 million and 75% of this force is working in developing countries . The total labor force in india is estimated to be 317 million, in which the organized sector employs only 26.8 million (8.5%) while the unorganized sector employs as many as 290.2 million (91.5%). The indian industry remains labor - intensive and often employs relatively inexpensive and hazardous technology due to financial constraints . Occupational safety and health (osh), also commonly referred to as occupational health and safety (ohs) or workplace health and safety (whs), is an area concerned with the safety, health, and welfare of people engaged in work or employment . Joint international labour organization (ilo)/world health organization (who) committee on occupational health focuses on three different objectives: (i) the maintenance and promotion of workers health and working capacity, (ii) the improvement of the working environment and work to become conducive to safety and health, and (iii) development of work organizations and working cultures in a direction, which supports the health and safety at work and in doing so also promotes a positive social climate and smooth operation and may enhance productivity of the undertakings . The concept of a working culture is intended in this context to mean a reflection of the essential value systems adopted by the undertaking concerned . Such a culture is reflected in practice in the managerial systems, personnel policy, principles for participation, training policies, and quality management of the undertaking . The occupational health safety network (ohsn) is a secure electronic surveillance system developed by the national institute for occupational safety and health (niosh) to address health and safety risks among health care personnel . Ohsn uses existing data to characterize the risk of injury and illness among health care workers . Hospitals and other health care facilities can upload the occupational injury data they already collect to the secure database for analysis and benchmarking with other de - identified facilities . It is a study to evaluate the effectiveness of video - assisted teaching program on safety measures followed by the employees working in the silica - based industry in puducherry, india . To assess the level of knowledge, attitude, and practice of the subjects on safety measures against occupational hazard among employees working in the silica - based industryto evaluate the effectiveness of video - assisted teaching program on safety measures against occupational hazard among employees working in the silica - based industry . To assess the level of knowledge, attitude, and practice of the subjects on safety measures against occupational hazard among employees working in the silica - based industry to evaluate the effectiveness of video - assisted teaching program on safety measures against occupational hazard among employees working in the silica - based industry . To associate the pretest knowledge, attitude, and practice score with selected demographic variables of the employees working in the silica - based industry to assess the level of knowledge, attitude, and practice of the subjects on safety measures against occupational hazard among employees working in the silica - based industryto evaluate the effectiveness of video - assisted teaching program on safety measures against occupational hazard among employees working in the silica - based industry . To assess the level of knowledge, attitude, and practice of the subjects on safety measures against occupational hazard among employees working in the silica - based industry to evaluate the effectiveness of video - assisted teaching program on safety measures against occupational hazard among employees working in the silica - based industry . To associate the pretest knowledge, attitude, and practice score with selected demographic variables of the employees working in the silica - based industry h1there will be a significant difference in the knowledge, attitude, and practice among the employees on safety measures followed in the silica - based industry before and after video - assisted teaching program . H2there will be a significant association among the knowledge, attitude, and practice, and selected demographic variables . The study was conducted in m / s ace glass containers ltd ., which is situated in puducherry, india . Based on a pilot study report, 105 samples were selected from the workmen category . Out of which, 45 samples were permanent workers and 60 were casual laborers . Reliability of the tool was established using split - half technique and it was found to be reliable with the reliability values for knowledge the value alpha = 0.87, for attitude = 0.87, and for practices = 0.70 . Video - assisted teaching program was provided to the employees in the workmen category who were selected for the study . The video - assisted teaching program included a brief knowledge about occupational health, occupational hazards, occupational diseases, general safety measures, personal protective equipment, medical measures, engineering measures, and legislation . Informed consent was taken from each subject and the data were collected from the workers . The knowledge of the subjects was assessed by using a self - administered questionnaire, their attitude was assessed by the likert scale, and their practice of using protective devices was assessed by a checklist . It took 10 - 15 min for each worker to complete the pretest . Each day, around 15 - 20 workers were gathered in the factory dispensary following which preassessment video - assisted teaching programs were given to the subjects on occupational health, occupational hazards, and safety measures . Booklet was also given to each subject to enrich and reinforce his / her knowledge on the use of safety measures to promote the health of the workers . After video - assisted teaching program, the investigator informed the date and time of posttest to all the subjects and posttest was conducted by using the same questionnaire after 1 week as per the schedule . The demographic data revealed that out of 105 subjects, 53 (50.5%) were in the age group of 30 - 39 years; 54 (51.4%) of them were from rural areas, 81 (77.1%) of them were married, 40 (38.1%) of them were technically educated, 60 (57.1%) subjects earned less than 3,000 per month, and 19 (18.1%) were working for 4 - 5 years in the same company . Most, i.e., 97 (92.4%) the subjects were on shift duty and the remaining 8 (7.6%) subjects were on regular duty from 8 pm to 4 pm . Table 1 shows the comparison of overall pretest and posttest knowledge score of the subjects where 57 (54.3%) subjects had inadequate knowledge and only 18 (17.1%) had adequate knowledge in the pretest . But after video - assisted teaching program, 98 (93.3%) subjects had adequate knowledge and 7 (6.7%) had moderately adequate knowledge . Comparison of overall pretest and posttest knowledge score of the subjects on safety measures table 2 shows that in the pretest, about 96 (91.4%) subjects had an uncertain attitude and only 9 (8.6%) subjects had a positive attitude . But in the posttest, almost all of them, i.e. 105 (100%) had a positive attitude toward the use of safety measures . Comparison of attitude score of the subjects between pretest and posttest table 3 represents that 84 (80%) subjects had adequate practice of using safety measures and 21 (20%) only had inadequate practice in pretest . But in posttest, 105 (100%) subjects were found to be adequately utilizing the safety measures . It was evident that the video - assisted teaching program was effective in improving their level of practice in the utilization of personal protective equipment from occupational hazards . Comparison of the practice score of the subjects between pretest and posttest the mean knowledge score of the subjects in pretest was found to be 21.06 with standard deviation but after video - assisted teaching program, the mean knowledge score on safety measures was increased to 34.38 (out of 40) with sd of 2.33, which was statistically significant at p <0.001 level . The mean attitude score on safety measures in pretest but after video - assisted teaching program, the mean attitude score on safety measures was increased to 54.48 with sd of 3, which was also found to be statistically significant at p <0.001 level . The mean practice score on safety measures before video - assisted teaching program was 25.06 with sd of 0.92 . But in the posttest, the mean practice score was found to be increased to 27.43 with the sd of 0.5, which was statistically significant at p <0.001 level from which it was evident that the video - assisted teaching program was effective in improving the level of knowledge, attitude, and practice of the subjects regarding safety measures . Comparison of the mean pretest and posttest scores on knowledge, attitude, and practice of the subjects auni fatin nadia chiek desa, et al ., (2013) stressed that the safety culture, employee involvement, employee attitude, leadership style, safety and health training, and effective communication may have an impact on osh administration performances . (2011) recommended raising awareness of the concerns of the recycling workers safety and health by advertising through the media and conducting comprehensive and intensive research so that the public would have a better understanding of the situation and start to be aware of occupational hazards . The study result revealed that there was a statistically significant association between the pretest knowledge and attitude score of the subjects with selected demographic variables such as their age, education, income, section of work and their experience . As the subjects ages were above 50 - 60 years, they had a high mean knowledge score of 24.2 6.38 and those who had technical educational qualification had a mean knowledge score of 24.6 5.38, which was highly significant while comparing with the others . The subjects experienced for more than 5 years had a higher mean knowledge score of 23.52 5.41, which was highly significant (p = 0.000 * * ). Further, those who were working in the foundry section had mean knowledge score of 50.33, 3.53, which was highly significant when compared to the others working in various other sections . Similarly as the subjects age increases above 50 - 60 years, their mean attitude score was high 24.2 6.38 and those who had technical education qualification had a favorable mean attitude score of 24.6 5.38, which was highly significant while comparing with the others . The subjects who were experienced for more than 5 years had a favorable mean attitude score of 23.52 5.41, which was highly significant (p = 0.000 * *) while comparing with the others experiences . Those who were working in the foundry section had a favorable mean attitude score of 50.33 3.53, which was highly significant comparing with others working in the other sections . (2015) highlighted the current issues in occupation - related injuries (oris) and occupational safety and health training (osht). Some of the elements of ori identified in the literature were differences in age, young workforce, aging workforce, multigenerations, working experience, cognitive abilities, and occupations . The elements of osht have indicated that the elements of learning effectiveness in safety training are training instructions, training method, adult learner, and training design . The study has revealed that video - assisted teaching program on ohs measures was effective in improving the knowledge, attitude, and practice of the subjects, which was statistically significant at p <0.001 level . There was a statistically significant association between the pretest knowledge and attitude score of the subjects with selected demographic variables as their age, education, income, section of work, and their experience.
The report is one of a trilogy of basic international documents which will guide future disability policy . The most important of these documents is the un convention on the rights of persons with disabilities(2) which lays out values, especially human rights, and principles such as accessibility . The second and third documents provide support for the convention and guidance to policymakers, researchers and others . They are the international classification of functioning, disability and health (icf) (3) which is a who classification used as a framework for analysis for the report, and the world report itself which provides evidence to support the convention and enlightened policy and practice . The purpose of the world report on disability is to provide robust evidence on which to make well - informed decisions about disability policy and programs . The report is intended to provide governments and civil society with evidence on which recommendations for actions are based in areas of policy development, health systems, action on access and attitudes, gaps in research and capacity building . Understanding the numbers of people with disabilities and their circumstances will help national and international policy makers, researchers, professionals, service providers and consumers to improve efforts to remove barriers and provide services . Statistics and research data will help advance the un convention on the rights of people with disabilities . Efforts to produce a world report on disability began in earnest in may 2005 when the world health assembly adopted resolution 58.23 on disability, including prevention, management and rehabilitation, directing who to produce a world report. (4) the development of the report was led and managed within the rehabilitation and disability unit of the violence and injury prevention and disability (vip) section of who(5) in collaboration with staff at the world bank . The process, which occurred over four years, involved a large number of stakeholders including an advisory and an editorial committee, over 370 contributors and over 70 low, middle, and high income countries . The report is composed of nine chapters covering approaches to disability, prevalence, healthcare, rehabilitation, assistance and support, enabling environments, education, work, and recommendations . The icf provides the conceptual model . Findings include a higher estimate of disability than who s former estimate in the 1970 s of 10 percent of the world population . Today, one billion people, 15 per cent of the world population, are estimated to have a disability of which 110190 million have very significant difficulties in functioning . Not all people are equally disadvantaged with poorer people, women and older people disproportionally affected . These numbers, as well as information about demographic, health and environmental factors affecting trends in disability, can improve efforts to remove barriers and provide services . Disabling barriers include inadequate policies and standards, negative attitudes, lack of provision of services, inadequate funding, lack of accessibility and lack of data and evidence . In turn, barriers contribute to poorer health outcomes, lower educational achievement, less economic participation, higher rates of poverty and increased dependency and restricted participation . Therefore, recommendations include access to all mainstream policies, systems and services, adopting a national disability strategy, funding, involvement of people with disabilities and support for research . The authors of the rehabilitation chapter of the report recognize that tr is an emerging resource that can enhance the capacity and availability of rehabilitation measures by providing interventions and other important resources remotely, thus reaching a vast underserved population . Technologies for service delivery include video and teleconferencing, mobile phones and remote data - collection equipment and telemonitoring . The technology may be used by rehabilitation professionals as well as by people with disabilities, therefore accessibility features are important . The chapter provides a number of examples of remote delivery of services such as remote assessments, training and support of health - care personnel, consultations between hospitals for problems related to prosthetics and orthotics and wheelchair prescriptions and sharing professional expertise . Finally, the experts who authored this chapter, like so many others, call for more information on resource allocation and costs to support implementation of tr policy and practice . The content of the information and communication section of the chapter entitled enabling environments departs from the health domain to focus more on the environmental domain . It is particularly sensitive to the relationship between access to communication and information and access to health care, education, local government and justice . The chapter drew from the expertise of agencies and organizations such as the international telecommunication union, the g3ict(6) and the un global alliance, the daisy consortium(7) and the w3c web accessibility initiative(8) to identify web usage figures, barriers, policies, best practices and to provide recommendations . 21st century communications and video accessibility act, and design principles such as universal design are very much a focus of this chapter . Many report - related events, often with educational objectives, are on the international calendar . The world bank has initiated webinars on the report. (9) launches of and symposia about the report are occurring in countries throughout the world . In the united states, the report was launched on september 1213, 2011 in the washington, d.c . Area. (10) the event, sponsored by the center for international rehabilitation research information and exchange (cirrie), featured a number of well - known leaders . Kareem dale, special assistant to the president for disability policy made opening remarks, followed by representatives from the world bank, world health organization and the pan american health organization . Agency and departmental representatives from the agency for international development, education, health and human services and labor served on panels to discuss the relationship between their work and the content of the report . The u.s . Launch program featured a sequence of panels of authors of each chapter of the report and discussants who were distinguished scholars, mainly from the u.s . Research community, focusing on the relationship between report content, their work and its impact on their future work . Again in the u.s ., the american academy of physical and rehabilitation medicine (acrm) featured the report in its recent meeting and the upcoming pacific rim international conference on disability & diversity (pacrim) conference will also include a major presentation about the report . While these activities and the report itself are major steps forward in advancing human rights for people with disability, there are issues important to tr that are not addressed in the report . The international framework for health information technology (hit) has developed largely independent of the convention, the icf and the report . However, international ehealth documents show increasing sensitivity to the usability of health information technology for end users . An action plan for a european ehealth area was published by the european commission in april 2004 and endorsed by the eu health ministers in june 2004. (11) the plan has a code of conduct that includes accessibility criteria, (i.e., accessibility sites should be developed to be as user - friendly as possible for all potential visitors). (12) there is some indication that individual nations, such as the united states, are beginning to consider the application of accessibility guidelines to hit(13)(14). If countries use the un convention principle of accessibility as a bridge from disability (and aging) to hit then resulting regulatory requirements may bring tr and other health technology applications into closer alignment with the needs of the disability community.
Appropriate placement of dental implants is essential for esthetic and restorative aspects.12 the development of computer - assisted guided surgery has helped realize restoration - driven implant placement.3 contemporary guided implant surgery systems are generally based on cone - beam computed tomography (cbct) and computer - aided design and computer - assisted manufacturing (cad / cam) technologies . Cbct visualizes anatomic structures without superimposition, which enables 3-dimensional (3d) diagnosis and treatment planning.456 cad / cam technologies improve the fabrication of surgical guides by reducing manual work and facilitating transfer of the planned implant position to the guide template.7 accurate placement of implants makes it possible to deliver restorations to the patient's mouth on the day of the surgery.89 accordingly, these advancements have optimized implant treatment to be more predictable, less invasive, and faster from both a surgical and a prosthodontic point of view.1011 surgical guide templates are categorized based on the extent of drilling restriction.12 nonlimiting design is simplistic; although such guides serve as imaging indicators for marking the entry point of drilling, they do not limit the angulation or the depth of drilling motion . However, in general, hole enlargement and implant placement are still performed freehand by the surgeon . Most surgical guides with partially limiting design are converted from a radiographic template that is used to evaluate the surgical bone site and devise a surgery plan . Completely limiting design is the most advanced type of guide, restricting the drilling process and placement of implant in three dimensions . This design concept reduces the need for decision making during surgery, thereby leading to more predictable results of implant placement . Contemporary cad / cam - based surgical guides are included in this category.1314 the accuracy of a guided implant surgery system is defined as the deviation between the planned and placed position of the implant.15 the accuracy of the entire procedure is a quantitative evaluation of positional and angular discrepancies in 3d coordinates.16 the measurements are performed using image superimposition of pre- and postoperative ct images.17 possible sources of error include factors such as digitizing, superimposition, machining process, the guide design concept, and the operator's experience . 1819 in a recent in vitro study, van assche and quirynen reported a noticeable tolerance of surgical implant instruments within the metal sleeve.15 this tolerance is caused by the gap between the drill and the guide sleeve, which allows rotation of the drill in the sleeve . Unwanted lateral osteotomy may occur when the drill is not parallel to the sleeve during the drilling; therefore, this type of error is defined as an intrinsic error.20 on the other hand, if there is no tolerance, the friction generated from mechanical components hinders the drilling process, which might result in sleeve deformation . Recently, a direct drill - guiding implant surgery system with a completely limiting design was developed . This system features shank - modified drills that use the shank portion of surgical instruments as a guiding component to limit drilling motion with little tolerance . Moreover, a guide sleeve is incorporated in the stereolithographic surgical guide design, which eliminates the need for additional insertion of metal guide sleeves into the guide template . The purpose of this study was to investigate the accuracy of this newly developed guided implant surgery system in partially edentulous patients using prospective clinical design and geometric analyses.2122 eleven patients (5 men, 6 women; aged 2175 years; mean age 46 years) requiring implant placements in partially edentulous jaws were included in this study . A total of 21 implants (anyone; megagen implant, gyeongbuk, korea) were placed . Patients with a history of debilitating systemic disease or requiring ridge augmentation with bone grafting were excluded from the study . The study was approved by the institutional review board of the hospital (2014 - 11 - 020). A conventional impression was taken, and a stone cast was fabricated for each patient . The surface image of the cast was then digitized into surface tessellation language (stl) format using a desktop scanner (ceramill map 400; amann girrbach, koblach, austria). Images of the underlying bone were obtained using a cbct scanner (pax - flex3d; vatech co., hwasung, korea) with a field of view of 120 85 mm, voxel size of 0.2 mm, and exposure conditions of 90 kvp, 10 ma, and 24-second pulsed scan . During cbct image taking, patients were directed to bite a radiopaque datum tray (megagen implant, gyeongbuk, korea) in centric occlusion . The cbct data were saved in digital imaging and communications in medicine (dicom) format . The datum tray was also digitized into a stl file using the desktop scanner (ceramill map 400; amann girrbach, koblach, austria). The solid block portion of the datum tray was used as a medium for superimposition of the surface image and underlying bone image . The dicom file and the two stl files were imported into an implant - planning software program (r2gate 1.0; megagen implant, gyeongbuk, korea) where the image merging and virtual surgery were performed . The image - merging process was performed with manual registration by selecting three anatomic landmarks from the dentition . The position of the implant was determined based on the underlying bone and virtual restoration (fig . 2) and fabricated using a 3d printer (perfactory 4 ddp; envisiontec, dearborn, mi, usa). The direct drill - guiding system in this study uses shankmodified drills whose structure has 3 parts: the stopper part, the guide part, and the drilling part (fig . The stopper structure of the drill corresponds with the stepped structure of the internal surface of the sleeve and restricts the drilling depth when the two structures are joined . The guide part of the drill closely accommodates the sleeve of the guide, which limits the orientation of the drilling motion . The guide part of the drill has the uniform diameter and length; this feature eliminates the need for additional internal tubes . The handpiece connector and ratchet connector are instruments for inserting the implant fixture after osteotomy . As the component for depth control, the handpiece connector has the stopper structure, and the ratchet connector has a horizontal marking to indicate the correct depth of insertion . The sleeve structure of this system is incorporated into the design of the guide template, so the guiding component is created together with the guide body when the template is fabricated (fig . Each drilling was performed until the stopper of the drill contacted the rim of the guide template . All implants were placed by a single operator . To obtain the positional information of the placed implant, postoperative cbct scanning was conducted using the same settings as the preoperative scan . The accuracy of the guided surgery system was evaluated at the abutment level by comparing the virtual abutments of the planned and placed implants (fig . The actual position of the abutment was determined based on the actual position of the implant in the postoperative cbct scan . The outcome parameters were horizontal deviation, vertical deviation, and angular deviation, and the values were calculated using the centerlines of the abutments and reference points in 3 dimensions . All data were reported as the mean standard deviation and visualized via bar graphs . The kruskal - wallis test and mann - whitney u test were used to compare the amounts of deviation among 3 planes . The means and standard deviations of horizontal deviation were 0.593 0.238 mm in the mesiodistal direction and 0.691 0.344 mm in the buccolingual direction . The mean vertical deviation was 0.925 0.376 mm in the occlusogingival direction, which was significantly larger than the horizontal deviations (p = .018). However, there was no significant difference between the two horizontal deviations (p = .421). As for angular deviation, the values were 2.024 0.942 degrees in the mesiodistal direction and 2.390 1.142 degrees in the buccolingual direction (fig . The direct drill - guiding system in this study showed higher accuracy in implant placement by using shank - modified drills and a stereolithographic surgical guide that reduces the tolerance of surgical drills inside the guide sleeves . In a recent systematic review, the mean horizontal deviation of implant placement compared to the planned position was reported as 1.2 mm,23 whereas the direct drill - guiding system showed a mean deviation of 0.642; thus, this system is approximately twice as accurate as other systems in terms of horizontal linear deviation . The angular deviation of the direct drill - guiding system in this study was less than the general value of angular deviation reported in the systematic review . These findings correspond well with those reported by cassetta et al.,14 who evaluated the effects of limiting the tolerance between the drill and guide sleeve on the total error of implant placement . To minimize tolerance, two tubes were used; a guide tube was attached to the head of the surgical handpiece, and a master tube was embedded in the surgical guide . Because the diameter of the guide tube was only 0.05 mm smaller than that of the master tube, these tubes fit closely during the drilling procedure . These mechanics allowed only in - and - out motion, restricting the lateral movement of the drill . As a result, the accuracy of the system with the guide tube was superior to that of the system without the guide tube . The direct drillguiding system in the present study has a similar mechanism for reducing tolerance . Therefore, it can be inferred that the direct guiding components play a key role in limiting drill movement and that tolerance control is essential for increasing the accuracy of the guided surgery system . Even when the sleeve of the guide template limits the blade part of the drill, a certain amount of gap is inevitable to allow the rotation of the drill within the sleeve.20 the deviation caused by the gap when the drill is not turning can be calculated theoretically by the interrelationship between the sleeve and drill angulation.24 basically, to increase the positional concordance of the planned and placed implants, it is important to use the drill in a centric position and parallel to the internal wall of sleeve.71525 however, it is not easy to keep a drill in the correct position because visibility and manipulability of the drill is limited in the narrow intraoral space . Meanwhile, the use of longer sleeves has been suggested as a mechanical approach to reduce the tolerance of surgical instruments . Although the above - mentioned parallel drilling and use of longer sleeves are helpful for increasing the accuracy of implant placement, the sleeve should still have some amount of tolerance to prevent friction when the drill is rotating . In other words, the gap between the drill and the guide sleeve is unavoidable, which leads to errors in implant placement . As an alternative for guiding a drilling part of drill through a sleeve, koyanagi26 suggested the use of two orthodontic wires and tubes to connect the head of the handpiece with the guide template . Since the wires slide along the tube, the drill advances as planned during the osteotomy . The guide system tested in the present study is based on a different working mechanism and consists of modified drills that use the shank part of drill as a guiding surface . Since the guiding surface makes direct contact with the inner surface of sleeve, the tolerance of the drill is markedly decreased . This direct contact can be maintained during drill rotation because both contact parts have smooth surfaces with low the friction coefficient . The combination of the shank - modified drill and sleeve - incorporated stereolithographic guide template therefore completely restricts the implant instruments and leads to more accurate implant placement . The depth control of instruments is an essential element of a guide system with a completely limiting design.27 the addition of a stopper physically restricts the depth of the osteotomy by allowing drill advancement only to the level of the stopper.2829 this depth control enhances safety by preventing drills from intruding on vital anatomic structures such as the maxillary sinus and inferior alveolar nerve.30 the stopper is also useful for placing the implant at the planned depth, which not only improves treatment convenience but also enables immediate placement of the coronal restoration.31 in general, the mean vertical error of previous implant guide systems was reported as 0.5 mm.19 however, the guide system in the present study showed less accurate outcomes in the depth parameter . Although the ratchet connector has a reference line to indicate the stop point, it lacks a physical stopper . Accordingly, the vertical positioning of implant is influenced by the operators' visual and tactile senses . Thus, to improve the accuracy of this system in the vertical dimension, inclusion of a stopper structure on the ratchet connector is recommended . The accuracy of guided implant surgery is influenced by procedures that transfer the digital virtual plan to the surgical site.19 possible individual errors originate from intrinsic sources, which include issues with radiography quality, file conversion, cad software, and the tolerance between mechanical components; and extrinsic sources, which relate to the fit of surgical guide, the mucosal thickness at the surgical site, the position of the edentulous area, and the surgeon's experience . This study revealed the error in the accuracy of the newly developed guided implant surgery system . Since the data were obtained from clinical cases, the outcome values are clinically valid and meaningful . Thus, controlled in vitro experiments or large - size clinical prospective trials will be needed in the future to analyze these effects . To our knowledge, this is the first clinical report to evaluate the accuracy of a direct drill - guiding system for implant placement . The present study confirms that the use of shank - modified drills and sleeve - incorporated stereolithographic templates is an effective way to improve the accuracy of implant placement by minimizing mechanical tolerance of the instruments.
Fiberoptic intubation is a valuable technique in securing the airway in predicted difficult intubation scenario, compromised airway, lower airway pathology and when neck extension is to be avoided . In awake fiberoptic intubation under intravenous (iv) sedation patient should remain calm, fall asleep if undisturbed and follow verbal commands . An ideal sedation regime should provide patient comfort, cooperation, amnesia, hemodynamic stability, blunt airway reflexes, and maintain a patent airway with spontaneous ventilation . Available conventional sedatives such as benzodiazepines, opioids and propofol cause respiratory depression, especially when used in higher doses . Dexmedetomidine, an 2-adrenoreceptor agonist, is a valuable drug for fiberoptic intubation as it induces sedation and analgesia without depressing respiratory function . These two effects make dexmedetomidine highly desirable for awake fiberoptic nasotracheal intubation . Unlike patients sedated with propofol, patients receiving dexmedetomidine are easily arousable without expressing irritation . The relative sympatholysis achieved during dexmedetomidine infusions is an additional benefit in a procedure that may lead to elevations of heart rate (hr) and blood pressure . It has been suggested that low - dose ketamine infusion (4 mcg / kg / min), effectively lowers postoperative narcotic requirements and has minimal impact on ventilatory drive and analgesic properties . The undesirable increase in airway secretions with ketamine administration is attenuated by the xerostomia induced by dexmedetomidine, while concurrent ketamine bolus injection prevents bradycardia and hypotension reported with dexmedetomidine . In addition scher and gitlin used ketamine combined with dexmedetomidine for awake fiberoptic intubation in a case of 52 years male with failed previous fiberoptic intubations and found this combination to provide excellent intubating conditions . However, there are no randomized control trials comparing the effectiveness of dexmedetomidine plus ketamine combination with dexmedetomidine alone for awake fiberoptic nasotracheal intubation . Hence, this study was undertaken to compare the effectiveness of dexmedetomidine plus ketamine combination with dexmedetomidine alone in achieving better intubating conditions during awake fiberoptic nasotracheal intubation . After approved by local institutional ethics committee and obtaining written informed consent, 60 adult patients of age group 18 - 60 years of either sex, american society of anesthesiologists grades i and ii posted for elective surgery under general anesthesia and were randomly allocated using computer generated randomization list into two groups of 30 each . A sample size of 30 patients in each group was calculated to have at least 80% power and an alpha of 0.05 to detect the expected differences between the two groups with respect to the primary goal of mean sedation score . Finding a difference of at least 15% change in mean sedation scores was regarded as a clinically significant difference . Exclusion criteria included uncooperative patients, any type of a - v block on electrocardiogram (ecg), heart failure, liver cirrhosis, thrombocytopenia and coagulopathies, severe bradycardia, current psychiatric disorder or any respiratory disorders . To achieve blinding three anesthesiologists were required to conduct the study case . One anesthesiologist prepared and controlled the drug infusions; the second one performed fiberoptic intubation and the third anesthesiologist documented the data and made postoperative visits the next day . All patients were premeditated with tablet ranitidine 150 mg hs and then at 6 a.m. on the day of surgery along with injection metoclopramide 10 mg as an institutional protocol for awake fiberoptic . In the operating theater, routine monitoring devices were placed and baseline ecg, hr, mean blood pressure, mean arterial pressure (map) and oxygen saturation (spo2) were recorded . Injection glycopyrrolate 0.2 mg iv was given 5 min prior to administering the study drugs . Groups i and ii patients received a bolus dose of dexmedetomidine at 1 mcg / kg over 10 min in 100 ml normal saline followed by a continuous infusion of dexmedetomidine at 0.5 mcg / kg / h using b - braun (software pfae) infusion pump . Upon completion of dexmedetomidine bolus, group i patients received ketamine 15 mg as a bolus of 5 ml, followed by continuous infusion of ketamine at 20 mg / h, while group ii patients received normal saline 5 ml bolus, followed by plain normal saline infusion until the end of intubation . Sedation score was assessed by anesthesiologist unaware of regime used by modified observer assessment of alertness / sedation (oaa / s) scale (5 = respond readily to name spoken in normal tone, 4 = lethargic response to name spoken in normal tone, 3 = respond only after name spoken loudly or repeatedly, 2 = respond after mild prodding or shaking, and 1 = does not respond to mild prodding or shaking). Xylometazoline nasal drops 0.1% (2 drops in each nostril), followed by 2 ml of 4% of lignocaine were administered . Two puffs of 15% lignocaine were instilled in the same nostril immediately before starting nasal fiberscopy . An endotracheal tube (ett) of appropriate size (softened in warm water) was mounted over the fiberscope (karl storz, working length 65 cm, distal tip diameter 3.7 mm) and introduced through the selected nostril after 10 min of the start of study drugs . After visualization of the glottis and vocal cords, 2 ml of 4% lignocaine was injected through epidural catheter passed through the working channel . A lubricated ett was passed over it into the trachea and positioned 2 - 3 cm above the carina . The primary outcome measurements were: (i) intubation scores as assessed by vocal cord movement (1 = open, 2 = moving, 3 = closing, 4 = closed), coughing (1 = none, 2 = one gag or cough only, 3 => 1 gag or cough, but acceptable conditions, 4 = unacceptable conditions) and (ii) patient tolerance as assessed by facial grimace score (1 = no grimace, 2 = minimal grimace, 3 = mild grimace, 4 = moderate grimace, 5 = severe grimace, 6 = very severe grimace). Hemodynamic variables (hr, map, spo2, and ecg) which were assessed at five different time intervals (baseline, 2 min after sedation, at the beginning of fiberscopy as it passes through the nostril, after advancing the ett through the nasopharynx and 2 min after endotracheal intubation). Other parameters included time taken for intubation, total dose of lignocaine used (for ensuring safe therapeutic levels) and the amount of study drugs used . A postoperative visit was undertaken the day after operation during, which the level of recall (memory of preanesthetic preparations, topical anesthesia, endoscopy, and intubation), adverse events (sore throat, hoarseness) and satisfaction score (1 = excellent, 2 = good, 3 = fair, and 4 = poor) were noted [appendix 1]. Statistical analysis of the data collected was done using spss 17 (ssps inc ., intubation score, sedation score, grimace, time taken for intubation were analyzed by mann - whitney test . Hemodynamic variables, spo2 and amount of lignocaine used were analyzed by student's t - test . Degree of patient satisfaction, level of recall, and adverse events were analyzed using the chi - square test . There was no statistically significant difference in the baseline data between the two groups [table 1]. Distribution of subjects according to baseline demographic profile and baseline hemodynamic parameters the mean hr and map decreased persistently in both groups . The mean hr decreased significantly at all points of measurements (2 min after sedation, start of fiberscopy, after passage of ett, 2 min after ett) compared to baseline in group ii patients (p = 0.019, 0.02, 0.028, and 0.03, respectively), while in group i the fall in hr was insignificant at all measurement points (p = 0.059, 0.271, 0.4, and 0.163, respectively). The maximum percentage fall in mean hr was 5.33% in group i and 9.2% in group ii patients and there were no episodes of bradycardia (<40 beats / min). Mean hr when compared between the two groups was not significant at all the points of measurement [figure 1]. Comparison of vitals (pulse, mean arterial pressure, oxygen saturation) in between the groups the map decreased significantly at all intervals (2 min after sedation, start of fiberscopy, after passage of ett, 2 min after ett) compared to baseline in group ii patients (p = 0.038, 0.003, 0.000, and 0.000), and at 2 min after passage of ett in group i patients (p = 0.000). The maximum percentage fall in map was 8.17% in group i and 14.81% in group ii patients . The fall in map, when compared between the two groups was significant from the start of fiberoscopy toward the end of the procedure [figure 1] (p = 0.014, 0.003 and 0.005 at start of fiberscopy, after passage of ett, 2 min after ett, respectively). There was no statistically significant difference in saturation in between the two groups, and there was no episode of desaturation in either group [figure 1]. Group i patients were sedated deeper at the end of 10 min after the start of the study drugs and none of the patients were sedated to a score of <2 (modified oaa / s score) in either of the groups . The mean sedation score in group i patients was 3.47, while in group ii the score was 3.93, which was statistically significant (p = 0.015) [table 2]. Parameters measured during fiberoptic intubation there was no statistically significant difference in the intubation scores, grimace score and time taken for intubation in between the two groups (p> 0.05). Only 1 patient in group i developed severe coughing while advancing the fiberoscope past the vocal cords, which was considered unacceptable for further guiding the fiberscope into the trachea and excluded from study group . The dose of lignocaine used was significantly lower in group i patients (p = 0.043). However, there was no significant difference in the dose of dexmedetomidine used (p = 0.45) [table 2]. The recall of administering preanesthetic preparations, topical anesthesia, and intubation were higher in group i patients (100%, 90%, and 86.7%, respectively) when compared with group ii patients (93.3%, 90%, and 70%, respectively), but this difference was statistically insignificant (p> 0.05). Satisfaction score was rated excellent in more number of patients in group i (53.3%) versus 20% in group ii, incidence of adverse events like hoarseness and sore throat were higher in group ii patients, but were statistically insignificant [table 3]. The primary outcomes of the study show that both dexmedetomidine with ketamine combination and dexmedetomidine alone provide satisfactory intubating conditions for awake fiberoptic nasotracheal intubation with minimal adverse effects and better patient satisfaction score . Dexmedetomidine provides appropriate sedation in which the patient is calm and easily arousable from sleep to wakefulness to allow cooperation, excellent communication and task performance while being ventilated and intubated and then quickly back to sleep when not stimulated . The primary site of action of alpha2 agonists is the locus ceruleous and not the cerebral cortex, unlike gamma - amino butyric acid - mimetic drugs . Locus ceruleous (nucleus in the pons) that is involved in physiological response to stress and anxiety is the principal site in the brain for norepinephrine synthesis . The present randomized controlled study comparing the effectiveness of dexmedetomdine plus ketamine combination against dexmedetomidine alone is unique as a thorough literature search could not elucidate similar studies, though a case report of the same is available . Sedation score was higher (lower sedation level) in group ii (dexmedetomidine alone) when compared to group i (dexmedetomidine and ketamine) which was statistically significant (p = 0.015). The sedative effects of the combination of ketamine and dexmedetomidine were found to be additive at the endpoints of hypnosis and anesthesia . Shimabukuro and satoh used ramsay sedation scale in their study and their patients were sedated in the scale of 2 - 4 and were very cooperative during the procedure, which is similar to the sedation levels achieved by our study subjects . Patient comfort is quintessential during awake fiberoptic intubation, which helps in confirming the position of tracheal tube and perform general anesthesia under controlled conditions . In our study, majority of patients in group i had no grimace (56.6%) or had minimal grimace (30%). This is because dexmedetomidine blocks the sympathetic supply of the upper airway, while lignocaine provided airway anesthesia . The amount of lignocaine used in group i patients was significantly lower than that of group ii patients probably due to better sedation level, hence better intubation scores and better cooperation of the patient to the procedure of fiberscopy and intubation . Group i patients had better hemodynamic stability because of the attenuation of bradycardia and hypotension by ketamine . It is noteworthy to mention that at all levels of intervention, there was no increase, rather decrease in the mean hr . Yildiz et al . Noted an increase in mean hr during laryngoscopy and intubation; however, we never encountered any increase in the hr, which could probably be related to the use of lignocaine through spray as you go there was a significant fall in the map when compared with the baseline at 2 min after intubation in group i patients that can be attributed to the use of inhalational agents and induction agents combined . However, in group ii patients there was a fall in map at all points of measurements due to the action of dexmedetomidine alone . None of the patients in either group had a fall in the mean hr and map more than 20% of the baseline value . The opposing action of ketamine and dexmedetomidine on cardiac and sympathetic system probably resulted in a more stable hemodynamic response . Dexmedetomidine has been reported to prevent the hemodynamic response to tracheal intubation more effectively than esmolol . The use of dexmedetomidine was associated with a decrease in map and hr, which might result from decrease in noradrenaline release, a decrease in centrally mediated sympathetic tone and an increase in vagal activity . Dexmedetomidine is reported to produce severe bradycardia, hypotension, hypertension and arrhythmias as side - effects . Recall of the procedures performed on the patient were more in group i patients (86.7%) than group ii (70%), but it was insignificant . This could probably be due to central nervous system stimulation effect of ketamine that is associated with hallucinations . Tsai et al . Have reported a higher incidence of recall of endoscopy (50%) and intubation (5%) than the propofol group . This was in concordant with the significantly lower state of entropy values in the propofol group, indicating higher sedation levels . There was increased the hoarseness (10% vs. 3.3%) and sore throat (26.7% vs. 6.9%) in group ii, but it was insignificant . This could probably be because ketamine produces intense analgesia and additive sedation effect with dexmedetomidine leading to less coughing and hence lesser incidence of hoarseness and sore throat . One of the limitations of the study was small sample size . We suggests large randomized controlled trials have to be carried out on a larger population . From our study, we conclude that the dexmedetomidine is a useful sedative agent for awake fiberoptic intubation when used with spray as you go technique for anesthetizing the upper airway . The drug allows good sedation, unusually cooperative patient who maintains the responsiveness with the task performance then going back to sleep without any respiratory depression or clinically significant hemodynamic compromise . The addition of low - dose ketamine further enhances the hemodynamic stability because of the opposing action on the cardiovascular system when compared with dexmedetomidine . Thus, we recommend the use of low - dose ketamine plus dexmedetomidine combination for hemodynamic stability and better sedation during awake fiberoptic nasotracheal intubation.
The purpose of this study was to explore nurses attitudes to the barriers of patient education as a right for getting information based on work situation of nurses, educational facilities in hospitals, and patients situation . Twenty questions were about their working situation, 4 questions about hospital educating facilities, and 12 questions were about patients situation in hospital . The type and frequency of education barriers were evaluated, and variables associated with reporting an obstacle were analyzed . In our questionnaire, we used a likert scale for determining severity of three domains as the barriers of patient education that ranged from 0 to 4 . Generally, it was obvious that educational condition in our hospitals was not good and most of the nurses believed that patient education is not their duties, facilities in hospitals are not sufficient and shortness of time is the most important cause of insufficiency of patient education the interactions of patient, physician and systemic factors have implications for the implementation of patient education . The failure of adequate patient education may be attributed to the lack of patient adherence, the failure of nurses knowledge and skill level or the insufficient funding and organization of necessary programs in the current health care system . Hospitalization, which is the major health care cost in community, consumes a considerable part of the health care budget in general . Good education skills and strategies are particularly important in the diagnosis, treatment and management of diseases . Few studies have explored the contextual dimensions and subsequent interactions that contribute to a lack of adherence in the application of guidelines for patient education that is the cornerstone of care for all patients with acute or chronic diseases . Patients education is a fundamental aspect of patient care and yet poor education is the most common source of patient's complaints in the health - care sector . Other work indicates that miscommunication in education often occurs because of cultural differences between the communicator and recipient . Problems of miscommunication and language may not only influence treatment but may also contribute to the reinforcement of stereotyped behavior . There are increasing pressures within primary care requiring a rethink of roles, responsibilities and skill mix . The use of suitably trained nurses to extend their sphere of responsibility may be an appropriate way to manage the demand without compromising quality or patient satisfaction . Patient education is an essential nursing practice standard that meaningfully impacts a patient's health and quality of life . Education process is a systematic, sequential, logical, planned course of action consisting of two major interdependent operations, teaching and learning . The education process has been compared to the nursing process as the steps of each process run parallel to one another . To provide thorough and appropriate education education is used to empower the patient and is an important aspect of quality improvement given that it has been associated with improved health outcomes . The nurses role has undergone historical change, shifting from imparting disease - oriented health education toward empowering patients to use their own resources to attain health . Essentials for effective patient education include use of an open communication style, written instructions and addressing barriers . Demographic variables, such as ethnic background, formal education level, reading ability, and barriers to participation in education must be considered to maximize the effectiveness of self - management education outcomes . Nurses attitude to patient education barriers can help to elimination of many problems for practitioners who are well suited to provide care that facilitates behavior change and health - oriented patient education . The process of patient education can be described in 5 steps: 1) assessment of the patient's previous knowledge, misconceptions, learning abilities, learning styles, cognition, attitudes and motivation . 3) the planning of the education and goals are set and educational interventions are chosen . In the planning phase, the type of education, the frequency, who will deliver the education and when and how it should be given, should also be addressed . Historically, the teaching role of nurses within medical education has been largely unrecognized, although in the clinical ward areas expert nurses frequently educate and induct newly qualified doctors into routines and procedures . Barriers cited in the literature to adherence to guidelines for diseases management include: a need for education, lack of time and lack of confidence in clinical skills, complexity, and a need for effective charting systems . With patients requesting for information that is relevant to their own disease or recovery process, nurses must focus their attention on patient - tailored information resources, seeking information from a variety of resources including colleagues, the patient record, or other high quality sources . The purpose of our study was to assess nurses attitude to patient education barriers in educational hospitals . Urmia city which is located in north - west of iran, has a population of 3200000 individuals . During 2009 - 2010, this cross - sectional study was carried out . Census method was used for sampling and all nurses who filled the questionnaire entered into the study . The data was gathered with a two part questionnaire: the first part included demographic variables such as age, marriage situation, ward, employment duration and kind of their shifts the second part assessed their attitudes to barriers of participation in education . Three domains were studied; 20 questions for their working situation, 4 questions for hospital educating facilities and 12 questions for patients situation in hospital . We used likert scale for determining severity of three domains as the barriers of patient education ranged from 0 to 4 . Its reliability was assessed by internal consistency as cronbach's alpha calculation was 0.89 and test - retest reliability was 0.91 . After explaining how to fill in the questionnaire, data were analyzed by spss version 16 and descriptive statistics used to show the barriers . In addition, we declare that have no conflict of interest in this study and subjects were surveyed in agreement with the research ethics . Most of the participants (82.5%) were female, and duration of working was 1 - 5years in the most subjects . The age average was 32.39 (sd=6.2) years and most of them were in 30 - 35 years age group and 102 (72.8%) subjects worked in rotating shifts . It was obvious that the education condition in our hospitals was not good and most of nurses believed that patient education was not their duty . Participants believed hospital facilities were not sufficient and shortness of time was the most important cause of insufficiency of patient education . Most of nurses (73.6%) were unaware about patient education importance and patient education in their job promotion was not important . The most important barriers of patient education regarding nurses working situation were low knowledge of nurses about importance of education, feeling of ineffectiveness of it in quality of treatment, lack of interest of nurses to participation in patients education . The most important barriers of patient education in terms of hospital educating facilities were lack of educational resources and shift rotation . Regarding patients situation in hospital, the most important barriers were lack of interest in patients for learning, insufficiency of hospitalization time, patient inconvenience and feeling of lack of importance of learning in hospital . Table 1 shows the most common answers of nurses to patient educational barriers and scores . Any combination of educational barriers might interfere with the plan being relevant and timely for the targeted learner . Education, often delivered by nurses, is an important part of all management programs for patients, both in clinical practice and research . Patient education includes all educational activities directed at patients, including aspects of therapeutic education, health education and clinical health promotion . It is obvious that interventions at multiple levels that address the demographic and socioeconomic obstacles to education are needed to ensure successful self - management training or self - efficacy . It is interesting to note that many study participants expressed concerns with aspects of the primary care process that are typical of more generally held concerns about health care changes resulting from the managed care revolution . Perceptions that physicians and nurses are hurried and do not have the time to stop and talk with or listen to patients echo a common theme in discussions of contemporary health care quality . The interactions of patient, physician, nurse and systemic factors have implications for the implementation of patient education . The failure to education adequately for patients may be attributed to a lack of patient adherence, a failure of personnel knowledge and skill level, or insufficient funding and organization of necessary programs in the current health care system . However, our findings suggest that no single player is at fault and, with education; the integration of the three factors relevant to patients care is achievable through implementation of a patient education model . Interventions at multiple levels that address the demographic and socioeconomic obstacles to patient education are needed to ensure successful self - management training . In summary, essential principles for the education role include: acknowledge control as belonging to the patient, dialogue rather than monologue, use language the patient can understand, not overload with verbal instructions, use memory aids such as written instructions and mailed reminders, and suggest specific helps . Patients in hospital need education in order to adapt to their condition and perform self - care behavior . Despite the fact that many patients received education and perceived information about their treatment as important, they had low levels of knowledge and lacked a clear understanding of why they had developed diseases, how it was defined and what relevant self - care behavior should be performed . It is important to target barriers to learning such as functional and cognitive limitations, misconceptions, low motivation and self - esteem . Health care professionals need to be skilled in assessing the requirements and the level of education given to the individual . Education can be further improved by combining clinical experience with new technologies and nurse managers and must explicitly support the patient - teaching role of the inpatient nurses upon their employment, by providing the resources they need and rewarding their efforts . Continuing education for nurses during new employee orientation programs and periodically thereafter can include information applicable to ambulatory care . This will allow hospital nurses to convey accurate information to patients regarding their care after discharge . Continuing education offerings afford an opportunity to address the additional barriers for nurses who want to improve outcomes for their patients . It is important that nurses develop and master information seeking skills so that they can access and find information resources they can offer directly to patients and caregivers . Some patients and caregivers, however, may doubt that their information needs are adequately addressed because the resources may not be available on the clinical unit . We believe our findings have exposed concerns that are likely to be held in similar general practice groups across the country and suggest that before nurses roles can become widespread, these concerns need to be addressed . The exploration of professional attitudes towards the employment of nurse practitioners is an essential precursor to a debate about how barriers may be overcome, and about the appropriate skill mix and employment arrangements required to manage primary health care services in the future.
Acne is a prevalent condition in society affecting nearly 80% of adolescents and often results in secondary damage in the form of scarring . Although these lesions can be treated in a number of ways, they are often physically and emotionally troublesome . Retinoic acid (ra) improves acne scars and postinflammatory hyperpigmentation (pih), while glycolic acid (ga) has keratolytic properties and reduces atrophic acne scars . Though the efficacy of retinaldehyde and ga (ralga) combination has been well explored in treating acne scars, the efficacy of ra and ga (raga) combination has not been recorded . In addition, ra is more readily available than retinaldehyde in india and therefore, we did the following retrospective assessment to study the efficacy of topical raga combination in the treatment of acne scars . A retrospective assessment was done at cutis academy of cutaneous sciences, bengaluru to study the efficacy of topical ra 0.025% and ga 12% (raga) combination in treating acne scars and pih (postacne). The patients previously treated for active acne and reporting with acne scars at our center were prescribed 0.025% ra and 12% ga . They were advised to mix half a fingertip unit of each and apply evenly over full face sparing 1 cm area around eyes, nostrils and mouth . The duration of application was escalated gradually from half an hour in the evening to few hours to overnight depending on patient's tolerance to the application . The case records and photographs of 35 patients (12 males and 23 females), who were on topical raga treatment for acne scars, were assessed . Photographs taken at the start of acne scar treatment (baseline) and at the end of 12 week were assessed and case records were reviewed for any history of irritation and noncompliance . The acne scars were graded according to goodman and baron's quantitative global scarring grading system (gsgs) at baseline and after 12 weeks of topical raga treatment [table 1] by an independent observer . The first point on this grading system is macular erythematous pigmented scars and the difference in these grades were considered to measure improvement in pih . Goodman and baron's quantitative global acne scarring grading system the differences in the acne scar grades before and after the treatment were noted . The improvement status was categorized into a 5-point scale depending on the reduction in the gsgs scores as depicted in table 2 . When difference between the gsgs scores of a patient before the treatment and after raga treatment is 0, the improvement status would be categorized as no improvement (when scar grades remained the same). Similarly when difference is 1 - 5 points then the improvement is categorized as mild, moderate improvement when scar grades reduced between 6 and 10 points, good improvement when scar grades decreased by 11 - 15 points and very good improvement when scar grades reduced by more than 15 points [table 2]. While considering only macular erythematous pigmented lesions, the improvement was categorized according to table 3 as no improvement (no change in 3 points score), mild improvement (1 point reduction), moderate improvement (2 point reduction in score), and good improvement (3 point reduction in score). Of the 35 patients, three showed no improvement in scar grades at the end of 12 weeks, while 16 patients demonstrated a mild improvement in their scars that is, the acne scar grades reduced to up to 5 points [figure 1a and b]. Thirteen patients had moderate improvement in their acne scars [figure 2a and b], two had good improvement [figure 3a and b] and one patient demonstrated 21 points reduction in the appearance of his acne scars and had very good improvement [figure 4a and b]. The overall improvement in acne scars is shown graphically in figures 5 and 6 . (a) acne scars with global scarring grading system score of 6 before starting of retinoic acid and glycolic acid treatment (b) acne scars after 12 weeks of retinoic acid and glycolic acid treatment showing mild improvement with a global scarring grading system score of 3 (a) acne scars with global scarring grading system score of 15 before starting of retinoic acid and glycolic acid treatment (b) acne scars after 12 weeks of retinoic acid and glycolic acid treatment showing moderate improvement with a global scarring grading system score of 9 (a) acne scars with global scarring grading system score of 28 before starting of retinoic acid and glycolic acid treatment (b) acne scars after 12 weeks of retinoic acid and glycolic acid treatment showing good improvement with a global scarring grading system score of 17 (a) acne scars with global scarring grading system score of 37 before starting raga treatment (b) acne scars showing very good improvement with global scarring grading system score of 16 line graph depicting the acne scar grades before starting retinoic acid and glycolic acid (raga) treatment (blue) and after 12 weeks of raga treatment (red) bar graph representing the number of patients with different improvement grades on taking retinoic acid and glycolic acid treatment on acne scars among macular pigmentary lesions, 20 patients showed a 3-point reduction in macular lesions [figure 7a and 7b], while eight of them had a reduction of 2 points and 2 patients showed a reduction of 1 point . Overall 85.71% of the patients had an improvement in the appearance of their pigmented macules . (a) picture showing postinflammatory hyperpigmentation as a sequelae to acne before starting retinoic acid and glycolic acid treatment (b) photograph showing 3 points improvement in postinflammatory hyperpigmentation graphical representation of the percentage of patients with different grades of improvement of macular pigmentary lesions on an average 80 - 90% of people with acne scars have atrophic scars associated with a loss of collagen compared to a minority who show hypertrophic scars and keloids . Scars originate at the site of tissue injury (during healing of active acne) and the wound healing process progresses through three stages: (1) inflammation; (2) granulation and tissue formation; and (3) matrix remodeling . During inflammation, this step plays an important role in the development of postacne erythema and hyperpigmentation.during granulation and tissue formation stage the damaged tissues are repaired and new capillaries are formed . New production of collagen by fibroblasts begins approximately 3 - 5 days after the wound is created.the matrix remodeling stage is associated with production of enzymes, by fibroblasts and keratinocytes, that determine the architecture of the extracellular matrix metalloproteinases (mmps) and tissue inhibitors of mmps . This results in an imbalance in the ratio of mmps to tissue inhibitors of mmps leading to the development of atrophic or hypertrophic scars . Inadequate response results in diminished deposition of collagen and formation of an atrophic scar while, if the healing response is exuberant, a raised nodule of fibrotic tissue forms hypertrophic scars . During inflammation, vasoconstriction for homeostasis results in blanching . This step plays an important role in the development of postacne erythema and hyperpigmentation . During granulation and tissue formation stage new production of collagen by fibroblasts begins approximately 3 - 5 days after the wound is created . The matrix remodeling stage is associated with production of enzymes, by fibroblasts and keratinocytes, that determine the architecture of the extracellular matrix metalloproteinases (mmps) and tissue inhibitors of mmps . This results in an imbalance in the ratio of mmps to tissue inhibitors of mmps leading to the development of atrophic or hypertrophic scars . Inadequate response results in diminished deposition of collagen and formation of an atrophic scar while, if the healing response is exuberant, a raised nodule of fibrotic tissue forms hypertrophic scars . Topical retinoids such as tretinoin have been shown to decrease the synthesis of mmps and increase dermal procollagen and collagen synthesis and hence may provide some benefits in preventing scar development and potentially reduce the extent of scar formation that is in progress . Schmidt et al . In their study showed that tretinoin - iontophoresis significantly decreased the depth of atrophic scars in 94% of the study subjects . Topical retinoids improve several features of photoaging that include dispigmentation and wrinkling (fine and coarse). The clinical improvement is accompanied by the reversal of epidermal atrophy and dysplasia along with increased collagen synthesis . This is supported by the study conducted by schwartz et al . Which stated that retinoic acid stimulates collagen synthesis in vivo . Glycolic acid is a naturally occurring alpha - hydroxy acid and has been well - established in dermatological practice for its cosmetic benefits when used on skin . The mechanism of its effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion on pigmentary lesions . Erbaci and akali in their study titled biweekly serial ga peels versus long term daily use of topical low - strength ga in the treatment of atrophic acne scars showed that long term daily use of ga is effective on scars and may be recommended for patients who cannot tolerate the peeling procedure . Studies conducted by dreno et al . Showed that ralga combination can efficiently treat acne scars and pih . Ga play an active role in scar remodeling, their combination can work synergistically in enhancing and hastening improvement in acne scars . In our study, we noticed that 91.4% showed improvement in their acne scars and of these 85.71% of patients showed a definite reduction in pih . All the patients were previously treated for active acne and perhaps the scar formation was still in the early stages . The improvement in the acne scars might be attributed to the increased mmps and collagen synthesis brought about by retinoic acid and epidermal remodeling and pigment dispersion brought about by ga in the raga combination . This retrospective assessment was conducted in a small sample size of patients and there was no interaction with the patients during this assessment . A prospective study of the same with a larger study group is intended in the future . This retrospective assessment was conducted in a small sample size of patients and there was no interaction with the patients during this assessment . A prospective study of the same with a larger study group is intended in the future . This study shows that the raga combination can be considered as a topical treatment for early acne scars including pih, thereby minimizing the need of procedural treatment for acne scars . However, more studies are required to optimize the ideal concentration of each ingredient, viability of combined formulations in a single tube, frequency of application, and duration of treatment.
The highest prevalence is seen in sephardic jews from iran and iraq that is 1:3000 who also often have an associated coagulation factor vii deficiency (14). Dubin johnson syndrome manifests with an intermittent jaundice in the first two decades of life . Pregnancy or intake of oral contraceptive may provoke manifestation of the disease . Except for the jaundice the patient is a 22-year old male that came to the office 3 year ago for the first time with fever, jaundice, fatigue and dark urine . He had no history of alcohol intake or any drug use (herbal or chemical). Liver function test were impaired and all serological studies was normal but havab igm was positive, the patient was being treated with the suspicion of acute viral hepatitis a (table 1). Paraclinical evaluations from first presentation until present ast= aspartate aminotransferase; alt= alanine transaminase; alp= alkaline phosphatase; inr= international normalized ratio; alb= albumin; lkm ab= liver kidney microsome antibody; asma= anti - smooth muscle antibody; ana= antinuclear antibody; ab= antibody; ag= antigen; ig= immunoglobulin; hbs= hepatitis b surface; hbc= hepatitis b core; hcv= hepatitis virus type c; hiv= human immunodeficiency virus; hav= hepatitis a virus; tsh= thyroid stimulating hormone; s.p= serum protein; ema= endomysial antibody; p - anca= perinuclear anti - neutrophil cytoplasmic antibody in the recent past 3 years total bilirubin has been fluctuates between 8.9- 13.5 mg / dl and the direct part between 7.4 - 9.5 mg / dl . Despite the regression of symptoms and reduction of liver enzymes to the normal levels, the jaundice remained persistent (table 1). Abdominal sonography in 3 years ago revealed nothing significant but mild hepatomegaly with heterogenous echo . Recently, liver biopsy was done and containing a specimen consisting of two pieces of small creamy needle - shaped dark brown tissue totally measuring 3 cm in length and 0.1 cm in diameter . Individual hepatocytes contain abundant course brown pigment granules especially in perivenular areas portal tracts show mild lymphocytic infiltration . He had one episode of upper gi bleeding that esophagogastroduodenoscopy revealed grade b esophagitis and small duodenal ulcer . In urine djs is listed as a rare disease by the office of rare disease (ord) of the national institutes of health (nih) (6, 7). In this situation the diagnosis is based on clinical and laboratory findings especially liver biopsy . Despite the normal liver enzymes, only the bilirubin is higher than normal level that is mainly conjugated part . In liver biopsy the total coproporphyrin in urine is normal, but 85 - 90% of urinary coproporphyrin is type i, whereas in normal persons 75% of urinary coproporphyrin is type iii (7, 9, 10). In our patient the jaundice was being provoked after a viral hepatitis and despite comprehensive work up, only direct hyperbilirubinemia was seen.
We administered intravitreal bevacizumab injection to eight eyes of eight patients of various etiologies ranging from retinal vein occlusion to diabetic retinopathy, age related macular degeneration amd, and choroidal neovascular membrane cnvm . The best corrected visual acuity of seven out of eight patients was poor and ranged from 20/120 to finger counting . The details of the procedure, complications were discussed with the patients, and written consent taken . Injection bevacizumab was procured by a patient five days prior to the date of appointment and stored under recommended conditions (i.e., below 4c). On the day of injection, under aseptic precautions, the vial was opened in operation theatres, hood was not used due to its nonavailability . The syringe was then capped with a 30-gauge needle and kept on a sterile tray . Best corrected visual acuity of patients and indication for intravitreal injection the eye of each patient was prepared following standard aseptic procedures (i.e., lids cleaned sequentially first with spirit and then with 10% povidone - iodine). Fornices were flushed with normal saline and 1 drop of 10% povidone - iodine was instilled 2 min before the procedure . Intravitreal bevacizumab injection was administered into the superotemporal quadrant, 4 mm from the limbus . Different needles were used each time after cleaning the surface of vial with spirit, thereby administering multiple pricks in the vial . All of them were asked to come next week for follow - up or earlier if patient experienced severe discomfort . Four of the eight patients reported to the hospital on the 3rd day after injection with complaints of pain, watering, and diminution of vision . Two patients who did not report by the 4th day were contacted and recalled for an examination . Six out of eight patients had absent fundal glow along with presence of cells and flares [table 2]. Clinical findings in patients following intravitreal injection of bevacizumab these six patients were clinically diagnosed to have endophthalmitis and were administered intravitreal antibiotics (injection ceftazidime 2.25 mg in 0.1 ml and injection vancomycin 1 mg in 0.1 ml) on the same day of presentation . Vitreous samples and drug vial were sent for culture sensitivity in two different laboratories which turned out to be sterile . Intravitreal antibiotics were repeated after 48 h. all patients were closely followed up and remaining drug was discarded . While pegaptanib and ranibizumab are labeled for intravitreal use, bevacizumab is labeled for use in cancer therapy and is currently being used off - label for the treatment of ocular neovascular diseases . Because of its off - label use, bevacizumab is supplied in much larger volumes than those needed for single intravitreal injection . Thus, hospitals and compounding pharmacies must divide the larger volume of bevacizumab into smaller units suitable for single - use, individual doses . Contaminants could possibly be introduced during the compounding process and compromise the sterility of the aliquoted drug . Multiple pricks (procedure common in india) were made in vial to prepare administrating dose for eight patients . An alternative protocol suggested is that small aliquot of drug should be prepared using single prick technique, i.e., 0.5 in . 26 gauge needle should be inserted into rubber cap of vial and drug should be drawn into different 1 ml syringes, every time changing only the syringe, leaving the needle in place . Next group should be administered injection after one week, i.e., after the first follow - up of the previous batch . In this way, we would be able to minimize incidence of cluster endophthalmitis and detect possible contamination in the compounded aliquoted drug before it is administered to the next batch . If required, each eye should be injected using drug from different lots under sterile conditions . Six out of eight patients had endophthalmitis, remaining two patients though belonging to different age groups (50 and 72 years), did not develop endophthalmitis . The possible reason for this could be the inherent immunity against the causative organism or the quantity of causative organism in the inoculums could have been below the threshold required for endophthalmitis . Presentation of cases with signs and symptoms of endophthalmitis and response with intravitreal injection of antibiotics led us to assume infective pathology despite the negative culture report . The possibility of tass syndrome in these patients was considered, but review of literature suggests that series of patients, who developed tass syndrome in canada, had reported as early as 24 h. the final visual outcome was poor even with aggressive treatment . All patients had worse visual acuity at the end of follow - up than on injection day . Four patients in our study presented on day 3, while two patients reported on day 4, after intravitreal injection . Three out six patients with endophthalmitis showed improvement in visual acuity with intravitreal antibiotic therapy, as compared to pretreatment level . Visual acuity remained same in two cases, while it deteriorated drastically in one case even after aggressive treatment [table 3]. As the approval of intravitreal use of bevacizumab and its subsequent availability in the market in single dose (0.05 ml ampoules) is still awaited, using the single - dose vial and aliquoting into smaller doses for multiple uses, is the call of the day . However, the present incident highlights the risks of microbial contamination and the need to stay vigilant against preexisting contamination within the vial or its access to the drug via multiple pricks . The alternative protocol, as described previously, is recommended to increase the safety margin of the intravitreal injection of bevacizumab.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.